Characterization of the differentially methylated region of the Impact gene that exhibits Glires-specific imprinting.

PubMed

Okamura, Kohji; Wintle, Richard F; Scherer, Stephen W

2008-01-01

Imprinted genes are exclusively expressed from one of the two parental alleles in a parent-of-origin-specific manner. In mammals, nearly 100 genes are documented to be imprinted. To understand the mechanism behind this gene regulation and to identify novel imprinted genes, common features of DNA sequences have been analyzed; however, the general features required for genomic imprinting have not yet been identified, possibly due to variability in underlying molecular mechanisms from locus to locus. We performed a thorough comparative genomic analysis of a single locus, Impact, which is imprinted only in Glires (rodents and lagomorphs). The fact that Glires and primates diverged from each other as recent as 70 million years ago makes comparisons between imprinted and non-imprinted orthologues relatively reliable. In species from the Glires clade, Impact bears a differentially methylated region, whereby the maternal allele is hypermethylated. Analysis of this region demonstrated that imprinting was not associated with the presence of direct tandem repeats nor with CpG dinucleotide density. In contrast, a CpG periodicity of 8 bp was observed in this region in species of the Glires clade compared to those of carnivores, artiodactyls, and primates. We show that tandem repeats are dispensable, establishment of the differentially methylated region does not rely on G+C content and CpG density, and the CpG periodicity of 8 bp is meaningful to the imprinting. This interval has recently been reported to be optimal for de novo methylation by the Dnmt3a-Dnmt3L complex, suggesting its importance in the establishment of imprinting in Impact and other genes.

Extensive sequence-influenced DNA methylation polymorphism in the human genome

PubMed Central

2010-01-01

Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters), but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups) of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs) reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome. PMID:20497546

Polycomb-like proteins link the PRC2 complex to CpG islands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Haojie; Liefke, Robert; Jiang, Junyi

The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

A heterozygous IDH1R132H/WT mutation induces genome-wide alterations in DNA methylation.

PubMed

Duncan, Christopher G; Barwick, Benjamin G; Jin, Genglin; Rago, Carlo; Kapoor-Vazirani, Priya; Powell, Doris R; Chi, Jen-Tsan; Bigner, Darell D; Vertino, Paula M; Yan, Hai

2012-12-01

Monoallelic point mutations of the NADP(+)-dependent isocitrate dehydrogenases IDH1 and IDH2 occur frequently in gliomas, acute myeloid leukemias, and chondromas, and display robust association with specific DNA hypermethylation signatures. Here we show that heterozygous expression of the IDH1(R132H) allele is sufficient to induce the genome-wide alterations in DNA methylation characteristic of these tumors. Using a gene-targeting approach, we knocked-in a single copy of the most frequently observed IDH1 mutation, R132H, into a human cancer cell line and profiled changes in DNA methylation at over 27,000 CpG dinucleotides relative to wild-type parental cells. We find that IDH1(R132H/WT) mutation induces widespread alterations in DNA methylation, including hypermethylation of 2010 and hypomethylation of 842 CpG loci. We demonstrate that many of these alterations are consistent with those observed in IDH1-mutant and G-CIMP+ primary gliomas and can segregate IDH wild-type and mutated tumors as well as those exhibiting the G-CIMP phenotype in unsupervised analysis of two primary glioma cohorts. Further, we show that the direction of IDH1(R132H/WT)-mediated DNA methylation change is largely dependent upon preexisting DNA methylation levels, resulting in depletion of moderately methylated loci. Additionally, whereas the levels of multiple histone H3 and H4 methylation modifications were globally increased, consistent with broad inhibition of histone demethylation, hypermethylation at H3K9 in particular accompanied locus-specific DNA hypermethylation at several genes down-regulated in IDH1(R132H/WT) knock-in cells. These data provide insight on epigenetic alterations induced by IDH1 mutations and support a causal role for IDH1(R132H/WT) mutants in driving epigenetic instability in human cancer cells.

Polymorphisms and Tissue Expression of the Feline Leukocyte Antigen Class I Loci FLAI-E, -H and -K

PubMed Central

Holmes, Jennifer C.; Holmer, Savannah G.; Ross, Peter; Buntzman, Adam S.; Frelinger, Jeffrey A.; Hess, Paul R.

2013-01-01

Cytotoxic CD8+ T-cell immunosurveillance for intracellular pathogens, such as viruses, is controlled by classical major histocompatibility complex (MHC) class Ia molecules, and ideally, these antiviral T-cell populations are defined by the specific peptide and restricting MHC allele. Surprisingly, despite the utility of the cat in modeling human viral immunity, little is known about the Feline Leukocyte Antigen class I complex (FLAI). Only a few coding sequences with uncertain locus origin and expression patterns have been reported. Of 19 class I genes, 3 loci - FLAI-E, -H and -K – are predicted to encode classical molecules, and our objective was to evaluate their status by analyzing polymorphisms and tissue expression. Using locus-specific, PCR-based genotyping, we amplified 33 FLAI-E, -H, and -K alleles from 12 cats of various breeds, identifying, for the first time, alleles across 3 distinct loci in a feline species. Alleles shared the expected polymorphic and invariant sites in the α1/α2 domains, and full-length cDNA clones possessed all characteristic class Ia exons. Alleles could be assigned to a specific locus with reasonable confidence, although there was evidence of potentially confounding interlocus recombination between FLAI-E and -K. Only FLAI-E, -H and -K-origin alleles were amplified from cDNAs of multiple tissue types. We also defined hypervariable regions across these genes, which permitted the assignment of names to both novel and established alleles. As predicted, FLAI-E, -H, and -K fulfill the major criteria of class Ia genes. These data represent a necessary prerequisite for studying epitope-specific antiviral CD8+ T-cell responses in cats. PMID:23812210

Bayesian inference supports a location and neighbour-dependent model of DNA methylation propagation at the MGMT gene promoter in lung tumours.

PubMed

Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin

2013-11-07

We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.

Genome-wide histone state profiling of fibroblasts from the opossum, Monodelphis domestica, identifies the first marsupial-specific imprinted gene

PubMed Central

2014-01-01

Background Imprinted genes have been extensively documented in eutherian mammals and found to exhibit significant interspecific variation in the suites of genes that are imprinted and in their regulation between tissues and developmental stages. Much less is known about imprinted loci in metatherian (marsupial) mammals, wherein studies have been limited to a small number of genes previously known to be imprinted in eutherians. We describe the first ab initio search for imprinted marsupial genes, in fibroblasts from the opossum, Monodelphis domestica, based on a genome-wide ChIP-seq strategy to identify promoters that are simultaneously marked by mutually exclusive, transcriptionally opposing histone modifications. Results We identified a novel imprinted gene (Meis1) and two additional monoallelically expressed genes, one of which (Cstb) showed allele-specific, but non-imprinted expression. Imprinted vs. allele-specific expression could not be resolved for the third monoallelically expressed gene (Rpl17). Transcriptionally opposing histone modifications H3K4me3, H3K9Ac, and H3K9me3 were found at the promoters of all three genes, but differential DNA methylation was not detected at CpG islands at any of these promoters. Conclusions In generating the first genome-wide histone modification profiles for a marsupial, we identified the first gene that is imprinted in a marsupial but not in eutherian mammals. This outcome demonstrates the practicality of an ab initio discovery strategy and implicates histone modification, but not differential DNA methylation, as a conserved mechanism for marking imprinted genes in all therian mammals. Our findings suggest that marsupials use multiple epigenetic mechanisms for imprinting and support the concept that lineage-specific selective forces can produce sets of imprinted genes that differ between metatherian and eutherian lines. PMID:24484454

Toll-like receptors 9 and 3 as essential components of innate immune defense against mouse cytomegalovirus infection.

PubMed

Tabeta, Koichi; Georgel, Philippe; Janssen, Edith; Du, Xin; Hoebe, Kasper; Crozat, Karine; Mudd, Suzanne; Shamel, Louis; Sovath, Sosathya; Goode, Jason; Alexopoulou, Lena; Flavell, Richard A; Beutler, Bruce

2004-03-09

Several subsets of dendritic cells have been shown to produce type I IFN in response to viral infections, thereby assisting the natural killer cell-dependent response that eliminates the pathogen. Type I IFN production can be induced both by unmethylated CpG-oligodeoxynucleotide and by double-stranded RNA. Here, we describe a codominant CpG-ODN unresponsive phenotype that results from an N-ethyl-N-nitrosourea-induced missense mutation in the Tlr9 gene (Tlr9(CpG1)). Mice homozygous for the Tlr9(CpG1) allele are highly susceptible to mouse cytomegalovirus infection and show impaired infection-induced secretion of IFN-alpha/beta and natural killer cell activation. We also demonstrate that both the Toll-like receptor (TLR) 9 --> MyD88 and TLR3 --> Trif signaling pathways are activated in vivo on viral inoculation, and that each pathway contributes to innate defense against systemic viral infection. Whereas both pathways lead to type I IFN production, neither pathway offers full protection against mouse cytomegalovirus infection in the absence of the other. The Tlr9(CpG1) mutation alters a leucine-rich repeat motif and lies within a receptor domain that is conserved within the evolutionary cluster encompassing TLRs 7, 8, and 9. In other TLRs, including three mouse-specific TLRs described in this paper, the affected region is not represented. The phenotypic effect of the Tlr9(CpG1) allele thus points to a critical role for TLR9 in viral sensing and identifies a vulnerable amino acid within the ectodomain of three TLR proteins, essential for a ligand response.

Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications

PubMed Central

Harris, R. Alan; Wang, Ting; Coarfa, Cristian; Nagarajan, Raman P.; Hong, Chibo; Downey, Sara L.; Johnson, Brett E.; Fouse, Shaun D.; Delaney, Allen; Zhao, Yongjun; Olshen, Adam; Ballinger, Tracy; Zhou, Xin; Forsberg, Kevin J.; Gu, Junchen; Echipare, Lorigail; O’Geen, Henriette; Lister, Ryan; Pelizzola, Mattia; Xi, Yuanxin; Epstein, Charles B.; Bernstein, Bradley E.; Hawkins, R. David; Ren, Bing; Chung, Wen-Yu; Gu, Hongcang; Bock, Christoph; Gnirke, Andreas; Zhang, Michael Q.; Haussler, David; Ecker, Joseph; Li, Wei; Farnham, Peggy J.; Waterland, Robert A.; Meissner, Alexander; Marra, Marco A.; Hirst, Martin; Milosavljevic, Aleksandar; Costello, Joseph F.

2010-01-01

Sequencing-based DNA methylation profiling methods are comprehensive and, as accuracy and affordability improve, will increasingly supplant microarrays for genome-scale analyses. Here, four sequencing-based methodologies were applied to biological replicates of human embryonic stem cells to compare their CpG coverage genome-wide and in transposons, resolution, cost, concordance and its relationship with CpG density and genomic context. The two bisulfite methods reached concordance of 82% for CpG methylation levels and 99% for non-CpG cytosine methylation levels. Using binary methylation calls, two enrichment methods were 99% concordant, while regions assessed by all four methods were 97% concordant. To achieve comprehensive methylome coverage while reducing cost, an approach integrating two complementary methods was examined. The integrative methylome profile along with histone methylation, RNA, and SNP profiles derived from the sequence reads allowed genome-wide assessment of allele-specific epigenetic states, identifying most known imprinted regions and new loci with monoallelic epigenetic marks and monoallelic expression. PMID:20852635

FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

PubMed Central

Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

2018-01-01

CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

Activation of the Early B-Cell-Specific mb-1 (Ig-α) Gene by Pax-5 Is Dependent on an Unmethylated Ets Binding Site

PubMed Central

Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James

2003-01-01

Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069

Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.

PubMed

Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J

2016-08-01

Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor.

Is Serotonin Transporter Genotype Associated with Epigenetic Susceptibility or Vulnerability? Examination of the Impact of SES Risk on African American Youth

PubMed Central

Beach, S. R. H.; Brody, G. H.; Lei, M.K.; Kim, S.; Cui, J.

2014-01-01

We hypothesized that presence of the s allele in the promoter region of the serotonin transporter (5-HTTLR) would moderate the effect of early cumulative SES risk on epigenetic change among African American youth. Contrasting hypotheses regarding the shape of the interaction effect were generated using vulnerability and susceptibility frameworks and applied to data from a sample of 388 African American youth. Early, cumulative SES risk assessed at 11–13 years based on parent report interacted with presence of the s allele to predict differential methylation assessed at age 19. Across multiple tests, a differential susceptibility perspective rather than a diathesis stress framework best fit the data for genes associated with depression, consistently demonstrating greater epigenetic response to early cumulative SES risk among s allele carriers. A pattern consistent with greater impact among s allele carriers also was observed using all CpG sites across the genome that were differentially affected by early cumulative SES risk. We conclude that the s allele is associated with increased responsiveness to early cumulative SES risk among African American youth, leading to epigenetic divergence for depression-related genes in response to exposure to heightened SES risk among s allele carriers in a “for better” or “for worse” pattern. PMID:24438855

Trisomy 21 Alters DNA Methylation in Parent-of-Origin-Dependent and -Independent Manners

PubMed Central

Alves da Silva, Antônio Francisco; Machado, Filipe Brum; Pavarino, Érika Cristina; Biselli-Périco, Joice Matos; Zampieri, Bruna Lancia; da Silva Francisco Junior, Ronaldo; Mozer Rodrigues, Pedro Thyago; Terra Machado, Douglas; Santos-Rebouças, Cíntia Barros; Gomes Fernandes, Maria; Chuva de Sousa Lopes, Susana Marina; Lopes Rios, Álvaro Fabricio

2016-01-01

The supernumerary chromosome 21 in Down syndrome differentially affects the methylation statuses at CpG dinucleotide sites and creates genome-wide transcriptional dysregulation of parental alleles, ultimately causing diverse pathologies. At present, it is unknown whether those effects are dependent or independent of the parental origin of the nondisjoined chromosome 21. Linkage analysis is a standard method for the determination of the parental origin of this aneuploidy, although it is inadequate in cases with deficiency of samples from the progenitors. Here, we assessed the reliability of the epigenetic 5mCpG imprints resulting in the maternally (oocyte)-derived allele methylation at a differentially methylated region (DMR) of the candidate imprinted WRB gene for asserting the parental origin of chromosome 21. We developed a methylation-sensitive restriction enzyme-specific PCR assay, based on the WRB DMR, across single nucleotide polymorphisms (SNPs) to examine the methylation statuses in the parental alleles. In genomic DNA from blood cells of either disomic or trisomic subjects, the maternal alleles were consistently methylated, while the paternal alleles were unmethylated. However, the supernumerary chromosome 21 did alter the methylation patterns at the RUNX1 (chromosome 21) and TMEM131 (chromosome 2) CpG sites in a parent-of-origin-independent manner. To evaluate the 5mCpG imprints, we conducted a computational comparative epigenomic analysis of transcriptome RNA sequencing (RNA-Seq) and histone modification expression patterns. We found allele fractions consistent with the transcriptional biallelic expression of WRB and ten neighboring genes, despite the similarities in the confluence of both a 17-histone modification activation backbone module and a 5-histone modification repressive module between the WRB DMR and the DMRs of six imprinted genes. We concluded that the maternally inherited 5mCpG imprints at the WRB DMR are uncoupled from the parental allele expression of WRB and ten neighboring genes in several tissues and that trisomy 21 alters DNA methylation in parent-of-origin-dependent and -independent manners. PMID:27100087

DNA hypermethylation and X chromosome inactivation are major determinants of phenotypic variation in women heterozygous for G6PD mutations.

PubMed

Wang, Jin; Xiao, Qi-Zhi; Chen, You-Ming; Yi, Sheng; Liu, Dun; Liu, Yan-Hui; Zhang, Cui-Mei; Wei, Xiao-Feng; Zhou, Yu-Qiu; Zhong, Xing-Ming; Zhao, Cun-You; Xiong, Fu; Wei, Xiang-Cai; Xu, Xiang-Min

2014-12-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked incompletely dominant enzyme deficiency that results from G6PD gene mutations. Women heterozygous for G6PD mutations exhibit variation in the loss of enzyme activity but the cause of this phenotypic variation is unclear. We determined DNA methylation and X-inactivation patterns in 71 G6PD-deficient female heterozygotes and 68 G6PD non-deficient controls with the same missense mutations (G6PD Canton c.1376G>T or Kaiping c.1388G>A) to correlate determinants with variable phenotypes. Specific CpG methylations within the G6PD promoter were significantly higher in G6PD-deficient heterozygotes than in controls. Preferential X-inactivation of the G6PD wild-type allele was determined in heterozygotes. The incidence of preferential X-inactivation was 86.2% in the deficient heterozygote group and 31.7% in the non-deficient heterozygote group. A significant negative correlation was observed between X-inactivation ratios of the wild-type allele and G6PD/6-phosphogluconate dehydrogenase (6PGD) ratios in heterozygous G6PD Canton (r=-0.657, p<0.001) or Kaiping (r=-0.668, p<0.001). Multivariate logistic regression indicated that heterozygotes with hypermethylation of specific CpG sites in the G6PD promoter and preferential X-inactivation of the wild-type allele were at risk of enzyme deficiency. Copyright © 2014 Elsevier Inc. All rights reserved.

Potential for diagnosis versus therapy monitoring of attention deficit hyperactivity disorder: a new epigenetic biomarker interacting with both genotype and auto-immunity.

PubMed

Adriani, Walter; Romano, Emilia; Pucci, Mariangela; Pascale, Esterina; Cerniglia, Luca; Cimino, Silvia; Tambelli, Renata; Curatolo, Paolo; Granstrem, Oleg; Maccarrone, Mauro; Laviola, Giovanni; D'Addario, Claudio

2018-02-01

In view of the need for easily accessible biomarkers, we evaluated in ADHD children the epigenetic status of the 5'-untranslated region (UTR) in the SLC6A3 gene, coding for human dopamine transporter (DAT). We analysed buccal swabs and sera from 30 children who met DSM-IV-TR criteria for ADHD, assigned to treatment according to severity. Methylation levels at six-selected CpG sites (among which, a CGGCGGCGG and a CGCG motif), alone or in combination with serum titers in auto-antibodies against dopamine transporter (DAT aAbs), were analysed for correlation with CGAS scores (by clinicians) and Conners' scales (by parents), collected at recruitment and after 6 weeks. In addition, we characterized the DAT genotype, i.e., the variable number tandem repeat (VNTR) polymorphisms at the 3'-UTR of the gene. DAT methylation levels were greatly reduced in ADHD patients compared to control, healthy children. Within patients carrying at least one DAT 9 allele (DAT 9/x), methylation at positions CpG2 and/or CpG6 correlated with recovery, as evident from delta-CGAS scores as well as delta Conners' scales ('inattentive' and 'hyperactive' subscales). Moreover, hypermethylation at CpG1 position denoted severity, specifically for those patients carrying a DAT 10/10 genotype. Intriguingly, high serum DAT-aAbs titers appeared to corroborate indications from high CpG1 versus high CpG2/CpG6 levels, likewise denoting severity versus recovery in DAT 10/10 versus 9/x patients, respectively. These profiles suggest that DAT 5'UTR epigenetics plus serum aAbs can serve as suitable biomarkers, to confirm ADHD diagnosis and/or to predict the efficacy of treatment.

Methylation profiling in individuals with Russell-Silver syndrome.

PubMed

Peñaherrera, Maria S; Weindler, Susanne; Van Allen, Margot I; Yong, Siu-Li; Metzger, Daniel L; McGillivray, Barbara; Boerkoel, Cornelius; Langlois, Sylvie; Robinson, Wendy P

2010-02-01

Russell-Silver syndrome (RSS) is a heterogeneous disorder associated with pre- and post-natal growth restriction and relative macrocephaly. Involvement of imprinted genes on both chromosome 7 and 11p15.5 has been reported. To further characterize the role of epimutations in RSS we evaluated the methylation status at both 11p15.5 imprinting control regions (ICRs): ICR1 associated with H19/IGF2 expression and ICR2 (KvDMR1) associated with CDKN1C expression in a series of 35 patients with RSS. We also evaluated methylation at the promoter regions of other imprinted genes involved in growth such as PLAGL1 (6q24), GCE (7q21), and PEG10 (7q21) in this series of 35 patients with RSS. Thirteen of the 35 patient samples, but none of 22 controls, showed methylation levels at ICR1 that were more than 2 SD below the mean for controls. Three RSS patients were highly methylated at the SCGE promoter, all of which were diagnosed with upd(7)mat. To identify further potential global methylation changes in RSS patients, a subset of 22 patients were evaluated at 1505 CpG sites by the Illumina GoldenGate methylation array. Among the few CpG sites displaying a significant difference between RSS patients and controls, was a CpG associated with the H19 promoter. No other sites associated with known imprinted genes were identified as abnormally methylated in RSS patients by this approach. While the association of hypomethylation of the H19/IGF2 ICR1 is clear, the continuous distribution of methylation values among the patients and controls complicates the establishment of clear cut-offs for clinical diagnosis. Copyright 2010 Wiley-Liss, Inc.

Stress-induced gene expression and behavior are controlled by DNA methylation and methyl donor availability in the dentate gyrus

PubMed Central

Saunderson, Emily A.; Spiers, Helen; Gutierrez-Mecinas, Maria; Trollope, Alexandra F.; Shaikh, Abeera; Mill, Jonathan; Reul, Johannes M. H. M.

2016-01-01

Stressful events evoke long-term changes in behavioral responses; however, the underlying mechanisms in the brain are not well understood. Previous work has shown that epigenetic changes and immediate-early gene (IEG) induction in stress-activated dentate gyrus (DG) granule neurons play a crucial role in these behavioral responses. Here, we show that an acute stressful challenge [i.e., forced swimming (FS)] results in DNA demethylation at specific CpG (5′-cytosine–phosphate–guanine-3′) sites close to the c-Fos (FBJ murine osteosarcoma viral oncogene homolog) transcriptional start site and within the gene promoter region of Egr-1 (early growth response protein 1) specifically in the DG. Administration of the (endogenous) methyl donor S-adenosyl methionine (SAM) did not affect CpG methylation and IEG gene expression at baseline. However, administration of SAM before the FS challenge resulted in an enhanced CpG methylation at the IEG loci and suppression of IEG induction specifically in the DG and an impaired behavioral immobility response 24 h later. The stressor also specifically increased the expression of the de novo DNA methyltransferase Dnmt3a [DNA (cytosine-5-)-methyltransferase 3 alpha] in this hippocampus region. Moreover, stress resulted in an increased association of Dnmt3a enzyme with the affected CpG loci within the IEG genes. No effects of SAM were observed on stress-evoked histone modifications, including H3S10p-K14ac (histone H3, phosphorylated serine 10 and acetylated lysine-14), H3K4me3 (histone H3, trimethylated lysine-4), H3K9me3 (histone H3, trimethylated lysine-9), and H3K27me3 (histone H3, trimethylated lysine-27). We conclude that the DNA methylation status of IEGs plays a crucial role in FS-induced IEG induction in DG granule neurons and associated behavioral responses. In addition, the concentration of available methyl donor, possibly in conjunction with Dnmt3a, is critical for the responsiveness of dentate neurons to environmental stimuli in terms of gene expression and behavior. PMID:27078100

DNA-inorganic hybrid nanovaccine for cancer immunotherapy

NASA Astrophysics Data System (ADS)

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-01

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy. Electronic supplementary information (ESI) available: ESI materials and methods, characterization of hNVs. See DOI: 10.1039/c5nr08821f

Multi-step aberrant CpG island hyper-methylation is associated with the progression of adult T-cell leukemia/lymphoma.

PubMed

Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

2010-01-01

Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.

Multi-Step Aberrant CpG Island Hyper-Methylation Is Associated with the Progression of Adult T–Cell Leukemia/Lymphoma

PubMed Central

Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

2010-01-01

Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193

The DNA Methylome of Human Peripheral Blood Mononuclear Cells

PubMed Central

Ye, Mingzhi; Zheng, Hancheng; Yu, Jian; Wu, Honglong; Sun, Jihua; Zhang, Hongyu; Chen, Quan; Luo, Ruibang; Chen, Minfeng; He, Yinghua; Jin, Xin; Zhang, Qinghui; Yu, Chang; Zhou, Guangyu; Sun, Jinfeng; Huang, Yebo; Zheng, Huisong; Cao, Hongzhi; Zhou, Xiaoyu; Guo, Shicheng; Hu, Xueda; Li, Xin; Kristiansen, Karsten; Bolund, Lars; Xu, Jiujin; Wang, Wen; Yang, Huanming; Wang, Jian; Li, Ruiqiang; Beck, Stephan; Wang, Jun; Zhang, Xiuqing

2010-01-01

DNA methylation plays an important role in biological processes in human health and disease. Recent technological advances allow unbiased whole-genome DNA methylation (methylome) analysis to be carried out on human cells. Using whole-genome bisulfite sequencing at 24.7-fold coverage (12.3-fold per strand), we report a comprehensive (92.62%) methylome and analysis of the unique sequences in human peripheral blood mononuclear cells (PBMC) from the same Asian individual whose genome was deciphered in the YH project. PBMC constitute an important source for clinical blood tests world-wide. We found that 68.4% of CpG sites and <0.2% of non-CpG sites were methylated, demonstrating that non-CpG cytosine methylation is minor in human PBMC. Analysis of the PBMC methylome revealed a rich epigenomic landscape for 20 distinct genomic features, including regulatory, protein-coding, non-coding, RNA-coding, and repeat sequences. Integration of our methylome data with the YH genome sequence enabled a first comprehensive assessment of allele-specific methylation (ASM) between the two haploid methylomes of any individual and allowed the identification of 599 haploid differentially methylated regions (hDMRs) covering 287 genes. Of these, 76 genes had hDMRs within 2 kb of their transcriptional start sites of which >80% displayed allele-specific expression (ASE). These data demonstrate that ASM is a recurrent phenomenon and is highly correlated with ASE in human PBMCs. Together with recently reported similar studies, our study provides a comprehensive resource for future epigenomic research and confirms new sequencing technology as a paradigm for large-scale epigenomics studies. PMID:21085693

Epigenetic inactivation of CHFR in human tumors

PubMed Central

Toyota, Minoru; Sasaki, Yasushi; Satoh, Ayumi; Ogi, Kazuhiro; Kikuchi, Takefumi; Suzuki, Hiromu; Mita, Hiroaki; Tanaka, Nobuyuki; Itoh, Fumio; Issa, Jean-Pierre J.; Jair, Kam-Wing; Schuebel, Kornel E.; Imai, Kohzoh; Tokino, Takashi

2003-01-01

Cell-cycle checkpoints controlling the orderly progression through mitosis are frequently disrupted in human cancers. One such checkpoint, entry into metaphase, is regulated by the CHFR gene encoding a protein possessing forkhead-associated and RING finger domains as well as ubiquitin–ligase activity. Although defects in this checkpoint have been described, the molecular basis and prevalence of CHFR inactivation in human tumors are still not fully understood. To address this question, we analyzed the pattern of CHFR expression in a number of human cancer cell lines and primary tumors. We found CpG methylation-dependent silencing of CHFR expression in 45% of cancer cell lines, 40% of primary colorectal cancers, 53% of colorectal adenomas, and 30% of primary head and neck cancers. Expression of CHFR was precisely correlated with both CpG methylation and deacetylation of histones H3 and H4 in the CpG-rich regulatory region. Moreover, CpG methylation and thus silencing of CHFR depended on the activities of two DNA methyltransferases, DNMT1 and DNMT3b, as their genetic inactivation restored CHFR expression. Finally, cells with CHFR methylation had an intrinsically high mitotic index when treated with microtubule inhibitor. This means that cells in which CHFR was epigenetically inactivated constitute loss-of-function alleles for mitotic checkpoint control. Taken together, these findings shed light on a pathway by which mitotic checkpoint is bypassed in cancer cells and suggest that inactivation of checkpoint genes is much more widespread than previously suspected. PMID:12810945

Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

PubMed

Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

2016-06-01

Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

DNA-inorganic hybrid nanovaccine for cancer immunotherapy.

PubMed

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-28

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.

DNA methylation analysis of phenotype specific stratified Indian population.

PubMed

Rotti, Harish; Mallya, Sandeep; Kabekkodu, Shama Prasada; Chakrabarty, Sanjiban; Bhale, Sameer; Bharadwaj, Ramachandra; Bhat, Balakrishna K; Dedge, Amrish P; Dhumal, Vikram Ram; Gangadharan, G G; Gopinath, Puthiya M; Govindaraj, Periyasamy; Joshi, Kalpana S; Kondaiah, Paturu; Nair, Sreekumaran; Nair, S N Venugopalan; Nayak, Jayakrishna; Prasanna, B V; Shintre, Pooja; Sule, Mayura; Thangaraj, Kumarasamy; Patwardhan, Bhushan; Valiathan, Marthanda Varma Sankaran; Satyamoorthy, Kapaettu

2015-05-08

DNA methylation and its perturbations are an established attribute to a wide spectrum of phenotypic variations and disease conditions. Indian traditional system practices personalized medicine through indigenous concept of distinctly descriptive physiological, psychological and anatomical features known as prakriti. Here we attempted to establish DNA methylation differences in these three prakriti phenotypes. Following structured and objective measurement of 3416 subjects, whole blood DNA of 147 healthy male individuals belonging to defined prakriti (Vata, Pitta and Kapha) between the age group of 20-30years were subjected to methylated DNA immunoprecipitation (MeDIP) and microarray analysis. After data analysis, prakriti specific signatures were validated through bisulfite DNA sequencing. Differentially methylated regions in CpG islands and shores were significantly enriched in promoters/UTRs and gene body regions. Phenotypes characterized by higher metabolism (Pitta prakriti) in individuals showed distinct promoter (34) and gene body methylation (204), followed by Vata prakriti which correlates to motion showed DNA methylation in 52 promoters and 139 CpG islands and finally individuals with structural attributes (Kapha prakriti) with 23 and 19 promoters and CpG islands respectively. Bisulfite DNA sequencing of prakriti specific multiple CpG sites in promoters and 5'-UTR such as; LHX1 (Vata prakriti), SOX11 (Pitta prakriti) and CDH22 (Kapha prakriti) were validated. Kapha prakriti specific CDH22 5'-UTR CpG methylation was also found to be associated with higher body mass index (BMI). Differential DNA methylation signatures in three distinct prakriti phenotypes demonstrate the epigenetic basis of Indian traditional human classification which may have relevance to personalized medicine.

Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

PubMed

Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

2014-11-28

NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters

PubMed Central

Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.

2014-01-01

While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842

Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

PubMed Central

Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

2012-01-01

CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013

Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene.

PubMed

Ohtsuki, Shozo; Takahashi, Yuki; Inoue, Takao; Takakura, Yoshinobu; Nishikawa, Makiya

2017-10-20

We used human Toll-like receptor 9 (hTLR9)-expressing HEK-Blue hTLR9 cells, which release secreted embryonic alkaline phosphatase (SEAP) upon response to CpG DNA, to evaluate the immunological properties of nucleic acid drug candidates. Our preliminary studies showed that phosphodiester CpG DNA hardly induced any SEAP secretion in HEK-Blue hTLR9 cells. In the current study, therefore, we developed HEK-Blue hTLR9 cells transduced with human macrophage scavenger receptor-1 (hMSR1), a cell-surface DNA receptor, and determined whether HEK-Blue hTLR9/hMSR1 cells respond to phosphorothioate (PS) CpG DNA and phosphodiester (PO) CpG DNA. We selected PS CpG2006, a single-stranded PO CpG DNA (ssCpG), and a tetrapod-like structured DNA (tetrapodna) containing ssCpG (tetraCpG) as model TLR9 ligands. Alexa Fluor 488-labeled ligands were used for flow cytometry. Unlike the mock-transfected HEK-Blue hTLR9 cells, the HEK-Blue hTLR9/hMSR1 cells efficiently took up all three CpG DNAs. SEAP release was almost proportional to the uptake. Treatment of HEK-Blue hTLR9/hMSR1 cells with an anti-hMSR1 antibody significantly reduced the uptake of ssCpG and tetraCpG. Collectively, reconstruction of TLR9-mediated responses to CpG DNA in HEK-Blue hTLR9 cells can be used to evaluate the toxicity of nucleic acid drug candidates with diverse physicochemical properties.

The nucleotides responsible for the direct physical contact between the chromatin insulator protein CTCF and the H19 imprinting control region manifest parent of origin-specific long-distance insulation and methylation-free domains

PubMed Central

Pant, Vinod; Mariano, Piero; Kanduri, Chandrasekhar; Mattsson, Anita; Lobanenkov, Victor; Heuchel, Rainer; Ohlsson, Rolf

2003-01-01

The repression of the maternally inherited Igf2 allele has been proposed to depend on a methylation-sensitive chromatin insulator organized by the 11 zinc finger protein CTCF at the H19 imprinting control region (ICR). Here we document that point mutations of the nucleotides in physical contact with CTCF within the endogenous H19 ICR lead to loss of CTCF binding and Igf2 imprinting only when passaged through the female germline. This effect is accompanied by a significant loss of methylation protection of the maternally derived H19 ICR. Because CTCF interacts with other imprinting control regions, it emerges as a central factor responsible for interpreting and propagating gamete-derived epigenetic marks and for organizing epigenetically controlled expression domains. PMID:12629040

Tet-mediated imprinting erasure in H19 locus following reprogramming of spermatogonial stem cells to induced pluripotent stem cells

USDA-ARS?s Scientific Manuscript database

Selective methylation of CpG islands at imprinting control regions (ICR) determines the monoparental expression of a subset of genes. The imprinting marks are protected from global demethylation taking place during pre-implantation development before being reset in primordial germ cells. However, it...

Combined epigenetic and intraspecific variation of the DRD4 and SERT genes influence novelty seeking behavior in great tit Parus major

PubMed Central

Riyahi, Sepand; Sánchez-Delgado, Marta; Calafell, Francesc; Monk, David; Senar, Juan Carlos

2015-01-01

DNA methylation is one of the main epigenetic mechanisms that can regulate gene expression and is an important means for creating phenotypic variation. In the present study, we performed methylation profiling of 2 candidate genes for personality traits, namely DRD4 and SERT, in the great tit Parus major to ascertain whether personality traits and behavior within different habitats have evolved with the aid of epigenetic variation. We applied bisulphite PCR and strand-specific sequencing to determine the methylation profile of the CpG dinucleotides in the DRD4 and SERT promoters and also in the CpG island overlapping DRD4 exon 3. Furthermore, we performed pyrosequencing to quantify the total methylation levels at each CpG location. Our results indicated that methylation was ∼1–4% higher in urban than in forest birds, for all loci and tissues analyzed, suggesting that this epigenetic modification is influenced by environmental conditions. Screening of genomic DNA sequence revealed that the SERT promoter is CpG poor region. The methylation at a single CpG dinucleotide located 288 bp from the transcription start site was related to exploration score in urban birds. In addition, the genotypes of the SERT polymorphism SNP234 located within the minimal promoter were significantly correlated with novelty seeking behavior in captivity, with the allele increasing this behavior being more frequent in urban birds. As a conclusion, it seems that both genetic and methylation variability of the SERT gene have an important role in shaping personality traits in great tits, whereas genetic and methylation variation at the DRD4 gene is not strongly involved in behavior and personality traits. PMID:25933062

Tumour specific promoter region methylation of the human homologue of the Drosophila Roundabout gene DUTT1 (ROBO1) in human cancers.

PubMed

Dallol, Ashraf; Forgacs, Eva; Martinez, Alonso; Sekido, Yoshitaka; Walker, Rosemary; Kishida, Takeshi; Rabbitts, Pamela; Maher, Eamonn R; Minna, John D; Latif, Farida

2002-05-02

The human homologue of the Drosophila Roundabout gene DUTT1 (Deleted in U Twenty Twenty) or ROBO1 (Locus Link ID 6091), a member of the NCAM family of receptors, was recently cloned from the lung cancer tumour suppressor gene region 2 (LCTSGR2 or U2020 region) at 3p12. DUTT1 maps within a region of overlapping homozygous deletions characterized in both small cell lung cancer lines (SCLC) and in a breast cancer line. In this report we (a) defined the genomic organization of the DUTT1 gene, (b) performed mutation and expression analysis of DUTT1 in lung, breast and kidney cancers, (c) identified tumour specific promoter region methylation of DUTT1 in human cancers. The gene was found to contain 29 exons and spans at least 240 kb of genomic sequence. The 5' region contains a CpG island, and the poly(A)(+) tail has an atypical 5'-GATAAA-3' signal. We analysed DUTT1 for mutations in lung, breast and kidney cancers, no inactivating mutations were detected by PCR-SSCP. However, seven germline missense changes were found and characterized. DUTT1 expression was not detectable in one out of 18 breast tumour lines analysed by RT-PCR. Bisulfite sequencing of the promoter region of DUTT1 gene in the HTB-19 breast tumour cell line (not expressing DUTT1) showed complete hypermethylation of CpG sites within the promoter region of the DUTT1 gene (-244 to +27 relative to the translation start site). The expression of DUTT1 gene was reactivated in HTB-19 after treatment with the demethylating agent 5-aza-2'-deoxycytidine. The same region was also found to be hypermethylated in six out of 32 (19%) primary invasive breast carcinomas and eight out of 44 (18%) primary clear cell renal cell carcinomas (CC-RCC) and in one out of 26 (4%) primary NSCLC tumours. Furthermore 80% of breast and 75% of CC-RCC tumours showing DUTT1 methylation had allelic losses for 3p12 markers hence obeying Knudson's two hit hypothesis. Our findings suggest that DUTT1 warrants further analysis as a candidate for the tumour suppressor gene (TSG) at 3p12, a region defined by hemi and homozygous deletions and functional analysis.

Genetic characterization of non-O157 verocytotoxigenic Escherichia coli isolated from raw beef products using multiple-locus variable-number tandem repeat analysis.

PubMed

Franci, Tomás; Sanso, A Mariel; Bustamante, Ana V; Lucchesi, Paula M A; Parma, Alberto E

2011-09-01

Verocytotoxigenic Escherichia coli (VTEC) can produce serious human illness linked to the consumption of contaminated food, mainly of bovine origin. There is growing concern about non-O157 VTEC serotypes, which in some countries cause severe infections in a proportion similar to O157:H7 strains. As several epidemiological studies indicated the important role of meat as the major vehicle in the transmission of this pathogen to human consumers, our aim was to investigate the genetic diversity among non-O157:H7 VTEC isolated from raw beef products. We performed a multiple-locus variable-number tandem repeat (VNTR) analysis (MLVA), and to our knowledge, this is the first time that VTEC serotypes O8:H19, O112:H2, O113:NM, O171:NM, ONT:H7, ONT:H19, and ONT:H21 were typed by this method. MLVA typing grouped the total number of strains from this study (51) into 21 distinct genotypes, and 11 of them were unique. Several MLVA profiles were found in different serotypes, O178:H19 being the most variable. The isolates could be principally discriminated by alleles of three of seven loci studied (CVN001, CVN004, and CVN014), and on the other hand, CVN003 rendered null alleles in all the isolates. As some VNTR markers might be serotype specific, it is possible that the implementation of new VNTR loci will increase intraserotype discrimination.

Quantitative detection of RASSF1A DNA promoter methylation in tumors and serum of patients with serous epithelial ovarian cancer.

PubMed

Bondurant, Amy E; Huang, Zhiqing; Whitaker, Regina S; Simel, Lauren R; Berchuck, Andrew; Murphy, Susan K

2011-12-01

Detection of cell free tumor-specific DNA methylation has been proposed as a potentially useful noninvasive mechanism to detect malignancies, including ovarian cancer, and to monitor response to treatment. However, there are few easily implemented quantitative approaches available for DNA methylation analysis. Our objectives were to develop an absolute quantitative method for detection of DNA methylation using RASSF1A, a known target of promoter methylation in ovarian cancer, and test the ability to detect RASSF1A methylation in tumors and serum specimens of women with ovarian cancer. Bisulfite modified DNAs were subjected to real time PCR using nondiscriminatory PCR primers and a probe with sequence containing a single CpG site, theoretically able to capture the methylation status of that CpG for every allele within a given specimen. Input DNA was normalized to ACTB levels detected simultaneously by assay multiplexing. Methylation levels were established by comparison to results obtained from universally methylated DNA. The assay was able to detect one methylated RASSF1A allele in 100,000 unmethylated alleles. RASSF1A was methylated in 54 of 106 (51%) invasive serous ovarian cancers analyzed and methylation status was concordant in 20/20 matched preoperative serum-tumor pairs. Serial serum specimens taken over the course of treatment for 8 of 9 patients showed fluctuations in RASSF1A methylation concomitant with disease status. This novel assay provides a real-time PCR-based method for absolute quantitation of DNA methylation. Our results support feasibility of monitoring RASSF1A methylation from serum samples taken over the course of treatment from women with ovarian cancer. Copyright © 2011 Elsevier Inc. All rights reserved.

pH-Responsive Nanoparticle Vaccines for Dual-Delivery of Antigens and Immunostimulatory Oligonucleotides

PubMed Central

Wilson, John T.; Keller, Salka; Manganiello, Matthew J.; Cheng, Connie; Lee, Chen-Chang; Opara, Chinonso; Convertine, Anthony; Stayton, Patrick S.

2013-01-01

Protein subunit vaccines offer important potential advantages over live vaccine vectors, but generally elicit weaker and shorter-lived cellular immune responses. Here we investigate the use of pH-responsive, endosomolytic polymer nanoparticles that were originally developed for RNA delivery as vaccine delivery vehicles for enhancing cellular and humoral immune responses. Micellar nanoparticles were assembled from amphiphilic diblock copolymers composed of an ampholytic core-forming block and a re-designed polycationic corona block doped with thiol-reactive pyridyl disulfide groups to enable dual-delivery of antigens and immunostimulatory CpG oligodeoxynucleotide (CpG ODN) adjuvants. Polymers assembled into 23 nm particles with simultaneous packaging of CpG ODN and a thiolated protein antigen, ovalbumin (ova). Conjugation of ova to nanoparticles significantly enhanced antigen cross-presentation in vitro relative to free ova or an unconjugated, physical mixture of the parent compounds. Subcutaneous vaccination of mice with ova-nanoparticle conjugates elicited a significantly higher CD8+ T cell response (0.5% IFN-ɣ+ of CD8+) compared to mice vaccinated with free ova or a physical mixture of the two components. Significantly, immunization with ova-nanoparticle conjugates electrostatically complexed with CpG ODN (dual-delivery) enhanced CD8+ T cell responses (3.4% IFN-ɣ+ of CD8+) 7-, 18-, and 8-fold relative to immunization with conjugates, ova administered with free CpG, or a formulation containing free ova and CpG complexed to micelles, respectively. Similarly, dual-delivery carriers significantly increased CD4+IFN-ɣ+ (Th1) responses, and elicited a balanced IgG1/IgG2c antibody response. Intradermal administration further augmented cellular immune responses, with dual-delivery carriers inducing ~7% antigen-specific CD8+ T cells. This work demonstrates the ability of pH-responsive, endosomolytic nanoparticles to actively promote antigen cross-presentation and augment cellular and humoral immune responses via dual-delivery of protein antigens and CpG ODN. Hence, pH-responsive polymeric nanoparticles offer promise as a delivery platform for protein subunit vaccines. PMID:23590591

Effect of alcohol consumption on CpG methylation in the differentially methylated regions of H19 and IG-DMR in male gametes: implications for fetal alcohol spectrum disorders.

PubMed

Ouko, Lillian A; Shantikumar, Katpaham; Knezovich, Jaysen; Haycock, Philip; Schnugh, Desmond J; Ramsay, Michèle

2009-09-01

Exposure to alcohol in utero is the main attributable cause of fetal alcohol spectrum disorders (FASD) which in its most severe form is characterized by irreversible behavioral and cognitive disability. Paternal preconception drinking is not considered to be a significant risk factor, even though animal studies have demonstrated that chronic paternal alcohol consumption has a detrimental effect on the physical and mental development of offspring even in the absence of in utero alcohol exposure. It has been documented that alcohol can reduce the levels and activity of DNA methyltransferases resulting in DNA hypomethylation and that reduced methyltransferase activity can cause activation of normally silenced genes. The aim of this study was to establish a link between alcohol use in men and hypomethylation of paternally imprinted loci in sperm DNA in genomic regions critical for embryonic development, thus providing a mechanism for paternal effects in the aetiology of FASD. Sperm DNA from male volunteers was bisulfite treated and the methylation patterns of 2 differentially methylated regions (DMRs), H19 and IG-DMR, analyzed following sequencing of individual clones. The methylation patterns were correlated with the alcohol consumption levels of the volunteer males. There was a pattern of increased demethylation with alcohol consumption at the 2 imprinted loci with a significant difference observed at the IG-DMR between the nondrinking and heavy alcohol consuming groups. Greater inter-individual variation in average methylation was observed at the H19 DMR and individual clones were more extensively demethylated than those of the IG-DMR. CpG site #4 in the IG-DMR was preferentially demethylated among all individuals and along with the H19 DMR CpG site #7 located within the CTCF binding site 6 showed significant demethylation in the alcohol consuming groups compared with the control group. This study demonstrates a correlation between chronic alcohol use and demethylation of normally hypermethylated imprinted regions in sperm DNA. We hypothesize that, should these epigenetic changes in imprinted genes be transmitted through fertilization, they would alter the critical gene expression dosages required for normal prenatal development resulting in offspring with features of FASD.

Functional PMS2 Hybrid Alleles Containing a Pseudogene-Specific Missense Variant Trace Back to a Single Ancient Intrachromosomal Recombination Event

PubMed Central

Ganster, Christina; Wernstedt, Annekatrin; Kehrer-Sawatzki, Hildegard; Messiaen, Ludwine; Schmidt, Konrad; Rahner, Nils; Heinimann, Karl; Fonatsch, Christa; Zschocke, Johannes; Wimmer, Katharina

2012-01-01

Sequence exchange between PMS2 and its pseudogene PMS2CL, embedded in an inverted duplication on chromosome 7p22, has been reported to be an ongoing process that leads to functional PMS2 hybrid alleles containing PMS2- and PMS2CL-specific sequence variants at the 5′-and the 3′-end, respectively. The frequency of PMS2 hybrid alleles, their biological significance, and the mechanisms underlying their formation are largely unknown. Here we show that overall hybrid alleles account for one-third of 384 PMS2 alleles analyzed in individuals of different ethnic backgrounds. Depending on the population, 14–60% of hybrid alleles carry PMS2CL-specific sequences in exons 13–15, the remainder only in exon 15. We show that exons 13–15 hybrid alleles, named H1 hybrid alleles, constitute different haplotypes but trace back to a single ancient intrachromosomal recombination event with crossover. Taking advantage of an ancestral sequence variant specific for all H1 alleles we developed a simple gDNA-based polymerase chain reaction (PCR) assay that can be used to identify H1-allele carriers with high sensitivity and specificity (100 and 99%, respectively). Because H1 hybrid alleles harbor missense variant p.N775S of so far unknown functional significance, we assessed the H1-carrier frequency in 164 colorectal cancer patients. So far, we found no indication that the variant plays a major role with regard to cancer susceptibility. PMID:20186689

Functional PMS2 hybrid alleles containing a pseudogene-specific missense variant trace back to a single ancient intrachromosomal recombination event.

PubMed

Ganster, Christina; Wernstedt, Annekatrin; Kehrer-Sawatzki, Hildegard; Messiaen, Ludwine; Schmidt, Konrad; Rahner, Nils; Heinimann, Karl; Fonatsch, Christa; Zschocke, Johannes; Wimmer, Katharina

2010-05-01

Sequence exchange between PMS2 and its pseudogene PMS2CL, embedded in an inverted duplication on chromosome 7p22, has been reported to be an ongoing process that leads to functional PMS2 hybrid alleles containing PMS2- and PMS2CL-specific sequence variants at the 5'-and the 3'-end, respectively. The frequency of PMS2 hybrid alleles, their biological significance, and the mechanisms underlying their formation are largely unknown. Here we show that overall hybrid alleles account for one-third of 384 PMS2 alleles analyzed in individuals of different ethnic backgrounds. Depending on the population, 14-60% of hybrid alleles carry PMS2CL-specific sequences in exons 13-15, the remainder only in exon 15. We show that exons 13-15 hybrid alleles, named H1 hybrid alleles, constitute different haplotypes but trace back to a single ancient intrachromosomal recombination event with crossover. Taking advantage of an ancestral sequence variant specific for all H1 alleles we developed a simple gDNA-based polymerase chain reaction (PCR) assay that can be used to identify H1-allele carriers with high sensitivity and specificity (100 and 99%, respectively). Because H1 hybrid alleles harbor missense variant p.N775S of so far unknown functional significance, we assessed the H1-carrier frequency in 164 colorectal cancer patients. So far, we found no indication that the variant plays a major role with regard to cancer susceptibility. (c) 2010 Wiley-Liss, Inc.

Formaldehyde activation of mitoxantrone yields CpG and CpA specific DNA adducts

PubMed Central

Parker, Belinda S.; Cutts, Suzanne M.; Cullinane, Carleen; Phillips, Don R.

2000-01-01

Recently we have found that mitoxantrone, like Adriamycin, can be activated by formaldehyde and subsequently form adducts which stabilise double-stranded DNA in vitro. This activation by formaldehyde may be biologically relevant since formaldehyde levels are elevated in those tumours in which mitoxantrone is most cytotoxic. In vitro transcription analysis revealed that these adducts block the progression of RNA polymerase during transcription and cause truncated RNA transcripts. There was an absolute requirement for both mitoxantrone and formaldehyde in transcriptional blockage formation and the activated complex was found to exhibit site specificity, with blockage occurring prior to CpG and CpA sites in the DNA (non-template strand). The stability of the adduct at 37°C was site dependent. The half-lives ranged from 45 min to ~5 h and this was dependent on both the central 2 bp blockage site as well as flanking sequences. The CpG specificity of mitoxantrone adduct sites was also confirmed independently by a λ exonuclease digestion assay. PMID:10648792

Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

PubMed

Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

2015-08-01

Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

Epigenetic regulation of the DRD4 gene and dimensions of attention-deficit/hyperactivity disorder in children.

PubMed

Dadds, Mark R; Schollar-Root, Olivia; Lenroot, Rhoshel; Moul, Caroline; Hawes, David J

2016-10-01

Recent evidence suggests that epigenetic regulation of the DRD4 gene may characterise specific aspects of ADHD symptomology. We tested associations between ADHD symptoms and epigenetic changes to the DRD4 gene in DNA extracted from blood and saliva in N = 330 children referred for a variety of behavioural and emotional problems. ADHD was indexed using DSM diagnoses as well as mother, father, and teacher reports. Methylation levels were assayed for the island of 18 CpG sites in the DRD4 receptor gene. A nearby SNP, rs3758653, was also genotyped as it has previously been shown to influence methylation levels. There was high consistency of methylation levels across CpG sites and tissue sources, and higher methylation levels were associated with the major allele of SNP rs3758653. Higher methylation levels were associated with more severe ADHD independent of SNP status, tissue source, ethnicity, environmental adversity, and comorbid conduct problems. The association applied specifically to the cognitive/attentional, rather than hyperactivity problems that characterise ADHD. The results indicate that epigenetic regulation of the DRD4 gene in the form of increased methylation is associated with the cognitive/attentional deficits in ADHD.

Quantitative methylation level of the EPHX1 promoter in peripheral blood DNA is associated with polycystic ovary syndrome.

PubMed

Sang, Qing; Li, Xin; Wang, Haojue; Wang, Huan; Zhang, Shaozhen; Feng, Ruizhi; Xu, Yao; Li, Qiaoli; Zhao, Xinzhi; Xing, Qinghe; Jin, Li; He, Lin; Wang, Lei

2014-01-01

Steroid synthesis and metabolic pathways play important roles in the pathophysiology of PCOS, but until now there have been no studies on the methylation profiles of specific genes in steroid synthesis pathways that are known to be associated with PCOS. Here we used MassARRAY quantitative methylation analysis to determine the methylation levels of each CpG site or cluster in the promoters of EPHX1, SRD5A1, and CYP11A1 in 64 peripheral blood samples. We further examined the methylation level of EPHX1 in an independent cohort consisting of 116 people. Finally, we investigated the role of EPHX1 in steroidogenesis in the KGN cell line. For SRD5A1 and CYP11A1, there was no significant difference in methylation level between patients and controls. For EPHX1, however, the methylation levels of a few consecutive CpG sites and clusters were found to be significantly associated with PCOS. The methylation levels of a number of CpG clusters or sites were significantly lower in patients than in controls in the first cohort consisting of 64 people, such as clusters 13-14 (P<0.05), 15-16 (P<0.001), and 19-24 (P<0.001) and sites CpG_53 (P<0.01) and CpG_54 (P<0.05). Among differentiated methylation sites and clusters, the methylation levels of the CpG cluster 13-14 and CpG cluster 19-24 in PCOS patients were significantly lower than in controls in the second cohort of 116 people (P<0.05 for both). In addition, knockdown and overexpression experiments in KGN cells showed that EPHX1 can regulate estradiol concentrations, and this indicates a role for EPHX1 in steroidogenesis. Our study has demonstrated that methylation of the EPHX1 promoter might be associated with PCOS. This study provides direct evidence that methylation plays an important role in PCOS and demonstrates a novel role for EPHX1 in female reproduction.

Quantitative Methylation Level of the EPHX1 Promoter in Peripheral Blood DNA Is Associated with Polycystic Ovary Syndrome

PubMed Central

Wang, Huan; Zhang, Shaozhen; Feng, Ruizhi; Xu, Yao; Li, Qiaoli; Zhao, Xinzhi; Xing, Qinghe; Jin, Li; He, Lin; Wang, Lei

2014-01-01

Steroid synthesis and metabolic pathways play important roles in the pathophysiology of PCOS, but until now there have been no studies on the methylation profiles of specific genes in steroid synthesis pathways that are known to be associated with PCOS. Here we used MassARRAY quantitative methylation analysis to determine the methylation levels of each CpG site or cluster in the promoters of EPHX1, SRD5A1, and CYP11A1 in 64 peripheral blood samples. We further examined the methylation level of EPHX1 in an independent cohort consisting of 116 people. Finally, we investigated the role of EPHX1 in steroidogenesis in the KGN cell line. For SRD5A1 and CYP11A1, there was no significant difference in methylation level between patients and controls. For EPHX1, however, the methylation levels of a few consecutive CpG sites and clusters were found to be significantly associated with PCOS. The methylation levels of a number of CpG clusters or sites were significantly lower in patients than in controls in the first cohort consisting of 64 people, such as clusters 13–14 (P<0.05), 15–16 (P<0.001), and 19–24 (P<0.001) and sites CpG_53 (P<0.01) and CpG_54 (P<0.05). Among differentiated methylation sites and clusters, the methylation levels of the CpG cluster 13–14 and CpG cluster 19–24 in PCOS patients were significantly lower than in controls in the second cohort of 116 people (P<0.05 for both). In addition, knockdown and overexpression experiments in KGN cells showed that EPHX1 can regulate estradiol concentrations, and this indicates a role for EPHX1 in steroidogenesis. Our study has demonstrated that methylation of the EPHX1 promoter might be associated with PCOS. This study provides direct evidence that methylation plays an important role in PCOS and demonstrates a novel role for EPHX1 in female reproduction. PMID:24505354

Comparison of sensitivity and specificity of 4 methods for detection of Giardia duodenalis in feces: immunofluorescence and PCR are superior to microscopy of concentrated iodine-stained samples.

PubMed

Gotfred-Rasmussen, Helle; Lund, Marianne; Enemark, Heidi L; Erlandsen, Mogens; Petersen, Eskild

2016-03-01

For decades, microscopy of feces after formol-ethylacetate (FEA) concentration and iodine staining has been the routine test for intestinal protozoa. Lately, polymerase chain reaction or fluorescence-labeled parasite-specific antibodies have been introduced, but their place in everyday routine diagnostics has not yet been established. We compared FEA and salt-sugar flotation (SSF) concentration followed by microscopy of iodine-stained concentrate and immunofluorescence assay (IFA) and real-time polymerase chain reaction (qPCR) for detection of Giardia duodenalis in human feces. The median number of Giardia cysts found by FEA in 19 Giardia-positive samples was 50 cysts per gram (CPG), by SSF 350 CPG, by IFA 76,700 CPG, and by qPCR 316,000 CPG. We next tested 455 consecutive samples for presence of Giardia cysts. Using IFA as reference, qPCR had a sensitivity of 91%, specificity of 95.1%, a false-positive rate of 50%, a false-negative rate of 0.48%, a positive predictive value of 50%, and a negative predictive value of 99.5%. In conclusion, qPCR and IFA were significantly more sensitive than microscopy of iodine-stained concentrates using either FEA or SSF. We suggest, when using qPCR, that positive samples are verified by IFA to prevent false-positive results. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Genome-wide methylation analysis in Silver-Russell syndrome patients

PubMed Central

Böhm, S; Frost, JM; Puszyk, W; Abu-Amero, S; Stanier, P; Schulz, R; Moore, GE; Oakey, RJ

2015-01-01

Silver-Russell Syndrome (SRS) is a clinically heterogeneous disorder characterised by severe in utero growth restriction and poor postnatal growth, body asymmetry, irregular craniofacial features and several additional minor malformations. The aetiology of SRS is complex and current evidence strongly implicates imprinted genes. Approximately half of all patients exhibit DNA hypomethylation at the H19/IGF2 imprinted domain, and around 10% have maternal uniparental disomy of chromosome 7. We measured DNA methylation in 18 SRS patients at >485,000 CpG sites using DNA methylation microarrays. Using a novel bioinformatics methodology specifically designed to identify subsets of patients with a shared epimutation, we analysed methylation changes genome-wide as well as at known imprinted regions to identify SRS-associated epimutations. Our analysis identifies epimutations at the previously characterised domains of H19/IGF2 and at imprinted regions on chromosome 7, providing proof of principle that our methodology can detect DNA methylation changes at imprinted loci. In addition we discovered two novel epimutations associated with SRS and located at imprinted loci previously linked to relevant mouse and human phenotypes. We identify RB1 as an additional imprinted locus associated with SRS, with a region near the RB1 DMR hypermethylated in 13/18 (~70 %) patients. We also report 6/18 (~33 %) patients were hypermethylated at a CpG island near the ANKRD11 gene. We do not observe consistent cooccurrence of epimutations at multiple imprinted loci in single SRS individuals. SRS is clinically heterogeneous and the absence of multiple imprinted loci epimutations reflects the heterogeneity at the molecular level. Further stratification of SRS patients by molecular phenotypes might aid the identification of disease causes. PMID:25563730

Allelic exclusion of the immunoglobulin heavy chain locus is independent of its nuclear localization in mature B cells

PubMed Central

Holwerda, Sjoerd J. B.; van de Werken, Harmen J. G.; Ribeiro de Almeida, Claudia; Bergen, Ingrid M.; de Bruijn, Marjolein J. W.; Verstegen, Marjon J. A. M.; Simonis, Marieke; Splinter, Erik; Wijchers, Patrick J.; Hendriks, Rudi W.; de Laat, Wouter

2013-01-01

In developing B cells, the immunoglobulin heavy chain (IgH) locus is thought to move from repressive to permissive chromatin compartments to facilitate its scheduled rearrangement. In mature B cells, maintenance of allelic exclusion has been proposed to involve recruitment of the non-productive IgH allele to pericentromeric heterochromatin. Here, we used an allele-specific chromosome conformation capture combined with sequencing (4C-seq) approach to unambigously follow the individual IgH alleles in mature B lymphocytes. Despite their physical and functional difference, productive and non-productive IgH alleles in B cells and unrearranged IgH alleles in T cells share many chromosomal contacts and largely reside in active chromatin. In brain, however, the locus resides in a different repressive environment. We conclude that IgH adopts a lymphoid-specific nuclear location that is, however, unrelated to maintenance of allelic exclusion. We additionally find that in mature B cells—but not in T cells—the distal VH regions of both IgH alleles position themselves away from active chromatin. This, we speculate, may help to restrict enhancer activity to the productively rearranged VH promoter element. PMID:23748562

A Knowledge-Modeling Approach to Integrate Multiple Clinical Practice Guidelines to Provide Evidence-Based Clinical Decision Support for Managing Comorbid Conditions.

PubMed

Abidi, Samina

2017-10-26

Clinical management of comorbidities is a challenge, especially in a clinical decision support setting, as it requires the safe and efficient reconciliation of multiple disease-specific clinical procedures to formulate a comorbid therapeutic plan that is both effective and safe for the patient. In this paper we pursue the integration of multiple disease-specific Clinical Practice Guidelines (CPG) in order to manage co-morbidities within a computerized Clinical Decision Support System (CDSS). We present a CPG integration framework-termed as COMET (Comorbidity Ontological Modeling & ExecuTion) that manifests a knowledge management approach to model, computerize and integrate multiple CPG to yield a comorbid CPG knowledge model that upon execution can provide evidence-based recommendations for handling comorbid patients. COMET exploits semantic web technologies to achieve (a) CPG knowledge synthesis to translate a paper-based CPG to disease-specific clinical pathways (CP) that include specialized co-morbidity management procedures based on input from domain experts; (b) CPG knowledge modeling to computerize the disease-specific CP using a Comorbidity CPG ontology; (c) CPG knowledge integration by aligning multiple ontologically-modeled CP to develop a unified comorbid CPG knowledge model; and (e) CPG knowledge execution using reasoning engines to derive CPG-mediated recommendations for managing patients with comorbidities. We present a web-accessible COMET CDSS that provides family physicians with CPG-mediated comorbidity decision support to manage Atrial Fibrillation and Chronic Heart Failure. We present our qualitative and quantitative analysis of the knowledge content and usability of COMET CDSS.

Combined Analysis of COX-2 and p53 Expressions Reveals Synergistic Inverse Correlations with Microsatellite Instability and CpG Island Methylator Phenotype in Colorectal Cancer1

PubMed Central

Ogino, Shuji; Brahmandam, Mohan; Kawasaki, Takako; Kirkner, Gregory J; Loda, Massimo; Fuchs, Charles S

2006-01-01

Abstract Cyclooxygenase-2 (COX-2) overexpression and mutations of p53 (a known COX-2 regulator) are inversely associated with microsatellite instability—high (MSI-H) and CpG island methylator phenotype (CIMP), characterized by extensive promoter methylation, is associated with MSI-H. However, no studies have comprehensively examined interrelations between COX-2, p53, MSI, and CIMP. Using MethyLight, we measured DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16/INK4A), CRABP1, MLH1, and NEUROG1] in relatively unbiased samples of 751 colorectal cancer cases obtained from two large prospective cohorts; 115 (15%) tumors were CIMP-high (≥ 4 of 5 methylated promoters), 251 (33%) were CIMP-low (1 to 3 methylated promoters), and the remaining 385 (51%) were CIMP-0 (no methylated promoters). CIMP-high tumors were much less frequent in COX-2+/p53+ tumors (4.6%) than in COX-2+/p53- tumors (19%; P < .0001), COX-2-/p53+ tumors (17%; P= .04), and COX-2-/p53- tumors (28%; P < .0001). In addition, COX-2+/p53+ tumors were significantly less common in MSI-H CIMP-high tumors (9.7%) than in non-MSI-H CIMP-low/CIMP-0 tumors (44–47%; P< .0001). In conclusion, COX-2 and p53 alterations were synergistically inversely correlated with both MSI-H and CIMP-high. Our data suggest that a combined analysis of COX-2 and p53 may be more useful for the molecular classification of colorectal cancer than either COX-2 or p53 analysis alone. PMID:16820091

Analysis of the methylation status of the KCNQ1OT and H19 genes in leukocyte DNA for the diagnosis and prognosis of Beckwith-Wiedemann syndrome.

PubMed

Gaston, V; Le Bouc, Y; Soupre, V; Burglen, L; Donadieu, J; Oro, H; Audry, G; Vazquez, M P; Gicquel, C

2001-06-01

Beckwith-Wiedemann syndrome (BWS) is an overgrowth disorder involving developmental abnormalities, tissue and organ hyperplasia and an increased risk of embryonal tumours (most commonly Wilms tumour). This multigenic disorder is caused by dysregulation of the expression of imprinted genes in the 11p15 chromosomal region. Molecular diagnosis of BWS is currently difficult, mostly due to the large spectrum of genetic and epigenetic abnormalities. The other difficulty in managing BWS is the identification of patients at risk of tumour. An imprinted antisense transcript within KCNQ1, called KCNQ1OT (also known as LIT1), was recently shown to be normally expressed from the paternal allele. A loss of imprinting of the KCNQ1OT gene, associated with the loss of maternal allele-specific methylation of the differentially methylated region KvDMR1 has been described in BWS patients. The principal aim of this study was to evaluate the usefulness of KvDMR1 methylation analysis of leukocyte DNA for the diagnosis of BWS. The allelic status of the 11p15 region and the methylation status of the KCNQ1OT and H19 genes were investigated in leukocyte DNA from 97 patients referred for BWS and classified into two groups according to clinical data: complete BWS (CBWS) (n=61) and incomplete BWS (IBWS) (n=36). Fifty-eight (60%) patients (39/61 CBWS and 19/36 IBWS) displayed abnormal demethylation of KvDMR1. In 11 of the 56 informative cases, demethylation of KvDMR1 was related to 11p15 uniparental disomy (UPD) (nine CBWS and two IBWS). Thirteen of the 39 patients with normal methylation of KvDMR1 displayed hypermethylation of the H19 gene. These 13 patients included two siblings with 11p15 trisomy. These results show that analysis of the methylation status of KvDMR1 and the H19 gene in leukocyte DNA is useful in the diagnosis of 11p15-related overgrowth syndromes, resulting in the diagnosis of BWS in more than 70% of investigated patients. We also evaluated clinical and molecular features as prognostic factors for tumour and showed that mosaicism for 11p15 UPD and hypermethylation of the H19 gene in blood cells were associated with an increased risk of tumour.

DNA methylation profiling for a confirmatory test for blood, saliva, semen, vaginal fluid and menstrual blood.

PubMed

Lee, Hwan Young; Jung, Sang-Eun; Lee, Eun Hee; Yang, Woo Ick; Shin, Kyoung-Jin

2016-09-01

The ability to predict the type of tissues or cells from molecular profiles of crime scene samples has important practical implications in forensics. A previously reported multiplex assay using DNA methylation markers could only discriminate between 4 types of body fluids: blood, saliva, semen, and the body fluid which originates from female reproductive organ. In the present study, we selected 15 menstrual blood-specific CpG marker candidates based on analysis of 12 genome-wide DNA methylation profiles of vaginal fluid and menstrual blood. The menstrual blood-specificity of the candidate markers was confirmed by comparison with HumanMethylation450 BeadChip array data obtained for 58 samples including 12 blood, 12 saliva, 12 semen, 3 vaginal fluid, and 19 skin epidermis samples. Among 15CpG marker candidates, 3 were located in the promoter region of the SLC26A10 gene, and 2 of them (cg09696411 and cg18069290) showed high menstrual blood specificity. DNA methylation at the 2CpG markers was further tested by targeted bisulfite sequencing of 461 additional samples including 49 blood, 52 saliva, 34 semen, 125 vaginal fluid, and 201 menstrual blood. Because the 2 markers showed menstrual blood-specific methylation patterns, we modified our previous multiplex methylation SNaPshot reaction to include these 2 markers. In addition, a blood marker cg01543184 with cross reactivity to semen was replaced with cg08792630, and a semen-specific unmethylation marker cg17621389 was removed. The resultant multiplex methylation SNaPshot allowed positive identification of blood, saliva, semen, vaginal fluid and menstrual blood using the 9CpG markers which show a methylation signal only in the target body fluids. Because of the complexity in cell composition, menstrual bloods produced DNA methylation profiles that vary with menstrual cycle and sample collection methods, which are expected to provide more insight into forensic menstrual blood test. Moreover, because the developed multiplex methylation SNaPshot reaction includes the 4CpG markers of which specificities have been confirmed by multiple studies, it will facilitate confirmatory tests for body fluids that are frequently observed in forensic casework. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Hepatocellular carcinomas of the albumin SV40 T-antigen transgenic rat display fetal-like re-expression of lgf2 and deregulation of H19.

PubMed

Czarny, Matthew J; Babcock, Karlee; Baus, Rebecca M; Manoharan, Herbert; Pitot, Henry C

2007-09-01

Previous studies in our laboratory have shown that one of the earliest events during hepatocarcinogenesis in the albumin SV40 T antigen (Alb SV40 T Ag) transgenic rat is the duplication of chromosome 1q3.7-4.3, a region which contains the imprinted and coordinately regulated genes Igf2 and H19. We have also shown that this duplication is associated with the biallelic expression of the normally monoallelically-expressed H19. These results, however, are seemingly at odds with studies in the mouse that have shown a conservation of fetal regulatory patterns of these two genes in hepatic neoplasms. We therefore aimed in this study to determine the allelic origin of Igf2 expression in hepatocellular carcinomas of the Alb SV40 T Ag transgenic rat. Sprague-Dawley Alb SV40 T Ag transgenic rats and Brown Norway rats were reciprocally mated and the expression of Igf2 in hepatocellular carcinomas of the resulting F(1) transgene-positive female rats was analyzed by Northern blotting and RT-PCR. We determined that Igf2 was expressed exclusively from the paternal allele, which prompted the study (by the same methods) of the allelic origin of H19 in the same hepatocellular carcinomas in order to determine if the two genes remained coordinately regulated. Our results demonstrate fetal-like re-expression of Igf2 and deregulation of H19 in singular hepatocellular carcinomas of the rat. These results imply that another regulatory mechanism other than the generally accepted ICR/CTCF mechanism may play a role in the control of Igf2 and H19 expression. (c) 2007 Wiley-Liss, Inc.

Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.

PubMed

Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A

2004-09-01

Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.

Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

PubMed

Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

2018-05-01

DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

Analysis of serotonin receptor 2A gene (HTR2A): association study with autism spectrum disorder in the Indian population and investigation of the gene expression in peripheral blood leukocytes.

PubMed

Guhathakurta, Subhrangshu; Singh, Asem Surindro; Sinha, Swagata; Chatterjee, Anindita; Ahmed, Shabina; Ghosh, Saurabh; Usha, Rajamma

2009-12-01

Several studies suggest involvement of serotoninergic system in the pathophysiology of Autism Spectrum Disorder (ASD). The 5-HT receptor binding studies using (3)H-lysergic acid diethylamide ((3)H-LSD) and linkage analysis provided evidences to consider HTR2A as a potential candidate gene for ASD. The three SNPs, -1438A/G (rs6311), 102T/C (rs6313) and 1354C/T (rs6314) of HTR2A have been well studied in the etiology of various neuropsychiatric disorders. But studies on association of this gene with ASD are limited to two reports from American and Korean populations. Additionally there are reports, which demonstrated paternal imprinting of HTR2A with expression from only one allele. So far no reports are available on HTR2A and its association with any neuropsychiatric disorders from Indian population. Therefore, the present study investigates association of the above mentioned three markers of HTR2A with ASD in Indian population using population and family-based approaches. The study also deals with allelic expression pattern of HTR2A in Peripheral Blood Leukocytes (PBLs) to understand the parental imprinting status. The genotyping analyses were carried out for probands, parents and controls. The subsequent association analyses did not show association of these markers with ASD. So, HTR2A is unlikely to be a genetic marker for ASD in Indian population. The expression analyses showed absence of monoallelic expression, suggesting lack of parental imprinting of HTR2A gene. However, we noticed methylation of the CpG sites at -1438A/G and 102T/C loci of HTR2A gene. Further bioinformatics analysis revealed absence of CpG islands in the promoter of the gene supporting biallelic expression pattern of HTR2A in PBLs.

A survey of FRAXE allele sizes in three populations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhong, N.; Ju, W.; Curley, D.

1996-08-09

FRAXE is a fragile site located at Xq27-8, which contains polymorphic triplet GCC repeats associated with a CpG island. Similar to FRAXA, expansion of the GCC repeats results in an abnormal methylation of the CpG island and is associated with a mild mental retardation syndrome (FRAXE-MR). We surveyed the GCC repeat alleles of FRAXE from 3 populations. A total of 665 X chromosomes including 416 from a New York Euro-American sample (259 normal and 157 with FRAXA mutations), 157 from a Chinese sample (144 normal and 13 FRAXA), and 92 from a Finnish sample (56 normal and 36 FRAXA) weremore » analyzed by polymerase chain reaction. Twenty-seven alleles, ranging from 4 to 39 GCC repeats, were observed. The modal repeat number was 16 in the New York and Finnish samples and accounted for 24% of all the chromosomes tested (162/665). The modal repeat number in the Chinese sample was 18. A founder effect for FRAXA was suggested among the Finnish FRAXA samples in that 75% had the FRAXE 16 repeat allele versus only 30% of controls. Sequencing of the FRAXE region showed no imperfections within the GCC repeat region, such as those commonly seen in FRAXA. The smaller size and limited range of repeats and the lack of imperfections suggests the molecular mechanisms underlying FRAXE triplet mutations may be different from those underlying FRAXA. 27 refs., 4 figs., 1 tab.« less

Silicon central pattern generators for cardiac diseases

PubMed Central

Nogaret, Alain; O'Callaghan, Erin L; Lataro, Renata M; Salgado, Helio C; Meliza, C Daniel; Duncan, Edward; Abarbanel, Henry D I; Paton, Julian F R

2015-01-01

Cardiac rhythm management devices provide therapies for both arrhythmias and resynchronisation but not heart failure, which affects millions of patients worldwide. This paper reviews recent advances in biophysics and mathematical engineering that provide a novel technological platform for addressing heart disease and enabling beat-to-beat adaptation of cardiac pacing in response to physiological feedback. The technology consists of silicon hardware central pattern generators (hCPGs) that may be trained to emulate accurately the dynamical response of biological central pattern generators (bCPGs). We discuss the limitations of present CPGs and appraise the advantages of analog over digital circuits for application in bioelectronic medicine. To test the system, we have focused on the cardio-respiratory oscillators in the medulla oblongata that modulate heart rate in phase with respiration to induce respiratory sinus arrhythmia (RSA). We describe here a novel, scalable hCPG comprising physiologically realistic (Hodgkin–Huxley type) neurones and synapses. Our hCPG comprises two neurones that antagonise each other to provide rhythmic motor drive to the vagus nerve to slow the heart. We show how recent advances in modelling allow the motor output to adapt to physiological feedback such as respiration. In rats, we report on the restoration of RSA using an hCPG that receives diaphragmatic electromyography input and use it to stimulate the vagus nerve at specific time points of the respiratory cycle to slow the heart rate. We have validated the adaptation of stimulation to alterations in respiratory rate. We demonstrate that the hCPG is tuneable in terms of the depth and timing of the RSA relative to respiratory phase. These pioneering studies will now permit an analysis of the physiological role of RSA as well as its any potential therapeutic use in cardiac disease. PMID:25433077

Biallelic expression of the H19 gene during spontaneous hepatocarcinogenesis in the albumin SV40 T antigen transgenic rat.

PubMed

Manoharan, Herbert; Babcock, Karlee; Willi, Jonathan; Pitot, Henry C

2003-09-01

Previous studies in this laboratory have demonstrated that the earliest cytogenetic alteration in the development of hepatic neoplasms in a transgenic strain of rats bearing the albumin Simian virus 40 T antigen (Alb SV40 T Ag) construct was a duplication of the chromosome 1q4.1-1q4.2 band. In this region, in the rat genome a cluster of linked imprinted genes occurs. One of these imprinted genes, H19, which is expressed in fetal liver but not in adult liver, was found to be expressed in virtually all neoplasms investigated. A single-nucleotide polymorphic marker in the H19 coding sequence was identified in two rat strains and utilized for the investigation of H19 imprinting. Our results reveal monoallelic expression of the maternal gene in fetal liver, but biallelic expression of the H19 gene in liver neoplasms, thus demonstrating the basis for the deregulation of the imprinted gene expression during hepatocarcinogenesis. These results suggest that the loss of genomic imprinting of the H19 gene found in the liver neoplasms of the Alb SV40 T Ag rat may result not from allelic loss, but from adverse changes in the epigenetic imprints present in the 5'-upstream region of the H19 promoter of the parental alleles. Copyright 2003 Wiley-Liss, Inc.

The dynamic DNA methylation landscape of the mutL homolog 1 shore is altered by MLH1-93G>A polymorphism in normal tissues and colorectal cancer.

PubMed

Savio, Andrea J; Mrkonjic, Miralem; Lemire, Mathieu; Gallinger, Steven; Knight, Julia A; Bapat, Bharat

2017-01-01

Colorectal cancers (CRCs) undergo distinct genetic and epigenetic alterations. Expression of mutL homolog 1 ( MLH1 ), a mismatch repair gene that corrects DNA replication errors, is lost in up to 15% of sporadic tumours due to mutation or, more commonly, due to DNA methylation of its promoter CpG island. A single nucleotide polymorphism (SNP) in the CpG island of MLH1 ( MLH1 -93G>A or rs1800734) is associated with CpG island hypermethylation and decreased MLH1 expression in CRC tumours. Further, in peripheral blood mononuclear cell (PBMC) DNA of both CRC cases and non-cancer controls, the variant allele of rs1800734 is associated with hypomethylation at the MLH1 shore, a region upstream of its CpG island that is less dense in CpG sites . To determine whether this genotype-epigenotype association is present in other tissue types, including colorectal tumours, we assessed DNA methylation in matched normal colorectal tissue, tumour, and PBMC DNA from 349 population-based CRC cases recruited from the Ontario Familial Colorectal Cancer Registry. Using the semi-quantitative real-time PCR-based MethyLight assay, MLH1 shore methylation was significantly higher in tumour tissue than normal colon or PBMCs ( P  < 0.01). When shore methylation levels were stratified by SNP genotype, normal colorectal DNA and PBMC DNA were significantly hypomethylated in association with variant SNP genotype ( P  < 0.05). However, this association was lost in tumour DNA. Among distinct stages of CRC, metastatic stage IV CRC tumours incurred significant hypomethylation compared to stage I-III cases, irrespective of genotype status. Shore methylation of MLH1 was not associated with MSI status or promoter CpG island hypermethylation, regardless of genotype. To confirm these results, bisulfite sequencing was performed in matched tumour and normal colorectal specimens from six CRC cases, including two cases per genotype (wildtype, heterozygous, and homozygous variant). Bisulfite sequencing results corroborated the methylation patterns found by MethyLight, with significant hypomethylation in normal colorectal tissue of variant SNP allele carriers. These results indicate that the normal tissue types tested (colorectum and PBMC) experience dynamic genotype-associated epigenetic alterations at the MLH1 shore, whereas tumour DNA incurs aberrant hypermethylation compared to normal DNA.

Efficient molecular screening of Lynch syndrome by specific 3' promoter methylation of the MLH1 or BRAF mutation in colorectal cancer with high-frequency microsatellite instability.

PubMed

Nakagawa, Hitoshi; Nagasaka, Takeshi; Cullings, Harry M; Notohara, Kenji; Hoshijima, Naoko; Young, Joanne; Lynch, Henry T; Tanaka, Noriaki; Matsubara, Nagahide

2009-06-01

It is sometimes difficult to diagnose Lynch syndrome by the simple but strict clinical criteria, or even by the definitive genetic testing for causative germline mutation of mismatch repair genes. Thus, some practical and efficient screening strategy to select highly possible Lynch syndrome patients is exceedingly desirable. We performed a comprehensive study to evaluate the methylation status of whole MLH1 promoter region by direct bisulfite sequencing of the entire MLH1 promoter regions on Lynch and non-Lynch colorectal cancers (CRCs). Then, we established a convenient assay to detect methylation in key CpG islands responsible for the silencing of MLH1 expression. We studied the methylation status of MLH1 as well as the CpG island methylator phenotype (CIMP) and immunohistochemical analysis of mismatch repair proteins on 16 cases of Lynch CRC and 19 cases of sporadic CRCs with high-frequency microsatellite instability (MSI-H). Sensitivity to detect Lynch syndrome by MLH1 (CCAAT) methylation was 88% and the specificity was 84%. Positive likelihood ratio (PLR) was 5.5 and negative likelihood ratio (NLR) was 0.15. Sensitivity by mutational analysis of BRAF was 100%, specificity was 84%, PLR was 6.3 and NLR was zero. By CIMP analysis; sensitivity was 88%, specificity was 79%, PLR was 4.2, and NLR was 0.16. BRAF mutation or MLH1 methylation analysis combined with MSI testing could be a good alternative to screen Lynch syndrome patients in a cost effective manner. Although the assay for CIMP status also showed acceptable sensitivity and specificity, it may not be practical because of its rather complicated assay.

A multifamily study on the relationship between CYP2C19 genotype and s-mephenytoin oxidation phenotype.

PubMed

Brøsen, K; de Morais, S M; Meyer, U A; Goldstein, J A

1995-10-01

It has recently been shown that the most common mutation (named m1) in both Caucasian and Japanese poor metabolizers (PM) of S-mephenytoin is a single base pair mutation (G-->A) in exon 5 of the CYP2C19 gene. In Japanese, a second defective allele of CYP2C19 named m2 consists of a G-->A mutation in exon 4. In the present study, we have investigated the inheritance of the CYP2C19 wild type allele (wt) and the two defective alleles (m1 and m2) in families of 11 Danish PM probands. The study was carried out for two principal reasons. First, we wanted to confirm the autosomal recessive inheritance of the defective alleles, and second, we wanted to examine the specificity and sensitivity of the CYP2C19 genotyping test. Individuals were phenotyped by measuring the ratio of S/R mephenytoin excreted in the urine after administration of mephenytoin, and genotyping was carried out by a PCR-based DNA amplification procedure. The genotypes of nine of the 11 probands were consistent with their phenotypes. Eight were homozygous m1/m1, and one was heterozygous m1/m2. The genotypes of two putative PM probands (wt/m1) were not consistent with their phenotypes. On the basis of extended phenotyping (additional late urine collections (24-36 h) and acidification of urine), one of these could probably be reclassified as an extensive metabolizer (EM) while the other was considered to be a true PM. This suggests the presence of an additional unknown mutant allele in the latter. Seven of the 41 phenotyped relatives in the 11 families were phenotyped as PMs, and with the exception of the father of family 10, their genotypes (m1/m1) were consistent with their phenotypes. Extended phenotyping (acidification of urine) suggested that the father of family 10 in fact is an EM and hence that his genotype (wt/m1) is concordant with his phenotype. Thus, the specificity of genotyping tests for PM was 100%, while the sensitivity was 15/16 or 94%. Our study provides unequivocal evidence for autosomal recessive inheritance of the PM trait.

A hypervariable STR polymorphism in the CFI gene: southern origin of East Asian-specific group H alleles.

PubMed

Yuasa, Isao; Jin, Feng; Harihara, Shinji; Matsusue, Aya; Fujihara, Junko; Takeshita, Haruo; Akane, Atsushi; Umetsu, Kazuo; Saitou, Naruya; Chattopadhyay, Prasanta K

2013-09-01

Previous studies of four populations revealed that a hypervariable short tandem repeat (iSTR) in intron 7 of the human complement factor I (CFI) gene on chromosome 4q was unique, with 17 possible East Asian-specific group H alleles observed at relatively high frequencies. To develop a deeper anthropological and forensic understanding of iSTR, 1161 additional individuals from 11 Asian populations were investigated. Group H alleles of iSTR and c.1217A allele of a SNP in exon 11 of the CFI gene were associated with each other and were almost entirely confined to East Asian populations. Han Chinese in Changsha, southern China, showed the highest frequency for East Asian-specific group H alleles (0.201) among 15 populations. Group H alleles were observed to decrease gradually from south to north in 11 East Asian populations. This expansion of group H alleles provides evidence that southern China and Southeast Asia are a hotspot of Asian diversity and a genetic reservoir of Asians after they entered East Asia. The expected heterozygosity values of iSTR ranged from 0.927 in Thais to 0.874 in Oroqens, higher than those of an STR in the fibrinogen alpha chain (FGA) gene on chromosome 4q. Thus, iSTR is a useful marker for anthropological and forensic genetics. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

An Animal Model of Abacavir-Induced HLA-Mediated Liver Injury.

PubMed

Song, Binbin; Aoki, Shigeki; Liu, Cong; Susukida, Takeshi; Ito, Kousei

2018-04-01

Genome-wide association studies indicate that several idiosyncratic adverse drug reactions are highly associated with specific human leukocyte antigen (HLA) alleles. For instance, abacavir, a human immunodeficiency virus reverse transcriptase inhibitor, induces multiorgan toxicity exclusively in patients carrying the HLA-B*57:01 allele. However, the underlying mechanism is unclear due to a lack of appropriate animal models. Previously, we developed HLA-B*57:01 transgenic mice and found that topical application of abacavir to the ears induced proliferation of CD8+ lymphocytes in local lymph nodes. Here, we attempted to reproduce abacavir-induced liver injury in these mice. However, oral administration of abacavir alone to HLA-B*57:01 transgenic mice did not increase levels of the liver injury marker alanine aminotransferase. Considering the importance of innate immune activation in mouse liver, we treated mice with CpG oligodeoxynucleotide, a toll-like receptor 9 agonist, plus abacavir. This resulted in a marked increase in alanine aminotransferase, pathological changes in liver, increased numbers of activated CD8+ T cells, and tissue infiltration by immune cells exclusively in HLA-B*57:01 transgenic mice. These results indicate that CpG oligodeoxynucleotide-induced inflammatory reactions and/or innate immune activation are necessary for abacavir-induced HLA-mediated liver injury characterized by infiltration of CD8+ T cells. Thus, we developed the first mouse model of HLA-mediated abacavir-induced idiosyncratic liver injury. Further investigation will show that the proposed HLA-mediated liver injury model can be applied to other combinations of drugs and HLA types, thereby improving drug development and contributing to the development of personalized medicine.

Short mucin 6 alleles are associated with H pylori infection

PubMed Central

Nguyen, Thai V; Janssen, Marcel JR; Gritters, Paulien; te Morsche, René HM; Drenth, Joost PH; van Asten, Henri; Laheij, Robert JF; Jansen, Jan BMJ

2006-01-01

AIM: To investigate the relationship between mucin 6 (MUC6) VNTR length and H pylori infection. METHODS: Blood samples were collected from patients visiting the Can Tho General Hospital for upper gastrointestinal endoscopy. DNA was isolated from whole blood, the repeated section was cut out using a restriction enzyme (PvuII) and the length of the allele fragments was determined by Southern blotting. H pylori infection was diagnosed by 14C urea breath test. For analysis, MUC6 allele fragment length was dichotomized as being either long (> 13.5 kbp) or short (≤ 13.5 kbp) and patients were classified according to genotype [long-long (LL), long-short (LS), short-short (SS)]. RESULTS: 160 patients were studied (mean age 43 years, 36% were males, 58% H pylori positive). MUC6 PvuII-restricted allele fragment lengths ranged from 7 to 19 kbp. Of the patients with the LL, LS, SS MUC6 genotype, 43% (24/56), 57% (25/58) and 76% (11/46) were infected with H pylori, respectively (P = 0.003). CONCLUSION: Short MUC6 alleles are associated with H pylori infection. PMID:17009402

Short mucin 6 alleles are associated with H pylori infection.

PubMed

Nguyen, Thai V; Janssen, Marcel; Gritters, Paulien; te Morsche, René H M; Drenth, Joost P H; van Asten, Henri; Laheij, Robert J F; Jansen, Jan B M J

2006-10-07

To investigate the relationship between mucin 6 (MUC6) VNTR length and H pylori infection. Blood samples were collected from patients visiting the Can Tho General Hospital for upper gastrointestinal endoscopy. DNA was isolated from whole blood, the repeated section was cut out using a restriction enzyme (Pvu II) and the length of the allele fragments was determined by Southern blotting. H pylori infection was diagnosed by (14)C urea breath test. For analysis, MUC6 allele fragment length was dichotomized as being either long (> 13.5 kbp) or short (< or = 13.5 kbp) and patients were classified according to genotype [long-long (LL), long-short (LS), short-short (SS)]. 160 patients were studied (mean age 43 years, 36% were males, 58% H pylori positive). MUC6 Pvu II-restricted allele fragment lengths ranged from 7 to 19 kbp. Of the patients with the LL, LS, SS MUC6 genotype, 43% (24/56), 57% (25/58) and 76% (11/46) were infected with H pylori, respectively (P = 0.003). Short MUC6 alleles are associated with H pylori infection.

Maternal treatment with a high dose of CpG ODN during gestation alters fetal craniofacial and distal limb development in C57BL/6 mice.

PubMed

Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D

2006-01-16

Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine profile shifts.

Impact of folic acid intake during pregnancy on genomic imprinting of IGF2/H19 and 1-carbon metabolism.

PubMed

Tserga, Aggeliki; Binder, Alexandra M; Michels, Karin B

2017-12-01

Folic acid is an essential component of 1-carbon metabolism, which generates methyl groups for DNA methylation. Disruption of genomic imprinting leads to biallelic expression which may affect disease susceptibility possibly reflected in high levels of S -adenosyl-homocysteine (SAH) and low levels of S -adenosyl-methionine (SAM). We investigated the association between folic acid supplementation during pregnancy and loss of imprinting (LOI) of IGF2 and H19 genes in placentas and cord blood of 90 mother-child dyads in association with the methylenetetrahydrofolate reductase ( MTHFR ) genotype. Pyrosequencing was used to evaluate deviation from monoallelic expression among 47 placentas heterozygous for H19 and 37 placentas and cord blood tissues heterozygous for IGF2 and H19 methylation levels of 48 placentas. We detected relaxation of imprinting (ROI) and LOI of H19 in placentas not associated with differences in methylation levels of the H19ICR. Placentas retained monoallelic allele-specific gene expression of IGF2 , but 32.4% of cord blood samples displayed LOI of IGF2 and 10.8% showed ROI. High SAH levels were significantly associated with low H19 methylation. An interesting positive association between SAM/SAH ratio and high H19 methylation levels was detected among infants with low B 12 levels. Our data suggest profound differences in regulation of imprinting in placenta and cord blood; a lack of correlation of the methylome, transcriptome, and proteome; and a complex regulatory feedback network between free methyl groups and genomic imprinting at birth.-Tserga, A., Binder, A. M., Michels, K. B. Impact of folic acid intake during pregnancy on genomic imprinting of IGF2/H19 and 1-carbon metabolism. © FASEB.

Links between DNA methylation and nucleosome occupancy in the human genome.

PubMed

Collings, Clayton K; Anderson, John N

2017-01-01

DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

Genome-Wide Assessment of Differential DNA Methylation Associated with Autoantibody Production in Systemic Lupus Erythematosus.

PubMed

Chung, Sharon A; Nititham, Joanne; Elboudwarej, Emon; Quach, Hong L; Taylor, Kimberly E; Barcellos, Lisa F; Criswell, Lindsey A

2015-01-01

Systemic lupus erythematosus (SLE) is characterized by the development of autoantibodies associated with specific clinical manifestations. Previous studies have shown an association between differential DNA methylation and SLE susceptibility, but have not investigated SLE-related autoantibodies. Our goal was to determine whether DNA methylation is associated with production of clinically relevant SLE-related autoantibodies, with an emphasis on the anti-dsDNA autoantibody. In this study, we characterized the methylation status of 467,314 CpG sites in 326 women with SLE. Using a discovery and replication study design, we identified and replicated significant associations between anti-dsDNA autoantibody production and the methylation status of 16 CpG sites (pdiscovery<1.07E-07 and preplication<0.0029) in 11 genes. Associations were further investigated using multivariable regression to adjust for estimated leukocyte cell proportions and population substructure. The adjusted mean DNA methylation difference between anti-dsDNA positive and negative cases ranged from 1.2% to 19%, and the adjusted odds ratio for anti-dsDNA autoantibody production comparing the lowest and highest methylation tertiles ranged from 6.8 to 18.2. Differential methylation for these CpG sites was also associated with anti-SSA, anti-Sm, and anti-RNP autoantibody production. Overall, associated CpG sites were hypomethylated in autoantibody positive compared to autoantibody negative cases. Differential methylation of CpG sites within the major histocompatibility region was not strongly associated with autoantibody production. Genes with differentially methylated CpG sites represent multiple biologic pathways, and have not been associated with autoantibody production in genetic association studies. In conclusion, hypomethylation of CpG sites within genes from different pathways is associated with anti-dsDNA, anti-SSA, anti-Sm, and anti-RNP production in SLE, and these associations are not explained by genetic variation. Thus, studies of epigenetic mechanisms such as DNA methylation represent a complementary method to genetic association studies to identify biologic pathways that may contribute to the clinical heterogeneity of autoimmune diseases.

Quantification of the methylation status of the PWS/AS imprinted region: comparison of two approaches based on bisulfite sequencing and methylation-sensitive MLPA.

PubMed

Dikow, Nicola; Nygren, Anders Oh; Schouten, Jan P; Hartmann, Carolin; Krämer, Nikola; Janssen, Bart; Zschocke, Johannes

2007-06-01

Standard methods used for genomic methylation analysis allow the detection of complete absence of either methylated or non-methylated alleles but are usually unable to detect changes in the proportion of methylated and unmethylated alleles. We compare two methods for quantitative methylation analysis, using the chromosome 15q11-q13 imprinted region as model. Absence of the non-methylated paternal allele in this region leads to Prader-Willi syndrome (PWS) whilst absence of the methylated maternal allele results in Angelman syndrome (AS). A proportion of AS is caused by mosaic imprinting defects which may be missed with standard methods and require quantitative analysis for their detection. Sequence-based quantitative methylation analysis (SeQMA) involves quantitative comparison of peaks generated through sequencing reactions after bisulfite treatment. It is simple, cost-effective and can be easily established for a large number of genes. However, our results support previous suggestions that methods based on bisulfite treatment may be problematic for exact quantification of methylation status. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) avoids bisulfite treatment. It detects changes in both CpG methylation as well as copy number of up to 40 chromosomal sequences in one simple reaction. Once established in a laboratory setting, the method is more accurate, reliable and less time consuming.

Genetically determined low maternal serum dopamine beta-hydroxylase levels and the etiology of autism spectrum disorders.

PubMed

Robinson, P D; Schutz, C K; Macciardi, F; White, B N; Holden, J J

2001-04-15

Autism, a neurodevelopmental disability characterized by repetitive stereopathies and deficits in reciprocal social interaction and communication, has a strong genetic basis. Since previous findings showed that some families with autistic children have a low level of serum dopamine beta-hydroxylase (DbetaH), which catalyzes the conversion of dopamine to norepinephrine, we examined the DBH gene as a candidate locus in families with two or more children with autism spectrum disorder using the affected sib-pair method. DBH alleles are defined by a polymorphic AC repeat and the presence/absence (DBH+/DBH-) of a 19-bp sequence 118 bp downstream in the 5' flanking region of the gene. There was no increased concordance for DBH alleles in affected siblings, but the mothers had a higher frequency of alleles containing the 19-bp deletion (DBH-), compared to an ethnically similar Canadian comparison group (chi(2) = 4.20, df = 1, P = 0.02 for all multiplex mothers; chi(2) = 4.71, df = 1, P < 0.02 for mothers with only affected sons). Although the odds ratios suggested only a moderate relevance for the DBH- allele as a risk allele, the attributable risk was high (42%), indicating that this allele is an important factor in determining the risk for having a child with autism. DBH genotypes also differed significantly among mothers and controls, with 37% of mothers with two affected sons having two DBH- alleles, compared to 19% of controls (chi(2) = 5.81, df = 2, P = 0.03). DbetaH enzyme activity was lower in mothers of autistic children than in controls (mean was 23.20 +/- 15.35 iU/liter for mothers vs. 33.14 +/- 21.39 iU/liter for controls; t = - 1.749, df = 46, P = 0.044). The DBH- allele was associated with lower mean serum DbetaH enzyme activity (nondeletion homozygotes: 41.02 +/- 24.34 iU/liter; heterozygotes: 32.07 +/- 18.10 iU/liter; and deletion homozygotes: 22.31 +/- 13.48 iU/liter; F = 5.217, df = 2, P = 0.007) in a pooled sample of mothers and controls. Taken together, these findings suggest that lowered maternal serum DbetaH activity results in a suboptimal uterine environment (decreased norepinephrine relative to dopamine), which, in conjunction with genotypic susceptibility of the fetus, results in autism spectrum disorder in some families. Copyright 2001 Wiley-Liss, Inc.

A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

PubMed Central

Martin, Elizabeth M.; Fry, Rebecca C.

2016-01-01

Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

Cytochrome P450 isoforms in the Metabolism of Decursin and Decursinol Angelate from Korean Angelica

PubMed Central

ZHANG, Jinhui; LI, Li; TANG, Suni; HALE, Thomas W.; XING, Chengguo; JIANG, Cheng; LÜ, Junxuan

2016-01-01

We have shown that the in vitro hepatic microsomal metabolism of pyranocoumarin compound decursinol angelate (DA) to decursinol (DOH) exclusively requires cytochrome P450 enzymes (CYP) whereas the conversion of its isomer decursin (D) to DOH can be mediated by CYP and esterase(s). To provide insight into specific isoforms involved, here we show with recombinant human CYP that 2C19 was the most active at metabolizing D and DA in vitro followed by 3A4. With carboxylesterases (CES), D was hydrolyzed by CES2 but not CES1, and DA was resistant to both CES1 and CES2. In human liver microsomal preparation, general CYP inhibitor 1-aminobenzotriazole (ABT) and respective competitive inhibitors for 2C19 and 3A4, (+)-N-3-benzylnirvanol and ketoconazole, substantially retarded the metabolism of DA and, to a lesser extent, of D. In healthy human subjects from a single-dose pharmacokinetic study, 2C19 extensive metabolizer genotype (2C19*17 allele) tended to have less plasma DA AUC0–48h and poor metabolizer genotype (2C19*2 allele) tended to have greater DA AUC0–48h. In mice given a single dose of D/DA, pretreatment with ABT boosted the plasma and prostate levels of D and DA by more than an order of magnitude. Taken together, our findings suggest that CYP isoforms 2C19 and 3A4 may play a crucial role in the first pass liver metabolism of DA and, to a lesser extent, that of D in humans. Pharmacogenetics with respect to CYP genotypes and interactions among CYP inhibitor drugs and D/DA should therefore be considered in designing future translation studies of DA and/or D. PMID:26394652

Cytochrome P450 Isoforms in the Metabolism of Decursin and Decursinol Angelate from Korean Angelica.

PubMed

Zhang, Jinhui; Li, Li; Tang, Suni; Hale, Thomas W; Xing, Chengguo; Jiang, Cheng; Lü, Junxuan

2015-01-01

We have shown that the in vitro hepatic microsomal metabolism of pyranocoumarin compound decursinol angelate (DA) to decursinol (DOH) exclusively requires cytochrome P450 (CYP) enzymes, whereas the conversion of its isomer decursin (D) to DOH can be mediated by CYP and esterase(s). To provide insight into specific isoforms involved, here we show with recombinant human CYP that 2C19 was the most active at metabolizing D and DA in vitro followed by 3A4. With carboxylesterases (CES), D was hydrolyzed by CES2 but not CES1, and DA was resistant to both CES1 and CES2. In human liver microsomal (HLM) preparation, the general CYP inhibitor 1-aminobenzotriazole (ABT) and respective competitive inhibitors for 2C19 and 3A4, (+)-N-3-benzylnirvanol (NBN) and ketoconazole substantially retarded the metabolism of DA and, to a lesser extent, of D. In healthy human subjects from a single-dose pharmacokinetic (PK) study, 2C19 extensive metabolizer genotype (2C19*17 allele) tended to have less plasma DA AUC0-48h and poor metabolizer genotype (2C19*2 allele) tended to have greater DA AUC0-48h. In mice given a single dose of D/DA, pretreatment with ABT boosted the plasma and prostate levels of D and DA by more than an order of magnitude. Taken together, our findings suggest that CYP isoforms 2C19 and 3A4 may play a crucial role in the first pass liver metabolism of DA and, to a lesser extent, that of D in humans. Pharmacogenetics with respect to CYP genotypes and interactions among CYP inhibitor drugs and D/DA should therefore be considered in designing future translation studies of DA and/or D.

CpG island methylation phenotype (CIMP) in oral cancer: associated with a marked inflammatory response and less aggressive tumour biology.

PubMed

Shaw, Richard J; Hall, Gillian L; Lowe, Derek; Bowers, Naomi L; Liloglou, Triantafillos; Field, John K; Woolgar, Julia A; Risk, Janet M

2007-10-01

Studies in several tumour sites highlight the significance of the CpG island methylation phenotype (CIMP), with distinct features of histology, biological aggression and outcome. We utilise pyrosequencing techniques of quantitative methylation analysis to investigate the presence of CIMP in oral squamous cell carcinoma (OSCC) for the first time, and evaluate its correlation with allelic imbalance, pathology and clinical behaviour. Tumour tissue, control tissue and PBLs were obtained from 74 patients with oral squamous cell carcinoma. Pyrosequencing was used to analyse methylation patterns in 75-200 bp regions of the CpG rich gene promoters of 10 genes with a broad range of cellular functions. Allelic imbalance was investigated using a multiplexed panel of 11 microsatellite markers. Corresponding variables, histopathological staging and grading were correlated with these genetic and epigenetic aberrations. A cluster of tumours with a greater degree of promoter methylation than would be predicted by chance alone (P=0.001) were designated CIMP+ve. This group had less aggressive tumour biology in terms of tumour thickness (p=0.015) and nodal metastasis (P=0.012), this being apparently independent of tumour diameter. Further, it seems that these CIMP+ve tumours excited a greater host inflammatory response (P=0.019). The exact mechanisms underlying CIMP remain obscure but the association with a greater inflammatory host response supports existing theories relating these features in other tumour sites. As CIMP has significant associations with other well documented prognostic indicators, it may prove beneficial to include methylation analyses in molecular risk modelling of tumours.

The two single nucleotide polymorphisms in the H37/RBM5 tumour suppressor gene at 3p21.3 correlated with different subtypes of non-small cell lung cancers

PubMed Central

Oh, Juliana J.; Koegel, Ashley; Phan, Diana T.; Razfar, Ali; Slamon, Dennis J.

2007-01-01

Summary Allele loss and genetic alteration in chromosome 3p, particularly in 3p21.3 region, are the most frequent and the earliest genomic abnormalities found in lung cancer. Multiple 3p21.3 genes exhibit various degrees of tumour suppression activity suggesting that 3p21.3 genes may function as an integrated tumour suppressor region through their diverse biological activities. We have previously demonstrated growth inhibitory effects and tumour suppression mechanism of the H37/RBM5 gene which is one of the 19 genes residing in the 370kb minimal overlap region at 3p21.3. In the current study, in an attempt to find, if any, mutations in the H37 coding region in lung cancer cells, we compared nucleotide sequences of the entire H37 gene in tumour vs. adjacent normal tissues from 17 non-small cell lung cancer (NSCLC) patients. No mutations were detected, instead, we found the two silent single nucleotide polymorphisms (SNPs), C1138T and C2185T, within the coding region of the H37 gene. In addition, we found that specific allele types at these SNP positions are correlated with different histological subtypes of NSCLC; tumours containing heterozygous alleles (C+T) at these SNP positions are more likely to be associated with adenocarcinoma (AC) whereas homozygous alleles (either C or T) are associated with squamous cell carcinoma (SCC) (p=0.0098). We postulate that, these two silent polymorphisms may be in linkage disequilibrium (LD) with a disease causative allele in the 3p21.3 tumour suppressor region which is packed with a large number of important genes affecting lung cancer development. In addition, because of prevalent loss of heterozygosity (LOH) detected at 3p21.3 which precedes lung cancer initiation, these SNPs may be developed into a marker screening for the high risk individuals. PMID:17606309

Gold nanoparticle–M2e conjugate coformulated with CpG induces protective immunity against influenza A virus

PubMed Central

Tao, Wenqian; Ziemer, Katherine S; Gill, Harvinder S

2014-01-01

Aim: This study aimed to develop a novel influenza A vaccine by conjugating the highly conserved extracellular region of the matrix 2 protein (M2e) of influenza A virus to gold nanoparticles (AuNPs) and to test the vaccine in a mouse influenza challenge model. Materials & methods: Citrate-reduced AuNPs (diameter: 12 nm) were synthesized, and characterized by transmission electron microscopy and dynamic light scattering. M2e was conjugated to AuNPs through thiol–gold interactions to form M2e–AuNP conjugates. Particle stability was confirmed by UV–visible spectra, and M2e conjugation was further characterized by x-ray photoelectron spectroscopy. Mice were immunized with M2e–AuNPs with or without CpG (cytosine-guanine rich oligonucleotide) as an adjuvant with appropriate control groups. Sera was collected and M2e-specific immunoglobulin (IgG) was measured, and immunized mice were challenged with PR8-H1N1 influenza virus. Results: M2e-capped AuNPs could be lyophilized and stably resuspended in water. Intranasal vaccination of mice with M2e–AuNP conjugates induced M2e-specific IgG serum antibodies, which significantly increased upon addition of soluble CpG as adjuvant. Upon challenge with lethal PR8, mice vaccinated with M2e-AuNP conjugates were only partially protected, while mice that received soluble CpG as adjuvant in addition to M2e–AuNP were fully protected. Conclusion: Overall, this study demonstrates the potential of using the M2e–AuNP conjugates with CpG as an adjuvant as a platform for developing an influenza A vaccine. PMID:23829488

76 FR 58398 - Revised Guidance on Marketed Unapproved Drugs; Compliance Policy Guide Sec. 440.100; Marketed New...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-21

... enforcement action at any time, without prior notice and without regard to the enforcement priorities set... the enforcement priorities set forth in CPG 440.100 for unapproved new drugs marketed prior to September 19, 2011. The revision to CPG 440.100 excludes from the enforcement priorities set forth in the...

Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

NASA Astrophysics Data System (ADS)

Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

1997-09-01

Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

The Impact of Social Media on Dissemination and Implementation of Clinical Practice Guidelines: A Longitudinal Observational Study.

PubMed

Narayanaswami, Pushpa; Gronseth, Gary; Dubinsky, Richard; Penfold-Murray, Rebecca; Cox, Julie; Bever, Christopher; Martins, Yolanda; Rheaume, Carol; Shouse, Denise; Getchius, Thomas S D

2015-08-13

Evidence-based clinical practice guidelines (CPGs) are statements that provide recommendations to optimize patient care for a specific clinical problem or question. Merely reading a guideline rarely leads to implementation of recommendations. The American Academy of Neurology (AAN) has a formal process of guideline development and dissemination. The last few years have seen a burgeoning of social media such as Facebook, Twitter, and LinkedIn, and newer methods of dissemination such as podcasts and webinars. The role of these media in guideline dissemination has not been studied. Systematic evaluation of dissemination methods and comparison of the effectiveness of newer methods with traditional methods is not available. It is also not known whether specific dissemination methods may be more effectively targeted to specific audiences. Our aim was to (1) develop an innovative dissemination strategy by adding social media-based dissemination methods to traditional methods for the AAN clinical practice guidelines "Complementary and alternative medicine in multiple sclerosis" ("CAM in MS") and (2) evaluate whether the addition of social media outreach improves awareness of the CPG and knowledge of CPG recommendations, and affects implementation of those recommendations. Outcomes were measured by four surveys in each of the two target populations: patients and physicians/clinicians ("physicians"). The primary outcome was the difference in participants' intent to discuss use of complementary and alternative medicine (CAM) with their physicians or patients, respectively, after novel dissemination, as compared with that after traditional dissemination. Secondary outcomes were changes in awareness of the CPG, knowledge of CPG content, and behavior regarding CAM use in multiple sclerosis (MS). Response rates were 25.08% (622/2480) for physicians and 43.5% (348/800) for patients. Awareness of the CPG increased after traditional dissemination (absolute difference, 95% confidence interval: physicians 36%, 95% CI 25-46, and patients 10%, 95% CI 1-11) but did not increase further after novel dissemination (physicians 0%, 95% CI -11 to 11, and patients -4%, 95% CI -6 to 14). Intent to discuss CAM also increased after traditional dissemination but did not change after novel dissemination (traditional: physicians 12%, 95% CI 2-22, and patients 19%, 95% CI 3-33; novel: physicians 11%, 95% CI -1 to -21, and patients -8%, 95% CI -22 to 8). Knowledge of CPG recommendations and behavior regarding CAM use in MS did not change after either traditional dissemination or novel dissemination. Social media-based dissemination methods did not confer additional benefit over print-, email-, and Internet-based methods in increasing CPG awareness and changing intent in physicians or patients. Research on audience selection, message formatting, and message delivery is required to utilize Web 2.0 technologies optimally for dissemination.

The Impact of Social Media on Dissemination and Implementation of Clinical Practice Guidelines: A Longitudinal Observational Study

PubMed Central

Gronseth, Gary; Dubinsky, Richard; Penfold-Murray, Rebecca; Cox, Julie; Bever Jr, Christopher; Martins, Yolanda; Rheaume, Carol; Shouse, Denise; Getchius, Thomas SD

2015-01-01

Background Evidence-based clinical practice guidelines (CPGs) are statements that provide recommendations to optimize patient care for a specific clinical problem or question. Merely reading a guideline rarely leads to implementation of recommendations. The American Academy of Neurology (AAN) has a formal process of guideline development and dissemination. The last few years have seen a burgeoning of social media such as Facebook, Twitter, and LinkedIn, and newer methods of dissemination such as podcasts and webinars. The role of these media in guideline dissemination has not been studied. Systematic evaluation of dissemination methods and comparison of the effectiveness of newer methods with traditional methods is not available. It is also not known whether specific dissemination methods may be more effectively targeted to specific audiences. Objective Our aim was to (1) develop an innovative dissemination strategy by adding social media-based dissemination methods to traditional methods for the AAN clinical practice guidelines “Complementary and alternative medicine in multiple sclerosis” (“CAM in MS”) and (2) evaluate whether the addition of social media outreach improves awareness of the CPG and knowledge of CPG recommendations, and affects implementation of those recommendations. Methods Outcomes were measured by four surveys in each of the two target populations: patients and physicians/clinicians (“physicians”). The primary outcome was the difference in participants’ intent to discuss use of complementary and alternative medicine (CAM) with their physicians or patients, respectively, after novel dissemination, as compared with that after traditional dissemination. Secondary outcomes were changes in awareness of the CPG, knowledge of CPG content, and behavior regarding CAM use in multiple sclerosis (MS). Results Response rates were 25.08% (622/2480) for physicians and 43.5% (348/800) for patients. Awareness of the CPG increased after traditional dissemination (absolute difference, 95% confidence interval: physicians 36%, 95% CI 25-46, and patients 10%, 95% CI 1-11) but did not increase further after novel dissemination (physicians 0%, 95% CI -11 to 11, and patients -4%, 95% CI -6 to 14). Intent to discuss CAM also increased after traditional dissemination but did not change after novel dissemination (traditional: physicians 12%, 95% CI 2-22, and patients 19%, 95% CI 3-33; novel: physicians 11%, 95% CI -1 to -21, and patients -8%, 95% CI -22 to 8). Knowledge of CPG recommendations and behavior regarding CAM use in MS did not change after either traditional dissemination or novel dissemination. Conclusions Social media-based dissemination methods did not confer additional benefit over print-, email-, and Internet-based methods in increasing CPG awareness and changing intent in physicians or patients. Research on audience selection, message formatting, and message delivery is required to utilize Web 2.0 technologies optimally for dissemination. PMID:26272267

Structure of the MLL CXXC domain – DNA complex and its functional role in MLL-AF9 leukemia

PubMed Central

Cierpicki, Tomasz; Risner, Laurie E.; Grembecka, Jolanta; Lukasik, Stephen M.; Popovic, Relja; Omonkowska, Monika; Shultis, David S.; Zeleznik-Le, Nancy J.; Bushweller, John H.

2010-01-01

MLL (Mixed Lineage Leukemia) is the target of chromosomal translocations which cause leukemias with poor prognosis. All leukemogenic MLL fusion proteins retain the CXXC domain which binds to nonmethylated CpG DNA. We present the solution structure of the MLL CXXC domain in complex with DNA, showing for the first time how the CXXC domain distinguishes nonmethylated from methylated CpG DNA. Based on the structure, we designed point mutations which disrupt DNA binding. Introduction of these mutations into MLL-AF9 results in increased DNA methylation of specific CpG nucleotides in Hoxa9, increased H3K9 methylation, decreased expression of Hoxa9 locus transcripts, loss of immortalization potential, and inability to induce leukemia in mice. These results establish that DNA binding by the CXXC domain and protection against DNA methylation is essential for MLL fusion leukemia. They also provide support for this interaction as a potential target for therapeutic intervention. PMID:20010842

Cas9/sgRNA selective targeting of the P23H Rhodopsin mutant allele for treating retinitis pigmentosa by intravitreal AAV9.PHP.B-based delivery.

PubMed

Giannelli, Serena G; Luoni, Mirko; Castoldi, Valerio; Massimino, Luca; Cabassi, Tommaso; Angeloni, Debora; Demontis, Gian Carlo; Leocani, Letizia; Andreazzoli, Massimiliano; Broccoli, Vania

2018-03-01

P23H is the most common mutation in the RHODOPSIN (RHO) gene leading to a dominant form of retinitis pigmentosa (RP), a rod photoreceptor degeneration that invariably causes vision loss. Specific disruption of the disease P23H RHO mutant while preserving the wild-type (WT) functional allele would be an invaluable therapy for this disease. However, various technologies tested in the past failed to achieve effective changes and consequently therapeutic benefits. We validated a CRISPR/Cas9 strategy to specifically inactivate the P23H RHO mutant, while preserving the WT allele in vitro. We, then, translated this approach in vivo by delivering the CRISPR/Cas9 components in murine Rho+/P23H mutant retinae. Targeted retinae presented a high rate of cleavage in the P23H but not WT Rho allele. This gene manipulation was sufficient to slow photoreceptor degeneration and improve retinal functions. To improve the translational potential of our approach, we tested intravitreal delivery of this system by means of adeno-associated viruses (AAVs). To this purpose, the employment of the AAV9-PHP.B resulted the most effective in disrupting the P23H Rho mutant. Finally, this approach was translated successfully in human cells engineered with the homozygous P23H RHO gene mutation. Overall, this is a significant proof-of-concept that gene allele specific targeting by CRISPR/Cas9 technology is specific and efficient and represents an unprecedented tool for treating RP and more broadly dominant genetic human disorders affecting the eye, as well as other tissues.

Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.

PubMed

Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

2017-08-16

Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.

Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity

PubMed Central

Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

2017-01-01

Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025

Evaluation of 16 SNPs allele-specific to quantify post hSCT chimerism by SYBR green-based qRT-PCR.

PubMed

Almeida, Carlos Arthur Cardoso; Dreyfuss, Juliana Luporini; Azevedo-Shimmoto, Marily Maria; Figueiredo, Maria Stela; de Oliveira, José Salvador Rodrigues

2013-03-01

The importance of monitoring post haematopoietic stem cell transplantation (hSCT) chimerism has been defined in numerous publications. Single-nucleotide polymorphisms (SNPs) are molecular markers that vary significantly among different populations. Allied to a very sensible technique, SNP assays seem to be very sensitive (0.001%) when post hSCT chimerism is measured. However, well known SNP frequencies are limited to certain populations, mainly in countries where there is a high level of diversity in its population, therefore restricting their use worldwide. Amplification by SYBR green based quantitative real time PCR of eight pairs of allele-specific SNPs (MLH-1, PECAM-1, ICAM-1, SUR-1, HA-1, rs715405, rs713503, rs2296600) was conducted in 88 patient/donor pairs, who underwent allogeneic myeloablative or non-myeloablative hSCT. One informative allele was detected in at least 42% (n=37) of the samples; 20% (n=18) had at least two informative alleles; 10% (n=9) had at least three informative alleles; 9% (n=8) had more than three informative alleles and 18% (n=16) showed no informative allele at all. Overall, the frequency of informative alleles for these SNPs in the Brazilian population was very low. Consequently, the amount of information attained reached 9% of those expected, being able to discriminate only eight pairs of donor/recipient samples with more than three informative alleles, making them useless for the quantification of chimerism in our routine.

Epigenetic Contribution of the Myosin Light Chain Kinase Gene to the Risk for Acute Respiratory Distress Syndrome

PubMed Central

Szilágyi, Keely L.; Liu, Cong; Zhang, Xu; Wang, Ting; Fortman, Jeffrey D.; Zhang, Wei; Garcia, Joe G.N.

2016-01-01

Acute respiratory distress syndrome (ARDS) is a devastating clinical syndrome with a considerable case fatality rate (~30-40%). Health disparities exist with African descent subjects (ADs) exhibiting greater mortality than European descent individuals (EDs). Myosin light chain kinase (MLCK) is encoded by MYLK whose genetic variants are implicated in ARDS pathogenesis and may influence ARDS mortality. As baseline population-specific epigenetic changes, i.e. cytosine modifications, have been observed between AD and ED individuals, epigenetic variations in MYLK may provide insights into ARDS disparities. We compared methylation levels of MYLK CpGs between ARDS patients and ICU controls overall and by ethnicity in a nested case control study of 39 ARDS cases and 75 non-ARDS intensive care unit controls. Two MYLK CpG sites (cg03892735, cg23344121) were differentially modified between ARDS subjects and controls (p<0.05; q<0.25) in a logistic regression model, where no effect modification from ethnicity or age was found. One CpG site was associated with ARDS in patients less than 58 years old, cg19611163 (intron 19,20). Two CpG sites were associated with ARDS in EDs only, gene body CpG (cg01894985, intron 2,3) and CpG (cg16212219, intron 31,32), with higher modification levels exhibited in ARDS subjects than controls. Cis-acting mQTL (modified cytosine quantitative trait loci) were identified using linear regression between local genetic variants and modification levels for two ARDS-associated CpGs (cg23344121, cg16212219). In summary, these ARDS-associated MYLK CpGs with effect modification by ethnicity and local mQTL, suggest that MYLK epigenetic variation and local genetic background may contribute to health disparities observed in ARDS. PMID:27543902

Intraperitoneal prophylaxis with CpG oligodeoxynucleotides protects neutropenic mice against intracerebral Escherichia coli K1 infection.

PubMed

Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland

2014-01-23

Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.

Novel Tay-Sachs disease mutations from China.

PubMed

Akalin, N; Shi, H P; Vavougios, G; Hechtman, P; Lo, W; Scriver, C R; Mahuran, D; Kaplan, F

1992-01-01

We describe three HEXA mutations associated with infantile Tay-Sachs disease (TSD) in three unrelated nonconsanguineous Chinese families. Novel mutations were found in two of these families. The third is a previously reported mutation (G-->A transition at nt 1444) (Nakano et al., 1988). Direct sequencing of PCR products identified a novel insertion of an A after nt 547 in family 1. This change generates an early termination codon 6 bp downstream from the insertion site. Allele-specific oligonucleotide hybridization confirmed homozygosity in the proband. Single strand conformational polymorphism analysis and direct sequencing of amplified exon 13 revealed a T-->C transition at nt 1453 with the corresponding amino acid substitution W485R in the second family. This mutation creates an Fnu4HI restriction site. The proband is homozygous for this allele. When the site-specific mutagenized alpha cDNA carrying the T-->C transition at nt 1453 was expressed in COS 1 cells hexosaminidase S activity was not detectable above background. A G-->A transition at nt 1444 (exon 13) corresponding to the E482K substitution was found in the third family. This mutation occurs at a CpG dinucleotide. It has been reported in an Italian TSD proband and causes defective intracellular transport of the alpha-subunit from the rough endoplasmic reticulum to the Golgi apparatus.

CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands, but also low-level methylation at individual loci.

PubMed

Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

2008-03-01

The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.

Targeting Stat3 in the myeloid compartment drastically improves the in vivo antitumor functions of adoptively transferred T cells

PubMed Central

Herrmann, Andreas; Kortylewski, Marcin; Kujawski, Maciej; Zhang, Chunyan; Reckamp, Karen; Armstrong, Brian; Wang, Lin; Kowolik, Claudia; Deng, Jiehui; Robert, Figlin; Yu, Hua

2010-01-01

Improving effector T cell functions is highly desirable for preventive or therapeutic interventions of diverse diseases. Stat3 in the myeloid compartment constrains Th-1 type immunity, dampening natural and induced antitumor immune responses. We have recently developed an in vivo siRNA delivery platform by conjugating a TLR9 agonist with siRNA that efficiently targets myeloid and B cells. Here we show that either ablating the Stat3 alleles in the myeloid compartment and B cells combined with CpG triggering or administrating the CpG-Stat3siRNA conjugates drastically augments effector functions of adoptively transferred CD8+ T cells. Specifically, we demonstrate that both approaches are capable of increasing dendritic cell and CD8+ T cell engagement in tumor draining lymph nodes. Furthermore, both approaches can significantly activate the transferred CD8+ T cells in vivo, upregulating effector molecules such as perforin, granzyme B and IFN-γ. Intravital multiphoton microscopy reveals that Stat3 silencing combined with CpG triggering greatly increases killing activity and tumor infiltration of transferred T cells. These results suggest the use of CpG-Stat3siRNA, and possibly other Stat3 inhibitors, as a potent adjuvant to improve T cell therapies. PMID:20841481

CpG island mapping by epigenome prediction.

PubMed

Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

2007-06-01

CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic epigenetic and functional states. And it is superior to purely experimental epigenome mapping for CpG island detection since it abstracts from specific properties that are limited to a single cell type or tissue. In addition, using computational epigenetics methods we could identify high correlation between the epigenome and characteristics of the DNA sequence, a finding which emphasizes the need for a better understanding of the mechanistic links between genome and epigenome.

A Nanoparticle Based Sp17 Peptide Vaccine Exposes New Immuno-Dominant and Species Cross-reactive B Cell Epitopes

PubMed Central

Xiang, Sue D.; Gao, Qian; Wilson, Kirsty L.; Heyerick, Arne; Plebanski, Magdalena

2015-01-01

Sperm protein antigen 17 (Sp17), expressed in primary as well as in metastatic lesions in >83% of patients with ovarian cancer, is a promising ovarian cancer vaccine candidate. Herein we describe the formulation of nanoparticle based vaccines based on human Sp17 (hSp17) sequence derived peptides, and map the immuno-dominant T cell and antibody epitopes induced using such formulations. The primary T and B cell immuno-dominant region within Sp17 was found to be the same when using biocompatible nanoparticle carriers or the conventional “mix-in” pro-inflammatory adjuvant CpG, both mapping to amino acids (aa) 111–142. However, delivery of hSp17111–142 as a nanoparticle conjugate promoted a number of new properties, changing the dominant antibody isotype induced from IgG2a to IgG1 and the fine specificity of the B cell epitopes within hSp17111–142, from an immuno-dominant region 134–142 aa for CpG, to region 121–138 aa for nanoparticles. Associated with this change in specificity was a substantial increase in antibody cross-reactivity between mouse and human Sp17. These results indicate conjugation of antigen to nanoparticles can have major effects on fine antigen specificity, which surprisingly could be beneficially used to increase the cross-reactivity of antibody responses. PMID:26529027

Comparison of immunohistochemistry, DNA sequencing and allele-specific PCR for the detection of IDH1 mutations in gliomas.

PubMed

Loussouarn, Delphine; Le Loupp, Anne-Gaëlle; Frenel, Jean-Sébastien; Leclair, François; Von Deimling, Andreas; Aumont, Maud; Martin, Stéphane; Campone, Mario; Denis, Marc G

2012-06-01

Previous studies have identified mutations of the isocitrate dehydrogenase 1 (IDH1) gene in more than 70% of World Health Organization (WHO) grade II and III gliomas. The most frequent mutation leads to a specific amino acid change from arginine to histidine at codon 132 (c.395G>A, p.R132H). IDH1 mutated tumors have a better prognosis than IDH1 non-mutated tumors. The aim of our study was to evaluate and compare the methods of mIDH1 R132H immunohistochemistry, allele-specific PCR and DNA sequencing for determination of IDH1 status. We performed a retrospective study of 91 patients with WHO grade II (n=43) and III (n=48) oligodendrogliomas. A fragment of exon 4 spanning the sequence encoding the catalytic domain of IDH1, including codon 132, was amplified and sequenced using standard conditions. Allele-specific amplification was performed using two forward primers with variations in their 3' nucleotides such that each was specific for the wild-type or the mutated variant, and one reverse primer. Immunohistochemistry was performed with mouse monoclonal mIDH1 R132H. DNA was extracted from FFPE sections following macrodissection. IDH1 mutations were found in 55/90 patients (61.1%) by direct sequencing. R132H mutations were found in 47/55 patients (85.4%). The results of the allele-specific PCR positively correlated with those from DNA sequencing. Other mutations (p.R132C, p.R132S and pR132G) were found by DNA sequencing in 3, 3 and 2 tumors, respectively (8/55 patients, 14.6%). mIDH1 R132H immunostaining was found in the 47 patients presenting the R132H mutation (sensitivity 47/47, 100% for this mutation). None of the tumors presenting a wild-type IDH1 gene were stained (specificity 35/35, 100%). Our results demonstrate that immunohistochemistry using the mIDH1 R132H antibody and allele-specific amplification are highly sensitive techniques to detect the most frequent mutation of the IDH1 gene.

The genotypes and methylation of MAO genes as factors behind smoking behavior.

PubMed

Tiili, Emmi M; Mitiushkina, Natalia V; Sukhovskaya, Olga A; Imyanitov, Evgeny N; Hirvonen, Ari P

2017-11-01

Smoking dependence is the main cause for tobacco-related illnesses. The addiction-causing substance in tobacco, nicotine, acts through the dopamine pathway in the brain, causing several pleasurable experiences through cigarette smoking. Thus, both genetic and epigenetic factors related to dopamine metabolism may play an important role in influencing an individual's smoking behavior. We studied the 1460 C/T variation and the variable number tandem repeat polymorphism in the MAOA gene and A/G variation in intron 13 in the MAOB gene together with four DNA methylation sites in both of these genes in relation to several smoking-related phenotypes in a study population of 1230 Whites of Russian origin. The genotypes studied were found to be associated with smoking status in women; the MAOB G variant allele was more prevalent in female smokers than nonsmokers [odds ratio (OR): 2.16, 95% confidence interval (CI): 1.08-4.33], whereas a reverse relation was observed for the MAOA 1460 T-variant allele (OR: 0.44, 95% CI: 0.21-0.91) and variable number tandem repeat low-activity alleles (OR: 0.49, 95% CI: 0.24-0.98). Moreover, the mean methylation values of the CpG sites studied in the MAOA gene were related to smoking behavior in women. Similarly, several methylation patterns in the MAOB gene were associated with a smoking history, with each CpG site showing a remarkable sex dependence. Smoking behavior seems to be related to the genetic and epigenetic profile of MAO genes, with considerable individual and sex-related differences.

Overexpression of hTERT increases stem-like properties and decreases spontaneous differentiation in human mesenchymal stem cell lines

PubMed Central

2010-01-01

To overcome loss of stem-like properties and spontaneous differentiation those hinder the expansion and application of human mesenchymal stem cells (hMSCs), we have clonally isolated permanent and stable human MSC lines by ectopic overexpression of primary cell cultures of hMSCs with HPV 16 E6E7 and human telomerase reverse transcriptase (hTERT) genes. These cells were found to have a differentiation potential far beyond the ordinary hMSCs. They expressed trophoectoderm and germline specific markers upon differentiation with BMP4 and retinoic acid, respectively. Furthermore, they displayed higher osteogenic and neural differentiation efficiency than primary hMSCs or hMSCs expressed HPV16 E6E7 alone with a decrease in methylation level as proven by a global CpG island methylation profile analysis. Notably, the demethylated CpG islands were highly associated with development and differentiation associated genes. Principal component analysis further pointed out the expression profile of the cells converged toward embryonic stem cells. These data demonstrate these cells not only are a useful tool for the studies of cell differentiation both for the mesenchymal and neurogenic lineages, but also provide a valuable source of cells for cell therapy studies in animal models of skeletal and neurological disorders. PMID:20670406

Plasma Triglyceride Levels May Be Modulated by Gene Expression of IQCJ, NXPH1, PHF17 and MYB in Humans

PubMed Central

Vallée Marcotte, Bastien; Guénard, Frédéric; Cormier, Hubert; Lemieux, Simone; Couture, Patrick; Rudkowska, Iwona; Vohl, Marie-Claude

2017-01-01

A genome-wide association study (GWAS) by our group identified loci associated with the plasma triglyceride (TG) response to ω-3 fatty acid (FA) supplementation in IQCJ, NXPH1, PHF17 and MYB. Our aim is to investigate potential mechanisms underlying the associations between single nucleotide polymorphisms (SNPs) in the four genes and TG levels following ω-3 FA supplementation. 208 subjects received 3 g/day of ω-3 FA (1.9–2.2 g of EPA and 1.1 g of docosahexaenoic acid (DHA)) for six weeks. Plasma TG were measured before and after the intervention. 67 SNPs were selected to increase the density of markers near GWAS hits. Genome-wide expression and methylation analyses were conducted on respectively 30 and 35 participants’ blood sample together with in silico analyses. Two SNPs of IQCJ showed different affinities to splice sites depending on alleles. Expression levels were influenced by genotype for one SNP in NXPH1 and one in MYB. Associations between 12 tagged SNPs of IQCJ, 26 of NXPH1, seven of PHF17 and four of MYB and gene-specific CpG site methylation levels were found. The response of plasma TG to ω-3 FA supplementation may be modulated by the effect of DNA methylation on expression levels of genes revealed by GWAS. PMID:28134766

Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

PubMed

Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

2015-07-08

The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Risk Factors Associated with Invasive Fungal Infections in Combat Trauma

PubMed Central

Rodriguez, Carlos J.; Weintrob, Amy C.; Shah, Jinesh; Malone, Debra; Dunne, James R.; Weisbrod, Allison B.; Lloyd, Bradley A.; Warkentien, Tyler E.; Murray, Clinton K.; Wilkins, Kenneth; Shaikh, Faraz; Carson, M. Leigh; Aggarwal, Deepak

2014-01-01

Abstract Background: In recent years, invasive fungal infections (IFI) have complicated the clinical course of patients with combat-related injuries. Commonalities in injury patterns and characteristics among patients with IFI led to the development of a Joint Trauma System (JTS) clinical practice guideline (CPG) for IFI management. We performed a case-control study to confirm and further delineate risk factors associated with IFI development in combat casualties with the objective of generating data to refine the CPG and promote timelier initiation of treatment. Methods: Data were collected retrospectively for United States (U.S.) military personnel injured during deployment in Afghanistan from June 2009 through August 2011. Cases were identified as IFI based upon wound cultures with fungal growth and/or fungal elements seen on histology, in addition to the presence of recurrent wound necrosis. Controls were matched using date of injury (±3 mo) and injury severity score (±10). Risk factor parameters analyzed included injury circumstances, blood transfusion requirements, amputations after first operative intervention, and associated injuries. Data are expressed as multivariate odds ratios (OR; 95% confidence interval [CI]). Results: Seventy-six IFI cases were identified from 1,133 U.S. military personnel wounded in Afghanistan and matched to 150 controls. Parameters associated significantly with the development of IFI multivariate analysis were blast injuries (OR: 5.7; CI: 1.1–29.6), dismounted at time of injury (OR: 8.5; CI: 1.2–59.8); above the knee amputations (OR: 4.1; CI: 1.3-12.7), and large-volume packed red blood cell (PRBC; >20 U) transfusions within first 24 h (OR: 7.0; CI: 2.5-19.7). Conclusions: Our analysis indicates that dismounted blast injuries, resulting in above the knee amputations, and requirement of large volume PRBC transfusions are independent predictors of IFI development. These data confirm all the preliminary risk factors, except for genitalia/perineal injuries, utilized by JTS in their IFI CPG. Model validation is necessary for further risk factor specification. PMID:24821267

Retardation of Antigen Release from DNA Hydrogel Using Cholesterol-Modified DNA for Increased Antigen-Specific Immune Response.

PubMed

Umeki, Yuka; Saito, Masaaki; Takahashi, Yuki; Takakura, Yoshinobu; Nishikawa, Makiya

2017-10-01

Our previous study indicates that cationization of an antigen is effective for sustained release of both immunostimulatory DNA containing unmethylated cytosine-phosphate-guanine (CpG) dinucleotides, or CpG DNA, and antigen from a DNA hydrogel. Another approach to sustained antigen release would increase the applicability and versatility of the system. In this study, a hydrophobic interaction-based sustained release system of ovalbumin (OVA), a model antigen, from immunostimulatory CpG DNA hydrogel is developed by the use of cholesterol-modified DNA and urea-denatured OVA (udOVA). Cholesterol-modified DNA forms a hydrogel, Dgel(chol), and induces IL-6 mRNA expression in mouse skin after intradermal injection, as DNA without cholesterol does. Cholesterol-modified DNA associated with OVA and denaturation of OVA using urea increases the interaction. The release of udOVA from Dgel(chol) is significantly slower than that from DNA hydrogel with no cholesterol, Dgel. Moreover, intratumoral injections of udOVA/Dgel(chol) significantly inhibit the growth of EG7-OVA tumors in mice. These results indicate that sustained release of antigen from Dgel can be achieved by the combination of urea denaturation and cholesterol modification, and retardation of antigen release is effective to induce antigen-specific cancer immunity. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The testis-specific factor CTCFL cooperates with the protein methyltransferase PRMT7 in H19 imprinting control region methylation.

PubMed

Jelinic, Petar; Stehle, Jean-Christophe; Shaw, Phillip

2006-10-01

Expression of imprinted genes is restricted to a single parental allele as a result of epigenetic regulation-DNA methylation and histone modifications. Igf2/H19 is a reciprocally imprinted locus exhibiting paternal Igf2 and maternal H19 expression. Their expression is regulated by a paternally methylated imprinting control region (ICR) located between the two genes. Although the de novo DNA methyltransferases have been shown to be necessary for the establishment of ICR methylation, the mechanism by which they are targeted to the region remains unknown. We demonstrate that CTCFL/BORIS, a paralog of CTCF, is an ICR-binding protein expressed during embryonic male germ cell development, coinciding with the timing of ICR methylation. PRMT7, a protein arginine methyltransferase with which CTCFL interacts, is also expressed during embryonic testis development. Symmetrical dimethyl arginine 3 of histone H4, a modification catalyzed by PRMT7, accumulates in germ cells during this developmental period. This modified histone is also found enriched in both H19 ICR and Gtl2 differentially methylated region (DMR) chromatin of testis by chromatin immunoprecipitation (ChIP) analysis. In vitro studies demonstrate that CTCFL stimulates the histone-methyltransferase activity of PRMT7 via interactions with both histones and PRMT7. Finally, H19 ICR methylation is demonstrated by nuclear co-injection of expression vectors encoding CTCFL, PRMT7, and the de novo DNA methyltransferases, Dnmt3a, -b and -L, in Xenopus oocytes. These results suggest that CTCFL and PRMT7 may play a role in male germline imprinted gene methylation.

The Testis-Specific Factor CTCFL Cooperates with the Protein Methyltransferase PRMT7 in H19 Imprinting Control Region Methylation

PubMed Central

Jelinic, Petar; Stehle, Jean-Christophe; Shaw, Phillip

2006-01-01

Expression of imprinted genes is restricted to a single parental allele as a result of epigenetic regulation—DNA methylation and histone modifications. Igf2/H19 is a reciprocally imprinted locus exhibiting paternal Igf2 and maternal H19 expression. Their expression is regulated by a paternally methylated imprinting control region (ICR) located between the two genes. Although the de novo DNA methyltransferases have been shown to be necessary for the establishment of ICR methylation, the mechanism by which they are targeted to the region remains unknown. We demonstrate that CTCFL/BORIS, a paralog of CTCF, is an ICR-binding protein expressed during embryonic male germ cell development, coinciding with the timing of ICR methylation. PRMT7, a protein arginine methyltransferase with which CTCFL interacts, is also expressed during embryonic testis development. Symmetrical dimethyl arginine 3 of histone H4, a modification catalyzed by PRMT7, accumulates in germ cells during this developmental period. This modified histone is also found enriched in both H19 ICR and Gtl2 differentially methylated region (DMR) chromatin of testis by chromatin immunoprecipitation (ChIP) analysis. In vitro studies demonstrate that CTCFL stimulates the histone-methyltransferase activity of PRMT7 via interactions with both histones and PRMT7. Finally, H19 ICR methylation is demonstrated by nuclear co-injection of expression vectors encoding CTCFL, PRMT7, and the de novo DNA methyltransferases, Dnmt3a, -b and -L, in Xenopus oocytes. These results suggest that CTCFL and PRMT7 may play a role in male germline imprinted gene methylation. PMID:17048991

Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

NASA Astrophysics Data System (ADS)

Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

2012-09-01

CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31189e

Exploiting Semantic Web Technologies to Develop OWL-Based Clinical Practice Guideline Execution Engines.

PubMed

Jafarpour, Borna; Abidi, Samina Raza; Abidi, Syed Sibte Raza

2016-01-01

Computerizing paper-based CPG and then executing them can provide evidence-informed decision support to physicians at the point of care. Semantic web technologies especially web ontology language (OWL) ontologies have been profusely used to represent computerized CPG. Using semantic web reasoning capabilities to execute OWL-based computerized CPG unties them from a specific custom-built CPG execution engine and increases their shareability as any OWL reasoner and triple store can be utilized for CPG execution. However, existing semantic web reasoning-based CPG execution engines suffer from lack of ability to execute CPG with high levels of expressivity, high cognitive load of computerization of paper-based CPG and updating their computerized versions. In order to address these limitations, we have developed three CPG execution engines based on OWL 1 DL, OWL 2 DL and OWL 2 DL + semantic web rule language (SWRL). OWL 1 DL serves as the base execution engine capable of executing a wide range of CPG constructs, however for executing highly complex CPG the OWL 2 DL and OWL 2 DL + SWRL offer additional executional capabilities. We evaluated the technical performance and medical correctness of our execution engines using a range of CPG. Technical evaluations show the efficiency of our CPG execution engines in terms of CPU time and validity of the generated recommendation in comparison to existing CPG execution engines. Medical evaluations by domain experts show the validity of the CPG-mediated therapy plans in terms of relevance, safety, and ordering for a wide range of patient scenarios.

Leveraging workflow control patterns in the domain of clinical practice guidelines.

PubMed

Kaiser, Katharina; Marcos, Mar

2016-02-10

Clinical practice guidelines (CPGs) include recommendations describing appropriate care for the management of patients with a specific clinical condition. A number of representation languages have been developed to support executable CPGs, with associated authoring/editing tools. Even with tool assistance, authoring of CPG models is a labor-intensive task. We aim at facilitating the early stages of CPG modeling task. In this context, we propose to support the authoring of CPG models based on a set of suitable procedural patterns described in an implementation-independent notation that can be then semi-automatically transformed into one of the alternative executable CPG languages. We have started with the workflow control patterns which have been identified in the fields of workflow systems and business process management. We have analyzed the suitability of these patterns by means of a qualitative analysis of CPG texts. Following our analysis we have implemented a selection of workflow patterns in the Asbru and PROforma CPG languages. As implementation-independent notation for the description of patterns we have chosen BPMN 2.0. Finally, we have developed XSLT transformations to convert the BPMN 2.0 version of the patterns into the Asbru and PROforma languages. We showed that although a significant number of workflow control patterns are suitable to describe CPG procedural knowledge, not all of them are applicable in the context of CPGs due to their focus on single-patient care. Moreover, CPGs may require additional patterns not included in the set of workflow control patterns. We also showed that nearly all the CPG-suitable patterns can be conveniently implemented in the Asbru and PROforma languages. Finally, we demonstrated that individual patterns can be semi-automatically transformed from a process specification in BPMN 2.0 to executable implementations in these languages. We propose a pattern and transformation-based approach for the development of CPG models. Such an approach can form the basis of a valid framework for the authoring of CPG models. The identification of adequate patterns and the implementation of transformations to convert patterns from a process specification into different executable implementations are the first necessary steps for our approach.

CpG Island Methylator Phenotype and Prognosis of Colorectal Cancer in Northeast China

PubMed Central

Li, Xia; Hu, Fulan; Yao, Xiaoping; Zhang, Zuoming; Wang, Fan; Sun, Guizhi; Cui, Bin-Bin; Dong, Xinshu; Zhao, Yashuang

2014-01-01

Purpose. To investigate the association between CpG island methylator phenotype (CIMP) and the overall survival of sporadic colorectal cancer (CRC) in Northeast China. Methods. 282 sporadic CRC patients were recruited in this study. We selected MLH1, MGMT, p16, APC, MINT1, MINT31, and RUNX3 as the CIMP panel markers. The promoter methylation was assessed by methylation sensitive high resolution melting (MS-HRM). Proportional hazards-regression models were fitted with computing hazard ratios (HR) and the corresponding 95% confidence intervals (95% CI). Results. 12.77% (36/282) of patients were CIMP-0, 74.1% (209/282) of patients were CIMP-L, and 13.12% (37/282) of patients were CIMP-H. The five-year survival of the 282 CRC patients was 58%. There was significant association between APC gene promoter methylation and CRC overall survival (HR = 1.61; 95% CI: 1.05–2.46; P = 0.03). CIMP-H was significantly associated with worse prognosis compared to CIMP-0 (HR = 3.06; 95% CI: 1.19–7.89; P = 0.02) and CIMP-L (HR = 1.97; 95% CI: 1.11–3.48; P = 0.02), respectively. While comparing with the combine of CIMP-L and CIMP-0 (CIMP-L/0), CIMP-H also presented a worse prognosis (HR = 2.31; 95% CI: 1.02–5.24; P = 0.04). Conclusion. CIMP-H may be a predictor of a poor prognosis of CRC in Northeast China patients. PMID:25243122

CpG island methylator phenotype and prognosis of colorectal cancer in Northeast China.

PubMed

Li, Xia; Hu, Fulan; Wang, Yibaina; Yao, Xiaoping; Zhang, Zuoming; Wang, Fan; Sun, Guizhi; Cui, Bin-Bin; Dong, Xinshu; Zhao, Yashuang

2014-01-01

To investigate the association between CpG island methylator phenotype (CIMP) and the overall survival of sporadic colorectal cancer (CRC) in Northeast China. 282 sporadic CRC patients were recruited in this study. We selected MLH1, MGMT, p16, APC, MINT1, MINT31, and RUNX3 as the CIMP panel markers. The promoter methylation was assessed by methylation sensitive high resolution melting (MS-HRM). Proportional hazards-regression models were fitted with computing hazard ratios (HR) and the corresponding 95% confidence intervals (95% CI). 12.77% (36/282) of patients were CIMP-0, 74.1% (209/282) of patients were CIMP-L, and 13.12% (37/282) of patients were CIMP-H. The five-year survival of the 282 CRC patients was 58%. There was significant association between APC gene promoter methylation and CRC overall survival (HR = 1.61; 95% CI: 1.05-2.46; P = 0.03). CIMP-H was significantly associated with worse prognosis compared to CIMP-0 (HR = 3.06; 95% CI: 1.19-7.89; P = 0.02) and CIMP-L (HR = 1.97; 95% CI: 1.11-3.48; P = 0.02), respectively. While comparing with the combine of CIMP-L and CIMP-0 (CIMP-L/0), CIMP-H also presented a worse prognosis (HR = 2.31; 95% CI: 1.02-5.24; P = 0.04). CIMP-H may be a predictor of a poor prognosis of CRC in Northeast China patients.

Epigenetic modifications during sex change repress gonadotropin stimulation of cyp19a1a in a teleost ricefield eel (Monopterus albus).

PubMed

Zhang, Yang; Zhang, Shen; Liu, Zhixin; Zhang, Lihong; Zhang, Weimin

2013-08-01

In vertebrates, cytochrome P450 aromatase, encoded by cyp19a1, converts androgens to estrogens and plays important roles in gonadal differentiation and development. The present study examines whether epigenetic mechanisms are involved in cyp19a1a expression and subsequent gonadal development in the hermaphroditic ricefield eel. The expression of the ricefield eel cyp19a1a was stimulated by gonadotropin via the cAMP pathway in the ovary but not the ovotestis or testis. The CpG within the cAMP response element (CRE) of the cyp19a1a promoter was hypermethylated in the ovotestis and testis compared with the ovary. The methylation levels of CpG sites around CRE in the distal region (region II) and around steroidogenic factor 1/adrenal 4 binding protein sites and TATA box in the proximal region (region I) were inversely correlated with cyp19a1a expression during the natural sex change from female to male. In vitro DNA methylation decreased the basal and forskolin-induced activities of cyp19a1a promoter. Chromatin immunoprecipitation assays indicated that histone 3 (Lys9) in both regions I and II of the cyp19a1a promoter were deacetylated and trimethylated in the testis, and in contrast to the ovary, phosphorylated CRE-binding protein failed to bind to these regions. Lastly, the DNA methylation inhibitor 5-aza-2'-deoxycytidine reversed the natural sex change of ricefield eels. These results suggested that epigenetic mechanisms involving DNA methylation and histone deacetylation and methylation may abrogate the stimulation of cyp19a1a by gonadotropins in a male-specific fashion. This may be a mechanism widely used to drive natural sex change in teleosts as well as gonadal differentiation in other vertebrates.

Methylation Analysis of the BMPR2 Gene Promoter Region in Patients With Pulmonary Arterial Hypertension.

PubMed

Pousada, Guillermo; Baloira, Adolfo; Valverde, Diana

2016-06-01

Pulmonary arterial hypertension is characterizated by obstruction of the pulmonary arteries. The gene mainly related to pathology is the bone morphogenetic protein receptor type II (BMPR2). The aim of this study was to analyze the methylation pattern of the BMPR2 promoter region in patients and controls. We used Methyl Primer Express(®) v.1.0 and MatInspector softwares to analyze this region. Genomic DNA obtained from the peripheral blood of patients and controls was modified with sodium bisulphite. Methylation was analyzed using methylation-specific PCR. DNA treated with CpG methyltransferase was used as a positive control for methylation and H1299 cell culture DNA was used as positive control for gene expression. We identified a CpG island, which may have been methylated, in the BMPR2 promoter region, in addition to NIT-2 (global-acting regulatory protein), sex-determining region Y) and heat shock factor transcription factor binding sites. We found no evidence of methylation in patients and controls. No methylated CpG sites were identified in H1299 cells expressing the BMPR2 gene. The BMPR2 promoter region is the most suitable for study because of the high number of transcription factor binding sites that could alter gene function. No evidence of methylation was detected in this region in patients and controls. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.

Complete Biallelic Insulation at the H19/Igf2 Imprinting Control Region Position Results in Fetal Growth Retardation and Perinatal Lethality

PubMed Central

Lee, Dong-Hoon; Singh, Purnima; Tsark, Walter M. K.; Szabó, Piroska E.

2010-01-01

Background The H19/Igf2 imprinting control region (ICR) functions as an insulator exclusively in the unmethylated maternal allele, where enhancer-blocking by CTCF protein prevents the interaction between the Igf2 promoter and the distant enhancers. DNA methylation inhibits CTCF binding in the paternal ICR allele. Two copies of the chicken β-globin insulator (ChβGI)2 are capable of substituting for the enhancer blocking function of the ICR. Insulation, however, now also occurs upon paternal inheritance, because unlike the H19 ICR, the (ChβGI)2 does not become methylated in fetal male germ cells. The (ChβGI)2 is a composite insulator, exhibiting enhancer blocking by CTCF and chromatin barrier functions by USF1 and VEZF1. We asked the question whether these barrier proteins protected the (ChβGI)2 sequences from methylation in the male germ line. Methodology/Principal Findings We genetically dissected the ChβGI in the mouse by deleting the binding sites USF1 and VEZF1. The methylation of the mutant versus normal (ChβGI)2 significantly increased from 11% to 32% in perinatal male germ cells, suggesting that the barrier proteins did have a role in protecting the (ChβGI)2 from methylation in the male germ line. Contrary to the H19 ICR, however, the mutant (mChβGI)2 lacked the potential to attain full de novo methylation in the germ line and to maintain methylation in the paternal allele in the soma, where it consequently functioned as a biallelic insulator. Unexpectedly, a stricter enhancer blocking was achieved by CTCF alone than by a combination of the CTCF, USF1 and VEZF1 sites, illustrated by undetectable Igf2 expression upon paternal transmission. Conclusions/Significance In this in vivo model, hypomethylation at the ICR position together with fetal growth retardation mimicked the human Silver-Russell syndrome. Importantly, late fetal/perinatal death occurred arguing that strict biallelic insulation at the H19/Igf2 ICR position is not tolerated in development. PMID:20838620

No association of CpG island methylator phenotype and colorectal cancer survival: population-based study.

PubMed

Jia, Min; Jansen, Lina; Walter, Viola; Tagscherer, Katrin; Roth, Wilfried; Herpel, Esther; Kloor, Matthias; Bläker, Hendrik; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael

2016-11-22

Previous studies have shown adverse effects of CpG island methylator phenotype (CIMP) on colorectal cancer (CRC) prognosis. However, sample sizes were often limited and only few studies were able to adjust for relevant molecular features associated with CIMP. The aim of this study was to investigate the impact of CIMP on CRC survival in a large population-based study with comprehensive adjustment. The CIMP status and other molecular tumour features were analysed in 1385 CRC patients diagnosed between 2003 and 2010. Detailed information were obtained from standardised personal interviews and medical records. During follow-up (median: 4.9 years), we assessed vital status, cause of death and therapy details. Cox proportional hazard regression models were used to estimate adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of survival after CRC. The CIMP-H occurred more frequently in patients with older age, female gender, cancer in the proximal colon, BRAF mutation and microsatellite instability-high (MSI-H). However, CIMP status was not associated with CRC prognosis in CRC patients (HR=1.00; 95% CI=0.72-1.40 for overall survival; HR=0.96; 95% CI=0.65-1.41 for disease-specific survival) or in any of the subgroups. Although CIMP status was associated with the presence of MSI-H and BRAF mutation, the prognostic effects of MSI-H (HR=0.49; 95% CI=0.27-0.90) and BRAF mutation (HR=1.78; 95% CI=1.10-2.84) were independent of CIMP status. Similar benefit of chemotherapy was found for CRC outcomes in both the CIMP-low/negative group and the CIMP-high group. CpG island methylator phenotype was not associated with CRC prognosis after adjusting for other important clinical factors and associated mutations.

Dietary and supplemental maternal methyl-group donor intake and cord blood DNA methylation.

PubMed

Pauwels, Sara; Ghosh, Manosij; Duca, Radu Corneliu; Bekaert, Bram; Freson, Kathleen; Huybrechts, Inge; A S Langie, Sabine; Koppen, Gudrun; Devlieger, Roland; Godderis, Lode

2017-01-02

Maternal nutrition is critically involved in the development and health of the fetus. We evaluated maternal methyl-group donor intake through diet (methionine, betaine, choline, folate) and supplementation (folic acid) before and during pregnancy in relation to global DNA methylation and hydroxymethylation and gene specific (IGF2 DMR, DNMT1, LEP, RXRA) cord blood methylation. A total of 115 mother-infant pairs were enrolled in the MAternal Nutrition and Offspring's Epigenome (MANOE) study. The intake of methyl-group donors was assessed using a food-frequency questionnaire. LC-MS/MS and pyrosequencing were used to measure global and gene specific methylation, respectively. Dietary intake of methyl-groups before and during pregnancy was associated with changes in LEP, DNMT1, and RXRA cord blood methylation. Statistically significant higher cord blood LEP methylation was observed when mothers started folic acid supplementation more than 6 months before conception compared with 3-6 months before conception (34.6 ± 6.3% vs. 30.1 ± 3.6%, P = 0.011, LEP CpG1) or no folic acid used before conception (16.2 ± 4.4% vs. 13.9 ± 3%, P = 0.036 for LEP CpG3 and 24.5 ± 3.5% vs. 22.2 ± 3.5%, P = 0.045 for LEP mean CpG). Taking folic acid supplements during the entire pregnancy resulted in statistically significantly higher cord blood RXRA methylation as compared with stopping supplementation in the second trimester (12.3 ± 1.9% vs. 11.1 ± 2%, P = 0.008 for RXRA mean CpG). To conclude, long-term folic acid use before and during pregnancy was associated with higher LEP and RXRA cord blood methylation, respectively. To date, pregnant women are advised to take a folic acid supplement of 400 µg/day from 4 weeks before until 12 weeks of pregnancy. Our results suggest significant epigenetic modifications when taking a folic acid supplement beyond the current advice.

The population genetics of human disease: The case of recessive, lethal mutations

PubMed Central

Gao, Ziyue; Baker, Zachary; Diesel, José Francisco; Simons, Yuval B.; Haque, Imran S.; Pickrell, Joseph; Przeworski, Molly

2017-01-01

Do the frequencies of disease mutations in human populations reflect a simple balance between mutation and purifying selection? What other factors shape the prevalence of disease mutations? To begin to answer these questions, we focused on one of the simplest cases: recessive mutations that alone cause lethal diseases or complete sterility. To this end, we generated a hand-curated set of 417 Mendelian mutations in 32 genes reported to cause a recessive, lethal Mendelian disease. We then considered analytic models of mutation-selection balance in infinite and finite populations of constant sizes and simulations of purifying selection in a more realistic demographic setting, and tested how well these models fit allele frequencies estimated from 33,370 individuals of European ancestry. In doing so, we distinguished between CpG transitions, which occur at a substantially elevated rate, and three other mutation types. Intriguingly, the observed frequency for CpG transitions is slightly higher than expectation but close, whereas the frequencies observed for the three other mutation types are an order of magnitude higher than expected, with a bigger deviation from expectation seen for less mutable types. This discrepancy is even larger when subtle fitness effects in heterozygotes or lethal compound heterozygotes are taken into account. In principle, higher than expected frequencies of disease mutations could be due to widespread errors in reporting causal variants, compensation by other mutations, or balancing selection. It is unclear why these factors would have a greater impact on disease mutations that occur at lower rates, however. We argue instead that the unexpectedly high frequency of disease mutations and the relationship to the mutation rate likely reflect an ascertainment bias: of all the mutations that cause recessive lethal diseases, those that by chance have reached higher frequencies are more likely to have been identified and thus to have been included in this study. Beyond the specific application, this study highlights the parameters likely to be important in shaping the frequencies of Mendelian disease alleles. PMID:28957316

The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

NASA Technical Reports Server (NTRS)

Nillen, Jeannie L.; Smith, Scott M.

2003-01-01

A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

PubMed

Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

2011-10-01

Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

Miniaturised optical fiber pH sensor for gastro-esophageal applications

NASA Astrophysics Data System (ADS)

Baldini, F.; Chiavaioli, F.; Cosi, F.; Giannetti, A.; Tombelli, S.; Trono, C.

2013-05-01

Monitoring pH for long periods, usually 24 h, in the stomach and in the esophagus may be essential in the diagnosis of gastro-esophageal diseases. The clinical range of interest is quite extended, between 1 to 8 pH units. Methyl red, after its covalent immobilization on controlled pore glass (CPG), is characterized by a working range which fits well with the clinical one. A novel probe, suitable for gastro-esophageal applications, was designed in order to optimize the performances of the colored CPG. This leads to a very simple probe configuration characterized by a very fast response.

Glucocorticoid receptor gene expression and promoter CpG modifications throughout the human brain.

PubMed

Cao-Lei, Lei; Suwansirikul, Songkiet; Jutavijittum, Prapan; Mériaux, Sophie B; Turner, Jonathan D; Muller, Claude P

2013-11-01

Glucocorticoids and the glucocorticoid (GR) and mineralocorticoid (MR) receptors have been implicated in many processes, particularly in negative feedback regulation of the hypothalamic-pituitary-adrenal axis. Epigenetically programmed GR alternative promoter usage underlies transcriptional control of GR levels, generation of GR 3' splice variants, and the overall GC response in the brain. No detailed analysis of GR first exons or GR transcript variants throughout the human brain has been reported. Therefore we investigated post mortem tissues from 28 brain regions of 5 individuals. GR first exons were expressed throughout the healthy human brain with no region-specific usage patterns. First exon levels were highly inter-correlated suggesting that they are co-regulated. GR 3' splice variants (GRα and GR-P) were equally distributed in all regions, and GRβ expression was always low. GR/MR ratios showed significant differences between the 28 tissues with the highest ratio in the pituitary gland. Modification levels of individual CpG dinucleotides, including 5-mC and 5-hmC, in promoters 1D, 1E, 1F, and 1H were low, and diffusely clustered; despite significant heterogeneity between the donors. In agreement with this clustering, sum modification levels rather than individual CpG modifications correlated with GR expression. Two-way ANOVA showed that this sum modification was both promoter and brain region specific, but that there was however no promoter*tissue interaction. The heterogeneity between donors may however hide such an interaction. In both promoters 1F and 1H modification levels correlated with GRα expression suggesting that 5-mC and 5-hmC play an important role in fine tuning GR expression levels throughout the brain. Copyright © 2013 Elsevier Ltd. All rights reserved.

The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

PubMed

Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

2014-01-01

DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

Factors affecting the persistence of drug-induced reprogramming of the cancer methylome

PubMed Central

Bell, Joshua S. K.; Kagey, Jacob D.; Barwick, Benjamin G.; Dwivedi, Bhakti; McCabe, Michael T.; Kowalski, Jeanne; Vertino, Paula M.

2016-01-01

ABSTRACT Aberrant DNA methylation is a critical feature of cancer. Epigenetic therapy seeks to reverse these changes to restore normal gene expression. DNA demethylating agents, including 5-aza-2′-deoxycytidine (DAC), are currently used to treat certain leukemias, and can sensitize solid tumors to chemotherapy and immunotherapy. However, it has been difficult to pin the clinical efficacy of these agents to specific demethylation events, and the factors that contribute to the durability of response remain largely unknown. Here we examined the genome-wide kinetics of DAC-induced DNA demethylation and subsequent remethylation after drug withdrawal in breast cancer cells. We find that CpGs differ in both their susceptibility to demethylation and propensity for remethylation after drug removal. DAC-induced demethylation was most apparent at CpGs with higher initial methylation levels and further from CpG islands. Once demethylated, such sites exhibited varied remethylation potentials. The most rapidly remethylating CpGs regained >75% of their starting methylation within a month of drug withdrawal. These sites had higher pretreatment methylation levels, were enriched in gene bodies, marked by H3K36me3, and tended to be methylated in normal breast cells. In contrast, a more resistant class of CpG sites failed to regain even 20% of their initial methylation after 3 months. These sites had lower pretreatment methylation levels, were within or near CpG islands, marked by H3K79me2 or H3K4me2/3, and were overrepresented in sites that become aberrantly hypermethylated in breast cancers. Thus, whereas DAC-induced demethylation affects both endogenous and aberrantly methylated sites, tumor-specific hypermethylation is more slowly regained, even as normal methylation promptly recovers. Taken together, these data suggest that the durability of DAC response is linked to its selective ability to stably reset at least a portion of the cancer methylome. PMID:27082926

Mapping the mouse Allelome reveals tissue-specific regulation of allelic expression

PubMed Central

Andergassen, Daniel; Dotter, Christoph P; Wenzel, Daniel; Sigl, Verena; Bammer, Philipp C; Muckenhuber, Markus; Mayer, Daniela; Kulinski, Tomasz M; Theussl, Hans-Christian; Penninger, Josef M; Bock, Christoph; Barlow, Denise P; Pauler, Florian M; Hudson, Quanah J

2017-01-01

To determine the dynamics of allelic-specific expression during mouse development, we analyzed RNA-seq data from 23 F1 tissues from different developmental stages, including 19 female tissues allowing X chromosome inactivation (XCI) escapers to also be detected. We demonstrate that allelic expression arising from genetic or epigenetic differences is highly tissue-specific. We find that tissue-specific strain-biased gene expression may be regulated by tissue-specific enhancers or by post-transcriptional differences in stability between the alleles. We also find that escape from X-inactivation is tissue-specific, with leg muscle showing an unexpectedly high rate of XCI escapers. By surveying a range of tissues during development, and performing extensive validation, we are able to provide a high confidence list of mouse imprinted genes including 18 novel genes. This shows that cluster size varies dynamically during development and can be substantially larger than previously thought, with the Igf2r cluster extending over 10 Mb in placenta. DOI: http://dx.doi.org/10.7554/eLife.25125.001 PMID:28806168

Epigenetic contribution of the myosin light chain kinase gene to the risk for acute respiratory distress syndrome.

PubMed

Szilágyi, Keely L; Liu, Cong; Zhang, Xu; Wang, Ting; Fortman, Jeffrey D; Zhang, Wei; Garcia, Joe G N

2017-02-01

Acute respiratory distress syndrome (ARDS) is a devastating clinical syndrome with a considerable case fatality rate (∼30%-40%). Health disparities exist with African descent (AD) subjects exhibiting greater mortality than European descent (ED) individuals. Myosin light chain kinase is encoded by MYLK, whose genetic variants are implicated in ARDS pathogenesis and may influence ARDS mortality. As baseline population-specific epigenetic changes, that is, cytosine modifications, have been observed between AD and ED individuals, epigenetic variations in MYLK may provide insights into ARDS disparities. We compared methylation levels of MYLK cytosine-guanine dinucleotides (CpGs) between ARDS patients and intensive care unit (ICU) controls overall and by ethnicity in a nested case-control study of 39 ARDS cases and 75 non-ARDS ICU controls. Two MYLK CpG sites (cg03892735 and cg23344121) were differentially modified between ARDS subjects and controls (P < 0.05; q < 0.25) in a logistic regression model, where no effect modification by ethnicity or age was found. One CpG site was associated with ARDS in patients aged <58 years, cg19611163 (intron 19, 20). Two CpG sites were associated with ARDS in EDs only, gene body CpG (cg01894985, intron 2, 3) and CpG (cg16212219, intron 31, 32), with higher modification levels exhibited in ARDS subjects than controls. Cis-acting modified cytosine quantitative trait loci (mQTL) were identified using linear regression between local genetic variants and modification levels for 2 ARDS-associated CpGs (cg23344121 and cg16212219). In summary, these ARDS-associated MYLK CpGs with effect modification by ethnicity and local mQTL suggest that MYLK epigenetic variation and local genetic background may contribute to health disparities observed in ARDS. Copyright © 2016 Elsevier Inc. All rights reserved.

Phylogenetic analysis of enterohemorrhagic Escherichia coli O157, Germany, 1987-2008.

PubMed

Jenke, Christian; Harmsen, Dag; Weniger, Thomas; Rothganger, Jorg; Hyytia-Trees, Eija; Bielaszewska, Martina; Karch, Helge; Mellmann, Alexander

2010-04-01

Multilocus variable number tandem repeat analysis (MLVA) is a subtyping technique for characterizing human pathogenic bacteria such as enterohemorrhagic Escherichia coli (EHEC) O157. We determined the phylogeny of 202 epidemiologically unrelated EHEC O157:H7/H- clinical isolates through 8 MLVA loci obtained in Germany during 1987-2008. Biodiversity in the loci ranged from 0.66 to 0.90. Four of 8 loci showed null alleles and a frequency < or =44.1%. These loci were distributed among 48.5% of all strains. Overall, 141 MLVA profiles were identified. Phylogenetic analysis assigned 67.3% of the strains to 19 MLVA clusters. Specific MLVA profiles with an evolutionary persistence were identified, particularly within sorbitol-fermenting EHEC O157:H-.These pathogens belonged to the same MLVA cluster. Our findings indicate successful persistence of this clone.

Impact of CYP2C19 genetic testing on provider prescribing patterns for antiplatelet therapy after acute coronary syndromes and percutaneous coronary intervention.

PubMed

Desai, Nihar R; Canestaro, William J; Kyrychenko, Pavlo; Chaplin, Donald; Martell, Lori A; Brennan, Troyen; Matlin, Olga S; Choudhry, Niteesh K

2013-11-01

Patients treated with clopidogrel who have ≥1 loss of function alleles for CYP2C19 have an increased risk for adverse cardiovascular events. In 2010, the US Food and Drug Administration issued a boxed warning cautioning against the use of clopidogrel in such patients. We sought to assess the impact of CYP2C19 genetic testing on prescribing patterns for antiplatelet therapy among patients with acute coronary syndrome or percutaneous coronary intervention. Patients with recent acute coronary syndrome or percutaneous coronary intervention prescribed clopidogrel were offered CYP2C19 testing. Genotype and phenotype results were provided to patients and their physicians, but no specific treatment recommendations were suggested. Patients were categorized based on their genotype (carriers versus noncarriers) and phenotype (extensive, intermediate, and poor metabolizers). The primary outcome was intensification in antiplatelet therapy defined as either dose escalation of clopidogrel or replacement of clopidogrel with prasugrel. Between July 2010 and April 2012, 6032 patients were identified, and 499 (8.3%) underwent CYP2C19 genotyping, of whom 146 (30%) were found to have ≥1 reduced function allele, including 15 (3%) with 2 reduced function alleles. Although reduced function allele carriers were significantly more likely than noncarriers to have an intensification of their antiplatelet therapy, only 20% of poor metabolizers of clopidogrel had their antiplatelet therapy intensified. Providers were significantly more likely to intensify antiplatelet therapy in CYP2C19 allele carriers, but only 20% of poor metabolizers of clopidogrel had an escalation in the dose of clopidogrel or were switched to prasugrel. These prescribing patterns likely reflect the unclear impact and evolving evidence for clopidogrel pharmacogenomics.

DNA containing CpG motifs induces angiogenesis

NASA Astrophysics Data System (ADS)

Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

2002-06-01

New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

PubMed

Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

2015-06-01

Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

Maternal 5mCpG Imprints at the PARD6G-AS1 and GCSAML Differentially Methylated Regions Are Decoupled From Parent-of-Origin Expression Effects in Multiple Human Tissues

PubMed Central

de Sá Machado Araújo, Graziela; da Silva Francisco Junior, Ronaldo; dos Santos Ferreira, Cristina; Mozer Rodrigues, Pedro Thyago; Terra Machado, Douglas; Louvain de Souza, Thais; Teixeira de Souza, Jozimara; Figueiredo Osorio da Silva, Cleiton; Alves da Silva, Antônio Francisco; Andrade, Claudia Caixeta Franco; da Silva, Alan Tardin; Ramos, Victor; Garcia, Ana Beatriz; Machado, Filipe Brum; Medina-Acosta, Enrique

2018-01-01

A hallmark of imprinted genes in mammals is the occurrence of parent-of-origin-dependent asymmetry of DNA cytosine methylation (5mC) of alleles at CpG islands (CGIs) in their promoter regions. This 5mCpG asymmetry between the parental alleles creates allele-specific imprinted differentially methylated regions (iDMRs). iDMRs are often coupled to the transcriptional repression of the methylated allele and the activation of the unmethylated allele in a tissue-specific, developmental-stage-specific and/or isoform-specific fashion. iDMRs function as regulatory platforms, built through the recruitment of chemical modifications to histones to achieve differential, parent-of-origin-dependent chromatin segmentation states. Here, we used a comparative computational data mining approach to identify 125 novel constitutive candidate iDMRs that integrate the maximal number of allele-specific methylation region records overlapping CGIs in human methylomes. Twenty-nine candidate iDMRs display gametic 5mCpG asymmetry, and another 96 are candidate secondary iDMRs. We established the maternal origin of the 5mCpG imprints of one gametic (PARD6G-AS1) and one secondary (GCSAML) iDMRs. We also found a constitutively hemimethylated, nonimprinted domain at the PWWP2AP1 promoter CGI with oocyte-derived methylation asymmetry. Given that the 5mCpG level at the iDMRs is not a sufficient criterion to predict active or silent locus states and that iDMRs can regulate genes from a distance of more than 1 Mb, we used RNA-Seq experiments from the Genotype-Tissue Expression project and public archives to assess the transcriptional expression profiles of SNPs across 4.6 Mb spans around the novel maternal iDMRs. We showed that PARD6G-AS1 and GCSAML are expressed biallelically in multiple tissues. We found evidence of tissue-specific monoallelic expression of ZNF124 and OR2L13, located 363 kb upstream and 419 kb downstream, respectively, of the GCSAML iDMR. We hypothesize that the GCSAML iDMR regulates the tissue-specific, monoallelic expression of ZNF124 but not of OR2L13. We annotated the non-coding epigenomic marks in the two maternal iDMRs using data from the Roadmap Epigenomics project and showed that the PARD6G-AS1 and GCSAML iDMRs achieve contrasting activation and repression chromatin segmentations. Lastly, we found that the maternal 5mCpG imprints are perturbed in several hematopoietic cancers. We conclude that the maternal 5mCpG imprints at PARD6G-AS1 and GCSAML iDMRs are decoupled from parent-of-origin transcriptional expression effects in multiple tissues. PMID:29545821

CPG2 Recruits Endophilin B2 to the Cytoskeleton for Activity-Dependent Endocytosis of Synaptic Glutamate Receptors.

PubMed

Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly

2016-02-08

Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

Evidence-based clinical practice guideline for adult Still's disease.

PubMed

Mimura, Toshihide; Kondo, Yuya; Ohta, Akihide; Iwamoto, Masahiro; Ota, Akiko; Okamoto, Nami; Kawaguchi, Yasushi; Kono, Hajime; Takasaki, Yoshinari; Takei, Shuji; Nishimoto, Norihiro; Fujimoto, Manabu; Asanuma, Yu Funakubo; Mimori, Akio; Okiyama, Naoko; Kaneko, Shunta; Takahashi, Hiroyuki; Yokosawa, Masahiro; Sumida, Takayuki

2018-05-09

Using an expert- and data-driven methodology, we have constructed the first clinical practice guidelines (CPGs) for adult Still's disease (ASD) after complete systematic review (SR) of the literature based upon the Medical Information Network Distribution Service (Minds) procedure. The CPG committee for ASD organized by the Research Team for Autoimmune Diseases, the Research Program for Intractable Disease of the Japanese Ministry of Health, Labour, and Welfare has developed CPG for ASD 2017, according to the procedure proposed by Minds. The CPG development process includes (1) clarification of the purpose of CPG, (2) organization of the steering committee, (3) organization of the CPG committee and secretariat, (4) defining the scope (setting of clinical questions (CQs)), (5) SR, (6) development of recommendations, (7) drafting the CPG, (8) external evaluation and public comments, and (9) release. Because we wanted to construct CPG for ASD to encompass both adult-onset Still's disease (AOSD) and adult patients with systemic juvenile idiopathic arthritis (sJIA), we also included SR data from sJIA in this study. Twenty-six CQs were selected and roughly divided into the following items: (1) clinical findings (CQs 1-4), (2) laboratory findings (CQs 5-8), (3) complications (CQs 9-13), (4) treatment with oral medicine (CQs 14-19), (5) treatment with biological reagents (CQs 20-23), and (6) treatments for sJIA (CQs 25-26). Recommendations and the strength of the recommendations for these CQs were decided by a modified Delphi method. We have developed the first published CPG for ASD including AOSD and sJIA, which includes 26 CQs and recommendations. This guideline will help rheumatologists, non-specialized physicians, other healthcare providers, medical and health-related students, and patients and their family members to understand and treat ASD.

TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

PubMed Central

Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

2016-01-01

Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

Tetranucleotide microsatellite loci from the black bear (Ursus americanus).

PubMed

Sanderlin, Jamie Skvarla; Faircloth, Brant C; Shamblin, Brian; Conroy, Michael J

2009-01-01

We describe primers and polymerase chain reaction conditions to amplify 21 tetranucleotide microsatellite DNA loci in black bears (Ursus americanus). We tested primers using individuals from two populations, one each in Georgia and Florida. Among individuals from Georgia (n = 29), primer pairs yielded an average of 2.9 alleles (range, one to four) and an average observed heterozygosity (H(O) ) of 0.50 (range, 0.00 to 0.79). Among individuals from Florida (n = 19), primer pairs yielded an average of 5.7 alleles (range, one to 14) and an H(O) of 0.55 (range, 0.00 to 1.00). A comparison of previously developed markers with individuals from Georgia suggests that bear populations in Georgia and Florida have reduced allelic diversity relative to other populations. © 2008 The Authors. Journal compilation © 2008 Blackwell Publishing Ltd.

Epigenetic Control of Gonadal Aromatase (cyp19a1) in Temperature-Dependent Sex Determination of Red-Eared Slider Turtles

PubMed Central

Matsumoto, Yuiko; Buemio, Alvin; Chu, Randy; Vafaee, Mozhgon; Crews, David

2013-01-01

In the red-eared slider turtle (Trachemys scripta), a species with temperature-dependent sex determination (TSD), the expression of the aromatase gene during gonad development is strictly limited to the female-producing temperature. The underlying mechanism remains unknown. In this study, we identified the upstream 5′-flanking region of the aromatase gene, gonad-specific promoter, and the temperature-dependent DNA methylation signatures during gonad development in the red-eared slider turtle. The 5′-flanking region of the slider aromatase exhibited sequence similarities to the aromatase genes of the American alligator, chicken, quail, and zebra finch. A putative TATA box was located 31 bp upstream of the gonad-specific transcription start site. DNA methylation at the CpG sites between the putative binding sites of the fork head domain factor (FOX) and vertebrate steroidogenic factor 1 (SF1) and adjacent TATA box in the promoter region were significantly lower in embryonic gonads at the female-producing temperature compared the male-producing temperature. A shift from male- to female-, but not from female- to male-, producing temperature changed the level of DNA methylation in gonads. Taken together these results indicate that the temperature, particularly female-producing temperature, allows demethylation at the specific CpG sites of the promoter region which leads the temperature-specific expression of aromatase during gonad development. PMID:23762231

Healthcare professionals' and policy makers' views on implementing a clinical practice guideline of hypertension management: a qualitative study.

PubMed

Lee, Ping Yein; Liew, Su May; Abdullah, Adina; Abdullah, Nurdiana; Ng, Chirk Jenn; Hanafi, Nik Sherina; Chia, Yook Chin; Lai, Pauline S M; Wong, Stalia S L; Khoo, Ee Ming

2015-01-01

Most studies have reported barriers to guideline usage mainly from doctors' perspective; few have reported the perspective of other stakeholders. This study aimed to determine the views and barriers to adherence of a national clinical practice guideline (CPG) on management of hypertension from the perspectives of policymakers, doctors and allied healthcare professionals. This study used a qualitative approach with purposive sampling. Seven in depth interviews and six focus group discussions were conducted with 35 healthcare professionals (policy makers, doctors, pharmacists and nurses) at a teaching hospital in Kuala Lumpur, Malaysia, between February and June 2013. All interviews were audio-recorded, transcribed verbatim and checked. Thematic approach was used to analyse the data. Two main themes and three sub-themes emerged from this study. The main themes were (1) variation in the use of CPG and (2) barriers to adherence to CPG. The three sub-themes for barriers were issues inherent to the CPG, systems and policy that is not supportive of CPG use, and attitudes and behaviour of stakeholders. The main users of the CPG were the primary care doctors. Pharmacists only partially use the guidelines, while nurses and policy makers were not using the CPG at all. Participants had suggested few strategies to improve usage and adherence to CPG. First, update the CPG regularly and keep its content simple with specific sections for allied health workers. Second, use technology to facilitate CPG accessibility and provide protected time for implementation of CPG recommendations. Third, incorporate local CPG in professional training, link CPG adherence to key performance indicators and provide incentives for its use. Barriers to the use of CPG hypertension management span across all stakeholders. The development and implementation of CPG focused mainly on doctors with lack of involvement of other healthcare stakeholders. Guidelines should be made simple, current, reliable, accessible, inclusive of all stakeholders and with good policy support.

Genome-wide mapping and analysis of active promoters in mouse embryonic stem cells and adult organs

PubMed Central

Barrera, Leah O.; Li, Zirong; Smith, Andrew D.; Arden, Karen C.; Cavenee, Webster K.; Zhang, Michael Q.; Green, Roland D.; Ren, Bing

2008-01-01

By integrating genome-wide maps of RNA polymerase II (Polr2a) binding with gene expression data and H3ac and H3K4me3 profiles, we characterized promoters with enriched activity in mouse embryonic stem cells (mES) as well as adult brain, heart, kidney, and liver. We identified ∼24,000 promoters across these samples, including 16,976 annotated mRNA 5′ ends and 5153 additional sites validating cap-analysis of gene expression (CAGE) 5′ end data. We showed that promoters with CpG islands are typically non-tissue specific, with the majority associated with Polr2a and the active chromatin modifications in nearly all the tissues examined. By contrast, the promoters without CpG islands are generally associated with Polr2a and the active chromatin marks in a tissue-dependent way. We defined 4396 tissue-specific promoters by adapting a quantitative index of tissue-specificity based on Polr2a occupancy. While there is a general correspondence between Polr2a occupancy and active chromatin modifications at the tissue-specific promoters, a subset of them appear to be persistently marked by active chromatin modifications in the absence of detectable Polr2a binding, highlighting the complexity of the functional relationship between chromatin modification and gene expression. Our results provide a resource for exploring promoter Polr2a binding and epigenetic states across pluripotent and differentiated cell types in mammals. PMID:18042645

Correlation of pathologic features with CpG island methylator phenotype (CIMP) by quantitative DNA methylation analysis in colorectal carcinoma.

PubMed

Ogino, Shuji; Odze, Robert D; Kawasaki, Takako; Brahmandam, Mohan; Kirkner, Gregory J; Laird, Peter W; Loda, Massimo; Fuchs, Charles S

2006-09-01

Extensive gene promoter methylation in colorectal carcinoma has been termed the CpG island methylator phenotype (CIMP). Previous studies on CIMP used primarily methylation-specific polymerase chain reaction (PCR), which, unfortunately, may detect low levels of methylation that has little or no biological significance. Utilizing quantitative real-time PCR (MethyLight), we measured DNA methylation in a panel of 5 CIMP-specific gene promoters (CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1) in 459 colorectal carcinomas obtained from 2 large prospective cohort studies. CIMP was defined as tumors that showed methylation in >or=4/5 promoters. CIMP was significantly associated with the presence of mucinous or signet ring cell morphology, marked Crohn's-like lymphoid reaction, tumor infiltrating lymphocytes, marked peritumoral lymphocytic reaction, tumor necrosis, tumor cell sheeting, and poor differentiation. All these features have previously been associated with microsatellite instability (MSI). Therefore, we divided the 459 colorectal carcinomas into 6 subtypes, namely, MSI-high (MSI-H)/CIMP, MSI-H/non-CIMP, MSI-low (MSI-L)/CIMP, MSI-L/non-CIMP, microsatellite stable/CIMP, and micro satellite sstable/non-CIMP. Compared with MSI-H/non-CIMP, MSI-H/CIMP was associated with marked tumor infiltrating lymphocytes, tumor necrosis, sheeting, and poor differentiation (all P

[Similarity of cycloprolylglycine to piracetam in antihypoxic and neuroprotective effects].

PubMed

Kolisnikova, K N; Gudasheva, T A; Nazarova, G A; Antipov, T A; Voronina, T A; Seredenin, S B

2012-01-01

The antihypoxic activity of the endogenous cyclic dipeptide cycloprolylglycine (CPG) has been studied on a model of normobaric hypoxia with hypercapnia and its neuroprotective activity has been studied on a model of human neuroblastoma SH-SY5Y cell damage by 6-hydroxydopamine. It is established that CPG exhibits the antihypoxic activity at doses of 0.5 and 1.0 mg/kg (i.p.) on outbred and BALB/c mice, but not on C57B1/6 mice. The neuroprotective activity of CPG was detected in 10(-5) - 10(-8) M concentration range only when the treatment was carried out 24h before toxin introduction. The obtained data confirm the hypothesis that piracetam is a mimetic of the endogenous CPG neuropeptide.

Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih

2014-02-01

Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p < 0.05) in spleen and intestine compared to gill, kidney, liver and skin. However, at adult stage, the significant high expression was found in gill and intestine. Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.

Development of a new 26plex Y-STRs typing system for forensic application.

PubMed

Zhang, Suhua; Tian, Huaizhou; Wang, Zheng; Zhao, Shumin; Hu, Zhen; Li, Chengtao; Ji, Chaoneng

2014-11-01

In this study, 26plex Y-STRs typing system, including 17 Y-STRs (DYS19, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS385ab, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458, DYS635 and GATA H4) recommended as YHRD standard loci and nine new highly discriminating Y-STRs (DYS549, DYS643, DYS388, DYS570, DYS533, DYS576, DYS460, DYS481 and DYS449), was established with 5-dye fluorescences labelling. Developmental validation indicated that the 26plex Y-STRs typing system was reproducible, accurate, sensitive and robust. The sensitivity of the system was such that a full profile was obtainable even with 125pg of male DNA. Specificity testing was demonstrated by the lack of cross-reactivity with a variety of commonly encountered animal species and bacteria. Also, the multiplex is suitable for mixture study. An average of above 97% of the minor alleles detected with the male/male mixture with 1:3 and 3:1 ratios, while an average of above 70% of the minor alleles detected with the male/male mixture with 1:19 and 19:1 ratios. Full profiles are consistently detected with 125pg of male DNA, even in the presence of excessive amounts of female DNA. In addition, the whole PCR amplification of the 26 Y-STRs can finish in 1h, making the multiplex system suitable for fast-detection. For the forensic evaluation of the multiplex system, 516 haplotypes were found among 517 unrelated males. HD of the multiplex system was 0.9999925 while DC was 0.9980658, which is suitable for forensic application. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Analysis of novel sph (spherocytosis) alleles in mice reveals allele-specific loss of band 3 and adducin in α-spectrin–deficient red cells

PubMed Central

Robledo, Raymond F.; Lambert, Amy J.; Birkenmeier, Connie S.; Cirlan, Marius V.; Cirlan, Andreea Flavia M.; Campagna, Dean R.; Lux, Samuel E.

2010-01-01

Five spontaneous, allelic mutations in the α-spectrin gene, Spna1, have been identified in mice (spherocytosis [sph], sph1J, sph2J, sph2BC, sphDem). All cause severe hemolytic anemia. Here, analysis of 3 new alleles reveals previously unknown consequences of red blood cell (RBC) spectrin deficiency. In sph3J, a missense mutation (H2012Y) in repeat 19 introduces a cryptic splice site resulting in premature termination of translation. In sphIhj, a premature stop codon occurs (Q1853Stop) in repeat 18. Both mutations result in markedly reduced RBC membrane spectrin content, decreased band 3, and absent β-adducin. Reevaluation of available, previously described sph alleles reveals band 3 and adducin deficiency as well. In sph4J, a missense mutation occurs in the C-terminal EF hand domain (C2384Y). Notably, an equally severe hemolytic anemia occurs despite minimally decreased membrane spectrin with normal band 3 levels and present, although reduced, β-adducin. The severity of anemia in sph4J indicates that the highly conserved cysteine residue at the C-terminus of α-spectrin participates in interactions critical to membrane stability. The data reinforce the notion that a membrane bridge in addition to the classic protein 4.1-p55-glycophorin C linkage exists at the RBC junctional complex that involves interactions between spectrin, adducin, and band 3. PMID:20056793

Analysis of novel sph (spherocytosis) alleles in mice reveals allele-specific loss of band 3 and adducin in alpha-spectrin-deficient red cells.

PubMed

Robledo, Raymond F; Lambert, Amy J; Birkenmeier, Connie S; Cirlan, Marius V; Cirlan, Andreea Flavia M; Campagna, Dean R; Lux, Samuel E; Peters, Luanne L

2010-03-04

Five spontaneous, allelic mutations in the alpha-spectrin gene, Spna1, have been identified in mice (spherocytosis [sph], sph(1J), sph(2J), sph(2BC), sph(Dem)). All cause severe hemolytic anemia. Here, analysis of 3 new alleles reveals previously unknown consequences of red blood cell (RBC) spectrin deficiency. In sph(3J), a missense mutation (H2012Y) in repeat 19 introduces a cryptic splice site resulting in premature termination of translation. In sph(Ihj), a premature stop codon occurs (Q1853Stop) in repeat 18. Both mutations result in markedly reduced RBC membrane spectrin content, decreased band 3, and absent beta-adducin. Reevaluation of available, previously described sph alleles reveals band 3 and adducin deficiency as well. In sph(4J), a missense mutation occurs in the C-terminal EF hand domain (C2384Y). Notably, an equally severe hemolytic anemia occurs despite minimally decreased membrane spectrin with normal band 3 levels and present, although reduced, beta-adducin. The severity of anemia in sph(4J) indicates that the highly conserved cysteine residue at the C-terminus of alpha-spectrin participates in interactions critical to membrane stability. The data reinforce the notion that a membrane bridge in addition to the classic protein 4.1-p55-glycophorin C linkage exists at the RBC junctional complex that involves interactions between spectrin, adducin, and band 3.

Provider Adherence to Implementation of Clinical Practice Guidelines for Neurogenic Bowel in Adults With Spinal Cord Injury

PubMed Central

Goetz, Lance L; Nelson, Audrey L; Guihan, Marylou; Bosshart, Helen T; Harrow, Jeffrey J; Gerhart, Kevin D; Krasnicka, Barbara; Burns, Stephen P

2005-01-01

Background/Objectives: Clinical Practice Guidelines (CPGs) have been published on a number of topics in spinal cord injury (SCI) medicine. Research in the general medical literature shows that the distribution of CPGs has a minimal effect on physician practice without targeted implementation strategies. The purpose of this study was to determine (a) whether dissemination of an SCI CPG improved the likelihood that patients would receive CPG recommended care and (b) whether adherence to CPG recommendations could be improved through a targeted implementation strategy. Specifically, this study addressed the “Neurogenic Bowel Management in Adults with Spinal Cord Injury” Clinical Practice Guideline published in March 1998 by the Consortium for Spinal Cord Medicine Methods: CPG adherence was determined from medical record review at 6 Veterans Affairs SCI centers for 3 time periods: before guideline publication (T1), after guideline publication but before CPG implementation (T2), and after targeted CPG implementation (T3). Specific implementation strategies to enhance guideline adherence were chosen to address the barriers identified by SCI providers in focus groups before the intervention. Results: Overall adherence to recommendations related to neurogenic bowel did not change between T1 and T2 (P = not significant) but increased significantly between T2 and T3 (P < 0.001) for 3 of 6 guideline recommendations. For the other 3 guideline recommendations, adherence rates were noted to be high at T1. Conclusions: While publication of the CPG alone did not alter rates of provider adherence, the use of a targeted implementation plan resulted in increases in adherence rates with some (3 of 6) CPG recommendations for neurogenic bowel management. PMID:16869086

B-cell activation with CD40L or CpG measures the function of B-cell subsets and identifies specific defects in immunodeficient patients.

PubMed

Marasco, Emiliano; Farroni, Chiara; Cascioli, Simona; Marcellini, Valentina; Scarsella, Marco; Giorda, Ezio; Piano Mortari, Eva; Leonardi, Lucia; Scarselli, Alessia; Valentini, Diletta; Cancrini, Caterina; Duse, Marzia; Grimsholm, Ola; Carsetti, Rita

2017-01-01

Around 65% of primary immunodeficiencies are antibody deficiencies. Functional tests are useful tools to study B-cell functions in vitro. However, no accepted guidelines for performing and evaluating functional tests have been issued yet. Here, we report our experience on the study of B-cell functions in infancy and throughout childhood. We show that T-independent stimulation with CpG measures proliferation and differentiation potential of memory B cells. Switched memory B cells respond better than IgM memory B cells. On the other hand, CD40L, a T-dependent stimulus, does not induce plasma cell differentiation, but causes proliferation of naïve and memory B cells. During childhood, the production of plasmablasts in response to CpG increases with age mirroring the development of memory B cells. The response to CD40L does not change with age. In patients with selective IgA deficiency (SIgAD), we observed that switched memory B cells are reduced due to the absence of IgA memory B cells. In agreement, IgA plasma cells are not generated in response to CpG. Unexpectedly, B cells from SIgAD patients show a reduced proliferative response to CD40L. Our results demonstrate that functional tests are an important tool to assess the functions of the humoral immune system. © 2016 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The effect of the cytochrome P450 CYP2C8 polymorphism on the disposition of (R)-ibuprofen enantiomer in healthy subjects

PubMed Central

Martínez, Carmen; García-Martín, Elena; Blanco, Gerardo; Gamito, Francisco J G; Ladero, José M; Agúndez, José A G

2005-01-01

Aims To study the effect of CYP2C8*3, the most common CYP2C8 variant allele on the dis-position of (R)-ibuprofen and the association of CYP2C8*3 with variant CYP2C9 alleles. Methods Three hundred and fifty-five randomly selected Spanish Caucasians were screened for the common CYP2C8 and CYP2C9 mutations. The pharmacokinetics of (R)-ibuprofen were studied in 25 individuals grouped into different CYP2C8 genotypes. Results The allele frequency of CYP2C8*3 (0.17) was found to be higher than that reported for other Caucasian populations (P = 0.0001). The frequencies of CYP2C9*2 and CYP2C9*3 were 0.19 (0.16–0.21) and 0.10 (0.08–0.12), respectively. An association between CYP2C8*3 and CYP2C9*2 alleles was observed, occurring together at a frequency 2.4-fold higher than expected for a random association of alleles (P = 0.0001). The presence of the CYP2C8*3 allele was found to influence the pharmacokinetics of (R)-ibuprofen in a gene–dose effect manner. Thus, after administration of 400 mg ibuprofen, the plasma half-life (95% confidence intervals) for individuals with genotypes CYP2C8*1/*1, CYP2C8*1/*3 and CYP2C8*3/*3, was 2.0 h (1.8–2.2), 4.2 h (1.9–6.5; P < 0.05) and 9.0 h (7.8–10.2; P < 0.002), respectively. A statistically significant trend with respect to the number of variant CYP2C8*3 alleles was also observed for the area under the concentration-time curve (P < 0.025), and drug clearance (P < 0.03). Conclusion Polymorphism of the CYP2C8 gene was found to be common, with nearly 30% of the population studied carrying the variant CYP2C8*3 allele. The presence of the latter caused a significant effect on the disposition of (R)-ibuprofen. This suggests that a substantial proportion of Caucasian subjects may show alterations in the disposition of drugs that are CYP2C8 substrates. PMID:15606441

Neonatal testosterone suppresses a neuroendocrine pulse generator required for reproduction

NASA Astrophysics Data System (ADS)

Israel, Jean-Marc; Cabelguen, Jean-Marie; Le Masson, Gwendal; Oliet, Stéphane H.; Ciofi, Philippe

2014-02-01

The pituitary gland releases hormones in a pulsatile fashion guaranteeing signalling efficiency. The determinants of pulsatility are poorly circumscribed. Here we show in magnocellular hypothalamo-neurohypophyseal oxytocin (OT) neurons that the bursting activity underlying the neurohormonal pulses necessary for parturition and the milk-ejection reflex is entirely driven by a female-specific central pattern generator (CPG). Surprisingly, this CPG is active in both male and female neonates, but is inactivated in males after the first week of life. CPG activity can be restored in males by orchidectomy or silenced in females by exogenous testosterone. This steroid effect is aromatase and caspase dependent, and is mediated via oestrogen receptor-α. This indicates the apoptosis of the CPG network during hypothalamic sexual differentiation, explaining why OT neurons do not burst in adult males. This supports the view that stereotypic neuroendocrine pulsatility is governed by CPGs, some of which are subjected to gender-specific perinatal programming.

EGFR mutant allelic-specific imbalance assessment in routine samples of non-small cell lung cancer.

PubMed

Malapelle, Umberto; Vatrano, Simona; Russo, Stefania; Bellevicine, Claudio; de Luca, Caterina; Sgariglia, Roberta; Rocco, Danilo; de Pietro, Livia; Riccardi, Fernando; Gobbini, Elisa; Righi, Luisella; Troncone, Giancarlo

2015-09-01

In non-small cell lung cancer (NSCLC), the epidermal growth factor receptor (EGFR) gene may undergo both mutations and copy number gains. EGFR mutant allele-specific imbalance (MASI) occurs when the ratio of mutant-to-wild-type alleles increases significantly. In this study, by using a previously validated microfluidic-chip-based technology, EGFR-MASI occurred in 25/67 mutant cases (37%), being more frequently associated with EGFR exon 19 deletions (p=0.033). In a subset of 49 treated patients, we assessed whether MASI is a modifier of anti-EGFR treatment benefit. The difference in progression-free survival and overall survival between EGFR-MASI-positive and EGFR-MASI-negative groups of patients did not show a statistical significance. In conclusion, EGFR-MASI is a significant event in NSCLC, specifically associated with EGFR exon 19 deletions. However, EGFR-MASI does not seem to play a role in predicting the response to first-generation EGFR small molecules inhibitors. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Term placenta shows methylation independent down regulation of Cyp19 gene in animals with retained fetal membranes.

PubMed

Ghai, Sandeep; Monga, Rachna; Mohanty, T K; Chauhan, M S; Singh, Dheer

2012-02-01

Retention of fetal membranes (RFM) is the major post-partum disorder in dairy cattle. Cyp19 gene encodes the aromatase enzyme responsible for catalyzing the rate limiting step in estrogen biosynthesis, an important hormone for placental maturation and expulsion. The present study was aimed for comparative analysis of Cyp19 gene expression and its epigenetic regulation in placental cotyledons of animals with and without RFM. Significantly lower expression of Cyp19 gene was found in placental samples of RFM affected animals in comparison to normal animals. Methylation analysis of 5 CpG dinucleotides of placenta specific Cyp19 gene promoter I.1 and proximal promoter, PII showed hypo-methylation of both PI.1 and PII in term placenta of normal and diseased animals. In conclusion, a mechanism other than promoter methylation is responsible for decreased aromatase expression in placental cotyledons of animals suffering from RFM. Copyright © 2010 Elsevier Ltd. All rights reserved.

Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

PubMed

Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

2015-08-01

DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

Long-chain (C19-C29) 1-chloro-n-alkanes in leaf waxes of halophytes of the Chenopodiaceae.

PubMed

Grossi, Vincent; Raphel, Danielle

2003-07-01

The hydrocarbon fraction of leaf waxes of three halophytes of the Chenopodiaceae common to Mediterranean salt marshes (Suaeda vera, Sarcocornia fruticosa and Halimione portulacoides) revealed the presence of a minor series of odd and even chains 1-chloro-n-alkanes ranging from C(19) to C(29). The identification of these new chlorinated plant constituents was based on a combination of mass spectrometry data with selective chlorine detection (CPG-AED) and was confirmed by comparison with authentic standards. The qualitative and quantitative distributions of these 1-chloro-n-alkanes varied inter-specifically. Homologues with an odd carbon-chain were predominant in all species but maximised at C(25) and C(27) in S. vera and S. fruticosa, and at C(27) and C(29) in H. portulacoides. Remarkably, 1-chloro-nonacosane was an abundant homologue only in this latter species. Leaves of S. vera contained 4 to 7 times more of total chloroalkanes than leaves of the other two species. These compounds accounted for 10, 4 and 1% of the hydrocarbon fraction of leaf waxes of S. vera, S. fruticosa and H. portulacoides, respectively. Attempts to link the occurrence of these chloroalkanes with other classes of leaf waxes (n-alkenes, n-aldehydes and n-alcohols) did not allowed a clear precursor-product relationship to be established. The biological functions as well as the mode of synthesis of alkylchlorides in (halophyte) plants remain unknown but undoubtedly deserve further attention.

Antimicrobial Resistance and Molecular Typing of Neisseria gonorrhoeae Isolates in Kyoto and Osaka, Japan, 2010 to 2012: Intensified Surveillance after Identification of the First Strain (H041) with High-Level Ceftriaxone Resistance

PubMed Central

Shimuta, Ken; Unemo, Magnus; Nakayama, Shu-ichi; Morita-Ishihara, Tomoko; Dorin, Misato; Kawahata, Takuya

2013-01-01

In 2009, the first high-level ceftriaxone-resistant Neisseria gonorrhoeae strain (H041) was isolated in Kyoto, Japan. The present study describes an intensified surveillance (antimicrobial resistance and molecular typing) of Neisseria gonorrhoeae isolates in Kyoto and its neighboring prefecture Osaka, Japan, in 2010 to 2012, which was initiated after the identification of H041. From April 2010 to March 2012, 193 N. gonorrhoeae isolates were collected and the MICs (μg/ml) to six antimicrobials, including ceftriaxone, were determined. All isolates showed susceptibility to ceftriaxone and cefixime (MIC values, <0.5 μg/ml), and spectinomycin. The rates of resistance (intermediate susceptibility) to azithromycin, penicillin G, and ciprofloxacin were 3.6% (19.7%), 24.4% (71.0%), and 78.2% (0.5%), respectively. Multilocus sequence typing (MLST) showed that 40.9%, 19.2%, and 17.1% of isolates belonged to ST1901, ST7359, and ST7363, respectively. Furthermore, N. gonorrhoeae multiantigen sequence typing (NG-MAST) revealed that 12 (63%) of the 19 isolates with decreased susceptibility to ceftriaxone (MIC > 0.064 μg/ml) were of ST1407. NG-MAST ST1407 was also the most prevalent ST (16.1%; 31 of 193 isolates). In those NG-MAST ST1407 strains, several mosaic type penA alleles were found, including SF-A type (penicillin binding protein 2 allele XXXIV) and its derivatives. These were confirmed using transformation of the penA mosaic alleles as critical determinants for enhanced cefixime and ceftriaxone MICs. The intensified surveillance in Kyoto and Osaka, Japan, did not identify any dissemination of the high-level ceftriaxone-resistant N. gonorrhoeae strain H041, suggesting that H041 might have caused only a sporadic case and has not spread further. PMID:23939890

Genetic variation in CDH13 gene was associated with non-small cell lung cancer (NSCLC): A population-based case-control study

PubMed Central

Li, Yingfu; Li, Chuanyin; Ma, Qianli; Zhang, Yu; Yao, Yueting; Liu, Shuyuan; Zhang, Xinwen; Hong, Chao; Tan, Fang; Shi, Li; Yao, Yufeng

2018-01-01

Cadherin 13 (CDH13, T-cadherin, H-cadherin) has been identified as an anti-oncogene in various cancers. Recent studies have reported that downregulation of H-cadherin in cancers is associated with CDH13 promoter hypermethylation, which could be affected by the single nucleotide polymorphisms (SNPs) near CpG sites in the CDH13 promoter. In the current study, we investigated and analyzed the association of seven SNPs (rs11646213, rs12596316, rs3865188, rs12444338, rs4783244, rs12051272 and rs7195409) with non-small cell lung cancer (NSCLC) using logistic regression analysis. SNPs rs11646213, rs12596316, rs3865188 and rs12444338 are located in the promoter region, rs4783244 and rs12051272 are located in intron 1, and rs7195409 is located in intron 7. A total of 454 patients with NSCLC were placed into a NSCLC group and 444 healthy controls were placed into a control group, all participants were recruited to genotype the SNPs using Taqman assay. Our results showed that the allelic frequencies of rs11646213 were significantly different between NSCLC and control groups (P = 0.006). In addition, the association analysis of these SNPs stratified into NSCLC pathologic stages I+II and III+IV showed that the allelic frequencies rs7195409 had a significant difference between NSCLC pathologic stages I+II and III+IV (P = 0.006). Our results indicated that the rs11646213 and rs7195409 in CDH13 could be associated with NSCLC or its pathologic stages in the Chinese Han population. PMID:29416663

Fragile X mental retardation 1 (FMR1) intron 1 methylation in blood predicts verbal cognitive impairment in female carriers of expanded FMR1 alleles: evidence from a pilot study.

PubMed

Godler, David E; Slater, Howard R; Bui, Quang M; Storey, Elsdon; Ono, Michele Y; Gehling, Freya; Inaba, Yoshimi; Francis, David; Hopper, John L; Kinsella, Glynda; Amor, David J; Hagerman, Randi J; Loesch, Danuta Z

2012-03-01

Cognitive status in females with mutations in the FMR1 (fragile X mental retardation 1) gene is highly variable. A biomarker would be of value for predicting which individuals were liable to develop cognitive impairment and could benefit from early intervention. A detailed analysis of CpG sites bridging exon 1 and intron 1 of FMR1, known as fragile X-related epigenetic element 2 (FREE2), suggests that a simple blood test could identify these individuals. Study participants included 74 control females (<40 CGG repeats), 62 premutation (PM) females (55-200 CGG repeats), and 18 full-mutation (FM) females assessed with Wechsler intelligence quotient (IQ) tests. We used MALDI-TOF mass spectrometry to determine the methylation status of FREE2 CpG sites that best identified low-functioning (IQ <70) FM females (>200 CGG repeats), compared the results with those for Southern blot FMR1 activation ratios, and related these assessments to the level of production of the FMR1 protein product in blood. A methylation analysis of intron 1 CpG sites 10-12 showed the highest diagnostic sensitivity (100%) and specificity (98%) of all the molecular measures tested for detecting females with a standardized verbal IQ of <70 among the study participants. In the group consisting of only FM females, methylation of these sites was significantly correlated with full-scale IQ, verbal IQ, and performance IQ. Several verbal subtest scores showed strong correlation with the methylation of these sites (P = 1.2 × 10(-5)) after adjustment for multiple measures. The data suggest that hypermethylation of the FMR1 intron 1 sites in blood is predictive of cognitive impairment in FM females, with implications for improved fragile X syndrome diagnostics in young children and screening of the newborn population.

Oral immunization with F4 fimbriae and CpG formulated with carboxymethyl starch enhances F4-specific mucosal immune response and modulates Th1 and Th2 cytokines in weaned pigs.

PubMed

Delisle, Benjamin; Calinescu, Carmen; Mateescu, Mircea Alexandru; Fairbrother, John Morris; Nadeau, Éric

2012-01-01

F4 fimbriae are a potential candidate for an oral subunit vaccine for prevention of post-weaning diarrhea in swine due to infection with F4-positive enterotoxigenic Escherichia coli. However, large quantities of F4 fimbriae are required to induce a specific antibody response. The aim of the present study was to evaluate the effect of supplementation of F4 fimbriae with Cytosine-phosphate-Guanosine-oligodeoxynucleotide (CpG-A D19) or with complete cholera toxin (CT) as adjuvants on the F4-specific antibody response and cytokine production in weaned pigs following oral administration of F4 fimbrial antigen formulated with Carboxymethyl Starch (CMS). Oral dosage forms of F4 fimbriae alone or supplemented with CpG-A D19 or with CT were formulated with CMS as monolithic tablets, obtained by direct compression, and administered to weaned pigs. Blood and faecal samples were collected to determine the systemic and mucosal immune status of animals at various times until necropsy. During necropsy, contents of the jejunum and ileum were collected for determination of mucosal F4 specific antibodies. Segments of jejunum and ileum were also used to measure mRNA cytokine production. The presence of CpG in the formulation of the fimbriae significantly increased F4-specific immunoglobulin (Ig) IgM and IgG levels in intestinal secretions, and enhanced Th1 (Interferon-gamma / IFN-γ, Tumour Necrosis Factor-alpha / TNF-α, Interleukin-12p40 / IL-12p40, IL-1β) and Th2 (IL-4, IL-6) cytokine production in intestinal tissues. Supplementation with CT did not result in induction of F4-specific antibodies in secretions, although a significant Th1 response (IFN-α, IFN-γ, IL-18) was detected in tissues. Neither F4-specific systemic antibodies, nor intestinally secreted IgA were detected throughout the immunization trial for all groups. CpG-A D19 appeared to be a promising adjuvant for an oral F4 subunit vaccine formulated with CMS excipient as monolithic tablets. This matrix afforded gastro-protection and delivered the F4 fimbriae at their intestinal sites.

The application of magnetic bead hybridization for the recovery and STR amplification of degraded and inhibited forensic DNA.

PubMed

Wang, Jing; McCord, Bruce

2011-06-01

A common problem in the analysis of forensic DNA evidence is the presence of environmentally degraded and inhibited DNA. Such samples produce a variety of interpretational problems such as allele imbalance, allele dropout and sequence specific inhibition. In an attempt to develop methods to enhance the recovery of this type of evidence, magnetic bead hybridization has been applied to extract and preconcentrate DNA sequences containing short tandem repeat (STR) alleles of interest. In this work, genomic DNA was fragmented by heating, and sequences associated with STR alleles were selectively hybridized to allele-specific biotinylated probes. Each particular biotinylated probe-DNA complex was bound to streptavidin-coated magnetic beads using enabling enrichment of target DNA sequences. Experiments conducted using degraded DNA samples, as well as samples containing a large concentration of inhibitory substances, showed good specificity and recovery of missing alleles. Based on the favorable results obtained with these specific probes, this method should prove useful as a tool to improve the recovery of alleles from degraded and inhibited DNA samples. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Regulation of ventral surface chemoreceptors by the central respiratory pattern generator.

PubMed

Guyenet, Patrice G; Mulkey, Daniel K; Stornetta, Ruth L; Bayliss, Douglas A

2005-09-28

The rat retrotrapezoid nucleus (RTN) contains neurons described as central chemoreceptors in the adult and respiratory rhythm-generating pacemakers in neonates [parafacial respiratory group (pfRG)]. Here we test the hypothesis that both RTN and pfRG neurons are intrinsically chemosensitive and tonically firing neurons whose respiratory rhythmicity is caused by a synaptic feedback from the central respiratory pattern generator (CPG). In halothane-anesthetized adults, RTN neurons were silent below 4.5% end-expiratory (e-exp) CO2. Their activity increased linearly (3.2 Hz/1% CO2) up to 6.5% (CPG threshold) and then more slowly to peak approximately 10 Hz at 10% CO2. Respiratory modulation of RTN neurons was absent below CPG threshold, gradually stronger beyond, and, like pfRG neurons, typically (42%) characterized by twin periods of reduced activity near phrenic inspiration. After CPG inactivation with kynurenate (KYN), RTN neurons discharged linearly as a function of e-exp CO2 (slope, +1.7 Hz/1% CO2) and arterial pH (threshold, 7.48; slope, 39 Hz/pH unit). In coronal brain slices (postnatal days 7-12), RTN chemosensitive neurons were silent at pH 7.55. Their activity increased linearly with acidification up to pH 7.2 (17 Hz/pH unit at 35 degrees C) and was always tonic. In conclusion, consistent with their postulated central chemoreceptor role, RTN/pfRG neurons encode pH linearly and discharge tonically when disconnected from the rest of the respiratory centers in vivo (KYN treatment) and in vitro. In vivo, RTN neurons receive respiratory synchronous inhibitory inputs that may serve as feedback and impart these neurons with their characteristic respiratory modulation.

[Allelic state of the molecular marker for the golden nematode (Globodera rostochiensis) resistance gene H1 among Ukrainian and world cultivars of potato (Solanum tuberosum ssp. tuberosum)].

PubMed

Karelov, A V; Pilipenko, L A; Kozub, N A; Bondus, R A; Borzykh, A U; Sozinov, I A; Blium, Ia B; Sozinov, A A

2013-01-01

The purpose of our investigation was determination of allelic state of the H1 resistance gene against the pathotypes Ro1 and Ro4 of golden potato cyst nematode (Globodera rostochiensis) among Ukrainian and world potato (Solanum tuberosum ssp. tuberosum) cultivars. The allelic condition of the TG689 marker was determined by PCR with DNA samples isolated from tubers of potato and primers, one pair of which flanks the allele-specific region and the other one was used for the control of DNA quality. Among analyzed 77 potato cultivars the allele of marker associated with the H1-type resistance was found in 74% of Ukrainian and 90% foreign ones although some of those cultivars proved to be susceptible to the golden potato nematode in field. The obtained data confirm the presence of H1-resistance against golden nematode pathotypes Ro1 and Ro4 among the Ukrainian potato cultivars and efficiency of the used marker within the accuracy that has been declared by its authors.

Extensive length variation in the ribosomal DNA intergenic spacer of yellow perch (Perca flavescens).

PubMed

Kakou, Bidénam; Angers, Bernard; Glémet, Hélène

2016-03-01

The intergenic spacer (IGS) is located between ribosomal RNA (rRNA) gene copies. Within the IGS, regulatory elements for rRNA gene transcription are found, as well as a varying number of other repetitive elements that are at the root of IGS length heterogeneity. This heterogeneity has been shown to have a functional significance through its effect on growth rate. Here, we present the structural organization of yellow perch (Perca flavescens) IGS based on its entire sequence, as well as the IGS length variation within a natural population. Yellow perch IGS structure has four discrete regions containing tandem repeat elements. For three of these regions, no specific length class was detected as allele size was seemingly normally distributed. However, for one repeat region, PCR amplification uncovered the presence of two distinctive IGS variants representing a length difference of 1116 bp. This repeat region was also devoid of any CpG sites despite a high GC content. Balanced selection may be holding the alleles in the population and would account for the high diversity of length variants observed for adjacent regions. Our study is an important precursor for further work aiming to assess the role of IGS length variation in influencing growth rate in fish.

Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

PubMed Central

Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

2014-01-01

Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

Use of DNA from human stools to detect aberrant CpG island methylation of genes implicated in colorectal cancer.

PubMed

Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T

2004-09-01

Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.

Identification and Evolution of Functional Alleles of the Previously Described Pollen Specific Myrosinase Pseudogene AtTGG6 in Arabidopsis thaliana.

PubMed

Fu, Lili; Han, Bingying; Tan, Deguan; Wang, Meng; Ding, Mei; Zhang, Jiaming

2016-02-22

Myrosinases are β-thioglucoside glucohydrolases and serve as defense mechanisms against insect pests and pathogens by producing toxic compounds. AtTGG6 in Arabidopsis thaliana was previously reported to be a myrosinase pseudogene but specifically expressed in pollen. However, we found that AlTGG6, an ortholog to AtTGG6 in A. lyrata (an outcrossing relative of A. thaliana) was functional, suggesting that functional AtTGG6 alleles may still exist in A. thaliana. AtTGG6 alleles in 29 A. thaliana ecotypes were cloned and sequenced. Results indicate that ten alleles were functional and encoded Myr II type myrosinase of 512 amino acids, and myrosinase activity was confirmed by overexpressing AtTGG6 in Pichia pastoris. However, the 19 other ecotypes had disabled alleles with highly polymorphic frame-shift mutations and diversified sequences. Thirteen frame-shift mutation types were identified, which occurred independently many times in the evolutionary history within a few thousand years. The functional allele was expressed specifically in pollen similar to the disabled alleles but at a higher expression level, suggesting its role in defense of pollen against insect pests such as pollen beetles. However, the defense function may have become less critical after A. thaliana evolved to self-fertilization, and thus resulted in loss of function in most ecotypes.

Signs of adaptation to local pH conditions across an environmental mosaic in the California Current Ecosystem.

PubMed

Pespeni, M H; Chan, F; Menge, B A; Palumbi, S R

2013-11-01

Little is known about the potential for rapid evolution in natural populations in response to the high rate of contemporary climatic change. Organisms that have evolved in environments that experience high variability across space and time are of particular interest as they may harbor genetic variation that can facilitate evolutionary response to changing conditions. Here we review what is known about genetic capacity for adaptation in the purple sea urchin, Strongylocentrotus purpuratus, a species that has evolved in the upwelling ecosystem of the Northeast Pacific Ocean. We also present new results testing for adaptation to local pH conditions in six populations from Oregon to southern California. We integrate data on 19,493 genetic polymorphisms with data on local pH conditions. We find correlations between allele frequency and rank average time spent at pH <7.8 in 318 single-nucleotide polymorphisms in 275 genes. Two of the genes most correlated with local pH are a protein associated with the cytoskeleton and a proton pump, with functional roles in maintenance of cell volume and with internal regulation of pH, respectively. Across all loci tested, high correlations with local pH were concentrated in genes related to transport of ions, biomineralization, lipid metabolism, and cell-cell adhesion, functional pathways important for maintaining homeostasis at low pH. We identify a set of seven genes as top candidates for rapid evolutionary response to acidification of the ocean. In these genes, the putative low-pH-adapted allele, based on allele frequencies in natural populations, rapidly increases in frequency in purple sea urchin larvae raised at low pH. We also found that populations from localities with high pH show a greater change in allele frequency toward putative low-pH-adapted alleles under experimental acidification, compared with low-pH populations, suggesting that both natural and artificial selection favor the same alleles for response to low pH. These results illustrate that purple sea urchins may be adapted to local pH and suggest that this species may possess the genetic capacity for rapid evolution in response to acidification. This adaptive capacity likely comes from standing genetic variation maintained in nature by balancing selection across the spatial and temporal environmental mosaic that characterizes the California Current Ecosystem.

Lead Exposure during Early Human Development and DNA Methylation of Imprinted Gene Regulatory Elements in Adulthood

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yue; Xie, Changchun; Murphy, Susan K.

Here, lead exposure during early development causes neurodevelopmental disorders by unknown mechanisms. Epidemiologic studies have focused recently on determining associations between lead exposure and global DNA methylation; however, such approaches preclude the identification of loci that may alter human disease risk. The objective of this study was to determine whether maternal, postnatal, and early childhood lead exposure can alter the differentially methylated regions (DMRs) that control the monoallelic expression of imprinted genes involved in metabolism, growth, and development. Questionnaire data and serial blood lead levels were obtained from 105 participants (64 females, 41 males) of the Cincinnati Lead Study frommore » birth to 78 months. When participants were adults, we used Sequenom EpiTYPER assays to test peripheral blood DNA to quantify CpG methylation in peripheral blood leukocytes at DMRs of 22 human imprinted genes. Statistical analyses were conducted using linear regression. Mean blood lead concentration from birth to 78 months was associated with a significant decrease in PEG3 DMR methylation (β = –0.0014; 95% CI: –0.0023, –0.0005, p = 0.002), stronger in males (β = –0.0024; 95% CI: –0.0038, –0.0009, p = 0.003) than in females (β = –0.0009; 95% CI: –0.0020, 0.0003, p = 0.1). Elevated mean childhood blood lead concentration was also associated with a significant decrease in IGF2/H19 (β = –0.0013; 95% CI: –0.0023, –0.0003, p = 0.01) DMR methylation, but primarily in females, (β = –0.0017; 95% CI: –0.0029, –0.0006, p = 0.005) rather than in males, (β = –0.0004; 95% CI: –0.0023, 0.0015, p = 0.7). Elevated blood lead concentration during the neonatal period was associated with higher PLAGL1/HYMAI DMR methylation regardless of sex (β = 0.0075; 95% CI: 0.0018, 0.0132, p = 0.01). The magnitude of associations between cumulative lead exposure and CpG methylation remained unaltered from 30 to 78 months. Our findings provide evidence that early childhood lead exposure results in sexdependent and gene-specific DNA methylation differences in the DMRs of PEG3, IGF2/H19, and PLAGL1/HYMAI in adulthood.« less

Lead Exposure during Early Human Development and DNA Methylation of Imprinted Gene Regulatory Elements in Adulthood

DOE PAGES

Li, Yue; Xie, Changchun; Murphy, Susan K.; ...

2015-06-26

Here, lead exposure during early development causes neurodevelopmental disorders by unknown mechanisms. Epidemiologic studies have focused recently on determining associations between lead exposure and global DNA methylation; however, such approaches preclude the identification of loci that may alter human disease risk. The objective of this study was to determine whether maternal, postnatal, and early childhood lead exposure can alter the differentially methylated regions (DMRs) that control the monoallelic expression of imprinted genes involved in metabolism, growth, and development. Questionnaire data and serial blood lead levels were obtained from 105 participants (64 females, 41 males) of the Cincinnati Lead Study frommore » birth to 78 months. When participants were adults, we used Sequenom EpiTYPER assays to test peripheral blood DNA to quantify CpG methylation in peripheral blood leukocytes at DMRs of 22 human imprinted genes. Statistical analyses were conducted using linear regression. Mean blood lead concentration from birth to 78 months was associated with a significant decrease in PEG3 DMR methylation (β = –0.0014; 95% CI: –0.0023, –0.0005, p = 0.002), stronger in males (β = –0.0024; 95% CI: –0.0038, –0.0009, p = 0.003) than in females (β = –0.0009; 95% CI: –0.0020, 0.0003, p = 0.1). Elevated mean childhood blood lead concentration was also associated with a significant decrease in IGF2/H19 (β = –0.0013; 95% CI: –0.0023, –0.0003, p = 0.01) DMR methylation, but primarily in females, (β = –0.0017; 95% CI: –0.0029, –0.0006, p = 0.005) rather than in males, (β = –0.0004; 95% CI: –0.0023, 0.0015, p = 0.7). Elevated blood lead concentration during the neonatal period was associated with higher PLAGL1/HYMAI DMR methylation regardless of sex (β = 0.0075; 95% CI: 0.0018, 0.0132, p = 0.01). The magnitude of associations between cumulative lead exposure and CpG methylation remained unaltered from 30 to 78 months. Our findings provide evidence that early childhood lead exposure results in sexdependent and gene-specific DNA methylation differences in the DMRs of PEG3, IGF2/H19, and PLAGL1/HYMAI in adulthood.« less

Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

PubMed Central

Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

2013-01-01

Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

Probing chromatin structure with nuclease sensitivity assays.

PubMed

Gregory, R I; Khosla, S; Feil, R

2001-01-01

To further our understanding of genomic imprinting it will be essential to identify key control elements, and to investigate their regulation by both epigenetic modifications (such as DNA methylation) and trans-acting factors. So far, sequence elements that regulate parental allele-specific gene expression have been identified in a number of imprinted loci, either because of their differential DNA methylation or through functional studies in transgenic mice (1,2). A systematic search for allele-specific chromatin features constitutes an alternative strategy to identify elements that regulate imprinting. The validity of such an in vivo chromatin approach derives from the fact that in several known imprinting control-elements, a specialized organization of chromatin characterized by nuclease hypersensitivity is present on only one of the two parental chromosome (3). For example, the differentially methylated 5 -portion of the human SNRPN gene-a sequence element that controls imprinting in the Prader-Willi and Angelman syndromes' domain on chromosome 15q11- q13-has strong DNase-I hypersensitive sites on the unmethylated paternal chromosome (4). A differentially methylated region that regulates the imprinting of H19 and that of the neighboring insulin-like growth factor-2 gene on mouse chromosome 7 was also found to have parental chromosome-specific hypersensitive sites (5,6). The precise nature of the allelic nuclease hypersensitivity in these and other imprinted loci remains to be determined in more detail, for example, by applying complementary chromatin methodologies (7,8). However, it is commonly observed that a nuclease hypersensitive site corresponds to a small region where nucleosomes are absent or partially disrupted.

Developing prehospital clinical practice guidelines for resource limited settings: why re-invent the wheel?

PubMed

McCaul, Michael; de Waal, Ben; Hodkinson, Peter; Pigoga, Jennifer L; Young, Taryn; Wallis, Lee A

2018-02-05

Methods on developing new (de novo) clinical practice guidelines (CPGs) have received substantial attention. However, the volume of literature is not matched by research into alternative methods of CPG development using existing CPG documents-a specific issue for guideline development groups in low- and middle-income countries. We report on how we developed a context specific prehospital CPG using an alternative guideline development method. Difficulties experienced and lessons learnt in applying existing global guidelines' recommendations to a national context are highlighted. The project produced the first emergency care CPG for prehospital providers in Africa. It included > 270 CPGs and produced over 1000 recommendations for prehospital emergency care. We encountered various difficulties, including (1) applicability issues: few pre-hospital CPGs applicable to Africa, (2) evidence synthesis: heterogeneous levels of evidence classifications and (3) guideline quality. Learning points included (1) focusing on key CPGs and evidence mapping, (2) searching other resources for CPGs, (3) broad representation on CPG advisory boards and (4) transparency and knowledge translation. Re-inventing the wheel to produce CPGs is not always feasible. We hope this paper will encourage further projects to use existing CPGs in developing guidance to improve patient care in resource-limited settings.

Encapsulating Immunostimulatory CpG Oligonucleotides in Listeriolysin O-Liposomes Promotes a Th1-Type Response and CTL Activity

PubMed Central

Andrews, Chasity D.; Huh, Myung-Sook; Patton, Kathryn; Higgins, Debbie; Van Nest, Gary; Ott, Gary; Lee, Kyung-Dall

2013-01-01

Immunostimulatory sequences (ISS) are short DNA sequences containing unmethylated CpG dimers that have multiple effects on the host immune system, including the ability to stimulate antigen-specific cytotoxic T lymphocytes (CTLs) and drive Th1-type immune responses. Listeriolysin O (LLO)-containing pH-sensitive liposomes have been shown to efficiently deliver macromolecules to the cytosol of APCs and efficiently stimulate CTLs. We hypothesized that encapsulating ISS-oligodeoxyribonucleotides (ODNs) in this delivery system would enhance the cell-mediated immune response and skew Th1-type responses in protein antigen-based vaccination utilizing LLO-liposomes. In vitro studies indicated that co-encapsulation of ISS in LLO-liposomes engendered activation of the NF-κB pathway while maintaining the efficient cytosolic delivery of antigen mediated by the co-encapsulated LLO. Antigen-specific CTL responses monitored by using the model antigen ovalbumin (OVA) in mice were enhanced when mice were immunized with OVA and ISS-ODN-containing LLO-liposomes compared with those immunized with either OVA-containing LLO-liposomes or OVA-ISS conjugates. The enhanced immune responses were of the Th1-type as monitored by the robust OVA-specific IgG2a induction and the OVA CD8 peptide-stimulated IFN-γ secretion. Our study suggests that including ISS-ODN in LLO-containing pH-sensitive liposomes yields a vaccine delivery system that enhances the cell-mediated immune response and skews this response toward the Th1-type. PMID:22376145

No association of CpG island methylator phenotype and colorectal cancer survival: population-based study

PubMed Central

Jia, Min; Jansen, Lina; Walter, Viola; Tagscherer, Katrin; Roth, Wilfried; Herpel, Esther; Kloor, Matthias; Bläker, Hendrik; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael

2016-01-01

Background: Previous studies have shown adverse effects of CpG island methylator phenotype (CIMP) on colorectal cancer (CRC) prognosis. However, sample sizes were often limited and only few studies were able to adjust for relevant molecular features associated with CIMP. The aim of this study was to investigate the impact of CIMP on CRC survival in a large population-based study with comprehensive adjustment. Methods: The CIMP status and other molecular tumour features were analysed in 1385 CRC patients diagnosed between 2003 and 2010. Detailed information were obtained from standardised personal interviews and medical records. During follow-up (median: 4.9 years), we assessed vital status, cause of death and therapy details. Cox proportional hazard regression models were used to estimate adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of survival after CRC. Results: The CIMP-H occurred more frequently in patients with older age, female gender, cancer in the proximal colon, BRAF mutation and microsatellite instability-high (MSI-H). However, CIMP status was not associated with CRC prognosis in CRC patients (HR=1.00; 95% CI=0.72–1.40 for overall survival; HR=0.96; 95% CI=0.65–1.41 for disease-specific survival) or in any of the subgroups. Although CIMP status was associated with the presence of MSI-H and BRAF mutation, the prognostic effects of MSI-H (HR=0.49; 95% CI=0.27–0.90) and BRAF mutation (HR=1.78; 95% CI=1.10–2.84) were independent of CIMP status. Similar benefit of chemotherapy was found for CRC outcomes in both the CIMP-low/negative group and the CIMP-high group. Conclusions: CpG island methylator phenotype was not associated with CRC prognosis after adjusting for other important clinical factors and associated mutations. PMID:27811854

Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

PubMed Central

Scheiermann, Julia; Klinman, Dennis M.

2014-01-01

Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

Transcultural Endocrinology: Adapting Type-2 Diabetes Guidelines on a Global Scale.

PubMed

Nieto-Martínez, Ramfis; González-Rivas, Juan P; Florez, Hermes; Mechanick, Jeffrey I

2016-12-01

Type-2 diabetes (T2D) needs to be prevented and treated effectively to reduce its burden and consequences. White papers, such as evidence-based clinical practice guidelines (CPG) and their more portable versions, clinical practice algorithms and clinical checklists, may improve clinical decision-making and diabetes outcomes. However, CPG are underused and poorly validated. Protocols that translate and implement these CPG are needed. This review presents the global dimension of T2D, details the importance of white papers in the transculturalization process, compares relevant international CPG, analyzes cultural variables, and summarizes translation strategies that can improve care. Specific protocols and algorithmic tools are provided. Copyright © 2016 Elsevier Inc. All rights reserved.

Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

PubMed

Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

2010-08-01

Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles.

PubMed

Aiba, Toshiki; Saito, Toshiyuki; Hayashi, Akiko; Sato, Shinji; Yunokawa, Harunobu; Maruyama, Toru; Fujibuchi, Wataru; Kurita, Hisaka; Tohyama, Chiharu; Ohsako, Seiichiroh

2017-03-09

It has been pointed out that environmental factors or chemicals can cause diseases that are developmental in origin. To detect abnormal epigenetic alterations in DNA methylation, convenient and cost-effective methods are required for such research, in which multiple samples are processed simultaneously. We here present methylated site display (MSD), a unique technique for the preparation of DNA libraries. By combining it with amplified fragment length polymorphism (AFLP) analysis, we developed a new method, MSD-AFLP. Methylated site display libraries consist of only DNAs derived from DNA fragments that are CpG methylated at the 5' end in the original genomic DNA sample. To test the effectiveness of this method, CpG methylation levels in liver, kidney, and hippocampal tissues of mice were compared to examine if MSD-AFLP can detect subtle differences in the levels of tissue-specific differentially methylated CpGs. As a result, many CpG sites suspected to be tissue-specific differentially methylated were detected. Nucleotide sequences adjacent to these methyl-CpG sites were identified and we determined the methylation level by methylation-sensitive restriction endonuclease (MSRE)-PCR analysis to confirm the accuracy of AFLP analysis. The differences of the methylation level among tissues were almost identical among these methods. By MSD-AFLP analysis, we detected many CpGs showing less than 5% statistically significant tissue-specific difference and less than 10% degree of variability. Additionally, MSD-AFLP analysis could be used to identify CpG methylation sites in other organisms including humans. MSD-AFLP analysis can potentially be used to measure slight changes in CpG methylation level. Regarding the remarkable precision, sensitivity, and throughput of MSD-AFLP analysis studies, this method will be advantageous in a variety of epigenetics-based research.

Assessing the efficacy of Duddingtonia flagrans chlamydospores per gram of faeces to control Haemonchus contortus larvae.

PubMed

Ojeda-Robertos, Nadia Florencia; Torres-Acosta, Juan Felipe de Jesus; Aguilar-Caballero, Armando Jacinto; Ayala-Burgos, Armín; Cob-Galera, Ligia Amira; Sandoval-Castro, Carlos Alfredo; Barrientos-Medina, Roberto Carlos; de Gives, Pedro Mendoza

2008-12-20

The aims were (a) to quantify the number of Duddingtonia flagrans chlamydospores per gram of faeces (CPG) recovered from sheep administered with different oral doses and, (b) to describe the relationship between CPG and eggs per gram of faeces (EPG) on the efficacy to reduce Haemonchus contortus infective larvae. Three doses of chlamydospores per kg BW were orally administered during seven days: (T1) non treated control group, (T2) 1 x 10(6), (T3) 2.5 x 10(6) and (T4) 5 x 10(6). Three lambs, infected with H. contortus, were used per group. Faeces were obtained from the rectum of each lamb during the fungal administration period (days 0-6) and for six days after that period. Four coproculture replicates were made from each animal in days 2, 4, 6, 8 and 10. A higher chlamydospore dose produced higher CPG in faeces (p < 0.05), but a clear dose dependent effect was not found either in the larvae reduction or in the CPG:EPG ratio. When ratios were re-analyzed, independently of the treatment groups of origin, a better efficacy was obtained with a ratio from 5 to 10 CPG:EPG and a higher ratio (> 10 per egg) showed a lower reduction efficacy (p < 0.05). The binomial analysis showed that for each unit of increment in CPG:EPG ratio there was a reduction of larvae number until a point (between 5 and 10 CPG:EPG) where no further reduction was detected. The surface response test indicated that the number of larvae was reduced by CPG until possible saturation. The highest CPG:EPG ratios did not necessarily improve efficacy of D. flagrans.

Multiple Nucleosome Positioning Sites Regulate the CTCF-Mediated Insulator Function of the H19 Imprinting Control Region†

PubMed Central

Kanduri, Meena; Kanduri, Chandrasekhar; Mariano, Piero; Vostrov, Alexander A.; Quitschke, Wolfgang; Lobanenkov, Victor; Ohlsson, Rolf

2002-01-01

The 5′ region of the H19 gene harbors a methylation-sensitive chromatin insulator within an imprinting control region (ICR). Insertional mutagenesis in combination with episomal assays identified nucleosome positioning sequences (NPSs) that set the stage for the remarkably precise distribution of the four target sites for the chromatin insulator protein CTCF to nucleosome linker sequences in the H19 ICR. Changing positions of the NPSs resulted in loss of both CTCF target site occupancy and insulator function, suggesting that the NPSs optimize the fidelity of the insulator function. We propose that the NPSs ensure the fidelity of the repressed status of the maternal Igf2 allele during development by constitutively maintaining availability of the CTCF target sites. PMID:11971967

Spatiotemporal clustering of the epigenome reveals rules of dynamic gene regulation

PubMed Central

Yu, Pengfei; Xiao, Shu; Xin, Xiaoyun; Song, Chun-Xiao; Huang, Wei; McDee, Darina; Tanaka, Tetsuya; Wang, Ting; He, Chuan; Zhong, Sheng

2013-01-01

Spatial organization of different epigenomic marks was used to infer functions of the epigenome. It remains unclear what can be learned from the temporal changes of the epigenome. Here, we developed a probabilistic model to cluster genomic sequences based on the similarity of temporal changes of multiple epigenomic marks during a cellular differentiation process. We differentiated mouse embryonic stem (ES) cells into mesendoderm cells. At three time points during this differentiation process, we used high-throughput sequencing to measure seven histone modifications and variants—H3K4me1/2/3, H3K27ac, H3K27me3, H3K36me3, and H2A.Z; two DNA modifications—5-mC and 5-hmC; and transcribed mRNAs and noncoding RNAs (ncRNAs). Genomic sequences were clustered based on the spatiotemporal epigenomic information. These clusters not only clearly distinguished gene bodies, promoters, and enhancers, but also were predictive of bidirectional promoters, miRNA promoters, and piRNAs. This suggests specific epigenomic patterns exist on piRNA genes much earlier than germ cell development. Temporal changes of H3K4me2, unmethylated CpG, and H2A.Z were predictive of 5-hmC changes, suggesting unmethylated CpG and H3K4me2 as potential upstream signals guiding TETs to specific sequences. Several rules on combinatorial epigenomic changes and their effects on mRNA expression and ncRNA expression were derived, including a simple rule governing the relationship between 5-hmC and gene expression levels. A Sox17 enhancer containing a FOXA2 binding site and a Foxa2 enhancer containing a SOX17 binding site were identified, suggesting a positive feedback loop between the two mesendoderm transcription factors. These data illustrate the power of using epigenome dynamics to investigate regulatory functions. PMID:23033340

Region of interest methylation analysis: a comparison of MSP with MS-HRM and direct BSP.

PubMed

Akika, Reem; Awada, Zainab; Mogharbil, Nahed; Zgheib, Nathalie K

2017-07-01

The aim of this study was to compare and contrast three DNA methylation methods of a specific region of interest (ROI): methylation-specific PCR (MSP), methylation-sensitive high resolution melting (MS-HRM) and direct bisulfite sequencing (BSP). The methylation of a CpG area in the promoter region of Estrogen receptor alpha (ESR1) was evaluated by these three methods with samples and standards of different methylation percentages. MSP data were neither reproducible nor sensitive, and the assay was not specific due to non-specific binding of primers. MS-HRM was highly reproducible and a step forward into categorizing the methylation status of the samples as percent ranges. Direct BSP was the most informative method regarding methylation percentage of each CpG site. Though not perfect, it was reproducible and sensitive. We recommend the use of either method depending on the research question and target amplicon, and provided that the designed primers and expected amplicons are within recommendations. If the research question targets a limited number of CpG sites and simple yes/no results are enough, MSP may be attempted. For short amplicons that are crowded with CpG sites and of single melting domain, MS-HRM may be the method of choice though it only indicates the overall methylation percentage of the entire amplicon. Although the assay is highly reproducible, being semi-quantitative makes it of lesser interest to study ROI methylation of samples with little methylation differences. Direct BSP is a step forward as it gives information about the methylation percentage at each CpG site.

A Hybrid Approach for CpG Island Detection in the Human Genome.

PubMed

Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

2016-01-01

CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

Variant-specific quantification of factor H in plasma reveals null alleles associated with atypical hemolytic uremic syndrome

PubMed Central

Hakobyan, Svetlana; Tortajada, Agustín; Harris, Claire L.; de Córdoba, Santiago Rodríguez; Morgan, B. Paul

2011-01-01

Atypical hemolytic uremic syndrome (aHUS) associates with complement alternative pathway defects in over 50% of cases. Mutations in factor H (fH) are most common, usually point mutations affecting complement surface regulation and sometimes null mutations in heterozygosity. The latter are difficult to identify; although consistently low plasma fH concentration is suggestive, definitive proof has required the demonstration that the mutant sequence does not express in vitro. Here, novel reagents and assays that distinguish and individually quantify the common fH-Y402H polymorphic variants were used to identify alleles of the CFH gene resulting in low or no (‘null’) expression of full-length fH, but normal or increased expression of the alternative splice product FHL-1, also detected in these assays. Their use in an aHUS cohort identified three Y402H heterozygotes with low or absent fH-H402 but normal or increased FHL-1 levels. Novel mutations in heterozygosis explained the null phenotype in two cases, confirmed by family studies in one. In the third case, family studies showed that a known mutation was present on the Y allele; the cause of the reduced expression of H allele was not found, although data suggested altered fH/FHL-1 splicing. In each family, inheritance of “low expression” or “null” alleles for fH strongly associated with aHUS. These assays provide a rapid means to identify fH expression defects in aHUS without resorting to gene sequencing or expression analysis. PMID:20703214

Genetic and epigenetic alteration of the NF2 gene in sporadic meningiomas.

PubMed

Lomas, Jesus; Bello, M Josefa; Arjona, Dolores; Alonso, M Eva; Martinez-Glez, Victor; Lopez-Marin, Isabel; Amiñoso, Cinthia; de Campos, Jose M; Isla, Alberto; Vaquero, Jesus; Rey, Juan A

2005-03-01

The role of the NF2 gene in the development of meningiomas has recently been documented; inactivating mutations plus allelic loss at 22q, the site of this gene (at 22q12), have been identified in both sporadic and neurofibromatosis type 2-associated tumors. Although epigenetic inactivation through aberrant CpG island methylation of the NF2 5' flanking region has been documented in schwannoma (another NF2-associated neoplasm), data on participation of this epigenetic modification in meningiomas are not yet widely available. Using methylation-specific PCR (MSP) plus sequencing, we assessed the presence of aberrant promoter NF2 methylation in a series of 88 meningiomas (61 grade I, 24 grade II, and 3 grade III), in which the allelic constitution at 22q and the NF2 mutational status also were determined by RFLP/microsatellite and PCR-SSCP analyses. Chromosome 22 allelic loss, NF2 gene mutation, and aberrant NF2 promoter methylation were detected in 49%, 24%, and 26% of cases, respectively. Aberrant NF2 methylation with loss of heterozygosity (LOH) at 22q was found in five cases, and aberrant methylation with NF2 mutation in another; LOH 22q and the mutation were found in 16 samples. The aberrant methylation of the NF2 gene also was the sole alteration in 15 samples, most of which were from grade I tumors. These results indicate that aberrant NF2 hypermethylation may participate in the development of a significant proportion of sporadic meningiomas, primarily those of grade I.

Immunoglobulin Heavy Chain Exclusion in the Shark

PubMed Central

Malecek, Karolina; Lee, Victor; Feng, Wendy; Huang, Jing Li; Flajnik, Martin F; Ohta, Yuko; Hsu, Ellen

2008-01-01

The adaptive immune system depends on specific antigen receptors, immunoglobulins (Ig) in B lymphocytes and T cell receptors (TCR) in T lymphocytes. Adaptive responses to immune challenge are based on the expression of a single species of antigen receptor per cell; and in B cells, this is mediated in part by allelic exclusion at the Ig heavy (H) chain locus. How allelic exclusion is regulated is unclear; we considered that sharks, the oldest vertebrates possessing the Ig/TCR-based immune system, would yield insights not previously approachable and reveal the primordial basis of the regulation of allelic exclusion. Sharks have an IgH locus organization consisting of 15–200 independently rearranging miniloci (VH-D1-D2-JH-Cμ), a gene organization that is considered ancestral to the tetrapod and bony fish IgH locus. We found that rearrangement takes place only within a minilocus, and the recombining gene segments are assembled simultaneously and randomly. Only one or few H chain genes were fully rearranged in each shark B cell, whereas the other loci retained their germline configuration. In contrast, most IgH were partially rearranged in every thymocyte (developing T cell) examined, but no IgH transcripts were detected. The distinction between B and T cells in their IgH configurations and transcription reveals a heretofore unsuspected chromatin state permissive for rearrangement in precursor lymphocytes, and suggests that controlled limitation of B cell lineage-specific factors mediate regulated rearrangement and allelic exclusion. This regulation may be shared by higher vertebrates in which additional mechanistic and regulatory elements have evolved with their structurally complex IgH locus. PMID:18578572

GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

PubMed

Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

2017-05-24

As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

Association between DNA Methylation in Whole Blood and Measures of Glucose Metabolism: KORA F4 Study

PubMed Central

Wahl, Simone; Kunze, Sonja; Molnos, Sophie; Volkova, Nadezda; Schramm, Katharina; Carstensen-Kirberg, Maren; Waldenberger, Melanie; Gieger, Christian; Peters, Annette; Illig, Thomas; Prokisch, Holger; Roden, Michael; Grallert, Harald

2016-01-01

Epigenetic regulation has been postulated to affect glucose metabolism, insulin sensitivity and the risk of type 2 diabetes. Therefore, we performed an epigenome-wide association study for measures of glucose metabolism in whole blood samples of the population-based Cooperative Health Research in the Region of Augsburg F4 study using the Illumina HumanMethylation 450 BeadChip. We identified a total of 31 CpG sites where methylation level was associated with measures of glucose metabolism after adjustment for age, sex, smoking, and estimated white blood cell proportions and correction for multiple testing using the Benjamini-Hochberg (B-H) method (four for fasting glucose, seven for fasting insulin, 25 for homeostasis model assessment-insulin resistance [HOMA-IR]; B-H-adjusted p-values between 9.2x10-5 and 0.047). In addition, DNA methylation at cg06500161 (annotated to ABCG1) was associated with all the aforementioned phenotypes and 2-hour glucose (B-H-adjusted p-values between 9.2x10-5 and 3.0x10-3). Methylation status of additional three CpG sites showed an association with fasting insulin only after additional adjustment for body mass index (BMI) (B-H-adjusted p-values = 0.047). Overall, effect strengths were reduced by around 30% after additional adjustment for BMI, suggesting that this variable has an influence on the investigated phenotypes. Furthermore, we found significant associations between methylation status of 21 of the aforementioned CpG sites and 2-hour insulin in a subset of samples with seven significant associations persisting after additional adjustment for BMI. In a subset of 533 participants, methylation of the CpG site cg06500161 (ABCG1) was inversely associated with ABCG1 gene expression (B-H-adjusted p-value = 1.5x10-9). Additionally, we observed an enrichment of the top 1,000 CpG sites for diabetes-related canonical pathways using Ingenuity Pathway Analysis. In conclusion, our study indicates that DNA methylation and diabetes-related traits are associated and that these associations are partially BMI-dependent. Furthermore, the interaction of ABCG1 with glucose metabolism is modulated by epigenetic processes. PMID:27019061

Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

PubMed

Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

2014-10-20

The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

Methyl-Cytosine-Driven Structural Changes Enhance Adduction Kinetics of an Exon 7 fragment of the p53 Gene

NASA Astrophysics Data System (ADS)

Malla, Spundana; Kadimisetty, Karteek; Fu, You-Jun; Choudhary, Dharamainder; Schenkman, John B.; Rusling, James F.

2017-01-01

Methylation of cytosine (C) at C-phosphate-guanine (CpG) sites enhances reactivity of DNA towards electrophiles. Mutations at CpG sites on the p53 tumor suppressor gene that can result from these adductions are in turn correlated with specific cancers. Here we describe the first restriction-enzyme-assisted LC-MS/MS sequencing study of the influence of methyl cytosines (MeC) on kinetics of p53 gene adduction by model metabolite benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), using methodology applicable to correlate gene damage sites for drug and pollutant metabolites with mutation sites. This method allows direct kinetic measurements by LC-MS/MS sequencing for oligonucleotides longer than 20 base pairs (bp). We used MeC and non-MeC (C) versions of a 32 bp exon 7 fragment of the p53 gene. Methylation of 19 cytosines increased the rate constant 3-fold for adduction on G at the major reactive CpG in codon 248 vs. the non-MeC fragment. Rate constants for non-CpG codons 244 and 243 were not influenced significantly by MeC. Conformational and hydrophobicity changes in the MeC-p53 exon 7 fragment revealed by CD spectra and molecular modeling increase the BPDE binding constant to G in codon 248 consistent with a pathway in which preceding reactant binding greatly facilitates the rate of covalent SN2 coupling.

Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

PubMed

Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

2017-08-07

Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.

Regulation of the mouse Treacher Collins syndrome homolog (Tcof1) promoter through differential repression of constitutive expression.

PubMed

Shows, Kathryn H; Shiang, Rita

2008-11-01

Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell-specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell-specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from -253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter.

Allele-Specific Inhibition of Rhodopsin With an Antisense Oligonucleotide Slows Photoreceptor Cell Degeneration

PubMed Central

Murray, Susan F.; Jazayeri, Ali; Matthes, Michael T.; Yasumura, Douglas; Yang, Haidong; Peralta, Raechel; Watt, Andy; Freier, Sue; Hung, Gene; Adamson, Peter S.; Guo, Shuling; Monia, Brett P.; LaVail, Matthew M.; McCaleb, Michael L.

2015-01-01

Purpose To preserve photoreceptor cell structure and function in a rodent model of retinitis pigmentosa with P23H rhodopsin by selective inhibition of the mutant rhodopsin allele using a second generation antisense oligonucleotide (ASO). Methods Wild-type mice and rats were treated with ASO by intravitreal (IVT) injection and rhodopsin mRNA and protein expression were measured. Transgenic rats expressing the murine P23H rhodopsin gene (P23H transgenic rat Line 1) were administered either a mouse-specific P23H ASO or a control ASO. The contralateral eye was injected with PBS and used as a comparator control. Electroretinography (ERG) measurements and analyses of the retinal outer nuclear layer were conducted and correlated with rhodopsin mRNA levels. Results Rhodopsin mRNA and protein expression was reduced after a single ASO injection in wild-type mice with a rhodopsin-specific ASO. Transgenic rat eyes that express a murine P23H rhodopsin gene injected with a murine P23H ASO had a 181 ± 39% better maximum amplitude response (scotopic a-wave) as compared with contralateral PBS-injected eyes; the response in control ASO eyes was not significantly different from comparator contralateral eyes. Morphometric analysis of the outer nuclear layer showed a significantly thicker nuclear layer in eyes injected with murine P23H ASO (18%) versus contralateral PBS-injected eyes. Conclusions Allele-specific ASO-mediated knockdown of mutant P23H rhodopsin expression slowed the rate of photoreceptor degeneration and preserved the function of photoreceptor cells in eyes of the P23H rhodopsin transgenic rat. Our data indicate that ASO treatment is a potentially effective therapy for the treatment of retinitis pigmentosa. PMID:26436889

Reduced-Function CYP2C19 Genotype and Risk of Adverse Clinical Outcomes Among Patients Treated With Clopidogrel Predominantly for PCI: A Meta-Analysis

PubMed Central

Mega, Jessica L.; Simon, Tabassome; Collet, Jean-Philippe; Anderson, Jeffrey L.; Antman, Elliott M.; Bliden, Kevin; Cannon, Christopher P.; Danchin, Nicolas; Giusti, Betti; Gurbel, Paul; Horne, Benjamin D.; Hulot, Jean-Sebastian; Kastrati, Adnan; Montalescot, Gilles; Neumann, Franz-Josef; Shen, Lei; Sibbing, Dirk; Steg, P. Gabriel; Trenk, Dietmar; Wiviott, Stephen D.; Sabatine, Marc S.

2011-01-01

Content Clopidogrel, one of the most commonly prescribed medications, is a pro-drug requiring CYP450 biotransformation. Data suggest its pharmacologic effect varies based on CYP2C19 genotype, but there is uncertainty regarding the clinical risk imparted by specific genotypes. Objective In patients treated with clopidogrel, to define the risk of major adverse cardiovascular outcomes among carriers of one (∼26% prevalence in whites) and carriers of two (∼2% prevalence in whites) reduced-function CYP2C19 variants. Data Sources and Study Selection A literature search was conducted (January 2000-August 2010) of the MEDLINE, Cochrane, and EMBASE databases. Genetic studies were included where clopidogrel was initiated in predominantly invasively managed patients in a manner consistent with the current guideline recommendations and where clinical outcomes were ascertained. Data Extraction Investigators from nine studies evaluating CYP2C19 genotype and clinical outcomes in patients treated with clopidogrel contributed the relevant hazard ratios (HRs) and their 95% confidence intervals (CI) for specific cardiovascular outcomes by genotype. Results Among 9685 patients [91.3% of whom underwent percutaneous coronary intervention (PCI) and 54.5% of whom had an acute coronary syndrome (ACS)], 863 experienced the composite endpoint of cardiovascular death, myocardial infarction, or stroke; 84 patients had stent thrombosis among the 5894 evaluated for such. Overall, 71.5% were non-carriers, 26.3% had one, and 2.2% had two CYP2C19 reduced-function alleles. A significantly increased risk of the composite endpoint was evident in both carriers of one (HR 1.55, 95% CI 1.11-2.27, P=0.01) and two (HR 1.76, 95% CI 1.24-2.50, P=0.002) CYP2C19 reduced-function alleles. Similarly, there was a significantly increased risk of stent thrombosis in both carriers of one (HR 2.67, 95% CI 1.69-4.22, P<0.0001) and two (HR 3.97, 95% CI 1.75-9.02, P=0.001) CYP2C19 reduced-function alleles. Conclusion Among patients treated with clopidogrel for PCI, carriage of even one reduced-function CYP2C19 allele appears to be associated with a significantly increased risk of major adverse cardiovascular events, particularly stent thrombosis. PMID:20978260

The AIRE -230Y Polymorphism Affects AIRE Transcriptional Activity: Potential Influence on AIRE Function in the Thymus.

PubMed

Lovewell, Thomas R J; McDonagh, Andrew J; Messenger, Andrew G; Azzouz, Mimoun; Tazi-Ahnini, Rachid

2015-01-01

The autoimmune regulator (AIRE) is expressed in the thymus, particularly in thymic medullary epithelial cells (mTECs), and is required for the ectopic expression of a diverse range of peripheral tissue antigens by mTECs, facilitating their ability to perform negative selection of auto-reactive immature T-cells. The expression profile of peripheral tissue antigens is affected not only by AIRE deficiency but also with variation of AIRE activity in the thymus. Therefore we screened 591bp upstream of the AIRE transcription start site including AIRE minimal promoter for single nucleotide polymorphism (SNPs) and identified two SNPs -655R (rs117557896) and -230Y (rs751032) respectively. To study the effect of these variations on AIRE promoter activity we generated a Flp-In host cell line which was stably transfected with a single copy of the reporter vector. Relative promoter activity was estimated by comparing the luciferase specific activity for lysates of the different reporter AIRE promoter-reporter gene constructs including AIRE-655G AIRE-230C, AIRE-655G AIRE-230T and AIRE-655A AIRE-230C. The analysis showed that the commonest haplotype AIRE-655G AIRE-230C has the highest luciferase specific activity (p<0.001). Whereas AIRE-655G AIRE-230T has a luciferase specific activity value that approaches null. Both AIRE promoter polymorphic sites have one allele that forms a CpG methylation site which we determined can be methylated in methylation assays using the M.SssI CpG methyltransferase. AIRE-230Y is in a conserved region of the promoter and is adjacent to a predicted WT1 transcription factor binding site, suggesting that AIRE-230Y affects AIRE expression by influencing the binding of biochemical factors to this region. Our findings show that AIRE-655GAIRE-230T haplotype could dramatically alter AIRE transcription and so have an effect on the process of negative selection and affect susceptibility to autoimmune conditions.

A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro

PubMed Central

2013-01-01

Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769

Developmentally Programmed 3′ CpG Island Methylation Confers Tissue- and Cell-Type-Specific Transcriptional Activation

PubMed Central

Yu, Da-Hai; Ware, Carol; Waterland, Robert A.; Zhang, Jiexin; Chen, Miao-Hsueh; Gadkari, Manasi; Kunde-Ramamoorthy, Govindarajan; Nosavanh, Lagina M.

2013-01-01

During development, a small but significant number of CpG islands (CGIs) become methylated. The timing of developmentally programmed CGI methylation and associated mechanisms of transcriptional regulation during cellular differentiation, however, remain poorly characterized. Here, we used genome-wide DNA methylation microarrays to identify epigenetic changes during human embryonic stem cell (hESC) differentiation. We discovered a group of CGIs associated with developmental genes that gain methylation after hESCs differentiate. Conversely, erasure of methylation was observed at the identified CGIs during subsequent reprogramming to induced pluripotent stem cells (iPSCs), further supporting a functional role for the CGI methylation. Both global gene expression profiling and quantitative reverse transcription-PCR (RT-PCR) validation indicated opposing effects of CGI methylation in transcriptional regulation during differentiation, with promoter CGI methylation repressing and 3′ CGI methylation activating transcription. By studying diverse human tissues and mouse models, we further confirmed that developmentally programmed 3′ CGI methylation confers tissue- and cell-type-specific gene activation in vivo. Importantly, luciferase reporter assays provided evidence that 3′ CGI methylation regulates transcriptional activation via a CTCF-dependent enhancer-blocking mechanism. These findings expand the classic view of mammalian CGI methylation as a mechanism for transcriptional silencing and indicate a functional role for 3′ CGI methylation in developmental gene regulation. PMID:23459939

Modulation of aerial respiratory behaviour in a pond snail.

PubMed

Lukowiak, Ken; Martens, Kara; Orr, Mike; Parvez, Kashif; Rosenegger, David; Sangha, Susan

2006-11-01

Aerial respiratory in Lymnaea is driven by a three-neuron CPG whose sufficiency and necessity has been directly demonstrated. While this CPG is 'hard-wired' it displays a tremendous amount of plasticity. That is, it is possible by employing specific training procedures to alter how it functions in a specific hypoxic environment. Thus, it is possible to study directly the causal mechanisms of long-term memory formation, forgetting, and modulation of the memory at a single cell level. Thus, it is possible to use a relatively simple three-neuron CPG to study not only important questions concerning regulation of important homeostatic mechanisms but to also use it to study how learning and non-declarative memory are mediated at a cellular level.

5meCpG epigenetic marks neighboring a primate-conserved core promoter short tandem repeat indicate X-chromosome inactivation.

PubMed

Machado, Filipe Brum; Machado, Fabricio Brum; Faria, Milena Amendro; Lovatel, Viviane Lamim; Alves da Silva, Antonio Francisco; Radic, Claudia Pamela; De Brasi, Carlos Daniel; Rios, Álvaro Fabricio Lopes; de Sousa Lopes, Susana Marina Chuva; da Silveira, Leonardo Serafim; Ruiz-Miranda, Carlos Ramon; Ramos, Ester Silveira; Medina-Acosta, Enrique

2014-01-01

X-chromosome inactivation (XCI) is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX) and males (XY). DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG) in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR) exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa) from inactive (Xi) X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8) and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2) and Xq (AR) chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae) and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic malignancies and the clonality of cancers in human and nonhuman primates.

5meCpG Epigenetic Marks Neighboring a Primate-Conserved Core Promoter Short Tandem Repeat Indicate X-Chromosome Inactivation

PubMed Central

Machado, Filipe Brum; Machado, Fabricio Brum; Faria, Milena Amendro; Lovatel, Viviane Lamim; Alves da Silva, Antonio Francisco; Radic, Claudia Pamela; De Brasi, Carlos Daniel; Rios, Álvaro Fabricio Lopes; de Sousa Lopes, Susana Marina Chuva; da Silveira, Leonardo Serafim; Ruiz-Miranda, Carlos Ramon; Ramos, Ester Silveira; Medina-Acosta, Enrique

2014-01-01

X-chromosome inactivation (XCI) is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX) and males (XY). DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG) in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR) exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa) from inactive (Xi) X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8) and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2) and Xq (AR) chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae) and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic malignancies and the clonality of cancers in human and nonhuman primates. PMID:25078280

CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

PubMed Central

Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

2004-01-01

Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use in clinical trials of recombinant malarial vaccine candidates. PMID:14742540

Assessing CpG island methylator phenotype, 1p/19q codeletion, and MGMT promoter methylation from epigenome-wide data in the biomarker cohort of the NOA-04 trial

PubMed Central

Wiestler, Benedikt; Capper, David; Hovestadt, Volker; Sill, Martin; Jones, David T.W.; Hartmann, Christian; Felsberg, Joerg; Platten, Michael; Feiden, Wolfgang; Keyvani, Kathy; Pfister, Stefan M.; Wiestler, Otmar D.; Meyermann, Richard; Reifenberger, Guido; Pietsch, Thorsten; von Deimling, Andreas; Weller, Michael; Wick, Wolfgang

2014-01-01

Background Molecular biomarkers including isocitrate dehydrogenase 1 or 2 (IDH1/2) mutation, 1p/19q codeletion, and O6-methylguanine-DNA-methyltransferase (MGMT) promoter methylation may improve prognostication and guide treatment decisions for patients with World Health Organization (WHO) anaplastic gliomas. At present, each marker is individually tested by distinct assays. Illumina Infinium HumanMethylation450 BeadChip arrays (HM450) enable the determination of large-scale methylation profiles and genome-wide DNA copy number changes. Algorithms have been developed to detect the glioma CpG island methylator phenotype (G-CIMP) associated with IDH1/2 mutation, 1p/19q codeletion, and MGMT promoter methylation using a single assay. Methods Here, we retrospectively investigated the diagnostic and prognostic performance of these algorithms in comparison to individual marker testing and patient outcome in the biomarker cohort (n = 115 patients) of the NOA-04 trial. Results Concordance for IDH and 1p/19q status was very high: In 92% of samples, the HM450 and reference data agreed. In discordant samples, survival analysis by Kaplan-Meier and Cox regression analyses suggested a more accurate assessment of biological phenotype by the HM450 analysis. The HM450-derived MGMT-STP27 model to calculate MGMT promoter methylation probability revealed this aberration in a significantly higher fraction of samples than conventional methylation-specific PCR, with 87 of 91 G-CIMP tumors predicted as MGMT promoter-methylated. Pyrosequencing of discordant samples confirmed the HM450 assessment in 14 of 17 cases. Conclusions G-CIMP and 1p/19q codeletion are reliably detectable by HM450 analysis and are associated with prognosis in the NOA-04 trial. For MGMT, HM450 suggests promoter methylation in the vast majority of G-CIMP tumors, which is supported by pyrosequencing. PMID:25028501

Treatment of Tobacco Dependence, a Critical Gap in Czech Clinical Practice Guidelines.

PubMed

Zvolská, Kamila; Fraser, Keely; Zvolský, Miroslav; Králíková, Eva

2017-06-01

Tobacco related comorbidities and treatment of dependence are relevant to clinicians of all disciplines. Clinicians should provide a brief intervention about tobacco use with smokers at each clinical contact (success rate of 5-10 %). Intensive treatment (success rate >30%) should be available to those who need it. Brief intervention is not yet standard clinical practice. Our aim was to assess clinical practice guidelines (CPG) of selected medical professional societies to determine whether or not tobacco dependence treatment recommendations were included. Between October and December 2013, we conducted a keyword search of CPG for 20 medical professional societies in the Czech Republic. We searched for the keywords "smoking", "tobacco" and "nicotine addiction" in 91 CPG documents, which were freely available on the websites of selected professional societies. We focused specifically on CPG relating to cardiovascular and respiratory diseases as well as cancer. We excluded any CPG focused on acute conditions, diagnostics only, laboratory methods, or administration. There was no mention of smoking in 27.7% (26/94) of CPG documents. Only 16% (15/94) of CPG documents listed smoking as a risk factor. 42.5% (40/94) mentioned smoking related phrases (e.g. "smoking ban"). Only 13.8% (13/94) of CPG included a section on tobacco dependence, referenced tobacco dependence treatment guidelines or mentioned specialized treatment centres where smokers can be referred. Nearly one third of CPG related to cardiovascular and respiratory diseases as well as cancer made no mention of smoking. Despite the clinical significance of smoking, the majority of CPG did not adequately address tobacco dependence and its treatment. Copyright© by the National Institute of Public Health, Prague 2017

CpG Island Methylator Phenotype-High Colorectal Cancers and Their Prognostic Implications and Relationships with the Serrated Neoplasia Pathway.

PubMed

Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon

2017-01-15

The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway.

Development of allele-specific multiplex PCR to determine the length of poly-T in intron 8 of CFTR

PubMed Central

Prada, Anne E.

2014-01-01

Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation analysis has been implemented for Cystic Fibrosis (CF) carrier screening, and molecular diagnosis of CF and congenital bilateral absence of the vas deferens (CBAVD). Although poly-T allele analysis in intron 8 of CFTR is required when a patient is positive for R117H, it is not recommended for routine carrier screening. Therefore, commercial kits for CFTR mutation analysis were designed either to mask the poly-T allele results, unless a patient is R117H positive, or to have the poly-T analysis as a standalone reflex test using the same commercial platform. There are other standalone assays developed to detect poly-T alleles, such as heteroduplex analysis, High Resolution Melting (HRM) curve analysis, allele-specific PCR (AS-PCR) and Sanger sequencing. In this report, we developed a simple and easy-to-implement multiplex AS-PCR assay using unlabeled standard length primers, which can be used as a reflex or standalone test for CFTR poly-T track analysis. Out of 115 human gDNA samples tested, results from our new AS-PCR matched to the previous known poly-T results or results from Sanger sequencing. PMID:25071991

CpG oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by a goose parvovirus vaccine in ducks.

PubMed

Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen

2010-11-23

Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.

Multiplex Allele-Specific Amplification from Whole Blood for Detecting Multiple Polymorphisms Simultaneously

PubMed Central

Zhu, Jianjie; Chen, Lanxin; Mao, Yong; Zhou, Huan

2013-01-01

Allele-specific amplification on the basis of polymerase chain reaction (PCR) has been widely used for single-nucleotide polymorphism (SNP) genotyping. However, the extraction of PCR-compatible genomic DNA from whole blood is usually required. This process is complicated and tedious, and is prone to cause cross-contamination between samples. To facilitate direct PCR amplification from whole blood without the extraction of genomic DNA, we optimized the pH value of PCR solution and the concentrations of magnesium ions and facilitator glycerol. Then, we developed multiplex allele-specific amplifications from whole blood and applied them to a case–control study. In this study, we successfully established triplex, five-plex, and eight-plex allele-specific amplifications from whole blood for determining the distribution of genotypes and alleles of 14 polymorphisms in 97 gastric cancer patients and 141 healthy controls. Statistical analysis results showed significant association of SNPs rs9344, rs1799931, and rs1800629 with the risk of gastric cancer. This method is accurate, time-saving, cost-effective, and easy-to-do, especially suitable for clinical prediction of disease susceptibility. PMID:23072573

Synthetic Poly(L-Glutamic Acid)-conjugated CpG Exhibits Antitumor Efficacy With Increased Retention in Tumor and Draining Lymph Nodes After Intratumoral Injection in a Mouse Model of Melanoma.

PubMed

Ma, Qing; Zhou, Dapeng; DeLyria, Elizabeth S; Wen, Xiaoxia; Lu, Wei; Thapa, Prakash; Liu, Chengwen; Li, Dan; Bassett, Roland L; Overwijk, Willem W; Hwu, Patrick; Li, Chun

2017-01-01

There is an urgent need for new clinically applicable drug-delivery methods to enhance accumulation of immune-activating drugs in tumors. We synthesized a poly(L-glutamic acid)-CpG ODN2216 conjugate (PG-CpG) and injected it intratumorally into C57BL/6 mice bearing subcutaneous B16-ovalbumin melanoma. PG-CpG elicited the same potent antitumoral activity as CpG with respect to reducing tumor growth and triggering antigen-specific CD8 T-cell responses in this well-established solid tumor model. Moreover, PG-CpG was retained significantly longer in both tumor and draining lymph nodes than was free CpG after intratumoral injection. Specifically, 48 hours after injection, 26.5%±16.9% of the injected PG-CpG dose versus 4.72%±2.61% of free CpG remained at the tumor, and 1.53%±1.22% of the injected PG-CpG versus 0.37%±0.33% of free CpG was retained in the draining inguinal lymph nodes. These findings indicate that PG is an effective synthetic polymeric carrier for delivery of immunostimulatory agents to tumors and lymph nodes.

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

PubMed

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

2017-10-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

PubMed

Najar, Hossain M; Dutz, Jan P

2008-09-01

Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands

PubMed Central

Farcas, Anca M; Blackledge, Neil P; Sudbery, Ian; Long, Hannah K; McGouran, Joanna F; Rose, Nathan R; Lee, Sheena; Sims, David; Cerase, Andrea; Sheahan, Thomas W; Koseki, Haruhiko; Brockdorff, Neil; Ponting, Chris P; Kessler, Benedikt M; Klose, Robert J

2012-01-01

CpG islands (CGIs) are associated with most mammalian gene promoters. A subset of CGIs act as polycomb response elements (PREs) and are recognized by the polycomb silencing systems to regulate expression of genes involved in early development. How CGIs function mechanistically as nucleation sites for polycomb repressive complexes remains unknown. Here we discover that KDM2B (FBXL10) specifically recognizes non-methylated DNA in CGIs and recruits the polycomb repressive complex 1 (PRC1). This contributes to histone H2A lysine 119 ubiquitylation (H2AK119ub1) and gene repression. Unexpectedly, we also find that CGIs are occupied by low levels of PRC1 throughout the genome, suggesting that the KDM2B-PRC1 complex may sample CGI-associated genes for susceptibility to polycomb-mediated silencing. These observations demonstrate an unexpected and direct link between recognition of CGIs by KDM2B and targeting of the polycomb repressive system. This provides the basis for a new model describing the functionality of CGIs as mammalian PREs. DOI: http://dx.doi.org/10.7554/eLife.00205.001 PMID:23256043

Distribution of Diego blood group alleles and identification of four novel mutations on exon 19 of SLC4A1 gene in the Chinese Han population by polymerase chain reaction sequence-based typing.

PubMed

Xu, X G; He, J; He, Y M; Tao, S D; Ying, Y L; Zhu, F M; Lv, H J; Yan, L X

2011-04-01

The Diego blood group system plays an important role in transfusion medicine. Genotyping of DI1 and DI2 alleles is helpful for the investigation into haemolytic disease of the newborn (HDN) and for the development of rare blood group databases. Here, we set up a polymerase chain reaction sequence-based typing (PCR-SBT) method for genotyping of Diego blood group alleles. Specific primers for exon 19 of the solute carrier family 4, anion exchanger, member1 (SLC4A1) gene were designed, and our PCR-SBT method was established and optimized for Diego genotyping. A total of 1053 samples from the Chinese Han population and the family members of a rare proband with DI1/DI1 genotype were investigated by the PCR-SBT method. An allele-specific primer PCR (PCR-ASP) was used to verify the reliability of the PCR-SBT method. The frequencies of DI1 and DI2 alleles in the Chinese Han population were 0.0247 and 0.9753, respectively. Six new single nucleotide polymorphisms (SNPs) were found in the sequenced regions of the SLC4A1 gene, and four novel SNPs located in the exon 19, in which one SNP could cause an amino acid alteration of Ala858Ser on erythrocyte anion exchanger protein 1. The genotypes for Diego blood group were identical among 41 selected samples with PCR-ASP and PCR-SBT. The PCR-SBT method can be used in Diego genotyping as a substitute of serological technique when the antisera is lacking and was suitable for screening large numbers of donors in rare blood group databases. © 2010 The Author(s). Vox Sanguinis © 2010 International Society of Blood Transfusion.

Genome-wide methylation analysis identifies a core set of hypermethylated genes in CIMP-H colorectal cancer.

PubMed

McInnes, Tyler; Zou, Donghui; Rao, Dasari S; Munro, Francesca M; Phillips, Vicky L; McCall, John L; Black, Michael A; Reeve, Anthony E; Guilford, Parry J

2017-03-28

Aberrant DNA methylation profiles are a characteristic of all known cancer types, epitomized by the CpG island methylator phenotype (CIMP) in colorectal cancer (CRC). Hypermethylation has been observed at CpG islands throughout the genome, but it is unclear which factors determine whether an individual island becomes methylated in cancer. DNA methylation in CRC was analysed using the Illumina HumanMethylation450K array. Differentially methylated loci were identified using Significance Analysis of Microarrays (SAM) and the Wilcoxon Signed Rank (WSR) test. Unsupervised hierarchical clustering was used to identify methylation subtypes in CRC. In this study we characterized the DNA methylation profiles of 94 CRC tissues and their matched normal counterparts. Consistent with previous studies, unsupervized hierarchical clustering of genome-wide methylation data identified three subtypes within the tumour samples, designated CIMP-H, CIMP-L and CIMP-N, that showed high, low and very low methylation levels, respectively. Differential methylation between normal and tumour samples was analysed at the individual CpG level, and at the gene level. The distribution of hypermethylation in CIMP-N tumours showed high inter-tumour variability and appeared to be highly stochastic in nature, whereas CIMP-H tumours exhibited consistent hypermethylation at a subset of genes, in addition to a highly variable background of hypermethylated genes. EYA4, TFPI2 and TLX1 were hypermethylated in more than 90% of all tumours examined. One-hundred thirty-two genes were hypermethylated in 100% of CIMP-H tumours studied and these were highly enriched for functions relating to skeletal system development (Bonferroni adjusted p value =2.88E-15), segment specification (adjusted p value =9.62E-11), embryonic development (adjusted p value =1.52E-04), mesoderm development (adjusted p value =1.14E-20), and ectoderm development (adjusted p value =7.94E-16). Our genome-wide characterization of DNA methylation in colorectal cancer has identified 132 genes hypermethylated in 100% of CIMP-H samples. Three genes, EYA4, TLX1 and TFPI2 are hypermethylated in >90% of all tumour samples, regardless of CIMP subtype.

Performance of Different Analytical Software Packages in Quantification of DNA Methylation by Pyrosequencing.

PubMed

Grasso, Chiara; Trevisan, Morena; Fiano, Valentina; Tarallo, Valentina; De Marco, Laura; Sacerdote, Carlotta; Richiardi, Lorenzo; Merletti, Franco; Gillio-Tos, Anna

2016-01-01

Pyrosequencing has emerged as an alternative method of nucleic acid sequencing, well suited for many applications which aim to characterize single nucleotide polymorphisms, mutations, microbial types and CpG methylation in the target DNA. The commercially available pyrosequencing systems can harbor two different types of software which allow analysis in AQ or CpG mode, respectively, both widely employed for DNA methylation analysis. Aim of the study was to assess the performance for DNA methylation analysis at CpG sites of the two pyrosequencing software which allow analysis in AQ or CpG mode, respectively. Despite CpG mode having been specifically generated for CpG methylation quantification, many investigations on this topic have been carried out with AQ mode. As proof of equivalent performance of the two software for this type of analysis is not available, the focus of this paper was to evaluate if the two modes currently used for CpG methylation assessment by pyrosequencing may give overlapping results. We compared the performance of the two software in quantifying DNA methylation in the promoter of selected genes (GSTP1, MGMT, LINE-1) by testing two case series which include DNA from paraffin embedded prostate cancer tissues (PC study, N = 36) and DNA from blood fractions of healthy people (DD study, N = 28), respectively. We found discrepancy in the two pyrosequencing software-based quality assignment of DNA methylation assays. Compared to the software for analysis in the AQ mode, less permissive criteria are supported by the Pyro Q-CpG software, which enables analysis in CpG mode. CpG mode warns the operators about potential unsatisfactory performance of the assay and ensures a more accurate quantitative evaluation of DNA methylation at CpG sites. The implementation of CpG mode is strongly advisable in order to improve the reliability of the methylation analysis results achievable by pyrosequencing.

[A new human leukocyte antigen class I allele, HLA- B*52:11].

PubMed

Li, Xiao-feng; Zhang, Xu; Zhang, Kun-lian; Chen, Yang; Liu, Xian-zhi; Li, Jian-ping

2011-12-01

To identify and confirm a novel HLA allele. A new human leukocyte antigen class I allele was found during routine HLA genotyping by polymerase chain reaction-sequence specific oligonucleotide probes (PCR-SSOP) and sequencing-based typing (SBT). The novel HLA-B*52 allele was identical to B*52:01:01 with an exception of one base substitution at position 583 of exon 3 where a C was changed to T resulting in codon 195 changed from CAC(H) to TAC(Y). A new HLA class I allele, B*52:11, is identified, and is named officially by the WHO Nomenclature Committee.

Different effects of apolipoprotein A5 SNPs and haplotypes on triglyceride concentration in three ethnic origins.

PubMed

Ken-Dror, Gie; Goldbourt, Uri; Dankner, Rachel

2010-05-01

Several polymorphisms in the ApoA5 gene emerged as important candidate genes in triglyceride metabolism. The aim of this study was to determine the associations between ApoA5 polymorphisms, plasma triglyceride concentrations and the presence of cardiovascular disease (CVD) in three ethnic origins. Genotypes for 15 single nucleotide polymorphisms (SNPs) were determined in 659 older adults (mean age 71+/-7 years) who immigrated to Israel or whose ancestors originated from East Europe (Ashkenazi), North Africa, Asia (Sephardic) or Yemen (Yemenite). The minor alleles of the four common SNPs (rs662799, rs651821, rs2072560 and rs2266788) are associated with an increase of 27-38% in triglyceride concentration among Ashkenazi and Yemenite Jews compared with the major alleles, but not among those of Sephardic origin. Conversely, among the Sephardic group, the presence of the minor allele in SNP rs3135506 compared with the major allele was associated with an increase of 34% in triglyceride concentration. The four SNPs were in significant linkage disequilibrium (D'=0.96-0.99), resulting in three haplotypes H1, H2 and H3, representing 98-99% of the population. Haplotype H2 was significantly associated with triglyceride concentration among Ashkenazi and Yemenite but not among Sephardic Jews. Conversely, haplotype H3 was associated with triglyceride concentration in Sephardic but not in Ashkenazi and Yemenite Jews. Ashkenazi carriers of H2 haplotype had a CVD odds ratio of 2.19 (95% CI: 1.05-4.58) compared with H1 (the most frequent), after adjustment for all other risk factors. These results suggest that different SNPs in ApoA5 polymorphisms may be associated with triglyceride concentration and CVD in each of these ethnic origins.

Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

PubMed Central

Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

2010-01-01

The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

H. pylori modifies methylation of global genomic DNA and the gastrin gene promoter in gastric mucosal cells and gastric cancer cells.

PubMed

Xie, Yuan; Zhou, Jian Jiang; Zhao, Yan; Zhang, Ting; Mei, Liu Zheng

2017-07-01

The aim of this study was to evaluate the correlation between H. pylori infection and global DNA methylation, as well as the methylation levels of the gastrin promoters. We constructed a eukaryotic expression vector, pcDNA3.1::cagA, and transfected it into GES-1 gastric mucosal cells and SGC-7901 gastric cancer cells. Both cell lines were infected with the H. pylori/CagA + strain NCTC11637. Then, we detected global DNA methylation by capture and detection antibodies, followed by colorimetric quantification. The methylation levels of the gastrin promoter were evaluated by base-specific cleavage and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. In H. pylori/CagA + -infected GES-1 and SGC-7901 cells, the methylation levels of genomic DNA decreased by 49.4% and 18.8%, and in GES-1 and SGC-7901 cells transfected with pcDNA3.1::cagA, the methylation levels of genomic DNA decreased by 17.05% and 25.6%, respectively. Among 24 methylation sites detected in the gastrin promoter region, the methylation levels of 9 CpG sites were significantly decreased in H. pylori/CagA+-infected and pcDNA3.1:: cagA-transfected cells in comparison to corresponding control cells. These results indicate that H. pylori/CagA + decreases the methylation of the genome and the gastrin promoter at some CpG sites in gastric mucosal and gastric cancer cells. Copyright © 2017. Published by Elsevier Ltd.

CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

PubMed

Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

2007-09-01

The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG PatternFinder is our further effort to create software tools for DNA methylation studies.

[The effect of entrapment of CpG sequence with cationic PLG nanoparticles on the immune responses of mice to pig paratyphoid vaccine].

PubMed

Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong

2005-10-01

Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.

Simultaneous genotyping of single-nucleotide polymorphisms in alcoholism-related genes using duplex and triplex allele-specific PCR with two-step thermal cycles.

PubMed

Shirasu, Naoto; Kuroki, Masahide

2014-01-01

We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.

Combined Chromatin and Expression Analysis Reveals Specific Regulatory Mechanisms within Cytokine Genes in the Macrophage Early Immune Response

PubMed Central

Emanuelsson, Olof; Sennblad, Bengt; Pirmoradian Najafabadi, Mohammad; Folkersen, Lasse; Mälarstig, Anders; Lagergren, Jens; Eriksson, Per; Hamsten, Anders; Odeberg, Jacob

2012-01-01

Macrophages play a critical role in innate immunity, and the expression of early response genes orchestrate much of the initial response of the immune system. Macrophages undergo extensive transcriptional reprogramming in response to inflammatory stimuli such as Lipopolysaccharide (LPS). To identify gene transcription regulation patterns involved in early innate immune responses, we used two genome-wide approaches - gene expression profiling and chromatin immunoprecipitation-sequencing (ChIP-seq) analysis. We examined the effect of 2 hrs LPS stimulation on early gene expression and its relation to chromatin remodeling (H3 acetylation; H3Ac) and promoter binding of Sp1 and RNA polymerase II phosphorylated at serine 5 (S5P RNAPII), which is a marker for transcriptional initiation. Our results indicate novel and alternative gene regulatory mechanisms for certain proinflammatory genes. We identified two groups of up-regulated inflammatory genes with respect to chromatin modification and promoter features. One group, including highly up-regulated genes such as tumor necrosis factor (TNF), was characterized by H3Ac, high CpG content and lack of TATA boxes. The second group, containing inflammatory mediators (interleukins and CCL chemokines), was up-regulated upon LPS stimulation despite lacking H3Ac in their annotated promoters, which were low in CpG content but did contain TATA boxes. Genome-wide analysis showed that few H3Ac peaks were unique to either +/−LPS condition. However, within these, an unpacking/expansion of already existing H3Ac peaks was observed upon LPS stimulation. In contrast, a significant proportion of S5P RNAPII peaks (approx 40%) was unique to either condition. Furthermore, data indicated a large portion of previously unannotated TSSs, particularly in LPS-stimulated macrophages, where only 28% of unique S5P RNAPII peaks overlap annotated promoters. The regulation of the inflammatory response appears to occur in a very specific manner at the chromatin level for specific genes and this study highlights the level of fine-tuning that occurs in the immune response. PMID:22384210

[Evaluation of the quality of clinical practice guidelines published in the Annales de Biologie Clinique with the help of the EFLM checklist].

PubMed

Wils, Julien; Fonfrède, Michèle; Augereau, Christine; Watine, Joseph

2014-01-01

Several tools are available to help evaluate the quality of clinical practice guidelines (CPG). The AGREE instrument (Appraisal of guidelines for research & evaluation) is the most consensual tool but it has been designed to assess CPG methodology only. The European federation of laboratory medicine (EFLM) recently designed a check-list dedicated to laboratory medicine which is supposed to be comprehensive and which therefore makes it possible to evaluate more thoroughly the quality of CPG in laboratory medicine. In the present work we test the comprehensiveness of this check-list on a sample of CPG written in French and published in Annales de biologie clinique (ABC). Thus we show that some work remains to be achieved before a truly comprehensive check-list is designed. We also show that there is some room for improvement for the CPG published in ABC, for example regarding the fact that some of these CPG do not provide any information about allowed durations of transport and of storage of biological samples before analysis, or about standards of minimal analytical performance, or about the sensitivities or the specificities of the recommended tests.

Epigenomic alterations define lethal CIMP-positive ependymomas of infancy

PubMed Central

Mack, S. C.; Witt, H.; Piro, R. M.; Gu, L.; Zuyderduyn, S.; Stütz, A. M.; Wang, X.; Gallo, M.; Garzia, L.; Zayne, K.; Zhang, X.; Ramaswamy, V.; Jäger, N.; Jones, D. T. W.; Sill, M.; Pugh, T. J.; Ryzhova, M.; Wani, K. M.; Shih, D. J. H.; Head, R.; Remke, M.; Bailey, S. D.; Zichner, T.; Faria, C. C.; Barszczyk, M.; Stark, S.; Seker-Cin, H.; Hutter, S.; Johann, P.; Bender, S.; Hovestadt, V.; Tzaridis, T.; Dubuc, A. M.; Northcott, P. A.; Peacock, J.; Bertrand, K. C.; Agnihotri, S.; Cavalli, F. M. G.; Clarke, I.; Nethery-Brokx, K.; Creasy, C. L.; Verma, S. K.; Koster, J.; Wu, X.; Yao, Y.; Milde, T.; Sin-Chan, P.; Zuccaro, J.; Lau, L.; Pereira, S.; Castelo-Branco, P.; Hirst, M.; Marra, M. A.; Roberts, S. S.; Fults, D.; Massimi, L.; Cho, Y. J.; Van Meter, T.; Grajkowska, W.; Lach, B.; Kulozik, A. E.; von Deimling, A.; Witt, O.; Scherer, S. W.; Fan, X.; Muraszko, K. M.; Kool, M.; Pomeroy, S. L.; Gupta, N.; Phillips, J.; Huang, A.; Tabori, U.; Hawkins, C.; Malkin, D.; Kongkham, P. N.; Weiss, W. A.; Jabado, N.; Rutka, J. T.; Bouffet, E.; Korbel, J. O.; Lupien, M.; Aldape, K. D.; Bader, G. D.; Eils, R.; Lichter, P.; Dirks, P. B.; Pfister, S. M.; Korshunov, A.; Taylor, M. D.

2014-01-01

Ependymomas are common childhood brain tumours that occur throughout the nervous system, but are most common in the paediatric hindbrain. Current standard therapy comprises surgery and radiation, but not cytotoxic chemotherapy as it does not further increase survival. Whole-genome and whole-exome sequencing of 47 hindbrain ependymomas reveals an extremely low mutation rate, and zero significant recurrent somatic single nucleotide variants. Although devoid of recurrent single nucleotide variants and focal copy number aberrations, poor-prognosis hindbrain ependymomas exhibit a CpG island methylator phenotype. Transcriptional silencing driven by CpG methylation converges exclusively on targets of the Polycomb repressive complex 2 which represses expression of differentiation genes through trimethylation of H3K27. CpG island methylator phenotype-positive hindbrain ependymomas are responsive to clinical drugs that target either DNA or H3K27 methylation both in vitro and in vivo. We conclude that epigenetic modifiers are the first rational therapeutic candidates for this deadly malignancy, which is epigenetically deregulated but genetically bland. PMID:24553142

Epigenomic alterations define lethal CIMP-positive ependymomas of infancy.

PubMed

Mack, S C; Witt, H; Piro, R M; Gu, L; Zuyderduyn, S; Stütz, A M; Wang, X; Gallo, M; Garzia, L; Zayne, K; Zhang, X; Ramaswamy, V; Jäger, N; Jones, D T W; Sill, M; Pugh, T J; Ryzhova, M; Wani, K M; Shih, D J H; Head, R; Remke, M; Bailey, S D; Zichner, T; Faria, C C; Barszczyk, M; Stark, S; Seker-Cin, H; Hutter, S; Johann, P; Bender, S; Hovestadt, V; Tzaridis, T; Dubuc, A M; Northcott, P A; Peacock, J; Bertrand, K C; Agnihotri, S; Cavalli, F M G; Clarke, I; Nethery-Brokx, K; Creasy, C L; Verma, S K; Koster, J; Wu, X; Yao, Y; Milde, T; Sin-Chan, P; Zuccaro, J; Lau, L; Pereira, S; Castelo-Branco, P; Hirst, M; Marra, M A; Roberts, S S; Fults, D; Massimi, L; Cho, Y J; Van Meter, T; Grajkowska, W; Lach, B; Kulozik, A E; von Deimling, A; Witt, O; Scherer, S W; Fan, X; Muraszko, K M; Kool, M; Pomeroy, S L; Gupta, N; Phillips, J; Huang, A; Tabori, U; Hawkins, C; Malkin, D; Kongkham, P N; Weiss, W A; Jabado, N; Rutka, J T; Bouffet, E; Korbel, J O; Lupien, M; Aldape, K D; Bader, G D; Eils, R; Lichter, P; Dirks, P B; Pfister, S M; Korshunov, A; Taylor, M D

2014-02-27

Ependymomas are common childhood brain tumours that occur throughout the nervous system, but are most common in the paediatric hindbrain. Current standard therapy comprises surgery and radiation, but not cytotoxic chemotherapy as it does not further increase survival. Whole-genome and whole-exome sequencing of 47 hindbrain ependymomas reveals an extremely low mutation rate, and zero significant recurrent somatic single nucleotide variants. Although devoid of recurrent single nucleotide variants and focal copy number aberrations, poor-prognosis hindbrain ependymomas exhibit a CpG island methylator phenotype. Transcriptional silencing driven by CpG methylation converges exclusively on targets of the Polycomb repressive complex 2 which represses expression of differentiation genes through trimethylation of H3K27. CpG island methylator phenotype-positive hindbrain ependymomas are responsive to clinical drugs that target either DNA or H3K27 methylation both in vitro and in vivo. We conclude that epigenetic modifiers are the first rational therapeutic candidates for this deadly malignancy, which is epigenetically deregulated but genetically bland.

Prediction of CpG-island function: CpG clustering vs. sliding-window methods

PubMed Central

2010-01-01

Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

Polycomb Responds to Low Levels of Transcription.

PubMed

Berrozpe, Georgina; Bryant, Gene O; Warpinski, Katherine; Spagna, Dan; Narayan, Santosh; Shah, Shivangi; Ptashne, Mark

2017-07-25

How is Polycomb (Pc), a eukaryotic negative regulator of transcription, targeted to specific mammalian genes? Our genome-wide analysis of the Pc mark H3K27me3 in murine cells revealed that Pc is preferentially associated with CpG island promoters of genes that are transcribed at a low level and less so with promoters of genes that are either silent or more highly expressed. Studies of the CpG island promoter of the Kit gene demonstrate that Pc is largely absent when the gene is silent in myeloid cells, as well as when the gene is highly expressed in mast cells. Manipulations that increase transcription in the former case, and reduce it in the latter, increase Pc occupancy. The average negative effect of Pc, we infer, is about 2-fold. We suggest possible biological roles for such negative effects and propose a mechanism by which Pc might be recruited to weakly transcribed genes. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Association between the CpG island methylator phenotype and its prognostic significance in primary pulmonary adenocarcinoma.

PubMed

Koh, Young Wha; Chun, Sung-Min; Park, Young-Soo; Song, Joon Seon; Lee, Geon Kook; Khang, Shin Kwang; Jang, Se Jin

2016-08-01

Aberrant methylation of promoter CpG islands is one of the most important inactivation mechanisms for tumor suppressor and tumor-related genes. Previous studies using genome-wide DNA methylation microarray analysis have suggested the existence of a CpG island methylator phenotype (CIMP) in lung adenocarcinomas. Although the biological behavior of these tumors varies according to tumor stage, no large-scale study has examined the CIMP in lung adenocarcinoma patients according to tumor stage. Furthermore, there have been no reported results regarding the clinical significance of each of the six CIMP markers. To examine the CIMP in patients with pulmonary adenocarcinoma after a surgical resection, we performed methylation analysis of six genes (CCNA1, ACAN, GFRA1, EDARADD, MGC45800, and p16 (INK4A)) in 230 pulmonary adenocarcinoma cases using the SEQUENOM MassARRAY platform. Fifty-four patients (28 %, 54/191) were in the CIMP-high (CIMP-H) group associated with high nodal stage (P = 0.007), the presence of micropapillary or solid histology (P = 0.003), and the absence of an epidermal growth factor receptor (EGFR) mutation (P = 0.002). By multivariate analysis, CIMP was an independent prognostic marker for overall survival (OS) and disease-specific survival (P = 0.03 and P = 0.43, respectively). In the stage I subgroups alone, CIMP-H patients had lower OS rates than the CIMP-low (CIMP-L) group (P = 0.041). Of the six CIMP markers, ACAN alone was significantly associated with patient survival. CIMP predicted the risk of progression independently of clinicopathological variables and enables the stratification of pulmonary adenocarcinoma patients, particularly among stage I cases.

DNA methylation profiles of donor nuclei cells and tissues of cloned bovine fetuses.

PubMed

Kremenskoy, Maksym; Kremenska, Yuliya; Suzuki, Masako; Imai, Kei; Takahashi, Seiya; Hashizume, Kazuyoshi; Yagi, Shintaro; Shiota, Kunio

2006-04-01

Methylation of DNA in CpG islands plays an important role during fetal development and differentiation because CpG islands are preferentially located in upstream regions of mammalian genomic DNA, including the transcription start site of housekeeping genes and are also associated with tissue-specific genes. Somatic nuclear transfer (NT) technology has been used to generate live clones in numerous mammalian species, but only a low percentage of nuclear transferred animals develop to term. Abnormal epigenetic changes in the CpG islands of donor nuclei after nuclear transfer could contribute to a high rate of abortion during early gestation and increase perinatal death. These changes have yet to be explored. Thus, we investigated the genome-wide DNA methylation profiles of CpG islands in nuclei donor cells and NT animals. Using Restriction Landmark Genomic Scanning (RLGS), we showed, for the first time, the epigenetic profile formation of tissues from NT bovine fetuses produced from cumulus cells. From approximately 2600 unmethylated NotI sites visualized on the RLGS profile, at least 35 NotI sites showed different methylation statuses. Moreover, we proved that fetal and placental tissues from artificially inseminated and cloned cattle have tissue-specific differences in the genome-wide methylation profiles of the CpG islands. We also found that possible abnormalities occurred in the fetal brain and placental tissues of cloned animals.

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

PubMed Central

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

2017-01-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

Association of aromatase (TTTA)n repeat polymorphisms with central precocious puberty in girls.

PubMed

Lee, Hae Sang; Kim, Kyung Hee; Hwang, Jin Soon

2014-09-01

Precocious puberty is characterized by early activation of the pituitary-gonadal axis. Oestrogen is the final key factor to start the onset of puberty. The cytochrome P450 19A1 (CYP19A1) gene encodes an aromatase that is responsible for the conversion of androgens to oestrogen, which is a key step in oestrogen biosynthesis. The aim of this study was to identify CYP19A1 gene mutations or polymorphisms in girls with central precocious puberty (CPP). We evaluated the frequency of allelic variants of the CYP19A1 exons and the tetranucleotide tandem repeat (TTTA)n in intron 4 in 203 idiopathic central precocious puberty (CPP) girls and 101 normal healthy women. The genotype analysis of the CYP19A1 (TTTA)n polymorphism revealed six different alleles ranging from seven to 13 repeats. Among the six different repeat alleles detected in this study, the (TTTA)₁₃ repeat allele was only detected in the patient group and carriers of the (TTTA)₁₃ allele were significantly associated with an increased risk of CPP (OR = 1·509, 95% CI = 1·425-1·598, P = 0·033). Carriers of the (TTTA)₁₃ repeat allele were significantly younger at pubertal onset and had higher levels of oestrogen than noncarriers of the (TTTA)₁₃ repeat allele. Although nine polymorphisms were detected in exons of the CYP19A1 gene, no clinical significance was observed. In this study, carriers of a higher repeat (TTTA)₁₃ polymorphism in intron 4 of the CYP19A1 gene had higher levels of oestrogen. Those carrying the (TTTA)₁₃ repeat allele may have a higher risk of developing CPP. © 2014 John Wiley & Sons Ltd.

Multiple roles for Saccharomyces cerevisiae histone H2A in telomere position effect, Spt phenotypes and double-strand-break repair.

PubMed Central

Wyatt, Holly R; Liaw, Hungjiun; Green, George R; Lustig, Arthur J

2003-01-01

Telomere position effects on transcription (TPE, or telomeric silencing) are nucleated by association of nonhistone silencing factors with the telomere and propagated in subtelomeric regions through association of silencing factors with the specifically modified histones H3 and H4. However, the function of histone H2A in TPE is unknown. We found that deletion of either the amino or the carboxyltails of H2A substantially reduces TPE. We identified four H2A modification sites necessary for wild-type efficiency of TPE. These "hta1tpe" alleles also act as suppressors of a delta insertion allele of LYS2, suggesting shared elements of chromatin structure at both loci. Interestingly, we observed combinatorial effects of allele pairs, suggesting both interdependent acetylation and deacetylation events in the amino-terminal tail and a regulatory circuit between multiple phosphorylated residues in the carboxyl-terminal tail. Decreases in silencing and viability are observed in most hta1tpe alleles after treatment with low and high concentrations, respectively, of bleomycin, which forms double-strand breaks (DSBs). In the absence of the DSB and telomere-binding protein yKu70, the bleomycin sensitivity of hta1tpe alleles is further enhanced. We also provide data suggesting the presence of a yKu-dependent histone H2A function in TPE. These data indicate that the amino- and carboxyl-terminal tails of H2A are essential for wild-type levels of yKu-mediated TPE and DSB repair. PMID:12750320

Regulation of the Mouse Treacher Collins Syndrome Homolog (Tcof1) Promoter Through Differential Repression of Constitutive Expression

PubMed Central

Shiang, Rita

2008-01-01

Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell–specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell–specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from −253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter. PMID:18771418

Design and pilot evaluation of a system to develop computer-based site-specific practice guidelines from decision models.

PubMed

Sanders, G D; Nease, R F; Owens, D K

2000-01-01

Local tailoring of clinical practice guidelines (CPGs) requires experts in medicine and evidence synthesis unavailable in many practice settings. The authors' computer-based system enables developers and users to create, disseminate, and tailor CPGs, using normative decision models (DMs). ALCHEMIST, a web-based system, analyzes a DM, creates a CPG in the form of an annotated algorithm, and displays for the guideline user the optimal strategy. ALCHEMIST'S interface enables remote users to tailor the guideline by changing underlying input variables and observing the new annotated algorithm that is developed automatically. In a pilot evaluation of the system, a DM was used to evaluate strategies for staging non-small-cell lung cancer. Subjects (n = 15) compared the automatically created CPG with published guidelines for this staging and critiqued both using a previously developed instrument to rate the CPGs' usability, accountability, and accuracy on a scale of 0 (worst) to 2 (best), with higher scores reflecting higher quality. The mean overall score for the ALCHEMIST CPG was 1.502, compared with the published-CPG score of 0.987 (p = 0.002). The ALCHEMIST CPG scores for usability, accountability, and accuracy were 1.683, 1.393, and 1.430, respectively; the published CPG scores were 1.192, 0.941, and 0.830 (each comparison p < 0.05). On a scale of 1 (worst) to 5 (best), users' mean ratings of ALCHEMIST'S ease of use, usefulness of content, and presentation format were 4.76, 3.98, and 4.64, respectively. The results demonstrate the feasibility of a web-based system that automatically analyzes a DM and creates a CPG as an annotated algorithm, enabling remote users to develop site-specific CPGs. In the pilot evaluation, the ALCHEMIST guidelines met established criteria for quality and compared favorably with national CPGs. The high usability and usefulness ratings suggest that such systems can be a good tool for guideline development.

CpG Island Methylator Phenotype-High Colorectal Cancers and Their Prognostic Implications and Relationships with the Serrated Neoplasia Pathway

PubMed Central

Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon

2017-01-01

The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway. PMID:27885175

Extending antigen release from particulate vaccines results in enhanced antitumor immune response.

PubMed

Kapadia, Chintan H; Tian, Shaomin; Perry, Jillian L; Sailer, David; Christopher Luft, J; DeSimone, Joseph M

2018-01-10

Tumor-specific CD8 + cytotoxic T lymphocytes (CTLs) play a critical role in an anti-tumor immune response. However, vaccination intended to elicit a potent CD8 + T cell responses employing tumor-associated peptide antigens, are typically ineffective due to poor immunogenicity. Previously, we engineered a polyethylene glycol (PEG) hydrogel-based subunit vaccine for the delivery of an antigenic peptide and CpG (adjuvant) to elicit potent CTLs. In this study, we further examined the effect of antigen release kinetics on their induced immune responses. A CD8 + T cell epitope peptide from OVA (CSIINFEKL) and CpG were co-conjugated to nanoparticles utilizing either a disulfide or a thioether linkage. Subsequent studies comparing peptide release rates as a function of linker, determined that the thioether linkage provided sustained release of peptide over 72h. Ability to control the release of peptide resulted in both higher and prolonged antigen presentation when compared to disulfide-linked peptide. Both NP vaccine formulations resulted in activation and maturation of bone marrow derived dendritic cells (BMDCs) and induced potent CD8 + T cell responses when compared to soluble antigen and soluble CpG. Immunization with either disulfide or thioether linked vaccine constructs effectively inhibited EG7-OVA tumor growth in mice, however only treatment with the thioether linked vaccine construct resulted in enhanced survival. Copyright © 2017. Published by Elsevier B.V.

BDNF rs6265 methylation and genotype interact on risk for schizophrenia.

PubMed

Ursini, Gianluca; Cavalleri, Tommaso; Fazio, Leonardo; Angrisano, Tiziana; Iacovelli, Luisa; Porcelli, Annamaria; Maddalena, Giancarlo; Punzi, Giovanna; Mancini, Marina; Gelao, Barbara; Romano, Raffaella; Masellis, Rita; Calabrese, Francesca; Rampino, Antonio; Taurisano, Paolo; Di Giorgio, Annabella; Keller, Simona; Tarantini, Letizia; Sinibaldi, Lorenzo; Quarto, Tiziana; Popolizio, Teresa; Caforio, Grazia; Blasi, Giuseppe; Riva, Marco A; De Blasi, Antonio; Chiariotti, Lorenzo; Bollati, Valentina; Bertolino, Alessandro

2016-01-01

Epigenetic mechanisms can mediate gene-environment interactions relevant for complex disorders. The BDNF gene is crucial for development and brain plasticity, is sensitive to environmental stressors, such as hypoxia, and harbors the functional SNP rs6265 (Val(66)Met), which creates or abolishes a CpG dinucleotide for DNA methylation. We found that methylation at the BDNF rs6265 Val allele in peripheral blood of healthy subjects is associated with hypoxia-related early life events (hOCs) and intermediate phenotypes for schizophrenia in a distinctive manner, depending on rs6265 genotype: in ValVal individuals increased methylation is associated with exposure to hOCs and impaired working memory (WM) accuracy, while the opposite is true for ValMet subjects. Also, rs6265 methylation and hOCs interact in modulating WM-related prefrontal activity, another intermediate phenotype for schizophrenia, with an analogous opposite direction in the 2 genotypes. Consistently, rs6265 methylation has a different association with schizophrenia risk in ValVals and ValMets. The relationships of methylation with BDNF levels and of genotype with BHLHB2 binding likely contribute to these opposite effects of methylation. We conclude that BDNF rs6265 methylation interacts with genotype to bridge early environmental exposures to adult phenotypes, relevant for schizophrenia. The study of epigenetic changes in regions containing genetic variation relevant for human diseases may have beneficial implications for the understanding of how genes are actually translated into phenotypes.

Increased expression of interleukin-6 (IL-6) gene transcript in relation to IL-6 promoter hypomethylation in gingival tissue from patients with chronic periodontitis.

PubMed

Kobayashi, Tetsuo; Ishida, Kohei; Yoshie, Hiromasa

2016-09-01

DNA methylation of the cytokine genes may play a role in the pathogenesis of periodontitis. The aim of this study is to evaluate whether the alteration of interleukin-6 (IL-6) gene promoter methylation in the gingival tissue (GT) and peripheral blood (PB) is unique to chronic periodontitis (CP). DNA isolated from the GT and PB of 25 patients with (CP) and 20 healthy controls (H) was modified with sodium bisulfite and analyzed for IL-6 promoter methylation with direct sequencing. The levels of IL-6 mRNA and serum IL-6 protein were evaluated by a quantitative reverse transcription polymerase chain reaction and an enzyme-linked immunosorbent assay. The CP group showed that the overall methylation rates of IL-6 promoter that contained 19 cytosine-guanine dinucleotide (CpG) motifs were significantly decreased in GT in comparison to PB (p<0.001), which was significantly negatively correlated with the probing depth (p=0.003). The GT and PB of the H group displayed similar overall methylation rates. No significant difference was observed in the methylation rates at each CpG in GT in comparison to the PB in both groups. The levels of IL-6 mRNA in the GT and PB and serum IL-6 of the two groups were comparable. The ratio of IL-6 mRNA in the GT relative to the PB was significantly higher in the CP group than in the H group (p=0.03). The increased expression of IL-6 gene transcription may be related to IL-6 promoter hypomethylation in the GT from CP patients. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification of Gene Networks Associated with Acute Myeloid Leukemia by Comparative Molecular Methylation and Expression Profiling

PubMed Central

Dellett, Margaret; O’Hagan, Kathleen Ann; Colyer, Hilary Ann Alexandra; Mills, Ken I.

2010-01-01

Around 80% of acute myeloid leukemia (AML) patients achieve a complete remission, however many will relapse and ultimately die of their disease. The association between karyotype and prognosis has been studied extensively and identified patient cohorts as having favourable [e.g. t(8; 21), inv (16)/t(16; 16), t(15; 17)], intermediate [e.g. cytogenetically normal (NK-AML)] or adverse risk [e.g. complex karyotypes]. Previous studies have shown that gene expression profiling signatures can classify the sub-types of AML, although few reports have shown a similar feature by using methylation markers. The global methylation patterns in 19 diagnostic AML samples were investigated using the Methylated CpG Island Amplification Microarray (MCAM) method and CpG island microarrays containing 12,000 CpG sites. The first analysis, comparing favourable and intermediate cytogenetic risk groups, revealed significantly differentially methylated CpG sites (594 CpG islands) between the two subgroups. Mutations in the NPM1 gene occur at a high frequency (40%) within the NK-AML subgroup and are associated with a more favourable prognosis in these patients. A second analysis comparing the NPM1 mutant and wild-type research study subjects again identified distinct methylation profiles between these two subgroups. Network and pathway analysis revealed possible molecular mechanisms associated with the different risk and/or mutation sub-groups. This may result in a better classification of the risk groups, improved monitoring targets, or the identification of novel molecular therapies. PMID:24179384

Association of HLA-A and Non-Classical HLA Class I Alleles

PubMed Central

Carlini, Federico; Ferreira, Virginia; Buhler, Stéphane; Tous, Audrey; Eliaou, Jean-François; René, Céline; Chiaroni, Jacques; Picard, Christophe; Di Cristofaro, Julie

2016-01-01

The HLA-A locus is surrounded by HLA class Ib genes: HLA-E, HLA-H, HLA-G and HLA-F. HLA class Ib molecules are involved in immuno-modulation with a central role for HLA-G and HLA-E, an emerging role for HLA-F and a yet unknown function for HLA-H. Thus, the principal objective of this study was to describe the main allelic associations between HLA-A and HLA-H, -G, -F and -E. Therefore, HLA-A, -E, -G, -H and -F coding polymorphisms, as well as HLA-G UnTranslated Region haplotypes (referred to as HLA-G UTRs), were explored in 191 voluntary blood donors. Allelic frequencies, Global Linkage Disequilibrium (GLD), Linkage Disequilibrium (LD) for specific pairs of alleles and two-loci haplotype frequencies were estimated. We showed that HLA-A, HLA-H, HLA-F, HLA-G and HLA-G UTRs were all in highly significant pairwise GLD, in contrast to HLA-E. Moreover, HLA-A displayed restricted associations with HLA-G UTR and HLA-H. We also confirmed several associations that were previously found to have a negative impact on transplantation outcome. In summary, our results suggest complex functional and clinical implications of the HLA-A genetic region. PMID:27701438

Epigenome-wide DNA methylation study of IgE concentration in relation to self-reported allergies.

PubMed

Ek, Weronica E; Ahsan, Muhammad; Rask-Andersen, Mathias; Liang, Liming; Moffatt, Miriam F; Gyllensten, Ulf; Johansson, Åsa

2017-04-01

Epigenetic mechanisms are critical for normal immune development and epigenetic alterations might therefore be possible contributors to immune diseases. To investigate if DNA methylation in whole blood is associated with total and allergen-specific IgE levels. We performed an epigenome-wide association study to investigate the association between DNA methylation and IgE level, allergen-specific IgE and self-reported immune diseases and allergies in 728 individuals. We identified and replicated 15 CpG sites associated with IgE, mapping to biologically relevant genes, including ACOT7, ILR5A, KCNH2, PRG2 and EPX. A total of 331 loci were associated with allergen-specific IgE, but none of these CpG sites were associated with self-reported allergies and immune diseases. This study shows that IgE levels are associated with DNA methylation levels at numerous CpG sites, which might provide new leads for investigating the links between IgE and allergic inflammation.

HLA-B*5701 clinical testing: early experience in the United States.

PubMed

Faruki, Hawazin; Heine, Uwe; Brown, Trisha; Koester, Ruth; Lai-Goldman, Myla

2007-10-01

HLA-B*5701 testing to provide risk stratification for abacavir hypersensitivity has the potential to reduce incidence of hypersensitivity reactions in susceptible individuals. Early experience with clinical HLA-B*5701 testing of the first 100 specimens, from a large clinical reference laboratory in the United States, is presented. Patient samples were tested using a two-step approach. The first step allowed rapid identification of most HLA-B*5701-negative samples in a high throughput mode. The second step involved resolution of putative positives by DNA sequencing to identify B*5701 specifically as well as other B57 subtypes. Test reporting included a phone call from a genetic counselor to obtain the ethnic background and indication for testing and to provide a patient-specific interpretation. The patients population was comprised of Caucasians, 84%; Hispanics, 13%; and African Americans, 3%. Among the 100 samples tested, 92% were HLA-B*5701-negative and 8% were positive for the HLA-B*5701 allele. All HLA-B*5701 allele positives were identified in Caucasian patients. Where the indication for testing was obtainable (57 patients), pre-abacavir therapy screening was the indication 67% of the time. Clarification of previous suspected history of hypersensitivity was the indication 33% of the time. Among samples tested to help clarify a previous history of hypersensitivity, 16/19 or 84% did not carry the HLA-B*5701 allele whereas 3/19 (16%) were carriers of the HLA-B*5701 allele. Early utilization of HLA-B*5701 testing in community practice was not always consistent with the clinical indications for testing. Post-test communication assisted in providing physician education and interpretation of patient-specific results.

In vitro induction of T regulatory cells by a methylated CpG DNA sequence in humans: Potential therapeutic applications in allergic and autoimmune diseases.

PubMed

Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo

2018-03-01

Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen-, mitogen-, and alloantigen-induced lymphoproliferation in vitro when measured by [3H]-thymidine. The synthetic methylated DNA CpG ODN but not an unmethylated CpG ODN sequence was shown to promote FoxP3 expression in human CD4+ T cells in the presence of TGF beta and IL-2. The induction of FoxP3+ suppressor cells is dose dependent and offers a potential clinical therapeutic application in allergic and autoimmune and inflammatory diseases. The use of this methylated CpG ODN offers a broad clinical application as a novel therapeutic method for Treg induction and, because of its low cost and small size, should facilitate delivery via nasal, respiratory, gastrointestinal routes, and/or by injection, routes of administration important for vaccine delivery to target sites responsible for respiratory, gastrointestinal, and systemic forms of allergic and autoimmune disease.

CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

PubMed Central

Qiao, Huan; May, James M.

2013-01-01

SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies.

PubMed

Ogino, S; Cantor, M; Kawasaki, T; Brahmandam, M; Kirkner, G J; Weisenberger, D J; Campan, M; Laird, P W; Loda, M; Fuchs, C S

2006-07-01

The concept of CpG island methylator phenotype (CIMP) is not universally accepted. Even if specific clinicopathological features have been associated with CIMP, investigators often failed to demonstrate a bimodal distribution of the number of methylated markers, which would suggest CIMP as a distinct subtype of colorectal cancer. Previous studies primarily used methylation specific polymerase chain reaction which might detect biologically insignificant low levels of methylation. To demonstrate a distinct genetic profile of CIMP colorectal cancer using quantitative DNA methylation analysis that can distinguish high from low levels of DNA methylation. We developed quantitative real time polymerase chain reaction (MethyLight) assays and measured DNA methylation (percentage of methylated reference) of five carefully selected loci (promoters of CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1) in 460 colorectal cancers from large prospective cohorts. There was a clear bimodal distribution of 80 microsatellite instability-high (MSI-H) tumours according to the number of methylated promoters, with no tumours showing 3/5 methylated loci. Thus we defined CIMP as having >or=4/5 methylated loci, and 17% (78) of the 460 tumours were classified as CIMP. CIMP was significantly associated with female sex, MSI, BRAF mutations, and wild-type KRAS. Both CIMP MSI-H tumours and CIMP microsatellite stable (MSS) tumours showed much higher frequencies of BRAF mutations (63% and 54%) than non-CIMP counterparts (non-CIMP MSI-H (0%, p<10(-5)) and non-CIMP MSS tumours (6.6%, p<10(-4)), respectively). CIMP is best characterised by quantitative DNA methylation analysis. CIMP is a distinct epigenotype of colorectal cancer and may be less frequent than previously reported.

Influence of prostate stem cell antigen gene polymorphisms on susceptibility to Helicobacter pylori-associated diseases: a case-control study.

PubMed

Ichikawa, Hitomi; Sugimoto, Mitsushige; Uotani, Takahiro; Sahara, Shu; Yamade, Mihoko; Iwaizumi, Moriya; Yamada, Takanori; Osawa, Satoshi; Sugimoto, Ken; Miyajima, Hiroaki; Yamaoka, Yoshio; Furuta, Takahisa

2015-04-01

Patients with duodenal ulcer have a reduced risk of developing gastric cancer compared to those without. Recently, the prostate stem cell antigen (PSCA) rs2294008 C>T polymorphism was found to be associated with different pathogenesis of duodenal ulcer and gastric cancer developments. However, whether PSCA rs2294008 C>T polymorphism is associated with severity of gastric mucosal atrophy is unclear. We examined the influence of the PSCA rs2294008 C>T polymorphism on susceptibility to H. pylori-related diseases and the relationships between PSCA polymorphism and gastric mucosal atrophy. PSCA rs2294008 C>T polymorphism was assessed in H. pylori-positive Japanese patients (n = 488) with noncardia gastric cancer (n = 193), gastric ulcer (n = 84), duodenal ulcer (n = 61), and atrophic gastritis (n = 150), as well as in H. pylori-negatives (n = 266). Frequency of PSCA rs2294008 C/C genotype in duodenal ulcer was 36.1%, which was significantly higher than those with gastric cancer (12.4%), gastric ulcer (19.0%), gastritis (10.7%), and H. pylori-negatives (19.5%) (p < .001). Compared with duodenal ulcer, having the T allele significantly increased the risk of gastric cancer (OR: 3.97, 95% CI: 2.02-7.80; p < .001), gastric ulcer (2.40, 1.13-5.10; p = .023), and gastritis (4.72, 2.26-9.86; p < .001). Mean pepsinogen (PG) I/PG II ratio in T allele carriers (2.17 ± 0.75) was significantly lower than that in C/C genotype (3.39 ± 1.27, p < .001). The PSCA rs2294008 C>T polymorphism is associated with differing susceptibilities to H. pylori-associated diseases. The PSCA rs2294008 C>T polymorphism may be acting through induction of gastric mucosal atrophy, finally leading to development of gastric ulcer and gastric cancer in PSCA rs2294008 T allele carriers, but not duodenal ulcer. © 2014 John Wiley & Sons Ltd.

DNA Methylation of Gene Expression in Acanthamoeba castellanii Encystation.

PubMed

Moon, Eun-Kyung; Hong, Yeonchul; Lee, Hae-Ahm; Quan, Fu-Shi; Kong, Hyun-Hee

2017-04-01

Encystation mediating cyst specific cysteine proteinase (CSCP) of Acanthamoeba castellanii is expressed remarkably during encystation. However, the molecular mechanism involved in the regulation of CSCP gene expression remains unclear. In this study, we focused on epigenetic regulation of gene expression during encystation of Acanthamoeba . To evaluate methylation as a potential mechanism involved in the regulation of CSCP expression, we first investigated the correlation between promoter methylation status of CSCP gene and its expression. A 2,878 bp of promoter sequence of CSCP gene was amplified by PCR. Three CpG islands (island 1-3) were detected in this sequence using bioinformatics tools. Methylation of CpG island in trophozoites and cysts was measured by bisulfite sequence PCR. CSCP promoter methylation of CpG island 1 (1,633 bp) was found in 8.2% of trophozoites and 7.3% of cysts. Methylation of CpG island 2 (625 bp) was observed in 4.2% of trophozoites and 5.8% of cysts. Methylation of CpG island 3 (367 bp) in trophozoites and cysts was both 3.6%. These results suggest that DNA methylation system is present in CSCP gene expression of Acanthamoeba . In addition, the expression of encystation mediating CSCP is correlated with promoter CpG island 1 hypomethylation.

Allelic variation contributes to bacterial host specificity

DOE PAGES

Yue, Min; Han, Xiangan; Masi, Leon De; ...

2015-10-30

Understanding the molecular parameters that regulate cross-species transmission and host adaptation of potential pathogens is crucial to control emerging infectious disease. Although microbial pathotype diversity is conventionally associated with gene gain or loss, the role of pathoadaptive nonsynonymous single-nucleotide polymorphisms (nsSNPs) has not been systematically evaluated. Here, our genome-wide analysis of core genes within Salmonella enterica serovar Typhimurium genomes reveals a high degree of allelic variation in surface-exposed molecules, including adhesins that promote host colonization. Subsequent multinomial logistic regression, MultiPhen and Random Forest analyses of known/suspected adhesins from 580 independent Typhimurium isolates identifies distinct host-specific nsSNP signatures. Moreover, population andmore » functional analyses of host-associated nsSNPs for FimH, the type 1 fimbrial adhesin, highlights the role of key allelic residues in host-specific adherence in vitro. In conclusion, together, our data provide the first concrete evidence that functional differences between allelic variants of bacterial proteins likely contribute to pathoadaption to diverse hosts.« less

Development of a multiplex allele-specific primer PCR assay for simultaneous detection of QoI and CAA fungicide resistance alleles in Plasmopara viticola populations.

PubMed

Aoki, Yoshinao; Hada, Yosuke; Suzuki, Shunji

2013-02-01

DNA-based diagnosis has become a common tool for the evaluation of fungicide resistance in obligate phytopathogenic fungus Plasmopara viticola. A multiplex allele-specific primer PCR assay has been developed for the rapid detection of fungicide resistance in P. viticola populations. With this assay, a glycine-to-alanine substitution at codon 143 of the P. viticola cytochrome b gene, which conferred QoI fungicide resistance, and a glycine-to-serine substitution at codon 1105 of the P. viticola cellulose synthase gene PvCesA3, which conferred CAA fungicide resistance, were detected simultaneously. It is suggested that the present assay is a reliable tool for the rapid and simultaneous detection of QoI and CAA fungicide resistance alleles in P. viticola populations. The assay required only 2 h from the sampling of symptoms to the detection of resistance alleles to both fungicides. Copyright © 2012 Society of Chemical Industry.

Epigenetic Biomarker to Support Classification into Pluripotent and Non-Pluripotent Cells

NASA Astrophysics Data System (ADS)

Lenz, Michael; Goetzke, Roman; Schenk, Arne; Schubert, Claudia; Veeck, Jürgen; Hemeda, Hatim; Koschmieder, Steffen; Zenke, Martin; Schuppert, Andreas; Wagner, Wolfgang

2015-03-01

Quality control of human induced pluripotent stem cells (iPSCs) can be performed by several methods. These methods are usually relatively labor-intensive, difficult to standardize, or they do not facilitate reliable quantification. Here, we describe a biomarker to distinguish between pluripotent and non-pluripotent cells based on DNA methylation (DNAm) levels at only three specific CpG sites. Two of these CpG sites were selected by their discriminatory power in 258 DNAm profiles - they were either methylated in pluripotent or non-pluripotent cells. The difference between these two β-values provides an Epi-Pluri-Score that was validated on independent DNAm-datasets (264 pluripotent and 1,951 non-pluripotent samples) with 99.9% specificity and 98.9% sensitivity. This score was complemented by a third CpG within the gene POU5F1 (OCT4), which better demarcates early differentiation events. We established pyrosequencing assays for the three relevant CpG sites and thereby correctly classified DNA of 12 pluripotent cell lines and 31 non-pluripotent cell lines. Furthermore, DNAm changes at these three CpGs were tracked in the course of differentiation of iPSCs towards mesenchymal stromal cells. The Epi-Pluri-Score does not give information on lineage-specific differentiation potential, but it provides a simple, reliable, and robust biomarker to support high-throughput classification into either pluripotent or non-pluripotent cells.

Site-specific methylation of the rat prolactin and growth hormone promoters correlates with gene expression.

PubMed Central

Ngô, V; Gourdji, D; Laverrière, J N

1996-01-01

The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139

Adjuvant guided polarization of the immune humoral response against a protective multicomponent antigenic protein (Q) from Leishmania infantum. A CpG + Q mix protects Balb/c mice from infection.

PubMed

Parody, N; Soto, M; Requena, J M; Alonso, C

2004-01-01

It has been shown that vaccination with three doses of the Leishmania infantum poly-protein Q containing five genetically fused antigenic determinants from the Lip2a, Lip2b, H2A and P0 proteins, mixed with BCG induces clearance of parasites in 9 out of 10 Leishmania infantum-infected Beagle dogs, in addition to clinical protection. In the present paper we analysed the immunogenic potential of the poly-protein Q and the specificity and polarization of the response against the antigenic determinants of Q when mixed with various adjuvants. The data showed that the Q protein had high intrinsic immunogenic potential and that it was able to induce a long-lasting IgG response. The IgM immunogenic potential of the poly-protein was mainly due to the LiP2a and LiP2b determinants, whereas the IgG immunogenic potential was mainly due to the LiP2a component. It was observed that the protein itself elicited a mixed IgG2a/IgG1 response and that the determinants of Q were endowed with different IgG2a/IgG1 potential. It was also observed that the adjuvants did not influence the intensity or specificity of the IgM response but that they modulated the intensity, the specificity and the polarization of the IgG response against the determinants of Q. CpG-ODN motifs or double-stranded DNA plasmids containing CpG motifs when mixed with Q induced a predominant IgG2a response mainly observed at early stages post-immunization. The data showed that a CpG + Q mix induced significant protection against L. infantum infection in Balb/c mice.

New malaria vaccine candidates based on the Plasmodium vivax Merozoite Surface Protein-1 and the TLR-5 agonist Salmonella Typhimurium FliC flagellin.

PubMed

Bargieri, Daniel Y; Rosa, Daniela S; Braga, Catarina J M; Carvalho, Bruna O; Costa, Fabio T M; Espíndola, Noeli Maria; Vaz, Adelaide José; Soares, Irene S; Ferreira, Luis C S; Rodrigues, Mauricio M

2008-11-11

The present study evaluated the immunogenicity of new malaria vaccine formulations based on the 19kDa C-terminal fragment of Plasmodium vivax Merozoite Surface Protein-1 (MSP1(19)) and the Salmonella enterica serovar Typhimurium flagellin (FliC), a Toll-like receptor 5 (TLR5) agonist. FliC was used as an adjuvant either admixed or genetically linked to the P. vivax MSP1(19) and administered to C57BL/6 mice via parenteral (s.c.) or mucosal (i.n.) routes. The recombinant fusion protein preserved MSP1(19) epitopes recognized by sera collected from P. vivax infected humans and TLR5 agonist activity. Mice parenterally immunized with recombinant P. vivax MSP1(19) in the presence of FliC, either admixed or genetically linked, elicited strong and long-lasting MSP1(19)-specific systemic antibody responses with a prevailing IgG1 subclass response. Incorporation of another TLR agonist, CpG ODN 1826, resulted in a more balanced response, as evaluated by the IgG1/IgG2c ratio, and higher cell-mediated immune response measured by interferon-gamma secretion. Finally, we show that MSP1(19)-specific antibodies recognized the native protein expressed on the surface of P. vivax parasites harvested from infected humans. The present report proposes a new class of malaria vaccine formulation based on the use of malarial antigens and the innate immunity agonist FliC. It contains intrinsic adjuvant properties and enhanced ability to induce specific humoral and cellular immune responses when administered alone or in combination with other adjuvants.

Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

PubMed Central

Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

1988-01-01

Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants

PubMed Central

Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo

2017-01-01

Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871

Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

PubMed

Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

2008-10-09

Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

Output variability across animals and levels in a motor system

PubMed Central

Norris, Brian J; Günay, Cengiz; Kueh, Daniel

2018-01-01

Rhythmic behaviors vary across individuals. We investigated the sources of this output variability across a motor system, from the central pattern generator (CPG) to the motor plant. In the bilaterally symmetric leech heartbeat system, the CPG orchestrates two coordinations in the bilateral hearts with different intersegmental phase relations (Δϕ) and periodic side-to-side switches. Population variability is large. We show that the system is precise within a coordination, that differences in repetitions of a coordination contribute little to population output variability, but that differences between bilaterally homologous cells may contribute to some of this variability. Nevertheless, much output variability is likely associated with genetic and life history differences among individuals. Variability of Δϕ were coordination-specific: similar at all levels in one, but significantly lower for the motor pattern than the CPG pattern in the other. Mechanisms that transform CPG output to motor neurons may limit output variability in the motor pattern. PMID:29345614

Genetic control of T cell responsiveness to the Friend murine leukemia virus envelope antigen. Identification of class II loci of the H-2 as immune response genes

PubMed Central

1988-01-01

T cells primed specifically for the envelope glycoprotein of Friend murine leukemia helper virus (F-MuLV) were prepared by immunizing mice with a recombinant vaccinia virus that expressed the entire env gene of F-MuLV. Significant proliferative responses of F-MuLV envelope- specific, H-2a/b T cells were observed when the T cells were stimulated with antigen-pulsed peritoneal exudate cells (PEC) having the b allele at the K, A beta, A alpha, and E beta loci of the H-2. On the other hand, PEC having only the kappa allele at these loci did not induce the envelope-specific T cell proliferation, even when the PEC had the b allele at the E alpha, S, or D loci. F-MuLV envelope-specific proliferation of H-2a/b T cells under the stimulation of antigen- pulsed, H-2a/b PEC was specifically blocked with anti-I-Ab and anti-I- Ek mAbs but not with anti-Kb, anti-Kk, or anti-I-Ak mAbs. Moreover, (B10.MBR x A/WySn)F1 mice that have the b allele only at the K locus but not in I-A subregion were nonresponders to the envelope glycoprotein, and the bm12 mutation at the A beta locus completely abolished the T cell responsiveness to this antigen. These results indicate that proliferative T cells recognize a limited number of epitopes on F-MuLV envelope protein in the context of I-Ab, hybrid I- Ak/b, and/or hybrid I-Ek/b class II MHC molecules but fail to recognize the same envelope protein in the context of I-Ak or I-Ek molecules. This influence of the H-2I region on T cell recognition of the envelope glycoprotein appeared to control in vivo induction of protective immunity against Friend virus complex after immunization with the vaccinia-F-MuLV env vaccine. Thus, these results provide, for the first time, direct evidence for Ir gene-controlled responder/nonresponder phenotypes influencing the immune response to a pathogenic virus of mice. PMID:3141552

The Growth Advantage in Stationary-Phase Phenotype Conferred by rpoS Mutations Is Dependent on the pH and Nutrient Environment

PubMed Central

Farrell, Michael J.; Finkel, Steven E.

2003-01-01

Escherichia coli cells that are aged in batch culture display an increased fitness referred to as the growth advantage in stationary phase, or GASP, phenotype. A common early adaptation to this culture environment is a mutant rpoS allele, such as rpoS819, that results in attenuated RpoS activity. However, it is important to note that during long-term batch culture, environmental conditions are in flux. To date, most studies of the GASP phenotype have focused on identifying alleles that render an advantage in a specific environment, Luria-Bertani broth (LB) batch culture. To determine what role environmental conditions play in rendering relative fitness advantages to E. coli cells carrying either the wild-type or rpoS819 alleles, we performed competitions under a variety of culture conditions in which either the available nutrients, the pH, or both were manipulated. In LB medium, we found that while the rpoS819 allele confers a strong competitive fitness advantage at basic pH, it confers a reduced advantage under neutral conditions, and it is disadvantageous under acidic conditions. Similar results were found using other media. rpoS819 conferred its greatest advantage in basic minimal medium in which either glucose or Casamino Acids were the sole source of carbon and energy. In acidic medium supplemented with either Casamino Acids or glucose, the wild-type allele conferred a slight advantage. In addition, populations were dynamic under all pH conditions tested, with neither the wild-type nor mutant rpoS alleles sweeping a culture. We also found that the strength of the fitness advantage gained during a 10-day incubation is pH dependent. PMID:14645263

Accounting for cell lineage and sex effects in the identification of cell-specific DNA methylation using a Bayesian model selection algorithm.

PubMed

White, Nicole; Benton, Miles; Kennedy, Daniel; Fox, Andrew; Griffiths, Lyn; Lea, Rodney; Mengersen, Kerrie

2017-01-01

Cell- and sex-specific differences in DNA methylation are major sources of epigenetic variation in whole blood. Heterogeneity attributable to cell type has motivated the identification of cell-specific methylation at the CpG level, however statistical methods for this purpose have been limited to pairwise comparisons between cell types or between the cell type of interest and whole blood. We developed a Bayesian model selection algorithm for the identification of cell-specific methylation profiles that incorporates knowledge of shared cell lineage and allows for the identification of differential methylation profiles in one or more cell types simultaneously. Under the proposed methodology, sex-specific differences in methylation by cell type are also assessed. Using publicly available, cell-sorted methylation data, we show that 51.3% of female CpG markers and 61.4% of male CpG markers identified were associated with differential methylation in more than one cell type. The impact of cell lineage on differential methylation was also highlighted. An evaluation of sex-specific differences revealed differences in CD56+NK methylation, within both single and multi- cell dependent methylation patterns. Our findings demonstrate the need to account for cell lineage in studies of differential methylation and associated sex effects.

DNA methylation of the BRD2 promoter is associated with juvenile myoclonic epilepsy in Caucasians.

PubMed

Pathak, Shilpa; Miller, James; Morris, Emily C; Stewart, William C L; Greenberg, David A

2018-05-01

Juvenile myoclonic epilepsy (JME) is a common adolescent-onset genetic generalized epilepsy (GGE) syndrome. Multiple linkage and association studies have found that BRD2 influences the expression of JME. The BRD2-JME connection is further corroborated by our murine model; Brd2 haploinsufficiency produces characteristics that typify the clinical hallmarks of JME. Neither we, nor several large-scale studies of JME, found JME-related BRD2 coding mutations. Therefore, we investigated noncoding BRD2 regions, seeking the origin of BRD2's JME influence. BRD2's promoter harbors a JME-associated single nucleotide polymorphism (rs3918149) and a CpG (C-phosphate-G dinucleotides) island (CpG76), making it a potential "hotspot" for JME-associated epigenetic variants. Methylating promoter CpG sites causes gene silencing, often resulting in reduced gene expression. We tested for differences in DNA methylation at CpG76 in 3 different subgroups: (1) JME patients versus their unaffected family members, (2) JME versus patients with other forms of GGE, and (3) Caucasian versus non-Caucasian JME patients. We used DNA pyrosequencing to analyze the methylation status of 10 BRD2 promoter CpG sites in lymphoblastoid cells from JME patients of Caucasian and non-Caucasian origin, unaffected family members, and also non-JME GGE patients. We also measured global methylation levels and DNA methyl transferase 1 (DNMT1) transcript expression in JME families by standard methods. CpG76 is highly methylated in JME patients compared to unaffected family members. In families with non-JME GGE, we found no relationship between promoter methylation and epilepsy. In non-Caucasian JME families, promoter methylation was mostly not associated with epilepsy. This makes the BRD2 promoter a JME-specific, ethnicity-specific, differentially methylated region. Global methylation was constant across groups. BRD2 promoter methylation in JME, and the lack of methylation in unaffected relatives, in non-JME GGE patients, and in non-Caucasian JME, demonstrate that methylation specificity is a possible seizure susceptibility motif in JME risk and suggests JME therapeutics targeting BRD2. Wiley Periodicals, Inc. © 2018 International League Against Epilepsy.

Role for DNA methylation in the regulation of miR-200c and miR-141 expression in normal and cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vrba, Lukas; Jensen, Taylor J.; Garbe, James C.

2009-12-23

BACKGROUND: The microRNA-200 family participates in the maintenance of an epithelial phenotype and loss of its expression can result in epithelial to mesenchymal transition (EMT). Furthermore, the loss of expression of miR-200 family members is linked to an aggressive cancer phenotype. Regulation of the miR-200 family expression in normal and cancer cells is not fully understood. METHODOLOGY/ PRINCIPAL FINDINGS: Epigenetic mechanisms participate in the control of miR-200c and miR-141 expression in both normal and cancer cells. A CpG island near the predicted mir-200c/mir-141 transcription start site shows a striking correlation between miR-200c and miR-141 expression and DNA methylation in bothmore » normal and cancer cells, as determined by MassARRAY technology. The CpG island is unmethylated in human miR-200/miR-141 expressing epithelial cells and in miR-200c/miR-141 positive tumor cells. The CpG island is heavily methylated in human miR-200c/miR-141 negative fibroblasts and miR-200c/miR-141 negative tumor cells. Mouse cells show a similar inverse correlation between DNA methylation and miR-200c expression. Enrichment of permissive histone modifications, H3 acetylation and H3K4 trimethylation, is seen in normal miR-200c/miR-141-positive epithelial cells, as determined by chromatin immunoprecipitation coupled to real-time PCR. In contrast, repressive H3K9 dimethylation marks are present in normal miR-200c/miR-141-negative fibroblasts and miR-200c/miR-141 negative cancer cells and the permissive histone modifications are absent. The epigenetic modifier drug, 5-aza-2'-deoxycytidine, reactivates miR-200c/miR-141 expression showing that epigenetic mechanisms play a functional role in their transcriptional control. CONCLUSIONS/ SIGNIFICANCE: We report that DNA methylation plays a role in the normal cell type-specific expression of miR-200c and miR-141 and this role appears evolutionarily conserved, since similar results were obtained in mouse. Aberrant DNA methylation of the miR-200c/141 CpG island is closely linked to their inappropriate silencing in cancer cells. Since the miR-200c cluster plays a significant role in EMT, our results suggest an important role for DNA methylation in the control of phenotypic conversions in normal cells.« less

Mapping QTL for popping expansion volume in popcorn with simple sequence repeat markers.

PubMed

Lu, H-J; Bernardo, R; Ohm, H W

2003-02-01

Popping expansion volume is the most important quality trait in popcorn ( Zea mays L.), but its genetics is not well understood. The objectives of this study were to map quantitative trait loci (QTLs) responsible for popping expansion volume in a popcorn x dent corn cross, and to compare the predicted efficiencies of phenotypic selection, marker-based selection, and marker-assisted selection for popping expansion volume. Of 259 simple sequence repeat (SSR) primer pairs screened, 83 pairs were polymorphic between the H123 (dent corn) and AG19 (popcorn) parental inbreds. Popping test data were obtained for 160 S(1) families developed from the [AG19(H123 x AG19)] BC(1) population. The heritability ( h(2)) for popping expansion volume on an S(1) family mean basis was 0.73. The presence of the gametophyte factor Ga1(s) in popcorn complicates the analysis of popcorn x dent corn crosses. But, from a practical perspective, the linkage between a favorable QTL allele and Ga1(s) in popcorn will lead to selection for the favorable QTL allele. Four QTLs, on chromosomes 1S, 3S, 5S and 5L, jointly explained 45% of the phenotypic variation. Marker-based selection for popping expansion volume would require less time and work than phenotypic selection. But due to the high h(2) of popping expansion volume, marker-based selection was predicted to be only 92% as efficient as phenotypic selection. Marker-assisted selection, which comprises index selection on phenotypic and marker scores, was predicted to be 106% as efficient as phenotypic selection. Overall, our results suggest that phenotypic selection will remain the preferred method for selection in popcorn x dent corn crosses.

Genetic diversity and population genetic analysis of bovine MHC class II DRB3.2 locus in three Bos indicus cattle breeds of Southern India.

PubMed

Das, D N; Sri Hari, V G; Hatkar, D N; Rengarajan, K; Saravanan, R; Suryanarayana, V V S; Murthy, L K

2012-12-01

The present study was performed to evaluate the genetic polymorphism of BoLA-DRB3.2 locus in Malnad Gidda, Hallikar and Ongole South Indian Bos indicus cattle breeds, employing the PCR-RFLP technique. In Malnad Gidda population, 37 BoLA-DRB3.2 alleles were detected, including one novel allele DRB3*2503 (GenBank: HM031389) that was observed in the frequency of 1.87%. In Hallikar and Ongole populations, 29 and 21 BoLA-DRB3.2 alleles were identified, respectively. The frequencies of the most common BoLA-DRB3.2 alleles (with allele frequency > 5%), in Malnad Gidda population, were DRB3.2*15 (10.30%), DRB3*5702 (9.35%), DRB3.2*16 (8.41%), DRB3.2*23 (7.01%) and DRB3.2*09 (5.61%). In Hallikar population, the most common alleles were DRB3.2*11 (13.00%), DRB3.2*44 (11.60%), DRB3.2*31 (10.30%), DRB3.2*28 (5.48%) and DRB3.2*51 (5.48%). The most common alleles in Ongole population were DRB3.2*15 (22.50%), DRB3.2*06 (20.00%), DRB3.2*13 (13.30%), DRB3.2*12 (9.17%) and DRB3.2*23 (7.50%). A high degree of heterozygosity observed in Malnad Gidda (H(O) = 0.934, H(E) = 0.955), Hallikar (H(O) = 0.931, H(E) = 0.943) and Ongole (H(O) = 0.800, H(E) = 0.878) populations, along with F(IS) values close to F(IS) zero (Malnad Gidda: F(IS) = 0.0221, Hallikar: F(IS) = 0.0127 and Ongole: F(IS) = 0.0903), yielded nonsignificant P-values with respect to Hardy-Weinberg equilibrium probabilities revealing, no perceptible inbreeding, greater genetic diversity and characteristic population structure being preserved in the three studied cattle populations. The phylogenetic tree constructed based on the frequencies of BoLA-DRB3.2 alleles observed in 10 Bos indicus and Bos taurus cattle breeds revealed distinct clustering of specific Bos indicus cattle breeds, along with unique genetic differentiation observed among them. The results of this study demonstrated that the BoLA-DRB3.2 is a highly polymorphic locus, with significant breed-specific genetic diversities being present amongst the three studied cattle breeds. The population genetics and phylogenetic analysis have revealed pivotal information about the population structure and importance of the presently studied three Bos indicus cattle breeds as unique animal genetic resources, which have to be conserved for maintaining native cattle genetic diversity. © 2012 Blackwell Publishing Ltd.

Maternal cell traffic bounds for immune modulation: tracking maternal H-2 alleles in spleens of baby mice by DNA fingerprinting.

PubMed

Wan, Wenhan; Shimizu, Shoji; Ikawa, Hiromichi; Sugiyama, Kiyosh; Yamaguchi, Nobuo

2002-10-01

We have previously reported that the immunization of pregnant mice with T-dependent antigens successfully induced suppression of the antigen-specific plaque-forming cell (PFC) response to the relevant antigens in the offspring. This suppression was not caused by the administered antigens, the antibodies produced by the pregnant mother, or lactational transfer, but was dependent on the presence of the intact maternal T cells. It was major histocompatibility complex (MHC)-restricted manner tolerance, which continued for at least one-sixth of the murine life. Traditionally, the placenta acts as a natural barrier, not allowing the cells to pass through. However, the results presented strongly suggested that maternal T cells pass through the placenta and subsequently induce tolerance. In this present study, we attempted to substantiate the presence of maternal cells in the fetal circulation through the use of molecular techniques. We found that a highly polymorphic microsatellite sequence within the class II Eb gene of the H-2 complex is useful for the molecular detection of various H-2 alleles. DNA polymorphic analysis was used for tracking maternal H-2 alleles in the spleens of baby mice. The main procedure involved polymerase chain reaction amplification and restriction fragment length polymorphism analysis of the DNA sequence encompassing the H-2-specific microsatellite from the genomic DNA of baby mice. The results indicated that maternal T cells of immunized pregnant mice cross the placenta into the fetus, eventually inducing antigen-specific immunological tolerance in the offspring.

Phenotype-specific CpG island methylation events in a murine model of prostate cancer.

PubMed

Camoriano, Marta; Kinney, Shannon R Morey; Moser, Michael T; Foster, Barbara A; Mohler, James L; Trump, Donald L; Karpf, Adam R; Smiraglia, Dominic J

2008-06-01

Aberrant DNA methylation plays a significant role in nearly all human cancers and may contribute to disease progression to advanced phenotypes. Study of advanced prostate cancer phenotypes in the human disease is hampered by limited availability of tissues. We therefore took advantage of the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model to study whether three different phenotypes of TRAMP tumors (PRIM, late-stage primary tumors; AIP, androgen-independent primary tumors; and MET, metastases) displayed specific patterns of CpG island hypermethylation using Restriction Landmark Genomic Scanning. Each tumor phenotype displayed numerous hypermethylation events, with the most homogeneous methylation pattern in AIP and the most heterogeneous pattern in MET. Several loci displayed a phenotype-specific methylation pattern; the most striking pattern being loci methylated at high frequency in PRIM and AIP but rarely in MET. Examination of the mRNA expression of three genes, BC058385, Goosecoid, and Neurexin 2, which exhibited nonpromoter methylation, revealed increased expression associated with downstream methylation. Only methylated samples showed mRNA expression, in which tumor phenotype was a key factor determining the level of expression. The CpG island in the human orthologue of BC058385 was methylated in human AIP but not in primary androgen-stimulated prostate cancer or benign prostate. The clinical data show a proof-of-principle that the TRAMP model can be used to identify targets of aberrant CpG island methylation relevant to human disease. In conclusion, phenotype-specific hypermethylation events were associated with the overexpression of different genes and may provide new markers of prostate tumorigenesis.

Kidney Dysfunction in Adult Offspring Exposed In Utero to Type 1 Diabetes Is Associated with Alterations in Genome-Wide DNA Methylation

PubMed Central

Gautier, Jean-François; Porcher, Raphaël; Abi Khalil, Charbel; Bellili-Munoz, Naima; Fetita, Lila Sabrina; Travert, Florence; Choukem, Simeon-Pierre; Riveline, Jean-Pierre; Hadjadj, Samy; Larger, Etienne; Boudou, Philippe; Blondeau, Bertrand; Roussel, Ronan; Ferré, Pascal; Ravussin, Eric; Rouzet, François; Marre, Michel

2015-01-01

Background Fetal exposure to hyperglycemia impacts negatively kidney development and function. Objective Our objective was to determine whether fetal exposure to moderate hyperglycemia is associated with epigenetic alterations in DNA methylation in peripheral blood cells and whether those alterations are related to impaired kidney function in adult offspring. Design Twenty nine adult, non-diabetic offspring of mothers with type 1 diabetes (T1D) (case group) were matched with 28 offspring of T1D fathers (control group) for the study of their leukocyte genome-wide DNA methylation profile (27,578 CpG sites, Human Methylation 27 BeadChip, Illumina Infinium). In a subset of 19 cases and 18 controls, we assessed renal vascular development by measuring Glomerular Filtration Rate (GFR) and Effective Renal Plasma Flow (ERPF) at baseline and during vasodilatation produced by amino acid infusion. Results Globally, DNA was under-methylated in cases vs. controls. Among the 87 CpG sites differently methylated, 74 sites were less methylated and 13 sites more methylated in cases vs. controls. None of these CpG sites were located on a gene known to be directly involved in kidney development and/or function. However, the gene encoding DNA methyltransferase 1 (DNMT1)—a key enzyme involved in gene expression during early development–was under-methylated in cases. The average methylation of the 74 under-methylated sites differently correlated with GFR in cases and controls. Conclusion Alterations in methylation profile imprinted by the hyperglycemic milieu of T1D mothers during fetal development may impact kidney function in adult offspring. The involved pathways seem to be a nonspecific imprinting process rather than specific to kidney development or function. PMID:26258530

Kidney Dysfunction in Adult Offspring Exposed In Utero to Type 1 Diabetes Is Associated with Alterations in Genome-Wide DNA Methylation.

PubMed

Gautier, Jean-François; Porcher, Raphaël; Abi Khalil, Charbel; Bellili-Munoz, Naima; Fetita, Lila Sabrina; Travert, Florence; Choukem, Simeon-Pierre; Riveline, Jean-Pierre; Hadjadj, Samy; Larger, Etienne; Boudou, Philippe; Blondeau, Bertrand; Roussel, Ronan; Ferré, Pascal; Ravussin, Eric; Rouzet, François; Marre, Michel

2015-01-01

Fetal exposure to hyperglycemia impacts negatively kidney development and function. Our objective was to determine whether fetal exposure to moderate hyperglycemia is associated with epigenetic alterations in DNA methylation in peripheral blood cells and whether those alterations are related to impaired kidney function in adult offspring. Twenty nine adult, non-diabetic offspring of mothers with type 1 diabetes (T1D) (case group) were matched with 28 offspring of T1D fathers (control group) for the study of their leukocyte genome-wide DNA methylation profile (27,578 CpG sites, Human Methylation 27 BeadChip, Illumina Infinium). In a subset of 19 cases and 18 controls, we assessed renal vascular development by measuring Glomerular Filtration Rate (GFR) and Effective Renal Plasma Flow (ERPF) at baseline and during vasodilatation produced by amino acid infusion. Globally, DNA was under-methylated in cases vs. controls. Among the 87 CpG sites differently methylated, 74 sites were less methylated and 13 sites more methylated in cases vs. controls. None of these CpG sites were located on a gene known to be directly involved in kidney development and/or function. However, the gene encoding DNA methyltransferase 1 (DNMT1)--a key enzyme involved in gene expression during early development--was under-methylated in cases. The average methylation of the 74 under-methylated sites differently correlated with GFR in cases and controls. Alterations in methylation profile imprinted by the hyperglycemic milieu of T1D mothers during fetal development may impact kidney function in adult offspring. The involved pathways seem to be a nonspecific imprinting process rather than specific to kidney development or function.

Genetics and epigenetics of small bowel adenocarcinoma: the interactions of CIN, MSI, and CIMP.

PubMed

Warth, Arne; Kloor, Matthias; Schirmacher, Peter; Bläker, Hendrik

2011-04-01

Characterization of tumor genetics and epigenetics allows to stratify a tumor entity according to molecular pathways and may shed light on the interactions of different types of DNA alterations during tumorigenesis. Small intestinal adenocarcinoma is rare, and to date the interrelation of genomic instability and epigenetics has not been investigated in this tumor type. We therefore analyzed 37 primary small bowel carcinomas with known microsatellite instability and KRAS status for chromosomal instability using comparative genomic hybridization, for the presence of aberrant methylation (CpG island methylation phenotype) by methylation-specific polymerase chain reaction, and for BRAF mutations. Chromosomal instability was detected in 22 of 37 (59%) tumors (3 of 9 microsatellite instable, and 19 of 28 microsatellite stable carcinomas). Nine carcinomas (24%) were microsatellite and chromosomally stable. High-level DNA methylation was found in 16% of chromosomal instable tumors and in 44% of both microsatellite instable and microsatellite and chromosomally stable carcinomas. KRAS was mutated in 55, 0, and 10% of chromosomal instable, microsatellite instable, and microsatellite and chromosomally stable tumors, respectively whereas the frequencies of BRAF mutations were 6% for chromosomal instable and 22% for both microsatellite instable and microsatellite and chromosomally stable carcinomas. In conclusion, in this study we show that chromosomal instable carcinomas of the small intestine are distinguished from microsatellite instable and microsatellite and chromosomally stable tumors by a high frequency of KRAS mutations, low frequencies of CpG island methylation phenotype, and BRAF mutations. In microsatellite instable and microsatellite and chromosomally stable cancers, CpG island methylation phenotype and BRAF/KRAS mutations are similarly distributed, indicating common mechanisms of tumor initiation or progression in their molecular pathogenesis.

Genetic and epigenetic regulation of YKL-40 in childhood.

PubMed

Guerra, Stefano; Melén, Erik; Sunyer, Jordi; Xu, Cheng-Jian; Lavi, Iris; Benet, Marta; Bustamante, Mariona; Carsin, Anne-Elie; Dobaño, Carlota; Guxens, Mònica; Tischer, Christina; Vrijheid, Martine; Kull, Inger; Bergström, Anna; Kumar, Ashish; Söderhäll, Cilla; Gehring, Ulrike; Dijkstra, Dorieke J; van der Vlies, Pieter; Wickman, Magnus; Bousquet, Jean; Postma, Dirkje S; Anto, Josep M; Koppelman, Gerard H

2018-03-01

Circulating levels of the chitinase-like protein YKL-40 are influenced by genetic variation in its encoding gene (chitinase 3-like 1 [CHI3L1]) and are increased in patients with several diseases, including asthma. Epigenetic regulation of circulating YKL-40 early in life is unknown. We sought to determine (1) whether methylation levels at CHI3L1 CpG sites mediate the association of CHI3L1 single nucleotide polymorphisms (SNPs) with YKL-40 levels in the blood and (2) whether these biomarkers (CHI3L1 SNPs, methylation profiles, and YKL-40 levels) are associated with asthma in early childhood. We used data from up to 2405 participants from the Spanish Infancia y Medio Ambiente; the Swedish Barn/Children, Allergy, Milieu, Stockholm, Epidemiological survey; and the Dutch Prevention and Incidence of Asthma and Mite Allergy birth cohorts. Associations between 68 CHI3L1 SNPs, methylation levels at 14 CHI3L1 CpG sites in whole-blood DNA, and circulating YKL-40 levels at 4 years of age were tested by using correlation analysis, multivariable regression, and mediation analysis. Each of these biomarkers was also tested for association with asthma at 4 years of age by using multivariable logistic regression. YKL-40 levels were significantly associated with 7 SNPs and with methylation at 5 CpG sites. Consistent associations between these 7 SNPs (particularly rs10399931 and rs4950928) and 5 CpG sites were observed. Alleles linked to lower YKL-40 levels were associated with higher methylation levels. Participants with high YKL-40 levels (defined as the highest YKL-40 tertile) had increased odds for asthma compared with subjects with low YKL-40 levels (meta-analyzed adjusted odds ratio, 1.90 [95% CI, 1.08-3.36]). In contrast, neither SNPs nor methylation levels at CpG sites in CHI3L1 were associated with asthma. The effects of CHI3L1 genetic variation on circulating YKL-40 levels are partly mediated by methylation profiles. In our study YKL-40 levels, but not CHI3L1 SNPs or methylation levels, were associated with childhood asthma. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

The AIRE -230Y Polymorphism Affects AIRE Transcriptional Activity: Potential Influence on AIRE Function in the Thymus

PubMed Central

Lovewell, Thomas R. J.; McDonagh, Andrew J.; Messenger, Andrew G.; Azzouz, Mimoun; Tazi-Ahnini, Rachid

2015-01-01

Background The autoimmune regulator (AIRE) is expressed in the thymus, particularly in thymic medullary epithelial cells (mTECs), and is required for the ectopic expression of a diverse range of peripheral tissue antigens by mTECs, facilitating their ability to perform negative selection of auto-reactive immature T-cells. The expression profile of peripheral tissue antigens is affected not only by AIRE deficiency but also with variation of AIRE activity in the thymus. Method and Results Therefore we screened 591bp upstream of the AIRE transcription start site including AIRE minimal promoter for single nucleotide polymorphism (SNPs) and identified two SNPs -655R (rs117557896) and -230Y (rs751032) respectively. To study the effect of these variations on AIRE promoter activity we generated a Flp-In host cell line which was stably transfected with a single copy of the reporter vector. Relative promoter activity was estimated by comparing the luciferase specific activity for lysates of the different reporter AIRE promoter-reporter gene constructs including AIRE-655G AIRE-230C, AIRE-655G AIRE-230T and AIRE-655A AIRE-230C. The analysis showed that the commonest haplotype AIRE-655G AIRE-230C has the highest luciferase specific activity (p<0.001). Whereas AIRE-655G AIRE-230T has a luciferase specific activity value that approaches null. Both AIRE promoter polymorphic sites have one allele that forms a CpG methylation site which we determined can be methylated in methylation assays using the M.SssI CpG methyltransferase. Conclusion AIRE-230Y is in a conserved region of the promoter and is adjacent to a predicted WT1 transcription factor binding site, suggesting that AIRE-230Y affects AIRE expression by influencing the binding of biochemical factors to this region. Our findings show that AIRE-655GAIRE-230T haplotype could dramatically alter AIRE transcription and so have an effect on the process of negative selection and affect susceptibility to autoimmune conditions. PMID:25978041

DNA Methylation of T1R1 Gene in the Vegetarian Adaptation of Grass Carp Ctenopharyngodon idella.

PubMed

Cai, Wenjing; He, Shan; Liang, Xu-Fang; Yuan, Xiaochen

2018-05-02

Although previous studies have indicated importance of taste receptors in food habits formation in mammals, little is known about those in fish. Grass carp is an excellent model for studying vegetarian adaptation, as it shows food habit transition from carnivore to herbivore. In the present study, pseudogenization or frameshift mutations of the umami receptors that hypothesized related to dietary switch in vertebrates, were not found in grass carp, suggesting other mechanisms for vegetarian adaptation in grass carp. T1R1 and T1R3 strongly responded to L-Arg and L-Lys, differing from those of zebrafish and medaka, contributing to high species specificity in amino acid preferences and diet selection of grass carp. After food habit transition of grass carp, DNA methylation levels were higher in CPG1 and CPG3 islands of upstream control region of T1R1 gene. Luciferase activity assay of upstream regulatory region of T1R1 (-2500-0 bp) without CPG1 or CPG3 indicated that CPG1 and CPG3 might be involved in transcriptional regulation of T1R1 gene. Subsequently, high DNA methylation decreased expression of T1R1 in intestinal tract. It could be a new mechanism to explain, at least partially, the vegetarian adaptation of grass carp by regulation of expression of umami receptor via epigenetic modification.

The abundance of cis-acting loci leading to differential allele expression in F1 mice and their relationship to loci harboring genes affecting complex traits.

PubMed

Yeo, Seungeun; Hodgkinson, Colin A; Zhou, Zhifeng; Jung, Jeesun; Leung, Ming; Yuan, Qiaoping; Goldman, David

2016-08-11

Genome-wide surveys have detected cis-acting quantitative trait loci altering levels of RNA transcripts (RNA-eQTLs) by associating SNV alleles to transcript levels. However, the sensitivity and specificity of detection of cis- expression quantitative trait loci (eQTLs) by genetic approaches, reliant as it is on measurements of transcript levels in recombinant inbred strains or offspring from arranged crosses, is unknown, as is their relationship to QTL's for complex phenotypes. We used transcriptome-wide differential allele expression (DAE) to detect cis-eQTLs in forebrain and kidney from reciprocal crosses between three mouse inbred strains, 129S1/SvlmJ, DBA/2J, and CAST/EiJ and C57BL/6 J. Two of these crosses were previously characterized for cis-eQTLs and QTLs for various complex phenotypes by genetic analysis of recombinant inbred (RI) strains. 5.4 %, 1.9 % and 1.5 % of genes assayed in forebrain of B6/129SF1, B6/DBAF1, and B6/CASTF1 mice, respectively, showed differential allelic expression, indicative of cis-acting alleles at these genes. Moreover, the majority of DAE QTLs were observed to be tissue-specific with only a small fraction showing cis-effects in both tissues. Comparing DAE QTLs in F1 mice to cis-eQTLs previously mapped in RI strains we observed that many of the cis-eQTLs were not confirmed by DAE. Additionally several novel DAE-QTLs not identified as cis-eQTLs were identified suggesting that there are differences in sensitivity and specificity for QTL detection between the two methodologies. Strain specific DAE QTLs in B6/DBAF1 mice were located in excess at candidate genes for alcohol use disorders, seizures, and angiogenesis previously implicated by genetic linkage in C57BL/6J × DBA/2JF2 mice or BXD RI strains. Via a survey for differential allele expression in F1 mice, a substantial proportion of genes were found to have alleles altering expression in cis-acting fashion. Comparing forebrain and kidney, many or most of these alleles were tissue-specific in action. The identification of strain specific DAE QTLs, can assist in assessment of candidate genes located within the large intervals associated with trait QTLs.

Relative contribution of variation within the APOC3/A4/A5 gene cluster in determining plasma triglycerides.

PubMed

Talmud, Philippa J; Hawe, Emma; Martin, Steve; Olivier, Michael; Miller, George J; Rubin, Edward M; Pennacchio, Len A; Humphries, Steve E

2002-11-15

Since triglycerides (TG) are a major independent risk factor for coronary heart disease, understanding their genetic and environmental determinants is of major importance. Mouse models indicate an inverse relationship between levels of the newly identified apolipoprotein AV (APOAV) and TG concentrations. We have examined the relative influence of human APOA5 variants on plasma lipids, compared to the impact of variation in APOC3 and APOA4 which lie in the same cluster. Single nucleotide polymorphisms (SNPs) in APOA5 (S19W, -1131T>C) and APOA4 (T347S, Q360H) and an APOA4/A5 intergenic T>C SNP were examined in a large study of healthy middle-aged men (n=2808). APOA5 19WW and -1131CC men had 52% and 40% higher TG (P<0.003) compared to common allele homozygotes, respectively, effects which were independent and additive. APOA4 347SS men had 23% lower TG compared to TT men (P<0.002). Haplotype analysis was carried out to identify TG-raising alleles and included, in addition, four previously genotyped APOC3 SNPs (-2845T>G, -482C>T, 1100C>T, and 3238C>G). The major TG-raising alleles were defined by APOA5 W19 and APOC3 -482T. This suggests that the TG-lowering effect of APOA4 S347 might merely reflect the strong negative linkage disequilibrium with the common alleles of these variants. Thus variation in APOA5 is associated with differences in TGs in healthy men, independent of those previously reported for APOC3, while association between APOA4 and TG reflects linkage disequilibrium with these sites. The molecular mechanisms for these effects remain to be determined.

A novel optical probe for pH sensing in gastro-esophageal apparatus

NASA Astrophysics Data System (ADS)

Baldini, F.; Ghini, G.; Giannetti, A.; Senesi, F.; Trono, C.

2011-03-01

Monitoring gastric pH for long periods, usually 24 h, may be essential in analyzing the physiological pattern of acidity, in obtaining information on changes in activity during peptic ulcer disease, and in assessing the effect of antisecretory drugs. Gastro-esophageal reflux, which causes a pH decrease in the esophagus content from pH 7 even down to pH 2, can determine esophagitis with possible strictures and Barrett's esophagus. One of the difficulties of the optical measurement of pH in the gastro-esophageal apparatus lies in the required extended working range from 1 to 8 pH units. The present paper deals with a novel optical pH sensor, using methyl red as optical pH indicator. Contrary to all acidbase indicators characterized by working ranges limited to 2-3 pH units, methyl red, after its covalent immobilization on controlled pore glass (CPG), is characterized by a wide working range which fits with the clinical requirements. The novel probe design here described is suitable for gastro-esophageal applications and allows the optimization of the performances of the CPG with the immobilised indicator. This leads to a very simple configuration characterized by a very fast response time.

Distribution of CYP2D6 and CYP2C19 Polymorphisms Associated with Poor Metabolizer Phenotype in Five Amerindian Groups and Western Mestizos from Mexico

PubMed Central

Salazar-Flores, Joel; Torres-Reyes, Luis A.; Martínez-Cortés, Gabriela; Rubi-Castellanos, Rodrigo; Sosa-Macías, Martha; Muñoz-Valle, José F.; González-González, César; Ramírez, Angélica; Román, Raquel; Méndez, José L.; Barrera, Andrés; Torres, Alfredo; Medina, Rafael

2012-01-01

Background: The distribution of polymorphisms in the CYP2D6 and CYP2C19 genes allows inferring the potential risk for specific adverse drug reactions and lack of therapeutic effects in humans. This variability shows differences among human populations. The aim of this study was to analyze single-nucleotide polymorphisms related to a poor metabolizer (PM) phenotype in nonpreviously studied Amerindian groups and Mestizos (general admixed population) from Mexico. Methods: We detected by SNaPshot® different polymorphisms located in CYP2D6 (*3, *4, *6, *7, and *8) and CYP2C19 (*2, *3, *4 and *5) in western Mestizos (n=145) and five Amerindian groups from Mexico: Tarahumaras from the North (n=88); Purépechas from the Center (n=101); and Tojolabales (n=68), Tzotziles (n=88), and Tzeltales (n=20) from the Southeast. Genotypes were observed by capillary electrophoresis. The genetic relationships among these populations were estimated based on these genes. Results and Discussion: The wild-type allele (*1) of both genes was predominant in the Mexican populations studied. The most widely observed alleles were CYP2C19*2 (range, 0%–31%) and CYP2D6*4 (range, 1.2%–7.3%), whereas CYP2D6*3 was exclusively detected in Mestizos. Conversely, CYP2C19*4 and *5, as well as CYP2D6*3, *6, *7, and *8, were not observed in the majority of the Mexican populations. The Tarahumaras presented a high frequency of the allele CYP2C19*2 (31%) and of homozygotes *2/*2 (10.7%), which represent a high frequency of potentially PM phenotypes in this Amerindian group. The genetic distances showed high differentiation of Tarahumaras (principally for CYP2C19 gene). In general, a relative proximity was observed between most of the Amerindian, Mexican-Mestizo, and Latin-American populations. Conclusion: In general, the wild-type allele (*1) predominates in Mexican populations, outlining a relatively homogeneous distribution for CYP2C19 and CYP2D6. The exception is the Tarahumara group that displays a potentially increased risk for adverse reactions to CYP2C19-metabolized drugs. PMID:22913530

Gene-Specific Differential DNA Methylation and Chronic Arsenic Exposure in an Epigenome-Wide Association Study of Adults in Bangladesh

PubMed Central

Argos, Maria; Chen, Lin; Jasmine, Farzana; Tong, Lin; Pierce, Brandon L.; Roy, Shantanu; Paul-Brutus, Rachelle; Gamble, Mary V.; Harper, Kristin N.; Parvez, Faruque; Rahman, Mahfuzar; Rakibuz-Zaman, Muhammad; Slavkovich, Vesna; Baron, John A.; Graziano, Joseph H.; Kibriya, Muhammad G.

2014-01-01

Background: Inorganic arsenic is one of the most common naturally occurring contaminants found in the environment. Arsenic is associated with a number of health outcomes, with epigenetic modification suggested as a potential mechanism of toxicity. Objective: Among a sample of 400 adult participants, we evaluated the association between arsenic exposure, as measured by blood and urinary total arsenic concentrations, and epigenome-wide white blood cell DNA methylation. Methods: We used linear regression models to examine the associations between arsenic exposure and methylation at each CpG site, adjusted for sex, age, and batch. Differentially methylated loci were subsequently examined in relation to corresponding gene expression for functional evidence of gene regulation. Results: In adjusted analyses, we observed four differentially methylated CpG sites with urinary total arsenic concentration and three differentially methylated CpG sites with blood arsenic concentration, based on the Bonferroni-corrected significance threshold of p < 1 × 10–7. Methylation of PLA2G2C (probe cg04605617) was the most significantly associated locus in relation to both urinary (p = 3.40 × 10–11) and blood arsenic concentrations (p = 1.48 × 10–11). Three additional novel methylation loci—SQSTM1 (cg01225779), SLC4A4 (cg06121226), and IGH (cg13651690)—were also significantly associated with arsenic exposure. Further, there was evidence of methylation-related gene regulation based on gene expression for a subset of differentially methylated loci. Conclusions: We observed significant associations between arsenic exposure and gene-specific differential white blood cell DNA methylation, suggesting that epigenetic modifications may be an important pathway underlying arsenic toxicity. The specific differentially methylated loci identified may inform potential pathways for future interventions. Citation: Argos M, Chen L, Jasmine F, Tong L, Pierce BL, Roy S, Paul-Brutus R, Gamble MV, Harper KN, Parvez F, Rahman M, Rakibuz-Zaman M, Slavkovich V, Baron JA, Graziano JH, Kibriya MG, Ahsan H. 2015. Gene-specific differential DNA methylation and chronic arsenic exposure in an epigenome-wide association study of adults in Bangladesh. Environ Health Perspect 123:64–71; http://dx.doi.org/10.1289/ehp.1307884 PMID:25325195

Frequency of a natural truncated allele of MdMLO19 in the germplasm of Malus domestica.

PubMed

Pessina, Stefano; Palmieri, Luisa; Bianco, Luca; Gassmann, Jennifer; van de Weg, Eric; Visser, Richard G F; Magnago, Pierluigi; Schouten, Henk J; Bai, Yuling; Riccardo Velasco, R; Malnoy, Mickael

2017-01-01

Podosphaera leucotricha is the causal agent of powdery mildew (PM) in apple. To reduce the amount of fungicides required to control this pathogen, the development of resistant apple cultivars should become a priority. Resistance to PM was achieved in various crops by knocking out specific members of the MLO gene family that are responsible for PM susceptibility (S-genes). In apple, the knockdown of MdMLO19 resulted in PM resistance. However, since gene silencing technologies such as RNAi are perceived unfavorably in Europe, a different approach that exploits this type of resistance is needed. This work evaluates the presence of non-functional naturally occurring alleles of MdMLO19 in apple germplasm. The screening of the re-sequencing data of 63 apple individuals led to the identification of 627 single nucleotide polymorphisms (SNPs) in five MLO genes ( MdMLO5, MdMLO7, MdMLO11, MdMLO18 , and MdMLO19 ), 127 of which were located in exons. The T-1201 insertion of a single nucleotide in MdMLO19 caused the formation of an early stop codon, resulting in a truncated protein lacking 185 amino acids, including the calmodulin-binding domain. The presence of the insertion was evaluated in 115 individuals. It was heterozygous in 64 and homozygous in 25. Twelve of the 25 individuals carrying the insertion in homozygosity were susceptible to PM. After barley, pea, cucumber, and tomato, apple would be the fifth species for which a natural non-functional mlo allele has been found.

Base Excision Repair of Tandem Modifications in a Methylated CpG Dinucleotide*

PubMed Central

Sassa, Akira; Çağlayan, Melike; Dyrkheeva, Nadezhda S.; Beard, William A.; Wilson, Samuel H.

2014-01-01

Cytosine methylation and demethylation in tracks of CpG dinucleotides is an epigenetic mechanism for control of gene expression. The initial step in the demethylation process can be deamination of 5-methylcytosine producing the TpG alteration and T:G mispair, and this step is followed by thymine DNA glycosylase (TDG) initiated base excision repair (BER). A further consideration is that guanine in the CpG dinucleotide may become oxidized to 7,8-dihydro-8-oxoguanine (8-oxoG), and this could affect the demethylation process involving TDG-initiated BER. However, little is known about the enzymology of BER of altered in-tandem CpG dinucleotides; e.g. Tp8-oxoG. Here, we investigated interactions between this altered dinucleotide and purified BER enzymes, the DNA glycosylases TDG and 8-oxoG DNA glycosylase 1 (OGG1), apurinic/apyrimidinic (AP) endonuclease 1, DNA polymerase β, and DNA ligases. The overall TDG-initiated BER of the Tp8-oxoG dinucleotide is significantly reduced. Specifically, TDG and DNA ligase activities are reduced by a 3′-flanking 8-oxoG. In contrast, the OGG1-initiated BER pathway is blocked due to the 5′-flanking T:G mispair; this reduces OGG1, AP endonuclease 1, and DNA polymerase β activities. Furthermore, in TDG-initiated BER, TDG remains bound to its product AP site blocking OGG1 access to the adjacent 8-oxoG. These results reveal BER enzyme specificities enabling suppression of OGG1-initiated BER and coordination of TDG-initiated BER at this tandem alteration in the CpG dinucleotide. PMID:24695738

Epicutaneous immunization with ovalbumin and CpG induces TH1/TH17 cytokines, which regulate IgE and IgG2a production

PubMed Central

Majewska-Szczepanik, Monika; Askenase, Philip W.; Lobo, Francis M.; Marcińska, Katarzyna; Wen, Li; Szczepanik, Marian

2017-01-01

Background Subcutaneous allergen-specific immunotherapy is a standard route for the immunotherapy of allergic diseases. It modulates the course of allergy and can generate long-term remission. However, subcutaneous allergen-specific immunotherapy can also induce anaphylaxis in some patients, and therefore additional routes of administration should be investigated to improve the safety and tolerability of immunotherapy. Objective We sought to determine whether epicutaneous treatment with antigen in the presence of a Toll-like receptor 9 agonist can suppress TH2-mediated responses in an antigen-specific manner. Methods Epicutaneous immunization was performed by applying a skin patch soaked with ovalbumin (OVA) plus CpG, and its suppressor activity was determined by using the mouse model of atopic dermatitis. Finally, adoptive cell transfers were implemented to characterize the regulatory cells that are induced by epicutaneous immunization. Results Epicutaneous immunization with OVA and CpG reduces the production of OVA-specific IgE and increases the synthesis of OVA-specific IgG2a antibodies in an antigen-specific manner. Moreover, eosinophil peroxidase activity in the skin and production of IL-4, IL-5, IL-10, and IL-13 are suppressed. The observed reduction of IgE synthesis is transferable with T-cell receptor (TCR) αβ+CD4+CD25− cells, whereas IgG2a production is dependent on both TCRαβ+ and TCRγδ+ T cells. Further experiments show that the described phenomenon is myeloid differentiation primary response 88, IFN-γ, and IL-17A dependent. Finally, the results suggest that epicutaneous immunization with OVA and CpG decreases the synthesis of OVA-specific IgE and skin eosinophil peroxidase activity in mice with ongoing skin allergy. Conclusion Epicutaneous application of protein antigen in the presence of adjuvant could be an attractive needle-free and self-administered immunotherapy for allergic diseases. PMID:26810716

DNA methylation profile distinguishes clear cell sarcoma of the kidney from other pediatric renal tumors.

PubMed

Ueno, Hitomi; Okita, Hajime; Akimoto, Shingo; Kobayashi, Kenichiro; Nakabayashi, Kazuhiko; Hata, Kenichiro; Fujimoto, Junichiro; Hata, Jun-Ichi; Fukuzawa, Masahiro; Kiyokawa, Nobutaka

2013-01-01

A number of specific, distinct neoplastic entities occur in the pediatric kidney, including Wilms' tumor, clear cell sarcoma of the kidney (CCSK), congenital mesoblastic nephroma (CMN), rhabdoid tumor of the kidney (RTK), and the Ewing's sarcoma family of tumors (ESFT). By employing DNA methylation profiling using Illumina Infinium HumanMethylation27, we analyzed the epigenetic characteristics of the sarcomas including CCSK, RTK, and ESFT in comparison with those of the non-neoplastic kidney (NK), and these tumors exhibited distinct DNA methylation profiles in a tumor-type-specific manner. CCSK is the most frequently hypermethylated, but least frequently hypomethylated, at CpG sites among these sarcomas, and exhibited 490 hypermethylated and 46 hypomethylated CpG sites in compared with NK. We further validated the results by MassARRAY, and revealed that a combination of four genes was sufficient for the DNA methylation profile-based differentiation of these tumors by clustering analysis. Furthermore, THBS1 CpG sites were found to be specifically hypermethylated in CCSK and, thus, the DNA methylation status of these THBS1 sites alone was sufficient for the distinction of CCSK from other pediatric renal tumors, including Wilms' tumor and CMN. Moreover, combined bisulfite restriction analysis could be applied for the detection of hypermethylation of a THBS1 CpG site. Besides the biological significance in the pathogenesis, the DNA methylation profile should be useful for the differential diagnosis of pediatric renal tumors.

Toward robust phase-locking in Melibe swim central pattern generator models

NASA Astrophysics Data System (ADS)

Jalil, Sajiya; Allen, Dane; Youker, Joseph; Shilnikov, Andrey

2013-12-01

Small groups of interneurons, abbreviated by CPG for central pattern generators, are arranged into neural networks to generate a variety of core bursting rhythms with specific phase-locked states, on distinct time scales, which govern vital motor behaviors in invertebrates such as chewing and swimming. These movements in lower level animals mimic motions of organs in higher animals due to evolutionarily conserved mechanisms. Hence, various neurological diseases can be linked to abnormal movement of body parts that are regulated by a malfunctioning CPG. In this paper, we, being inspired by recent experimental studies of neuronal activity patterns recorded from a swimming motion CPG of the sea slug Melibe leonina, examine a mathematical model of a 4-cell network that can plausibly and stably underlie the observed bursting rhythm. We develop a dynamical systems framework for explaining the existence and robustness of phase-locked states in activity patterns produced by the modeled CPGs. The proposed tools can be used for identifying core components for other CPG networks with reliable bursting outcomes and specific phase relationships between the interneurons. Our findings can be employed for identifying or implementing the conditions for normal and pathological functioning of basic CPGs of animals and artificially intelligent prosthetics that can regulate various movements.

Crossovers are associated with mutation and biased gene conversion at recombination hotspots.

PubMed

Arbeithuber, Barbara; Betancourt, Andrea J; Ebner, Thomas; Tiemann-Boege, Irene

2015-02-17

Meiosis is a potentially important source of germline mutations, as sites of meiotic recombination experience recurrent double-strand breaks (DSBs). However, evidence for a local mutagenic effect of recombination from population sequence data has been equivocal, likely because mutation is only one of several forces shaping sequence variation. By sequencing large numbers of single crossover molecules obtained from human sperm for two recombination hotspots, we find direct evidence that recombination is mutagenic: Crossovers carry more de novo mutations than nonrecombinant DNA molecules analyzed for the same donors and hotspots. The observed mutations were primarily CG to TA transitions, with a higher frequency of transitions at CpG than non-CpGs sites. This enrichment of mutations at CpG sites at hotspots could predominate in methylated regions involving frequent single-stranded DNA processing as part of DSB repair. In addition, our data set provides evidence that GC alleles are preferentially transmitted during crossing over, opposing mutation, and shows that GC-biased gene conversion (gBGC) predominates over mutation in the sequence evolution of hotspots. These findings are consistent with the idea that gBGC could be an adaptation to counteract the mutational load of recombination.

Crossovers are associated with mutation and biased gene conversion at recombination hotspots

PubMed Central

Arbeithuber, Barbara; Betancourt, Andrea J.; Ebner, Thomas; Tiemann-Boege, Irene

2015-01-01

Meiosis is a potentially important source of germline mutations, as sites of meiotic recombination experience recurrent double-strand breaks (DSBs). However, evidence for a local mutagenic effect of recombination from population sequence data has been equivocal, likely because mutation is only one of several forces shaping sequence variation. By sequencing large numbers of single crossover molecules obtained from human sperm for two recombination hotspots, we find direct evidence that recombination is mutagenic: Crossovers carry more de novo mutations than nonrecombinant DNA molecules analyzed for the same donors and hotspots. The observed mutations were primarily CG to TA transitions, with a higher frequency of transitions at CpG than non-CpGs sites. This enrichment of mutations at CpG sites at hotspots could predominate in methylated regions involving frequent single-stranded DNA processing as part of DSB repair. In addition, our data set provides evidence that GC alleles are preferentially transmitted during crossing over, opposing mutation, and shows that GC-biased gene conversion (gBGC) predominates over mutation in the sequence evolution of hotspots. These findings are consistent with the idea that gBGC could be an adaptation to counteract the mutational load of recombination. PMID:25646453

[Distribution of DRD4 and DAT1 alleles from dopaminergic system in a mixed Chilean population].

PubMed

Vieyra, Gonzalo; Moraga, Mauricio; Henríquez, Hugo; Aboitiz, Francisco; Rothhammer, Francisco

2003-02-01

Genes for dopamine receptor DRD4 and dopamine transporter DAT1 are highly polymorphic. Two alleles of these genes, namely the DRD4.7 and the DAT1*9 are frequently associated to the attention deficit disorder with hyperactivity. In Europe, the allele for DRD4 receptor with four repetitions (DRD4.4) has the highest frequency, with a median of 69%, followed by DRD4.7, with a frequency of 15%. South American indigenous populations have higher frequencies for DRD4.7 (61%) than for DRD4.4 (29%). The ten repetition allele for DAT1 transporter has a high frequency among Europeans (72%) and Amerindians (100%). The allele DAT1*9 is the second most frequent allele. To study the frequency of DRD4 and DAT1 alleles in a Chilean population sample. One hundred serum samples were obtained from blood donors in two public hospitals in Santiago. Polymorphic regions for DRD4 and DAT1 were amplified by polymerase chain reaction. The allele DRD4.4 had a frequency of 59% and DRD4.7 a frequency of 27%. The allele DAT1*10 had a frequency of 74%, followed by DAT 1*9, with a frequency of 23%. In a Chilean population sample, the frequency of DRD4 and DAT1 alleles was very similar to that of European populations.

Deregulation of an imprinted gene network in prostate cancer

PubMed Central

Ribarska, Teodora; Goering, Wolfgang; Droop, Johanna; Bastian, Klaus-Marius; Ingenwerth, Marc; Schulz, Wolfgang A

2014-01-01

Multiple epigenetic alterations contribute to prostate cancer progression by deregulating gene expression. Epigenetic mechanisms, especially differential DNA methylation at imprinting control regions (termed DMRs), normally ensure the exclusive expression of imprinted genes from one specific parental allele. We therefore wondered to which extent imprinted genes become deregulated in prostate cancer and, if so, whether deregulation is due to altered DNA methylation at DMRs. Therefore, we selected presumptive deregulated imprinted genes from a previously conducted in silico analysis and from the literature and analyzed their expression in prostate cancer tissues by qRT-PCR. We found significantly diminished expression of PLAGL1/ZAC1, MEG3, NDN, CDKN1C, IGF2, and H19, while LIT1 was significantly overexpressed. The PPP1R9A gene, which is imprinted in selected tissues only, was strongly overexpressed, but was expressed biallelically in benign and cancerous prostatic tissues. Expression of many of these genes was strongly correlated, suggesting co-regulation, as in an imprinted gene network (IGN) reported in mice. Deregulation of the network genes also correlated with EZH2 and HOXC6 overexpression. Pyrosequencing analysis of all relevant DMRs revealed generally stable DNA methylation between benign and cancerous prostatic tissues, but frequent hypo- and hyper-methylation was observed at the H19 DMR in both benign and cancerous tissues. Re-expression of the ZAC1 transcription factor induced H19, CDKN1C and IGF2, supporting its function as a nodal regulator of the IGN. Our results indicate that a group of imprinted genes are coordinately deregulated in prostate cancers, independently of DNA methylation changes. PMID:24513574

Deregulation of an imprinted gene network in prostate cancer.

PubMed

Ribarska, Teodora; Goering, Wolfgang; Droop, Johanna; Bastian, Klaus-Marius; Ingenwerth, Marc; Schulz, Wolfgang A

2014-05-01

Multiple epigenetic alterations contribute to prostate cancer progression by deregulating gene expression. Epigenetic mechanisms, especially differential DNA methylation at imprinting control regions (termed DMRs), normally ensure the exclusive expression of imprinted genes from one specific parental allele. We therefore wondered to which extent imprinted genes become deregulated in prostate cancer and, if so, whether deregulation is due to altered DNA methylation at DMRs. Therefore, we selected presumptive deregulated imprinted genes from a previously conducted in silico analysis and from the literature and analyzed their expression in prostate cancer tissues by qRT-PCR. We found significantly diminished expression of PLAGL1/ZAC1, MEG3, NDN, CDKN1C, IGF2, and H19, while LIT1 was significantly overexpressed. The PPP1R9A gene, which is imprinted in selected tissues only, was strongly overexpressed, but was expressed biallelically in benign and cancerous prostatic tissues. Expression of many of these genes was strongly correlated, suggesting co-regulation, as in an imprinted gene network (IGN) reported in mice. Deregulation of the network genes also correlated with EZH2 and HOXC6 overexpression. Pyrosequencing analysis of all relevant DMRs revealed generally stable DNA methylation between benign and cancerous prostatic tissues, but frequent hypo- and hyper-methylation was observed at the H19 DMR in both benign and cancerous tissues. Re-expression of the ZAC1 transcription factor induced H19, CDKN1C and IGF2, supporting its function as a nodal regulator of the IGN. Our results indicate that a group of imprinted genes are coordinately deregulated in prostate cancers, independently of DNA methylation changes.

Quality assessment of osteoporosis clinical practice guidelines for physical activity and safe movement: an AGREE II appraisal.

PubMed

Armstrong, James Jacob; Rodrigues, Isabel Braganca; Wasiuta, Tom; MacDermid, Joy C

2016-01-01

Many osteoporosis clinical practice guidelines are published, and the extent to which physical activity and safe movement is addressed varies. To better inform clinical decision-making, a quality assessment and structured analysis of recommendations was undertaken. Guideline quality varied substantially, and improvement is necessary in physical activity and safe movement recommendations. The purpose of the present study is to survey available osteoporosis clinical practice guidelines (CPGs) containing physical activity and safe movement recommendations in order to assess the methodological quality with which they were developed. An analysis of the various physical activity and safe movement recommendations was conducted to determine variability between CPGs. An online literature search revealed 19 CPGs meeting our inclusion criteria. Three independent scorers evaluated CPG quality using the Appraisal of Guidelines for Research and Evaluation version II (AGREE II) instrument. Two separate individuals used a standard table to extract relevant recommendations. Intra-reviewer AGREE II score agreement ranged from fair to good (intra-class correlation coefficient (ICC) = 0.34 to 0.65). The quality of the 19 included CPGs was variable (AGREE sub-scores: 14 to 100%). CPGs scored higher in the "scope and purpose" and "clarity of presentation" domains. They scored the lowest in "applicability" and "editorial independence." Four CPGs were classified as high quality, ten average quality, and five low quality. Most CPGs recommended weight-bearing, muscle-strengthening, and resistance exercises. Information on exercise dosage, progression, and contraindications was often absent. Immobility and movements involving spinal flexion and/or torsion were discouraged. There were several high-quality CPGs; however, variability in quality and lack of specific parameters for implementation necessitates caution and critical examination by readers. CPG development groups should pay special attention to the clinical applicability of their CPGs as well as fully disclosing conflicts of interest. CPGs were in general an agreement regarding safe physical activity and safe movement recommendations. However, recommendations were often vague and the more specific recommendations were inconsistent between CPGs.

Enhanced immune response to gastric cancer specific antigen Peptide by coencapsulation with CpG oligodeoxynucleotides in nanoemulsion.

PubMed

Shi, Rui; Hong, Liu; Wu, Daocheng; Ning, Xiaoxuan; Chen, Yu; Lin, Tao; Fan, Daiming; Wu, Kaichun

2005-02-01

CpG oligodeoxynucleotides (CpG ODN) have been shown to have potent adjuvant activity for a wide range of antigens. Of particular interest is their improved activity when closely associated with the antigen. The purpose of this study is to construct a nanovaccine coencapsulated with a gastric cancer specific antigen MG7 mimotope peptide and adjuvant CpG ODN 1645 using new nanotechnology as nanoemulsion and evaluate its immunocompetence. Nanoemulsion vaccine was prepared using magnetic ultrasound methods. BALB/c mice were immunized and the in vivo effectiveness was evaluated using tumor challenge assay. It was shown that the tumor masses formed in the mice immunized with coencapsulated nanovaccine (0.0825 g) markedly smaller (P < 0.01) than those formed in the mice immunized with nanovaccine encapsulated with antigen peptide alone (0.4465 g). A tumor inhibiting rate as high as 82.5% of the coencapsulated nanovaccine was obtained, while nanovaccine encapsulated with peptide only could not achieve the same effect (28.5%) (P < 0.01). Enzyme-linked immunospot assay (ELISPOT) showed that immunization using MG7 mimotope peptide coencapsulated with CpG ODN within the same nanoemulsion enhanced the frequency of splenocytes secreting IFN-gamma significantly (P < 0.01) when compared with immunization using MG7 peptide encapsulated in nanoemulsion alone (197spots/1 x 10(6) vs. 73 spots/1 x 10(6)). Cellular ELISA indicated that serum titer of antibody against MG7-Ag was significantly higher (P < 0.01) in mice immunized with coencapsulation form nanovaccine (0.7884) than that in the group immunized with nanovaccine encapsulated with MG7 peptide alone (0.3616). Using intracellular flow cytometric analysis, it was found that the IFN-gamma response was contributed by CD4+ T-cells. Our experiments suggest that a vaccinal approach using nano-delivery system carrying in tumoral epitope and CpG ODN as adjuvant may have important implications for cancer therapy.

Helicobacter pylori virulence genes and host genetic polymorphisms as risk factors for peptic ulcer disease.

PubMed

Miftahussurur, Muhammad; Yamaoka, Yoshio

2015-01-01

Helicobacter pylori infection plays an important role in the pathogenesis of peptic ulcer disease (PUD). Several factors have been proposed as possible H. pylori virulence determinants; for example, bacterial adhesins and gastric inflammation factors are associated with an increased risk of PUD. However, differences in bacterial virulence factors alone cannot explain the opposite ends of the PUD disease spectrum, that is duodenal and gastric ulcers; presumably, both bacterial and host factors contribute to the differential response. Carriers of the high-producer alleles of the pro-inflammatory cytokines IL-1B, IL-6, IL-8, IL-10, and TNF-α who also carry low-producer allele of anti-inflammatory cytokines have severe gastric mucosal inflammation, whereas carriers of the alternative alleles have mild inflammation. Recent reports have suggested that the PSCA and CYP2C19 ultra-rapid metabolizer genotypes are also associated with PUD.

Analysis of S-RNase alleles of almond (Prunus dulcis): characterization of new sequences, resolution of synonyms and evidence of intragenic recombination.

PubMed

Ortega, Encarnación; Bosković, Radovan I; Sargent, Daniel J; Tobutt, Kenneth R

2006-11-01

Cross-compatibility relationships in almond are controlled by a gametophytically expressed incompatibility system partly mediated by stylar RNases, of which 29 have been reported. To resolve possible synonyms and to provide data for phylogenetic analysis, 21 almond S-RNase alleles were cloned and sequenced from SP (signal peptide region) or C1 (first conserved region) to C5, except for the S29 allele, which could be cloned only from SP to C1. Nineteen sequences (S4, S6, S11-S22, S25-S29)) were potentially new whereas S10 and S24 had previously been published but with different labels. The sequences for S16 and S17 were identical to that for S1, published previously; likewise, S15 was identical to S5. In addition, S4 and S20 were identical, as were S13 and S19. A revised version of the standard table of almond incompatibility genotypes is presented. Several alleles had AT or GA tandem repeats in their introns. Sequences of the 23 distinct newly cloned or already published alleles were aligned. Sliding windows analysis of Ka/Ks identified regions where positive selection may operate; in contrast to the Maloideae, most of the region from the beginning of C3 to the beginning of RC4 appeared not to be under positive selection. Phylogenetic analysis indicated four pairs of alleles had "bootstrap" support > 80%: S5/S10, S4/S8, S11/S24, and S3/S6. Various motifs up to 19 residues long occurred in at least two alleles, and their distributions were consistent with intragenic recombination, as were separate phylogenetic analyses of the 5' and 3' sections. Sequence comparison of phylogenetically related alleles indicated the significance of the region between RC4 and C5 in defining specificity.

BDNF rs6265 methylation and genotype interact on risk for schizophrenia

PubMed Central

Ursini, Gianluca; Cavalleri, Tommaso; Fazio, Leonardo; Angrisano, Tiziana; Iacovelli, Luisa; Porcelli, Annamaria; Maddalena, Giancarlo; Punzi, Giovanna; Mancini, Marina; Gelao, Barbara; Romano, Raffaella; Masellis, Rita; Calabrese, Francesca; Rampino, Antonio; Taurisano, Paolo; Giorgio, Annabella Di; Keller, Simona; Tarantini, Letizia; Sinibaldi, Lorenzo; Quarto, Tiziana; Popolizio, Teresa; Caforio, Grazia; Blasi, Giuseppe; Riva, Marco A.; De Blasi, Antonio; Chiariotti, Lorenzo; Bollati, Valentina; Bertolino, Alessandro

2016-01-01

Abstract Epigenetic mechanisms can mediate gene-environment interactions relevant for complex disorders. The BDNF gene is crucial for development and brain plasticity, is sensitive to environmental stressors, such as hypoxia, and harbors the functional SNP rs6265 (Val66Met), which creates or abolishes a CpG dinucleotide for DNA methylation. We found that methylation at the BDNF rs6265 Val allele in peripheral blood of healthy subjects is associated with hypoxia-related early life events (hOCs) and intermediate phenotypes for schizophrenia in a distinctive manner, depending on rs6265 genotype: in ValVal individuals increased methylation is associated with exposure to hOCs and impaired working memory (WM) accuracy, while the opposite is true for ValMet subjects. Also, rs6265 methylation and hOCs interact in modulating WM-related prefrontal activity, another intermediate phenotype for schizophrenia, with an analogous opposite direction in the 2 genotypes. Consistently, rs6265 methylation has a different association with schizophrenia risk in ValVals and ValMets. The relationships of methylation with BDNF levels and of genotype with BHLHB2 binding likely contribute to these opposite effects of methylation. We conclude that BDNF rs6265 methylation interacts with genotype to bridge early environmental exposures to adult phenotypes, relevant for schizophrenia. The study of epigenetic changes in regions containing genetic variation relevant for human diseases may have beneficial implications for the understanding of how genes are actually translated into phenotypes. PMID:26889735

Ancestry-Shift Refinement Mapping of the C6orf97-ESR1 Breast Cancer Susceptibility Locus

PubMed Central

Stacey, Simon N.; Sulem, Patrick; Zanon, Carlo; Gudjonsson, Sigurjon A.; Thorleifsson, Gudmar; Helgason, Agnar; Jonasdottir, Aslaug; Besenbacher, Soren; Kostic, Jelena P.; Fackenthal, James D.; Huo, Dezheng; Adebamowo, Clement; Ogundiran, Temidayo; Olson, Janet E.; Fredericksen, Zachary S.; Wang, Xianshu; Look, Maxime P.; Sieuwerts, Anieta M.; Martens, John W. M.; Pajares, Isabel; Garcia-Prats, Maria D.; Ramon-Cajal, Jose M.; de Juan, Ana; Panadero, Angeles; Ortega, Eugenia; Aben, Katja K. H.; Vermeulen, Sita H.; Asadzadeh, Fatemeh; van Engelenburg, K. C. Anton; Margolin, Sara; Shen, Chen-Yang; Wu, Pei-Ei; Försti, Asta; Lenner, Per; Henriksson, Roger; Johansson, Robert; Enquist, Kerstin; Hallmans, Göran; Jonsson, Thorvaldur; Sigurdsson, Helgi; Alexiusdottir, Kristin; Gudmundsson, Julius; Sigurdsson, Asgeir; Frigge, Michael L.; Gudmundsson, Larus; Kristjansson, Kristleifur; Halldorsson, Bjarni V.; Styrkarsdottir, Unnur; Gulcher, Jeffrey R.; Hemminki, Kari; Lindblom, Annika; Kiemeney, Lambertus A.; Mayordomo, Jose I.; Foekens, John A.; Couch, Fergus J.; Olopade, Olufunmilayo I.; Gudbjartsson, Daniel F.; Thorsteinsdottir, Unnur; Rafnar, Thorunn; Johannsson, Oskar T.; Stefansson, Kari

2010-01-01

We used an approach that we term ancestry-shift refinement mapping to investigate an association, originally discovered in a GWAS of a Chinese population, between rs2046210[T] and breast cancer susceptibility. The locus is on 6q25.1 in proximity to the C6orf97 and estrogen receptor α (ESR1) genes. We identified a panel of SNPs that are correlated with rs2046210 in Chinese, but not necessarily so in other ancestral populations, and genotyped them in breast cancer case∶control samples of Asian, European, and African origin, a total of 10,176 cases and 13,286 controls. We found that rs2046210[T] does not confer substantial risk of breast cancer in Europeans and Africans (OR = 1.04, P = 0.099, and OR = 0.98, P = 0.77, respectively). Rather, in those ancestries, an association signal arises from a group of less common SNPs typified by rs9397435. The rs9397435[G] allele was found to confer risk of breast cancer in European (OR = 1.15, P = 1.2×10−3), African (OR = 1.35, P = 0.014), and Asian (OR = 1.23, P = 2.9×10−4) population samples. Combined over all ancestries, the OR was 1.19 (P = 3.9×10−7), was without significant heterogeneity between ancestries (Phet = 0.36) and the SNP fully accounted for the association signal in each ancestry. Haplotypes bearing rs9397435[G] are well tagged by rs2046210[T] only in Asians. The rs9397435[G] allele showed associations with both estrogen receptor positive and estrogen receptor negative breast cancer. Using early-draft data from the 1,000 Genomes project, we found that the risk allele of a novel SNP (rs77275268), which is closely correlated with rs9397435, disrupts a partially methylated CpG sequence within a known CTCF binding site. These studies demonstrate that shifting the analysis among ancestral populations can provide valuable resolution in association mapping. PMID:20661439

Immunogenic properties of a recombinant fusion protein containing the C-terminal 19 kDa of Plasmodium falciparum merozoite surface protein-1 and the innate immunity agonist FliC flagellin of Salmonella typhimurium.

PubMed

Bargieri, Daniel Y; Leite, Juliana A; Lopes, Stefanie C P; Sbrogio-Almeida, Maria Elisabete; Braga, Catarina J M; Ferreira, Luis C S; Soares, Irene S; Costa, Fabio T M; Rodrigues, Mauricio M

2010-04-01

In a recent study, we demonstrated the immunogenic properties of a new malaria vaccine polypeptide based on a 19 kDa C-terminal fragment of the merozoite surface protein-1 (MSP1(19)) from Plasmodium vivax and an innate immunity agonist, the Salmonella enterica serovar Typhimurium flagellin (FliC). Herein, we tested whether the same strategy, based on the MSP1(19) component of the deadly malaria parasite Plasmodium falciparum, could also generate a fusion polypeptide with enhanced immunogenicity. The His(6)FliC-MSP1(19) fusion protein was expressed from a recombinant Escherichia coli and showed preserved in vitro TLR5-binding activity. In contrast to animals injected with His(6)MSP1(19), mice subcutaneously immunised with the recombinant His(6)FliC-MSP1(19) developed strong MSP1(19)-specific systemic antibody responses with a prevailing IgG1 subclass. Incorporation of other adjuvants, such as CpG ODN 1826, complete and incomplete Freund's adjuvants or Quil-A, improved the IgG responses after the second, but not the third, immunising dose. It also resulted in a more balanced IgG subclass response, as evaluated by the IgG1/IgG2c ratio, and higher cell-mediated immune response, as determined by the detection of antigen-specific interferon-gamma secretion by immune spleen cells. MSP1(19)-specific antibodies recognised not only the recombinant protein, but also the native protein expressed on the surface of P. falciparum parasites. Finally, sera from rabbits immunised with the fusion protein alone inhibited the in vitro growth of three different P. falciparum strains. In summary, these results extend our previous observations and further demonstrate that fusion of the innate immunity agonist FliC to Plasmodium antigens is a promising alternative to improve their immunogenicity. (c) 2010 Elsevier Ltd. All rights reserved.

Prevalence of C282Y, H63D, and S65C mutations in hereditary HFE-hemochromatosis gene in Lithuanian population.

PubMed

Kucinskas, Laimutis; Juzenas, Simonas; Sventoraityte, Jurgita; Cedaviciute, Ruta; Vitkauskiene, Astra; Kalibatas, Vytenis; Kondrackiene, Jurate; Kupcinskas, Limas

2012-04-01

HFE-hemochromatosis is a common autosomal recessive disease caused by HFE gene mutations and characterized as iron overload and failure of different organs. The aim of this study was to determine the prevalence of C282Y (c.845 G>A), H63D (c.187 C>G), and S65C (c.193A>T) alleles of HFE gene in the Lithuanian population. One thousand and eleven healthy blood donors of Lithuanian nationality were examined in four different ethnic Lithuanian regions to determine HFE gene alleles and genotype frequencies. The samples of DNA were analyzed for the presence of restriction fragment length polymorphism and validated by DNA sequencing. Among 1,011 blood donors tested, the frequency of C282Y, H63D, and S65C alleles were 2.6%, 15.9%, and 1.9%, respectively. One third of the tested subjects (n = 336) had at least one of the C282Y or H63D HFE gene mutations. The screening of Lithuanian blood donors has detected 13 (1.3%) subjects with a genotype C282Y/C282Y or C282Y/H63D responsible for the development of HFE-hemochromatosis. The prevalence of C282Y mutation was significantly higher among the inhabitants of Zemaitija (Somogitia) at the Baltic Sea area (5.9%) in comparison to the regions of continental part of Lithuania (2.4% in Dzukija, 2.3% in Aukstaitija, and 2% in Suvalkija, p < 0.05). These data support the hypothesis that the p.C282Y mutation originated from Scandinavia and spread with the Vikings along the Baltic Sea coast. The first epidemiological investigation of HFE gene mutations in ethnic Lithuanians showed that the frequencies of H63D, C282Y, and S65C of HFE gene alleles are similar to the other North-Eastern Europeans, especially in the Baltic region (Estonia, Latvia), Poland, and part of Russia (Moscow region).

Aberrant DNA methylation at genes associated with a stem cell-like phenotype in cholangiocarcinoma tumours

PubMed Central

Dai, Wei; Siddiq, Afshan; Walley, Andrew J; Limpaiboon, Temduang; Brown, Robert

2013-01-01

Genetic abnormalities of cholangiocarcinoma have been widely studied; however, epigenomic changes related to cholangiocarcinogenesis have been less well characterised. We have profiled the DNA methylomes of 28 primary cholangiocarcinoma and six matched adjacent normal tissues using Infinium’s HumanMethylation27 BeadChips with the aim of identifying gene sets aberrantly epigenetically regulated in this tumour type. Using a linear model for microarray data we identified 1610 differentially methylated autosomal CpG sites with 809 CpG sites (representing 603 genes) being hypermethylated and 801 CpG sites (representing 712 genes) being hypomethylated in cholangiocarcinoma versus adjacent normal tissues (false discovery rate ≤ 0.05). Gene ontology and gene set enrichment analyses identified gene sets significantly associated with hypermethylation at linked CpG sites in cholangiocarcinoma including homeobox genes and target genes of PRC2, EED, SUZ12 and histone H3 trimethylation at lysine 27. We confirmed frequent hypermethylation at the homeobox genes HOXA9 and HOXD9 by bisulfite pyrosequencing in a larger cohort of cholangiocarcinoma (n = 102). Our findings indicate a key role for hypermethylation of multiple CpG sites at genes associated with a stem cell-like phenotype as a common molecular aberration in cholangiocarcinoma. These data have implications for cholangiocarcinogenesis, as well as possible novel treatment options using histone methyltransferase inhibitors. PMID:24089088

Linkage disequilibrium between the CYP2C19*2,*17 and CYP2C9*1 alleles and impact of VKORC1, CYP2C9, CYP2C19 gene polymorphisms and gene-gene interactions on warfarin therapy.

PubMed

Khalighi, Koroush; Cheng, Gang; Mirabbasi, Seyedabbas; Khalighi, Bahar; Wu, Yin; Fan, Wuqiang

2017-01-01

Warfarin therapy is complicated by its large inter-individual and intra-individual variability. Both genetic and non-genetic factors can affect warfarin therapy. This study aims to investigate the allele distribution of VKORC1, CYP2C9 and CYP2C19, contribution of different allele variants and possible gene-gene interaction on warfarin therapy. Four hundreds and ninety-two patients were enrolled and single nucleotide polymorphisms for vitamin K epoxide reductase complex subunit 1 (VKORC1), cytochrome P450 CYP2C9 and cytochrome P450 CYP2C19 were genotyped. CYP2C9*1 allele is in complete linkage disequilibrium with CYP2C19*2 and CYP2C19*17 (D' = 1) in our study population. Patient with VKORC1-1639 G > A, CYP2C9*2 and CYP2C9*3 genetic variants need significant lower warfarin dose than patient with wild type allele of VKORC1 1639 G or CYP2C9*1. There is no significant differences between CYP2C19 allele variants for warfarin stable dose and INR > 5 event. Because of the complete linkage disequilibrium between CYP2C19*2,*17 and CYP2C9*1, patient with CYP2C19 *2/*2, *2/*17 and *17/*17 genotypes tend to have higher warfarin dose than patient with CYP2C19*1/*1 genotype. Stepwise regression analysis showed that VKORC1, CYP2C9, body mass index (BMI), age and gender were included as a factor significantly contributing to warfarin dose, whereas CYP2C19 did not contribute to warfarin dose. No statistically significant interaction between CYP2C9 and VKORC1 on warfarin dose and INR > 5 event was detected in univariate general linear model analysis. Our study suggests that polymorphic variants of VKORC1 and CYP2C9 affect warfarin dose independently, whereas CYP2C19 did not contribute to warfarin therapy.

Low molecular weight glutenin subunit gene Glu-B3h confers superior dough strength and breadmaking quality in wheat (Triticum aestivum L.)

PubMed Central

Wang, Yaping; Zhen, Shoumin; Luo, Nana; Han, Caixia; Lu, Xiaobing; Li, Xiaohui; Xia, Xianchun; He, Zhonghu; Yan, Yueming

2016-01-01

Low molecular weight glutenin subunit is one of the important quality elements in wheat (Triticum aestivum L.). Although considerable allelic variation has been identified, the functional properties of individual alleles at Glu-3 loci are less studied. In this work, we performed the first comprehensive study on the molecular characteristics and functional properties of the Glu-B3h gene using the wheat cultivar CB037B and its Glu-B3 deletion line CB037C. The results showed that the Glu-B3h deletion had no significant effects on plant morphological or yield traits, but resulted in a clear reduction in protein body number and size and main quality parameters, including inferior mixing property, dough strength, loaf volume, and score. Molecular characterization showed that the Glu-B3h gene consists of 1179 bp, and its encoded B-subunit has a longer repetitive domain and an increased number of α-helices, as well as higher expression, which could contribute to superior flour quality. The SNP-based allele-specific PCR markers designed for the Glu-B3h gene were developed and validated with bread wheat holding various alleles at Glu-B3 locus, which could effectively distinguish the Glu-B3h gene from others at the Glu-B3 locus, and have potential applications for wheat quality improvement through marker-assisted selection. PMID:27273251

Perception, attitude, and satisfaction of paediatric physicians and nurses towards clinical practice guidelines at a university teaching hospital.

PubMed

Amer, Yasser Sami; Al Nemri, Abdulrahman; Osman, Mohamed Elfaki; Saeed, Elshazaly; Assiri, Asaad Mohamed; Mohamed, Sarar

2018-04-03

To explore perception, attitude, and satisfaction of paediatric clinicians, trainees, and nurses at King Khalid University Hospital towards clinical practice guidelines (CPGs) including the locally adapted diabetic ketoacidosis CPG (DKA-CPG). A cross-sectional survey was distributed to 260 doctors and nurses working in the paediatrics department. The response rate was 95.4%. The respondents had a positive perception and attitude towards general CPGs and specifically for the DKA-CPG; 98.7% thought CPGs were useful sources of advice, improved safety, and decreased risk, and reduced variation in practice. A total of 99.2% thought CPGs were good clinical tools, 98.3% satisfied with, had confidence in well-developed CPGs, and would recommend them to their colleagues to use, and 94.6% agreed they were cost-effective. The preferred format for CPGs was paper (46.6%) and electronic (42.9%). The DKA-CPG helped in managing patients and respondents were all satisfied and had confidence with it (100%). The rationale and objectives of the DKA-CPG were clear for 99.25%; 98.5% thought the layout was clear and well organized and user-friendly (96.2%). Compared with nurses, physicians had a higher perception towards CPGs in general (P < .05) and the DKA-CPG (P < .05). The paediatric doctors, and nurses have a great perception and satisfaction and positive attitude towards CPGs in general, towards the paediatric diabetic ketoacidosis CPG in particular, which in turn had a positive impact on the acceptability and implementation of the CPGs. These findings could help in sustaining a safe and high-quality health care environment through implementation of evidence-based CPGs. © 2018 John Wiley & Sons, Ltd.

A dinucleotide motif in oligonucleotides shows potent immunomodulatory activity and overrides species-specific recognition observed with CpG motif.

PubMed

Kandimalla, Ekambar R; Bhagat, Lakshmi; Zhu, Fu-Gang; Yu, Dong; Cong, Yan-Ping; Wang, Daqing; Tang, Jimmy X; Tang, Jin-Yan; Knetter, Cathrine F; Lien, Egil; Agrawal, Sudhir

2003-11-25

Bacterial and synthetic DNAs containing CpG dinucleotides in specific sequence contexts activate the vertebrate immune system through Toll-like receptor 9 (TLR9). In the present study, we used a synthetic nucleoside with a bicyclic heterobase [1-(2'-deoxy-beta-d-ribofuranosyl)-2-oxo-7-deaza-8-methyl-purine; R] to replace the C in CpG, resulting in an RpG dinucleotide. The RpG dinucleotide was incorporated in mouse- and human-specific motifs in oligodeoxynucleotides (oligos) and 3'-3-linked oligos, referred to as immunomers. Oligos containing the RpG motif induced cytokine secretion in mouse spleen-cell cultures. Immunomers containing RpG dinucleotides showed activity in transfected-HEK293 cells stably expressing mouse TLR9, suggesting direct involvement of TLR9 in the recognition of RpG motif. In J774 macrophages, RpG motifs activated NF-kappa B and mitogen-activated protein kinase pathways. Immunomers containing the RpG dinucleotide induced high levels of IL-12 and IFN-gamma, but lower IL-6 in time- and concentration-dependent fashion in mouse spleen-cell cultures costimulated with IL-2. Importantly, immunomers containing GTRGTT and GARGTT motifs were recognized to a similar extent by both mouse and human immune systems. Additionally, both mouse- and human-specific RpG immunomers potently stimulated proliferation of peripheral blood mononuclear cells obtained from diverse vertebrate species, including monkey, pig, horse, sheep, goat, rat, and chicken. An immunomer containing GTRGTT motif prevented conalbumin-induced and ragweed allergen-induced allergic inflammation in mice. We show that a synthetic bicyclic nucleotide is recognized in the C position of a CpG dinucleotide by immune cells from diverse vertebrate species without bias for flanking sequences, suggesting a divergent nucleotide motif recognition pattern of TLR9.

A Chimeric Plasmodium falciparum Merozoite Surface Protein Vaccine Induces High Titers of Parasite Growth Inhibitory Antibodies

PubMed Central

Alaro, James R.; Partridge, Andrea; Miura, Kazutoyo; Diouf, Ababacar; Lopez, Ana M.; Angov, Evelina; Long, Carole A.

2013-01-01

The C-terminal 19-kDa domain of Plasmodium falciparum merozoite surface protein 1 (PfMSP119) is an established target of protective antibodies. However, clinical trials of PfMSP142, a leading blood-stage vaccine candidate which contains the protective epitopes of PfMSP119, revealed suboptimal immunogenicity and efficacy. Based on proof-of-concept studies in the Plasmodium yoelii murine model, we produced a chimeric vaccine antigen containing recombinant PfMSP119 (rPfMSP119) fused to the N terminus of P. falciparum merozoite surface protein 8 that lacked its low-complexity Asn/Asp-rich domain, rPfMSP8 (ΔAsn/Asp). Immunization of mice with the chimeric rPfMSP1/8 vaccine elicited strong T cell responses to conserved epitopes associated with the rPfMSP8 (ΔAsn/Asp) fusion partner. While specific for PfMSP8, this T cell response was adequate to provide help for the production of high titers of antibodies to both PfMSP119 and rPfMSP8 (ΔAsn/Asp) components. This occurred with formulations adjuvanted with either Quil A or with Montanide ISA 720 plus CpG oligodeoxynucleotide (ODN) and was observed in both inbred and outbred strains of mice. PfMSP1/8-induced antibodies were highly reactive with two major alleles of PfMSP119 (FVO and 3D7). Of particular interest, immunization with PfMSP1/8 elicited higher titers of PfMSP119-specific antibodies than a combined formulation of rPfMSP142 and rPfMSP8 (ΔAsn/Asp). As a measure of functionality, PfMSP1/8-specific rabbit IgG was shown to potently inhibit the in vitro growth of blood-stage parasites of the FVO and 3D7 strains of P. falciparum. These data support the further testing and evaluation of this chimeric PfMSP1/8 antigen as a component of a multivalent vaccine for P. falciparum malaria. PMID:23897613

The role of system Xc- in methamphetamine-induced dopaminergic neurotoxicity in mice.

PubMed

Dang, Duy-Khanh; Shin, Eun-Joo; Tran, Hai-Quyen; Kim, Dae-Joong; Jeong, Ji Hoon; Jang, Choon-Gon; Nah, Seung-Yeol; Sato, Hideyo; Nabeshima, Toshitaka; Yoneda, Yukio; Kim, Hyoung-Chun

2017-09-01

The cystine/glutamate antiporter (system Xc - , Sxc) transports cystine into cell in exchange for glutamate. Since xCT is a specific subunit of Sxc, we employed xCT knockout mice and investigated whether this antiporter affected methamphetamine (MA)-induced dopaminergic neurotoxicity. MA treatment significantly increased striatal oxidative burdens in wild type mice. xCT inhibitor [i.e., S-4-carboxy-phenylglycine (CPG), sulfasalazine] or an xCT knockout significantly protected against these oxidative burdens. MA-induced increases in Iba-1 expression and Iba-1-labeled microglial immunoreactivity (Iba-1-IR) were significantly attenuated by CPG or sulfasalazine administration or xCT knockout. CPG or sulfasalazine significantly attenuated MA-induced TUNEL-positive cell populations in the striatum of Taconic ICR mice. The decrease in excitatory amino acid transporter-2 (or glutamate transporter-1) expression and increase in glutamate release were attenuated by CPG, sulfasalazine or xCT knockout. In addition, CPG, sulfasalazine or xCT knockout significantly protected against dopaminergic loss (i.e., decreases in tyrosine hydroxylase expression and immunoreactivity, and an increase in dopamine turnover rate) induced by MA. However, CPG, sulfasalazine or xCT knockout did not significantly affect the impaired glutathione system [i.e., decrease in reduced glutathione (GSH) and increase in oxidized glutathione (GSSG)] induced by MA. Our results suggest that Sxc mediates MA-induced neurotoxicity via facilitating oxidative stress, microgliosis, proapoptosis, and glutamate-related toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

GeneiASE: Detection of condition-dependent and static allele-specific expression from RNA-seq data without haplotype information

PubMed Central

Edsgärd, Daniel; Iglesias, Maria Jesus; Reilly, Sarah-Jayne; Hamsten, Anders; Tornvall, Per; Odeberg, Jacob; Emanuelsson, Olof

2016-01-01

Allele-specific expression (ASE) is the imbalance in transcription between maternal and paternal alleles at a locus and can be probed in single individuals using massively parallel DNA sequencing technology. Assessing ASE within a single sample provides a static picture of the ASE, but the magnitude of ASE for a given transcript may vary between different biological conditions in an individual. Such condition-dependent ASE could indicate a genetic variation with a functional role in the phenotypic difference. We investigated ASE through RNA-sequencing of primary white blood cells from eight human individuals before and after the controlled induction of an inflammatory response, and detected condition-dependent and static ASE at 211 and 13021 variants, respectively. We developed a method, GeneiASE, to detect genes exhibiting static or condition-dependent ASE in single individuals. GeneiASE performed consistently over a range of read depths and ASE effect sizes, and did not require phasing of variants to estimate haplotypes. We observed condition-dependent ASE related to the inflammatory response in 19 genes, and static ASE in 1389 genes. Allele-specific expression was confirmed by validation of variants through real-time quantitative RT-PCR, with RNA-seq and RT-PCR ASE effect-size correlations r = 0.67 and r = 0.94 for static and condition-dependent ASE, respectively. PMID:26887787

The effects of maternal anxiety during pregnancy on IGF2/H19 methylation in cord blood

PubMed Central

Mansell, T; Novakovic, B; Meyer, B; Rzehak, P; Vuillermin, P; Ponsonby, A-L; Collier, F; Burgner, D; Saffery, R; Ryan, J; Vuillermin, Peter; Ponsonby, Anne-Louise; Carlin, John B; Allen, Katie J; Tang, Mimi L; Saffery, Richard; Ranganathan, Sarath; Burgner, David; Dwyer, Terry; Jachno, Kim; Sly, Peter

2016-01-01

Compelling evidence suggests that maternal mental health in pregnancy can influence fetal development. The imprinted genes, insulin-like growth factor 2 (IGF2) and H19, are involved in fetal growth and each is regulated by DNA methylation. This study aimed to determine the association between maternal mental well-being during pregnancy and differentially methylated regions (DMRs) of IGF2 (DMR0) and the IGF2/H19 imprinting control region (ICR) in newborn offspring. Maternal depression, anxiety and perceived stress were assessed at 28 weeks of pregnancy in the Barwon Infant Study (n=576). DNA methylation was measured in purified cord blood mononuclear cells using the Sequenom MassArray Platform. Maternal anxiety was associated with a decrease in average ICR methylation (Δ=−2.23% 95% CI=−3.68 to −0.77%), and across all six of the individual CpG units in anxious compared with non-anxious groups. Birth weight and sex modified the association between prenatal anxiety and infant methylation. When stratified into lower (⩽3530 g) and higher (>3530 g) birth weight groups using the median birth weight, there was a stronger association between anxiety and ICR methylation in the lower birth weight group (Δ=−3.89% 95% CI=−6.06 to −1.72%), with no association in the higher birth weight group. When stratified by infant sex, there was a stronger association in female infants (Δ=−3.70% 95% CI=−5.90 to −1.51%) and no association in males. All the linear regression models were adjusted for maternal age, smoking and folate intake. These findings show that maternal anxiety in pregnancy is associated with decreased IGF2/H19 ICR DNA methylation in progeny at birth, particularly in female, low birth weight neonates. ICR methylation may help link poor maternal mental health and adverse birth outcomes, but further investigation is needed. PMID:27023171

Bisphenol A-associated epigenomic changes in prepubescent girls: a cross-sectional study in Gharbiah, Egypt

PubMed Central

2013-01-01

Background There is now compelling evidence that epigenetic modifications link adult disease susceptibility to environmental exposures during specific life stages, including pre-pubertal development. Animal studies indicate that bisphenol A (BPA), the monomer used in epoxy resins and polycarbonate plastics, may impact health through epigenetic mechanisms, and epidemiological data associate BPA levels with metabolic disorders, behavior changes, and reproductive effects. Thus, we conducted an environmental epidemiology study of BPA exposure and CpG methylation in pre-adolescent girls from Gharbiah, Egypt hypothesizing that methylation profiles exhibit exposure-dependent trends. Methods Urinary concentrations of total (free plus conjugated) species of BPA in spot samples were quantified for 60 girls aged 10 to 13. Genome-wide CpG methylation was concurrently measured in bisulfite-converted saliva DNA using the Infinium HumanMethylation27 BeadChip (N = 46). CpG sites from four candidate genes were validated via quantitative bisulfite pyrosequencing. Results CpG methylation varied widely among girls, and higher urinary BPA concentrations were generally associated with less genomic methylation. Based on pathway analyses, genes exhibiting reduced methylation with increasing urinary BPA were involved in immune function, transport activity, metabolism, and caspase activity. In particular, hypomethylation of CpG targets on chromosome X was associated with higher urinary BPA. Using the Comparative Toxicogenomics Database, we identified a number of candidate genes in our sample that previously have been associated with BPA-related expression change. Conclusions These data indicate that BPA may affect human health through specific epigenomic modification of genes in relevant pathways. Thus, epigenetic epidemiology holds promise for the identification of biomarkers from previous exposures and the development of epigenetic-based diagnostic strategies. PMID:23590724

Royal Australian and New Zealand College of Psychiatrists clinical practice guidelines for the treatment of eating disorders.

PubMed

Hay, Phillipa; Chinn, David; Forbes, David; Madden, Sloane; Newton, Richard; Sugenor, Lois; Touyz, Stephen; Ward, Warren

2014-11-01

This clinical practice guideline for treatment of DSM-5 feeding and eating disorders was conducted as part of the Royal Australian and New Zealand College of Psychiatrists (RANZCP) Clinical Practice Guidelines (CPG) Project 2013-2014. The CPG was developed in accordance with best practice according to the National Health and Medical Research Council of Australia. Literature of evidence for treatments of anorexia nervosa (AN), bulimia nervosa (BN), binge eating disorder (BED), other specified and unspecified eating disorders and avoidant restrictive food intake disorder (ARFID) was sourced from the previous RANZCP CPG reviews (dated to 2009) and updated with a systematic review (dated 2008-2013). A multidisciplinary working group wrote the draft CPG, which then underwent expert, community and stakeholder consultation, during which process additional evidence was identified. In AN the CPG recommends treatment as an outpatient or day patient in most instances (i.e. in the least restrictive environment), with hospital admission for those at risk of medical and/or psychological compromise. A multi-axial and collaborative approach is recommended, including consideration of nutritional, medical and psychological aspects, the use of family based therapies in younger people and specialist therapist-led manualised based psychological therapies in all age groups and that include longer-term follow-up. A harm minimisation approach is recommended in chronic AN. In BN and BED the CPG recommends an individual psychological therapy for which the best evidence is for therapist-led cognitive behavioural therapy (CBT). There is also a role for CBT adapted for internet delivery, or CBT in a non-specialist guided self-help form. Medications that may be helpful either as an adjunctive or alternative treatment option include an antidepressant, topiramate, or orlistat (the last for people with comorbid obesity). No specific treatment is recommended for ARFID as there are no trials to guide practice. Specific evidence based psychological and pharmacological treatments are recommended for most eating disorders but more trials are needed for specific therapies in AN, and research is urgently needed for all aspects of ARFID assessment and management. Associate Professor Susan Byrne, Dr Angelica Claudino, Dr Anthea Fursland, Associate Professor Jennifer Gaudiani, Dr Susan Hart, Ms Gabriella Heruc, Associate Professor Michael Kohn, Dr Rick Kausman, Dr Sarah Maguire, Ms Peta Marks, Professor Janet Treasure and Mr Andrew Wallis. © The Royal Australian and New Zealand College of Psychiatrists 2014.

Phylogenetic Analysis of Enterohemorrhagic Escherichia coli O157, Germany, 1987–2008

PubMed Central

Jenke, Christian; Harmsen, Dag; Weniger, Thomas; Rothgänger, Jörg; Hyytiä-Trees, Eija; Bielaszewska, Martina; Karch, Helge

2010-01-01

Multilocus variable number tandem repeat analysis (MLVA) is a subtyping technique for characterizing human pathogenic bacteria such as enterohemorrhagic Escherichia coli (EHEC) O157. We determined the phylogeny of 202 epidemiologically unrelated EHEC O157:H7/H– clinical isolates through 8 MLVA loci obtained in Germany during 1987–2008. Biodiversity in the loci ranged from 0.66 to 0.90. Four of 8 loci showed null alleles and a frequency <44.1%. These loci were distributed among 48.5% of all strains. Overall, 141 MLVA profiles were identified. Phylogenetic analysis assigned 67.3% of the strains to 19 MLVA clusters. Specific MLVA profiles with an evolutionary persistence were identified, particularly within sorbitol-fermenting EHEC O157:H–.These pathogens belonged to the same MLVA cluster. Our findings indicate successful persistence of this clone. PMID:20350374

Genetic landscape of extreme responders with anaplastic oligodendroglioma.

PubMed

Holdhoff, Matthias; Cairncross, Gregory J; Kollmeyer, Thomas M; Zhang, Ming; Zhang, Peixin; Mehta, Minesh P; Werner-Wasik, Maria; Souhami, Luis; Bahary, Jean-Paul; Kwok, Young; Hartford, Alan C; Chakravarti, Arnab; Yegnasubramanian, Srinivasan; Vogelstein, Bert; Papadopoulos, Nickolas; Kinzler, Kenneth; Jenkins, Robert B; Bettegowda, Chetan

2017-05-30

The NRG Oncology RTOG 9402 trial showed significant survival benefit in patients with 1p/19q co-deleted anaplastic oligodendrogliomas (AO) who received both radiation (RT) and chemotherapy (PCV regimen) versus RT alone. Substantial separation of the survival curves was only seen after 7.3 years. We aimed to determine whether there are specific genetic alterations that distinguish co-deleted AO patients who benefit from the addition of PCV from those who do not. We performed whole exome sequencing on matched tumor and normal DNA from all available short-term (STS) and long-term survivors (LTS) who received RT+PCV. hTERT status and rs55705857 genotypes (G-allele) were analyzed in both cohorts. Six STS (survival of <7.3y) and 7 LTS (survival of ≥7.3y and no progression) had sufficient material for analysis. There was no significant difference between the groups regarding age, performance status and extent of resection. On average, STS had 7 and LTS 4 mutations. Most common mutations in STS vs. LTS were: IDH1 (67 vs. 86%), CIC (50 vs. 71%) and FUBP1 (17 vs. 71%). The hTERT promoter was mutated in 83% STS and 86% LTS. Genotyping of rs55705857 showed a higher prevalence of G allele carriers in LTS than STS (43 vs. 17%). These findings confirm that IDH, CIC, FUBP1 mutations and rs55705857 genotype are common in AO. No distinct genetic signature was identified to differentiate STS and LTS.

Mitochondrial haplogroup H1 is protective for ischemic stroke in Portuguese patients.

PubMed

Rosa, Alexandra; Fonseca, Benedita V; Krug, Tiago; Manso, Helena; Gouveia, Liliana; Albergaria, Isabel; Gaspar, Gisela; Correia, Manuel; Viana-Baptista, Miguel; Simões, Rita Moiron; Pinto, Amélia Nogueira; Taipa, Ricardo; Ferreira, Carla; Fontes, João Ramalho; Silva, Mário Rui; Gabriel, João Paulo; Matos, Ilda; Lopes, Gabriela; Ferro, José M; Vicente, Astrid M; Oliveira, Sofia A

2008-07-01

The genetic contribution to stroke is well established but it has proven difficult to identify the genes and the disease-associated alleles mediating this effect, possibly because only nuclear genes have been intensely investigated so far. Mitochondrial DNA (mtDNA) has been implicated in several disorders having stroke as one of its clinical manifestations. The aim of this case-control study was to assess the contribution of mtDNA polymorphisms and haplogroups to ischemic stroke risk. We genotyped 19 mtDNA single nucleotide polymorphisms (SNPs) defining the major European haplogroups in 534 ischemic stroke patients and 499 controls collected in Portugal, and tested their allelic and haplogroup association with ischemic stroke risk. Haplogroup H1 was found to be significantly less frequent in stroke patients than in controls (OR = 0.61, 95% CI = 0.45-0.83, p = 0.001), when comparing each clade against all other haplogroups pooled together. Conversely, the pre-HV/HV and U mtDNA lineages emerge as potential genetic factors conferring risk for stroke (OR = 3.14, 95% CI = 1.41-7.01, p = 0.003, and OR = 2.87, 95% CI = 1.13-7.28, p = 0.021, respectively). SNPs m.3010G>A, m.7028C>T and m.11719G>A strongly influence ischemic stroke risk, their allelic state in haplogroup H1 corroborating its protective effect. Our data suggests that mitochondrial haplogroup H1 has an impact on ischemic stroke risk in a Portuguese sample.

Formulation of vaccines containing CpG oligonucleotides and alum

PubMed Central

Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

2007-01-01

CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

Association study of ERβ, AR, and CYP19A1 genes and MtF transsexualism.

PubMed

Fernández, Rosa; Esteva, Isabel; Gómez-Gil, Esther; Rumbo, Teresa; Almaraz, Mari Cruz; Roda, Ester; Haro-Mora, Juan-Jesús; Guillamón, Antonio; Pásaro, Eduardo

2014-12-01

The etiology of male-to-female (MtF) transsexualism is unknown. Both genetic and neurological factors may play an important role. To investigate the possible influence of the genetic factor on the etiology of MtF transsexualism. We carried out a cytogenetic and molecular analysis in 442 MtFs and 473 healthy, age- and geographical origin-matched XY control males. The karyotype was investigated by G-banding and by high-density array in the transsexual group. The molecular analysis involved three tandem variable regions of genes estrogen receptor β (ERβ) (CA tandem repeats in intron 5), androgen receptor (AR) (CAG tandem repeats in exon 1), and CYP19A1 (TTTA tandem repeats in intron 4). The allele and genotype frequencies, after division into short and long alleles, were obtained. We investigated the association between genotype and transsexualism by performing a molecular analysis of three variable regions of genes ERβ, AR, and CYP19A1 in 915 individuals (442 MtFs and 473 control males). Most MtFs showed an unremarkable 46,XY karyotype (97.96%). No specific chromosome aberration was associated with MtF transsexualism, and prevalence of aneuploidy (2.04%) was slightly higher than in the general population. Molecular analyses showed no significant difference in allelic or genotypic distribution of the genes examined between MtFs and controls. Moreover, molecular findings presented no evidence of an association between the sex hormone-related genes (ERβ, AR, and CYP19A1) and MtF transsexualism. The study suggests that the analysis of karyotype provides limited information in these subjects. Variable regions analyzed from ERβ, AR, and CYP19A1 are not associated with MtF transsexualism. Nevertheless, this does not exclude other polymorphic regions not analyzed. © 2014 International Society for Sexual Medicine.

Differential regulation of genomic imprinting by TET proteins in embryonic stem cells.

PubMed

Liu, Lizhi; Mao, Shi-Qing; Ray, Chelsea; Zhang, Yu; Bell, Fong T; Ng, Sheau-Fang; Xu, Guo-Liang; Li, Xiajun

2015-09-01

TET proteins have been found to play an important role in active demethylation at CpG sites in mammals. There are some reports implicating their functions in removal of DNA methylation imprint at the imprinted regions in the germline. However, it is not well established whether TET proteins can also be involved in demethylation of DNA methylation imprint in embryonic stem (ES) cells. Here we report that loss of TET proteins caused a significant increase in DNA methylation at the Igf2-H19 imprinted region in ES cells. We also observed a variable increase in DNA methylation at the Peg1 imprinted region in the ES clones devoid of TET proteins, in particular in the differentiated ES cells. By contrast, we did not observe a significant increase of DNA methylation imprint at the Peg3, Snrpn and Dlk1-Dio3 imprinted regions in ES cells lacking TET proteins. Interestingly, loss of TET proteins did not result in a significant increase of DNA methylation imprint at the Igf2-H19 and Peg1 imprinted regions in the embryoid bodies (EB). Therefore, TET proteins seem to be differentially involved in maintaining DNA methylation imprint at a subset of imprinted regions in ES cells and EBs. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Immunogenicity of porcine circovirus type 2 nucleic acid vaccine containing CpG motif for mice.

PubMed

Li, Jun; Yu, Jiang; Xu, Shaojian; Shi, Jianli; Xu, Shengnan; Wu, Xiaoyan; Fu, Fang; Peng, Zhe; Zhang, Lingling; Zheng, Shuxuan; Yuan, Xiaoyuan; Cong, Xiaoyan; Sun, Wenbo; Cheng, Kaihui; Du, Yijun; Wu, Jiaqiang; Wang, Jinbao

2016-11-14

This study aimed at reseaching the immune effect of porcine circovirus type 2 (PCV2) DNA vaccine containing CpG motif on mice. A total of 40 6-week-old female BALB/c mice were randomly divided into four groups which were immunized by 18CpG-pVAX1-ORF2, pVAX1-ORF2, pVAX1 and PBS, respectively, and immunized again 2 weeks later. All mice were challenged with 0.2 mL PCV2 cells virulent strain SD (10 6.0 TCID 50 /mL) after 4 weeks. Average daily gain, blood antibody levels, microscopic changes and viremia were detected to estimate the effect of DNA vaccine. The results showed that compared to those of the control mice, groups immunized with pVAX1-ORF2 and 18CpG-pVAX1-ORF2 could induce PCV2-specific antibodies. The PCV2-specific antibodies level of 18 CpG-pVAX1-ORF2 groups was higher significantly than other groups and decreased slowly along with time. There was no distinct pathological damage and viremia occurring in mice that inoculated with CpG motif DNA vaccines. The results demonstrated that the DNA vaccine containing 18 CpG could build up resistibility immunity and reduce immune organ damage on mice.

Correlation of the level of full-length CFTR transcript with pulmonary phenotype in patients carrying R117H and 1342-1,-2delAG mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamosh, A.; Cutting, G.R.; Oates, R.

The R117H mutation occurs on two chromosome backgrounds, one associated with a 7 thymidine tract (7T-R11H) in the splice-acceptor site of intron 8, the other with a 5 thymidine tract (5T-R117H). We examined exon 9 splicing efficiency in 5 patients of genotype R117H/{delta}F508 and one carrying 1342-1,-2delAG{delta}F508, an obligate exon 9 slice site mutation. Four patients carried R117H on a 7T background -- three adult men with congenital bilateral absence of the vas deferens and one adolescent female with pancreatitis and borderline sweat chloride concentration. The patient with R117H on a 5T background had pancreatic sufficient CF (PS-CF). The 1342-1,-2delAGmore » patient has classic pancreatic insufficient CF (PI-CF). cDNA was synthesized from total RNA extracted from nasal epithlial cells and analyzed for CFTR splicing by 35 cycle PCR using primers in exon 7 and 11. The quantity of full length transcript derived from the R117H or {delta}F508 alleles was assessed by allele-specific oligonucleotide hybridization. While 91.4% of transcript from the 5T-R117H allele was full-length, only 42.2% of CFTR transcript from the 5T-R117H allele was full length. Since CBAVD patients have no lung disease and PS-CF patients do, this indicates that the threshold of developing CF lung disease is crossed when the amount of CFTR transcript bearing R117H is reduced by half. Interestingly, 17.1% of transcript derived from the 1342-1,-2delAG allele (or 8.6% of total CFTR transcript) was normal and full length. This suggests that up to 9% of full length wild-type CFTR transcript may be inadequate to escape the lung disease of CF and that a 9 thymidine tract followed by AAC (the result of the AG deletion) can be used as a splice donor with 2-9% efficiency.« less

Physical Activity Attenuates the Influence of FTO Variants on Obesity Risk: A Meta-Analysis of 218,166 Adults and 19,268 Children

PubMed Central

Kilpeläinen, Tuomas O.; Qi, Lu; Brage, Soren; Sharp, Stephen J.; Sonestedt, Emily; Demerath, Ellen; Ahmad, Tariq; Mora, Samia; Kaakinen, Marika; Sandholt, Camilla Helene; Holzapfel, Christina; Autenrieth, Christine S.; Hyppönen, Elina; Cauchi, Stéphane; He, Meian; Kutalik, Zoltan; Kumari, Meena; Stančáková, Alena; Meidtner, Karina; Balkau, Beverley; Tan, Jonathan T.; Mangino, Massimo; Timpson, Nicholas J.; Song, Yiqing; Zillikens, M. Carola; Jablonski, Kathleen A.; Garcia, Melissa E.; Johansson, Stefan; Bragg-Gresham, Jennifer L.; Wu, Ying; van Vliet-Ostaptchouk, Jana V.; Onland-Moret, N. Charlotte; Zimmermann, Esther; Rivera, Natalia V.; Tanaka, Toshiko; Stringham, Heather M.; Silbernagel, Günther; Kanoni, Stavroula; Feitosa, Mary F.; Snitker, Soren; Ruiz, Jonatan R.; Metter, Jeffery; Larrad, Maria Teresa Martinez; Atalay, Mustafa; Hakanen, Maarit; Amin, Najaf; Cavalcanti-Proença, Christine; Grøntved, Anders; Hallmans, Göran; Jansson, John-Olov; Kuusisto, Johanna; Kähönen, Mika; Lutsey, Pamela L.; Nolan, John J.; Palla, Luigi; Pedersen, Oluf; Pérusse, Louis; Renström, Frida; Scott, Robert A.; Shungin, Dmitry; Sovio, Ulla; Tammelin, Tuija H.; Rönnemaa, Tapani; Lakka, Timo A.; Uusitupa, Matti; Rios, Manuel Serrano; Ferrucci, Luigi; Bouchard, Claude; Meirhaeghe, Aline; Fu, Mao; Walker, Mark; Borecki, Ingrid B.; Dedoussis, George V.; Fritsche, Andreas; Ohlsson, Claes; Boehnke, Michael; Bandinelli, Stefania; van Duijn, Cornelia M.; Ebrahim, Shah; Lawlor, Debbie A.; Gudnason, Vilmundur; Harris, Tamara B.; Sørensen, Thorkild I. A.; Mohlke, Karen L.; Hofman, Albert; Uitterlinden, André G.; Tuomilehto, Jaakko; Lehtimäki, Terho; Raitakari, Olli; Isomaa, Bo; Njølstad, Pål R.; Florez, Jose C.; Liu, Simin; Ness, Andy; Spector, Timothy D.; Tai, E. Shyong; Froguel, Philippe; Boeing, Heiner; Laakso, Markku; Marmot, Michael; Bergmann, Sven; Power, Chris; Khaw, Kay-Tee; Chasman, Daniel; Ridker, Paul; Hansen, Torben; Monda, Keri L.; Illig, Thomas; Järvelin, Marjo-Riitta; Wareham, Nicholas J.; Hu, Frank B.; Groop, Leif C.; Orho-Melander, Marju; Ekelund, Ulf; Franks, Paul W.; Loos, Ruth J. F.

2011-01-01

Background The FTO gene harbors the strongest known susceptibility locus for obesity. While many individual studies have suggested that physical activity (PA) may attenuate the effect of FTO on obesity risk, other studies have not been able to confirm this interaction. To confirm or refute unambiguously whether PA attenuates the association of FTO with obesity risk, we meta-analyzed data from 45 studies of adults (n = 218,166) and nine studies of children and adolescents (n = 19,268). Methods and Findings All studies identified to have data on the FTO rs9939609 variant (or any proxy [r 2>0.8]) and PA were invited to participate, regardless of ethnicity or age of the participants. PA was standardized by categorizing it into a dichotomous variable (physically inactive versus active) in each study. Overall, 25% of adults and 13% of children were categorized as inactive. Interaction analyses were performed within each study by including the FTO×PA interaction term in an additive model, adjusting for age and sex. Subsequently, random effects meta-analysis was used to pool the interaction terms. In adults, the minor (A−) allele of rs9939609 increased the odds of obesity by 1.23-fold/allele (95% CI 1.20–1.26), but PA attenuated this effect (p interaction  = 0.001). More specifically, the minor allele of rs9939609 increased the odds of obesity less in the physically active group (odds ratio  = 1.22/allele, 95% CI 1.19–1.25) than in the inactive group (odds ratio  = 1.30/allele, 95% CI 1.24–1.36). No such interaction was found in children and adolescents. Conclusions The association of the FTO risk allele with the odds of obesity is attenuated by 27% in physically active adults, highlighting the importance of PA in particular in those genetically predisposed to obesity. Please see later in the article for the Editors' Summary PMID:22069379

Genome-wide CpG island methylation and intergenic demethylation propensities vary among different tumor sites.

PubMed

Lee, Seung-Tae; Wiemels, Joseph L

2016-02-18

The epigenetic landscape of cancer includes both focal hypermethylation and broader hypomethylation in a genome-wide manner. By means of a comprehensive genomic analysis on 6637 tissues of 21 tumor types, we here show that the degrees of overall methylation in CpG island (CGI) and demethylation in intergenic regions, defined as 'backbone', largely vary among different tumors. Depending on tumor type, both CGI methylation and backbone demethylation are often associated with clinical, epidemiological and biological features such as age, sex, smoking history, anatomic location, histological type and grade, stage, molecular subtype and biological pathways. We found connections between CGI methylation and hypermutability, microsatellite instability, IDH1 mutation, 19p gain and polycomb features, and backbone demethylation with chromosomal instability, NSD1 and TP53 mutations, 5q and 19p loss and long repressive domains. These broad epigenetic patterns add a new dimension to our understanding of tumor biology and its clinical implications. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Diet, Helicobacter pylori, and p53 mutations in gastric cancer: a molecular epidemiology study in Italy.

PubMed

Palli, D; Caporaso, N E; Shiao, Y H; Saieva, C; Amorosi, A; Masala, G; Rice, J M; Fraumeni, J F

1997-12-01

A series of 105 gastric cancer (GC) cases with paraffin-embedded specimens interviewed in a previous population-based case-control study conducted in a high-risk area around Florence, Italy, was examined for the presence of p53 mutations. Overall, 33 of 105 cases had a mutation (p53+) identified by single-strand conformational polymorphism and confirmed by sequencing (Y-H. Shiao et al., submitted for publication). p53+ cases had a more traditional dietary pattern (i.e., corn meal mush, meat soup, and other homemade dishes) and reported less frequent consumption of raw vegetables (particularly lettuce and raw carrots). A positive association with a high nitrite intake and a negative association with raw vegetables and diffuse type histology persisted in a multivariate analysis. In addition, p53+ cases tended to be located in the upper portion of the stomach and to be associated with advanced age and blood group A. No relation was found between the presence of p53 mutations and histologically defined Helicobacter pylori infection, smoking history, family history of gastric cancer, education, and social class. Of the 33 p53+ cases, 19 had G:C-->A:T transitions at CpG sites. These tumors tended to occur in females and in association with H. pylori infection but not other risk factors. The remaining 14 cases with a p53 mutation had mainly transversions but also two deletions and two transitions at non-CpG sites. These tumors showed a strong positive association with a traditional dietary pattern and with the estimated intake of selected nutrients (nitrite, protein, and fat, particularly from animal sources). The findings of this case-case analysis suggest that p53 mutations at non-CpG sites are related to exposure to alkylating compounds from diet, whereas p53 mutations at CpG sites might be related to H. pylori infection.

Association between the DRD2 A1 allele and response to methadone and buprenorphine maintenance treatments.

PubMed

Barratt, Daniel T; Coller, Janet K; Somogyi, Andrew A

2006-06-05

The TaqI A polymorphism (A(1)) of the dopamine D(2) receptor gene (DRD2), although not a specific predictor of opioid dependence, has been strongly associated with high levels of prior heroin use and poor treatment outcomes among methadone maintenance patients. The aims of this study were to confirm these findings via a retrospective analysis of A(1) allele frequency in methadone (n = 46) and buprenorphine (n = 25) patients, and non-opioid-dependent controls (n = 95). Subjects were genotyped at the DRD2 TaqI A locus using PCR amplification followed by TaqI restriction enzyme digestion and gel electrophoresis. For methadone and buprenorphine subjects, heroin use (prior to treatment), treatment outcomes, and withdrawal occurrence were determined from comprehensive case notes. No significant differences in A(1) allele frequency (%) were observed between: methadone (19.6%), buprenorphine (18.0%), and control (17.9%) groups (P > 0.7); successful and poor treatment outcome groups, methadone: 20.0% and 19.2%, respectively (P = 1.0); buprenorphine: 18.4% and 20.0%, respectively (P = 1.0). Also, there were no significant relationships between TaqI A genotype and prior heroin use (P = 0.47). However, among the successful methadone subjects, significantly fewer A(1) allele carriers experienced withdrawal than non-A(1) carriers (P = 0.04). In conclusion, the DRD2 genotype effects did not affect opioid maintenance treatment outcomes. This suggests the need for a further prospective investigation into the role of the DRD2 A(1) allele in heroin use and response to maintenance pharmacotherapies for opioid dependence.

Molecular and morphological characterization of local apple cultivars in Southern Spain.

PubMed

Pérez-Romero, L F; Suárez, M P; Dapena, E; Rallo, P

2015-02-20

The number of local and traditional fruit cultivars in Andalusia (Southern Spain) has decreased dramatically since the 1970s when new commercial cultivars from breeding programs were introduced, replacing old varieties, and thus decreasing genetic diversity. The present study was included in a genetic resources project with the objective of identifying and preserving traditional fruit tree cultivars in Southern Spain. The goal of this study was to begin the characterization of 29 apple accessions (Malus x domestica Borkh) belonging to 13 traditional cultivar denominations. For molecular characterization studies, 12 simple sequence repeat markers previously developed for apple species were used. Morphological characterization was performed using 33 fruit traits. A total of 115 alleles were amplified for the 12 loci, ranging from 7 (CH01h01, CH01h10, and GD 12) to 13 alleles per locus (CH02c11). Forty-one alleles were unique to specific genotypes. The locus with the highest number of detected unique alleles was CH01f03b with 6 alleles. Expected heterozygosity ranged from 0.74 for CH01h10 to 0.88 for CH02c11, with an average of 0.82. Observed heterozygosity varied from 0.45 for CH01h01 to 1.0 for CH02d08, with an average of 0.86. Three homonyms were found for accessions belonging to varieties 'Maguillo', 'Pero Minguela', and 'Castellana'. The most discriminant morphological characters studied revealed no homonyms or synonyms among cultivar denominations, although they are useful for describing varietal characteristics that have not been previously defined.

Enhancement of infectious disease vaccines through TLR9-dependent recognition of CpG DNA.

PubMed

McCluskie, M J; Krieg, A M

2006-01-01

The adaptive immune system-with its remarkable ability to generate antigen-specific antibodies and T lymphocytes against pathogens never before "seen" by an organism-is one of the marvels of evolution. However, to generate these responses, the adaptive immune system requires activation by the innate immune system. Toll-like receptors (TLRs) are perhaps the best-understood family of innate immune receptors for detecting infections and stimulating adaptive immune responses. TLR9 appears to have evolved to recognize infections by a subtle structural difference between eukaryotic and prokaryotic/viral DNA; only the former frequently methylates CpG dinucleotides. Used as vaccine adjuvants, synthetic oligodeoxynucleotide (ODN) ligands for TLR9--CpG ODN--greatly enhance the speed and strength of the immune responses to vaccination.

Two Orangutan Species Have Evolved Different KIR Alleles and Haplotypes1

PubMed Central

Guethlein, Lisbeth A.; Norman, Paul J.; Heijmans, Corinne M. C.; de Groot, Natasja G.; Hilton, Hugo G.; Babrzadeh, Farbod; Abi-Rached, Laurent; Bontrop, Ronald E.; Parham, Peter

2017-01-01

The immune and reproductive functions of human Natural Killer (NK) cells are regulated by interactions of the C1 and C2 epitopes of HLA-C with C1-specific and C2-specific lineage III killer cell immunoglobulin-like receptors (KIR). This rapidly evolving and diverse system of ligands and receptors is restricted to humans and great apes. In this context, the orangutan has particular relevance because it represents an evolutionary intermediate, one having the C1 epitope and corresponding KIR, but lacking the C2 epitope. Through a combination of direct sequencing, KIR genotyping and data mining from the Great Ape Genome Project (GAGP) we characterized the KIR alleles and haplotypes for panels of ten Bornean orangutans and 19 Sumatran orangutans. The orangutan KIR haplotypes have between five and ten KIR genes. The seven orangutan lineage III KIR genes all locate to the centromeric region of the KIR locus, whereas their human counterparts also populate the telomeric region. One lineage III KIR gene is Bornean-specific, one is Sumatran-specific and five are shared. Of twelve KIR gene-content haplotypes five are Bornean-specific, five are Sumatran-specific and two are shared. The haplotypes have different combinations of genes encoding activating and inhibitory C1 receptors that can be of higher or lower affinity. All haplotypes encode an inhibitory C1 receptor, but only some haplotypes encode an activating C1 receptor. Of 130 KIR alleles, 55 are Bornean-specific, 65 are Sumatran specific and ten are shared. PMID:28264973

Role of the B Allele of Influenza A Virus Segment 8 in Setting Mammalian Host Range and Pathogenicity

PubMed Central

Turnbull, Matthew L.; Wise, Helen M.; Nicol, Marlynne Q.; Smith, Nikki; Dunfee, Rebecca L.; Beard, Philippa M.; Jagger, Brett W.; Ligertwood, Yvonne; Hardisty, Gareth R.; Xiao, Haixia; Benton, Donald J.; Coburn, Alice M.; Paulo, Joao A.; Gygi, Steven P.; McCauley, John W.; Taubenberger, Jeffery K.; Lycett, Samantha J.; Weekes, Michael P.; Dutia, Bernadette M.

2016-01-01

ABSTRACT Two alleles of segment 8 (NS) circulate in nonchiropteran influenza A viruses. The A allele is found in avian and mammalian viruses, but the B allele is viewed as being almost exclusively found in avian viruses. This might reflect the fact that one or both of its encoded proteins (NS1 and NEP) are maladapted for replication in mammalian hosts. To test this, a number of clade A and B avian virus-derived NS segments were introduced into human H1N1 and H3N2 viruses. In no case was the peak virus titer substantially reduced following infection of various mammalian cell types. Exemplar reassortant viruses also replicated to similar titers in mice, although mice infected with viruses with the avian virus-derived segment 8s had reduced weight loss compared to that achieved in mice infected with the A/Puerto Rico/8/1934 (H1N1) parent. In vitro, the viruses coped similarly with type I interferons. Temporal proteomics analysis of cellular responses to infection showed that the avian virus-derived NS segments provoked lower levels of expression of interferon-stimulated genes in cells than wild type-derived NS segments. Thus, neither the A nor the B allele of avian virus-derived NS segments necessarily attenuates virus replication in a mammalian host, although the alleles can attenuate disease. Phylogenetic analyses identified 32 independent incursions of an avian virus-derived A allele into mammals, whereas 6 introductions of a B allele were identified. However, A-allele isolates from birds outnumbered B-allele isolates, and the relative rates of Aves-to-Mammalia transmission were not significantly different. We conclude that while the introduction of an avian virus segment 8 into mammals is a relatively rare event, the dogma of the B allele being especially restricted is misleading, with implications in the assessment of the pandemic potential of avian influenza viruses. IMPORTANCE Influenza A virus (IAV) can adapt to poultry and mammalian species, inflicting a great socioeconomic burden on farming and health care sectors. Host adaptation likely involves multiple viral factors. Here, we investigated the role of IAV segment 8. Segment 8 has evolved into two distinct clades: the A and B alleles. The B-allele genes have previously been suggested to be restricted to avian virus species. We introduced a selection of avian virus A- and B-allele segment 8s into human H1N1 and H3N2 virus backgrounds and found that these reassortant viruses were fully competent in mammalian host systems. We also analyzed the currently available public data on the segment 8 gene distribution and found surprisingly little evidence for specific avian host restriction of the B-clade segment. We conclude that B-allele segment 8 genes are, in fact, capable of supporting infection in mammals and that they should be considered during the assessment of the pandemic risk of zoonotic influenza A viruses. PMID:27489273

Role of the B Allele of Influenza A Virus Segment 8 in Setting Mammalian Host Range and Pathogenicity.

PubMed

Turnbull, Matthew L; Wise, Helen M; Nicol, Marlynne Q; Smith, Nikki; Dunfee, Rebecca L; Beard, Philippa M; Jagger, Brett W; Ligertwood, Yvonne; Hardisty, Gareth R; Xiao, Haixia; Benton, Donald J; Coburn, Alice M; Paulo, Joao A; Gygi, Steven P; McCauley, John W; Taubenberger, Jeffery K; Lycett, Samantha J; Weekes, Michael P; Dutia, Bernadette M; Digard, Paul

2016-10-15

Two alleles of segment 8 (NS) circulate in nonchiropteran influenza A viruses. The A allele is found in avian and mammalian viruses, but the B allele is viewed as being almost exclusively found in avian viruses. This might reflect the fact that one or both of its encoded proteins (NS1 and NEP) are maladapted for replication in mammalian hosts. To test this, a number of clade A and B avian virus-derived NS segments were introduced into human H1N1 and H3N2 viruses. In no case was the peak virus titer substantially reduced following infection of various mammalian cell types. Exemplar reassortant viruses also replicated to similar titers in mice, although mice infected with viruses with the avian virus-derived segment 8s had reduced weight loss compared to that achieved in mice infected with the A/Puerto Rico/8/1934 (H1N1) parent. In vitro, the viruses coped similarly with type I interferons. Temporal proteomics analysis of cellular responses to infection showed that the avian virus-derived NS segments provoked lower levels of expression of interferon-stimulated genes in cells than wild type-derived NS segments. Thus, neither the A nor the B allele of avian virus-derived NS segments necessarily attenuates virus replication in a mammalian host, although the alleles can attenuate disease. Phylogenetic analyses identified 32 independent incursions of an avian virus-derived A allele into mammals, whereas 6 introductions of a B allele were identified. However, A-allele isolates from birds outnumbered B-allele isolates, and the relative rates of Aves-to-Mammalia transmission were not significantly different. We conclude that while the introduction of an avian virus segment 8 into mammals is a relatively rare event, the dogma of the B allele being especially restricted is misleading, with implications in the assessment of the pandemic potential of avian influenza viruses. Influenza A virus (IAV) can adapt to poultry and mammalian species, inflicting a great socioeconomic burden on farming and health care sectors. Host adaptation likely involves multiple viral factors. Here, we investigated the role of IAV segment 8. Segment 8 has evolved into two distinct clades: the A and B alleles. The B-allele genes have previously been suggested to be restricted to avian virus species. We introduced a selection of avian virus A- and B-allele segment 8s into human H1N1 and H3N2 virus backgrounds and found that these reassortant viruses were fully competent in mammalian host systems. We also analyzed the currently available public data on the segment 8 gene distribution and found surprisingly little evidence for specific avian host restriction of the B-clade segment. We conclude that B-allele segment 8 genes are, in fact, capable of supporting infection in mammals and that they should be considered during the assessment of the pandemic risk of zoonotic influenza A viruses. Copyright © 2016 Turnbull et al.

Discovery of 8-Membered Ring Sulfonamides as Inhibitors of Oncogenic Mutant Isocitrate Dehydrogenase 1.

PubMed

Law, Jason M; Stark, Sebastian C; Liu, Ke; Liang, Norah E; Hussain, Mahmud M; Leiendecker, Matthias; Ito, Daisuke; Verho, Oscar; Stern, Andrew M; Johnston, Stephen E; Zhang, Yan-Ling; Dunn, Gavin P; Shamji, Alykhan F; Schreiber, Stuart L

2016-10-13

Evidence suggests that specific mutations of isocitrate dehydrogenases 1 and 2 (IDH1/2) are critical for the initiation and maintenance of certain tumor types and that inhibiting these mutant enzymes with small molecules may be therapeutically beneficial. In order to discover mutant allele-selective IDH1 inhibitors with chemical features distinct from existing probes, we screened a collection of small molecules derived from diversity-oriented synthesis. The assay identified compounds that inhibit the IDH1-R132H mutant allele commonly found in glioma. Here, we report the discovery of a potent (IC 50 = 50 nM) series of IDH1-R132H inhibitors having 8-membered ring sulfonamides as exemplified by the compound BRD2879. The inhibitors suppress ( R )-2-hydroxyglutarate production in cells without apparent toxicity. Although the solubility and pharmacokinetic properties of the specific inhibitor BRD2879 prevent its use in vivo , the scaffold presents a validated starting point for the synthesis of future IDH1-R132H inhibitors having improved pharmacological properties.

Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

DTIC Science & Technology

2005-09-01

tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

IRAK-M alters the polarity of macrophages to facilitate the survival of Mycobacterium tuberculosis.

PubMed

Shen, Pei; Li, Quan; Ma, Jilei; Tian, Maopeng; Hong, Fei; Zhai, Xinjie; Li, Jianrong; Huang, Hanju; Shi, Chunwei

2017-08-23

Intracellular bacterium, Mycobacterium tuberculosis (M. tb), infects specifically macrophages as host cells. IRAK-M, a member of IRAK family, is a negative regulator in TLR signaling and specifically expresses in monocytes and macrophages. The role of IRAK-M in intracellular growth of M. tb and macrophage polarization was explored, for deeply understanding the pathogenesis of M. tb, the significance of IRAK-M to innate immunity and pathogen-host interaction. IRAK-M expression was detected in M. tb infected macrophages and in human lung tissue of pulmonary tuberculosis with immunofluorescence staining, Western blot and immunohistochemistry. IRAK-M knock-down and over-expressing cell strains were constructed and intracellular survival of M. tb was investigated by acid-fast staining and colony forming units. Molecular markers of M1-type (pSTAT1 and iNOS) and M2-type (pSTAT6 and Arg-1) macrophages were detected using Western blot in IRAK-M knockdown U937 cells infected with M. tb H37Rv. U937 cells were stimulated with immunostimulant CpG7909 into M1 status and then infected with M. tb H37Rv. Expression of IRAK-M, IRAK-4 and iNOS was detected with immunofluorescence staining and Western blot, to evaluate the effect of IRAK-M to CpG directed M1-type polarization of macrophages during M. tb infection. Molecules related with macrophage's bactericidal ability such as Hif-1 and phosphorylated ERK1/2 were detected with immunohistochemistry and Western blot. IRAK-M increased in M. tb infected macrophage cells and also in human lung tissue of pulmonary tuberculosis. IRAK-M over-expression resulted in higher bacterial load, while IRAK-M interference resulted in lower bacterial load in M. tb infected cells. During M. tb infection, IRAK-M knockdown induced M1-type, while inhibited M2-type polarization of macrophage. M1-type polarization of U937 cells induced by CpG7909 was inhibited by M. tb infection, which was reversed by IRAK-M knockdown in U937 cells. IRAK-M affected Hif-1 and MAPK signaling cascade during M. tb infection. Conclusively, IRAK-M might alter the polarity of macrophages, to facilitate intracellular survival of M. tb and affect Th1-type immunity of the host, which is helpful to understanding the pathogenesis of M. tb.

Sequential DNA methylation changes are associated with DNMT3B overexpression in colorectal neoplastic progression.

PubMed

Ibrahim, Ashraf E K; Arends, Mark J; Silva, Ana-Luisa; Wyllie, Andrew H; Greger, Liliana; Ito, Yoko; Vowler, Sarah L; Huang, Tim H-M; Tavaré, Simon; Murrell, Adele; Brenton, James D

2011-04-01

Although aberrant methylation of key genes in the progression of colorectal neoplasia has been reported, no model-based analysis of the incremental changes through the intermediate adenoma stage has been described. In addition, the biological drivers for these methylation changes have yet to be defined. Linear mixed-effects modelling was used in this study to understand the onset and patterns of the methylation changes of SFRP2, IGF2 DMR0, H19, LINE-1 and a CpG island methylator phenotype (CIMP) marker panel, and they were correlated with DNA methyltransferase 3B (DNMT3B) levels of expression in a sample set representative of colorectal neoplastic progression. Methylation of the above CpG islands was measured using quantitative pyrosequencing assays in 261 tissue samples. This included a prospective collection of 44 colectomy specimens with concurrent normal mucosa, adenoma and invasive cancer tissues. Tissue microarrays from a subset of 64 cases were used for immunohistochemical analysis of DNMT3B expression. It is shown that the onset and pattern of methylation changes during colorectal neoplastic progression are locus dependent. The CIMP marker RUNX3 was the earliest CpG island showing significant change, followed by the CIMP markers NEUROG1 and CACNA1G at the hyperplastic polyp stage. SFRP2 and IGF2 DMR0 showed significant methylation changes at the adenomatous polyp stage, followed by the CIMP markers CDKN2A and hMLH1 at the adenocarcinoma stage. DNMT3B levels of immunohistochemical expression increased significantly (p < 0.001) from normal to hyperplastic and from adenomatous polyps to carcinoma samples. DNMT3B expression correlated positively with SFRP2 methylation (r = 0.42, p < 0.001, 95% CI 0.25 to 0.56), but correlated negatively with IGF2 DMR0 methylation (r = 0.26, p = 0.01, 95% CI -0.45 to -0.05). A subset of the CIMP panel (NEUROG1, CACNA1G and CDKN2A) positively correlated with DNMT3B levels of expression (p < 0.05). Hierarchical epigenetic alterations occur at transition points during colorectal neoplastic progression. These cumulative changes are closely correlated with a gain of DNMT3B expression, suggesting a causal relationship.

Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

PubMed

Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

2012-06-06

First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

Allelotype analysis of chemically induced squamous cell carcinomas in F(1) hybrids of two inbred mouse strains with different susceptibility to tumor progression.

PubMed

Stern, M C; Benavides, F; Klingelberger, E A; Conti, C J

2000-07-01

Loss of heterozygosity (LOH) at specific chromosomal loci is generally considered indirect evidence for the presence of putative suppressor genes. Allelotyping of tumors using polymorphic markers distributed throughout the entire genome allows the analysis of specific allelic losses. In the field of chemical carcinogenesis, the outbred SENCAR mouse has been commonly used to analyze the multistage nature of skin tumor development. In the study reported here we generated F(1) hybrids between two inbred strains (SENCARB/Pt and SSIN/Sprd) derived from the SENCAR stock that differ in their susceptibility to tumor progression. We typed 24 7, 12-dimethylbenz[a]anthracene and 12-O-tetradecanoylphorbol-13-acetate-induced squamous cell carcinomas for LOH using 56 microsatellite markers distributed among all autosomal chromosomes. The highest percentage of LOH, 78%, was found on chromosome 7, but there was no preferential loss of one particular allele, indicating that the putative suppressor genes found in this area are not involved in genetic susceptibility. High levels of LOH were also found on chromosomes 16 (39%), 6 (29%), 4 (25%), 9 (25%), 14 (22%), 10 (20%) and 19 (20%), but with no preferential loss of the alleles of one strain. The chromosomal regions with LOH on mouse chromosomes 4, 6, 7, 9, 10, 14, 16 and 19 correspond to regions in the human genome where LOH has been reported and have been suggested to harbor tumor suppressor genes.

Concomitant mutation and epimutation of the MLH1 gene in a Lynch syndrome family.

PubMed

Cini, Giulia; Carnevali, Ileana; Quaia, Michele; Chiaravalli, Anna Maria; Sala, Paola; Giacomini, Elisa; Maestro, Roberta; Tibiletti, Maria Grazia; Viel, Alessandra

2015-04-01

Lynch syndrome (LS) is an inherited predisposition cancer syndrome, typically caused by germline mutations in the mismatch repair genes MLH1, MSH2, MSH6 and PMS2. In the last years, a role for epimutations of the same genes has also been reported. MLH1 promoter methylation is a well known mechanism of somatic inactivation in tumors, and more recently, several cases of constitutional methylation have been identified. In four subjects affected by multiple tumors and belonging to a suspected LS family, we detected a novel secondary MLH1 gene epimutation. The methylation of MLH1 promoter was always linked in cis with a 997 bp-deletion (c.-168_c.116+713del), that removed exon 1 and partially involved the promoter of the same gene. Differently from cases with constitutional primary MLH1 inactivation, this secondary methylation was allele-specific and CpGs of the residual promoter region were totally methylated, leading to complete allele silencing. In the colon tumor of the proband, MLH1 and PMS2 expression was completely lost as a consequence of a pathogenic somatic point mutation (MLH1 c.199G>A, p.Gly67Arg) that also abrogated local methylation by destroying a CpG site. The evidences obtained highlight how MLH1 mutations and epimutations can reciprocally influence each other and suggest that an altered structure of the MLH1 locus results in epigenetic alteration. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Grade-specific prostate cancer associations of IGF1 (CA)19 repeats and IGFBP3-202A/C in blacks and whites.

PubMed

Hoyo, Cathrine; Grubber, Janet; Demark-Wahnefried, Wendy; Marks, Jeffrey R; Freedland, Stephen J; Jeffreys, Amy S; Grambow, Steven C; Wenham, Robert M; Walther, Philip J; Schildkraut, Joellen M

2007-07-01

Carrying the cytosine-adenosine (CA)19 repeat polymorphism in insulin-like growth factor-1 (IGF1) is associated with lower serum proteins and decreased prostate cancer risk. Carrying the -202A/C genotype in insulin-like growth factor binding protein-3 (IGFBP3) also has been associated with lower serum levels of the binding protein. However, the association between this variant and prostate cancer is inconsistent. To test the hypothesis that inconsistencies are partly due to cancer grade-specific differences in strength and direction of associations, we reanalyzed data from our previous Durham Veterans Administration Hospital study of blacks and whites comprising 47 cases (19 African Americans) with Gleason sum > or = 7, 50 cases (30 African Americans) with Gleason sum < 7 and 93 controls (49 African Americans). Compared to controls, the association between carrying the IGFBP3 C allele and prostate cancer risk was in OR(Low-Gleason) = 4.0; 95% CI: 1.4-12.3 compared to OR(High-Gleason) = 1.0; 95% CI: 0.4-2.2. Association patterns were similar in African Americans (OR(Low-Gleason) = 3.6; 95% CI: 1.0-13.2 vs. OR(High-Gleason) = 1.4; 95% CI: 0.4-2.3) and whites (OR(Low-Gleason) = 5.6; 95% CI: 0.6-49.0 vs. OR(High-Gleason) = 0.6; 95% CI: 0.2-2.2). The inverse association between carrying the IGF1 (CA)19 repeat variant did not vary by grade or ethnicity. If confirmed in larger studies, these findings support the hypothesis that the association between IGFBP3 C allele and prostate cancer is grade specific in both ethnic groups.

Grade-specific prostate cancer associations of IGF1 (CA)19 repeats and IGFBP3-202A/C in blacks and whites.

PubMed Central

Hoyo, Cathrine; Grubber, Janet; Demark-Wahnefried, Wendy; Marks, Jeffrey R.; Freedland, Stephen J.; Jeffreys, Amy S.; Grambow, Steven C.; Wenham, Robert M.; Walther, Philip J.; Schildkraut, Joellen M.

2007-01-01

Carrying the cytosine-adenosine (CA)19 repeat polymorphism in insulin-like growth factor-1 (IGF1) is associated with lower serum proteins and decreased prostate cancer risk. Carrying the -202A/C genotype in insulin-like growth factor binding protein-3 (IGFBP3) also has been associated with lower serum levels of the binding protein. However, the association between this variant and prostate cancer is inconsistent. To test the hypothesis that inconsistencies are partly due to cancer grade-specific differences in strength and direction of associations, we reanalyzed data from our previous Durham Veterans Administration Hospital study of blacks and whites comprising 47 cases (19 African Americans) with Gleason sum > or = 7, 50 cases (30 African Americans) with Gleason sum < 7 and 93 controls (49 African Americans). Compared to controls, the association between carrying the IGFBP3 C allele and prostate cancer risk was in OR(Low-Gleason) = 4.0; 95% CI: 1.4-12.3 compared to OR(High-Gleason) = 1.0; 95% CI: 0.4-2.2. Association patterns were similar in African Americans (OR(Low-Gleason) = 3.6; 95% CI: 1.0-13.2 vs. OR(High-Gleason) = 1.4; 95% CI: 0.4-2.3) and whites (OR(Low-Gleason) = 5.6; 95% CI: 0.6-49.0 vs. OR(High-Gleason) = 0.6; 95% CI: 0.2-2.2). The inverse association between carrying the IGF1 (CA)19 repeat variant did not vary by grade or ethnicity. If confirmed in larger studies, these findings support the hypothesis that the association between IGFBP3 C allele and prostate cancer is grade specific in both ethnic groups. PMID:17668637

Triglyceride associated polymorphisms of the APOA5 gene have very different allele frequencies in Pune, India compared to Europeans

PubMed Central

Chandak, Giriraj R; Ward, Kirsten J; Yajnik, Chittaranjan S; Pandit, Anand N; Bavdekar, Ashish; Joglekar, Charu V; Fall, Caroline HD; Mohankrishna, P; Wilkin, Terence J; Metcalf, Bradley S; Weedon, Michael N; Frayling, Timothy M; Hattersley, Andrew T

2006-01-01

Background The APOA5 gene variants, -1131T>C and S19W, are associated with altered triglyceride concentrations in studies of subjects of Caucasian and East Asian descent. There are few studies of these variants in South Asians. We investigated whether the two APOA5 variants also show similar association with various lipid parameters in Indian population as in the UK white subjects. Methods We genotyped 557 Indian adults from Pune, India, and 237 UK white adults for -1131T>C and S19W variants in the APOA5 gene, compared their allelic and genotype frequency and determined their association with fasting serum triglycerides, total cholesterol, HDL and LDL cholesterol levels using univariate general linear analysis. APOC3 SstI polymorphism was also analyzed in 175 Pune Indian subjects for analysis of linkage disequilibrium with the APOA5 variants. Results The APOA5 -1131C allele was more prevalent in Indians from Pune (Pune Indians) compared to UK white subjects (allele frequency 20% vs. 4%, p = 0.00001), whereas the 19W allele was less prevalent (3% vs. 6% p = 0.0015). Patterns of linkage disequilibrium between the two variants were similar between the two populations and confirmed that they occur on two different haplotypes. In Pune Indians, the presence of -1131C allele and the 19W allele was associated with a 19% and 15% increase respectively in triglyceride concentrations although only -1131C was significant (p = 0.0003). This effect size was similar to that seen in the UK white subjects. Analysis of the APOC3 SstI polymorphism in 175 Pune Indian subjects showed that this variant is not in appreciable linkage disequilibrium with the APOA5 -1131T>C variant (r2 = 0.07). Conclusion This is the first study to look at the role of APOA5 in Asian Indian subjects that reside in India. The -1131C allele is more prevalent and the 19W allele is less prevalent in Pune Indians compared to UK Caucasians. We confirm that the APOA5 variants are associated with triglyceride levels independent of ethnicity and that this association is similar in magnitude in Asian Indians and Caucasians. The -1131C allele is present in 36% of the Pune Indian population making it a powerful marker for looking at the role of elevated triglycerides in important conditions such as pancreatitis, diabetes and coronary heart disease. PMID:17032446

Sequence variant on 8q24 confers susceptibility to urinary bladder cancer

PubMed Central

Kiemeney, Lambertus A.; Thorlacius, Steinunn; Sulem, Patrick; Geller, Frank; Aben, Katja K.H.; Stacey, Simon N.; Gudmundsson, Julius; Jakobsdottir, Margret; Bergthorsson, Jon T.; Sigurdsson, Asgeir; Blondal, Thorarinn; Witjes, J. Alfred; Vermeulen, Sita H.; Hulsbergen-van de Kaa, Christina A.; Swinkels, Dorine W.; Ploeg, Martine; Cornel, Erik B.; Vergunst, Henk; Thorgeirsson, Thorgeir E.; Gudbjartsson, Daniel; Gudjonsson, Sigurjon A.; Thorleifsson, Gudmar; Kristinsson, Kari T.; Mouy, Magali; Snorradottir, Steinunn; Placidi, Donatella; Campagna, Marcello; Arici, Cecilia; Koppova, Kvetoslava; Gurzau, Eugene; Rudnai, Peter; Kellen, Eliane; Polidoro, Silvia; Guarrera, Simonetta; Sacerdote, Carlotta; Sanchez, Manuel; Saez, Berta; Valdivia, Gabriel; Ryk, Charlotta; de Verdier, Petra; Lindblom, Annika; Golka, Klaus; Bishop, D. Timothy; Knowles, Margaret A.; Nikulasson, Sigfus; Petursdottir, Vigdis; Jonsson, Eirikur; Geirsson, Gudmundur; Kristjansson, Baldvin; Mayordomo, Jose I.; Steineck, Gunnar; Porru, Stefano; Buntinx, Frank; Zeegers, Maurice P.; Fletcher, Tony; Kumar, Rajiv; Matullo, Giuseppe; Vineis, Paolo; Kiltie, Anne E.; Gulcher, Jeffrey R.; Thorsteinsdottir, Unnur; Kong, Augustine; Rafnar, Thorunn; Stefansson, Kari

2015-01-01

We conducted a genome wide SNP association study on 1,803 Urinary Bladder Cancer (UBC) cases and 34,336 controls from Iceland and the Netherlands and follow up studies in seven additional case control groups (2,165 cases and 3,800 controls). The strongest association was observed with allele T of rs9642880 on chromosome 8q24, 30kb upstream of the c-Myc gene (allele specific OR=1.22; P=9.34×10−12). Approximately 20% of individuals of European ancestry are homozygous for rs9642880 (T) and their estimated risk of developing UBC is 1.49 times that of non-carriers with population attributable risk (PAR) of 17%. No association was observed between UBC and the four 8q24 variants previously associated with prostate, colorectal and breast cancers, nor did rs9642880 associate with any of these three cancers. A weaker signal, but nonetheless of genome wide significance, was captured by rs710521 (A) located near the TP63 gene on chromosome 3q28 (allele specific OR=1.19; P=1. 15× 10−7). PMID:18794855

Fundamental differences in promoter CpG island DNA hypermethylation between human cancer and genetically engineered mouse models of cancer.

PubMed

Diede, Scott J; Yao, Zizhen; Keyes, C Chip; Tyler, Ashlee E; Dey, Joyoti; Hackett, Christopher S; Elsaesser, Katrina; Kemp, Christopher J; Neiman, Paul E; Weiss, William A; Olson, James M; Tapscott, Stephen J

2013-12-01

Genetic and epigenetic alterations are essential for the initiation and progression of human cancer. We previously reported that primary human medulloblastomas showed extensive cancer-specific CpG island DNA hypermethylation in critical developmental pathways. To determine whether genetically engineered mouse models (GEMMs) of medulloblastoma have comparable epigenetic changes, we assessed genome-wide DNA methylation in three mouse models of medulloblastoma. In contrast to human samples, very few loci with cancer-specific DNA hypermethylation were detected, and in almost all cases the degree of methylation was relatively modest compared with the dense hypermethylation in the human cancers. To determine if this finding was common to other GEMMs, we examined a Burkitt lymphoma and breast cancer model and did not detect promoter CpG island DNA hypermethylation, suggesting that human cancers and at least some GEMMs are fundamentally different with respect to this epigenetic modification. These findings provide an opportunity to both better understand the mechanism of aberrant DNA methylation in human cancer and construct better GEMMs to serve as preclinical platforms for therapy development.

Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

NASA Astrophysics Data System (ADS)

Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

2015-08-01

In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

Paradoxical Role of DNA Methylation in Activation of FoxA2 Gene Expression during Endoderm Development*

PubMed Central

Bahar Halpern, Keren; Vana, Tal; Walker, Michael D.

2014-01-01

The transcription factor FoxA2 is a master regulator of endoderm development and pancreatic beta cell gene expression. To elucidate the mechanisms underlying the activation of the FoxA2 gene during differentiation, we have compared the epigenetic status of undifferentiated human embryonic stem cells (hESCs), hESC-derived early endoderm stage cells (CXCR4+ cells), and pancreatic islet cells. Unexpectedly, a CpG island in the promoter region of the FoxA2 gene displayed paradoxically high levels of DNA methylation in expressing tissues (CXCR4+, islets) and low levels in nonexpressing tissues. This CpG island region was found to repress reporter gene expression and bind the Polycomb group protein SUZ12 and the DNA methyltransferase (DNMT)3b preferentially in undifferentiated hESCs as compared with CXCR4+ or islets cells. Consistent with this, activation of FoxA2 gene expression, but not CXCR4 or SOX17, was strongly inhibited by 5-aza-2′-deoxycytidine and by knockdown of DNMT3b. We hypothesize that in nonexpressing tissues, the lack of DNA methylation allows the binding of DNA methyltransferases and repressing proteins, such as Polycomb group proteins; upon differentiation, DNMT activation leads to CpG island methylation, causing loss of repressor protein binding. These results suggest a novel and unexpected role for DNA methylation in the activation of FoxA2 gene expression during differentiation. PMID:25016019

CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

PubMed

Jung, Myung-Hwa; Jung, Sung-Ju

2017-10-01

Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

Association of CYP2C19*2 and *3 Genetic Variants with Essential Hypertension in Koreans

PubMed Central

Shin, Dong-Jik; Kwon, Jisun; Park, Ah-Ram; Bae, Yousun; Shin, Eun-Soon; Park, Sungha

2012-01-01

Purpose The cytochrome P450 2C19 (CYP2C19) metabolizes arachidonic acid to produce epoxyicosanoid acids, which are involved in vascular tone and regulation of blood pressure. Recent findings suggest that CYP2C19 gene might be considered as a novel candidate gene for treatment of cardiovascular disease. The aim of the present study was to evaluate the association between two variants, CYP2C19*2 (681G>A) and CYP2C19*3 (636G>A) and the development of essential hypertension (EH) in Koreans. Materials and Methods We carried out an association study in a total of 1190 individuals (527 hypertensive subjects and 663 unrelated healthy controls). The CYP2C19 polymorphisms were genotyped using the SNaPShot™ assay. Results The distribution of alleles and genotypes of CYP2C19*3 showed significant difference between hypertensive patients and normal controls (p=0.011 and p=0.013, respectively). Logistic regression analysis indicated that the CYP2C19*3 (636A) allele carriers were significantly associated with EH [odds ratio, 0.691; 95% confidence interval (CI), 0.512-0.932, p=0.016], in comparison to wild type homozygotes (CYP2C19*1/*1). Neither genotype nor allele distribution of CYP2C19*2 polymorphism showed significant differences between hypertensive and control groups (p>0.05). Conclusion Our present findings strengthen the evidence of an association between CYP2C19 gene polymorphism and EH prevalence. In particular, the CYP2C19*3 defective allele may contribute to reduced risk for the development of EH. PMID:23074110

Genetic variation and epigenetic modification of the prodynorphin gene in peripheral blood cells in alcoholism.

PubMed

D'Addario, Claudio; Shchetynsky, Klementy; Pucci, Mariangela; Cifani, Carlo; Gunnar, Agneta; Vukojević, Vladana; Padyukov, Leonid; Terenius, Lars

2017-06-02

Dynorphins are critically involved in the development, maintenance and relapse of alcoholism. Alcohol-induced changes in the prodynorphin gene expression may be influenced by both gene polymorphisms and epigenetic modifications. The present study of human alcoholics aims to evaluate DNA methylation patterns in the prodynorphin gene (PDYN) promoter and to identify single nucleotide polymorphisms (SNPs) associated with alcohol dependence and with altered DNA methylation. Genomic DNA was isolated from peripheral blood cells of alcoholics and healthy controls, and DNA methylation was studied in the PDYN promoter by bisulfite pyrosequencing. In alcoholics, DNA methylation increased in three of the seven CpG sites investigated, as well as in the average of the seven CpG sites. Data stratification showed lower increase in DNA methylation levels in individuals reporting craving and with higher levels of alcohol consumption. Association with alcoholism was observed for rs2235751 and the presence of the minor allele G was associated with reduced DNA methylation at PDYN promoter in females and younger subjects. Genetic and epigenetic factors within PDYN are related to risk for alcoholism, providing further evidence of its involvement on ethanol effects. These results might be of relevance for developing new biomarkers to predict disease trajectories and therapeutic outcome. Copyright © 2017 Elsevier Inc. All rights reserved.

New Aspects of the Interplay between Penicillin Binding Proteins, murM, and the Two-Component System CiaRH of Penicillin-Resistant Streptococcus pneumoniae Serotype 19A Isolates from Hungary

PubMed Central

Schweizer, Inga; Blättner, Sebastian; Maurer, Patrick; Peters, Katharina; Vollmer, Daniela; Vollmer, Waldemar; Hakenbeck, Regine

2017-01-01

ABSTRACT The Streptococcus pneumoniae clone Hungary19A-6 expresses unusually high levels of β-lactam resistance, which is in part due to mutations in the MurM gene, encoding a transferase involved in the synthesis of branched peptidoglycan. Moreover, it contains the allele ciaH232, encoding the histidine kinase CiaH (M. Müller, P. Marx, R. Hakenbeck, and R. Brückner, Microbiology 157:3104–3112, 2011, https://doi.org/10.1099/mic.0.053157-0). High-level penicillin resistance primarily requires the presence of low-affinity (mosaic) penicillin binding protein (PBP) genes, as, for example, in strain Hu17, a closely related member of the Hungary19A-6 lineage. Interestingly, strain Hu15 is β-lactam sensitive due to the absence of mosaic PBPs. This unique situation prompted us to investigate the development of cefotaxime resistance in transformation experiments with genes known to play a role in this phenotype, pbp2x, pbp1a, murM, and ciaH, and penicillin-sensitive recipient strains R6 and Hu15. Characterization of phenotypes, peptidoglycan composition, and CiaR-mediated gene expression revealed several novel aspects of penicillin resistance. The murM gene of strain Hu17 (murMHu17), which is highly similar to murM of Streptococcus mitis, induced morphological changes which were partly reversed by ciaH232. murMHu17 conferred cefotaxime resistance only in the presence of the pbp2x of strain Hu17 (pbp2xHu17). The ciaH232 allele contributed to a remarkable increase in cefotaxime resistance in combination with pbp2xHu17 and pbp1a of strain Hu17 (pbp1aHu17), accompanied by higher levels of expression of CiaR-regulated genes, documenting that ciaH232 responds to PBP1aHu17-mediated changes in cell wall synthesis. Most importantly, the proportion of branched peptides relative to the proportion of linear muropeptides increased in cells containing mosaic PBPs, suggesting an altered enzymatic activity of these proteins. PMID:28483958

The CpG island searcher: a new WWW resource.

PubMed

Takai, Daiya; Jones, Peter A

2003-01-01

Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

Smoking-Associated Site-Specific Differential Methylation in Buccal Mucosa in the COPDGene Study

PubMed Central

Qiu, Weiliang; Carey, Vincent J.; Morrow, Jarrett; Bacherman, Helene; Foreman, Marilyn G.; Hokanson, John E.; Bowler, Russell P.; Crapo, James D.; DeMeo, Dawn L.

2015-01-01

DNA methylation is a complex, tissue-specific phenomenon that can reflect both endogenous factors and exogenous exposures. Buccal brushings represent an easily accessible source of DNA, which may be an appropriate surrogate tissue in the study of environmental exposures and chronic respiratory diseases. Buccal brushings were obtained from a subset of current and former smokers from the COPDGene study. Genome-wide DNA methylation data were obtained in the discovery cohort (n = 82) using the Illumina HumanMethylation450K array. Empirical Bayes methods were used to test for differential methylation by current smoking status at 468,219 autosomal CpG sites using linear models adjusted for age, sex, and race. Pyrosequencing was performed in a nonoverlapping replication cohort (n = 130). Current smokers were significantly younger than former smokers in both the discovery and replication cohorts. Seven CpG sites were associated with current smoking at a false discovery rate less than 0.05 in the discovery cohort. Six of the seven significant sites were pyrosequenced in the replication cohort; five CpG sites, including sites annotated to CYP1B1 and PARVA, were replicated. Correlations between cumulative smoke exposure and time since smoking cessation were observed in a subset of the significantly associated CpG sites. A significant correlation between reduced lung function and increased radiographic emphysema with methylation at cg02162897 (CYP1B1) was observed among female subjects. Site-specific methylation of DNA isolated from buccal mucosa is associated with exposure to cigarette smoke, and may provide insights into the mechanisms underlying differential susceptibility toward the development of smoking-related chronic respiratory diseases. PMID:25517428

Exome sequencing identifies DYNC2H1 mutations as a common cause of asphyxiating thoracic dystrophy (Jeune syndrome) without major polydactyly, renal or retinal involvement

PubMed Central

Schmidts, Miriam; Arts, Heleen H; Bongers, Ernie M H F; Yap, Zhimin; Oud, Machteld M; Antony, Dinu; Duijkers, Lonneke; Emes, Richard D; Stalker, Jim; Yntema, Jan-Bart L; Plagnol, Vincent; Hoischen, Alexander; Gilissen, Christian; Forsythe, Elisabeth; Lausch, Ekkehart; Veltman, Joris A; Roeleveld, Nel; Superti-Furga, Andrea; Kutkowska-Kazmierczak, Anna; Kamsteeg, Erik-Jan; Elçioğlu, Nursel; van Maarle, Merel C; Graul-Neumann, Luitgard M; Devriendt, Koenraad; Smithson, Sarah F; Wellesley, Diana; Verbeek, Nienke E; Hennekam, Raoul C M; Kayserili, Hulya; Scambler, Peter J; Beales, Philip L; Knoers, Nine VAM; Roepman, Ronald; Mitchison, Hannah M

2013-01-01

Background Jeune asphyxiating thoracic dystrophy (JATD) is a rare, often lethal, recessively inherited chondrodysplasia characterised by shortened ribs and long bones, sometimes accompanied by polydactyly, and renal, liver and retinal disease. Mutations in intraflagellar transport (IFT) genes cause JATD, including the IFT dynein-2 motor subunit gene DYNC2H1. Genetic heterogeneity and the large DYNC2H1 gene size have hindered JATD genetic diagnosis. Aims and methods To determine the contribution to JATD we screened DYNC2H1 in 71 JATD patients JATD patients combining SNP mapping, Sanger sequencing and exome sequencing. Results and conclusions We detected 34 DYNC2H1 mutations in 29/71 (41%) patients from 19/57 families (33%), showing it as a major cause of JATD especially in Northern European patients. This included 13 early protein termination mutations (nonsense/frameshift, deletion, splice site) but no patients carried these in combination, suggesting the human phenotype is at least partly hypomorphic. In addition, 21 missense mutations were distributed across DYNC2H1 and these showed some clustering to functional domains, especially the ATP motor domain. DYNC2H1 patients largely lacked significant extra-skeletal involvement, demonstrating an important genotype–phenotype correlation in JATD. Significant variability exists in the course and severity of the thoracic phenotype, both between affected siblings with identical DYNC2H1 alleles and among individuals with different alleles, which suggests the DYNC2H1 phenotype might be subject to modifier alleles, non-genetic or epigenetic factors. Assessment of fibroblasts from patients showed accumulation of anterograde IFT proteins in the ciliary tips, confirming defects similar to patients with other retrograde IFT machinery mutations, which may be of undervalued potential for diagnostic purposes. PMID:23456818

Unusual Characteristics of the DNA Binding Domain of Epigenetic Regulatory Protein MeCP2 Determine Its Binding Specificity

PubMed Central

2015-01-01

The protein MeCP2 mediates epigenetic regulation by binding methyl-CpG (mCpG) sites on chromatin. MeCP2 consists of six domains of which one, the methyl binding domain (MBD), binds mCpG sites in duplex DNA. We show that solution conditions with physiological or greater salt concentrations or the presence of nonspecific competitor DNA is necessary for the MBD to discriminate mCpG from CpG with high specificity. The specificity for mCpG over CpG is >100-fold under these solution conditions. In contrast, the MBD does not discriminate hydroxymethyl-CpG from CpG. The MBD is unusual among site-specific DNA binding proteins in that (i) specificity is not conferred by the enhanced affinity for the specific site but rather by suppression of its affinity for generic DNA, (ii) its specific binding to mCpG is highly electrostatic, and (iii) it takes up as well as displaces monovalent cations upon DNA binding. The MBD displays an unusually high affinity for single-stranded DNA independent of modification or sequence. In addition, the MBD forms a discrete dimer on DNA via a noncooperative binding pathway. Because the affinity of the second monomer is 1 order of magnitude greater than that of nonspecific binding, the MBD dimer is a unique molecular complex. The significance of these results in the context of neuronal function and development and MeCP2-related developmental disorders such as Rett syndrome is discussed. PMID:24828757

The Composite of Bone Marrow Concentrate and PRP as an Alternative to Autologous Bone Grafting

PubMed Central

Hakimi, Mohssen; Grassmann, Jan-Peter; Betsch, Marcel; Schneppendahl, Johannes; Gehrmann, Sebastian; Hakimi, Ahmad-Reza; Kröpil, Patric; Sager, Martin; Herten, Monika; Wild, Michael; Windolf, Joachim; Jungbluth, Pascal

2014-01-01

One possible alternative to the application of autologous bone grafts represents the use of autologous bone marrow concentrate (BMC). The purpose of our study was to evaluate the potency of autologous platelet-rich plasma (PRP) in combination with BMC. In 32 mini-pigs a metaphyseal critical-size defect was surgically created at the proximal tibia. The animals were allocated to four treatment groups of eight animals each (1. BMC+CPG group, 2. BMC+CPG+PRP group, 3. autograft group, 4. CPG group). In the BMC+CPG group the defect was filled with autologous BMC in combination with calcium phosphate granules (CPG), whereas in the BMC+CPG+PRP group the defect was filled with the composite of autologous BMC, CPG and autologous PRP. In the autograft group the defect was filled with autologous cancellous graft, whereas in the CPG group the defect was filled with CPG solely. After 6 weeks radiological and histomorphometrical analysis showed significantly more new bone formation in the BMC+CPG+PRP group compared to the BMC+CPG group and the CPG group. There were no significant differences between the BMC+CPG+PRP group and the autograft group. In the PRP platelets were enriched significantly about 4.7-fold compared to native blood. In BMC the count of mononuclear cells increased significantly (3.5-fold) compared to the bone marrow aspirate. This study demonstrates that the composite of BMC+CPG+PRP leads to a significantly higher bone regeneration of critical-size defects at the proximal tibia in mini-pigs than the use of BMC+CPG without PRP. Furthermore, within the limits of the present study the composite BMC+CPG+PRP represents a comparable alternative to autologous bone grafting. PMID:24950251

Variation of p53 mutational spectra between carcinoma of the upper and lower respiratory tract.

PubMed

Law, J C; Whiteside, T L; Gollin, S M; Weissfeld, J; El-Ashmawy, L; Srivastava, S; Landreneau, R J; Johnson, J T; Ferrell, R E

1995-07-01

Mutations of the p53 tumor suppressor gene are the most common genetic alterations associated with human cancer. Tumor-associated p53 mutations often show characteristic tissue-specific profiles which may infer environmentally induced mutational mechanisms. The p53 mutational frequency and spectrum were determined for 95 carcinomas of the upper and lower respiratory tract (32 lung and 63 upper respiratory tract). Mutations were identified at a frequency of 30% in upper respiratory tract (URT) tumors and 31% in lung tumors. All 29 identified mutations were single-base substitutions. Comparison of the frequency of specific base substitutions between lung and URT showed a striking difference. Transitions occurred at a frequency of 68% in URT, but only 30% in lung. Mutations involving G:C-->A:T transitions, which are commonly reported in gastric and esophageal tumors, were the most frequently identified alteration in URT (11/19). Mutations involving G:C-->T:A transversions, which were relatively common in lung tumors (3/10) and are representative of tobacco smoke-induced mutations were rare in URT tumors (1/19). Interestingly, G:C-->A:T mutations at CpG sites, which are characteristic of endogenous processes, were observed frequently in URT tumors (9/19) but only rarely in lung tumors (1/10), suggesting that both endogenous and exogenous factors are responsible for the observed differences in mutational spectra between the upper and lower respiratory systems.

Rapid single nucleotide polymorphism based method for hematopoietic chimerism analysis and monitoring using high-speed droplet allele-specific PCR and allele-specific quantitative PCR.

PubMed

Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Uehara, Masayuki; Sugano, Mitsutoshi; Okumura, Nobuo; Honda, Takayuki

2015-05-20

Chimerism analysis is important for the evaluation of engraftment and predicting relapse following hematopoietic stem cell transplantation (HSCT). We developed a chimerism analysis for single nucleotide polymorphisms (SNPs), including rapid screening of the discriminable donor/recipient alleles using droplet allele-specific PCR (droplet-AS-PCR) pre-HSCT and quantitation of recipient DNA using AS-quantitative PCR (AS-qPCR) following HSCT. SNP genotyping of 20 donor/recipient pairs via droplet-AS-PCR and the evaluation of the informativity of 5 SNP markers for chimerism analysis were performed. Samples from six follow-up patients were analyzed to assess the chimerism via AS-qPCR. These results were compared with that determined by short tandem repeat PCR (STR-PCR). Droplet-AS-PCR could determine genotypes within 8min. The total informativity using all 5 loci was 95% (19/20). AS-qPCR provided the percentage of recipient DNA in all 6 follow-up patients without influence of the stutter peak or the amplification efficacy, which affected the STR-PCR results. The droplet-AS-PCR had an advantage over STR-PCR in terms of rapidity and simplicity for screening before HSCT. Furthermore, AS-qPCR had better accuracy than STR-PCR for quantification of recipient DNA following HSCT. The present chimerism assay compensates for the disadvantages of STR-PCR and is readily performable in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

The Principal Genetic Determinants for Nasopharyngeal Carcinoma in China Involve the HLA Class I Antigen Recognition Groove

PubMed Central

Tang, Minzhong; Lautenberger, James A.; Gao, Xiaojiang; Sezgin, Efe; Hendrickson, Sher L.; Troyer, Jennifer L.; David, Victor A.; Guan, Li; Mcintosh, Carl E.; Guo, Xiuchan; Zheng, Yuming; Liao, Jian; Deng, Hong; Malasky, Michael; Kessing, Bailey; Winkler, Cheryl A.; Carrington, Mary; dé The, Guy; Zeng, Yi; O'Brien, Stephen J.

2012-01-01

Nasopharyngeal carcinoma (NPC) is an epithelial malignancy facilitated by Epstein-Barr Virus infection. Here we resolve the major genetic influences for NPC incidence using a genome-wide association study (GWAS), independent cohort replication, and high-resolution molecular HLA class I gene typing including 4,055 study participants from the Guangxi Zhuang Autonomous Region and Guangdong province of southern China. We detect and replicate strong association signals involving SNPs, HLA alleles, and amino acid (aa) variants across the major histocompatibility complex-HLA-A, HLA –B, and HLA -C class I genes (PHLA-A-aa-site-62 = 7.4×10−29; P HLA-B-aa-site-116 = 6.5×10−19; P HLA-C-aa-site-156 = 6.8×10−8 respectively). Over 250 NPC-HLA associated variants within HLA were analyzed in concert to resolve separate and largely independent HLA-A, -B, and -C gene influences. Multivariate logistical regression analysis collapsed significant associations in adjacent genes spanning 500 kb (OR2H1, GABBR1, HLA-F, and HCG9) as proxies for peptide binding motifs carried by HLA- A*11:01. A similar analysis resolved an independent association signal driven by HLA-B*13:01, B*38:02, and B*55:02 alleles together. NPC resistance alleles carrying the strongly associated amino acid variants implicate specific class I peptide recognition motifs in HLA-A and -B peptide binding groove as conferring strong genetic influence on the development of NPC in China. PMID:23209447

ATRX Plays a Key Role in Maintaining Silencing at Interstitial Heterochromatic Loci and Imprinted Genes

PubMed Central

Voon, Hsiao P.J.; Hughes, Jim R.; Rode, Christina; De La Rosa-Velázquez, Inti A.; Jenuwein, Thomas; Feil, Robert; Higgs, Douglas R.; Gibbons, Richard J.

2015-01-01

Summary Histone H3.3 is a replication-independent histone variant, which replaces histones that are turned over throughout the entire cell cycle. H3.3 deposition at euchromatin is dependent on HIRA, whereas ATRX/Daxx deposits H3.3 at pericentric heterochromatin and telomeres. The role of H3.3 at heterochromatic regions is unknown, but mutations in the ATRX/Daxx/H3.3 pathway are linked to aberrant telomere lengthening in certain cancers. In this study, we show that ATRX-dependent deposition of H3.3 is not limited to pericentric heterochromatin and telomeres but also occurs at heterochromatic sites throughout the genome. Notably, ATRX/H3.3 specifically localizes to silenced imprinted alleles in mouse ESCs. ATRX KO cells failed to deposit H3.3 at these sites, leading to loss of the H3K9me3 heterochromatin modification, loss of repression, and aberrant allelic expression. We propose a model whereby ATRX-dependent deposition of H3.3 into heterochromatin is normally required to maintain the memory of silencing at imprinted loci. PMID:25865896

Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine termination. Black-Right-Pointing-Pointer Single CpG methylation located at Pax6 binding motif regulates StAR expression.« less

Analysis of estrogen receptor β gene methylation in autistic males in a Chinese Han population.

PubMed

Wang, Xuelai; Liang, Shuang; Sun, Yi; Li, Haixin; Endo, Fumio; Nakao, Mitsuyoshi; Saitoh, Noriko; Wu, Lijie

2017-08-01

Autism spectrum disorder (ASD) is a neurodevelopment disorder with abnormalities of social interaction, communication and repetitive behaviors. The higher prevalence of ASD in men implies a potential relationship between sex hormones and ASD etiology. The ESR2 gene encodes estrogen receptor beta (ESR2) and plays an important role during brain development. A relationship between ESR2 and ASD has been suggested by studies on single nucleotide polymorphisms and mRNA and protein expression levels in ASD patients. Here, we explored the possible epigenetic regulation of the ESR2 gene in autism. We collected genomic DNA from the peripheral blood of Chinese Han males with autism and age-matched normal males and measured DNA methylation of CpG islands in the ESR2 gene, which consisted of 41 CpG sites among the proximal promoter region and an untranslated exon, by bisulfite sequencing. We also investigated a relationship between DNA methylation and phenotypic features of autism, as assessed by the Children Autism Rating Scale. We found little overall difference in the DNA methylation of the ESR2 5'-flanking region in individuals with autism compared with normal individuals. However, detailed analyses revealed that eight specific CpG sites were hypermethylated in autistic individuals and that four specific CpG sites were positively associated with the severity of autistic symptoms. Our study indicates that the epigenetic dysregulation of ESR2 may govern the development of autism.

Helicobacter pylori virulence factors and their role in peptic ulcer diseases in Turkey.

PubMed

Tuncel, I E; Hussein, N R; Bolek, B K; Arikan, S; Salih, B A

2010-01-01

The role of virulence factors present in Helicobacter pylori (H. pylori) strains and the characterization of such factors being predictive of specific disease is still not clear. In this study, the cagA, vacA alleles and the recently characterized vacA i-region and dupA and their association with the severity of the disease was determined. Antral biopsies from 91patients with peptic ulcer (PU) (n = 41), gastritis (n = 48) and gastric cancer (GC) (n = 2) were analyzed for the presence of H. pylori by the CLO-test and PCR. A 79/91 (86%) patients were positive for H. pylori by either PCR or by both PCR and CLO-test. PCR-based typing of H. pylori isolates was performed on DNA extracted directly from biopsy samples. The cagA+ strains were found more likely to be associated with vacA s1 than s2. The vacA i1 allele detected in 16/23 (70%) of samples had significant association with duodenal ulcers than those 16/37 (44%) of gastritis (P < 0.04). No significant association was found between dupA and duodenal ulcer. This study provided more evidence that the vacA i1 allele is one of the virulence factors of H. pylori that had significant association with severe outcome.

[Correlation between polymorphisms in the coagulation factor VII gene hypervariable region 4 site and the risk of coronary heart disease in population with different ethnic backgrounds: a Meta-analysis].

PubMed

Wang, Li-li; Ma, Bin; Qian, Dun; Pang, Jun; Yao, Ya-li

2013-12-01

To assess the correlation between polymorphisms in the coagulation factor VII (F VII)gene hypervariable region 4 (HVR4)site and risk related to coronary heart disease (CHD)in different ethnic populations, especially the Asian populations. Publications up to April 2013, from CBM, CNKI, Wanfang Database,VIP, PubMed, Cochrane Library and Embase were searched to collect data from case-control studies related to F VII gene HVR4 site and CHD in populations from different ethnicities. Quality of studies was evaluated, available data extracted and both RevMan 5.1 and Stata 11.0 softwares were used for Meta-analysis. Fifteen case-control studies were included, involving 3167 cases with CHD group and 3168 cases in the control group. on this Meta-analysis showed that:a)polymorphism of the F VII gene HVR4 site H7/H6+H5 and CHD, b)H7H7/H6H6 + H7H6 and CHD were both slightly correlated between people with different ethnic backgrounds. However, the H6 allele versus H7+H5 allele and CHD showed different results-a high correlation seen in different ethnic groups. H5 allele versus H6+H7 allele and CHD did not appear significant difference(OR = 1.20, 95%CI:0.76-1.90, P = 0.43). Both F VII gene HVR4 polymorphisms H7 allele and the H7H7 genotype might have served as protective factors for CHD in different ethnic groups, H6 allele might serve as a risk factor for CHD, but H5 allele was likely not to be associated with CHD in different ethnic groups.

Clinical Relevant Polymorphisms Affecting Clopidogrel Pharmacokinetics and Pharmacodynamics: Insights from the Puerto Rico Newborn Screening Program.

PubMed

Hernandez-Suarez, Dagmar F; Tomassini-Fernandini, Jonnalie C; Cuevas, Angelica; Rosario-Berrios, Anyelis N; Nuñez-Medina, Héctor J; Padilla-Arroyo, Dariana; Rivera, Nannette; Liriano, Jennifer; Vega-Roman, Rocio K; Renta, Jessicca Y; Melin, Kyle; Duconge, Jorge

2018-05-30

Background: Variations in several clopidogrel-pharmacogenes have been linked to clopidogrel response variability and clinical outcomes. We aimed to determine the frequency distribution of major polymorphisms on CYP2C19 , PON1 , ABCB1 and P2RY12 pharmacogenes in Puerto Ricans. Methods : This was a cross-sectional, population-based study of 200 unrelated "Guthrie" cards specimens from newborns registered in the Puerto Rican newborn screening program (PRNSP) between 2004 and 2014. Taqman ® SNP assay techniques were used for genotyping. Results: Minor allele frequencies (MAF) were 46% for PON1 (rs662), 41% for ABCB1 (rs1045642), 14% for CYP2C19 *17, 13% for CYP2C19 *2, 12% for P2RY12 -H2 and 0.3% for CYP2C19 *4. No carriers of the CYP2C19 *3 variants were detected. All alleles and genotype proportions were found to be in Hardy⁻Weinberg equilibrium (HWE). Overall, there were no significant differences between MAFs of these variants in Puerto Ricans and the general population ( n = 453) of the 1000 Genome project, except when comparisons to each individual parental group were performed (i.e., Africans, Europeans and East-Asians; p < 0.05). As expected, the prevalence of these markers in Puerto Ricans most resembled those in the 181 subjects from reference populations of the Americas. Conclusions: These prevalence data provide a necessary groundwork for future clinical studies of clopidogrel pharmacogenetics in Caribbean Hispanics.

CYP2C19 polymorphism frequency in Russian patients in Central Russia and Siberia with acute coronary syndrome

PubMed Central

Mirzaev, Karin B; Zelenskaya, Elena M; Barbarash, Olga L; Ganyukov, Vladimir I; Apartsin, Konstantin A; Saraeva, Natalya O; Nikolaev, Konstantin Y; Ryzhikova, Kristina A; Lifshits, Galina I; Sychev, Dmitry A

2017-01-01

Purpose The aim of this study is to investigate the frequency of CYP2C19*2, *3 allelic variants, associated with poor response to clopidogrel, and CYP2C19*17, associated with excessive response to clopidogrel, in patients with acute coronary syndrome (ACS) from Siberia and Moscow regions of Russia. Patients and methods The study included 512 ACS patients who were subsequently treated with coronary arterial stenting. The subjects assigned were from the cities of Central (Novosibirsk, Kemerovo), Eastern (Irkutsk), Northern (Surgut) Siberia regions and from Moscow region. The mean age of patients enrolled was 63.9±10.9 years. Among the assigned subjects, the proportion of men accounted for 80% and women 20%. Results According to the results obtained in the present study, from 16% up to 27.5% of patients in different regions of Russia have at least one CYP2C19 “poor metabolizer” (PM) allele variant affecting clopidogrel metabolism and, therefore, suppressing its antiplatelet activity. CYP2C19*17 allele variant was identified with the frequency of 15.4% up to 33.3%. The study revealed the presence of statistically significant differences in CYP2C19*3 allele frequency between the Russian ethnic group patients from Eastern and Central Siberia (p=0.001; odds ratio=1.05 [95% confidence interval 1.01–1.09]). Conclusion The study revealed statistically significant differences between the allele frequencies in Eastern and Central Siberia, which can probably be caused by a considerable number of Buryats inhabiting Eastern Siberia. PMID:28442925

Dynamic Ligand Modulation of EPO Receptor Pools, and Dysregulation by Polycythemia-Associated EPOR Alleles

PubMed Central

Singh, Seema; Verma, Rakesh; Pradeep, Anamika; Leu, Karen; Mortensen, R. Bruce; Young, Peter R.; Oyasu, Miho; Schatz, Peter J.; Green, Jennifer M.; Wojchowski, Don M.

2012-01-01

Erythropoietin (EPO) and its cell surface receptor (EPOR) are essential for erythropoiesis; can modulate non-erythroid target tissues; and have been reported to affect the progression of certain cancers. Basic studies of EPOR expression and trafficking, however, have been hindered by low-level EPOR occurrence, and the limited specificity of anti-EPOR antibodies. Consequently, these aspects of EPOR biology are not well defined, nor are actions of polycythemia- associated mutated EPOR alleles. Using novel rabbit monoclonal antibodies to intracellular, PY- activated and extracellular EPOR domains, the following properties of the endogenous hEPOR in erythroid progenitors first are unambiguously defined. 1) High- Mr EPOR forms become obviously expressed only when EPO is limited. 2) EPOR-68K plus -70K species sequentially accumulate, and EPOR-70K comprises an apparent cell surface EPOR population. 3) Brefeldin A, N-glycanase and associated analyses point to EPOR-68K as a core-glycosylated intracellular EPOR pool (of modest size). 4) In contrast to recent reports, EPOR inward trafficking is shown (in UT7epo cells, and primary proerythroblasts) to be sharply ligand-dependent. Beyond this, when C-terminal truncated hEPOR-T mutant alleles as harbored by polycythemia patients are co-expressed with the wild-type EPOR in EPO-dependent erythroid progenitors, several specific events become altered. First, EPOR-T alleles are persistently activated upon EPO- challenge, yet are also subject to apparent turn-over (to low-Mr EPOR products). Furthermore, during exponential cell growth EPOR-T species become both over-represented, and hyper-activated. Interestingly, EPOR-T expression also results in an EPO dose-dependent loss of endogenous wild-type EPOR's (and, therefore, a squelching of EPOR C-terminal- mediated negative feedback effects). New knowledge concerning regulated EPOR expression and trafficking therefore is provided, together with new insight into mechanisms via which mutated EPOR-T polycythemia alleles dysregulate the erythron. Notably, specific new tools also are characterized for studies of EPOR expression, activation, action and metabolism. PMID:22253704

Analysis of RET promoter CpG island methylation using methylation-specific PCR (MSP), pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM): impact on stage II colon cancer patient outcome.

PubMed

Draht, Muriel X G; Smits, Kim M; Jooste, Valérie; Tournier, Benjamin; Vervoort, Martijn; Ramaekers, Chantal; Chapusot, Caroline; Weijenberg, Matty P; van Engeland, Manon; Melotte, Veerle

2016-01-01

Already since the 1990s, promoter CpG island methylation markers have been considered promising diagnostic, prognostic, and predictive cancer biomarkers. However, so far, only a limited number of DNA methylation markers have been introduced into clinical practice. One reason why the vast majority of methylation markers do not translate into clinical applications is lack of independent validation of methylation markers, often caused by differences in methylation analysis techniques. We recently described RET promoter CpG island methylation as a potential prognostic marker in stage II colorectal cancer (CRC) patients of two independent series. In the current study, we analyzed the RET promoter CpG island methylation of 241 stage II colon cancer patients by direct methylation-specific PCR (MSP), nested-MSP, pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM). All primers were designed as close as possible to the same genomic region. In order to investigate the effect of different DNA methylation assays on patient outcome, we assessed the clinical sensitivity and specificity as well as the association of RET methylation with overall survival for three and five years of follow-up. Using direct-MSP and nested-MSP, 12.0 % (25/209) and 29.6 % (71/240) of the patients showed RET promoter CpG island methylation. Methylation frequencies detected by pyrosequencing were related to the threshold for positivity that defined RET methylation. Methylation frequencies obtained by pyrosequencing (threshold for positivity at 20 %) and MS-HRM were 13.3 % (32/240) and 13.8 % (33/239), respectively. The pyrosequencing threshold for positivity of 20 % showed the best correlation with MS-HRM and direct-MSP results. Nested-MSP detected RET promoter CpG island methylation in deceased patients with a higher sensitivity (33.1 %) compared to direct-MSP (10.7 %), pyrosequencing (14.4 %), and MS-HRM (15.4 %). While RET methylation frequencies detected by nested-MSP, pyrosequencing, and MS-HRM varied, the prognostic effect seemed similar (HR 1.74, 95 % CI 0.97-3.15; HR 1.85, 95 % CI 0.93-3.86; HR 1.83, 95 % CI 0.92-3.65, respectively). Our results show that upon optimizing and aligning four RET methylation assays with regard to primer location and sensitivity, differences in methylation frequencies and clinical sensitivities are observed; however, the effect on the marker's prognostic outcome is minimal.

Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.

PubMed

Peng, Liu; Wei, He; Liren, Li

2014-01-01

To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.

Status of Helicobacter pylori cag pathogenicity island (cagPAI) integrity and significance of its individual genes.

PubMed

Markovska, Rumyana; Boyanova, Lyudmila; Yordanov, Daniel; Stankova, Petya; Gergova, Galina; Mitov, Ivan

2018-04-01

One of the most important virulence factors of H. pylori is the intact cagPAI. The aim of the present study is to investigate cagPAI intactness among Bulgarian H. pylori isolates, its associations with clinical outcomes and vacA alleles, and to evaluate the significance of individual cagPAI genes. Totally, 156 isolates from 156 patients with endoscopic findings for duodenal or gastric ulcer (33 subjects), non-ulcer disease (121) and other diseases, such as Crohn's disease and hepatitis (2) were tested. Polymerase chain reaction (PCR) was used to detect 14 essential cagPAI genes, including cagA, as well as vacA s, i and m alleles. CagA positive were 81.4% of all H. pylori isolates. Intact cagPAI was found in 64.1% of the all isolates, 16.7% and 19.2% showed complete and partial cagPAI absence, respectively. The prevalence of all cagPAI genes and intact cagPAI was significantly higher in isolates from ulcer patients compared with those from non-ulcer patients (p = 0.001). The most frequently missing genes among the isolates with partially deleted cagPAIs were cagE or/and cagY (28 of 30 isolates). Overall prevalence of vacA s1a allele was 80.1% and that of vacA i1 was 64.1%. The vacA s1a, m1 and i1 alleles were more prevalent in H. pylori isolates from ulcer patients (p = 0.03, p = 0.009, and p = 0.0003, respectively) and were associated with isolates with intact cagPAI. In Bulgaria the prevalence of intact cagPAI was high. cagE or/and cagY absence was the most important predictor of cagPAI status. Copyright © 2018 Elsevier B.V. All rights reserved.

Helicobacter pylori genotyping from American indigenous groups shows novel Amerindian vacA and cagA alleles and Asian, African and European admixture.

PubMed

Camorlinga-Ponce, Margarita; Perez-Perez, Guillermo; Gonzalez-Valencia, Gerardo; Mendoza, Irma; Peñaloza-Espinosa, Rosenda; Ramos, Irma; Kersulyte, Dangeruta; Reyes-Leon, Adriana; Romo, Carolina; Granados, Julio; Muñoz, Leopoldo; Berg, Douglas E; Torres, Javier

2011-01-01

It is valuable to extend genotyping studies of Helicobacter pylori to strains from indigenous communities across the world to better define adaption, evolution, and associated diseases. We aimed to genetically characterize both human individuals and their infecting H. pylori from indigenous communities of Mexico, and to compare them with those from other human groups. We studied individuals from three indigenous groups, Tarahumaras from the North, Huichols from the West and Nahuas from the center of Mexico. Volunteers were sampled at their community site, DNA was isolated from white blood cells and mtDNA, Y-chromosome, and STR alleles were studied. H. pylori was cultured from gastric juice, and DNA extracted for genotyping of virulence and housekeeping genes. We found Amerindian mtDNA haplogroups (A, B, C, and D), Y-chromosome DYS19T, and Amerindian STRs alleles frequent in the three groups, confirming Amerindian ancestry in these Mexican groups. Concerning H.pylori cagA phylogenetic analyses, although most isolates were of the Western type, a new Amerindian cluster neither Western nor Asian, was formed by some indigenous Mexican, Colombian, Peruvian and Venezuelan isolates. Similarly, vacA phylogenetic analyses showed the existence of a novel Amerindian type in isolates from Alaska, Mexico and Colombia. With hspA strains from Mexico and other American groups clustered within the three major groups, Asian, African or European. Genotyping of housekeeping genes confirmed that Mexican strains formed a novel Asian-related Amerindian group together with strains from remote Amazon Aborigines. This study shows that Mexican indigenous people with Amerindian markers are colonized with H. pylori showing admixture of Asian, European and African strains in genes known to interact with the gastric mucosa. We present evidence of novel Amerindian cagA and vacA alleles in indigenous groups of North and South America.

Helicobacter pylori Genotyping from American Indigenous Groups Shows Novel Amerindian vacA and cagA Alleles and Asian, African and European Admixture

PubMed Central

Camorlinga-Ponce, Margarita; Perez-Perez, Guillermo; Gonzalez-Valencia, Gerardo; Mendoza, Irma; Peñaloza-Espinosa, Rosenda; Ramos, Irma; Kersulyte, Dangeruta; Reyes-Leon, Adriana; Romo, Carolina; Granados, Julio; Muñoz, Leopoldo; Berg, Douglas E.; Torres, Javier

2011-01-01

It is valuable to extend genotyping studies of Helicobacter pylori to strains from indigenous communities across the world to better define adaption, evolution, and associated diseases. We aimed to genetically characterize both human individuals and their infecting H. pylori from indigenous communities of Mexico, and to compare them with those from other human groups. We studied individuals from three indigenous groups, Tarahumaras from the North, Huichols from the West and Nahuas from the center of Mexico. Volunteers were sampled at their community site, DNA was isolated from white blood cells and mtDNA, Y-chromosome, and STR alleles were studied. H. pylori was cultured from gastric juice, and DNA extracted for genotyping of virulence and housekeeping genes. We found Amerindian mtDNA haplogroups (A, B, C, and D), Y-chromosome DYS19T, and Amerindian STRs alleles frequent in the three groups, confirming Amerindian ancestry in these Mexican groups. Concerning H.pylori cagA phylogenetic analyses, although most isolates were of the Western type, a new Amerindian cluster neither Western nor Asian, was formed by some indigenous Mexican, Colombian, Peruvian and Venezuelan isolates. Similarly, vacA phylogenetic analyses showed the existence of a novel Amerindian type in isolates from Alaska, Mexico and Colombia. With hspA strains from Mexico and other American groups clustered within the three major groups, Asian, African or European. Genotyping of housekeeping genes confirmed that Mexican strains formed a novel Asian-related Amerindian group together with strains from remote Amazon Aborigines. This study shows that Mexican indigenous people with Amerindian markers are colonized with H. pylori showing admixture of Asian, European and African strains in genes known to interact with the gastric mucosa. We present evidence of novel Amerindian cagA and vacA alleles in indigenous groups of North and South America. PMID:22073291

Comprehensive analysis of MGMT promoter methylation: correlation with MGMT expression and clinical response in GBM.

PubMed

Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg

2011-01-07

O⁶-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR  = 5.23, 95% CI [2.089-13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR  = 3.076, 95% CI [1.301-7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting.

Comprehensive Analysis of MGMT Promoter Methylation: Correlation with MGMT Expression and Clinical Response in GBM

PubMed Central

Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg

2011-01-01

O6-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR  = 5.23, 95% CI [2.089–13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR  = 3.076, 95% CI [1.301–7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting. PMID:21249131

Comprehensive DNA methylation analysis of human neuroblastoma cells treated with blonanserin.

PubMed

Murata, Yui; Nishioka, Masaki; Bundo, Miki; Sunaga, Fumiko; Kasai, Kiyoto; Iwamoto, Kazuya

2014-03-20

Blonanserin is a second-generation antipsychotic drug for schizophrenia. The pharmacological actions of blonanserin are shown to be the antagonism of dopamine receptor 2 and serotonin receptors. However, its molecular mechanisms in brain cells have not been fully characterized. Accumulating evidence suggests that antipsychotic drugs and mood stabilizers show epigenetic effects on a wide range of genes in animal and cellular models. We performed genome-wide DNA methylation analysis targeting 479,814 CpG sites of cultured human neuroblastoma cells administered with blonanserin. We found that 3,057 CpG sites showed statistically significant changes in DNA methylation at two different doses of blonanserin (1.36 nM and 13.6 nM). These included hypermethylated CpG sites that were enriched in genes related to axonogenesis and cell morphogenesis involved in neuron differentiation. We also showed that the global effect on DNA methylome depends on the concentration of the drug. With a high dose of blonanserin, the overall methylation levels across all CpG sites significantly increased. These increases in DNA methylation were prominent in the CpG sites distant from promoter regions. We further examined DNA methylation changes in specific genes implicated for the actions of antipsychotic drugs, such as the dopamine receptor 2 (DRD2) gene and the serotonin receptor 2A (HTR2A) gene. We observed that CpG sites that were located within DRD2 and HTR2A genes were significantly hypermethylated by blonanserin. The DNA methylation changes induced by the treatment with blonanserin will be useful for understanding its pharmacological actions at the cellular level. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Silencing of GSTP1 gene by CpG island DNA hypermethylation in HBV-associated hepatocellular carcinomas.

PubMed

Zhong, Sheng; Tang, Mandy W; Yeo, Winnie; Liu, Cuiling; Lo, Y M Dennis; Johnson, Philip J

2002-04-01

Glutathione S-transferases, enzymes that defend cells against damage mediated by oxidant and electrophilic carcinogens, may be critical determinants of cancer pathogenesis. In this report, we assess the role of epigenetic silencing of the GSTP1 gene, a gene encoding the pi-class glutathione S-transferase, in the pathogenesis of hepatitis B virus (HBV)-associated hepatocellular carcinomas (HCC). The cell lines Hep3B, HepG2, and a cohort of 43 HBV-associated HCC tissue specimens and corresponding nontumor tissues were subjected to analysis for GSTP1 epigenetic alteration and expression. GSTP1 "CpG" island DNA hypermethylation in the liver cell lines, and the tissue specimens were determined by methylation-specific PCR and correlated with expression of the gene using reverse-transcription PCR, immunoblotting, and immunohistochemistry. GSTP1 CpG island DNA hypermethylation was detected in 28 of 43 (65.1%) HCC tissues and 4 of 40 (10%) corresponding nontumor tissues. GSTP1 protein was absent in those cases showing hypermethylation of the gene. Similarly, DNA from Hep3B and HepG2 cell lines displayed complete GSTP1 hypermethylation in the CpG island, and they failed to express GSTP1 mRNA and the corresponding protein product. Treatment of the cell lines with the DNA methyltransferase inhibitor 5-aza-deoxycytidine reversed the hypermethylation, and restored GSTP1 mRNA and polypeptide expression. These data indicate that epigenetic silencing of GSTP1 gene expression by CpG island DNA hypermethylation is common in human HBV-associated HCC. In addition, somatic GSTP1 inactivation via CpG island hypermethylation may contribute to the pathogenesis of this malignancy.

Evaluation of Allele-Specific Somatic Changes of Genome-Wide Association Study Susceptibility Alleles in Human Colorectal Cancers

PubMed Central

Gerber, Madelyn M.; Hampel, Heather; Schulz, Nathan P.; Fernandez, Soledad; Wei, Lai; Zhou, Xiao-Ping; de la Chapelle, Albert; Toland, Amanda Ewart

2012-01-01

Background Tumors frequently exhibit loss of tumor suppressor genes or allelic gains of activated oncogenes. A significant proportion of cancer susceptibility loci in the mouse show somatic losses or gains consistent with the presence of a tumor susceptibility or resistance allele. Thus, allele-specific somatic gains or losses at loci may demarcate the presence of resistance or susceptibility alleles. The goal of this study was to determine if previously mapped susceptibility loci for colorectal cancer show evidence of allele-specific somatic events in colon tumors. Methods We performed quantitative genotyping of 16 single nucleotide polymorphisms (SNPs) showing statistically significant association with colorectal cancer in published genome-wide association studies (GWAS). We genotyped 194 paired normal and colorectal tumor DNA samples and 296 paired validation samples to investigate these SNPs for allele-specific somatic gains and losses. We combined analysis of our data with published data for seven of these SNPs. Results No statistically significant evidence for allele-specific somatic selection was observed for the tested polymorphisms in the discovery set. The rs6983267 variant, which has shown preferential loss of the non-risk T allele and relative gain of the risk G allele in previous studies, favored relative gain of the G allele in the combined discovery and validation samples (corrected p-value = 0.03). When we combined our data with published allele-specific imbalance data for this SNP, the G allele of rs6983267 showed statistically significant evidence of relative retention (p-value = 2.06×10−4). Conclusions Our results suggest that the majority of variants identified as colon cancer susceptibility alleles through GWAS do not exhibit somatic allele-specific imbalance in colon tumors. Our data confirm previously published results showing allele-specific imbalance for rs6983267. These results indicate that allele-specific imbalance of cancer susceptibility alleles may not be a common phenomenon in colon cancer. PMID:22629442

In Vivo-Selected Compensatory Mutations Restore the Fitness Cost of Mosaic penA Alleles That Confer Ceftriaxone Resistance in Neisseria gonorrhoeae.

PubMed

Vincent, Leah R; Kerr, Samuel R; Tan, Yang; Tomberg, Joshua; Raterman, Erica L; Dunning Hotopp, Julie C; Unemo, Magnus; Nicholas, Robert A; Jerse, Ann E

2018-04-03

Resistance to ceftriaxone in Neisseria gonorrhoeae is mainly conferred by mosaic penA alleles that encode penicillin-binding protein 2 (PBP2) variants with markedly lower rates of acylation by ceftriaxone. To assess the impact of these mosaic penA alleles on gonococcal fitness, we introduced the mosaic penA alleles from two ceftriaxone-resistant (Cro r ) clinical isolates (H041 and F89) into a Cro s strain (FA19) by allelic exchange and showed that the resultant Cro r mutants were significantly outcompeted by the Cro s parent strain in vitro and in a murine infection model. Four Cro r compensatory mutants of FA19 penA41 were isolated independently from mice that outcompeted the parent strain both in vitro and in vivo One of these compensatory mutants (LV41C) displayed a unique growth profile, with rapid log growth followed by a sharp plateau/gradual decline at stationary phase. Genome sequencing of LV41C revealed a mutation (G348D) in the acnB gene encoding the bifunctional aconitate hydratase 2/2 methylisocitrate dehydratase. Introduction of the acnB G348D allele into FA19 penA41 conferred both a growth profile that phenocopied that of LV41C and a fitness advantage, although not as strongly as that exhibited by the original compensatory mutant, suggesting the existence of additional compensatory mutations. The mutant aconitase appears to be a functional knockout with lower activity and expression than wild-type aconitase. Transcriptome sequencing (RNA-seq) analysis of FA19 penA41 acnB G348D revealed a large set of upregulated genes involved in carbon and energy metabolism. We conclude that compensatory mutations can be selected in Cro r gonococcal strains that increase metabolism to ameliorate their fitness deficit. IMPORTANCE The emergence of ceftriaxone-resistant (Cro r ) Neisseria gonorrhoeae has led to the looming threat of untreatable gonorrhea. Whether Cro resistance is likely to spread can be predicted from studies that compare the relative fitnesses of susceptible and resistant strains that differ only in the penA gene that confers Cro resistance. We showed that mosaic penA alleles found in Cro r clinical isolates are outcompeted by the Cro s parent strain in vitro and in vivo but that compensatory mutations that allow ceftriaxone resistance to be maintained by increasing bacterial fitness are selected during mouse infection. One compensatory mutant that was studied in more detail had a mutation in acnB , which encodes the aconitase that functions in the tricarboxylic acid (TCA) cycle. This study illustrates that compensatory mutations can be selected during infection, which we hypothesize may allow the spread of Cro resistance in nature. This study also provides novel insights into gonococcal metabolism and physiology.

NcoI and TaqI RFLPs for human M creatine kinase (CKM)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perryman, M.B.; Hejtmancik, J.F.; Ashizawa, Tetsuo

1988-09-12

Probe pHMCKUT contains a 135 bp cDNA fragment inserted into pGEM 3. The probe corresponds to nucleotides 1,201 to 1,336 located in the 3{prime} untranslated region of human M creatine kinase. The probe is specific for human M creatine kinase and does not hybridize to human B cretine kinase sequences. NcoI identifies a two allele polymorphism of a band at either 2.5 kb or 3.6 kb. TaqI identifies a two allele polymorphism at either 3.8 kb or 4.5 kb. Human M creatine has been localized to chromosome 19q. Autosomal co-dominant inheritance was shown in six informative Caucasian families.

Distinctive Klf4 mutants determine preference for DNA methylation status

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hashimoto, Hideharu; Wang, Dongxue; Steves, Alyse N.

Reprogramming of mammalian genome methylation is critically important but poorly understood. Klf4, a transcription factor directing reprogramming, contains a DNA binding domain with three consecutive C2H2 zinc fingers. Klf4 recognizes CpG or TpG within a specific sequence. Mouse Klf4 DNA binding domain has roughly equal affinity for methylated CpG or TpG, and slightly lower affinity for unmodified CpG. The structural basis for this key preference is unclear, though the side chain of Glu446 is known to contact the methyl group of 5-methylcytosine (5mC) or thymine (5-methyluracil). We examined the role of Glu446 by mutagenesis. Substituting Glu446 with aspartate (E446D) resultedmore » in preference for unmodified cytosine, due to decreased affinity for 5mC. In contrast, substituting Glu446 with proline (E446P) increased affinity for 5mC by two orders of magnitude. Structural analysis revealed hydrophobic interaction between the proline's aliphatic cyclic structure and the 5-methyl group of the pyrimidine (5mC or T). As in wild-type Klf4 (E446), the proline at position 446 does not interact directly with either the 5mC N4 nitrogen or the thymine O4 oxygen. In contrast, the unmethylated cytosine's exocyclic N4 amino group (NH2) and its ring carbon C5 atom hydrogen bond directly with the aspartate carboxylate of the E446D variant. Both of these interactions would provide a preference for cytosine over thymine, and the latter one could explain the E446D preference for unmethylated cytosine. Finally, we evaluated the ability of these Klf4 mutants to regulate transcription of methylated and unmethylated promoters in a luciferase reporter assay.« less

Allelic variation in Salmonella: an underappreciated driver of adaptation and virulence

PubMed Central

Yue, Min; Schifferli, Dieter M.

2014-01-01

Salmonella enterica causes substantial morbidity and mortality in humans and animals. Infection and intestinal colonization by S. enterica require virulence factors that mediate bacterial binding and invasion of enterocytes and innate immune cells. Some S. enterica colonization factors and their alleles are host restricted, suggesting a potential role in regulation of host specificity. Recent data also suggest that colonization factors promote horizontal gene transfer of antimicrobial resistance genes by increasing the local density of Salmonella in colonized intestines. Although a profusion of genes are involved in Salmonella pathogenesis, the relative importance of their allelic variation has only been studied intensely in the type 1 fimbrial adhesin FimH. Although other Salmonella virulence factors demonstrate allelic variation, their association with specific metadata (e.g., host species, disease or carrier state, time and geographic place of isolation, antibiotic resistance profile, etc.) remains to be interrogated. To date, genome-wide association studies (GWAS) in bacteriology have been limited by the paucity of relevant metadata. In addition, due to the many variables amid metadata categories, a very large number of strains must be assessed to attain statistically significant results. However, targeted approaches in which genes of interest (e.g., virulence factors) are specifically sequenced alleviates the time-consuming and costly statistical GWAS analysis and increases statistical power, as larger numbers of strains can be screened for non-synonymous single nucleotide polymorphisms (SNPs) that are associated with available metadata. Congruence of specific allelic variants with specific metadata from strains that have a relevant clinical and epidemiological history will help to prioritize functional wet-lab and animal studies aimed at determining cause-effect relationships. Such an approach should be applicable to other pathogens that are being collected in well-curated repositories. PMID:24454310

Identification of body fluid-specific DNA methylation markers for use in forensic science.

PubMed

Park, Jong-Lyul; Kwon, Oh-Hyung; Kim, Jong Hwan; Yoo, Hyang-Sook; Lee, Han-Chul; Woo, Kwang-Man; Kim, Seon-Young; Lee, Seung-Hwan; Kim, Yong Sung

2014-11-01

DNA methylation, which occurs at the 5'-position of the cytosine in CpG dinucleotides, has great potential for forensic identification of body fluids, because tissue-specific patterns of DNA methylation have been demonstrated, and DNA is less prone to degradation than proteins or RNA. Previous studies have reported several body fluid-specific DNA methylation markers, but DNA methylation differences are sometimes low in saliva and vaginal secretions. Moreover, specific DNA methylation markers in four types of body fluids (blood, saliva, semen, and vaginal secretions) have not been investigated with genome-wide profiling. Here, we investigated novel DNA methylation markers for identification of body fluids for use in forensic science using the Illumina HumanMethylation 450K bead array, which contains over 450,000 CpG sites. Using methylome data from 16 samples of blood, saliva, semen, and vaginal secretions, we first selected 2986 hypermethylated or hypomethylated regions that were specific for each type of body fluid. We then selected eight CpG sites as novel, forensically relevant DNA methylation markers: cg06379435 and cg08792630 for blood, cg26107890 and cg20691722 for saliva, cg23521140 and cg17610929 for semen, and cg01774894 and cg14991487 for vaginal secretions. These eight selected markers were evaluated in 80 body fluid samples using pyrosequencing, and all showed high sensitivity and specificity for identification of the target body fluid. We suggest that these eight DNA methylation markers may be good candidates for developing an effective molecular assay for identification of body fluids in forensic science. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Identification of multiple interacting alleles conferring low glycerol and high ethanol yield in Saccharomyces cerevisiae ethanolic fermentation

PubMed Central

2013-01-01

Background Genetic engineering of industrial microorganisms often suffers from undesirable side effects on essential functions. Reverse engineering is an alternative strategy to improve multifactorial traits like low glycerol/high ethanol yield in yeast fermentation. Previous rational engineering of this trait always affected essential functions like growth and stress tolerance. We have screened Saccharomyces cerevisiae biodiversity for specific alleles causing lower glycerol/higher ethanol yield, assuming higher compatibility with normal cellular functionality. Previous work identified ssk1E330N…K356N as causative allele in strain CBS6412, which displayed the lowest glycerol/ethanol ratio. Results We have now identified a unique segregant, 26B, that shows similar low glycerol/high ethanol production as the superior parent, but lacks the ssk1E330N…K356N allele. Using segregants from the backcross of 26B with the inferior parent strain, we applied pooled-segregant whole-genome sequence analysis and identified three minor quantitative trait loci (QTLs) linked to low glycerol/high ethanol production. Within these QTLs, we identified three novel alleles of known regulatory and structural genes of glycerol metabolism, smp1R110Q,P269Q, hot1P107S,H274Y and gpd1L164P as causative genes. All three genes separately caused a significant drop in the glycerol/ethanol production ratio, while gpd1L164P appeared to be epistatically suppressed by other alleles in the superior parent. The order of potency in reducing the glycerol/ethanol ratio of the three alleles was: gpd1L164P > hot1P107S,H274Y ≥ smp1R110Q,P269Q. Conclusions Our results show that natural yeast strains harbor multiple specific alleles of genes controlling essential functions, that are apparently compatible with survival in the natural environment. These newly identified alleles can be used as gene tools for engineering industrial yeast strains with multiple subtle changes, minimizing the risk of negatively affecting other essential functions. The gene tools act at the transcriptional, regulatory or structural gene level, distributing the impact over multiple targets and thus further minimizing possible side-effects. In addition, the results suggest polygenic analysis of complex traits as a promising new avenue to identify novel components involved in cellular functions, including those important in industrial applications. PMID:23759206

Comparative anatomy of chromosomal domains with imprinted and non-imprinted allele-specific DNA methylation.

PubMed

Paliwal, Anupam; Temkin, Alexis M; Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

2013-08-01

Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM.

Comparative Anatomy of Chromosomal Domains with Imprinted and Non-Imprinted Allele-Specific DNA Methylation

PubMed Central

Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L.; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

2013-01-01

Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM. PMID:24009515

Identification of a novel CHEK2 variant and assessment of its contribution to the risk of breast cancer in French Canadian women.

PubMed

Novak, David J; Chen, Long Qi; Ghadirian, Parviz; Hamel, Nancy; Zhang, Phil; Rossiny, Vanessa; Cardinal, Guy; Robidoux, André; Tonin, Patricia N; Rousseau, Francois; Narod, Steven A; Foulkes, William D

2008-08-15

BRCA1 and BRCA2 account for the majority of the known familial breast cancer risk, however, the impact of other cancer susceptibility genes largely remains to be elucidated. Checkpoint Kinase 2 (CHEK2) is an important signal transducer of cellular responses to DNA damage, whose defects have been associated with an increase in breast cancer risk. Previous studies have identified low penetrance CHEK2 alleles such as 1100delC and I157T, as well as variants such as S428F in the Ashkenazi Jewish population and IVS2 + 1G>A in the Polish population. No founder allele has been specifically identified in the French Canadian population. The 14 coding exons of CHEK2 were fully sequenced for variant alleles in a panel of 25 affected French Canadian women and 25 healthy controls. Two variants were identified of which one novel variant was further screened for in an additional panel of 667 breast cancer patients and 6548 healthy controls. Additional genotyping was conducted using allele specific PCR and a restriction digest assay. Significance of amino acid substitutions were deduced by employing comparative analysis techniques. Two variants were identified: the previously reported silent substitution 252A>G (E84E) and the novel missense variant, 1217G>A (R406H). No significant difference in allele distribution between French Canadian women with breast cancer and healthy controls was observed (3/692, 0.43% vs. 22/6573, 0.33%, respectively, P = 0.73). The novel CHEK2 missense variant identified in this study, R406H, is unlikely to contribute to breast cancer risk in French Canadian women.

Identification of a novel CHEK2 variant and assessment of its contribution to the risk of breast cancer in French Canadian women

PubMed Central

Novak, David J; Chen, Long Qi; Ghadirian, Parviz; Hamel, Nancy; Zhang, Phil; Rossiny, Vanessa; Cardinal, Guy; Robidoux, André; Tonin, Patricia N; Rousseau, Francois; Narod, Steven A; Foulkes, William D

2008-01-01

Background BRCA1 and BRCA2 account for the majority of the known familial breast cancer risk, however, the impact of other cancer susceptibility genes largely remains to be elucidated. Checkpoint Kinase 2 (CHEK2) is an important signal transducer of cellular responses to DNA damage, whose defects have been associated with an increase in breast cancer risk. Previous studies have identified low penetrance CHEK2 alleles such as 1100delC and I157T, as well as variants such as S428F in the Ashkenazi Jewish population and IVS2 + 1G>A in the Polish population. No founder allele has been specifically identified in the French Canadian population. Methods The 14 coding exons of CHEK2 were fully sequenced for variant alleles in a panel of 25 affected French Canadian women and 25 healthy controls. Two variants were identified of which one novel variant was further screened for in an additional panel of 667 breast cancer patients and 6548 healthy controls. Additional genotyping was conducted using allele specific PCR and a restriction digest assay. Significance of amino acid substitutions were deduced by employing comparative analysis techniques. Results Two variants were identified: the previously reported silent substitution 252A>G (E84E) and the novel missense variant, 1217G>A (R406H). No significant difference in allele distribution between French Canadian women with breast cancer and healthy controls was observed (3/692, 0.43% vs. 22/6573, 0.33%, respectively, P = 0.73). Conclusion The novel CHEK2 missense variant identified in this study, R406H, is unlikely to contribute to breast cancer risk in French Canadian women. PMID:18706089

Sequence diversity within the HA-1 gene as detected by melting temperature assay without oligonucleotide probes

PubMed Central

Graziano, Claudio; Giorgi, Massimo; Malentacchi, Cecilia; Mattiuz, Pier Luigi; Porfirio, Berardino

2005-01-01

Background The minor histocompatibility antigens (mHags) are self-peptides derived from common cellular proteins and presented by MHC class I and II molecules. Disparities in mHags are a potential risk for the development of graft-versus-host disease (GvHD) in the recipients of bone marrow from HLA-identical donors. Two alleles have been identified in the mHag HA-1. The correlation between mismatches of the mHag HA-1 and GvHD has been suggested and methods to facilitate large-scale testing were afterwards developed. Methods We used sequence specific primer (SSP) PCR and direct sequencing to detect HA-1 gene polymorphisms in a sample of 131 unrelated Italian subjects. We then set up a novel melting temperature (Tm) assay that may help identification of HA-1 alleles without oligonucleotide probes. Results We report the frequencies of HA-1 alleles in the Italian population and the presence of an intronic 5 base-pair deletion associated with the immunogeneic allele HA-1H. We also detected novel variable sites with respect to the consensus sequence of HA-1 locus. Even though recombination/gene conversion events are documented, there is considerable linkage disequilibrium in the data. The gametic associations between HA-1R/H alleles and the intronic 5-bp ins/del polymorphism prompted us to try the Tm analysis with SYBR® Green I. We show that the addition of dimethylsulfoxide (DMSO) during the assay yields distinct patterns when amplicons from HA-1H homozygotes, HA-1R homozygotes, and heterozygotes are analysed. Conclusion The possibility to use SYBR® Green I to detect Tm differences between allelic variants is attractive but requires great caution. We succeeded in allele discrimination of the HA-1 locus using a relatively short (101 bp) amplicon, only in the presence of DMSO. We believe that, at least in certain assets, Tm assays may benefit by the addition of DMSO or other agents affecting DNA strand conformation and stability. PMID:16202172

Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

PubMed Central

Zhao, Jian; Giles, Brendan M; Taylor, Rhonda L; Yette, Gabriel A; Lough, Kara M; Ng, Han Leng; Abraham, Lawrence J; Wu, Hui; Kelly, Jennifer A; Glenn, Stuart B; Adler, Adam J; Williams, Adrienne H; Comeau, Mary E; Ziegler, Julie T; Marion, Miranda; Alarcón-Riquelme, Marta E; Alarcón, Graciela S; Anaya, Juan-Manuel; Bae, Sang-Cheol; Kim, Dam; Lee, Hye-Soon; Criswell, Lindsey A; Freedman, Barry I; Gilkeson, Gary S; Guthridge, Joel M; Jacob, Chaim O; James, Judith A; Kamen, Diane L; Merrill, Joan T; Sivils, Kathy Moser; Niewold, Timothy B; Petri, Michelle A; Ramsey-Goldman, Rosalind; Reveille, John D; Scofield, R Hal; Stevens, Anne M; Vilá, Luis M; Vyse, Timothy J; Kaufman, Kenneth M; Harley, John B; Langefeld, Carl D; Gaffney, Patrick M; Brown, Elizabeth E; Edberg, Jeffrey C; Kimberly, Robert P; Ulgiati, Daniela; Tsao, Betty P; Boackle, Susan A

2016-01-01

Objectives Systemic lupus erythematosus (SLE; OMIM 152700) is characterised by the production of antibodies to nuclear antigens. We previously identified variants in complement receptor 2 (CR2/CD21) that were associated with decreased risk of SLE. This study aimed to identify the causal variant for this association. Methods Genotyped and imputed genetic variants spanning CR2 were assessed for association with SLE in 15 750 case-control subjects from four ancestral groups. Allele-specific functional effects of associated variants were determined using quantitative real-time PCR, quantitative flow cytometry, electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP)-PCR. Results The strongest association signal was detected at rs1876453 in intron 1 of CR2 (pmeta=4.2×10−4, OR 0.85), specifically when subjects were stratified based on the presence of dsDNA autoantibodies (case-control pmeta=7.6×10−7, OR 0.71; case-only pmeta=1.9×10−4, OR 0.75). Although allele-specific effects on B cell CR2 mRNA or protein levels were not identified, levels of complement receptor 1 (CR1/CD35) mRNA and protein were significantly higher on B cells of subjects harbouring the minor allele (p=0.0248 and p=0.0006, respectively). The minor allele altered the formation of several DNA protein complexes by EMSA, including one containing CCCTC-binding factor (CTCF), an effect that was confirmed by ChIP-PCR. Conclusions These data suggest that rs1876453 in CR2 has long-range effects on gene regulation that decrease susceptibility to lupus. Since the minor allele at rs1876453 is preferentially associated with reduced risk of the highly specific dsDNA autoantibodies that are present in preclinical, active and severe lupus, understanding its mechanisms will have important therapeutic implications. PMID:25180293

A global analysis of Y-chromosomal haplotype diversity for 23 STR loci

PubMed Central

Purps, Josephine; Siegert, Sabine; Willuweit, Sascha; Nagy, Marion; Alves, Cíntia; Salazar, Renato; Angustia, Sheila M.T.; Santos, Lorna H.; Anslinger, Katja; Bayer, Birgit; Ayub, Qasim; Wei, Wei; Xue, Yali; Tyler-Smith, Chris; Bafalluy, Miriam Baeta; Martínez-Jarreta, Begoña; Egyed, Balazs; Balitzki, Beate; Tschumi, Sibylle; Ballard, David; Court, Denise Syndercombe; Barrantes, Xinia; Bäßler, Gerhard; Wiest, Tina; Berger, Burkhard; Niederstätter, Harald; Parson, Walther; Davis, Carey; Budowle, Bruce; Burri, Helen; Borer, Urs; Koller, Christoph; Carvalho, Elizeu F.; Domingues, Patricia M.; Chamoun, Wafaa Takash; Coble, Michael D.; Hill, Carolyn R.; Corach, Daniel; Caputo, Mariela; D’Amato, Maria E.; Davison, Sean; Decorte, Ronny; Larmuseau, Maarten H.D.; Ottoni, Claudio; Rickards, Olga; Lu, Di; Jiang, Chengtao; Dobosz, Tadeusz; Jonkisz, Anna; Frank, William E.; Furac, Ivana; Gehrig, Christian; Castella, Vincent; Grskovic, Branka; Haas, Cordula; Wobst, Jana; Hadzic, Gavrilo; Drobnic, Katja; Honda, Katsuya; Hou, Yiping; Zhou, Di; Li, Yan; Hu, Shengping; Chen, Shenglan; Immel, Uta-Dorothee; Lessig, Rüdiger; Jakovski, Zlatko; Ilievska, Tanja; Klann, Anja E.; García, Cristina Cano; de Knijff, Peter; Kraaijenbrink, Thirsa; Kondili, Aikaterini; Miniati, Penelope; Vouropoulou, Maria; Kovacevic, Lejla; Marjanovic, Damir; Lindner, Iris; Mansour, Issam; Al-Azem, Mouayyad; Andari, Ansar El; Marino, Miguel; Furfuro, Sandra; Locarno, Laura; Martín, Pablo; Luque, Gracia M.; Alonso, Antonio; Miranda, Luís Souto; Moreira, Helena; Mizuno, Natsuko; Iwashima, Yasuki; Neto, Rodrigo S. Moura; Nogueira, Tatiana L.S.; Silva, Rosane; Nastainczyk-Wulf, Marina; Edelmann, Jeanett; Kohl, Michael; Nie, Shengjie; Wang, Xianping; Cheng, Baowen; Núñez, Carolina; Pancorbo, Marian Martínez de; Olofsson, Jill K.; Morling, Niels; Onofri, Valerio; Tagliabracci, Adriano; Pamjav, Horolma; Volgyi, Antonia; Barany, Gusztav; Pawlowski, Ryszard; Maciejewska, Agnieszka; Pelotti, Susi; Pepinski, Witold; Abreu-Glowacka, Monica; Phillips, Christopher; Cárdenas, Jorge; Rey-Gonzalez, Danel; Salas, Antonio; Brisighelli, Francesca; Capelli, Cristian; Toscanini, Ulises; Piccinini, Andrea; Piglionica, Marilidia; Baldassarra, Stefania L.; Ploski, Rafal; Konarzewska, Magdalena; Jastrzebska, Emila; Robino, Carlo; Sajantila, Antti; Palo, Jukka U.; Guevara, Evelyn; Salvador, Jazelyn; Ungria, Maria Corazon De; Rodriguez, Jae Joseph Russell; Schmidt, Ulrike; Schlauderer, Nicola; Saukko, Pekka; Schneider, Peter M.; Sirker, Miriam; Shin, Kyoung-Jin; Oh, Yu Na; Skitsa, Iulia; Ampati, Alexandra; Smith, Tobi-Gail; Calvit, Lina Solis de; Stenzl, Vlastimil; Capal, Thomas; Tillmar, Andreas; Nilsson, Helena; Turrina, Stefania; De Leo, Domenico; Verzeletti, Andrea; Cortellini, Venusia; Wetton, Jon H.; Gwynne, Gareth M.; Jobling, Mark A.; Whittle, Martin R.; Sumita, Denilce R.; Wolańska-Nowak, Paulina; Yong, Rita Y.Y.; Krawczak, Michael; Nothnagel, Michael; Roewer, Lutz

2014-01-01

In a worldwide collaborative effort, 19,630 Y-chromosomes were sampled from 129 different populations in 51 countries. These chromosomes were typed for 23 short-tandem repeat (STR) loci (DYS19, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS385ab, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458, DYS635, GATAH4, DYS481, DYS533, DYS549, DYS570, DYS576, and DYS643) and using the PowerPlex Y23 System (PPY23, Promega Corporation, Madison, WI). Locus-specific allelic spectra of these markers were determined and a consistently high level of allelic diversity was observed. A considerable number of null, duplicate and off-ladder alleles were revealed. Standard single-locus and haplotype-based parameters were calculated and compared between subsets of Y-STR markers established for forensic casework. The PPY23 marker set provides substantially stronger discriminatory power than other available kits but at the same time reveals the same general patterns of population structure as other marker sets. A strong correlation was observed between the number of Y-STRs included in a marker set and some of the forensic parameters under study. Interestingly a weak but consistent trend toward smaller genetic distances resulting from larger numbers of markers became apparent. PMID:24854874

Genome-wide identification of allele-specific expression (ASE) in response to Marek's disease virus infection using next generation sequencing.

PubMed

Maceachern, Sean; Muir, William M; Crosby, Seth; Cheng, Hans H

2011-06-03

Marek's disease (MD), a T cell lymphoma induced by the highly oncogenic α-herpesvirus Marek's disease virus (MDV), is the main chronic infectious disease concern threatening the poultry industry. Enhancing genetic resistance to MD in commercial poultry is an attractive method to augment MD vaccines, which is currently the control method of choice. In order to optimally implement this control strategy through marker-assisted selection (MAS) and to gain biological information, it is necessary to identify specific genes that influence MD incidence. A genome-wide screen for allele-specific expression (ASE) in response to MDV infection was conducted. The highly inbred ADOL chicken lines 6 (MD resistant) and 7 (MD susceptible) were inter-mated in reciprocal crosses and half of the progeny challenged with MDV. Splenic RNA pools at a single time after infection for each treatment group point were generated, sequenced using a next generation sequencer, then analyzed for allele-specific expression (ASE). To validate and extend the results, Illumina GoldenGate assays for selected cSNPs were developed and used on all RNA samples from all 6 time points following MDV challenge. RNA sequencing resulted in 11-13+ million mappable reads per treatment group, 1.7+ Gb total sequence, and 22,655 high-confidence cSNPs. Analysis of these cSNPs revealed that 5360 cSNPs in 3773 genes exhibited statistically significant allelic imbalance. Of the 1536 GoldenGate assays, 1465 were successfully scored with all but 19 exhibiting evidence for allelic imbalance. ASE is an efficient method to identify potentially all or most of the genes influencing this complex trait. The identified cSNPs can be further evaluated in resource populations to determine their allelic direction and size of effect on genetic resistance to MD as well as being directly implemented in genomic selection programs. The described method, although demonstrated in inbred chicken lines, is applicable to all traits in any diploid species, and should prove to be a simple method to identify the majority of genes controlling any complex trait.

Epigenetic analysis leads to identification of HNF1B as a subtype-specific susceptibility gene for ovarian cancer

PubMed Central

Shen, Hui; Fridley, Brooke L.; Song, Honglin; Lawrenson, Kate; Cunningham, Julie M.; Ramus, Susan J.; Cicek, Mine S.; Tyrer, Jonathan; Stram, Douglas; Larson, Melissa C.; Köbel, Martin; Ziogas, Argyrios; Zheng, Wei; Yang, Hannah P.; Wu, Anna H.; Wozniak, Eva L.; Woo, Yin Ling; Winterhoff, Boris; Wik, Elisabeth; Whittemore, Alice S.; Wentzensen, Nicolas; Weber, Rachel Palmieri; Vitonis, Allison F.; Vincent, Daniel; Vierkant, Robert A.; Vergote, Ignace; Van Den Berg, David; Van Altena, Anne M.; Tworoger, Shelley S.; Thompson, Pamela J.; Tessier, Daniel C.; Terry, Kathryn L.; Teo, Soo-Hwang; Templeman, Claire; Stram, Daniel O.; Southey, Melissa C.; Sieh, Weiva; Siddiqui, Nadeem; Shvetsov, Yurii B.; Shu, Xiao-Ou; Shridhar, Viji; Wang-Gohrke, Shan; Severi, Gianluca; Schwaab, Ira; Salvesen, Helga B.; Rzepecka, Iwona K.; Runnebaum, Ingo B.; Rossing, Mary Anne; Rodriguez-Rodriguez, Lorna; Risch, Harvey A.; Renner, Stefan P.; Poole, Elizabeth M.; Pike, Malcolm C.; Phelan, Catherine M.; Pelttari, Liisa M.; Pejovic, Tanja; Paul, James; Orlow, Irene; Omar, Siti Zawiah; Olson, Sara H.; Odunsi, Kunle; Nickels, Stefan; Nevanlinna, Heli; Ness, Roberta B.; Narod, Steven A.; Nakanishi, Toru; Moysich, Kirsten B.; Monteiro, Alvaro N.A.; Moes-Sosnowska, Joanna; Modugno, Francesmary; Menon, Usha; McLaughlin, John R.; McGuire, Valerie; Matsuo, Keitaro; Adenan, Noor Azmi Mat; Massuger, Leon F.A. G.; Lurie, Galina; Lundvall, Lene; Lubiński, Jan; Lissowska, Jolanta; Levine, Douglas A.; Leminen, Arto; Lee, Alice W.; Le, Nhu D.; Lambrechts, Sandrina; Lambrechts, Diether; Kupryjanczyk, Jolanta; Krakstad, Camilla; Konecny, Gottfried E.; Kjaer, Susanne Krüger; Kiemeney, Lambertus A.; Kelemen, Linda E.; Keeney, Gary L.; Karlan, Beth Y.; Karevan, Rod; Kalli, Kimberly R.; Kajiyama, Hiroaki; Ji, Bu-Tian; Jensen, Allan; Jakubowska, Anna; Iversen, Edwin; Hosono, Satoyo; Høgdall, Claus K.; Høgdall, Estrid; Hoatlin, Maureen; Hillemanns, Peter; Heitz, Florian; Hein, Rebecca; Harter, Philipp; Halle, Mari K.; Hall, Per; Gronwald, Jacek; Gore, Martin; Goodman, Marc T.; Giles, Graham G.; Gentry-Maharaj, Aleksandra; Garcia-Closas, Montserrat; Flanagan, James M.; Fasching, Peter A.; Ekici, Arif B.; Edwards, Robert; Eccles, Diana; Easton, Douglas F.; Dürst, Matthias; du Bois, Andreas; Dörk, Thilo; Doherty, Jennifer A.; Despierre, Evelyn; Dansonka-Mieszkowska, Agnieszka; Cybulski, Cezary; Cramer, Daniel W.; Cook, Linda S.; Chen, Xiaoqing; Charbonneau, Bridget; Chang-Claude, Jenny; Campbell, Ian; Butzow, Ralf; Bunker, Clareann H.; Brueggmann, Doerthe; Brown, Robert; Brooks-Wilson, Angela; Brinton, Louise A.; Bogdanova, Natalia; Block, Matthew S.; Benjamin, Elizabeth; Beesley, Jonathan; Beckmann, Matthias W.; Bandera, Elisa V.; Baglietto, Laura; Bacot, François; Armasu, Sebastian M.; Antonenkova, Natalia; Anton-Culver, Hoda; Aben, Katja K.; Liang, Dong; Wu, Xifeng; Lu, Karen; Hildebrandt, Michelle A.T.; Schildkraut, Joellen M.; Sellers, Thomas A.; Huntsman, David; Berchuck, Andrew; Chenevix-Trench, Georgia; Gayther, Simon A.; Pharoah, Paul D.P.; Laird, Peter W.; Goode, Ellen L.; Pearce, Celeste Leigh

2013-01-01

HNF1B is overexpressed in clear cell epithelial ovarian cancer, and we observed epigenetic silencing in serous epithelial ovarian cancer, leading us to hypothesize that variation in this gene differentially associates with epithelial ovarian cancer risk according to histological subtype. Here we comprehensively map variation in HNF1B with respect to epithelial ovarian cancer risk and analyse DNA methylation and expression profiles across histological subtypes. Different single-nucleotide polymorphisms associate with invasive serous (rs7405776 odds ratio (OR) = 1.13, P = 3.1 × 10−10) and clear cell (rs11651755 OR = 0.77, P = 1.6 × 10−8) epithelial ovarian cancer. Risk alleles for the serous subtype associate with higher HNF1B-promoter methylation in these tumours. Unmethylated, expressed HNF1B, primarily present in clear cell tumours, coincides with a CpG island methylator phenotype affecting numerous other promoters throughout the genome. Different variants in HNF1B associate with risk of serous and clear cell epithelial ovarian cancer; DNA methylation and expression patterns are also notably distinct between these subtypes. These findings underscore distinct mechanisms driving different epithelial ovarian cancer histological subtypes. PMID:23535649

Sequence Variations in the Flagellar Antigen Genes fliC H25 and fliC H28 of Escherichia coli and Their Use in Identification and Characterization of Enterohemorrhagic E. coli (EHEC) O145:H25 and O145:H28

PubMed Central

Beutin, Lothar; Delannoy, Sabine; Fach, Patrick

2015-01-01

Enterohemorrhagic E. coli (EHEC) serogroup O145 is regarded as one of the major EHEC serogroups involved in severe infections in humans. EHEC O145 encompasses motile and non-motile strains of serotypes O145:H25 and O145:H28. Sequencing the fliC-genes associated with the flagellar antigens H25 and H28 revealed the genetic diversity of the fliC H25 and fliC H28 gene sequences in E. coli. Based on allele discrimination of these fliC-genes real-time PCR tests were designed for identification of EHEC O145:H25 and O145:H28. The fliC H25 genes present in O145:H25 were found to be very similar to those present in E. coli serogroups O2, O100, O165, O172 and O177 pointing to their common evolution but were different from fliC H25 genes of a multiple number of other E. coli serotypes. In a similar way, EHEC O145:H28 harbor a characteristic fliC H28 allele which, apart from EHEC O145:H28, was only found in enteropathogenic (EPEC) O28:H28 strains that shared some common traits with EHEC O145:H28. The real time PCR-assays targeting these fliC H25[O145] and fliC H28[O145] alleles allow better characterization of EHEC O145:H25 and EHEC O145:H28. Evaluation of these PCR assays in spiked ready-to eat salad samples resulted in specific detection of both types of EHEC O145 strains even when low spiking levels of 1–10 cfu/g were used. Furthermore these PCR assays allowed identification of non-motile E. coli strains which are serologically not typable for their H-antigens. The combined use of O-antigen genotyping (O145wzy) and detection of the respective fliC H25[O145] and fliC H28[O145] allele types contributes to improve identification and molecular serotyping of E. coli O145 isolates. PMID:26000885

TSA-induced DNMT1 down-regulation represses hTERT expression via recruiting CTCF into demethylated core promoter region of hTERT in HCT116.

PubMed

Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho

2010-01-01

Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.

Genome-wide and caste-specific DNA methylomes of the ants Camponotus floridanus and Harpegnathos saltator

PubMed Central

Bonasio, Roberto; Li, Qiye; Lian, Jinmin; Mutti, Navdeep S.; Jin, Lijun; Zhao, Hongmei; Zhang, Pei; Wen, Ping; Xiang, Hui; Ding, Yun; Jin, Zonghui; Shen, Steven S.; Wang, Zongji; Wang, Wen; Wang, Jun; Berger, Shelley L.; Liebig, Jürgen; Zhang, Guojie; Reinberg, Danny

2012-01-01

SUMMARY Background Ant societies comprise individuals belonging to different castes characterized by specialized morphologies and behaviors. Because ant embryos can follow different developmental trajectories, epigenetic mechanisms must play a role in caste determination. Ants have a full set of DNA methyltransferase and their genomes contain methylcytosine. To determine the relationship between DNA methylation and phenotypic plasticity in ants, we obtained and compared the genome-wide methylomes of different castes and developmental stages of Camponotus floridanus and Harpegnathos saltator. Results In the ant genomes, methylcytosines are found both in CpG and non-CpG contexts and are strongly enriched at exons of active genes. Changes in exonic DNA methylation correlate with alternative splicing events such as exon skipping and alternative splice site selection. Several genes exhibit caste-specific and developmental changes in DNA methylation that are conserved between the two species, including genes involved in reproduction, telomere maintenance, and noncoding RNA metabolism. Several loci are methylated and expressed monoallelically, and in some cases the choice of methylated allele depends on the caste. Conclusions These first ant methylomes and their intra- and inter-species comparison reveal an exonic methylation pattern that points to a connection between DNA methylation and splicing. The presence of monoallelic DNA methylation and the methylation of non-CpG sites in all samples suggest roles in genome regulation in these social insects, including the intriguing possibility of parental or caste-specific genomic imprinting. PMID:22885060

CpG Oligodeoxynucleotides Facilitate Delivery of Whole Inactivated H9N2 Influenza Virus via Transepithelial Dendrites of Dendritic Cells in Nasal Mucosa

PubMed Central

Qin, Tao; Yin, Yinyan; Yu, Qinghua; Huang, Lulu; Wang, Xiaoqing; Lin, Jian

2015-01-01

ABSTRACT The spread of the low-pathogenicity avian H9N2 influenza virus has seriously increased the risk of a new influenza pandemic. Although whole inactivated virus (WIV) vaccine via intranasal pathway is the effective method of blocking virus transmission, the mucosal barrier seems to be a major factor hampering its development. CpG oligodeoxynucleotides, a known adjuvant, can target downstream dendritic cells (DCs) and effectively enhance the mucosal and systemic immune responses. However, the ability of CpGs to assist H9N2 WIV in transepithelial transport remains unknown. Here, in vitro and in vivo, we showed that CpGs provided assistance for H9N2 WIV in recruiting DCs to the nasal epithelial cells (ECs) and forming transepithelial dendrites (TEDs) to capture luminal viruses. CD103+ DCs participated in this process. Chemokine CCL20 from nasal ECs played a key role in driving DC recruitment and TED formation. Virus-loaded DCs quickly migrated into the draining cervical lymph nodes (CLNs) for antigen presentation. In addition, the competence of CpGs was independent of direct epithelial transport via the transcellular or paracellular pathway. Taken together, our data demonstrated that CpGs enhanced the transport of H9N2 WIV via TEDs of nasal DCs, which might be a novel mechanism for optimal adaptive immune responses. IMPORTANCE This paper demonstrates by both an in vivo and an in vitro coculture model that CpG oligodeoxynucleotides, known as an adjuvant generally targeting downstream immune responses, also are crucial for the transport of H9N2 WIV across nasal epithelial cells (ECs) via the uptake of transepithelial dendrites (TEDs). Our results prove for the first time to our knowledge that the immune-potentiating mechanism of CpGs is based on strengthening the transepithelial uptake of H9N2 WIV in nasal mucosa. These findings provide a fresh perspective for further improvement of intranasal influenza vaccines, which are urgently needed in the face of the potential threat of H9N2 influenza. PMID:25810544

Structure of allelic variants of subtype 5 of histone H1 in pea Pisum sativum L.

PubMed

Bogdanova, V S; Lester, D R; Berdnikov, V A; Andersson, I

2005-06-01

The pea genome contains seven histone H1 genes encoding different subtypes. Previously, the DNA sequence of only one gene, His1, coding for the subtype H1-1, had been identified. We isolated a histone H1 allele from a pea genomic DNA library. Data from the electrophoretic mobility of the pea H1 subtypes and their N-bromosuccinimide cleavage products indicated that the newly isolated gene corresponded to the H1-5 subtype encoded by His5. We confirmed this result by sequencing the gene from three pea lines with H1-5 allelic variants of altered electrophoretic mobility. The allele of the slow H1-5 variant differed from the standard allele by a nucleotide substitution that caused the replacement of the positively charged lysine with asparagine in the DNA-interacting domain of the histone molecule. A temperature-related occurrence had previously been demonstrated for this H1-5 variant in a study on a worldwide collection of pea germplasm. The variant tended to occur at higher frequencies in geographic regions with a cold climate. The fast allelic variant of H1-5 displayed a deletion resulting in the loss of a duplicated pentapeptide in the C-terminal domain.

Disruption of the Crithidia fasciculata RNH1 gene results in the loss of two active forms of ribonuclease H.

PubMed Central

Ray, D S; Hines, J C

1995-01-01

Both prokaryotic and eukaryotic cells contain multiple forms of ribonuclease H, a ribonuclease that specifically degrades the RNA strand of RNA-DNA hybrids and which has been implicated in the processing of initiator RNAs and in the removal of RNA primers from Okazaki fragments. The Crithidia fasciculata RNH1 gene encodes an RNase H and was shown to be a single-copy gene in this diploid trypanosomatid. The RNH1 gene has been disrupted by targeted gene disruption using hygromycin or G418 drug-resistance cassettes. Major active forms of RNase H (38 and 45 kDa) were observed on activity gels of extracts of wild-type cells or cells in which one allele of RNH1 was disrupted. Both the 38 and 45 kDa activities were absent in extracts of cells in which both alleles of RNH1 were disrupted indicating that both forms of the C.fasciculata RNase H are encoded by the RNH1 gene. Images PMID:7630731

The Cambridge Prognostic Groups for improved prediction of disease mortality at diagnosis in primary non-metastatic prostate cancer: a validation study.

PubMed

Gnanapragasam, V J; Bratt, O; Muir, K; Lee, L S; Huang, H H; Stattin, P; Lophatananon, A

2018-02-28

The purpose of this study is to validate a new five-tiered prognostic classification system to better discriminate cancer-specific mortality in men diagnosed with primary non-metastatic prostate cancer. We applied a recently described five-strata model, the Cambridge Prognostic Groups (CPGs 1-5), in two international cohorts and tested prognostic performance against the current standard three-strata classification of low-, intermediate- or high-risk disease. Diagnostic clinico-pathological data for men obtained from the Prostate Cancer data Base Sweden (PCBaSe) and the Singapore Health Study were used. The main outcome measure was prostate cancer mortality (PCM) stratified by age group and treatment modality. The PCBaSe cohort included 72,337 men, of whom 7162 died of prostate cancer. The CPG model successfully classified men with different risks of PCM with competing risk regression confirming significant intergroup distinction (p < 0.0001). The CPGs were significantly better at stratified prediction of PCM compared to the current three-tiered system (concordance index (C-index) 0.81 vs. 0.77, p < 0.0001). This superiority was maintained for every age group division (p < 0.0001). Also in the ethnically different Singapore cohort of 2550 men with 142 prostate cancer deaths, the CPG model outperformed the three strata categories (C-index 0.79 vs. 0.76, p < 0.0001). The model also retained superior prognostic discrimination in the treatment sub-groups: radical prostatectomy (n = 20,586), C-index 0.77 vs. 074; radiotherapy (n = 11,872), C-index 0.73 vs. 0.69; and conservative management (n = 14,950), C-index 0.74 vs. 0.73. The CPG groups that sub-divided the old intermediate-risk (CPG2 vs. CPG3) and high-risk categories (CPG4 vs. CPG5) significantly discriminated PCM outcomes after radical therapy or conservative management (p < 0.0001). This validation study of nearly 75,000 men confirms that the CPG five-tiered prognostic model has superior discrimination compared to the three-tiered model in predicting prostate cancer death across different age and treatment groups. Crucially, it identifies distinct sub-groups of men within the old intermediate-risk and high-risk criteria who have very different prognostic outcomes. We therefore propose adoption of the CPG model as a simple-to-use but more accurate prognostic stratification tool to help guide management for men with newly diagnosed prostate cancer.

Different definitions of CpG island methylator phenotype and outcomes of colorectal cancer: a systematic review.

PubMed

Jia, Min; Gao, Xu; Zhang, Yan; Hoffmeister, Michael; Brenner, Hermann

2016-01-01

Contradictory results were reported for the prognostic role of CpG island methylator phenotype (CIMP) among colorectal cancer (CRC) patients. Differences in the definitions of CIMP were the most common explanation for these discrepancies. The aim of this systematic review was to give an overview of the published studies on CRC prognosis according to the different definitions of CIMP. A systematic literature search was performed in MEDLINE and ISI Web of Science for articles published until 3 April 2015. Data extraction included information about the study population, the definition of CIMP, and investigated outcomes. Thirty-six studies were included in this systematic review. Among them, 30 studies reported the association of CIMP and CRC prognosis and 11 studies reported the association of CIMP with survival after CRC therapy. Overall, 16 different definitions of CIMP were identified. The majority of studies reported a poorer prognosis for patients with CIMP-positive (CIMP+)/CIMP-high (CIMP-H) CRC than with CIMP-negative (CIMP-)/CIMP-low (CIMP-L) CRC. Inconsistent results or varying effect strengths could not be explained by different CIMP definitions used. No consistent variation in response to specific therapies according to CIMP status was found. Comparative analyses of different CIMP panels in the same large study populations are needed to further clarify the role of CIMP definitions and to find out how methylation information can best be used to predict CRC prognosis and response to specific CRC therapies.

Oxytocin Receptor Genetic and Epigenetic Variations: Association With Child Abuse and Adult Psychiatric Symptoms.

PubMed

Smearman, Erica L; Almli, Lynn M; Conneely, Karen N; Brody, Gene H; Sales, Jessica M; Bradley, Bekh; Ressler, Kerry J; Smith, Alicia K

2016-01-01

Childhood abuse can alter biological systems and increase risk for adult psychopathology. Epigenetic mechanisms, alterations in DNA structure that regulate the gene expression, are a potential mechanism underlying this risk. While abuse associates with methylation of certain genes, particularly those in the stress response system, no study to date has evaluated abuse and methylation of the oxytocin receptor (OXTR). However, studies support a role for OXTR in the link between abuse and adverse adult outcomes, showing that abuse can confer greater risk for psychiatric symptoms in those with specific OXTR genotypes. This study therefore sought to (a) assess the role of epigenetics in the link between abuse and psychopathology and (b) begin to integrate the genetic and epigenetic literature by exploring associations between OXTR genotypes and DNA CpG methylation. Data on 18 OXTR CpG sites, 44 single nucleotide polymorphisms, childhood abuse, and adult depression and anxiety symptoms were assessed in 393 African American adults (age = 41 ± 12.8 years). Overall, 68% of genotypes were associated with methylation of nearby CpG sites, with a subset surviving multiple test correction. Child abuse associated with higher methylation of two CpG sites yet did not survive correction or serve as a mediator of psychopathology. However, abuse interacted with CpG methylation to predict psychopathology. These findings suggest a role for OXTR in understanding the influence of early environments on adult psychiatric symptoms. © 2016 The Authors. Child Development © 2016 Society for Research in Child Development, Inc.

Unique DNA methylome profiles in CpG island methylator phenotype colon cancers

PubMed Central

Xu, Yaomin; Hu, Bo; Choi, Ae-Jin; Gopalan, Banu; Lee, Byron H.; Kalady, Matthew F.; Church, James M.; Ting, Angela H.

2012-01-01

A subset of colorectal cancers was postulated to have the CpG island methylator phenotype (CIMP), a higher propensity for CpG island DNA methylation. The validity of CIMP, its molecular basis, and its prognostic value remain highly controversial. Using MBD-isolated genome sequencing, we mapped and compared genome-wide DNA methylation profiles of normal, non-CIMP, and CIMP colon specimens. Multidimensional scaling analysis revealed that each specimen could be clearly classified as normal, non-CIMP, and CIMP, thus signifying that these three groups have distinctly different global methylation patterns. We discovered 3780 sites in various genomic contexts that were hypermethylated in both non-CIMP and CIMP colon cancers when compared with normal colon. An additional 2026 sites were found to be hypermethylated in CIMP tumors only; and importantly, 80% of these sites were located in CpG islands. These data demonstrate on a genome-wide level that the additional hypermethylation seen in CIMP tumors occurs almost exclusively at CpG islands and support definitively that these tumors were appropriately named. When these sites were examined more closely, we found that 25% were adjacent to sites that were also hypermethylated in non-CIMP tumors. Thus, CIMP is also characterized by more extensive methylation of sites that are already prone to be hypermethylated in colon cancer. These observations indicate that CIMP tumors have specific defects in controlling both DNA methylation seeding and spreading and serve as an important first step in delineating molecular mechanisms that control these processes. PMID:21990380

The Evolutionary Divergence of Shiga Toxin-Producing Escherichia coli Is Reflected in Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Spacer Composition

PubMed Central

Yin, Shuang; Jensen, Mark A.; Bai, Jiawei; DebRoy, Chitrita; Barrangou, Rodolphe

2013-01-01

The Shiga toxin-producing Escherichia coli (STEC) strains, including those of O157:H7 and the “big six” serogroups (i.e., serogroups O26, O45, O103, O111, O121, and O145), are a group of pathogens designated food adulterants in the United States. The relatively conserved nature of clustered regularly interspaced short palindromic repeats (CRISPRs) in phylogenetically related E. coli strains makes them potential subtyping markers for STEC detection, and a quantitative PCR (qPCR)-based assay was previously developed for O26:H11, O45:H2, O103:H2, O111:H8, O121:H19, O145:H28, and O157:H7 isolates. To better evaluate the sensitivity and specificity of this qPCR method, the CRISPR loci of 252 O157 and big-six STEC isolates were sequenced and analyzed along with 563 CRISPR1 and 624 CRISPR2 sequences available in GenBank. General conservation of spacer content and order was observed within each O157 and big-six serogroup, validating the qPCR method. Meanwhile, it was found that spacer deletion, the presence of an insertion sequence, and distinct alleles within a serogroup are sources of false-negative reactions. Conservation of CRISPR arrays among isolates expressing the same flagellar antigen, specifically, H7, H2, and H11, suggested that these isolates share an ancestor and provided an explanation for the false positives previously observed in the qPCR results. An analysis of spacer distribution across E. coli strains provided limited evidence for temporal spacer acquisition. Conversely, comparison of CRISPR sequences between strains along the stepwise evolution of O157:H7 from its O55:H7 ancestor revealed that, over this ∼7,000-year span, spacer deletion was the primary force generating CRISPR diversity. PMID:23851088

The evolutionary divergence of Shiga toxin-producing Escherichia coli is reflected in clustered regularly interspaced short palindromic repeat (CRISPR) spacer composition.

PubMed

Yin, Shuang; Jensen, Mark A; Bai, Jiawei; Debroy, Chitrita; Barrangou, Rodolphe; Dudley, Edward G

2013-09-01

The Shiga toxin-producing Escherichia coli (STEC) strains, including those of O157:H7 and the "big six" serogroups (i.e., serogroups O26, O45, O103, O111, O121, and O145), are a group of pathogens designated food adulterants in the United States. The relatively conserved nature of clustered regularly interspaced short palindromic repeats (CRISPRs) in phylogenetically related E. coli strains makes them potential subtyping markers for STEC detection, and a quantitative PCR (qPCR)-based assay was previously developed for O26:H11, O45:H2, O103:H2, O111:H8, O121:H19, O145:H28, and O157:H7 isolates. To better evaluate the sensitivity and specificity of this qPCR method, the CRISPR loci of 252 O157 and big-six STEC isolates were sequenced and analyzed along with 563 CRISPR1 and 624 CRISPR2 sequences available in GenBank. General conservation of spacer content and order was observed within each O157 and big-six serogroup, validating the qPCR method. Meanwhile, it was found that spacer deletion, the presence of an insertion sequence, and distinct alleles within a serogroup are sources of false-negative reactions. Conservation of CRISPR arrays among isolates expressing the same flagellar antigen, specifically, H7, H2, and H11, suggested that these isolates share an ancestor and provided an explanation for the false positives previously observed in the qPCR results. An analysis of spacer distribution across E. coli strains provided limited evidence for temporal spacer acquisition. Conversely, comparison of CRISPR sequences between strains along the stepwise evolution of O157:H7 from its O55:H7 ancestor revealed that, over this ∼7,000-year span, spacer deletion was the primary force generating CRISPR diversity.

The potential of immunostimulatory CpG DNA for inducing immunity against genital herpes: opportunities and challenges.

PubMed

Harandi, Ali M

2004-07-01

Herpes simplex virus type 2 (HSV-2) invades human genital tract mucosa and following local replications can be rapidly transmitted via peripheral nerve axons to the sacral ganglia where it can establish latency. Reactivation of the latent viral reservoir results in recurrent ulcers in the genital region. Innate immunity, the first line of defence during both primary and recurrent genital herpes infections, is crucial during the period of acute infection to limit early virus replication and to facilitate the development of an appropriate specific acquired immunity. Recent developments in immunology reveal that the mammalian innate immune systems use Toll-like receptor (TLR) to specifically sense evolutionary conserved molecules such as bacterial DNA in pathogens. Recently, local-vaginal delivery of CpG containing oligodeoxynucleotide (ODN), a synthetic mimic of bacterial DNA, holds substantial promise as a strong inducer of innate immunity against genital herpes infections in the animal models of the disease. These preclinical observations provide a scientific ground work for introduction of this novel intervention strategy to clinic. This review aims to highlight recent developments and future challenges in use of immunostimulatory CpG ODN for inducing immunity against genital herpes infection and disease.

The type of adjuvant strongly influences the T-cell response during nanoparticle-based immunization

PubMed Central

Knuschke, Torben; Epple, Matthias; Westendorf, Astrid M

2014-01-01

Potent vaccines require the ability to effectively induce immune responses. Especially for the control of infectious diseases with intracellular pathogens, like viruses or bacteria, potent T-cell responses are indispensable. Several delivery systems such as nanoparticles have been considered to boost the immunogenicity of pathogen derived peptides or subunits for the induction of potent T-cell responses. Since they can be further functionalized with immunostimulants, like Toll-like receptor (TLR) agonists, they improve the response by enhanced activation of the innate immune system. Currently, TLR agonists like unmethylated CpG oligonucleotides and the synthetic dsRNA derivate polyriboinosinic acid-polyribocytidylic acid (poly[I:C]) are widely used as vaccine adjuvants. CpG and poly(I:C) trigger different TLRs and therefore show differential signal transduction. Recently, we established biodegradable calcium phosphate (CaP) nanoparticles as potent T cell inducing vaccination vehicles. In this commentary we discuss the role of CpG and poly(I:C) for the effective induction of virus-specific T cells during immunization with CaP nanoparticles. The presented results underline the importance of the right formulation of vaccines for specific immunization purpose. PMID:23982325

The 19q12 bladder cancer GWAS signal: association with cyclin E function and aggressive disease

PubMed Central

Fu, Yi-Ping; Kohaar, Indu; Moore, Lee E.; Lenz, Petra; Figueroa, Jonine D.; Tang, Wei; Porter-Gill, Patricia; Chatterjee, Nilanjan; Scott-Johnson, Alexandra; Garcia-Closas, Montserrat; Muchmore, Brian; Baris, Dalsu; Paquin, Ashley; Ylaya, Kris; Schwenn, Molly; Apolo, Andrea B.; Karagas, Margaret R.; Tarway, McAnthony; Johnson, Alison; Mumy, Adam; Schned, Alan; Guedez, Liliana; Jones, Michael A.; Kida, Masatoshi; Monawar Hosain, GM; Malats, Nuria; Kogevinas, Manolis; Tardon, Adonina; Serra, Consol; Carrato, Alfredo; Garcia-Closas, Reina; Lloreta, Josep; Wu, Xifeng; Purdue, Mark; Andriole, Gerald L.; Grubb, Robert L.; Black, Amanda; Landi, Maria T.; Caporaso, Neil E.; Vineis, Paolo; Siddiq, Afshan; Bueno-de-Mesquita, H. Bas; Trichopoulos, Dimitrios; Ljungberg, Börje; Severi, Gianluca; Weiderpass, Elisabete; Krogh, Vittorio; Dorronsoro, Miren; Travis, Ruth C.; Tjønneland, Anne; Brennan, Paul; Chang-Claude, Jenny; Riboli, Elio; Prescott, Jennifer; Chen, Constance; De Vivo, Immaculata; Govannucci, Edward; Hunter, David; Kraft, Peter; Lindstrom, Sara; Gapstur, Susan M.; Jacobs, Eric J.; Diver, W. Ryan; Albanes, Demetrius; Weinstein, Stephanie J.; Virtamo, Jarmo; Kooperberg, Charles; Hohensee, Chancellor; Rodabough, Rebecca J.; Cortessis, Victoria K.; Conti, David V.; Gago-Dominguez, Manuela; Stern, Mariana C.; Pike, Malcolm C.; Van Den Berg, David; Yuan, Jian-Min; Haiman, Christopher A.; Cussenot, Olivier; Cancel-Tassin, Geraldine; Roupret, Morgan; Comperat, Eva; Porru, Stefano; Carta, Angela; Pavanello, Sofia; Arici, Cecilia; Mastrangelo, Giuseppe; Grossman, H. Barton; Wang, Zhaoming; Deng, Xiang; Chung, Charles C.; Hutchinson, Amy; Burdette, Laurie; Wheeler, William; Fraumeni, Joseph; Chanock, Stephen J.; Hewitt, Stephen M.; Silverman, Debra T.; Rothman, Nathaniel; Prokunina-Olsson, Ludmila

2014-01-01

A genome-wide association study (GWAS) of bladder cancer identified a genetic marker rs8102137 within the 19q12 region as a novel susceptibility variant. This marker is located upstream of the CCNE1 gene, which encodes cyclin E, a cell cycle protein. We performed genetic fine mapping analysis of the CCNE1 region using data from two bladder cancer GWAS (5,942 cases and 10,857 controls). We found that the original GWAS marker rs8102137 represents a group of 47 linked SNPs (with r2≥0.7) associated with increased bladder cancer risk. From this group we selected a functional promoter variant rs7257330, which showed strong allele-specific binding of nuclear proteins in several cell lines. In both GWAS, rs7257330 was associated only with aggressive bladder cancer, with a combined per-allele odds ratio (OR) =1.18 (95%CI=1.09-1.27, p=4.67×10−5 vs. OR =1.01 (95%CI=0.93-1.10, p=0.79) for non-aggressive disease, with p=0.0015 for case-only analysis. Cyclin E protein expression analyzed in 265 bladder tumors was increased in aggressive tumors (p=0.013) and, independently, with each rs7257330-A risk allele (ptrend=0.024). Over-expression of recombinant cyclin E in cell lines caused significant acceleration of cell cycle. In conclusion, we defined the 19q12 signal as the first GWAS signal specific for aggressive bladder cancer. Molecular mechanisms of this genetic association may be related to cyclin E over-expression and alteration of cell cycle in carriers of CCNE1 risk variants. In combination with established bladder cancer risk factors and other somatic and germline genetic markers, the CCNE1 variants could be useful for inclusion into bladder cancer risk prediction models. PMID:25320178

High-Performance Multiplex SNP Analysis of Three Hemochromatosis-Related Mutations With Capillary Array Electrophoresis Microplates

PubMed Central

Medintz, Igor; Wong, Wendy W.; Berti, Lorenzo; Shiow, Lawrence; Tom, Jennifer; Scherer, James; Sensabaugh, George; Mathies, Richard A.

2001-01-01

An assay is described for high-throughput single nucleotide polymorphism (SNP) genotyping on a microfabricated capillary array electrophoresis (CAE) microchip. The assay targets the three common variants at the HFE locus associated with the genetic disease hereditary hemochromatosis (HHC). The assay employs allele-specific PCR (ASPCR) for the C282Y (845g->a), H63D (187c->g), and S65C (193a->t) variants using fluorescently-labeled energy-transfer (ET) allele-specific primers. Using a 96-channel radial CAE microplate, the labeled ASPCR products generated from 96 samples in a reference Caucasian population are simultaneously separated with single-base-pair resolution and genotyped in under 10 min. Detection is accomplished with a laser-excited rotary four-color fluorescence scanner. The allele-specific amplicons are differentiated on the basis of both their size and the color of the label emission. This study is the first demonstration of the combined use of ASPCR with ET primers and microfabricated radial CAE microplates to perform multiplex SNP analyses in a clinically relevant population. PMID:11230165

TREM2 R47H variant and risk of essential tremor: A cross-sectional international multicenter study

PubMed Central

Ortega-Cubero, Sara; Lorenzo-Betancor, Oswaldo; Lorenzo, Elena; Agúndez, José A.G.; Jiménez-Jiménez, Félix J.; Ross, Owen A.; Wurster, Isabel; Mielke, Carina; Lin, Juei-Jueng; Coria, Francisco; Clarimon, Jordi; Ezquerra, Mario; Brighina, Laura; Annesi, Grazia; Alonso-Navarro, Hortensia; García-Martin, Elena; Gironell, Alex; Marti, Maria J.; Yueh, Kuo-Chu; Wszolek, Zbigniew K.; Sharma, Manu; Berg, Daniela; Krüger, Rejko; Pastor, Maria A.; Pastor, Pau

2015-01-01

Introduction Essential tremor (ET) is the most frequent movement disorder in adults. Its pathophysiology is not clearly understood, however there is growing evidence showing common etiologic factors with other neurodegenerative disorders such as Alzheimer’s and Parkinson’s diseases (AD, PD). Recently, a rare p.R47H substitution (rs75932628) in the TREM2 protein (triggering receptor expressed on myeloid cells 2; OMIM: *605086) has been proposed as a risk factor for AD, PD and amyotrophic lateral sclerosis (ALS). The objective of the study was to determine whether TREM2 p.R47H allele is also a risk factor for developing ET. Methods This was a cross-sectional multicenter international study. An initial case-control cohort from Spain (n = 456 ET, n = 2715 controls) was genotyped. In a replication phase, a case-control series (n = 897 ET, n = 1449 controls) from different populations (Italy, Germany, North-America and Taiwan) was studied. Owed to the rarity of the variant, published results on p.R47H allele frequency from 14777 healthy controls from European, North American or Chinese descent were additionally considered. The main outcome measure was p.R47H (rs75932628) allelic frequency. Results There was a significant association between TREM2 p.R47H variant and ET in the Spanish cohort (odds ratio [OR], 5.97; 95% CI, 1.203–29.626; p = 0.042), but it was not replicated in other populations. Conclusions These results argue in favor of population-specific differences in the allelic distribution and suggest that p.R47H (rs75932628) variant may contribute to the susceptibility of ET in Spanish population. However, taking into account the very low frequency of p.R47H, further confirmatory analyses of larger ET series are needed. PMID:25585992

TREM2 R47H variant and risk of essential tremor: a cross-sectional international multicenter study.

PubMed

Ortega-Cubero, Sara; Lorenzo-Betancor, Oswaldo; Lorenzo, Elena; Agúndez, José A G; Jiménez-Jiménez, Félix J; Ross, Owen A; Wurster, Isabel; Mielke, Carina; Lin, Juei-Jueng; Coria, Francisco; Clarimon, Jordi; Ezquerra, Mario; Brighina, Laura; Annesi, Grazia; Alonso-Navarro, Hortensia; García-Martin, Elena; Gironell, Alex; Marti, Maria J; Yueh, Kuo-Chu; Wszolek, Zbigniew K; Sharma, Manu; Berg, Daniela; Krüger, Rejko; Pastor, Maria A; Pastor, Pau

2015-03-01

Essential tremor (ET) is the most frequent movement disorder in adults. Its pathophysiology is not clearly understood, however there is growing evidence showing common etiologic factors with other neurodegenerative disorders such as Alzheimer's and Parkinson's diseases (AD, PD). Recently, a rare p.R47H substitution (rs75932628) in the TREM2 protein (triggering receptor expressed on myeloid cells 2; OMIM: *605086) has been proposed as a risk factor for AD, PD and amyotrophic lateral sclerosis (ALS). The objective of the study was to determine whether TREM2 p.R47H allele is also a risk factor for developing ET. This was a cross-sectional multicenter international study. An initial case-control cohort from Spain (n = 456 ET, n = 2715 controls) was genotyped. In a replication phase, a case-control series (n = 897 ET, n = 1449 controls) from different populations (Italy, Germany, North-America and Taiwan) was studied. Owed to the rarity of the variant, published results on p.R47H allele frequency from 14777 healthy controls from European, North American or Chinese descent were additionally considered. The main outcome measure was p.R47H (rs75932628) allelic frequency. There was a significant association between TREM2 p.R47H variant and ET in the Spanish cohort (odds ratio [OR], 5.97; 95% CI, 1.203-29.626; p = 0.042), but it was not replicated in other populations. These results argue in favor of population-specific differences in the allelic distribution and suggest that p.R47H (rs75932628) variant may contribute to the susceptibility of ET in Spanish population. However, taking into account the very low frequency of p.R47H, further confirmatory analyses of larger ET series are needed. Copyright © 2014 Elsevier Ltd. All rights reserved.

Murine Polyomavirus Virus-Like Particles Carrying Full-Length Human PSA Protect BALB/c Mice from Outgrowth of a PSA Expressing Tumor

PubMed Central

Eriksson, Mathilda; Andreasson, Kalle; Weidmann, Joachim; Lundberg, Kajsa; Tegerstedt, Karin

2011-01-01

Virus-like particles (VLPs) consist of capsid proteins from viruses and have been shown to be usable as carriers of protein and peptide antigens for immune therapy. In this study, we have produced and assayed murine polyomavirus (MPyV) VLPs carrying the entire human Prostate Specific Antigen (PSA) (PSA-MPyVLPs) for their potential use for immune therapy in a mouse model system. BALB/c mice immunized with PSA-MPyVLPs were only marginally protected against outgrowth of a PSA-expressing tumor. To improve protection, PSA-MPyVLPs were co-injected with adjuvant CpG, either alone or loaded onto murine dendritic cells (DCs). Immunization with PSA-MPyVLPs loaded onto DCs in the presence of CpG was shown to efficiently protect mice from tumor outgrowth. In addition, cellular and humoral immune responses after immunization were examined. PSA-specific CD4+ and CD8+ cells were demonstrated, but no PSA-specific IgG antibodies. Vaccination with DCs loaded with PSA-MPyVLPs induced an eight-fold lower titre of anti-VLP antibodies than vaccination with PSA-MPyVLPs alone. In conclusion, immunization of BALB/c mice with PSA-MPyVLPs, loaded onto DCs and co-injected with CpG, induces an efficient PSA-specific tumor protective immune response, including both CD4+ and CD8+ cells with a low induction of anti-VLP antibodies. PMID:21858228

Are clinicopathological features of colorectal cancers with methylation in half of CpG island methylator phenotype panel markers different from those of CpG island methylator phenotype-high colorectal cancers?

PubMed

Bae, Jeong Mo; Rhee, Ye-Young; Kim, Kyung Ju; Wen, Xianyu; Song, Young Seok; Cho, Nam-Yun; Kim, Jung Ho; Kang, Gyeong Hoon

2016-01-01

CpG island methylator phenotype (CIMP)-high (CIMP-H) colorectal cancer (CRC) is defined when a tumor shows methylation at greater than or equal to 60% of CIMP panel markers. Although CRCs with methylation at 50% of panel markers are classified as CIMP-low/CIMP-0 tumors, little is known regarding the clinicopathological and molecular features of CRCs with methylation at 4/8 panel markers (4/8 methylated markers) and whether they are akin to CIMP-H or CIMP-low/CIMP-0 CRCs in terms of their clinicopathological or molecular features. A total of 1164 cases of surgically resected CRC were analyzed for their methylation status in 8 CIMP panel markers, and the frequencies of various clinicopathological and molecular features were compared between CRCs with 0/8, 1/8 to 3/8, 4/8, and 5/8 to 8/8 methylated markers. CRCs with 4/8 methylated markers were closer to CRCs with 5/8 to 8/8 methylated markers in terms of sex distribution, mucin production, serration, nodal metastasis, CK7 expression, CK20 loss, and CDX2 loss frequencies and overall survival rate. CRCs with methylation at 4/8 markers were closer to CRCs with 1/8 to 3/8 methylated markers in terms of less frequent right colon location and poor differentiation. CRCs with 4/8 methylated markers showed the shortest overall survival time compared with CRCs with 0/8, 1/8 to 3/8, 4/8, or 5/8 to 8/8 methylated markers. In terms of clinicopathological and molecular features, CRCs with 4/8 methylated markers appeared to be closer to CIMP-H than to CIMP-low/CIMP-0 and would thus be better classified as CIMP-H if the CRCs require classification into either CIMP-H or CIMP-low/CIMP-0. Copyright © 2015 Elsevier Inc. All rights reserved.

A phenolic glycoside from Flacourtia indica induces heme mediated oxidative stress in Plasmodium falciparum and attenuates malaria pathogenesis in mice.

PubMed

Singh, Shiv Vardan; Manhas, Ashan; Singh, Suriya P; Mishra, Sonali; Tiwari, Nimisha; Kumar, Parmanand; Shanker, Karuna; Srivastava, Kumkum; Sashidhara, Koneni V; Pal, Anirban

2017-07-01

Flacourtia indica is especially popular among the various communities of many African countries where it is being used traditionally for the treatment of malaria. In our previous report, we have identified some phenolic glycosides from the aerial parts of F. indica as promising antiplasmodial agents under in vitro conditions. Antimalarial bioprospection of F. indica derived phenolic glycoside in Swiss mice (in vivo) with special emphasis on its mode of action. Chloroquine sensitive strain of Plasmodium falciparum was routinely cultured and used for the in vitro studies. The in vivo antimalarial potential of phenolic glycoside was evaluated against P. berghei in Swiss mice through an array of parameters viz., hematological, biochemical, chemo-suppression and mean survival time. 2-(6-benzoyl-β-d-glucopyranosyloxy)-7-(1α, 2α, 6α-trihydroxy-3-oxocyclohex-4-enoyl)-5-hydroxybenzyl alcohol (CPG), a phenolic glycoside isolated from the aerial parts of F. indica was found to exhibit promising antiplasmodial activity by arresting the P. falciparum growth at the trophozoite stage. Spectroscopic investigations reveal that CPG possesses a strong binding affinity with free heme moieties. In addition, these interactions lead to the inhibition of heme polymerization in malaria parasite, augmenting oxidative stress, and delaying the rapid growth of parasite. Under in-vivo condition, CPG exhibited significant antimalarial activity against P. berghei at 50 and 75mg/kg body weight through chemo-suppression of parasitemia and ameliorating the parasite induced inflammatory and oxidative (hepatic) imbalance in the experimental mice. CPG was found to be a potential antimalarial constituent of F. indica with an explored mechanism of action, which also offers the editing choices for developing CPG based antimalarial chemotypes. Copyright © 2017 Elsevier GmbH. All rights reserved.

In vitro effects of CpG oligodeoxynucleotides delivered by gelatin nanoparticles on canine peripheral blood mononuclear cells of atopic and healthy dogs - a pilot study.

PubMed

Prélaud, Ana Rostaher; Fuchs, Sebastian; Weber, Karin; Winter, Gerhard; Coester, Conrad; Mueller, Ralf S

2013-10-01

Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides offer a novel promising immunotherapeutic approach for atopic dermatitis (AD) both in humans and animals. Gelatin nanoparticles (GNP) enhance and prolong CpG-associated immunomodulatory effects and minimize adverse effects both in vitro and in vivo. Information about the effects of this combination in dogs is lacking. The aim of this study was to evaluate immunological effects of CpG coupled to GNP on canine peripheral blood mononuclear cells (PBMCs) in vitro. Eight dogs with AD, diagnosed by standard criteria and with a concurrent immediate hypersensitivity to house dust mites were included. Control samples were taken from eight healthy, age-matched control dogs without history or evidence of cutaneous or systemic illness. Peripheral blood mononuclear cells of healthy and allergic dogs were incubated with CpG-GNP and the uptake of CpG-GNP was demonstrated using confocal laser scanning microscopy. Cell culture supernatant concentrations of interferon gamma (IFN-γ), interleukin (IL)-4, IL-6 and IL-10 were measured by Canine Cytokine Milliplex. No significant changes in IFN-γ and IL-4 were found when comparing PBMCs incubated with CpG and CpG-GNP with the negative controls in atopic and healthy dogs. Interleukin-6 was not detected in any of the groups. However, a statistically significant increase in IL-10 concentration was found after 24 h stimulation with CpG-GNP compared with CpG alone both in atopic and healthy dogs. As IL-10 is considered an immunosuppressive cytokine playing a key role in peripheral tolerance; the reported CpG-GNP formulation could be a new approach in allergy treatment. © 2013 ESVD and ACVD.

DHA-rich n-3 fatty acid supplementation decreases DNA methylation in blood leukocytes: the OmegAD study.

PubMed

Karimi, Mohsen; Vedin, Inger; Freund Levi, Yvonne; Basun, Hans; Faxén Irving, Gerd; Eriksdotter, Maria; Wahlund, Lars-Olof; Schultzberg, Marianne; Hjorth, Erik; Cederholm, Tommy; Palmblad, Jan

2017-10-01

Background: Dietary fish oils, rich in long-chain n-3 (ω-3) fatty acids (FAs) [e.g., docosahexaenoic acid (DHA, 22:6n-3) and eicosapentaenoic acid (EPA, 20:5n-3)], modulate inflammatory reactions through various mechanisms, including gene expression, which is measured as messenger RNA concentration. However, the effects of long-term treatment of humans with DHA and EPA on various epigenetic factors-such as DNA methylation, which controls messenger RNA generation-are poorly described. Objective: We wanted to determine the effects of 6 mo of dietary supplementation with an n-3 FA preparation rich in DHA on global DNA methylation of peripheral blood leukocytes (PBLs) and the relation to plasma EPA and DHA concentrations in Alzheimer disease (AD) patients. Design: In the present study, DNA methylation in four 5'-cytosine-phosphate-guanine-3' (CpG) sites of long interspersed nuclear element-1 repetitive sequences was assessed in a group of 63 patients (30 given the n-3 FA preparation and 33 given placebo) as an estimation of the global DNA methylation in blood cells. Patients originated from the randomized, double-blind, placebo-controlled OmegAD study, in which 174 AD patients received either 1.7 g DHA and 0.6 g EPA (the n-3 FA group) or placebo daily for 6 mo. Results: At 6 mo, the n-3 FA group displayed marked increases in DHA and EPA plasma concentrations (2.6- and 3.5-fold), as well as decreased methylation in 2 out of 4 CpG sites ( P < 0.05 for all), respectively. This hypomethylation in CpG2 and CpG4 sites showed a reverse correlation to changes in plasma EPA concentration ( r = -0.25, P = 0.045; and r = -0.26, P = 0.041, respectively), but not to changes in plasma DHA concentration, and were not related to apolipoprotein E-4 allele frequency. Conclusion: Supplementation with n-3 FA for 6 mo was associated with global DNA hypomethylation in PBLs. Our data may be of importance in measuring various effects of marine oils, including gene expression, in patients with AD and in other patients taking n-3 FA supplements. This trial was registered at clinicaltrials.gov as NCT00211159. © 2017 American Society for Nutrition.

Gene silencing of Nox4 by CpG island methylation during hepatocarcinogenesis in rats

PubMed Central

López-Álvarez, Guadalupe S.; Wojdacz, Tomasz K.; García-Cuellar, Claudia M.; Monroy-Ramírez, Hugo C.; Rodríguez-Segura, Miguel A.; Pacheco-Rivera, Ruth A.; Valencia-Antúnez, Carlos A.; Cervantes-Anaya, Nancy; Soto-Reyes, Ernesto; Vásquez-Garzón, Verónica R.; Sánchez-Pérez, Yesennia; Villa-Treviño, Saúl

2017-01-01

ABSTRACT The association between the downregulation of genes and DNA methylation in their CpG islands has been extensively studied as a mechanism that favors carcinogenesis. The objective of this study was to analyze the methylation of a set of genes selected based on their microarray expression profiles during the process of hepatocarcinogenesis. Rats were euthanized at: 24 h, 7, 11, 16 and 30 days and 5, 9, 12 and 18 months post-treatment. We evaluated the methylation status in the CpG islands of four deregulated genes (Casp3, Cldn1, Pex11a and Nox4) using methylation-sensitive high-resolution melting technology for the samples obtained from different stages of hepatocarcinogenesis. We did not observe methylation in Casp3, Cldn1 or Pex11a. However, Nox4 exhibited altered methylation patterns, reaching a maximum of 10%, even during the early stages of hepatocarcinogenesis. We observed downregulation of mRNA and protein of Nox4 (97.5% and 40%, respectively) after the first carcinogenic stimulus relative to the untreated samples. Our results suggest that Nox4 downregulation is associated with DNA methylation of the CpG island in its promoter. We propose that methylation is a mechanism that can silence the expression of Nox4, which could contribute to the acquisition of neoplastic characteristics during hepatocarcinogenesis in rats. PMID:27895046

Distinct genetic profiles in colorectal tumors with or without the CpG island methylator phenotype

PubMed Central

Toyota, Minoru; Ohe-Toyota, Mutsumi; Ahuja, Nita; Issa, Jean-Pierre J.

2000-01-01

Colorectal cancers (CRCs) are characterized by multiple genetic (mutations) and epigenetic (CpG island methylation) alterations, but it is not known whether these evolve independently through stochastic processes. We have recently described a novel pathway termed CpG island methylator phenotype (CIMP) in CRC, which is characterized by the simultaneous methylation of multiple CpG islands, including several known genes, such as p16, hMLH1, and THBS1. We have now studied mutations in K-RAS, p53, DPC4, and TGFβRII in a panel of colorectal tumors with or without CIMP. We find that CIMP defines two groups of tumors with significantly different genetic lesions: frequent K-RAS mutations were found in CIMP+ CRCs (28/41, 68%) compared with CIMP− cases (14/47, 30%, P = 0.0005). By contrast, p53 mutations were found in 24% (10/41) of CIMP+ CRCs vs. 60% (30/46) of CIMP− cases (P = 0.002). Both of these differences were independent of microsatellite instability. These interactions between CIMP, K-RAS mutations, and p53 mutations were preserved in colorectal adenomas, suggesting that they occur early in carcinogenesis. The distinct combinations of epigenetic and genetic alterations in each group suggest that activation of oncogenes and inactivation of tumor suppressor genes is related to the underlying mechanism of generating molecular diversity in cancer, rather than simply accumulate stochastically during cancer development. PMID:10639144

Oral and intraperitoneal administration of phosphorothioate oligodeoxynucleotides leads to control of Cryptosporidium parvum infection in neonatal mice.

PubMed

Barrier, Mathieu; Lacroix-Lamandé, Sonia; Mancassola, Roselyne; Auray, Gaël; Bernardet, Nelly; Chaussé, Anne-Marie; Uematsu, Satoshi; Akira, Shizuo; Laurent, Fabrice

2006-05-15

Neonates are particularly vulnerable to infections, in part because of the incomplete development of their immune system. Recent advances in immunostimulatory treatments based on conserved microbial components led us to assess the potential of oligodeoxynucleotides (ODNs) for decreasing the sensitivity of neonates to Cryptosporidium parvum infection. Neonate mice were treated orally or intraperitoneally (ip) with CpG ODNs or non-CpG ODNs 24 h before C. parvum infection, and parasite load and cytokine up-regulation were evaluated. CpG ODN 1668 and non-CpG ODN 1668 administered orally, as well as CpG ODN 1668 administered ip, induced an 80%-95% decrease in intestinal parasite load 6 days after infection. Intraperitoneal and oral pretreatment with CpG ODN 1668 led to a strong initial up-regulation of cytokines and CD69 messenger RNA in the intestine and a decrease in parasite load by a Toll-like receptor 9 (TLR9)-dependent mechanism. By contrast, oral administration of non-CpG ODN 1668 decreased parasite load by a TLR9-independent mechanism. The control of neonatal C. parvum infection by ip or oral administration of ODNs is feasible by 2 different mechanisms: (1) the well-known interaction involving CpG/TLR9, leading to the production of cytokines and lymphocyte activation, and (2) a new unknown mechanism that is independent of TLR9 and effective orally.

Prevalence of nine mutations among Jewish and non-Jewish Gaucher disease patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horowitz, M.; Tzuri, G.; Eyal, N.

1993-10-01

The frequency of nine different mutated alleles known to occur in the glucocerebrosidase gene was determined in 247 Gaucher patients, of whom 176 were of Jewish extraction, 2 were Jewish with one converted parent, and 69 were of non-Jewish origin. DNA was prepared from peripheral blood, active glucocerebrosidase sequences were amplified by using the PCR technique, and the mutations were identified by using the allele-specific oligonucleotide hybridization method. The N37OS mutation appeared in 69.77% of the mutated alleles in Jewis patients and in 22.86% of the mutated alleles in non-Jews. The 84GG mutation, which has not been found so farmore » among non-Jewish patients, existed in 10.17% of the disease alleles among Jewish patients. The IVS2+1 mutation constituted 2.26% of the disease alleles among Jewish Patients and 1.43% among the non-Jewish patients. RecTL, a complex allele containing four single-base-pair changes, occurred in 2.26% of the alleles in Jewish patients and was found in two (1.43%) of the patients of non-Jewish extraction. Another complex allele, designated [open quotes]RecNcil[close quotes] and containing three single-point mutations, appeared in 7.8% of alleles of non-Jewish patients and in only two (0.56%) of the Jewish families. The prevalence of the L444P mutation among non-Jewish Gaucher patients was 31.43%, while its prevalence among Jewish patients was only 4.24%. The prevalence of two other point mutations-D409H and R463C- was 5.00% and 3.57%, respectively, among non-Jewish patients and was not found among the Jewish Gaucher patient population. The prevalence of the R496H mutation, found so far only among Jewish patients, is 1.13%. The results presented demonstrate that seven mutations identify 90.40% of the mutations among Jewish patients and that these seven mutations allow diagnosis of only 73.52% of the non-Jewish patients. Identification of additional mutant alleles will enhance the accuracy of carrier detection. 33 refs, 3 figs., 4 tabs.« less

Reversible and formaldehyde-mediated covalent binding of a bis-amino mitoxantrone analogue to DNA.

PubMed

Konda, Shyam K; Kelso, Celine; Pumuye, Paul P; Medan, Jelena; Sleebs, Brad E; Cutts, Suzanne M; Phillips, Don R; Collins, J Grant

2016-05-18

The ability of a bis-amino mitoxantrone anticancer drug (named WEHI-150) to form covalent adducts with DNA, after activation by formaldehyde, has been studied by electrospray ionisation mass spectrometry and HPLC. Mass spectrometry results showed that WEHI-150 could form covalent adducts with d(ACGCGCGT)2 that contained one, two or three covalent links to the octanucleotide, whereas the control drugs (daunorubicin and the anthracenediones mitoxantrone and pixantrone) only formed adducts with one covalent link to the octanucleotide. HPLC was used to examine the extent of covalent bond formation of WEHI-150 with d(CGCGCG)2 and d(CG(5Me)CGCG)2. Incubation of WEHI-150 with d(CG(5Me)CGCG)2 in the presence of formaldehyde resulted in the formation of significantly greater amounts of covalent adducts than was observed with d(CGCGCG)2. In order to understand the observed increase of covalent adducts with d(CG(5Me)CGCG)2, an NMR study of the reversible interaction of WEHI-150 at both CpG and (5Me)CpG sites was undertaken. Intermolecular NOEs were observed in the NOESY spectra of d(ACGGCCGT)2 with added WEHI-150 that indicated that the drug selectively intercalated at the CpG sites and from the major groove. In particular, NOEs were observed from the WEHI-150 H2,3 protons to the H1' protons of G3 and G7 and from the H6,7 protons to the H5 protons of C2 and C6. By contrast, intermolecular NOEs were observed between the WEHI-150 H2,3 protons to the H2'' proton of the (5Me)C3 in d(CG(5Me)CGCG)2, and between the drug aliphatic protons and the H1' proton of G4. This demonstrated that WEHI-150 preferentially intercalates at (5Me)CpG sites, compared to CpG sequences, and predominantly via the minor groove at the (5Me)CpG site. The results of this study demonstrate that WEHI-150 is likely to form interstrand DNA cross-links, upon activation by formaldehyde, and consequently exhibit greater cytotoxicity than other current anthracenedione drugs.

Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients.

PubMed

Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele

2011-05-26

The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.

Vaccination with Leishmania histone H1-pulsed dendritic cells confers protection in murine visceral leishmaniasis.

PubMed

Agallou, Maria; Smirlis, Despina; Soteriadou, Ketty P; Karagouni, Evdokia

2012-07-20

Visceral leishmaniasis is the most severe form of leishmaniases affecting millions of people worldwide often resulting in death despite optimal therapy. Thus, there is an urgent need for the development of effective anti-infective vaccine(s). In the present study, we evaluated the prophylactic value of bone marrow-derived dendritic cells (BM-DCs) pulsed with the Leishmania (L.) infantum histone H1. We developed fully mature BM-DCs characterized by enhanced capacity of IL-12 production after ex vivo pulsing with GST-LeishH1. Intravenous administration of these BM-DCs in naive BALB/c mice resulted in antigen-specific spleenocyte proliferation and IgG1 isotype antibody production and conferred protection against experimental challenge with L. infantum independently of CpG oligonucleotides (ODNs) co-administration. Protection was associated with a pronounced enhancement of parasite-specific IFNγ-producing cells and reduction of cells producing IL-10, whereas IL-4 production was comparable in protected and non-protected mice. The polarization of immune responses to Th1 type was further confirmed by the elevation of parasite-specific IgG2a/IgG1 ratio in protected mice. The above data indicate the immunostimulatory capacity of Leishmania histone H1 and further support its exploitation as a candidate protein for vaccine development against leishmaniasis. Copyright © 2012 Elsevier Ltd. All rights reserved.

Rad50S alleles of the Mre11 complex: questions answered and questions raised.

PubMed

Usui, Takehiko; Petrini, John H J; Morales, Monica

2006-08-15

We find that Rad50S mutations in yeast and mammals exhibit constitutive PIKK (PI3-kinase like kinase)-dependent signaling [T. Usui, H. Ogawa, J.H. Petrini, A DNA damage response pathway controlled by Tel1 and the Mre11 complex. Mol. Cell 7 (2001) 1255-1266.; M. Morales, J.W. Theunissen, C.F. Kim, R. Kitagawa, M.B. Kastan, J.H. Petrini, The Rad50S allele promotes ATM-dependent DNA damage responses and suppresses ATM deficiency: implications for the Mre11 complex as a DNA damage sensor. Genes Dev. 19 (2005) 3043-4354.]. The signaling depends on Mre11 complex functions, consistent with its role as a DNA damage sensor. Rad50S is distinct from hypomorphic mutations of Mre11 and Nbs1 in mammals [M. Morales, J.W. Theunissen, C.F. Kim, R. Kitagawa, M.B. Kastan, J.H. Petrini, The Rad50S allele promotes ATM-dependent DNA damage responses and suppresses ATM deficiency: implications for the Mre11 complex as a DNA damage sensor. Genes Dev. 19 (2005) 3043-3054.; J.P. Carney, R.S. Maser, H. Olivares, E.M. Davis, Le M. Beau, J.R. Yates, III, L. Hays, W.F. Morgan, J.H. Petrini, The hMre11/hRad50 protein complex and Nijmegen breakage syndrome: linkage of double-strand break repair to the cellular DNA damage response. Cell 93 (1998) 477-486.; G.S. Stewart, R.S. Maser, T. Stankovic, D.A. Bressan, M.I. Kaplan, N.G. Jaspers, A. Raams, P.J. Byrd, J.H. Petrini, A.M. Taylor, The DNA double-strand break repair gene hMRE11 is mutated in individuals with an ataxia-telangiectasia-like disorder. Cell 99 (1999) 577-587.; B.R. Williams, O.K. Mirzoeva, W.F. Morgan, J. Lin, W. Dunnick, J.H. Petrini, A murine model of nijmegen breakage syndrome. Curr. Biol. 12 (2002) 648-653.; J.W. Theunissen, M.I. Kaplan, P.A. Hunt, B.R. Williams, D.O. Ferguson, F.W. Alt, J.H. Petrini, Checkpoint failure and chromosomal instability without lymphomagenesis in Mre11(ATLD1/ATLD1) mice. Mol. Cell 12 (2003) 1511-1523.] and the Mre11 complex deficiency in yeast [T. Usui, H. Ogawa, J.H. Petrini, A DNA damage response pathway controlled by Tel1 and the Mre11 complex. Mol. Cell 7 (2001) 1255-1266.; D'D. Amours, S.P. Jackson, The yeast Xrs2 complex functions in S phase checkpoint regulation. Genes Dev. 15 (2001) 2238-49. ; M. Grenon, C. Gilbert, N.F. Lowndes, Checkpoint activation in response to double-strand breaks requires the Mre11/Rad50/Xrs2 complex. Nat. Cell Biol. 3 (2001) 844-847. ] where the signaling is compromised. Herein, we describe evidence for chronic signaling by Rad50S and discuss possible mechanisms.

Regional Brain Shrinkage over Two Years: Individual Differences and Effects of Pro-Inflammatory Genetic Polymorphisms

PubMed Central

Persson, N.; Ghisletta, P.; Dahle, C.L.; Bender, A.R.; Yang, Y.; Yuan, P.; Daugherty, A.M.; Raz, N.

2014-01-01

We examined regional changes in brain volume in healthy adults (N = 167, age 19-79 years at baseline; N = 90 at follow-up) over approximately two years. With latent change score models, we evaluated mean change and individual differences in rates of change in 10 anatomically-defined and manually-traced regions of interest (ROIs): lateral prefrontal cortex (LPFC), orbital frontal cortex (OF), prefrontal white matter (PFw), hippocampus (HC), parahippocampal gyrus (PhG), caudate nucleus (Cd), putamen (Pt), insula (In), cerebellar hemispheres (CbH), and primary visual cortex (VC). Significant mean shrinkage was observed in the HC, CbH, In, OF, and the PhG, and individual differences in change were noted in all regions, except the OF. Pro-inflammatory genetic variants mediated shrinkage in PhG and CbH. Carriers of two T alleles of interleukin-1β (IL-1βC-511T, rs16944) and a T allele of methylenetetrahydrofolate reductase (MTHFRC677T, rs1801133) polymorphisms showed increased PhG shrinkage. No effects of a pro-inflammatory polymorphism for C-reactive protein (CRP-286C>A>T, rs3091244) or apolipoprotein (APOE) ε4 allele were noted. These results replicate the pattern of brain shrinkage observed in previous studies, with a notable exception of the LPFC thus casting doubt on the unique importance of prefrontal cortex in aging. Larger baseline volumes of CbH and In were associated with increased shrinkage, in conflict with the brain reserve hypothesis. Contrary to previous reports, we observed no significant linear effects of age and hypertension on regional brain shrinkage. Our findings warrant further investigation of the effects of neuroinflammation on structural brain change throughout the lifespan. PMID:25264227

Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.

PubMed

Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I

2013-04-16

Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.

Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy

PubMed Central

Shchors, Ksenya; Persson, Anders I.; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S.; Hanahan, Douglas; Weiss, William A.; Evan, Gerard I.

2013-01-01

Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRasV12 mouse model crossed into the p53ERTAM background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ERTAM allele. The p53ERTAM protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRasV12;p53+/KI mice abrogate the p53 pathway by mutating p19ARF/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ERTAM allele. By contrast, gliomas arising in GFAP-HRasV12;p53KI/KI mice develop in the absence of functional p53. Such tumors retain a functional p19ARF/MDM2-signaling pathway, and restoration of p53ERTAM allele triggers p53-tumor–suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14ARF/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRasV12;p53KI/KI animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ERTAM activity mitigated the selective pressure to inactivate the p19ARF/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance. PMID:23542378

S locus-linked F-box genes expressed in anthers of Hordeum bulbosum.

PubMed

Kakeda, Katsuyuki

2009-09-01

Diploid Hordeum bulbosum (a wild relative of cultivated barley) exhibits a two-locus self-incompatibility (SI) system gametophytically controlled by the unlinked multiallelic loci S and Z. This unique SI system is observed in the grasses (Poaceae) including the tribe Triticeae. This paper describes the identification and characterization of two F-box genes cosegregating with the S locus in H. bulbosum, named Hordeum S locus-linked F-box 1 (HSLF1) and HSLF2, which were derived from an S (3) haplotype-specific clone (HAS175) obtained by previous AMF (AFLP-based mRNA fingerprinting) analysis. Sequence analysis showed that both genes encode similar F-box proteins with a C-terminal leucine-rich repeat (LRR) domain, which are distinct from S locus (or S haplotype-specific) F-box protein (SLF/SFB), a class of F-box proteins identified as the pollen S determinant in S-RNase-based gametophytic SI systems. A number of homologous F-box genes with an LRR domain were found in the rice genome, although the functions of the gene family are unknown. One allele of the HSLF1 gene (HSLF1-S (3)) was expressed specifically in mature anthers, whereas no expression was detected from the other two alleles examined. Although the degree of sequence polymorphism among the three HSLF1 alleles was low, a frameshift mutation was found in one of the unexpressed alleles. The HSLF2 gene showed a low level of expression with no tissue specificity as well as little sequence polymorphism among the three alleles. The multiplicity of S locus-linked F-box genes is discussed in comparison with those found in the S-RNase-based SI system.

The Genetics of a Small Autosomal Region of DROSOPHILA MELANOGASTER Containing the Structural Gene for Alcohol Dehydrogenase. III. Hypomorphic and Hypermorphic Mutations Affecting the Expression of Hairless

PubMed Central

Ashburner, Michael

1982-01-01

A lethal locus (l(2)br7;35B6-10), near Adh on chromosome arm 2L of D. melanogaster, is identified with Plunkett's dominant suppressor of Hairless (H). Of eight new alleles, seven act as dominant suppressors of H, the eighth is a dominant enhancer of H. One of the suppressor alleles is both a leaky lethal and a weak suppressor of H. Confirming Nash (1970), deletions of l(2)br7 are dominant suppressors, and duplications are dominant enhancers of H. A simple model is proposed to account for the interaction of l(2)br7 and H, assuming that amorphic (or hypomorphic) alleles of l(2)br7 suppress H and that hypermorphic alleles enhance H. PMID:6816670

Induction of anti-aging gene klotho with a small chemical compound that demethylates CpG islands

PubMed Central

Jung, Dongju; Xu, Yuechi; Sun, Zhongjie

2017-01-01

Klotho (KL) is described as an anti-aging gene because mutation of Kl gene leads to multiple pre-mature aging phenotypes and shortens lifespan in mice. Growing evidence suggests that an increase in KL expression may be beneficial for age-related diseases such as arteriosclerosis and diabetes. It remains largely unknown, however, how Kl expression could be induced. Here we discovered novel molecular mechanism for induction of Kl expression with a small molecule ‘Compound H’, N-(2-chlorophenyl)-1H-indole-3-caboxamide. Compound H was originally identified through a high-throughput screening of small molecules for identifying Kl inducers. However, how Compound H induces Kl expression has never been investigated. We found that Compound H increased Kl expression via demethylation in CpG islands of the Kl gene. The demethylation was accomplished by activating demethylases rather than inhibiting methylases. Due to demethylation, Compound H enhanced binding of transcription factors, Pax4 and Kid3, to the promoter of the Kl gene. Pax4 and Kid3 regulated Kl promoter activity positively and negatively, respectively. Thus, our results show that demethylation is an important molecular mechanism that mediates Compound H-induced Kl expression. Further investigation is warranted to determine whether Compound H demethylates the Kl gene in vivo and whether it can serve as a therapeutic agent for repressing or delaying the onset of age-related diseases. PMID:28657902

Comprehensive Cancer-Predisposition Gene Testing in an Adult Multiple Primary Tumor Series Shows a Broad Range of Deleterious Variants and Atypical Tumor Phenotypes.

PubMed

Whitworth, James; Smith, Philip S; Martin, Jose-Ezequiel; West, Hannah; Luchetti, Andrea; Rodger, Faye; Clark, Graeme; Carss, Keren; Stephens, Jonathan; Stirrups, Kathleen; Penkett, Chris; Mapeta, Rutendo; Ashford, Sofie; Megy, Karyn; Shakeel, Hassan; Ahmed, Munaza; Adlard, Julian; Barwell, Julian; Brewer, Carole; Casey, Ruth T; Armstrong, Ruth; Cole, Trevor; Evans, Dafydd Gareth; Fostira, Florentia; Greenhalgh, Lynn; Hanson, Helen; Henderson, Alex; Hoffman, Jonathan; Izatt, Louise; Kumar, Ajith; Kwong, Ava; Lalloo, Fiona; Ong, Kai Ren; Paterson, Joan; Park, Soo-Mi; Chen-Shtoyerman, Rakefet; Searle, Claire; Side, Lucy; Skytte, Anne-Bine; Snape, Katie; Woodward, Emma R; Tischkowitz, Marc D; Maher, Eamonn R

2018-06-12

Multiple primary tumors (MPTs) affect a substantial proportion of cancer survivors and can result from various causes, including inherited predisposition. Currently, germline genetic testing of MPT-affected individuals for variants in cancer-predisposition genes (CPGs) is mostly targeted by tumor type. We ascertained pre-assessed MPT individuals (with at least two primary tumors by age 60 years or at least three by 70 years) from genetics centers and performed whole-genome sequencing (WGS) on 460 individuals from 440 families. Despite previous negative genetic assessment and molecular investigations, pathogenic variants in moderate- and high-risk CPGs were detected in 67/440 (15.2%) probands. WGS detected variants that would not be (or were not) detected by targeted resequencing strategies, including low-frequency structural variants (6/440 [1.4%] probands). In most individuals with a germline variant assessed as pathogenic or likely pathogenic (P/LP), at least one of their tumor types was characteristic of variants in the relevant CPG. However, in 29 probands (42.2% of those with a P/LP variant), the tumor phenotype appeared discordant. The frequency of individuals with truncating or splice-site CPG variants and at least one discordant tumor type was significantly higher than in a control population (χ 2 = 43.642; p ≤ 0.0001). 2/67 (3%) probands with P/LP variants had evidence of multiple inherited neoplasia allele syndrome (MINAS) with deleterious variants in two CPGs. Together with variant detection rates from a previous series of similarly ascertained MPT-affected individuals, the present results suggest that first-line comprehensive CPG analysis in an MPT cohort referred to clinical genetics services would detect a deleterious variant in about a third of individuals. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Genome sequence comparison reveals a candidate gene involved in male-hermaphrodite differentiation in papaya (Carica papaya) trees.

PubMed

Ueno, Hiroki; Urasaki, Naoya; Natsume, Satoshi; Yoshida, Kentaro; Tarora, Kazuhiko; Shudo, Ayano; Terauchi, Ryohei; Matsumura, Hideo

2015-04-01

The sex type of papaya (Carica papaya) is determined by the pair of sex chromosomes (XX, female; XY, male; and XY(h), hermaphrodite), in which there is a non-recombining genomic region in the Y and Y(h) chromosomes. This region is presumed to be involved in determination of males and hermaphrodites; it is designated as the male-specific region in the Y chromosome (MSY) and the hermaphrodite-specific region in the Y(h) chromosome (HSY). Here, we identified the genes determining male and hermaphrodite sex types by comparing MSY and HSY genomic sequences. In the MSY and HSY genomic regions, we identified 14,528 nucleotide substitutions and 965 short indels with a large gap and two highly diverged regions. In the predicted genes expressed in flower buds, we found no nucleotide differences leading to amino acid changes between the MSY and HSY. However, we found an HSY-specific transposon insertion in a gene (SVP like) showing a similarity to the Short Vegetative Phase (SVP) gene. Study of SVP-like transcripts revealed that the MSY allele encoded an intact protein, while the HSY allele encoded a truncated protein. Our findings demonstrated that the SVP-like gene is a candidate gene for male-hermaphrodite determination in papaya.

RNA-templated single-base mutation detection based on T4 DNA ligase and reverse molecular beacon.

PubMed

Tang, Hongxing; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Huimin; He, Lifang; Liu, Bin

2008-06-15

A novel RNA-templated single-base mutation detection method based on T4 DNA ligase and reverse molecular beacon (rMB) has been developed and successfully applied to identification of single-base mutation in codon 273 of the p53 gene. The discrimination was carried out using allele-specific primers, which flanked the variable position in the target RNA and was ligated using T4 DNA ligase only when the primers perfectly matched the RNA template. The allele-specific primers also carried complementary stem structures with end-labels (fluorophore TAMRA, quencher DABCYL), which formed a molecular beacon after RNase H digestion. One-base mismatch can be discriminated by analyzing the change of fluorescence intensity before and after RNase H digestion. This method has several advantages for practical applications, such as direct discrimination of single-base mismatch of the RNA extracted from cell; no requirement of PCR amplification; performance of homogeneous detection; and easily design of detection probes.

The relationship between obstructive sleep apnea syndrome and apolipoprotein E genetic variants.

PubMed

Uyrum, Ebru; Balbay, Oner; Annakkaya, Ali Nihat; Gulec Balbay, Ege; Silan, Fatma; Arbak, Peri

2015-01-01

Clinical and epidemiological studies indicate that obstructive sleep apnea syndrome (OSAS) has a strong genetic basis. To investigate the apolipoprotein E (APOE) alleles as a genetic risk factor in OSAS. A total of 73 patients (37 male) were included. All underwent full-night polysomnography and were evaluated for APOE alleles. The mean age was 51 ± 12 years. Forty-two of the patients had OSAS. The APOE3 allele was found in 97.3% (71/73) of the study population. The most common APOE genotype was E3/E3 (55/73, 75.3%). Compared to the individuals with no APOE2 alleles (E3/E3, E3/E4), the individuals with at least one APOE2 allele (E2/E3, E2/E4) had a 9.37-fold greater OSAS risk (OR = 9.37, 95% CI 1.13-77.7, p = 0.019). The individuals with APOE2 alleles (E2/E3, E2/E4) compared to the individuals with only an E3/E3 allele genotype had a 10-fold greater OSAS risk (OR = 10.3, 95% CI 1.24-86.61, p = 0.0308). Compared to the individuals with no APOE4 alleles (E2/E3, E3/E3), the individuals with APOE4 alleles (E2/E4, E3/E4) had a high but insignificant risk for OSAS (OR = 2.9, 95% CI 0.55-15.05, p = 0.286). The individuals with APOE4 alleles (E2/E4, E3/E4) compared to APOE3 alleles (E3/E3) had an increased but insignificant risk for OSAS (OR = 3.62, 95% CI 0.96-19.05, p = 0.127). Specific APOE genotypes are associated with OSAS in a high-risk population.

An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

PubMed

Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

2016-07-21

Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

Co-expression of HLA-B7 and HLA-B27 alleles is associated with B7-restricted immunodominant responses following influenza infection.

PubMed

Akram, Ali; Inman, Robert D

2013-12-01

It is recognized that host response following viral infection is characterized by immunodominance, but deciphering the different factors contributing to immunodominance has proved a challenge due to concurrent expression of multiple MHC class I alleles. To address this, we generated H2-K(-/-)/D(-/-) double-knockout transgenic mice expressing either one or two human MHC-I alleles. We hypothesized that co-expression of different allele combinations figures critically in immunodominance and examined this in influenza-infected, double Tg MHC-I mice. In A2/B7 or A2/B27 mice, using ELISpot assays with the A2-restricted matrix I.58-66, the B7-restricted NP418-426 or the B27-restricted NP383-391 influenza A (flu) epitopes, we observed the expected recognition of both peptides for both alleles. In contrast, in flu-infected B7/B27 mice, a significantly reduced level of B27/NP383-restricted CTL response was detected while there was no change in the B7/NP418-restricted CTL response. Flu-specific tetramer studies revealed a partial deletion of Vβ8.1(+) NP383/B27-restricted CD8(+) T cells, and a diminished Vβ12(+) CD8(+) T-cell expansion in B7/B27 Tg mice. Using HLA Tg chimeric mice, we confirmed these findings. These findings shed light on the immune consequences of co-dominant expression of MHC-I alleles for host immune response to pathogens. © 2013 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.

CpG Island Methylator Phenotype-Low (CIMP-Low) in Colorectal Cancer: Possible Associations with Male Sex and KRAS Mutations

PubMed Central

Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J.; Loda, Massimo; Fuchs, Charles S.

2006-01-01

The CpG island methylator phenotype (CIMP or CIMP-high) with extensive promoter methylation seems to be a distinct epigenotype of colorectal cancer. However, no study has comprehensively examined features of colorectal cancer with less extensive promoter methylation (designated as “CIMP-low”). Using real-time polymerase chain reaction (MethyLight), we quantified DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1] in 840 relatively unbiased, population-based colorectal cancer samples, obtained from two large prospective cohort studies. CIMP-low (defined as 1/5 to 3/5 methylated promoters) colorectal cancers were significantly more common among men (38 versus 30% in women, P = 0.01) and among KRAS-mutated tumors (44 versus 30% in KRAS/BRAF wild-type tumors, P = 0.0003; 19% in BRAF-mutated tumors, P < 0.0001). In addition, KRAS mutations were significantly more common in CIMP-low tumors (47%) than in CIMP-high tumors (with ≥4/5 methylated promoters, 12%, P < 0.0001) and CIMP-0 tumors (with 0/5 methylated promoters, 37%, P = 0.007). The associations of CIMP-low tumors with male sex and KRAS mutations still existed after tumors were stratified by microsatellite instability status. In conclusion, CIMP-low colorectal cancer is associated with male sex and KRAS mutations. The hypothesis that CIMP-low tumors are different from CIMP-high and CIMP-0 tumors needs to be tested further. PMID:17065427

CpG island methylator phenotype-low (CIMP-low) in colorectal cancer: possible associations with male sex and KRAS mutations.

PubMed

Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J; Loda, Massimo; Fuchs, Charles S

2006-11-01

The CpG island methylator phenotype (CIMP or CIMP-high) with extensive promoter methylation seems to be a distinct epigenotype of colorectal cancer. However, no study has comprehensively examined features of colorectal cancer with less extensive promoter methylation (designated as "CIMP-low"). Using real-time polymerase chain reaction (MethyLight), we quantified DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1] in 840 relatively unbiased, population-based colorectal cancer samples, obtained from two large prospective cohort studies. CIMP-low (defined as 1/5 to 3/5 methylated promoters) colorectal cancers were significantly more common among men (38 versus 30% in women, P = 0.01) and among KRAS-mutated tumors (44 versus 30% in KRAS/BRAF wild-type tumors, P = 0.0003; 19% in BRAF-mutated tumors, P < 0.0001). In addition, KRAS mutations were significantly more common in CIMP-low tumors (47%) than in CIMP-high tumors (with > or =4/5 methylated promoters, 12%, P < 0.0001) and CIMP-0 tumors (with 0/5 methylated promoters, 37%, P = 0.007). The associations of CIMP-low tumors with male sex and KRAS mutations still existed after tumors were stratified by microsatellite instability status. In conclusion, CIMP-low colorectal cancer is associated with male sex and KRAS mutations. The hypothesis that CIMP-low tumors are different from CIMP-high and CIMP-0 tumors needs to be tested further.

CYP2C19 genetic variation and individualized clopidogrel prescription in a cardiology clinic.

PubMed

Mirabbasi, Seyed Abbas; Khalighi, Koroush; Wu, Yin; Walker, Stanley; Khalighi, Bahar; Fan, Wuqiang; Kodali, Archana; Cheng, Gang

2017-07-01

Background : Clopidogrel (Plavix) is an antiplatelet medication that is routinely used in patients with cardiovascular disease. Cytochrome P2C19 enzymes play a major role in its metabolism, which determines its varied therapeutic level and its effectiveness. Objectives : To customize clopidogrel therapy and evaluate its efficacy by using CYP2C19 genotypic and phenotypic information to improve clinical outcomes in patients. Methods : A total of 465 patients with underlying cardiovascular disease were selected from our out-patient cardiology clinic. DNA sequences of CYP2C19 were analyzed in 465 patients. Results : Of 465 patients, 183 were wild-type homozygous (*1/*1) and 18.8% gain-of function and 19.8% loss-of-function alleles in our patient population The following changes were made: 1) Switching to prasugrel in patients whose genotype noted them to be "Slow metabolizers. This medication adjustment improved clinical outcomes in this patient group. 2) Discontinuing or lowering clopidogrel doses in patients whose genotypes noted them to be "Fast or ultra-fast metabolizes" to decrease bleeding risk. For those who were not on clopidogrel but carried abnormal allele(s), "clopidogrel caution" was documented. These individuals were followed up for 3 years and there has not been any cardiac clinical symptoms, cardiac death or excessive bleeding reported. Conclusions : Given the varied effectiveness of clopidogrel due to its metabolism by CYP2C19 enzyme, and the relatively high frequency of both gain-of-function (18.8%) and loss-of-function (19.8%) alleles in our patient population, we believe that genotyping CYP2C19 is clinically important in order to improve patient outcomes and minimize patient risk.

Toll-like receptor 9 agonist enhances anti-tumor immunity and inhibits tumor-associated immunosuppressive cells numbers in a mouse cervical cancer model following recombinant lipoprotein therapy.

PubMed

Chang, Li-Sheng; Leng, Chih-Hsiang; Yeh, Yi-Chen; Wu, Chiao-Chieh; Chen, Hsin-Wei; Huang, Hai-Mei; Liu, Shih-Jen

2014-03-19

Although cytotoxic T lymphocytes (CTLs) play a major role in eradicating cancer cells during immunotherapy, the cancer-associated immunosuppressive microenvironment often limits the success of such therapies. Therefore, the simultaneous induction of cancer-specific CTLs and reversal of the immunosuppressive tumor microenvironment may be more effectively achieved through a single therapeutic vaccine. A recombinant lipoprotein with intrinsic Toll-like receptor 2 (TLR2) agonist activity containing a mutant form of E7 (E7m) and a bacterial lipid moiety (rlipo-E7m) has been demonstrated to induce robust CTL responses against small tumors. This treatment in combination with other TLR agonists is able to eliminate large tumors. Mouse bone marrow-derived dendritic cells (DCs) were employed to determine the synergistic production of pro-inflammatory cytokines upon combination of rlipo-E7m and other TLR agonists. Antigen-specific CTL responses were investigated using immunospots or in vivo cytolytic assays after immunization in mice. Mice bearing various tumor sizes were used to evaluate the anti-tumor effects of the formulation. Specific subpopulations of immunosuppressive cells in the tumor infiltrate were quantitatively determined by flow cytometry. We demonstrate that a TLR9 agonist (unmethylated CpG oligodeoxynucleotide, CpG ODN) enhances CTL responses and eradicates large tumors when combined with rlipo-E7m. Moreover, combined treatment with rlipo-E7m and CpG ODN effectively increases tumor infiltration by CTLs and reduces the numbers of myeloid-derived suppressor cells (MDSCs), tumor-associated macrophages (TAMs) and regulatory T cells (Tregs) in the tumor microenvironment. These findings suggest that the dramatic anti-tumor effects of the recombinant lipoprotein together with CpG ODN may reflect the amplification of CTL responses and the repression of the immunosuppressive environment. This promising approach could be applied for the development of additional therapeutic cancer vaccines.

PiiL: visualization of DNA methylation and gene expression data in gene pathways.

PubMed

Moghadam, Behrooz Torabi; Zamani, Neda; Komorowski, Jan; Grabherr, Manfred

2017-08-02

DNA methylation is a major mechanism involved in the epigenetic state of a cell. It has been observed that the methylation status of certain CpG sites close to or within a gene can directly affect its expression, either by silencing or, in some cases, up-regulating transcription. However, a vertebrate genome contains millions of CpG sites, all of which are potential targets for methylation, and the specific effects of most sites have not been characterized to date. To study the complex interplay between methylation status, cellular programs, and the resulting phenotypes, we present PiiL, an interactive gene expression pathway browser, facilitating analyses through an integrated view of methylation and expression on multiple levels. PiiL allows for specific hypothesis testing by quickly assessing pathways or gene networks, where the data is projected onto pathways that can be downloaded directly from the online KEGG database. PiiL provides a comprehensive set of analysis features that allow for quick and specific pattern searches. Individual CpG sites and their impact on host gene expression, as well as the impact on other genes present in the regulatory network, can be examined. To exemplify the power of this approach, we analyzed two types of brain tumors, Glioblastoma multiform and lower grade gliomas. At a glance, we could confirm earlier findings that the predominant methylation and expression patterns separate perfectly by mutations in the IDH genes, rather than by histology. We could also infer the IDH mutation status for samples for which the genotype was not known. By applying different filtering methods, we show that a subset of CpG sites exhibits consistent methylation patterns, and that the status of sites affect the expression of key regulator genes, as well as other genes located downstream in the same pathways. PiiL is implemented in Java with focus on a user-friendly graphical interface. The source code is available under the GPL license from https://github.com/behroozt/PiiL.git .

Oligoamine analogues in combination with 2-difluoromethylornithine synergistically induce re-expression of aberrantly silenced tumour-suppressor genes

PubMed Central

Wu, Yu; Steinbergs, Nora; Murray-Stewart, Tracy; Marton, Laurence J.; Casero, Robert A.

2011-01-01

Epigenetic gene silencing is an important mechanism in the initiation and progression of cancer. Abnormal DNA CpG island hypermethylation and histone modifications are involved in aberrant silencing of tumour-suppressor genes. LSD1 (lysine-specific demethylase 1) was the first enzyme identified to specifically demethylate H3K4 (Lys4 of histone H3). Methylated H3K4 is an important mark associated with transcriptional activation. The flavin adenine dinucleotide-binding amine oxidase domain of LSD1 is homologous with two polyamine oxidases, SMO (spermine oxidase) and APAO (N1-acetylpolyamine oxidase). We have demonstrated previously that long-chain polyamine analogues, the oligoamines, are inhibitors of LSD1. In the present paper we report the synergistic effects of specific oligoamines in combination with DFMO (2-difluoromethylornithine), an inhibitor of ornithine decarboxylase, in human colorectal cancer cells. DFMO treatment depletes natural polyamines and increases the uptake of exogenous polyamines. The combination of oligoamines and DFMO results in a synergistic re-expression of aberrantly silenced tumour-suppressor genes, including SFRP2 (secreted frizzled-related protein 2), which encodes a Wnt signalling pathway antagonist and plays an anti-tumorigenic role in colorectal cancer. The treatment-induced re-expression of SFRP2 is associated with increased H3K4me2 (di-methyl H3K4) in the gene promoter. The combination of LSD1-inhibiting oligoamines and DFMO represents a novel approach to epigenetic therapy of cancer. PMID:22132744

Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.

PubMed

Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M

2011-07-01

Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value < 2 × 10(-16)). We found distinct patterns of promoter methylation around transcription start sites, where methylation occurred not only on the CGIs, but also on flanking regions and CGI sparse promoters. Among the 6691 methylated promoters in prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.

Identification of the physiological promoter for spinocerebellar ataxia 2 gene reveals a CpG island for promoter activity situated into the exon 1 of this gene and provides data about the origin of the nonmethylated state of these types of islands.

PubMed

Aguiar, J; Santurlidis, S; Nowok, J; Alexander, C; Rudnicki, D; Gispert, S; Schulz, W; Auburger, G

1999-01-19

In order to further use the spinocerebellar ataxia 2 (SCA2) promoter for transgenic mice models of "CAG repeat" neurodegeneration, different fragments of this 5' end were ligated into pGL3-Luc plasmid to obtain the better promoter-activity of the physiological promoter for SCA2. Base-par composition of the SCA2-5' region, and promoter prediction algorithms such as TSSW and TSSG, together with the high firefly luciferase expression after 48 hours of transient transfection in mammalian cells lines, showed a typical CpG island for promoter-activity. The promoter activity was specifically localized into the exon 1 of the SCA2 gene. The higher expression of firefly luciferase in the embryonal F9 cells by the use of SCA2 promoter, rather than by the use of CMV promoter may be related with the origin of the nonmethylated CpG island during the early embryogenesis. Analysis of the 5' region from HD gene revealed to a CpG island, which could be containing the physiological promoter for this gene. Copyright 1999 Academic Press.

CpG island methylator phenotype (CIMP) in cancer: causes and implications.

PubMed

Teodoridis, Jens M; Hardie, Catriona; Brown, Robert

2008-09-18

Strong evidence exists for a subgroup of tumours, from a variety of tissue types, exhibiting concordant tumour specific DNA methylation: the "CpG island methylator phenotype" (CIMP). Occurrence of CIMP is associated with a range of genetic and environmental factors, although the molecular causes are not well-understood. Both increased expression and aberrant targeting of DNA methyltransferases (DNMTs) could contribute to the occurrence of CIMP. One under-explored area is the possibility that DNA damage may induce or select for CIMP during carcinogenesis or treatment of tumours with chemotherapy. DNA damaging agents can induce DNA damage at guanine rich regions throughout the genome, including CpG islands. This DNA damage can result in stalled DNA synthesis, which will lead to localised increased DNMT1 concentration and therefore potentially increased DNA methylation at these sites. Chemotherapy can select for cells which have increased tolerance to DNA damage due to increased lesion bypass, in some cases by mechanisms which involve inactivation of genes by CpG island methylation. CIMP has been associated with worse patient prognosis, probably due to increased epigenetic plasticity. Therefore, further clinical testing of the diagnostic and prognostic value of the current CIMP markers, as well as increasing our understanding of the molecular causes underlying CIMP are required.

IDH-mutant glioma specific association of rs55705857 located at 8q24.21 involves MYC deregulation

PubMed Central

Oktay, Yavuz; Ülgen, Ege; Can, Özge; Akyerli, Cemaliye B.; Yüksel, Şirin; Erdemgil, Yiğit; Durası, İ. Melis; Henegariu, Octavian Ioan; Nanni, E. Paolo; Selevsek, Nathalie; Grossmann, Jonas; Erson-Omay, E. Zeynep; Bai, Hanwen; Gupta, Manu; Lee, William; Turcan, Şevin; Özpınar, Aysel; Huse, Jason T.; Sav, M. Aydın; Flanagan, Adrienne; Günel, Murat; Sezerman, O. Uğur; Yakıcıer, M. Cengiz; Pamir, M. Necmettin; Özduman, Koray

2016-01-01

The single nucleotide polymorphism rs55705857, located in a non-coding but evolutionarily conserved region at 8q24.21, is strongly associated with IDH-mutant glioma development and was suggested to be a causal variant. However, the molecular mechanism underlying this association has remained unknown. With a case control study in 285 gliomas, 316 healthy controls, 380 systemic cancers, 31 other CNS-tumors, and 120 IDH-mutant cartilaginous tumors, we identified that the association was specific to IDH-mutant gliomas. Odds-ratios were 9.25 (5.17–16.52; 95% CI) for IDH-mutated gliomas and 12.85 (5.94–27.83; 95% CI) for IDH-mutated, 1p/19q co-deleted gliomas. Decreasing strength with increasing anaplasia implied a modulatory effect. No somatic mutations were noted at this locus in 114 blood-tumor pairs, nor was there a copy number difference between risk-allele and only-ancestral allele carriers. CCDC26 RNA-expression was rare and not different between the two groups. There were only minor subtype-specific differences in common glioma driver genes. RNA sequencing and LC-MS/MS comparisons pointed to significantly altered MYC-signaling. Baseline enhancer activity of the conserved region specifically on the MYC promoter and its further positive modulation by the SNP risk-allele was shown in vitro. Our findings implicate MYC deregulation as the underlying cause of the observed association. PMID:27282637

New Aspects of the Interplay between Penicillin Binding Proteins, murM, and the Two-Component System CiaRH of Penicillin-Resistant Streptococcus pneumoniae Serotype 19A Isolates from Hungary.

PubMed

Schweizer, Inga; Blättner, Sebastian; Maurer, Patrick; Peters, Katharina; Vollmer, Daniela; Vollmer, Waldemar; Hakenbeck, Regine; Denapaite, Dalia

2017-07-01

The Streptococcus pneumoniae clone Hungary 19A -6 expresses unusually high levels of β-lactam resistance, which is in part due to mutations in the MurM gene, encoding a transferase involved in the synthesis of branched peptidoglycan. Moreover, it contains the allele ciaH232 , encoding the histidine kinase CiaH (M. Müller, P. Marx, R. Hakenbeck, and R. Brückner, Microbiology 157:3104-3112, 2011, https://doi.org/10.1099/mic.0.053157-0). High-level penicillin resistance primarily requires the presence of low-affinity (mosaic) penicillin binding protein (PBP) genes, as, for example, in strain Hu17, a closely related member of the Hungary 19A -6 lineage. Interestingly, strain Hu15 is β-lactam sensitive due to the absence of mosaic PBPs. This unique situation prompted us to investigate the development of cefotaxime resistance in transformation experiments with genes known to play a role in this phenotype, pbp2x , pbp1a , murM , and ciaH , and penicillin-sensitive recipient strains R6 and Hu15. Characterization of phenotypes, peptidoglycan composition, and CiaR-mediated gene expression revealed several novel aspects of penicillin resistance. The murM gene of strain Hu17 ( murM Hu17 ), which is highly similar to murM of Streptococcus mitis , induced morphological changes which were partly reversed by ciaH232. murM Hu17 conferred cefotaxime resistance only in the presence of the pbp2x o f strain Hu17 ( pbp2x Hu17 ). The ciaH232 allele contributed to a remarkable increase in cefotaxime resistance in combination with pbp2x Hu17 and pbp1a of strain Hu17 ( pbp1a Hu17 ), accompanied by higher levels of expression of CiaR-regulated genes, documenting that ciaH232 responds to PBP1a Hu17 -mediated changes in cell wall synthesis. Most importantly, the proportion of branched peptides relative to the proportion of linear muropeptides increased in cells containing mosaic PBPs, suggesting an altered enzymatic activity of these proteins. Copyright © 2017 Schweizer et al.

Radiolabelling of glycosylated MFE-23::CPG2 fusion protein (MFECP1) with 99mTc for quantitation of tumour antibody-enzyme localisation in antibody-directed enzyme pro-drug therapy (ADEPT).

PubMed

Francis, R J; Mather, S J; Chester, K; Sharma, S K; Bhatia, J; Pedley, R B; Waibel, R; Green, A J; Begent, R H J

2004-08-01

MFECP1 is a glycosylated recombinant fusion protein composed of MFE-23, a high-affinity anti-carcinoembryonic antigen (CEA) single chain Fv (scFv), fused to the enzyme carboxypeptidase G2 (CPG2), and has been constructed for use in antibody-directed enzyme pro-drug therapy (ADEPT). Radiolabelling of glycosylated MFECP1 with technetium-99m was developed for the purpose of determining tumour localisation of MFECP1 in a phase I ADEPT clinical study. The method used was 99mTc-carbonyl [99mTc(H2O)3(CO)3]+ (abbreviated to TcCO) mediated labelling of 99mTc to the hexahistidine (His) tag of MFECP1. MFECP1 fusion protein was labelled with TcCO under a variety of conditions, and this was shown to be a relatively simple and robust method. Tissue biodistribution was assessed in a CEA-expressing LS174T (human colon carcinoma) nude mouse xenograft model. Tissues were taken at 1, 4 and 6 h for assessment of distribution of radioactivity and for measurement of CPG2 enzyme levels. The amount of radioactivity retained by the tumour proved to be an accurate estimation of actual measured enzyme activity, indicating that this radiolabelling method does not appear to damage the antibody-antigen binding or the enzyme activity of MFECP1. However, correlation between CPG2 enzyme activity and measured radioactivity in liver, spleen and kidney was poor, indicating retention of radioactivity in non-tumour sites but loss of enzyme activity. The high retention of technetium radioisotope in normal tissues may limit the clinical applicability of this radiolabelling method for MFECP1; however, these results suggest that this technique does have applicability for measuring the biodistribution of His-tagged recombinant proteins.

Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

PubMed

Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

2016-01-01

Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.

Computational Modeling Approach in Probing the Effects of Cytosine Methylation on the Transcription Factor Binding to DNA.

PubMed

Tenayuca, John; Cousins, Kimberley; Yang, Shumei; Zhang, Lubo

2017-01-01

Cytosine methylation at CpG dinucleotides is a chief mechanism in epigenetic modification of gene expression patterns. Previous studies demonstrated that increased CpG methylation of Sp1 sites at -268 and -346 of protein kinase C ε promoter repressed the gene expression. The present study investigated the impact of CpG methylation on the Sp1 binding via molecular modeling and electrophoretic mobility shift assay. Each of the Sp1 sites contain two CpGs. Methylation of either CpG lowered the binding affinity of Sp1, whereas methylation of both CpGs produced a greater decrease in the binding affinity. Computation of van der Waals (VDW) energy of Sp1 in complex with the Sp1 sites demonstrated increased VDW values from one to two sites of CpG methylation. Molecular modeling indicated that single CpG methylation caused underwinding of the DNA fragment, with the phosphate groups at C1, C4 and C5 reoriented from their original positions. Methylation of both CpGs pinched the minor groove and increased the helical twist concomitant with a shallow, hydrophobic major groove. Additionally, double methylation eliminated hydrogen bonds on recognition helix residues located at positions -1 and 1, which were essential for interaction with O6/N7 of G-bases. Bonding from linker residues Arg565, Lys595 and Lys596 were also reduced. Methylation of single or both CpGs significantly affected hydrogen bonding from all three Sp1 DNA binding domains, demonstrating that the consequences of cytosine modification extend beyond the neighboring nucleotides. The results indicate that cytosine methylation causes subtle structural alterations in Sp1 binding sites consequently resulting in inhibition of side chain interactions critical for specific base recognition and reduction of the binding affinity of Sp1. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Sequence Variations in the Flagellar Antigen Genes fliCH25 and fliCH28 of Escherichia coli and Their Use in Identification and Characterization of Enterohemorrhagic E. coli (EHEC) O145:H25 and O145:H28.

PubMed

Beutin, Lothar; Delannoy, Sabine; Fach, Patrick

2015-01-01

Enterohemorrhagic E. coli (EHEC) serogroup O145 is regarded as one of the major EHEC serogroups involved in severe infections in humans. EHEC O145 encompasses motile and non-motile strains of serotypes O145:H25 and O145:H28. Sequencing the fliC-genes associated with the flagellar antigens H25 and H28 revealed the genetic diversity of the fliCH25 and fliCH28 gene sequences in E. coli. Based on allele discrimination of these fliC-genes real-time PCR tests were designed for identification of EHEC O145:H25 and O145:H28. The fliCH25 genes present in O145:H25 were found to be very similar to those present in E. coli serogroups O2, O100, O165, O172 and O177 pointing to their common evolution but were different from fliCH25 genes of a multiple number of other E. coli serotypes. In a similar way, EHEC O145:H28 harbor a characteristic fliCH28 allele which, apart from EHEC O145:H28, was only found in enteropathogenic (EPEC) O28:H28 strains that shared some common traits with EHEC O145:H28. The real time PCR-assays targeting these fliCH25[O145] and fliCH28[O145] alleles allow better characterization of EHEC O145:H25 and EHEC O145:H28. Evaluation of these PCR assays in spiked ready-to eat salad samples resulted in specific detection of both types of EHEC O145 strains even when low spiking levels of 1-10 cfu/g were used. Furthermore these PCR assays allowed identification of non-motile E. coli strains which are serologically not typable for their H-antigens. The combined use of O-antigen genotyping (O145wzy) and detection of the respective fliCH25[O145] and fliCH28[O145] allele types contributes to improve identification and molecular serotyping of E. coli O145 isolates.

Predicting aberrant CpG island methylation

PubMed Central

Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

2003-01-01

Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

Predicting aberrant CpG island methylation.

PubMed

Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

2003-10-14

Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

Implementation of antibiotic use guidelines for fresh traumatic wound at Siriraj Hospital.

PubMed

Sirijatuphat, Rujipas; Choochan, Tanatchon; Siritongtaworn, Preecha; Sripojtham, Vipaporn; Thamlikitkul, Visanu

2015-03-01

To determine the effectiveness of implementing a clinical practice guideline (CPG) on antibiotic use for adults with fresh traumatic wounds who attended the trauma center at Siriraj Hospital, Bangkok. A prospective study of 600 adult patients who had fresh traumatic wounds (≤ 6 hours) was conducted at Siriraj Trauma Center from March 2013 to March 2014. The CPG was introduced to physicians, nurses and medical students by posting the CPG at the patient care areas of the trauma center. The outcomes were an appropriate classification of wounds according to the CPG recommendations, prevalence of antibiotic prescribing, incidence of wound infection and compliance with the CPG. Clean-contaminated wounds that did not need antibiotic treatment and clean-contaminated and contaminated wounds that required antibiotics were observed in 63.2, 6.7, and 30.1% ofthe patients, respectively. Antibiotics were given to 512 patients (85.3%). Infections occurred in six patients (1.0%). Antibiotic prescription according to CPG recommendations was observed for 243 patients (40.5%). The prevalence of antibiotic use in the CPG-compliant group (65.8%) was significantly less than that in the CPG-noncompliant group (98.6%) (p < 0.001). The patients in the CPG-compliant group had more contaminated wounds than those in the CPG-noncompliant group (51.4 vs. 15.7%, p < 0.001). The incidences of wound infection were very low in both groups and not significantly different (1.2 vs. 0.8%, p = 0.690). Antibiotic prophylaxis was necessary in less than 36.8% of adults with fresh traumatic wounds who attended Siriraj Trauma Center Compliance to CPG implementation using simple intervention seemed to be low. Adhering to CPG recommendations for antibiotic prophylaxis in adults with fresh traumatic wounds can reduce the unnecessary prescribing of antibiotics without increasing the rate of wound infection.

A global analysis of Y-chromosomal haplotype diversity for 23 STR loci.

PubMed

Purps, Josephine; Siegert, Sabine; Willuweit, Sascha; Nagy, Marion; Alves, Cíntia; Salazar, Renato; Angustia, Sheila M T; Santos, Lorna H; Anslinger, Katja; Bayer, Birgit; Ayub, Qasim; Wei, Wei; Xue, Yali; Tyler-Smith, Chris; Bafalluy, Miriam Baeta; Martínez-Jarreta, Begoña; Egyed, Balazs; Balitzki, Beate; Tschumi, Sibylle; Ballard, David; Court, Denise Syndercombe; Barrantes, Xinia; Bäßler, Gerhard; Wiest, Tina; Berger, Burkhard; Niederstätter, Harald; Parson, Walther; Davis, Carey; Budowle, Bruce; Burri, Helen; Borer, Urs; Koller, Christoph; Carvalho, Elizeu F; Domingues, Patricia M; Chamoun, Wafaa Takash; Coble, Michael D; Hill, Carolyn R; Corach, Daniel; Caputo, Mariela; D'Amato, Maria E; Davison, Sean; Decorte, Ronny; Larmuseau, Maarten H D; Ottoni, Claudio; Rickards, Olga; Lu, Di; Jiang, Chengtao; Dobosz, Tadeusz; Jonkisz, Anna; Frank, William E; Furac, Ivana; Gehrig, Christian; Castella, Vincent; Grskovic, Branka; Haas, Cordula; Wobst, Jana; Hadzic, Gavrilo; Drobnic, Katja; Honda, Katsuya; Hou, Yiping; Zhou, Di; Li, Yan; Hu, Shengping; Chen, Shenglan; Immel, Uta-Dorothee; Lessig, Rüdiger; Jakovski, Zlatko; Ilievska, Tanja; Klann, Anja E; García, Cristina Cano; de Knijff, Peter; Kraaijenbrink, Thirsa; Kondili, Aikaterini; Miniati, Penelope; Vouropoulou, Maria; Kovacevic, Lejla; Marjanovic, Damir; Lindner, Iris; Mansour, Issam; Al-Azem, Mouayyad; Andari, Ansar El; Marino, Miguel; Furfuro, Sandra; Locarno, Laura; Martín, Pablo; Luque, Gracia M; Alonso, Antonio; Miranda, Luís Souto; Moreira, Helena; Mizuno, Natsuko; Iwashima, Yasuki; Neto, Rodrigo S Moura; Nogueira, Tatiana L S; Silva, Rosane; Nastainczyk-Wulf, Marina; Edelmann, Jeanett; Kohl, Michael; Nie, Shengjie; Wang, Xianping; Cheng, Baowen; Núñez, Carolina; Pancorbo, Marian Martínez de; Olofsson, Jill K; Morling, Niels; Onofri, Valerio; Tagliabracci, Adriano; Pamjav, Horolma; Volgyi, Antonia; Barany, Gusztav; Pawlowski, Ryszard; Maciejewska, Agnieszka; Pelotti, Susi; Pepinski, Witold; Abreu-Glowacka, Monica; Phillips, Christopher; Cárdenas, Jorge; Rey-Gonzalez, Danel; Salas, Antonio; Brisighelli, Francesca; Capelli, Cristian; Toscanini, Ulises; Piccinini, Andrea; Piglionica, Marilidia; Baldassarra, Stefania L; Ploski, Rafal; Konarzewska, Magdalena; Jastrzebska, Emila; Robino, Carlo; Sajantila, Antti; Palo, Jukka U; Guevara, Evelyn; Salvador, Jazelyn; Ungria, Maria Corazon De; Rodriguez, Jae Joseph Russell; Schmidt, Ulrike; Schlauderer, Nicola; Saukko, Pekka; Schneider, Peter M; Sirker, Miriam; Shin, Kyoung-Jin; Oh, Yu Na; Skitsa, Iulia; Ampati, Alexandra; Smith, Tobi-Gail; Calvit, Lina Solis de; Stenzl, Vlastimil; Capal, Thomas; Tillmar, Andreas; Nilsson, Helena; Turrina, Stefania; De Leo, Domenico; Verzeletti, Andrea; Cortellini, Venusia; Wetton, Jon H; Gwynne, Gareth M; Jobling, Mark A; Whittle, Martin R; Sumita, Denilce R; Wolańska-Nowak, Paulina; Yong, Rita Y Y; Krawczak, Michael; Nothnagel, Michael; Roewer, Lutz

2014-09-01

In a worldwide collaborative effort, 19,630 Y-chromosomes were sampled from 129 different populations in 51 countries. These chromosomes were typed for 23 short-tandem repeat (STR) loci (DYS19, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS385ab, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458, DYS635, GATAH4, DYS481, DYS533, DYS549, DYS570, DYS576, and DYS643) and using the PowerPlex Y23 System (PPY23, Promega Corporation, Madison, WI). Locus-specific allelic spectra of these markers were determined and a consistently high level of allelic diversity was observed. A considerable number of null, duplicate and off-ladder alleles were revealed. Standard single-locus and haplotype-based parameters were calculated and compared between subsets of Y-STR markers established for forensic casework. The PPY23 marker set provides substantially stronger discriminatory power than other available kits but at the same time reveals the same general patterns of population structure as other marker sets. A strong correlation was observed between the number of Y-STRs included in a marker set and some of the forensic parameters under study. Interestingly a weak but consistent trend toward smaller genetic distances resulting from larger numbers of markers became apparent. Copyright © 2014 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

PubMed

Upadhyay, Mohita; Vivekanandan, Perumal

2015-01-01

Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our results highlight the existence of divergent evolutionary pressures leading to CpG dinucleotide depletion among small ds-DNA viruses infecting vertebrate hosts.

Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients

PubMed Central

2011-01-01

Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918

The impact of cytochrome P450 2C19 polymorphism on the occurrence of one-year in-stent restenosis in patients who underwent percutaneous coronary intervention: A case-match study

PubMed Central

Nozari, Younes; Vosooghi, Sirous; Boroumand, Mohammadali; Poorhosseini, Hamidreza; Nematipour, Ebrahim; Salarifar, Mojtaba; Kassaian, Seyed Ebrahim; Amirzadegan, Alireza; Alidoosti, Mohammad; Haji-Zeinali, Ali-Mohammad; Saroukhani, Sepideh

2015-01-01

Objective In this case-match study, we evaluated the impact of the CYP2C19*2 polymorphism in the occurrence of in-stent restenosis during a 1-year follow-up period despite adequate dual anti-platelet therapy in Iranian patients having undergone percutaneous coronary intervention (PCI). Methods This study, conducted at a tertiary referral heart center in Tehran, recruited 100 patients: 50 patients had in-stent restenosis after PCI during a 1-year follow-up and were compared to another 50 patients without in-stent restenosis who were individually matched according to sex. In order to evaluate the impact of the CYP2C19*2 polymorphism, case frequency matching was performed with respect to variables previously shown to be predictors of in-stent restenosis. The CYP2C19*2 polymorphism evaluated using real-time PCR methods. Results Among all 100 patients (mean age=60.09±10.29: 72.0% male), 89 (89%) patients had wild (CYP2C19*1/CYP2C19*1) and 11% had a heterozygous (CYP2C19*1/CYP2C19*2) genotypes, and there was no patient with a completely mutant genotype (CYP2C19*2/CYP2C19*2). Conditional logistic regression analysis showed that there was no significant association between genotype CYP2C19*1/CYP2C19*2 and the occurrence of in-stent restenosis after PCI (OR=2.5, p value=0.273). Conclusion Our findings indicated that carrying a CYP2C19*2 allele with a functional CYP2C19*1 allele had no significant association with instent restenosis 1 year after PCI. The antiplatelet treatment strategy for non-functional allele carriers is still a matter of controversy. Further studies with larger sample sizes are necessary to determine the prevalence of non-functional alleles in various populations and to achieve a consensus about the effective treatment strategy. PMID:25993709

Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

PubMed Central

Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

2013-01-01

Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude of cytokine induction by varying the strength of condensation of the CpG oligodeoxynucleotides. Conclusion Although the loading capacity of BNNS coated with low molecular weight chitosan preparations was the lowest of all the preparations, they induced the highest levels of cytokines. PMID:23674892

Gaining insight into the Clinical Practice Guideline development processes: qualitative study in a workshop to implement the GRADE proposal in Spain

PubMed Central

Calderón, Carlos; Rotaeche, Rafael; Etxebarria, Arritxu; Marzo, Mercé; Rico, Rosa; Barandiaran, Marta

2006-01-01

Background The GRADE method represents a new approach to grading the quality of evidence and strength of recommendations in the preparation of Clinical Practice Guidelines (CPG). In the context of a pilot study to assess the implementability of the system in Spain, we considered it relevant to gain an insight into the significance of the perceptions and attitudes expressed by the actual experts participating in the system try-out. Methods Qualitative research with an ethnographic approach, through non-participant observation and focus groups within the context of a consensus workshop in which 19 CPG experts participated to evaluate the GRADE proposal using 12 evidence tables taken from hypertension, asthma and arthritis CPGs. The interventions were recorded, under a guarantee of confidentiality. The transcriptions and field notes were analyzed, based on a sociological discourse analysis model, and the provisional findings were re-sent to participants in order to improve their validity. Results 1) Certain problems over procedure and terminology hindered the acceptance of this new method as a common reference system for the preparation of CPGs. 2). A greater closeness to clinical practice was accompanied by concerns over value judgments and subjectivity, with a demand for greater explicitness in the consensus process. 3). The type of "evidence" on which the guidelines are based, how and by whom the evidence is prepared, and what the role of the different actors should be, all constitute unresolved concerns in the CPG preparation and implementation processes. 4). The grading process is not neutral: professional background, prior experience and the degree of leadership all condition the participants' input and interactions. Conclusion The findings obtained allow the quantitative evaluation to be better interpreted and, in turn, go beyond the particularities of the GRADE method. Adaptation to the complexities of clinical practice, the need for carefully designed multi-disciplinary work and the reflexivity present in the CPG preparation process, all represent lines of debate that are necessary to improve the CPG quality in the Spanish health care sector. PMID:17059600

CpG DNA in the prevention and treatment of infections.

PubMed

Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

2002-01-01

Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

Emergent central pattern generator behavior in chemical coupled two-compartment models with time delay

NASA Astrophysics Data System (ADS)

Li, Shanshan; Zhang, Guoshan; Wang, Jiang; Chen, Yingyuan; Deng, Bin

2018-02-01

This paper proposes that modified two-compartment Pinsky-Rinzel (PR) neural model can be used to develop the simple form of central pattern generator (CPG). The CPG is called as 'half-central oscillator', which constructed by two inhibitory chemical coupled PR neurons with time delay. Some key properties of PR neural model related to CPG are studied and proved to meet the requirements of CPG. Using the simple CPG network, we first study the relationship between rhythmical output and key factors, including ambient noise, sensory feedback signals, morphological character of single neuron as well as the coupling delay time. We demonstrate that, appropriate intensity noise can enhance synchronization between two coupled neurons. Different output rhythm of CPG network can be entrained by sensory feedback signals. We also show that the morphology of single neuron has strong effect on the output rhythm. The phase synchronization indexes decrease with the increase of morphology parameter's difference. Through adjusting coupled delay time, we can get absolutely phase synchronization and antiphase state of CPG. Those results of simulation show the feasibility of PR neural model as a valid CPG as well as the emergent behaviors of the particularly CPG.

Minding the Cyber-Physical Gap: Model-Based Analysis and Mitigation of Systemic Perception-Induced Failure.

PubMed

Mordecai, Yaniv; Dori, Dov

2017-07-17

The cyber-physical gap (CPG) is the difference between the 'real' state of the world and the way the system perceives it. This discrepancy often stems from the limitations of sensing and data collection technologies and capabilities, and is inevitable at some degree in any cyber-physical system (CPS). Ignoring or misrepresenting such limitations during system modeling, specification, design, and analysis can potentially result in systemic misconceptions, disrupted functionality and performance, system failure, severe damage, and potential detrimental impacts on the system and its environment. We propose CPG-Aware Modeling & Engineering (CPGAME), a conceptual model-based approach to capturing, explaining, and mitigating the CPG. CPGAME enhances the systems engineer's ability to cope with CPGs, mitigate them by design, and prevent erroneous decisions and actions. We demonstrate CPGAME by applying it for modeling and analysis of the 1979 Three Miles Island 2 nuclear accident, and show how its meltdown could be mitigated. We use ISO-19450:2015-Object Process Methodology as our conceptual modeling framework.

[Study on correlation between HLA-A, B, DR alleles and Duchenne muscular dystrophy].

PubMed

Chen, Wei; Xiao, Lulu; Zhang, Cheng; Wu, Hong-ling

2007-10-01

To analyze the polymorphism of HLA-A, B and DR alleles of Duchenne muscular dystrophy (DMD) patients in Han nationality of South China and to discuss the role of immune and genetic factors in the pathogenesis of DMD and muscular fiber necrosis. Polymerase chain reaction-reverse sequence specific oligonucleotide (PCR-RSSO) and National Marrow Donor Program (NMDP) were used to analyze the polymorphism of HLA-A,B and DR alleles of 113 DMD patients and 406 normal controls in Han nationality of South China. The frequencies of HLA-A24, A30 alleles in DMD group were 11.25% and 5.46% respectively, indicating notable difference (P=0.001, < 0.01) from 22.16% and 0.87% of control group; the frequencies of HLA-B13, B15, B61 and B62 alleles in DMD group were 12.26%, 16.92%, 0.44% and 0.44%, indicating a notable difference (P=0.016, < 0.01, 0.001) from 6.76%, 1.49%, 4.79% and 5.05% of control group; the frequencies of HLA-DR04, DR07, DR12 alleles in DMD group were 17.45%, 6.40% and 19.62%, indicating a notable difference (P=0.018, < 0.01, 0.012) from 10.67%, 2.24% and 11.92% of control group. There are significant differences in the HLA gene frequencies between DMD patients and normal controls. These results suggest that HLA genotype relates to the muscular necrosis and the pathogenesis of DMD.

Complement factor H gene (CFH) polymorphisms C-257T, G257A and haplotypes are associated with protection against severe dengue phenotype, possible related with high CFH expression

PubMed Central

Pastor, André F.; Moura, Laís Rodrigues; Neto, José W.D.; Nascimento, Eduardo J.M.; Calzavara-Silva, Carlos E.; Gomes, Ana Lisa V.; da Silva, Ana Maria; Cordeiro, Marli T.; Braga-Neto, Ulisses; Crovella, Sergio; Gil, Laura H.V.G.; Marques, Ernesto T.A.; Acioli-Santos, Bartolomeu

2013-01-01

Four genetic polymorphisms located at the promoter (C-257T) and coding regions of CFH gene (exon 2 G257A, exon 14 A2089G and exon 19 G2881T) were investigated in 121 dengue patients (DENV-3) in order to assess the relationship between allele/haplotypes variants and clinical outcomes. A statistical value was found between the CFH-257T allele (TT/TC genotypes) and reduced susceptibility to severe dengue (SD). Statistical associations indicate that individuals bearing a T allele presented significantly higher protein levels in plasma. The –257T variant is located within a NF-κB binding site, suggesting that this variant might have effect on the ability of the CFH gene to respond to signals via the NF-κB pathway. The G257A allelic variant showed significant protection against severe dengue. When CFH haplotypes effect was considered, the ancestral CG/CG promoter-exon 2 SNP genotype showed significant risk to SD either in a general comparison (ancestral × all variant genotypes), as well as in individual genotypes comparison (ancestral × each variant genotype), where the most prevalent effect was observed in the CG/CG × CA/TG comparison. These findings support the involvement of –257T, 257A allele variants and haplotypes on severe dengue phenotype protection, related with high basal CFH expression. PMID:23747994

DNA Methylation Pyrosequencing Assay Is Applicable for the Assessment of Epigenetic Active Environmental or Clinical Relevant Chemicals

PubMed Central

Florea, Ana-Maria

2013-01-01

Exposure of cells and organisms to stressors might result in epigenetic changes. Here it is shown that investigation of DNA methylation using pyrosequencing is an alternative for in vitro and in vivo toxicological testing of epigenetic effects induced by chemicals and drugs. An in vitro evaluation of global and CpG site specific DNA methylation upon treatment of cells with chemicals/drugs is shown. Bisulfite genomic sequencing of methylation controls showed high methylation of LINE1 in methylation positive control and low methylation in the negative controls. The CpG sites within the LINE1 element are methylated at different levels. In vitro cell cultures show a methylation level ranging from 56% to 49%. Cultures of drug resistant tumor cells show significant hypomethylation as compared with the originating nonresistant tumor cells. The in vitro testing of epigenetically active chemicals (5-methyl-2'-deoxycytidine and trichostatin A) revealed a significant change of LINE1 methylation status upon treatment, while specific CpG sites were more prone to demethylation than others (focal methylation). In conclusion, DNA methylation using pyrosequencing might be used not only for testing epigenetic toxins/drugs but also in risk assessment of drugs, food, and environmental relevant pollutants. PMID:24093099

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

PubMed Central

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

PubMed

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

D1S80 (pMCT118) allele frequencies in a Malay population sample from Malaysia.

PubMed

Koh, C L; Lim, M E; Ng, H S; Sam, C K

1997-01-01

The D1S80 allele frequencies in 124 unrelated Malays from the Malaysian population were determined and 51 genotypes and 19 alleles were encountered. The D1S80 frequency distribution met Hardy-Weinberg expectations. The observed heterozygosity was 0.80 and the power of discrimination was 0.96.

Complexity of the 5' Untranslated Region of EIF4A3, a Critical Factor for Craniofacial and Neural Development.

PubMed

Hsia, Gabriella S P; Musso, Camila M; Alvizi, Lucas; Brito, Luciano A; Kobayashi, Gerson S; Pavanello, Rita C M; Zatz, Mayana; Gardham, Alice; Wakeling, Emma; Zechi-Ceide, Roseli M; Bertola, Debora; Passos-Bueno, Maria Rita

2018-01-01

Repeats in coding and non-coding regions have increasingly been associated with many human genetic disorders, such as Richieri-Costa-Pereira syndrome (RCPS). RCPS, mostly characterized by midline cleft mandible, Robin sequence and limb defects, is an autosomal-recessive acrofacial dysostosis mainly reported in Brazilian patients. This disorder is caused by decreased levels of EIF4A3 , mostly due to an increased number of repeats at the EIF4A3 5'UTR. EIF4A3 5'UTR alleles are CG-rich and vary in size and organization of three types of motifs. An exclusive allelic pattern was identified among affected individuals, in which the CGCA-motif is the most prevalent, herein referred as "disease-associated CGCA-20nt motif." The origin of the pathogenic alleles containing the disease-associated motif, as well as the functional effects of the 5'UTR motifs on EIF4A3 expression, to date, are entirely unknown. Here, we characterized 43 different EIF4A3 5'UTR alleles in a cohort of 380 unaffected individuals. We identified eight heterozygous unaffected individuals harboring the disease-associated CGCA-20nt motif and our haplotype analyses indicate that there are more than one haplotype associated with RCPS. The combined analysis of number, motif organization and haplotypic diversity, as well as the observation of two apparently distinct haplotypes associated with the disease-associated CGCA-20nt motif, suggest that the RCPS alleles might have arisen from independent unequal crossing-over events between ancient alleles at least twice. Moreover, we have shown that the number and sequence of motifs in the 5'UTR region is associated with EIF4A3 repression, which is not mediated by CpG methylation. In conclusion, this study has shown that the large number of repeats in EIF4A3 does not represent a dynamic mutation and RCPS can arise in any population harboring alleles with the CGCA-20nt motif. We also provided further evidence that EIF4A3 5'UTR is a regulatory region and the size and sequence type of the repeats at 5'UTR may contribute to clinical variability in RCPS.

iASeq: integrative analysis of allele-specificity of protein-DNA interactions in multiple ChIP-seq datasets

PubMed Central

2012-01-01

Background ChIP-seq provides new opportunities to study allele-specific protein-DNA binding (ASB). However, detecting allelic imbalance from a single ChIP-seq dataset often has low statistical power since only sequence reads mapped to heterozygote SNPs are informative for discriminating two alleles. Results We develop a new method iASeq to address this issue by jointly analyzing multiple ChIP-seq datasets. iASeq uses a Bayesian hierarchical mixture model to learn correlation patterns of allele-specificity among multiple proteins. Using the discovered correlation patterns, the model allows one to borrow information across datasets to improve detection of allelic imbalance. Application of iASeq to 77 ChIP-seq samples from 40 ENCODE datasets and 1 genomic DNA sample in GM12878 cells reveals that allele-specificity of multiple proteins are highly correlated, and demonstrates the ability of iASeq to improve allelic inference compared to analyzing each individual dataset separately. Conclusions iASeq illustrates the value of integrating multiple datasets in the allele-specificity inference and offers a new tool to better analyze ASB. PMID:23194258

Allelic Variants of Complement Genes Associated with Dense Deposit Disease

PubMed Central

Abrera-Abeleda, Maria Asuncion; Nishimura, Carla; Frees, Kathy; Jones, Michael; Maga, Tara; Katz, Louis M.; Zhang, Yuzhou

2011-01-01

The alternative pathway of the complement cascade plays a role in the pathogenesis of dense deposit disease (DDD). Deficiency of complement factor H and mutations in CFH associate with the development of DDD, but it is unknown whether allelic variants in other complement genes also associate with this disease. We studied patients with DDD and identified previously unreported sequence alterations in several genes in addition to allelic variants and haplotypes common to patients with DDD. We found that the likelihood of developing DDD increases with the presence of two or more risk alleles in CFH and C3. To determine the functional consequence of this finding, we measured the activity of the alternative pathway in serum samples from phenotypically normal controls genotyped for variants in CFH and C3. Alternative pathway activity was higher in the presence of variants associated with DDD. Taken together, these data confirm that DDD is a complex genetic disease and may provide targets for the development of disease-specific therapies. PMID:21784901

Evidence that the APOE locus influences rate of disease progression in late onset familial Alzheimer`s disease but is not causative

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bennett, C.; Crawford, F.; Osborne, A.

1995-02-27

An association has been observed in several independent data sets between late onset Alzheimer`s Disease (AD) and the APOE locus on chromosome 19. We have examined the genotype in family history positive (FHP) and family history negative (FHN) cases and find a distortion of the APOE allele frequencies in accord with previous studies. However, when we examined the allele distribution of the at-risk siblings of the FHP group we found an excess of the {epsilon}4 allele which also differs significantly from historic controls but not from the affected siblings. The age distribution of the affected and unaffected siblings was similar,more » suggesting that the allelic frequency distortion in the unaffected siblings was not due to their being below the mean age of onset. Lod score linkage analysis, with age dependent onset and non-stringent specification of the genetic parameters, did not suggest linkage to the APOE locus. Furthermore, an analysis of variance of the age of disease free survival suggested that APOE genotype contributes a small fraction of the total variance indicating that the APOE locus is a poor predictor of disease free survival age within late onset families. One explanation for the age dependent association reported by other groups, and our results, is that the APOE locus enhances the rate of progression of the disease process in otherwise predisposed individuals and that variation at this locus is not able in and of itself to cause the disease. We suggest this hypothesis is compatible with the current literature regarding APOE and AD. 19 refs., 1 fig., 2 tabs.« less

Allelic diversity in an NLR gene BPH9 enables rice to combat planthopper variation.

PubMed

Zhao, Yan; Huang, Jin; Wang, Zhizheng; Jing, Shengli; Wang, Yang; Ouyang, Yidan; Cai, Baodong; Xin, Xiu-Fang; Liu, Xin; Zhang, Chunxiao; Pan, Yufang; Ma, Rui; Li, Qiaofeng; Jiang, Weihua; Zeng, Ya; Shangguan, Xinxin; Wang, Huiying; Du, Bo; Zhu, Lili; Xu, Xun; Feng, Yu-Qi; He, Sheng Yang; Chen, Rongzhi; Zhang, Qifa; He, Guangcun

2016-10-24

Brown planthopper (BPH), Nilaparvata lugens Stål, is one of the most devastating insect pests of rice (Oryza sativa L.). Currently, 30 BPH-resistance genes have been genetically defined, most of which are clustered on specific chromosome regions. Here, we describe molecular cloning and characterization of a BPH-resistance gene, BPH9, mapped on the long arm of rice chromosome 12 (12L). BPH9 encodes a rare type of nucleotide-binding and leucine-rich repeat (NLR)-containing protein that localizes to the endomembrane system and causes a cell death phenotype. BPH9 activates salicylic acid- and jasmonic acid-signaling pathways in rice plants and confers both antixenosis and antibiosis to BPH. We further demonstrated that the eight BPH-resistance genes that are clustered on chromosome 12L, including the widely used BPH1, are allelic with each other. To honor the priority in the literature, we thus designated this locus as BPH1/9 These eight genes can be classified into four allelotypes, BPH1/9-1, -2, -7, and -9 These allelotypes confer varying levels of resistance to different biotypes of BPH. The coding region of BPH1/9 shows a high level of diversity in rice germplasm. Homologous fragments of the nucleotide-binding (NB) and leucine-rich repeat (LRR) domains exist, which might have served as a repository for generating allele diversity. Our findings reveal a rice plant strategy for modifying the genetic information to gain the upper hand in the struggle against insect herbivores. Further exploration of natural allelic variation and artificial shuffling within this gene may allow breeding to be tailored to control emerging biotypes of BPH.

Distinct features between MLH1-methylated and unmethylated colorectal carcinomas with the CpG island methylator phenotype: implications in the serrated neoplasia pathway

PubMed Central

Cho, Nam-Yun; Kang, Gyeong Hoon

2016-01-01

The presence or absence of MLH1 methylation may critically affect the heterogeneity of colorectal carcinoma (CRC) with the CpG island methylator phenotype (CIMP). Here, we investigated the differential characteristics of CIMP-high (CIMP-H) CRCs according to MLH1 methylation status. To further confirm the MLH1-dependent features in CIMP-H CRC, an independent analysis was performed using data from The Cancer Genome Atlas (TCGA). In our CIMP-H CRC samples, MLH1-methylated tumors were characterized by older patient age, proximal colonic location, mucinous histology, intense lymphoid reactions, RUNX3/SOCS1 promoter methylation, BRAF mutations, and microsatellite instability-high (MSI-H) status. By contrast, MLH1-unmethylated tumors were associated with earlier age of onset, increased distal colorectal localization, adverse pathologic features, and KRAS mutations. In the TCGA dataset, the MLH1-silenced CIMP-H CRC demonstrated proximal location, MSI-H status, hypermutated phenotype, and frequent BRAF mutations, but the MLH1-non-silenced CIMP-H CRC was significantly associated with high frequencies of KRAS and APC mutations. In conclusion, the differential nature of CIMP-H CRCs depends primarily on the MLH1 methylation status. Based on the current knowledge, the sessile serrated adenoma/polyp may be the major precursor of MLH1-methylated CIMP-H CRCs, whereas MLH1-unmethylated CIMP-H CRCs may develop predominantly from KRAS-mutated traditional serrated adenomas and less commonly from BRAF-mutated traditional serrated adenomas and/or sessile serrated adenomas/polyps. PMID:26883113

Distinct features between MLH1-methylated and unmethylated colorectal carcinomas with the CpG island methylator phenotype: implications in the serrated neoplasia pathway.

PubMed

Kim, Jung Ho; Bae, Jeong Mo; Cho, Nam-Yun; Kang, Gyeong Hoon

2016-03-22

The presence or absence of MLH1 methylation may critically affect the heterogeneity of colorectal carcinoma (CRC) with the CpG island methylator phenotype (CIMP). Here, we investigated the differential characteristics of CIMP-high (CIMP-H) CRCs according to MLH1 methylation status. To further confirm the MLH1-dependent features in CIMP-H CRC, an independent analysis was performed using data from The Cancer Genome Atlas (TCGA). In our CIMP-H CRC samples, MLH1-methylated tumors were characterized by older patient age, proximal colonic location, mucinous histology, intense lymphoid reactions, RUNX3/SOCS1 promoter methylation, BRAF mutations, and microsatellite instability-high (MSI-H) status. By contrast, MLH1-unmethylated tumors were associated with earlier age of onset, increased distal colorectal localization, adverse pathologic features, and KRAS mutations. In the TCGA dataset, the MLH1-silenced CIMP-H CRC demonstrated proximal location, MSI-H status, hypermutated phenotype, and frequent BRAF mutations, but the MLH1-non-silenced CIMP-H CRC was significantly associated with high frequencies of KRAS and APC mutations. In conclusion, the differential nature of CIMP-H CRCs depends primarily on the MLH1 methylation status. Based on the current knowledge, the sessile serrated adenoma/polyp may be the major precursor of MLH1-methylated CIMP-H CRCs, whereas MLH1-unmethylated CIMP-H CRCs may develop predominantly from KRAS-mutated traditional serrated adenomas and less commonly from BRAF-mutated traditional serrated adenomas and/or sessile serrated adenomas/polyps.

Neuromodulation intrinsic to the central pattern generator for escape swimming in Tritonia.

PubMed

Katz, P S

1998-11-16

Extrinsic neuromodulatory inputs to central pattern generators (CPGs) can alter the properties and synaptic interactions of neurons in those circuits and thereby modify the output of the CPG. Recent work in a number of systems has now demonstrated that neurons intrinsic to CPG can also evoke neuromodulatory actions on other members of the CPG. Such "intrinsic neuromodulation" plays a role in controlling the CPG underlying the escape swim response of the nudibrach mollusc, Tritonia diomedea. The dorsal swim interneurons (DSIs) are a bilaterally represented set of three serotonergic neurons that participate in the generation of the rhythmic swim motor program. Serotonin released from these CPG neurons functions both as a fast neurotransmitter and as a slower neuromodulator. In its modulatory role, serotonin enhances the release of neurotransmitter from another CPG neuron, C2, and also increases C2 excitability by decreasing spike frequency adaptation. These neuromodulatory actions intrinsic to the CPG may be important for the initial self-configuration of the system into a function CPG and for experience-dependent changes in the output such as behavioral sensitization and habituation.

Epistasis between polymorphisms in PCSK1 and DBH is associated with premature ovarian failure.

PubMed

Pyun, Jung-A; Kim, Sunshin; Cha, Dong Hyun; Kwack, KyuBum

2014-11-01

This study examined whether epistasis between single nucleotide polymorphisms (SNPs) within proprotein convertase subtilisin/kexin type 1 (PCSK1) and dopamine β-hydroxylase (DBH) genes is associated with premature ovarian failure (POF). One hundred twenty women with POF and 222 female controls were recruited for this study. To genotype SNPs within PCSK1 and DBH, we used a GoldenGate assay with VeraCode technology, which uses an allele-specific primer extension method. Two SNPs (rs155979 and rs3762986) within PCSK1 and one SNP (rs1611114) within DBH, which were located in the 5' flanking region, were involved in synergistic interactions. The C allele in the rs155979 SNP showed an increased risk of POF in a dominant model when AA genotype in the rs1611114 SNP was present (odds ratio, 3.60; 95% CI, 1.82-7.14; P = 0.00024), whereas the G allele in the rs1611114 SNP showed a reduced risk of POF in a dominant model when at least one C allele at the rs155979 SNP was present (odds ratio, 0.24; 95% CI, 0.11-0.51; P = 0.00018) or one G allele at the rs3762986 SNP was present (odds ratio, 0.33; 95% CI, 0.19-0.60; P = 0.00023). Epistases between SNPs within PCSK1 and DBH genes are significantly associated with susceptibility or resistance to POF.

Analysis of meiotic segregation, using single-sperm typing: Meiotic drive at the myotonic dystrophy locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leeflang, E.P.; Arnheim, N.; McPeek, M.S.

Meiotic drive at the myotonic dystrophy (DM) locus has recently been suggested as being responsible for maintaining the frequency, in the human population, of DM chromosomes capable of expansion to the disease state. In order to test this hypothesis, we have studied samples of single sperm from three individuals heterozygous at the DM locus, each with one allele larger and one allele smaller than 19 CTG repeats. To guard against the possible problem of differential PCR amplification rates based on the lengths of the alleles, the sperm were also typed at another closely linked marker whose allele size was unrelatedmore » to the allele size at the DM locus. Using statistical models specifically designed to study single-sperm segregation data, we find no evidence of meiotic segregation distortion. The upper limit of the two-sided 95% confidence interval for the estimate of the common segregation probability for the three donors is at or below .515 for all models considered, and no statistically significant difference from .5 is detected in any of the models. This suggests that any greater amount of segregation distortion at the myotonic dystrophy locus must result from events following sperm ejaculation. The mathematical models developed make it possible to study segregation distortion with high resolution by using sperm-typing data from any locus. 26 refs., 1 fig., 8 tabs.« less

H2-M polymorphism in mice susceptible to collagen-induced arthritis involves the peptide binding groove

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walter, W.; Loos, M.; Maeurer, M.J.

1996-12-31

The ability to develop type II collagen (CII)-induced arthritis (CIA) in mice is associated with the major histocompatibility I-A gene and with as yet poorly defined regulatory molecules of the major histocompatibility complex (MHC) class II antigen processing and presentation pathway. H2-M molecules are thought to be involved in the loading of antigenic peptides into the MHC class II binding cleft. We sequenced H2-Ma, H2-Mb1, and H2-Mb2 genes from CIA-susceptible and -resistant mouse strains and identified four different Ma and Mb2 alleles, and three different Mb1 alleles defined by polymorphic residues within the predicted peptide binding groove. Most CIA-resistant mousemore » strains share common Ma, Mb1, and Mb2 alleles. In contrast, H2-M alleles designated Ma-III, Ma-IV, Mb1-III, and Mb2-IV could be exclusively identified in the CIA-susceptible H2{sup r} and H2{sup q} haplotypes, suggesting that allelic H2-M molecules may modulate the composition of different CII peptides loaded onto MHC class II molecules, presumably presenting {open_quotes}arthritogenic{close_quotes} epitopes to T lymphocytes. 42 refs., 4 figs., 3 tabs.« less

Targeted-bisulfite sequence analysis of the methylation of CpG islands in genes encoding PNPLA3, SAMM50, and PARVB of patients with non-alcoholic fatty liver disease.

PubMed

Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko

2015-08-01

The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Prenatal antidepressant exposure associated with CYP2E1 DNA methylation change in neonates

PubMed Central

Gurnot, Cécile; Martin-Subero, Ignacio; Mah, Sarah M; Weikum, Whitney; Goodman, Sarah J; Brain, Ursula; Werker, Janet F; Kobor, Michael S; Esteller, Manel; Oberlander, Tim F; Hensch, Takao K

2015-01-01

Some but not all neonates are affected by prenatal exposure to serotonin reuptake inhibitor antidepressants (SRI) and maternal mood disturbances. Distinguishing the impact of these 2 exposures is challenging and raises critical questions about whether pharmacological, genetic, or epigenetic factors can explain the spectrum of reported outcomes. Using unbiased DNA methylation array measurements followed by a detailed candidate gene approach, we examined whether prenatal SRI exposure was associated with neonatal DNA methylation changes and whether such changes were associated with differences in birth outcomes. Prenatal SRI exposure was first associated with increased DNA methylation status primarily at CYP2E1(βNon-exposed = 0.06, βSRI-exposed = 0.30, FDR = 0); however, this finding could not be distinguished from the potential impact of prenatal maternal depressed mood. Then, using pyrosequencing of CYP2E1 regulatory regions in an expanded cohort, higher DNA methylation status—both the mean across 16 CpG sites (P < 0.01) and at each specific CpG site (P < 0.05)—was associated with exposure to lower 3rd trimester maternal depressed mood symptoms only in the SRI-exposed neonates, indicating a maternal mood x SRI exposure interaction. In addition, higher DNA methylation levels at CpG2 (P = 0.04), CpG9 (P = 0.04) and CpG10 (P = 0.02), in the interrogated CYP2E1 region, were associated with increased birth weight independently of prenatal maternal mood, SRI drug exposure, or gestational age at birth. Prenatal SRI antidepressant exposure and maternal depressed mood were associated with altered neonatal CYP2E1 DNA methylation status, which, in turn, appeared to be associated with birth weight. PMID:25891251

Genome-wide methylation analysis identifies differentially methylated CpG loci associated with severe obesity in childhood.

PubMed

Huang, R C; Garratt, E S; Pan, H; Wu, Y; Davis, E A; Barton, S J; Burdge, G C; Godfrey, K M; Holbrook, J D; Lillycrop, K A

2015-01-01

Childhood obesity is a major public health issue. Here we investigated whether differential DNA methylation was associated with childhood obesity. We studied DNA methylation profiles in whole blood from 78 obese children (mean BMI Z-score: 2.6) and 71 age- and sex-matched controls (mean BMI Z-score: 0.1). DNA samples from obese and control groups were pooled and analyzed using the Infinium HumanMethylation450 BeadChip array. Comparison of the methylation profiles between obese and control subjects revealed 129 differentially methylated CpG (DMCpG) loci associated with 80 unique genes that had a greater than 10% difference in methylation (P-value < 0.05). The top pathways enriched among the DMCpGs included developmental processes, immune system regulation, regulation of cell signaling, and small GTPase-mediated signal transduction. The associations between the methylation of selected DMCpGs with childhood obesity were validated using sodium bisulfite pyrosequencing across loci within the FYN, PIWIL4, and TAOK3 genes in individual subjects. Three CpG loci within FYN were hypermethylated in obese individuals (all P < 0.01), while obesity was associated with lower methylation of CpG loci within PIWIL4 (P = 0.003) and TAOK3 (P = 0.001). After building logistic regression models, we determined that a 1% increase in methylation in TAOK3, multiplicatively decreased the odds of being obese by 0.91 (95% CI: 0.86 - 0.97), and an increase of 1% methylation in FYN CpG3, multiplicatively increased the odds of being obese by 1.03 (95% CI: 0.99 - 1.07). In conclusion, these findings provide evidence that childhood obesity is associated with specific DNA methylation changes in whole blood, which may have utility as biomarkers of obesity risk.

Adherence to Clinical Practice Guidelines (CPG) management of dengue infection in adults (revised 2nd edition)

PubMed Central

Suli, Zailiza; Singh Gill, Balvinder; Rudra Deva, Shanti; Abdullah Sani, Ana Fizalinda; Romli, Erni Zurina; Mohamed Ghazali, Izzuna Mudla; Mohd. Yusof, Mohd. Aminuddin; Ahmad Lutfi, Nafisah; Shuib, Shahril Effendi; Mohd Darus, Noormah; Bakri, Rugayah

2017-01-01

The Malaysian Dengue Clinical Practice Guidelines (CPG) have been developed to provide evidence-based guidance in the management of dengue infections. The use of these guidelines is essential to ensure its recommendations are being practiced. However, the adherence to the guidelines for management of dengue (revised 2nd edition) by healthcare providers still remains unknown. Therefore, the aim of this study was to evaluate the proportion among healthcare providers that adhere to this Dengue CPG. A retrospective cohort study of dengue cases registered from 1 January 2014 to 1 June 2015 was conducted in public hospitals and health clinics in Selangor, Putrajaya and Kuala Lumpur. Adherence to the CPG recommendations were recorded by reviewing patients’ case notes. Overall proportion of adherence in clinical components of the recommendation were (7.1 to 100.0% versus 7.7 to 73.8%) in history taking, (6.7 to 100.0% versus 12.3 to 60.0%) in physical examinations, (18.4 to 100.0% versus 23.1 to 83.2%) in assessment of warning signs, (0.6 to 100.0% versus 12.3 to 87.7%) in assessment of haemodynamic status, (60.0 to 100.0% versus 27.7 to 40.0%) in diagnosis, (46.6 to 80.0% versus 52.3%) in case notifications, (73.2 to 100.0% versus 89.2 to 96.9%) in performing specific laboratory investigations and (7.9 to 100.0% versus 21.5%) in monitoring, for outpatient versus inpatient, respectively. Adherence trends were demonstrated to be higher in hospital settings compared to outpatient settings. Adherence to this Dengue CPG varies widely with overall good clinical outcomes observed. PMID:29095822

Allele-Specific Polymerase Chain Reaction for the Imatinib-Resistant KIT D816V and D816F Mutations in Mastocytosis and Acute Myelogenous Leukemia

PubMed Central

Corless, Christopher L.; Harrell, Patina; Lacouture, Mario; Bainbridge, Troy; Le, Claudia; Gatter, Ken; White, Clifton; Granter, Scott; Heinrich, Michael C.

2006-01-01

Oncogenic mutations of the receptor tyrosine kinase KIT contribute to the pathogenesis of gastrointestinal stromal tumors, systemic mastocytosis (SM), and some cases of acute myelogenous leukemia (AML). The D816V substitution in the activation loop of KIT results in relative resistance to the kinase inhibitor imatinib (Gleevec). Because this mutation occurs in 80 to 95% of adult SM, its detection has diagnostic and predictive significance. Unfortunately, the fraction of mutation-positive cells in clinical SM samples is often below the 20 to 30% threshold needed for detection by direct DNA sequencing. We have developed an allele-specific polymerase chain reaction assay using a mutation-specific primer combined with a wild-type blocking oligonucleotide that amplifies D816V at the level of 1% mutant allele in DNA extracted from formalin-fixed, paraffin-embedded tissue. There were no amplifications among 64 KIT wild-type tumors and cell lines, whereas all D816V-mutant samples (eight AML and 11 mast cell disease) were positive. Other D816 substitutions associated with resistance to imatinib in vitro are rare in SM. Among these D816F was detectable with the assay whereas D816H, D816Y, and D816G did not amplify. Nine biopsies (bone marrow, skin, or colon) with suspected SM were negative by denaturing high performance liquid chromatography and/or DNA sequencing but positive by allele-specific polymerase chain reaction. Thus, the assay may be useful in confirming the diagnosis of SM. PMID:17065430

Hypermethylation of the Human Glutathione S-Transferase-π Gene (GSTP1) CpG Island Is Present in a Subset of Proliferative Inflammatory Atrophy Lesions but Not in Normal or Hyperplastic Epithelium of the Prostate

PubMed Central

Nakayama, Masashi; Bennett, Christina J.; Hicks, Jessica L.; Epstein, Jonathan I.; Platz, Elizabeth A.; Nelson, William G.; De Marzo, Angelo M.

2003-01-01

Somatic inactivation of the glutathione S-transferase-π gene (GSTP1) via CpG island hypermethylation occurs early during prostate carcinogenesis, present in ∼70% of high-grade prostatic intraepithelial neoplasia (high-grade PIN) lesions and more than 90% of adenocarcinomas. Recently, there has been a resurgence of the concept that foci of prostatic atrophy (referred to as proliferative inflammatory atrophy or PIA) may be precursor lesions for the development of prostate cancer and/or high-grade PIN. Many of the cells within PIA lesions contain elevated levels of GSTP1, glutathione S-transferase-α (GSTA1), and cyclooxygenase-II proteins, suggesting a stress response. Because not all PIA cells are positive for GSTP1 protein, we hypothesized that some of the cells within these regions acquire GSTP1 CpG island hypermethylation, increasing the chance of progression to high-grade PIN and/or adenocarcinoma. Separate regions (n =199) from 27 formalin-fixed paraffin-embedded prostates were microdissected by laser-capture microdissection (Arcturus PixCell II). These regions included normal epithelium (n = 48), hyperplasticepithelium from benign prostatic hyperplasia nodules (n = 22), PIA (n = 64), high-grade PIN (n = 32), and adenocarcinoma (n = 33). Genomic DNA was isolated and assessed for GSTP1 CpG island hypermethylation by methylation-specific polymerase chain reaction. GSTP1 CpG island hypermethylation was not detected in normal epithelium (0 of 48) or in hyperplastic epithelium (0 of 22), but was found in 4 of 64 (6.3%) PIA lesions. The difference in the frequency of GSTP1 CpG island hypermethylation between normal or hyperplastic epithelium and PIA was statistically significant (P = 0.049). Similar to studies using nonmicrodissected cases, hypermethylation was found in 22 of 32 (68.8%) high-grade PIN lesions and in 30 of 33 (90.9%) adenocarcinoma lesions. Unlike normal or hyperplastic epithelium, GSTP1 CpG island hypermethylation can be detected in some PIA lesions. These data support the hypothesis that atrophic epithelium in a subset of PIA lesions may lead to high-grade PIN and/or adenocarcinoma. Because these atrophic lesions are so prevalent and extensive, even though only a small subset contains this somatic DNA alteration, the clinical impact may be substantial. PMID:12937133

Efficient disruption of Zebrafish genes using a Gal4-containing gene trap

PubMed Central

2013-01-01

Background External development and optical transparency of embryos make zebrafish exceptionally suitable for in vivo insertional mutagenesis using fluorescent proteins to visualize expression patterns of mutated genes. Recently developed Gene Breaking Transposon (GBT) vectors greatly improve the fidelity and mutagenicity of transposon-based gene trap vectors. Results We constructed and tested a bipartite GBT vector with Gal4-VP16 as the primary gene trap reporter. Our vector also contains a UAS:eGFP cassette for direct detection of gene trap events by fluorescence. To confirm gene trap events, we generated a UAS:mRFP tester line. We screened 270 potential founders and established 41 gene trap lines. Three of our gene trap alleles display homozygous lethal phenotypes ranging from embryonic to late larval: nsf tpl6, atp1a3atpl10 and flrtpl19. Our gene trap cassette is flanked by direct loxP sites, which enabled us to successfully revert nsf tpl6, atp1a3atpl10 and flrtpl19 gene trap alleles by injection of Cre mRNA. The UAS:eGFP cassette is flanked by direct FRT sites. It can be readily removed by injection of Flp mRNA for use of our gene trap alleles with other tissue-specific GFP-marked lines. The Gal4-VP16 component of our vector provides two important advantages over other GBT vectors. The first is increased sensitivity, which enabled us to detect previously unnoticed expression of nsf in the pancreas. The second advantage is that all our gene trap lines, including integrations into non-essential genes, can be used as highly specific Gal4 drivers for expression of other transgenes under the control of Gal4 UAS. Conclusions The Gal4-containing bipartite Gene Breaking Transposon vector presented here retains high specificity for integrations into genes, high mutagenicity and revertibility by Cre. These features, together with utility as highly specific Gal4 drivers, make gene trap mutants presented here especially useful to the research community. PMID:24034702

Association of H2A{sup b} with resistance to collagen-induced arthritis in H2-recombinant mouse strains: An allele associated with reduction of several apparently unrelated responses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mitchison, N.A.; Brunner, M.C.

1995-02-01

HLA class II alleles can protect against immunological diseases. Seeking an animal model for a naturally occurring protective allele, we screened a panel of H2-congenic and recombinant mouse strains for ability to protect against collagen-induced arthritis. The strains were crossed with the susceptible strain DBA/1, and the F{sub 1} hybrids immunized with cattle and chicken type II collagen. Hybrids having the H2A{sup b} allele displayed a reduced incidence and duration of the disease. They also had a reduced level of pre-disease inflammation, but not of anti-collagen antibodies. The allele is already known to be associated with reduction of other apparentlymore » unrelated immune responses, suggesting that some form of functional differentiation may operate that is not exclusively related to epitope-binding. It is suggested that this may reflect allelic variation in the class II major histocompatibility complex promoter region. 42 refs., 7 figs., 1 tab.« less

Neural networks underlying trait aggression depend on MAOA gene alleles.

PubMed

Klasen, Martin; Wolf, Dhana; Eisner, Patrick D; Habel, Ute; Repple, Jonathan; Vernaleken, Ingo; Schlüter, Thorben; Eggermann, Thomas; Zerres, Klaus; Zepf, Florian D; Mathiak, Klaus

2018-03-01

Low expressing alleles of the MAOA gene (MAOA-L) have been associated with an increased risk for developing an aggressive personality. This suggests an MAOA-L-specific neurobiological vulnerability associated with trait aggression. The neural networks underlying this vulnerability are unknown. The present study investigated genotype-specific associations between resting state brain networks and trait aggression (Buss-Perry Aggression Questionnaire) in 82 healthy Caucasian males. Genotype influences on aggression-related networks were studied for intrinsic and seed-based brain connectivity. Intrinsic connectivity was higher in the ventromedial prefrontal cortex (VMPFC) of MAOA-L compared to high expressing allele (MAOA-H) carriers. Seed-based connectivity analyses revealed genotype differences in the functional involvement of this region. MAOA genotype modulated the relationship between trait aggression and VMPFC connectivity with supramarginal gyrus (SMG) and areas of the default mode network (DMN). Separate analyses for the two groups were performed to better understand how the genotype modulated the relationship between aggression and brain networks. They revealed a positive correlation between VMPFC connectivity and aggression in right angular gyrus (AG) and a negative correlation in right SMG in the MAOA-L group. No such effect emerged in the MAOA-H carriers. The results indicate a particular relevance of VMPFC for aggression in MAOA-L carriers; in specific, a detachment from the DMN along with a strengthened coupling to the AG seems to go along with lower trait aggression. MAOA-L carriers may thus depend on a synchronization of emotion regulation systems (VMPFC) with core areas of empathy (SMG) to prevent aggression.

Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

PubMed Central

Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

1999-01-01

We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

Common structural and epigenetic changes in the genome of castration-resistant prostate cancer.

PubMed

Friedlander, Terence W; Roy, Ritu; Tomlins, Scott A; Ngo, Vy T; Kobayashi, Yasuko; Azameera, Aruna; Rubin, Mark A; Pienta, Kenneth J; Chinnaiyan, Arul; Ittmann, Michael M; Ryan, Charles J; Paris, Pamela L

2012-02-01

Progression of primary prostate cancer to castration-resistant prostate cancer (CRPC) is associated with numerous genetic and epigenetic alterations that are thought to promote survival at metastatic sites. In this study, we investigated gene copy number and CpG methylation status in CRPC to gain insight into specific pathophysiologic pathways that are active in this advanced form of prostate cancer. Our analysis defined and validated 495 genes exhibiting significant differences in CRPC in gene copy number, including gains in androgen receptor (AR) and losses of PTEN and retinoblastoma 1 (RB1). Significant copy number differences existed between tumors with or without AR gene amplification, including a common loss of AR repressors in AR-unamplified tumors. Simultaneous gene methylation and allelic deletion occurred frequently in RB1 and HSD17B2, the latter of which is involved in testosterone metabolism. Lastly, genomic DNA from most CRPC was hypermethylated compared with benign prostate tissue. Our findings establish a comprehensive methylation signature that couples epigenomic and structural analyses, thereby offering insights into the genomic alterations in CRPC that are associated with a circumvention of hormonal therapy. Genes identified in this integrated genomic study point to new drug targets in CRPC, an incurable disease state which remains the chief therapeutic challenge. ©2012 AACR.

Sex differences in DNA methylation and expression in zebrafish brain: a test of an extended 'male sex drive' hypothesis.

PubMed

Chatterjee, Aniruddha; Lagisz, Malgorzata; Rodger, Euan J; Zhen, Li; Stockwell, Peter A; Duncan, Elizabeth J; Horsfield, Julia A; Jeyakani, Justin; Mathavan, Sinnakaruppan; Ozaki, Yuichi; Nakagawa, Shinichi

2016-09-30

The sex drive hypothesis predicts that stronger selection on male traits has resulted in masculinization of the genome. Here we test whether such masculinizing effects can be detected at the level of the transcriptome and methylome in the adult zebrafish brain. Although methylation is globally similar, we identified 914 specific differentially methylated CpGs (DMCs) between males and females (435 were hypermethylated and 479 were hypomethylated in males compared to females). These DMCs were prevalent in gene body, intergenic regions and CpG island shores. We also discovered 15 distinct CpG clusters with striking sex-specific DNA methylation differences. In contrast, at transcriptome level, more female-biased genes than male-biased genes were expressed, giving little support for the male sex drive hypothesis. Our study provides genome-wide methylome and transcriptome assessment and sheds light on sex-specific epigenetic patterns and in zebrafish for the first time. Copyright © 2016 Elsevier B.V. All rights reserved.

A hypoxia- and {alpha}-fetoprotein-dependent oncolytic adenovirus exhibits specific killing of hepatocellular carcinomas.

PubMed

Kwon, Oh-Joon; Kim, Pyung-Hwan; Huyn, Steven; Wu, Lily; Kim, Minjung; Yun, Chae-Ok

2010-12-15

Oncolytic adenoviruses (Ad) constitute a new promising modality of cancer gene therapy that displays improved efficacy over nonreplicating Ads. We have previously shown that an E1B 19-kDa-deleted oncolytic Ad exhibits a strong cell-killing effect but lacks tumor selectivity. To achieve hepatoma-restricted cytotoxicity and enhance replication of Ad within the context of tumor microenvironment, we used a modified human α-fetoprotein (hAFP) promoter to control the replication of Ad with a hypoxia response element (HRE). We constructed Ad-HRE(6)/hAFPΔ19 and Ad-HRE(12)/hAFPΔ19 that incorporated either 6 or 12 copies of HRE upstream of promoter. The promoter activity and specificity to hepatoma were examined by luciferase assay and fluorescence-activated cell sorting analysis. In addition, the AFP expression- and hypoxia-dependent in vitro cytotoxicity of Ad-HRE(6)/hAFPΔ19 and Ad-HRE(12)/hAFPΔ19 was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and cytopathic effect assay. In vivo tumoricidal activity on subcutaneous and liver orthotopic model was monitored by noninvasive molecular imaging. Ad-HRE(12)/hAFPΔ19 exhibited enhanced tumor selectivity and cell-killing activity when compared with Ad-hAFPΔ19. The tumoricidal activity of Ad-HRE(12)/hAFPΔ19 resulted in significant inhibition of tumor growth in both subcutaneous and orthotopic models. Histologic examination of the primary tumor after treatment confirmed accumulation of viral particles near hypoxic areas. Furthermore, Ad-HRE(12)/hAFPΔ19 did not cause severe inflammatory immune response and toxicity after systemic injection. The results presented here show the advantages of incorporating HREs into a hAFP promoter-driven oncolytic virus. This system is unique in that it acts in both a tissue-specific and tumor environment-selective manner. The greatly enhanced selectivity and tumoricidal activity of Ad-HRE(12)/hAFPΔ19 make it a promising therapeutic agent in the treatment of liver cancers. ©2010 AACR.

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

PubMed Central

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

2016-01-01

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

PubMed

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

The apolipoprotein E/CI/CII gene cluster and late-onset Alzheimer disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Chang-En; Nemens, E.; Olson, J.M.

1994-04-01

The chromosome 19 apolipoprotein E/CI/CII gene cluster was examined for evidence of linkage to a familial Alzheimer disease (FAD) locus. The family groups studied were Volga German (VG), early-onset non-VG (ENVG; mean age at onset <60 years), and late-onset families. A genetic association was observed between apolipoprotein E (ApoE) allele E4 and FAD in late-onset families; the E4 allele frequency was .51 in affected subjects, .37 in at-risk subjects, .11 in spouses, and .19 in unrelated controls. The differences between the E4 frequencies in affected subjects versus controls and in at-risk subjects versus controls were highly significant. No association betweenmore » the E4 allele and FAD was observed in the ENVG or VG groups. A statistically significant allelic association between E4 and AD was also observed in a group of unrelated subjects; the E4 frequency was .26 in affected subjects, versus .19 in controls (Z[sub SND] = 2.20, P < .03). Evidence of linkage of ApoE and ApoCII to FAD was examined by maximum-likelihood methods, using three models and assuming autosomal dominant inheritance: (1) age-dependent penetrance, (2) extremely low (1%) penetrance, and (3) age-dependent penetrance corrected for sporadic Alzheimer disease (AD). For ApoCII in late-onset families, results for close linkage were negative, and only small positive lod-score-statistic (Z) values were obtained. For ApoE in late-onset kindreds, positive Z values were obtained when either allele frequencies from controls or allele frequencies from the families were used. When linkage disequilibrium was incorporated into the analysis, the Z values increased. For the ENVG group, results for ApoE and ApoCII were uniformly negative. Affected-pedigree-member analysis gave significant results for the late-onset kindreds, for ApoE, when control allele frequencies were used but not when allele frequencies were derived from the families. 58 refs., 6 tabs.« less

H3 K79 dimethylation marks developmental activation of the beta-globin gene but is reduced upon LCR-mediated high-level transcription.

PubMed

Sawado, Tomoyuki; Halow, Jessica; Im, Hogune; Ragoczy, Tobias; Bresnick, Emery H; Bender, M A; Groudine, Mark

2008-07-15

Genome-wide analyses of the relationship between H3 K79 dimethylation and transcription have revealed contradictory results. To clarify this relationship at a single locus, we analyzed expression and H3 K79 modification levels of wild-type (WT) and transcriptionally impaired beta-globin mutant genes during erythroid differentiation. Analysis of fractionated erythroid cells derived from WT/Delta locus control region (LCR) heterozygous mice reveals no significant H3 K79 dimethylation of the beta-globin gene on either allele prior to activation of transcription. Upon transcriptional activation, H3 K79 di-methylation is observed along both WT and DeltaLCR alleles, and both alleles are located in proximity to H3 K79 dimethylation nuclear foci. However, H3 K79 di-methylation is significantly increased along the DeltaLCR allele compared with the WT allele. In addition, analysis of a partial LCR deletion mutant reveals that H3 K79 dimethylation is inversely correlated with beta-globin gene expression levels. Thus, while our results support a link between H3 K79 dimethylation and gene expression, high levels of this mark are not essential for high level beta-globin gene transcription. We propose that H3 K79 dimethylation is destabilized on a highly transcribed template.