Evaluation of 16 SNPs allele-specific to quantify post hSCT chimerism by SYBR green-based qRT-PCR.

PubMed

Almeida, Carlos Arthur Cardoso; Dreyfuss, Juliana Luporini; Azevedo-Shimmoto, Marily Maria; Figueiredo, Maria Stela; de Oliveira, José Salvador Rodrigues

2013-03-01

The importance of monitoring post haematopoietic stem cell transplantation (hSCT) chimerism has been defined in numerous publications. Single-nucleotide polymorphisms (SNPs) are molecular markers that vary significantly among different populations. Allied to a very sensible technique, SNP assays seem to be very sensitive (0.001%) when post hSCT chimerism is measured. However, well known SNP frequencies are limited to certain populations, mainly in countries where there is a high level of diversity in its population, therefore restricting their use worldwide. Amplification by SYBR green based quantitative real time PCR of eight pairs of allele-specific SNPs (MLH-1, PECAM-1, ICAM-1, SUR-1, HA-1, rs715405, rs713503, rs2296600) was conducted in 88 patient/donor pairs, who underwent allogeneic myeloablative or non-myeloablative hSCT. One informative allele was detected in at least 42% (n=37) of the samples; 20% (n=18) had at least two informative alleles; 10% (n=9) had at least three informative alleles; 9% (n=8) had more than three informative alleles and 18% (n=16) showed no informative allele at all. Overall, the frequency of informative alleles for these SNPs in the Brazilian population was very low. Consequently, the amount of information attained reached 9% of those expected, being able to discriminate only eight pairs of donor/recipient samples with more than three informative alleles, making them useless for the quantification of chimerism in our routine.

Association of the CpG Methylation Pattern of the Proximal Insulin Gene Promoter with Type 1 Diabetes

PubMed Central

Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre

2012-01-01

The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146

Effect of alcohol consumption on CpG methylation in the differentially methylated regions of H19 and IG-DMR in male gametes: implications for fetal alcohol spectrum disorders.

PubMed

Ouko, Lillian A; Shantikumar, Katpaham; Knezovich, Jaysen; Haycock, Philip; Schnugh, Desmond J; Ramsay, Michèle

2009-09-01

Exposure to alcohol in utero is the main attributable cause of fetal alcohol spectrum disorders (FASD) which in its most severe form is characterized by irreversible behavioral and cognitive disability. Paternal preconception drinking is not considered to be a significant risk factor, even though animal studies have demonstrated that chronic paternal alcohol consumption has a detrimental effect on the physical and mental development of offspring even in the absence of in utero alcohol exposure. It has been documented that alcohol can reduce the levels and activity of DNA methyltransferases resulting in DNA hypomethylation and that reduced methyltransferase activity can cause activation of normally silenced genes. The aim of this study was to establish a link between alcohol use in men and hypomethylation of paternally imprinted loci in sperm DNA in genomic regions critical for embryonic development, thus providing a mechanism for paternal effects in the aetiology of FASD. Sperm DNA from male volunteers was bisulfite treated and the methylation patterns of 2 differentially methylated regions (DMRs), H19 and IG-DMR, analyzed following sequencing of individual clones. The methylation patterns were correlated with the alcohol consumption levels of the volunteer males. There was a pattern of increased demethylation with alcohol consumption at the 2 imprinted loci with a significant difference observed at the IG-DMR between the nondrinking and heavy alcohol consuming groups. Greater inter-individual variation in average methylation was observed at the H19 DMR and individual clones were more extensively demethylated than those of the IG-DMR. CpG site #4 in the IG-DMR was preferentially demethylated among all individuals and along with the H19 DMR CpG site #7 located within the CTCF binding site 6 showed significant demethylation in the alcohol consuming groups compared with the control group. This study demonstrates a correlation between chronic alcohol use and

Allelic variation contributes to bacterial host specificity

DOE PAGES

Yue, Min; Han, Xiangan; Masi, Leon De; ...

2015-10-30

Understanding the molecular parameters that regulate cross-species transmission and host adaptation of potential pathogens is crucial to control emerging infectious disease. Although microbial pathotype diversity is conventionally associated with gene gain or loss, the role of pathoadaptive nonsynonymous single-nucleotide polymorphisms (nsSNPs) has not been systematically evaluated. Here, our genome-wide analysis of core genes within Salmonella enterica serovar Typhimurium genomes reveals a high degree of allelic variation in surface-exposed molecules, including adhesins that promote host colonization. Subsequent multinomial logistic regression, MultiPhen and Random Forest analyses of known/suspected adhesins from 580 independent Typhimurium isolates identifies distinct host-specific nsSNP signatures. Moreover, population andmore » functional analyses of host-associated nsSNPs for FimH, the type 1 fimbrial adhesin, highlights the role of key allelic residues in host-specific adherence in vitro. In conclusion, together, our data provide the first concrete evidence that functional differences between allelic variants of bacterial proteins likely contribute to pathoadaption to diverse hosts.« less

Delimiting Allelic Imbalance of TYMS by Allele-Specific Analysis.

PubMed

Balboa-Beltrán, Emilia; Cruz, Raquel; Carracedo, Angel; Barros, Francisco

2015-07-01

Allelic imbalance of thymidylate synthase (TYMS) is attributed to polymorphisms in the 5'- and 3'-untranslated region (UTR). These polymorphisms have been related to the risk of suffering different cancers, for example leukemia, breast or gastric cancer, and response to different drugs, among which are methotrexate glutamates, stavudine, and specifically 5-fluorouracil (5-FU), as TYMS is its direct target. A vast literature has been published in relation to 5-FU, even suggesting the sole use of these polymorphisms to effectively manage 5-FU dosage. Estimates of the extent to which these polymorphisms influence in TYMS expression have in the past been based on functional analysis by luciferase assays and quantification of TYMS mRNA, but both these studies, as the association studies with cancer risk or with toxicity or response to 5-FU, are very contradictory. Regarding functional assays, the artificial genetic environment created in luciferase assay and the problems derived from quantitative polymerase chain reactions (qPCRs), for example the use of a reference gene, may have distorted the results. To avoid these sources of interference, we have analyzed the allelic imbalance of TYMS by allelic-specific analysis in peripheral blood mononuclear cells (PBMCs) from patients.Allelic imbalance in PBMCs, taken from 40 patients with suspected myeloproliferative haematological diseases, was determined by fluorescent fragment analysis (for the 3'-UTR polymorphism), Sanger sequencing and allelic-specific qPCR in multiplex (for the 5'-UTR polymorphisms).For neither the 3'- nor the 5'-UTR polymorphisms did the observed allelic imbalance exceed 1.5 fold. None of the TYMS polymorphisms is statistically associated with allelic imbalance.The results acquired allow us to deny the previously established assertion of an influence of 2 to 4 fold of the rs45445694 and rs2853542 polymorphisms in the expression of TYMS and narrow its allelic imbalance to 1.5 fold, in our population

Polycomb-like proteins link the PRC2 complex to CpG islands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Haojie; Liefke, Robert; Jiang, Junyi

The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

PubMed

Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

2018-05-01

DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

Mapping the mouse Allelome reveals tissue-specific regulation of allelic expression

PubMed Central

Andergassen, Daniel; Dotter, Christoph P; Wenzel, Daniel; Sigl, Verena; Bammer, Philipp C; Muckenhuber, Markus; Mayer, Daniela; Kulinski, Tomasz M; Theussl, Hans-Christian; Penninger, Josef M; Bock, Christoph; Barlow, Denise P; Pauler, Florian M; Hudson, Quanah J

2017-01-01

To determine the dynamics of allelic-specific expression during mouse development, we analyzed RNA-seq data from 23 F1 tissues from different developmental stages, including 19 female tissues allowing X chromosome inactivation (XCI) escapers to also be detected. We demonstrate that allelic expression arising from genetic or epigenetic differences is highly tissue-specific. We find that tissue-specific strain-biased gene expression may be regulated by tissue-specific enhancers or by post-transcriptional differences in stability between the alleles. We also find that escape from X-inactivation is tissue-specific, with leg muscle showing an unexpectedly high rate of XCI escapers. By surveying a range of tissues during development, and performing extensive validation, we are able to provide a high confidence list of mouse imprinted genes including 18 novel genes. This shows that cluster size varies dynamically during development and can be substantially larger than previously thought, with the Igf2r cluster extending over 10 Mb in placenta. DOI: http://dx.doi.org/10.7554/eLife.25125.001 PMID:28806168

Variant-specific quantification of factor H in plasma reveals null alleles associated with atypical hemolytic uremic syndrome

PubMed Central

Hakobyan, Svetlana; Tortajada, Agustín; Harris, Claire L.; de Córdoba, Santiago Rodríguez; Morgan, B. Paul

2011-01-01

Atypical hemolytic uremic syndrome (aHUS) associates with complement alternative pathway defects in over 50% of cases. Mutations in factor H (fH) are most common, usually point mutations affecting complement surface regulation and sometimes null mutations in heterozygosity. The latter are difficult to identify; although consistently low plasma fH concentration is suggestive, definitive proof has required the demonstration that the mutant sequence does not express in vitro. Here, novel reagents and assays that distinguish and individually quantify the common fH-Y402H polymorphic variants were used to identify alleles of the CFH gene resulting in low or no (‘null’) expression of full-length fH, but normal or increased expression of the alternative splice product FHL-1, also detected in these assays. Their use in an aHUS cohort identified three Y402H heterozygotes with low or absent fH-H402 but normal or increased FHL-1 levels. Novel mutations in heterozygosis explained the null phenotype in two cases, confirmed by family studies in one. In the third case, family studies showed that a known mutation was present on the Y allele; the cause of the reduced expression of H allele was not found, although data suggested altered fH/FHL-1 splicing. In each family, inheritance of “low expression” or “null” alleles for fH strongly associated with aHUS. These assays provide a rapid means to identify fH expression defects in aHUS without resorting to gene sequencing or expression analysis. PMID:20703214

Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer

PubMed Central

Savio, Andrea J.; Bapat, Bharati

2017-01-01

ABSTRACT The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located. PMID:28304185

Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer.

PubMed

Savio, Andrea J; Bapat, Bharati

2017-06-03

The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located.

Heritable Individual-Specific and Allele-Specific Chromatin Signatures in Humans

PubMed Central

McDaniell, Ryan; Lee, Bum-Kyu; Song, Lingyun; Liu, Zheng; Boyle, Alan P.; Erdos, Michael R.; Scott, Laura J.; Morken, Mario A.; Kucera, Katerina S.; Battenhouse, Anna; Keefe, Damian; Collins, Francis S.; Willard, Huntington F.; Lieb, Jason D.; Furey, Terrence S.; Crawford, Gregory E.; Iyer, Vishwanath R.; Birney, Ewan

2010-01-01

The extent to which variation in chromatin structure and transcription factor binding may influence gene expression, and thus underlie or contribute to variation in phenotype, is unknown. To address this question, we cataloged both individual-to-individual variation and differences between homologous chromosomes within the same individual (allele-specific variation) in chromatin structure and transcription factor binding in lymphoblastoid cells derived from individuals of geographically diverse ancestry. Ten percent of active chromatin sites were individual-specific; a similar proportion were allele-specific. Both individual-specific and allele-specific sites were commonly transmitted from parent to child, which suggests that they are heritable features of the human genome. Our study shows that heritable chromatin status and transcription factor binding differ as a result of genetic variation and may underlie phenotypic variation in humans. PMID:20299549

Evaluation of Allele-Specific Somatic Changes of Genome-Wide Association Study Susceptibility Alleles in Human Colorectal Cancers

PubMed Central

Gerber, Madelyn M.; Hampel, Heather; Schulz, Nathan P.; Fernandez, Soledad; Wei, Lai; Zhou, Xiao-Ping; de la Chapelle, Albert; Toland, Amanda Ewart

2012-01-01

Background Tumors frequently exhibit loss of tumor suppressor genes or allelic gains of activated oncogenes. A significant proportion of cancer susceptibility loci in the mouse show somatic losses or gains consistent with the presence of a tumor susceptibility or resistance allele. Thus, allele-specific somatic gains or losses at loci may demarcate the presence of resistance or susceptibility alleles. The goal of this study was to determine if previously mapped susceptibility loci for colorectal cancer show evidence of allele-specific somatic events in colon tumors. Methods We performed quantitative genotyping of 16 single nucleotide polymorphisms (SNPs) showing statistically significant association with colorectal cancer in published genome-wide association studies (GWAS). We genotyped 194 paired normal and colorectal tumor DNA samples and 296 paired validation samples to investigate these SNPs for allele-specific somatic gains and losses. We combined analysis of our data with published data for seven of these SNPs. Results No statistically significant evidence for allele-specific somatic selection was observed for the tested polymorphisms in the discovery set. The rs6983267 variant, which has shown preferential loss of the non-risk T allele and relative gain of the risk G allele in previous studies, favored relative gain of the G allele in the combined discovery and validation samples (corrected p-value = 0.03). When we combined our data with published allele-specific imbalance data for this SNP, the G allele of rs6983267 showed statistically significant evidence of relative retention (p-value = 2.06×10−4). Conclusions Our results suggest that the majority of variants identified as colon cancer susceptibility alleles through GWAS do not exhibit somatic allele-specific imbalance in colon tumors. Our data confirm previously published results showing allele-specific imbalance for rs6983267. These results indicate that allele-specific imbalance of cancer

CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands, but also low-level methylation at individual loci.

PubMed

Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

2008-03-01

The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.

Functional PMS2 hybrid alleles containing a pseudogene-specific missense variant trace back to a single ancient intrachromosomal recombination event.

PubMed

Ganster, Christina; Wernstedt, Annekatrin; Kehrer-Sawatzki, Hildegard; Messiaen, Ludwine; Schmidt, Konrad; Rahner, Nils; Heinimann, Karl; Fonatsch, Christa; Zschocke, Johannes; Wimmer, Katharina

2010-05-01

Sequence exchange between PMS2 and its pseudogene PMS2CL, embedded in an inverted duplication on chromosome 7p22, has been reported to be an ongoing process that leads to functional PMS2 hybrid alleles containing PMS2- and PMS2CL-specific sequence variants at the 5'-and the 3'-end, respectively. The frequency of PMS2 hybrid alleles, their biological significance, and the mechanisms underlying their formation are largely unknown. Here we show that overall hybrid alleles account for one-third of 384 PMS2 alleles analyzed in individuals of different ethnic backgrounds. Depending on the population, 14-60% of hybrid alleles carry PMS2CL-specific sequences in exons 13-15, the remainder only in exon 15. We show that exons 13-15 hybrid alleles, named H1 hybrid alleles, constitute different haplotypes but trace back to a single ancient intrachromosomal recombination event with crossover. Taking advantage of an ancestral sequence variant specific for all H1 alleles we developed a simple gDNA-based polymerase chain reaction (PCR) assay that can be used to identify H1-allele carriers with high sensitivity and specificity (100 and 99%, respectively). Because H1 hybrid alleles harbor missense variant p.N775S of so far unknown functional significance, we assessed the H1-carrier frequency in 164 colorectal cancer patients. So far, we found no indication that the variant plays a major role with regard to cancer susceptibility. (c) 2010 Wiley-Liss, Inc.

Functional PMS2 Hybrid Alleles Containing a Pseudogene-Specific Missense Variant Trace Back to a Single Ancient Intrachromosomal Recombination Event

PubMed Central

Ganster, Christina; Wernstedt, Annekatrin; Kehrer-Sawatzki, Hildegard; Messiaen, Ludwine; Schmidt, Konrad; Rahner, Nils; Heinimann, Karl; Fonatsch, Christa; Zschocke, Johannes; Wimmer, Katharina

2012-01-01

Sequence exchange between PMS2 and its pseudogene PMS2CL, embedded in an inverted duplication on chromosome 7p22, has been reported to be an ongoing process that leads to functional PMS2 hybrid alleles containing PMS2- and PMS2CL-specific sequence variants at the 5′-and the 3′-end, respectively. The frequency of PMS2 hybrid alleles, their biological significance, and the mechanisms underlying their formation are largely unknown. Here we show that overall hybrid alleles account for one-third of 384 PMS2 alleles analyzed in individuals of different ethnic backgrounds. Depending on the population, 14–60% of hybrid alleles carry PMS2CL-specific sequences in exons 13–15, the remainder only in exon 15. We show that exons 13–15 hybrid alleles, named H1 hybrid alleles, constitute different haplotypes but trace back to a single ancient intrachromosomal recombination event with crossover. Taking advantage of an ancestral sequence variant specific for all H1 alleles we developed a simple gDNA-based polymerase chain reaction (PCR) assay that can be used to identify H1-allele carriers with high sensitivity and specificity (100 and 99%, respectively). Because H1 hybrid alleles harbor missense variant p.N775S of so far unknown functional significance, we assessed the H1-carrier frequency in 164 colorectal cancer patients. So far, we found no indication that the variant plays a major role with regard to cancer susceptibility. PMID:20186689

Multiplex Allele-Specific Amplification from Whole Blood for Detecting Multiple Polymorphisms Simultaneously

PubMed Central

Zhu, Jianjie; Chen, Lanxin; Mao, Yong; Zhou, Huan

2013-01-01

Allele-specific amplification on the basis of polymerase chain reaction (PCR) has been widely used for single-nucleotide polymorphism (SNP) genotyping. However, the extraction of PCR-compatible genomic DNA from whole blood is usually required. This process is complicated and tedious, and is prone to cause cross-contamination between samples. To facilitate direct PCR amplification from whole blood without the extraction of genomic DNA, we optimized the pH value of PCR solution and the concentrations of magnesium ions and facilitator glycerol. Then, we developed multiplex allele-specific amplifications from whole blood and applied them to a case–control study. In this study, we successfully established triplex, five-plex, and eight-plex allele-specific amplifications from whole blood for determining the distribution of genotypes and alleles of 14 polymorphisms in 97 gastric cancer patients and 141 healthy controls. Statistical analysis results showed significant association of SNPs rs9344, rs1799931, and rs1800629 with the risk of gastric cancer. This method is accurate, time-saving, cost-effective, and easy-to-do, especially suitable for clinical prediction of disease susceptibility. PMID:23072573

ALEA: a toolbox for allele-specific epigenomics analysis.

PubMed

Younesy, Hamid; Möller, Torsten; Heravi-Moussavi, Alireza; Cheng, Jeffrey B; Costello, Joseph F; Lorincz, Matthew C; Karimi, Mohammad M; Jones, Steven J M

2014-04-15

The assessment of expression and epigenomic status using sequencing based methods provides an unprecedented opportunity to identify and correlate allelic differences with epigenomic status. We present ALEA, a computational toolbox for allele-specific epigenomics analysis, which incorporates allelic variation data within existing resources, allowing for the identification of significant associations between epigenetic modifications and specific allelic variants in human and mouse cells. ALEA provides a customizable pipeline of command line tools for allele-specific analysis of next-generation sequencing data (ChIP-seq, RNA-seq, etc.) that takes the raw sequencing data and produces separate allelic tracks ready to be viewed on genome browsers. The pipeline has been validated using human and hybrid mouse ChIP-seq and RNA-seq data. The package, test data and usage instructions are available online at http://www.bcgsc.ca/platform/bioinfo/software/alea CONTACT: : mkarimi1@interchange.ubc.ca or sjones@bcgsc.ca Supplementary information: Supplementary data are available at Bioinformatics online. © The Author 2013. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Stress-related methylation of the catechol-O-methyltransferase Val 158 allele predicts human prefrontal cognition and activity.

PubMed

Ursini, Gianluca; Bollati, Valentina; Fazio, Leonardo; Porcelli, Annamaria; Iacovelli, Luisa; Catalani, Assia; Sinibaldi, Lorenzo; Gelao, Barbara; Romano, Raffaella; Rampino, Antonio; Taurisano, Paolo; Mancini, Marina; Di Giorgio, Annabella; Popolizio, Teresa; Baccarelli, Andrea; De Blasi, Antonio; Blasi, Giuseppe; Bertolino, Alessandro

2011-05-04

DNA methylation at CpG dinucleotides is associated with gene silencing, stress, and memory. The catechol-O-methyltransferase (COMT) Val(158) allele in rs4680 is associated with differential enzyme activity, stress responsivity, and prefrontal activity during working memory (WM), and it creates a CpG dinucleotide. We report that methylation of the Val(158) allele measured from peripheral blood mononuclear cells (PBMCs) of Val/Val humans is associated negatively with lifetime stress and positively with WM performance; it interacts with stress to modulate prefrontal activity during WM, such that greater stress and lower methylation are related to reduced cortical efficiency; and it is inversely related to mRNA expression and protein levels, potentially explaining the in vivo effects. Finally, methylation of COMT in prefrontal cortex and that in PBMCs of rats are correlated. The relationship of methylation of the COMT Val(158) allele with stress, gene expression, WM performance, and related brain activity suggests that stress-related methylation is associated with silencing of the gene, which partially compensates the physiological role of the high-activity Val allele in prefrontal cognition and activity. Moreover, these results demonstrate how stress-related DNA methylation of specific functional alleles impacts directly on human brain physiology beyond sequence variation.

CpG island mapping by epigenome prediction.

PubMed

Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

2007-06-01

CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic

Phenotype-specific CpG island methylation events in a murine model of prostate cancer.

PubMed

Camoriano, Marta; Kinney, Shannon R Morey; Moser, Michael T; Foster, Barbara A; Mohler, James L; Trump, Donald L; Karpf, Adam R; Smiraglia, Dominic J

2008-06-01

Aberrant DNA methylation plays a significant role in nearly all human cancers and may contribute to disease progression to advanced phenotypes. Study of advanced prostate cancer phenotypes in the human disease is hampered by limited availability of tissues. We therefore took advantage of the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model to study whether three different phenotypes of TRAMP tumors (PRIM, late-stage primary tumors; AIP, androgen-independent primary tumors; and MET, metastases) displayed specific patterns of CpG island hypermethylation using Restriction Landmark Genomic Scanning. Each tumor phenotype displayed numerous hypermethylation events, with the most homogeneous methylation pattern in AIP and the most heterogeneous pattern in MET. Several loci displayed a phenotype-specific methylation pattern; the most striking pattern being loci methylated at high frequency in PRIM and AIP but rarely in MET. Examination of the mRNA expression of three genes, BC058385, Goosecoid, and Neurexin 2, which exhibited nonpromoter methylation, revealed increased expression associated with downstream methylation. Only methylated samples showed mRNA expression, in which tumor phenotype was a key factor determining the level of expression. The CpG island in the human orthologue of BC058385 was methylated in human AIP but not in primary androgen-stimulated prostate cancer or benign prostate. The clinical data show a proof-of-principle that the TRAMP model can be used to identify targets of aberrant CpG island methylation relevant to human disease. In conclusion, phenotype-specific hypermethylation events were associated with the overexpression of different genes and may provide new markers of prostate tumorigenesis.

The testis-specific factor CTCFL cooperates with the protein methyltransferase PRMT7 in H19 imprinting control region methylation.

PubMed

Jelinic, Petar; Stehle, Jean-Christophe; Shaw, Phillip

2006-10-01

Expression of imprinted genes is restricted to a single parental allele as a result of epigenetic regulation-DNA methylation and histone modifications. Igf2/H19 is a reciprocally imprinted locus exhibiting paternal Igf2 and maternal H19 expression. Their expression is regulated by a paternally methylated imprinting control region (ICR) located between the two genes. Although the de novo DNA methyltransferases have been shown to be necessary for the establishment of ICR methylation, the mechanism by which they are targeted to the region remains unknown. We demonstrate that CTCFL/BORIS, a paralog of CTCF, is an ICR-binding protein expressed during embryonic male germ cell development, coinciding with the timing of ICR methylation. PRMT7, a protein arginine methyltransferase with which CTCFL interacts, is also expressed during embryonic testis development. Symmetrical dimethyl arginine 3 of histone H4, a modification catalyzed by PRMT7, accumulates in germ cells during this developmental period. This modified histone is also found enriched in both H19 ICR and Gtl2 differentially methylated region (DMR) chromatin of testis by chromatin immunoprecipitation (ChIP) analysis. In vitro studies demonstrate that CTCFL stimulates the histone-methyltransferase activity of PRMT7 via interactions with both histones and PRMT7. Finally, H19 ICR methylation is demonstrated by nuclear co-injection of expression vectors encoding CTCFL, PRMT7, and the de novo DNA methyltransferases, Dnmt3a, -b and -L, in Xenopus oocytes. These results suggest that CTCFL and PRMT7 may play a role in male germline imprinted gene methylation.

The Testis-Specific Factor CTCFL Cooperates with the Protein Methyltransferase PRMT7 in H19 Imprinting Control Region Methylation

PubMed Central

Jelinic, Petar; Stehle, Jean-Christophe; Shaw, Phillip

2006-01-01

Expression of imprinted genes is restricted to a single parental allele as a result of epigenetic regulation—DNA methylation and histone modifications. Igf2/H19 is a reciprocally imprinted locus exhibiting paternal Igf2 and maternal H19 expression. Their expression is regulated by a paternally methylated imprinting control region (ICR) located between the two genes. Although the de novo DNA methyltransferases have been shown to be necessary for the establishment of ICR methylation, the mechanism by which they are targeted to the region remains unknown. We demonstrate that CTCFL/BORIS, a paralog of CTCF, is an ICR-binding protein expressed during embryonic male germ cell development, coinciding with the timing of ICR methylation. PRMT7, a protein arginine methyltransferase with which CTCFL interacts, is also expressed during embryonic testis development. Symmetrical dimethyl arginine 3 of histone H4, a modification catalyzed by PRMT7, accumulates in germ cells during this developmental period. This modified histone is also found enriched in both H19 ICR and Gtl2 differentially methylated region (DMR) chromatin of testis by chromatin immunoprecipitation (ChIP) analysis. In vitro studies demonstrate that CTCFL stimulates the histone-methyltransferase activity of PRMT7 via interactions with both histones and PRMT7. Finally, H19 ICR methylation is demonstrated by nuclear co-injection of expression vectors encoding CTCFL, PRMT7, and the de novo DNA methyltransferases, Dnmt3a, -b and -L, in Xenopus oocytes. These results suggest that CTCFL and PRMT7 may play a role in male germline imprinted gene methylation. PMID:17048991

Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.

PubMed

Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J

2016-08-01

Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor.

DNA containing CpG motifs induces angiogenesis

NASA Astrophysics Data System (ADS)

Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

2002-06-01

New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

Comparison of immunohistochemistry, DNA sequencing and allele-specific PCR for the detection of IDH1 mutations in gliomas.

PubMed

Loussouarn, Delphine; Le Loupp, Anne-Gaëlle; Frenel, Jean-Sébastien; Leclair, François; Von Deimling, Andreas; Aumont, Maud; Martin, Stéphane; Campone, Mario; Denis, Marc G

2012-06-01

Previous studies have identified mutations of the isocitrate dehydrogenase 1 (IDH1) gene in more than 70% of World Health Organization (WHO) grade II and III gliomas. The most frequent mutation leads to a specific amino acid change from arginine to histidine at codon 132 (c.395G>A, p.R132H). IDH1 mutated tumors have a better prognosis than IDH1 non-mutated tumors. The aim of our study was to evaluate and compare the methods of mIDH1 R132H immunohistochemistry, allele-specific PCR and DNA sequencing for determination of IDH1 status. We performed a retrospective study of 91 patients with WHO grade II (n=43) and III (n=48) oligodendrogliomas. A fragment of exon 4 spanning the sequence encoding the catalytic domain of IDH1, including codon 132, was amplified and sequenced using standard conditions. Allele-specific amplification was performed using two forward primers with variations in their 3' nucleotides such that each was specific for the wild-type or the mutated variant, and one reverse primer. Immunohistochemistry was performed with mouse monoclonal mIDH1 R132H. DNA was extracted from FFPE sections following macrodissection. IDH1 mutations were found in 55/90 patients (61.1%) by direct sequencing. R132H mutations were found in 47/55 patients (85.4%). The results of the allele-specific PCR positively correlated with those from DNA sequencing. Other mutations (p.R132C, p.R132S and pR132G) were found by DNA sequencing in 3, 3 and 2 tumors, respectively (8/55 patients, 14.6%). mIDH1 R132H immunostaining was found in the 47 patients presenting the R132H mutation (sensitivity 47/47, 100% for this mutation). None of the tumors presenting a wild-type IDH1 gene were stained (specificity 35/35, 100%). Our results demonstrate that immunohistochemistry using the mIDH1 R132H antibody and allele-specific amplification are highly sensitive techniques to detect the most frequent mutation of the IDH1 gene.

Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

PubMed

Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

2015-07-08

The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

S-genotype identification based on allele-specific PCR in Japanese pear

PubMed Central

Nashima, Kenji; Terakami, Shingo; Nishio, Sogo; Kunihisa, Miyuki; Nishitani, Chikako; Saito, Toshihiro; Yamamoto, Toshiya

2015-01-01

Gametophytic self-incompatibility in Japanese pear (Pyrus pyrifolia Nakai) is controlled by the single, multi-allelic S-locus. Information about the S-genotypes is important for breeding and the selection of pollen donors for fruit production. Rapid and reliable S-genotype identification system is necessary for efficient breeding of new cultivars in Japanese pear. We designed S allele-specific PCR primer pairs for ten previously reported S-RNase alleles (S1–S9 and Sk) as simple and reliable method. Specific nucleotide sequences were chosen to design the primers to amplify fragments of only the corresponding S alleles. The developed primer pairs were evaluated by using homozygous S-genotypes (S1/S1–S9/S9 and S4sm/S4sm) and 14 major Japanese pear cultivars, and found that S allele-specific primer pairs can identify S-genotypes effectively. The S allele-specific primer pairs developed in this study will be useful for efficient S-genotyping and for marker-assisted selection in Japanese pear breeding programs. PMID:26175617

Direct testing for allele-specific expression differences between conditions

USDA-ARS?s Scientific Manuscript database

Genetic differences in cis regulatory regions contribute to the phenotypic variation observed in natural and human populations, including beneficial, potentially adaptive, traits as well as disease states. The two alleles in a diploid cell can differ in their allele-specific expression leading to al...

Allele-Specific Inhibition of Rhodopsin With an Antisense Oligonucleotide Slows Photoreceptor Cell Degeneration

PubMed Central

Murray, Susan F.; Jazayeri, Ali; Matthes, Michael T.; Yasumura, Douglas; Yang, Haidong; Peralta, Raechel; Watt, Andy; Freier, Sue; Hung, Gene; Adamson, Peter S.; Guo, Shuling; Monia, Brett P.; LaVail, Matthew M.; McCaleb, Michael L.

2015-01-01

Purpose To preserve photoreceptor cell structure and function in a rodent model of retinitis pigmentosa with P23H rhodopsin by selective inhibition of the mutant rhodopsin allele using a second generation antisense oligonucleotide (ASO). Methods Wild-type mice and rats were treated with ASO by intravitreal (IVT) injection and rhodopsin mRNA and protein expression were measured. Transgenic rats expressing the murine P23H rhodopsin gene (P23H transgenic rat Line 1) were administered either a mouse-specific P23H ASO or a control ASO. The contralateral eye was injected with PBS and used as a comparator control. Electroretinography (ERG) measurements and analyses of the retinal outer nuclear layer were conducted and correlated with rhodopsin mRNA levels. Results Rhodopsin mRNA and protein expression was reduced after a single ASO injection in wild-type mice with a rhodopsin-specific ASO. Transgenic rat eyes that express a murine P23H rhodopsin gene injected with a murine P23H ASO had a 181 ± 39% better maximum amplitude response (scotopic a-wave) as compared with contralateral PBS-injected eyes; the response in control ASO eyes was not significantly different from comparator contralateral eyes. Morphometric analysis of the outer nuclear layer showed a significantly thicker nuclear layer in eyes injected with murine P23H ASO (18%) versus contralateral PBS-injected eyes. Conclusions Allele-specific ASO-mediated knockdown of mutant P23H rhodopsin expression slowed the rate of photoreceptor degeneration and preserved the function of photoreceptor cells in eyes of the P23H rhodopsin transgenic rat. Our data indicate that ASO treatment is a potentially effective therapy for the treatment of retinitis pigmentosa. PMID:26436889

EGFR mutant allelic-specific imbalance assessment in routine samples of non-small cell lung cancer.

PubMed

Malapelle, Umberto; Vatrano, Simona; Russo, Stefania; Bellevicine, Claudio; de Luca, Caterina; Sgariglia, Roberta; Rocco, Danilo; de Pietro, Livia; Riccardi, Fernando; Gobbini, Elisa; Righi, Luisella; Troncone, Giancarlo

2015-09-01

In non-small cell lung cancer (NSCLC), the epidermal growth factor receptor (EGFR) gene may undergo both mutations and copy number gains. EGFR mutant allele-specific imbalance (MASI) occurs when the ratio of mutant-to-wild-type alleles increases significantly. In this study, by using a previously validated microfluidic-chip-based technology, EGFR-MASI occurred in 25/67 mutant cases (37%), being more frequently associated with EGFR exon 19 deletions (p=0.033). In a subset of 49 treated patients, we assessed whether MASI is a modifier of anti-EGFR treatment benefit. The difference in progression-free survival and overall survival between EGFR-MASI-positive and EGFR-MASI-negative groups of patients did not show a statistical significance. In conclusion, EGFR-MASI is a significant event in NSCLC, specifically associated with EGFR exon 19 deletions. However, EGFR-MASI does not seem to play a role in predicting the response to first-generation EGFR small molecules inhibitors. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Tissue-specific patterns of allelically-skewed DNA methylation

PubMed Central

Marzi, Sarah J.; Meaburn, Emma L.; Dempster, Emma L.; Lunnon, Katie; Paya-Cano, Jose L.; Smith, Rebecca G.; Volta, Manuela; Troakes, Claire; Schalkwyk, Leonard C.; Mill, Jonathan

2016-01-01

ABSTRACT While DNA methylation is usually thought to be symmetrical across both alleles, there are some notable exceptions. Genomic imprinting and X chromosome inactivation are two well-studied sources of allele-specific methylation (ASM), but recent research has indicated a more complex pattern in which genotypic variation can be associated with allelically-skewed DNA methylation in cis. Given the known heterogeneity of DNA methylation across tissues and cell types we explored inter- and intra-individual variation in ASM across several regions of the human brain and whole blood from multiple individuals. Consistent with previous studies, we find widespread ASM with > 4% of the ∼220,000 loci interrogated showing evidence of allelically-skewed DNA methylation. We identify ASM flanking known imprinted regions, and show that ASM sites are enriched in DNase I hypersensitivity sites and often located in an extended genomic context of intermediate DNA methylation. We also detect examples of genotype-driven ASM, some of which are tissue-specific. These findings contribute to our understanding of the nature of differential DNA methylation across tissues and have important implications for genetic studies of complex disease. As a resource to the community, ASM patterns across each of the tissues studied are available in a searchable online database: http://epigenetics.essex.ac.uk/ASMBrainBlood. PMID:26786711

Characterization and expression of cyp19a gene in the Chinese giant salamander Andrias davidianus.

PubMed

Hu, Qiaomu; Xiao, Hanbing; Tian, HaiFeng; Meng, Yan

2016-02-01

We cloned the full length cyp19a of Chinese giant salamander Andrias davidianus, determined its distribution in tissues and developing gonads, and analyzed the CpG methylation pattern of the cyp19a promoter. The results revealed isoforms of 1706 bp (G arom) and 1698 bp (B arom) in length, differing in the 5' flanking region, both encoding 502 amino acids. The G arom gene was observed mainly in the ovary and kidney, with little in other investigated tissues, while B arom expression was high in the brain, ovary, testis, and pituitary, with low or undetected expression in other examined tissues. Total aromatase expression was high in the ovary; moderate in the kidney, brain, testis, and pituitary; and low in the remaining tissues. G arom expression was significantly higher in the ovary than in the testis and gradually decreased with maturation of the salamander. A single injection of methyltestosterone or letrozole resulted in ovarian G arom expression decreasing over a 12-96 h period. A 1366 bp sequence of the cyp19a promoter was cloned and shown to be conserved in selected species. CpG methylation level was negatively correlated with cyp19a expression in the examined tissues and developing ovaries. Five and three CpG methylation sites positively correlated with DNA methylation levels in tissues and developing ovary, suggesting that they play an important role in regulating cyp19a expression. The aromatase gene showed two isoforms with distinct expression patterns, and the promoter methylation level at specific CpG sites was associated with variation in expression profiles of tissues and developing ovaries. Copyright © 2015 Elsevier Inc. All rights reserved.

Biallelic expression of the H19 gene during spontaneous hepatocarcinogenesis in the albumin SV40 T antigen transgenic rat.

PubMed

Manoharan, Herbert; Babcock, Karlee; Willi, Jonathan; Pitot, Henry C

2003-09-01

Previous studies in this laboratory have demonstrated that the earliest cytogenetic alteration in the development of hepatic neoplasms in a transgenic strain of rats bearing the albumin Simian virus 40 T antigen (Alb SV40 T Ag) construct was a duplication of the chromosome 1q4.1-1q4.2 band. In this region, in the rat genome a cluster of linked imprinted genes occurs. One of these imprinted genes, H19, which is expressed in fetal liver but not in adult liver, was found to be expressed in virtually all neoplasms investigated. A single-nucleotide polymorphic marker in the H19 coding sequence was identified in two rat strains and utilized for the investigation of H19 imprinting. Our results reveal monoallelic expression of the maternal gene in fetal liver, but biallelic expression of the H19 gene in liver neoplasms, thus demonstrating the basis for the deregulation of the imprinted gene expression during hepatocarcinogenesis. These results suggest that the loss of genomic imprinting of the H19 gene found in the liver neoplasms of the Alb SV40 T Ag rat may result not from allelic loss, but from adverse changes in the epigenetic imprints present in the 5'-upstream region of the H19 promoter of the parental alleles. Copyright 2003 Wiley-Liss, Inc.

Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

PubMed

Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

2016-06-01

Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

PubMed

Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

2017-08-07

were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.

Frequency of a natural truncated allele of MdMLO19 in the germplasm of Malus domestica.

PubMed

Pessina, Stefano; Palmieri, Luisa; Bianco, Luca; Gassmann, Jennifer; van de Weg, Eric; Visser, Richard G F; Magnago, Pierluigi; Schouten, Henk J; Bai, Yuling; Riccardo Velasco, R; Malnoy, Mickael

2017-01-01

Podosphaera leucotricha is the causal agent of powdery mildew (PM) in apple. To reduce the amount of fungicides required to control this pathogen, the development of resistant apple cultivars should become a priority. Resistance to PM was achieved in various crops by knocking out specific members of the MLO gene family that are responsible for PM susceptibility (S-genes). In apple, the knockdown of MdMLO19 resulted in PM resistance. However, since gene silencing technologies such as RNAi are perceived unfavorably in Europe, a different approach that exploits this type of resistance is needed. This work evaluates the presence of non-functional naturally occurring alleles of MdMLO19 in apple germplasm. The screening of the re-sequencing data of 63 apple individuals led to the identification of 627 single nucleotide polymorphisms (SNPs) in five MLO genes ( MdMLO5, MdMLO7, MdMLO11, MdMLO18 , and MdMLO19 ), 127 of which were located in exons. The T-1201 insertion of a single nucleotide in MdMLO19 caused the formation of an early stop codon, resulting in a truncated protein lacking 185 amino acids, including the calmodulin-binding domain. The presence of the insertion was evaluated in 115 individuals. It was heterozygous in 64 and homozygous in 25. Twelve of the 25 individuals carrying the insertion in homozygosity were susceptible to PM. After barley, pea, cucumber, and tomato, apple would be the fifth species for which a natural non-functional mlo allele has been found.

QuASAR: quantitative allele-specific analysis of reads.

PubMed

Harvey, Chris T; Moyerbrailean, Gregory A; Davis, Gordon O; Wen, Xiaoquan; Luca, Francesca; Pique-Regi, Roger

2015-04-15

Expression quantitative trait loci (eQTL) studies have discovered thousands of genetic variants that regulate gene expression, enabling a better understanding of the functional role of non-coding sequences. However, eQTL studies are costly, requiring large sample sizes and genome-wide genotyping of each sample. In contrast, analysis of allele-specific expression (ASE) is becoming a popular approach to detect the effect of genetic variation on gene expression, even within a single individual. This is typically achieved by counting the number of RNA-seq reads matching each allele at heterozygous sites and testing the null hypothesis of a 1:1 allelic ratio. In principle, when genotype information is not readily available, it could be inferred from the RNA-seq reads directly. However, there are currently no existing methods that jointly infer genotypes and conduct ASE inference, while considering uncertainty in the genotype calls. We present QuASAR, quantitative allele-specific analysis of reads, a novel statistical learning method for jointly detecting heterozygous genotypes and inferring ASE. The proposed ASE inference step takes into consideration the uncertainty in the genotype calls, while including parameters that model base-call errors in sequencing and allelic over-dispersion. We validated our method with experimental data for which high-quality genotypes are available. Results for an additional dataset with multiple replicates at different sequencing depths demonstrate that QuASAR is a powerful tool for ASE analysis when genotypes are not available. http://github.com/piquelab/QuASAR. fluca@wayne.edu or rpique@wayne.edu Supplementary Material is available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

QuASAR: quantitative allele-specific analysis of reads

PubMed Central

Harvey, Chris T.; Moyerbrailean, Gregory A.; Davis, Gordon O.; Wen, Xiaoquan; Luca, Francesca; Pique-Regi, Roger

2015-01-01

Motivation: Expression quantitative trait loci (eQTL) studies have discovered thousands of genetic variants that regulate gene expression, enabling a better understanding of the functional role of non-coding sequences. However, eQTL studies are costly, requiring large sample sizes and genome-wide genotyping of each sample. In contrast, analysis of allele-specific expression (ASE) is becoming a popular approach to detect the effect of genetic variation on gene expression, even within a single individual. This is typically achieved by counting the number of RNA-seq reads matching each allele at heterozygous sites and testing the null hypothesis of a 1:1 allelic ratio. In principle, when genotype information is not readily available, it could be inferred from the RNA-seq reads directly. However, there are currently no existing methods that jointly infer genotypes and conduct ASE inference, while considering uncertainty in the genotype calls. Results: We present QuASAR, quantitative allele-specific analysis of reads, a novel statistical learning method for jointly detecting heterozygous genotypes and inferring ASE. The proposed ASE inference step takes into consideration the uncertainty in the genotype calls, while including parameters that model base-call errors in sequencing and allelic over-dispersion. We validated our method with experimental data for which high-quality genotypes are available. Results for an additional dataset with multiple replicates at different sequencing depths demonstrate that QuASAR is a powerful tool for ASE analysis when genotypes are not available. Availability and implementation: http://github.com/piquelab/QuASAR. Contact: fluca@wayne.edu or rpique@wayne.edu Supplementary information: Supplementary Material is available at Bioinformatics online. PMID:25480375

Impact of folic acid intake during pregnancy on genomic imprinting of IGF2/H19 and 1-carbon metabolism.

PubMed

Tserga, Aggeliki; Binder, Alexandra M; Michels, Karin B

2017-12-01

Folic acid is an essential component of 1-carbon metabolism, which generates methyl groups for DNA methylation. Disruption of genomic imprinting leads to biallelic expression which may affect disease susceptibility possibly reflected in high levels of S -adenosyl-homocysteine (SAH) and low levels of S -adenosyl-methionine (SAM). We investigated the association between folic acid supplementation during pregnancy and loss of imprinting (LOI) of IGF2 and H19 genes in placentas and cord blood of 90 mother-child dyads in association with the methylenetetrahydrofolate reductase ( MTHFR ) genotype. Pyrosequencing was used to evaluate deviation from monoallelic expression among 47 placentas heterozygous for H19 and 37 placentas and cord blood tissues heterozygous for IGF2 and H19 methylation levels of 48 placentas. We detected relaxation of imprinting (ROI) and LOI of H19 in placentas not associated with differences in methylation levels of the H19ICR. Placentas retained monoallelic allele-specific gene expression of IGF2 , but 32.4% of cord blood samples displayed LOI of IGF2 and 10.8% showed ROI. High SAH levels were significantly associated with low H19 methylation. An interesting positive association between SAM/SAH ratio and high H19 methylation levels was detected among infants with low B 12 levels. Our data suggest profound differences in regulation of imprinting in placenta and cord blood; a lack of correlation of the methylome, transcriptome, and proteome; and a complex regulatory feedback network between free methyl groups and genomic imprinting at birth.-Tserga, A., Binder, A. M., Michels, K. B. Impact of folic acid intake during pregnancy on genomic imprinting of IGF2/H19 and 1-carbon metabolism. © FASEB.

A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

PubMed Central

Martin, Elizabeth M.; Fry, Rebecca C.

2016-01-01

Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

PubMed

Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

2014-11-28

NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors

Multi-step aberrant CpG island hyper-methylation is associated with the progression of adult T-cell leukemia/lymphoma.

PubMed

Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

2010-01-01

Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.

Multi-Step Aberrant CpG Island Hyper-Methylation Is Associated with the Progression of Adult T–Cell Leukemia/Lymphoma

PubMed Central

Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

2010-01-01

Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193

Development of a multiplex allele-specific primer PCR assay for simultaneous detection of QoI and CAA fungicide resistance alleles in Plasmopara viticola populations.

PubMed

Aoki, Yoshinao; Hada, Yosuke; Suzuki, Shunji

2013-02-01

DNA-based diagnosis has become a common tool for the evaluation of fungicide resistance in obligate phytopathogenic fungus Plasmopara viticola. A multiplex allele-specific primer PCR assay has been developed for the rapid detection of fungicide resistance in P. viticola populations. With this assay, a glycine-to-alanine substitution at codon 143 of the P. viticola cytochrome b gene, which conferred QoI fungicide resistance, and a glycine-to-serine substitution at codon 1105 of the P. viticola cellulose synthase gene PvCesA3, which conferred CAA fungicide resistance, were detected simultaneously. It is suggested that the present assay is a reliable tool for the rapid and simultaneous detection of QoI and CAA fungicide resistance alleles in P. viticola populations. The assay required only 2 h from the sampling of symptoms to the detection of resistance alleles to both fungicides. Copyright © 2012 Society of Chemical Industry.

Enhanced immune response to gastric cancer specific antigen Peptide by coencapsulation with CpG oligodeoxynucleotides in nanoemulsion.

PubMed

Shi, Rui; Hong, Liu; Wu, Daocheng; Ning, Xiaoxuan; Chen, Yu; Lin, Tao; Fan, Daiming; Wu, Kaichun

2005-02-01

CpG oligodeoxynucleotides (CpG ODN) have been shown to have potent adjuvant activity for a wide range of antigens. Of particular interest is their improved activity when closely associated with the antigen. The purpose of this study is to construct a nanovaccine coencapsulated with a gastric cancer specific antigen MG7 mimotope peptide and adjuvant CpG ODN 1645 using new nanotechnology as nanoemulsion and evaluate its immunocompetence. Nanoemulsion vaccine was prepared using magnetic ultrasound methods. BALB/c mice were immunized and the in vivo effectiveness was evaluated using tumor challenge assay. It was shown that the tumor masses formed in the mice immunized with coencapsulated nanovaccine (0.0825 g) markedly smaller (P < 0.01) than those formed in the mice immunized with nanovaccine encapsulated with antigen peptide alone (0.4465 g). A tumor inhibiting rate as high as 82.5% of the coencapsulated nanovaccine was obtained, while nanovaccine encapsulated with peptide only could not achieve the same effect (28.5%) (P < 0.01). Enzyme-linked immunospot assay (ELISPOT) showed that immunization using MG7 mimotope peptide coencapsulated with CpG ODN within the same nanoemulsion enhanced the frequency of splenocytes secreting IFN-gamma significantly (P < 0.01) when compared with immunization using MG7 peptide encapsulated in nanoemulsion alone (197spots/1 x 10(6) vs. 73 spots/1 x 10(6)). Cellular ELISA indicated that serum titer of antibody against MG7-Ag was significantly higher (P < 0.01) in mice immunized with coencapsulation form nanovaccine (0.7884) than that in the group immunized with nanovaccine encapsulated with MG7 peptide alone (0.3616). Using intracellular flow cytometric analysis, it was found that the IFN-gamma response was contributed by CD4+ T-cells. Our experiments suggest that a vaccinal approach using nano-delivery system carrying in tumoral epitope and CpG ODN as adjuvant may have important implications for cancer therapy.

Identification and Evolution of Functional Alleles of the Previously Described Pollen Specific Myrosinase Pseudogene AtTGG6 in Arabidopsis thaliana.

PubMed

Fu, Lili; Han, Bingying; Tan, Deguan; Wang, Meng; Ding, Mei; Zhang, Jiaming

2016-02-22

Myrosinases are β-thioglucoside glucohydrolases and serve as defense mechanisms against insect pests and pathogens by producing toxic compounds. AtTGG6 in Arabidopsis thaliana was previously reported to be a myrosinase pseudogene but specifically expressed in pollen. However, we found that AlTGG6, an ortholog to AtTGG6 in A. lyrata (an outcrossing relative of A. thaliana) was functional, suggesting that functional AtTGG6 alleles may still exist in A. thaliana. AtTGG6 alleles in 29 A. thaliana ecotypes were cloned and sequenced. Results indicate that ten alleles were functional and encoded Myr II type myrosinase of 512 amino acids, and myrosinase activity was confirmed by overexpressing AtTGG6 in Pichia pastoris. However, the 19 other ecotypes had disabled alleles with highly polymorphic frame-shift mutations and diversified sequences. Thirteen frame-shift mutation types were identified, which occurred independently many times in the evolutionary history within a few thousand years. The functional allele was expressed specifically in pollen similar to the disabled alleles but at a higher expression level, suggesting its role in defense of pollen against insect pests such as pollen beetles. However, the defense function may have become less critical after A. thaliana evolved to self-fertilization, and thus resulted in loss of function in most ecotypes.

Comparative anatomy of chromosomal domains with imprinted and non-imprinted allele-specific DNA methylation.

PubMed

Paliwal, Anupam; Temkin, Alexis M; Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

2013-08-01

Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM.

Comparative Anatomy of Chromosomal Domains with Imprinted and Non-Imprinted Allele-Specific DNA Methylation

PubMed Central

Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L.; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

2013-01-01

Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM. PMID:24009515

H19 Induces Abdominal Aortic Aneurysm Development and Progression.

PubMed

Li, Daniel Y; Busch, Albert; Jin, Hong; Chernogubova, Ekaterina; Pelisek, Jaroslav; Karlsson, Joakim; Sennblad, Bengt; Liu, Shengliang; Lao, Shen; Hofmann, Patrick; Bäcklund, Alexandra; Eken, Suzanne M; Roy, Joy; Eriksson, Per; Dacken, Brian; Ramanujam, Deepak; Dueck, Anne; Engelhardt, Stefan; Boon, Reinier A; Eckstein, Hans-Henning; Spin, Joshua M; Tsao, Philip S; Maegdefessel, Lars

2018-04-18

Background -Long noncoding RNAs (lncRNAs) have emerged as critical molecular regulators in various biological processes and diseases. Here we sought to identify and functionally characterize lncRNAs as potential mediators in abdominal aortic aneurysm (AAA) development. Methods -We profiled RNA transcript expression in two murine AAA models, Angiotensin II (ANGII) infusion in ApoE-/- mice ( n =8) and porcine pancreatic elastase (PPE) instillation in C57BL/6 wildtype mice ( n =12). The lncRNA H19 was identified as one of the most highly up-regulated transcripts in both mouse aneurysm models compared to sham-operated controls. This was confirmed by qRT-PCR and in situ hybridization. Results -Experimental knock-down of H19, utilizing site-specific antisense oligonucleotides (LNA-GapmeRs) in vivo , significantly limited aneurysm growth in both models. Upregulated H19 correlated with smooth muscle cell (SMC) content and SMC apoptosis in progressing aneurysms. Importantly, a similar pattern could be observed in human AAA tissue samples, and in a novel preclinical LDLR-/- Yucatan mini-pig aneurysm model. In vitro knock-down of H19 markedly decreased apoptotic rates of cultured human aortic SMCs, while overexpression of H19 had the opposite effect. Notably, H19-dependent apoptosis mechanisms in SMCs appeared to be independent of miR-675, which is embedded in the first exon of the H19 gene. A customized transcription factor array identified hypoxia-inducible factor 1-alpha (HIF1α) as the main downstream effector. Increased SMC apoptosis was associated with cytoplasmic interaction between H19 and HIF1α and sequential p53 stabilization. Additionally, H19 induced transcription of HIF1α via recruiting the transcription factor specificity protein 1 (Sp1) to the promoter region. Conclusions -The lncRNA H19 is a novel regulator of SMC survival in AAA development and progression. Inhibition of H19 expression might serve as a novel molecular therapeutic target for aortic aneurysm

QuASAR-MPRA: accurate allele-specific analysis for massively parallel reporter assays.

PubMed

Kalita, Cynthia A; Moyerbrailean, Gregory A; Brown, Christopher; Wen, Xiaoquan; Luca, Francesca; Pique-Regi, Roger

2018-03-01

The majority of the human genome is composed of non-coding regions containing regulatory elements such as enhancers, which are crucial for controlling gene expression. Many variants associated with complex traits are in these regions, and may disrupt gene regulatory sequences. Consequently, it is important to not only identify true enhancers but also to test if a variant within an enhancer affects gene regulation. Recently, allele-specific analysis in high-throughput reporter assays, such as massively parallel reporter assays (MPRAs), have been used to functionally validate non-coding variants. However, we are still missing high-quality and robust data analysis tools for these datasets. We have further developed our method for allele-specific analysis QuASAR (quantitative allele-specific analysis of reads) to analyze allele-specific signals in barcoded read counts data from MPRA. Using this approach, we can take into account the uncertainty on the original plasmid proportions, over-dispersion, and sequencing errors. The provided allelic skew estimate and its standard error also simplifies meta-analysis of replicate experiments. Additionally, we show that a beta-binomial distribution better models the variability present in the allelic imbalance of these synthetic reporters and results in a test that is statistically well calibrated under the null. Applying this approach to the MPRA data, we found 602 SNPs with significant (false discovery rate 10%) allele-specific regulatory function in LCLs. We also show that we can combine MPRA with QuASAR estimates to validate existing experimental and computational annotations of regulatory variants. Our study shows that with appropriate data analysis tools, we can improve the power to detect allelic effects in high-throughput reporter assays. http://github.com/piquelab/QuASAR/tree/master/mpra. fluca@wayne.edu or rpique@wayne.edu. Supplementary data are available online at Bioinformatics. © The Author (2017). Published by

The nucleotides responsible for the direct physical contact between the chromatin insulator protein CTCF and the H19 imprinting control region manifest parent of origin-specific long-distance insulation and methylation-free domains

PubMed Central

Pant, Vinod; Mariano, Piero; Kanduri, Chandrasekhar; Mattsson, Anita; Lobanenkov, Victor; Heuchel, Rainer; Ohlsson, Rolf

2003-01-01

The repression of the maternally inherited Igf2 allele has been proposed to depend on a methylation-sensitive chromatin insulator organized by the 11 zinc finger protein CTCF at the H19 imprinting control region (ICR). Here we document that point mutations of the nucleotides in physical contact with CTCF within the endogenous H19 ICR lead to loss of CTCF binding and Igf2 imprinting only when passaged through the female germline. This effect is accompanied by a significant loss of methylation protection of the maternally derived H19 ICR. Because CTCF interacts with other imprinting control regions, it emerges as a central factor responsible for interpreting and propagating gamete-derived epigenetic marks and for organizing epigenetically controlled expression domains. PMID:12629040

Allele-specific copy-number discovery from whole-genome and whole-exome sequencing

PubMed Central

Wang, WeiBo; Wang, Wei; Sun, Wei; Crowley, James J.; Szatkiewicz, Jin P.

2015-01-01

Copy-number variants (CNVs) are a major form of genetic variation and a risk factor for various human diseases, so it is crucial to accurately detect and characterize them. It is conceivable that allele-specific reads from high-throughput sequencing data could be leveraged to both enhance CNV detection and produce allele-specific copy number (ASCN) calls. Although statistical methods have been developed to detect CNVs using whole-genome sequence (WGS) and/or whole-exome sequence (WES) data, information from allele-specific read counts has not yet been adequately exploited. In this paper, we develop an integrated method, called AS-GENSENG, which incorporates allele-specific read counts in CNV detection and estimates ASCN using either WGS or WES data. To evaluate the performance of AS-GENSENG, we conducted extensive simulations, generated empirical data using existing WGS and WES data sets and validated predicted CNVs using an independent methodology. We conclude that AS-GENSENG not only predicts accurate ASCN calls but also improves the accuracy of total copy number calls, owing to its unique ability to exploit information from both total and allele-specific read counts while accounting for various experimental biases in sequence data. Our novel, user-friendly and computationally efficient method and a complete analytic protocol is freely available at https://sourceforge.net/projects/asgenseng/. PMID:25883151

Association of Tissue-Specific DNA Methylation Alterations with α-Thalassemia Southeast Asian Deletion

PubMed Central

Pangeson, Tanapat; Sanguansermsri, Phanchana; Sanguansermsri, Torpong; Seeratanachot, Teerapat; Suwanakhon, Narutchala; Srikummool, Metawee; Kaewkong, Worasak; Mahingsa, Khwanruedee

2017-01-01

In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA) deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA. PMID:29162979

CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

PubMed

Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

2007-09-01

The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG Pattern

Analysis of novel sph (spherocytosis) alleles in mice reveals allele-specific loss of band 3 and adducin in α-spectrin–deficient red cells

PubMed Central

Robledo, Raymond F.; Lambert, Amy J.; Birkenmeier, Connie S.; Cirlan, Marius V.; Cirlan, Andreea Flavia M.; Campagna, Dean R.; Lux, Samuel E.

2010-01-01

Five spontaneous, allelic mutations in the α-spectrin gene, Spna1, have been identified in mice (spherocytosis [sph], sph1J, sph2J, sph2BC, sphDem). All cause severe hemolytic anemia. Here, analysis of 3 new alleles reveals previously unknown consequences of red blood cell (RBC) spectrin deficiency. In sph3J, a missense mutation (H2012Y) in repeat 19 introduces a cryptic splice site resulting in premature termination of translation. In sphIhj, a premature stop codon occurs (Q1853Stop) in repeat 18. Both mutations result in markedly reduced RBC membrane spectrin content, decreased band 3, and absent β-adducin. Reevaluation of available, previously described sph alleles reveals band 3 and adducin deficiency as well. In sph4J, a missense mutation occurs in the C-terminal EF hand domain (C2384Y). Notably, an equally severe hemolytic anemia occurs despite minimally decreased membrane spectrin with normal band 3 levels and present, although reduced, β-adducin. The severity of anemia in sph4J indicates that the highly conserved cysteine residue at the C-terminus of α-spectrin participates in interactions critical to membrane stability. The data reinforce the notion that a membrane bridge in addition to the classic protein 4.1-p55-glycophorin C linkage exists at the RBC junctional complex that involves interactions between spectrin, adducin, and band 3. PMID:20056793

Analysis of novel sph (spherocytosis) alleles in mice reveals allele-specific loss of band 3 and adducin in alpha-spectrin-deficient red cells.

PubMed

Robledo, Raymond F; Lambert, Amy J; Birkenmeier, Connie S; Cirlan, Marius V; Cirlan, Andreea Flavia M; Campagna, Dean R; Lux, Samuel E; Peters, Luanne L

2010-03-04

Five spontaneous, allelic mutations in the alpha-spectrin gene, Spna1, have been identified in mice (spherocytosis [sph], sph(1J), sph(2J), sph(2BC), sph(Dem)). All cause severe hemolytic anemia. Here, analysis of 3 new alleles reveals previously unknown consequences of red blood cell (RBC) spectrin deficiency. In sph(3J), a missense mutation (H2012Y) in repeat 19 introduces a cryptic splice site resulting in premature termination of translation. In sph(Ihj), a premature stop codon occurs (Q1853Stop) in repeat 18. Both mutations result in markedly reduced RBC membrane spectrin content, decreased band 3, and absent beta-adducin. Reevaluation of available, previously described sph alleles reveals band 3 and adducin deficiency as well. In sph(4J), a missense mutation occurs in the C-terminal EF hand domain (C2384Y). Notably, an equally severe hemolytic anemia occurs despite minimally decreased membrane spectrin with normal band 3 levels and present, although reduced, beta-adducin. The severity of anemia in sph(4J) indicates that the highly conserved cysteine residue at the C-terminus of alpha-spectrin participates in interactions critical to membrane stability. The data reinforce the notion that a membrane bridge in addition to the classic protein 4.1-p55-glycophorin C linkage exists at the RBC junctional complex that involves interactions between spectrin, adducin, and band 3.

PanGEA: identification of allele specific gene expression using the 454 technology.

PubMed

Kofler, Robert; Teixeira Torres, Tatiana; Lelley, Tamas; Schlötterer, Christian

2009-05-14

Next generation sequencing technologies hold great potential for many biological questions. While mainly used for genomic sequencing, they are also very promising for gene expression profiling. Sequencing of cDNA does not only provide an estimate of the absolute expression level, it can also be used for the identification of allele specific gene expression. We developed PanGEA, a tool which enables a fast and user-friendly analysis of allele specific gene expression using the 454 technology. PanGEA allows mapping of 454-ESTs to genes or whole genomes, displaying gene expression profiles, identification of SNPs and the quantification of allele specific gene expression. The intuitive GUI of PanGEA facilitates a flexible and interactive analysis of the data. PanGEA additionally implements a modification of the Smith-Waterman algorithm which deals with incorrect estimates of homopolymer length as occuring in the 454 technology To our knowledge, PanGEA is the first tool which facilitates the identification of allele specific gene expression. PanGEA is distributed under the Mozilla Public License and available at: http://www.kofler.or.at/bioinformatics/PanGEA

PanGEA: Identification of allele specific gene expression using the 454 technology

PubMed Central

Kofler, Robert; Teixeira Torres, Tatiana; Lelley, Tamas; Schlötterer, Christian

2009-01-01

Background Next generation sequencing technologies hold great potential for many biological questions. While mainly used for genomic sequencing, they are also very promising for gene expression profiling. Sequencing of cDNA does not only provide an estimate of the absolute expression level, it can also be used for the identification of allele specific gene expression. Results We developed PanGEA, a tool which enables a fast and user-friendly analysis of allele specific gene expression using the 454 technology. PanGEA allows mapping of 454-ESTs to genes or whole genomes, displaying gene expression profiles, identification of SNPs and the quantification of allele specific gene expression. The intuitive GUI of PanGEA facilitates a flexible and interactive analysis of the data. PanGEA additionally implements a modification of the Smith-Waterman algorithm which deals with incorrect estimates of homopolymer length as occuring in the 454 technology Conclusion To our knowledge, PanGEA is the first tool which facilitates the identification of allele specific gene expression. PanGEA is distributed under the Mozilla Public License and available at: PMID:19442283

CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

PubMed Central

Qiao, Huan; May, James M.

2013-01-01

SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.

PubMed

Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A

2004-09-01

Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.

Allele-specific copy-number discovery from whole-genome and whole-exome sequencing.

PubMed

Wang, WeiBo; Wang, Wei; Sun, Wei; Crowley, James J; Szatkiewicz, Jin P

2015-08-18

Copy-number variants (CNVs) are a major form of genetic variation and a risk factor for various human diseases, so it is crucial to accurately detect and characterize them. It is conceivable that allele-specific reads from high-throughput sequencing data could be leveraged to both enhance CNV detection and produce allele-specific copy number (ASCN) calls. Although statistical methods have been developed to detect CNVs using whole-genome sequence (WGS) and/or whole-exome sequence (WES) data, information from allele-specific read counts has not yet been adequately exploited. In this paper, we develop an integrated method, called AS-GENSENG, which incorporates allele-specific read counts in CNV detection and estimates ASCN using either WGS or WES data. To evaluate the performance of AS-GENSENG, we conducted extensive simulations, generated empirical data using existing WGS and WES data sets and validated predicted CNVs using an independent methodology. We conclude that AS-GENSENG not only predicts accurate ASCN calls but also improves the accuracy of total copy number calls, owing to its unique ability to exploit information from both total and allele-specific read counts while accounting for various experimental biases in sequence data. Our novel, user-friendly and computationally efficient method and a complete analytic protocol is freely available at https://sourceforge.net/projects/asgenseng/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Direct Fluorescence Detection of Allele-Specific PCR Products Using Novel Energy-Transfer Labeled Primers.

PubMed

Winn-Deen

1998-12-01

Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe.

Predicting aberrant CpG island methylation

PubMed Central

Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

2003-01-01

Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

Predicting aberrant CpG island methylation.

PubMed

Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

2003-10-14

Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

Rapid single nucleotide polymorphism based method for hematopoietic chimerism analysis and monitoring using high-speed droplet allele-specific PCR and allele-specific quantitative PCR.

PubMed

Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Uehara, Masayuki; Sugano, Mitsutoshi; Okumura, Nobuo; Honda, Takayuki

2015-05-20

Chimerism analysis is important for the evaluation of engraftment and predicting relapse following hematopoietic stem cell transplantation (HSCT). We developed a chimerism analysis for single nucleotide polymorphisms (SNPs), including rapid screening of the discriminable donor/recipient alleles using droplet allele-specific PCR (droplet-AS-PCR) pre-HSCT and quantitation of recipient DNA using AS-quantitative PCR (AS-qPCR) following HSCT. SNP genotyping of 20 donor/recipient pairs via droplet-AS-PCR and the evaluation of the informativity of 5 SNP markers for chimerism analysis were performed. Samples from six follow-up patients were analyzed to assess the chimerism via AS-qPCR. These results were compared with that determined by short tandem repeat PCR (STR-PCR). Droplet-AS-PCR could determine genotypes within 8min. The total informativity using all 5 loci was 95% (19/20). AS-qPCR provided the percentage of recipient DNA in all 6 follow-up patients without influence of the stutter peak or the amplification efficacy, which affected the STR-PCR results. The droplet-AS-PCR had an advantage over STR-PCR in terms of rapidity and simplicity for screening before HSCT. Furthermore, AS-qPCR had better accuracy than STR-PCR for quantification of recipient DNA following HSCT. The present chimerism assay compensates for the disadvantages of STR-PCR and is readily performable in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

Multiple Avirulence Loci and Allele-Specific Effector Recognition Control the Pm3 Race-Specific Resistance of Wheat to Powdery Mildew[OPEN

PubMed Central

Roffler, Stefan; Stirnweis, Daniel; Treier, Georges; Herren, Gerhard; Korol, Abraham B.; Wicker, Thomas

2015-01-01

In cereals, several mildew resistance genes occur as large allelic series; for example, in wheat (Triticum aestivum and Triticum turgidum), 17 functional Pm3 alleles confer agronomically important race-specific resistance to powdery mildew (Blumeria graminis). The molecular basis of race specificity has been characterized in wheat, but little is known about the corresponding avirulence genes in powdery mildew. Here, we dissected the genetics of avirulence for six Pm3 alleles and found that three major Avr loci affect avirulence, with a common locus_1 involved in all AvrPm3-Pm3 interactions. We cloned the effector gene AvrPm3a2/f2 from locus_2, which is recognized by the Pm3a and Pm3f alleles. Induction of a Pm3 allele-dependent hypersensitive response in transient assays in Nicotiana benthamiana and in wheat demonstrated specificity. Gene expression analysis of Bcg1 (encoded by locus_1) and AvrPm3 a2/f2 revealed significant differences between isolates, indicating that in addition to protein polymorphisms, expression levels play a role in avirulence. We propose a model for race specificity involving three components: an allele-specific avirulence effector, a resistance gene allele, and a pathogen-encoded suppressor of avirulence. Thus, whereas a genetically simple allelic series controls specificity in the plant host, recognition on the pathogen side is more complex, allowing flexible evolutionary responses and adaptation to resistance genes. PMID:26452600

A survey of FRAXE allele sizes in three populations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhong, N.; Ju, W.; Curley, D.

1996-08-09

FRAXE is a fragile site located at Xq27-8, which contains polymorphic triplet GCC repeats associated with a CpG island. Similar to FRAXA, expansion of the GCC repeats results in an abnormal methylation of the CpG island and is associated with a mild mental retardation syndrome (FRAXE-MR). We surveyed the GCC repeat alleles of FRAXE from 3 populations. A total of 665 X chromosomes including 416 from a New York Euro-American sample (259 normal and 157 with FRAXA mutations), 157 from a Chinese sample (144 normal and 13 FRAXA), and 92 from a Finnish sample (56 normal and 36 FRAXA) weremore » analyzed by polymerase chain reaction. Twenty-seven alleles, ranging from 4 to 39 GCC repeats, were observed. The modal repeat number was 16 in the New York and Finnish samples and accounted for 24% of all the chromosomes tested (162/665). The modal repeat number in the Chinese sample was 18. A founder effect for FRAXA was suggested among the Finnish FRAXA samples in that 75% had the FRAXE 16 repeat allele versus only 30% of controls. Sequencing of the FRAXE region showed no imperfections within the GCC repeat region, such as those commonly seen in FRAXA. The smaller size and limited range of repeats and the lack of imperfections suggests the molecular mechanisms underlying FRAXE triplet mutations may be different from those underlying FRAXA. 27 refs., 4 figs., 1 tab.« less

Allele-specific Characterization of Alanine: Glyoxylate Aminotransferase Variants Associated with Primary Hyperoxaluria

PubMed Central

Lage, Melissa D.; Pittman, Adrianne M. C.; Roncador, Alessandro; Cellini, Barbara; Tucker, Chandra L.

2014-01-01

Primary Hyperoxaluria Type 1 (PH1) is a rare autosomal recessive kidney stone disease caused by deficiency of the peroxisomal enzyme alanine: glyoxylate aminotransferase (AGT), which is involved in glyoxylate detoxification. Over 75 different missense mutations in AGT have been found associated with PH1. While some of the mutations have been found to affect enzyme activity, stability, and/or localization, approximately half of these mutations are completely uncharacterized. In this study, we sought to systematically characterize AGT missense mutations associated with PH1. To facilitate analysis, we used two high-throughput yeast-based assays: one that assesses AGT specific activity, and one that assesses protein stability. Approximately 30% of PH1-associated missense mutations are found in conjunction with a minor allele polymorphic variant, which can interact to elicit complex effects on protein stability and trafficking. To better understand this allele interaction, we functionally characterized each of 34 mutants on both the major (wild-type) and minor allele backgrounds, identifying mutations that synergize with the minor allele. We classify these mutants into four distinct categories depending on activity/stability results in the different alleles. Twelve mutants were found to display reduced activity in combination with the minor allele, compared with the major allele background. When mapped on the AGT dimer structure, these mutants reveal localized regions of the protein that appear particularly sensitive to interactions with the minor allele variant. While the majority of the deleterious effects on activity in the minor allele can be attributed to synergistic interaction affecting protein stability, we identify one mutation, E274D, that appears to specifically affect activity when in combination with the minor allele. PMID:24718375

Structure of allelic variants of subtype 5 of histone H1 in pea Pisum sativum L.

PubMed

Bogdanova, V S; Lester, D R; Berdnikov, V A; Andersson, I

2005-06-01

The pea genome contains seven histone H1 genes encoding different subtypes. Previously, the DNA sequence of only one gene, His1, coding for the subtype H1-1, had been identified. We isolated a histone H1 allele from a pea genomic DNA library. Data from the electrophoretic mobility of the pea H1 subtypes and their N-bromosuccinimide cleavage products indicated that the newly isolated gene corresponded to the H1-5 subtype encoded by His5. We confirmed this result by sequencing the gene from three pea lines with H1-5 allelic variants of altered electrophoretic mobility. The allele of the slow H1-5 variant differed from the standard allele by a nucleotide substitution that caused the replacement of the positively charged lysine with asparagine in the DNA-interacting domain of the histone molecule. A temperature-related occurrence had previously been demonstrated for this H1-5 variant in a study on a worldwide collection of pea germplasm. The variant tended to occur at higher frequencies in geographic regions with a cold climate. The fast allelic variant of H1-5 displayed a deletion resulting in the loss of a duplicated pentapeptide in the C-terminal domain.

Allelic inhibition of displacement activity: a simplified one tube allele-specific PCR for evaluation of ITPA polymorphisms.

PubMed

Galmozzi, E; Facchetti, F; Degasperi, E; Aghemo, A; Lampertico, P

2013-02-01

Recently, genome-wide association studies (GWAS) in patients with chronic hepatitis C virus (HCV) infection have identified two functional single nucleotide polymorphisms (SNPs) in the inosine triphosphatase (ITPA) gene, that are associated strongly and independently with hemolytic anemia in patients exposed to pegylated-interferon (Peg-IFN) plus ribavirin (RBV) combined therapy. Here has been developed a simplified allele discrimination polymerase chain reaction (PCR) assay named allelic inhibition of displacement activity (AIDA) for evaluation of ITPA polymorphisms. AIDA system relies on three unlabeled primers only, two outer common primers and one inner primer with allele-specific 3' terminus mismatch. DNA samples from 192 patients with chronic HCV infection were used to validate the AIDA system and results were compared with the gold standard TaqMan(®) SNP genotyping assay. Concordant data were obtained for all samples, granting for high specificity of the method. In conclusion, AIDA is a practical one-tube method to reproducibly and to assess accurately rs7270101 and rs1127354 ITPA SNPs. Copyright © 2012 Elsevier B.V. All rights reserved.

Development of allele-specific multiplex PCR to determine the length of poly-T in intron 8 of CFTR

PubMed Central

Prada, Anne E.

2014-01-01

Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation analysis has been implemented for Cystic Fibrosis (CF) carrier screening, and molecular diagnosis of CF and congenital bilateral absence of the vas deferens (CBAVD). Although poly-T allele analysis in intron 8 of CFTR is required when a patient is positive for R117H, it is not recommended for routine carrier screening. Therefore, commercial kits for CFTR mutation analysis were designed either to mask the poly-T allele results, unless a patient is R117H positive, or to have the poly-T analysis as a standalone reflex test using the same commercial platform. There are other standalone assays developed to detect poly-T alleles, such as heteroduplex analysis, High Resolution Melting (HRM) curve analysis, allele-specific PCR (AS-PCR) and Sanger sequencing. In this report, we developed a simple and easy-to-implement multiplex AS-PCR assay using unlabeled standard length primers, which can be used as a reflex or standalone test for CFTR poly-T track analysis. Out of 115 human gDNA samples tested, results from our new AS-PCR matched to the previous known poly-T results or results from Sanger sequencing. PMID:25071991

Cas9/sgRNA selective targeting of the P23H Rhodopsin mutant allele for treating retinitis pigmentosa by intravitreal AAV9.PHP.B-based delivery.

PubMed

Giannelli, Serena G; Luoni, Mirko; Castoldi, Valerio; Massimino, Luca; Cabassi, Tommaso; Angeloni, Debora; Demontis, Gian Carlo; Leocani, Letizia; Andreazzoli, Massimiliano; Broccoli, Vania

2018-03-01

P23H is the most common mutation in the RHODOPSIN (RHO) gene leading to a dominant form of retinitis pigmentosa (RP), a rod photoreceptor degeneration that invariably causes vision loss. Specific disruption of the disease P23H RHO mutant while preserving the wild-type (WT) functional allele would be an invaluable therapy for this disease. However, various technologies tested in the past failed to achieve effective changes and consequently therapeutic benefits. We validated a CRISPR/Cas9 strategy to specifically inactivate the P23H RHO mutant, while preserving the WT allele in vitro. We, then, translated this approach in vivo by delivering the CRISPR/Cas9 components in murine Rho+/P23H mutant retinae. Targeted retinae presented a high rate of cleavage in the P23H but not WT Rho allele. This gene manipulation was sufficient to slow photoreceptor degeneration and improve retinal functions. To improve the translational potential of our approach, we tested intravitreal delivery of this system by means of adeno-associated viruses (AAVs). To this purpose, the employment of the AAV9-PHP.B resulted the most effective in disrupting the P23H Rho mutant. Finally, this approach was translated successfully in human cells engineered with the homozygous P23H RHO gene mutation. Overall, this is a significant proof-of-concept that gene allele specific targeting by CRISPR/Cas9 technology is specific and efficient and represents an unprecedented tool for treating RP and more broadly dominant genetic human disorders affecting the eye, as well as other tissues.

Molecular Basis of Allele-Specific Efficacy of a Blood-Stage Malaria Vaccine: Vaccine Development Implications

PubMed Central

Ouattara, Amed; Takala-Harrison, Shannon; Thera, Mahamadou A.; Coulibaly, Drissa; Niangaly, Amadou; Saye, Renion; Tolo, Youssouf; Dutta, Sheetij; Heppner, D. Gray; Soisson, Lorraine; Diggs, Carter L.; Vekemans, Johan; Cohen, Joe; Blackwelder, William C.; Dube, Tina; Laurens, Matthew B.; Doumbo, Ogobara K.; Plowe, Christopher V.

2013-01-01

The disappointing efficacy of blood-stage malaria vaccines may be explained in part by allele-specific immune responses that are directed against polymorphic epitopes on blood-stage antigens. FMP2.1/AS02A, a blood-stage candidate vaccine based on apical membrane antigen 1 (AMA1) from the 3D7 strain of Plasmodium falciparum, had allele-specific efficacy against clinical malaria in a phase II trial in Malian children. We assessed the cross-protective efficacy of the malaria vaccine and inferred which polymorphic amino acid positions in AMA1 were the targets of protective allele-specific immune responses. FMP2.1/AS02A had the highest efficacy against AMA1 alleles that were identical to the 3D7 vaccine-type allele at 8 highly polymorphic amino acid positions in the cluster 1 loop (c1L) but differed from 3D7 elsewhere in the molecule. Comparison of the incidence of vaccine-type alleles before and after vaccination in the malaria vaccine and control groups and examination of the patterns of allele change at polymorphic positions in consecutive malaria episodes suggest that the highly polymorphic amino acid position 197 in c1L was the most critical determinant of allele-specific efficacy. These results indicate that a multivalent AMA1 vaccine with broad efficacy could include only a limited set of key alleles of this extremely polymorphic antigen. PMID:23204168

A dinucleotide motif in oligonucleotides shows potent immunomodulatory activity and overrides species-specific recognition observed with CpG motif.

PubMed

Kandimalla, Ekambar R; Bhagat, Lakshmi; Zhu, Fu-Gang; Yu, Dong; Cong, Yan-Ping; Wang, Daqing; Tang, Jimmy X; Tang, Jin-Yan; Knetter, Cathrine F; Lien, Egil; Agrawal, Sudhir

2003-11-25

Bacterial and synthetic DNAs containing CpG dinucleotides in specific sequence contexts activate the vertebrate immune system through Toll-like receptor 9 (TLR9). In the present study, we used a synthetic nucleoside with a bicyclic heterobase [1-(2'-deoxy-beta-d-ribofuranosyl)-2-oxo-7-deaza-8-methyl-purine; R] to replace the C in CpG, resulting in an RpG dinucleotide. The RpG dinucleotide was incorporated in mouse- and human-specific motifs in oligodeoxynucleotides (oligos) and 3'-3-linked oligos, referred to as immunomers. Oligos containing the RpG motif induced cytokine secretion in mouse spleen-cell cultures. Immunomers containing RpG dinucleotides showed activity in transfected-HEK293 cells stably expressing mouse TLR9, suggesting direct involvement of TLR9 in the recognition of RpG motif. In J774 macrophages, RpG motifs activated NF-kappa B and mitogen-activated protein kinase pathways. Immunomers containing the RpG dinucleotide induced high levels of IL-12 and IFN-gamma, but lower IL-6 in time- and concentration-dependent fashion in mouse spleen-cell cultures costimulated with IL-2. Importantly, immunomers containing GTRGTT and GARGTT motifs were recognized to a similar extent by both mouse and human immune systems. Additionally, both mouse- and human-specific RpG immunomers potently stimulated proliferation of peripheral blood mononuclear cells obtained from diverse vertebrate species, including monkey, pig, horse, sheep, goat, rat, and chicken. An immunomer containing GTRGTT motif prevented conalbumin-induced and ragweed allergen-induced allergic inflammation in mice. We show that a synthetic bicyclic nucleotide is recognized in the C position of a CpG dinucleotide by immune cells from diverse vertebrate species without bias for flanking sequences, suggesting a divergent nucleotide motif recognition pattern of TLR9.

Hepatocellular carcinomas of the albumin SV40 T-antigen transgenic rat display fetal-like re-expression of lgf2 and deregulation of H19.

PubMed

Czarny, Matthew J; Babcock, Karlee; Baus, Rebecca M; Manoharan, Herbert; Pitot, Henry C

2007-09-01

Previous studies in our laboratory have shown that one of the earliest events during hepatocarcinogenesis in the albumin SV40 T antigen (Alb SV40 T Ag) transgenic rat is the duplication of chromosome 1q3.7-4.3, a region which contains the imprinted and coordinately regulated genes Igf2 and H19. We have also shown that this duplication is associated with the biallelic expression of the normally monoallelically-expressed H19. These results, however, are seemingly at odds with studies in the mouse that have shown a conservation of fetal regulatory patterns of these two genes in hepatic neoplasms. We therefore aimed in this study to determine the allelic origin of Igf2 expression in hepatocellular carcinomas of the Alb SV40 T Ag transgenic rat. Sprague-Dawley Alb SV40 T Ag transgenic rats and Brown Norway rats were reciprocally mated and the expression of Igf2 in hepatocellular carcinomas of the resulting F(1) transgene-positive female rats was analyzed by Northern blotting and RT-PCR. We determined that Igf2 was expressed exclusively from the paternal allele, which prompted the study (by the same methods) of the allelic origin of H19 in the same hepatocellular carcinomas in order to determine if the two genes remained coordinately regulated. Our results demonstrate fetal-like re-expression of Igf2 and deregulation of H19 in singular hepatocellular carcinomas of the rat. These results imply that another regulatory mechanism other than the generally accepted ICR/CTCF mechanism may play a role in the control of Igf2 and H19 expression. (c) 2007 Wiley-Liss, Inc.

Detection of nucleotide-specific CRISPR/Cas9 modified alleles using multiplex ligation detection

PubMed Central

KC, R.; Srivastava, A.; Wilkowski, J. M.; Richter, C. E.; Shavit, J. A.; Burke, D. T.; Bielas, S. L.

2016-01-01

CRISPR/Cas9 genome-editing has emerged as a powerful tool to create mutant alleles in model organisms. However, the precision with which these mutations are created has introduced a new set of complications for genotyping and colony management. Traditional gene-targeting approaches in many experimental organisms incorporated exogenous DNA and/or allele specific sequence that allow for genotyping strategies based on binary readout of PCR product amplification and size selection. In contrast, alleles created by non-homologous end-joining (NHEJ) repair of double-stranded DNA breaks generated by Cas9 are much less amenable to such strategies. Here we describe a novel genotyping strategy that is cost effective, sequence specific and allows for accurate and efficient multiplexing of small insertion-deletions and single-nucleotide variants characteristic of CRISPR/Cas9 edited alleles. We show that ligation detection reaction (LDR) can be used to generate products that are sequence specific and uniquely detected by product size and/or fluorescent tags. The method works independently of the model organism and will be useful for colony management as mutant alleles differing by a few nucleotides become more prevalent in experimental animal colonies. PMID:27557703

Extensive variation between tissues in allele specific expression in an outbred mammal.

PubMed

Chamberlain, Amanda J; Vander Jagt, Christy J; Hayes, Benjamin J; Khansefid, Majid; Marett, Leah C; Millen, Catriona A; Nguyen, Thuy T T; Goddard, Michael E

2015-11-23

Allele specific gene expression (ASE), with the paternal allele more expressed than the maternal allele or vice versa, appears to be a common phenomenon in humans and mice. In other species the extent of ASE is unknown, and even in humans and mice there are several outstanding questions. These include; to what extent is ASE tissue specific? how often does the direction of allele expression imbalance reverse between tissues? how often is only one of the two alleles expressed? is there a genome wide bias towards expression of the paternal or maternal allele; and finally do genes that are nearby on a chromosome share the same direction of ASE? Here we use gene expression data (RNASeq) from 18 tissues from a single cow to investigate each of these questions in turn, and then validate some of these findings in two tissues from 20 cows. Between 40 and 100 million sequence reads were generated per tissue across three replicate samples for each of the eighteen tissues from the single cow (the discovery dataset). A bovine gene expression atlas was created (the first from RNASeq data), and differentially expressed genes in each tissue were identified. To analyse ASE, we had access to unambiguously phased genotypes for all heterozygous variants in the cow's whole genome sequence, where these variants were homozygous in the whole genome sequence of her sire, and as a result we were able to map reads to parental genomes, to determine SNP and genes showing ASE in each tissue. In total 25,251 heterozygous SNP within 7985 genes were tested for ASE in at least one tissue. ASE was pervasive, 89 % of genes tested had significant ASE in at least one tissue. This large proportion of genes displaying ASE was confirmed in the two tissues in a validation dataset. For individual tissues the proportion of genes showing significant ASE varied from as low as 8-16 % of those tested in thymus to as high as 71-82 % of those tested in lung. There were a number of cases where the direction of

iASeq: integrative analysis of allele-specificity of protein-DNA interactions in multiple ChIP-seq datasets

PubMed Central

2012-01-01

Background ChIP-seq provides new opportunities to study allele-specific protein-DNA binding (ASB). However, detecting allelic imbalance from a single ChIP-seq dataset often has low statistical power since only sequence reads mapped to heterozygote SNPs are informative for discriminating two alleles. Results We develop a new method iASeq to address this issue by jointly analyzing multiple ChIP-seq datasets. iASeq uses a Bayesian hierarchical mixture model to learn correlation patterns of allele-specificity among multiple proteins. Using the discovered correlation patterns, the model allows one to borrow information across datasets to improve detection of allelic imbalance. Application of iASeq to 77 ChIP-seq samples from 40 ENCODE datasets and 1 genomic DNA sample in GM12878 cells reveals that allele-specificity of multiple proteins are highly correlated, and demonstrates the ability of iASeq to improve allelic inference compared to analyzing each individual dataset separately. Conclusions iASeq illustrates the value of integrating multiple datasets in the allele-specificity inference and offers a new tool to better analyze ASB. PMID:23194258

Formulation of vaccines containing CpG oligonucleotides and alum

PubMed Central

Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

2007-01-01

CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

Developmentally Programmed 3′ CpG Island Methylation Confers Tissue- and Cell-Type-Specific Transcriptional Activation

PubMed Central

Yu, Da-Hai; Ware, Carol; Waterland, Robert A.; Zhang, Jiexin; Chen, Miao-Hsueh; Gadkari, Manasi; Kunde-Ramamoorthy, Govindarajan; Nosavanh, Lagina M.

2013-01-01

During development, a small but significant number of CpG islands (CGIs) become methylated. The timing of developmentally programmed CGI methylation and associated mechanisms of transcriptional regulation during cellular differentiation, however, remain poorly characterized. Here, we used genome-wide DNA methylation microarrays to identify epigenetic changes during human embryonic stem cell (hESC) differentiation. We discovered a group of CGIs associated with developmental genes that gain methylation after hESCs differentiate. Conversely, erasure of methylation was observed at the identified CGIs during subsequent reprogramming to induced pluripotent stem cells (iPSCs), further supporting a functional role for the CGI methylation. Both global gene expression profiling and quantitative reverse transcription-PCR (RT-PCR) validation indicated opposing effects of CGI methylation in transcriptional regulation during differentiation, with promoter CGI methylation repressing and 3′ CGI methylation activating transcription. By studying diverse human tissues and mouse models, we further confirmed that developmentally programmed 3′ CGI methylation confers tissue- and cell-type-specific gene activation in vivo. Importantly, luciferase reporter assays provided evidence that 3′ CGI methylation regulates transcriptional activation via a CTCF-dependent enhancer-blocking mechanism. These findings expand the classic view of mammalian CGI methylation as a mechanism for transcriptional silencing and indicate a functional role for 3′ CGI methylation in developmental gene regulation. PMID:23459939

Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

NASA Astrophysics Data System (ADS)

Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

1997-09-01

Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

Allele-specific cytokine responses at the HLA-C locus: implications for psoriasis.

PubMed

Hundhausen, Christian; Bertoni, Anna; Mak, Rose K; Botti, Elisabetta; Di Meglio, Paola; Clop, Alex; Laggner, Ute; Chimenti, Sergio; Hayday, Adrian C; Barker, Jonathan N; Trembath, Richard C; Capon, Francesca; Nestle, Frank O

2012-03-01

Psoriasis is an inflammatory skin disorder that is inherited as a complex trait. Genetic studies have repeatedly highlighted HLA-C as the major determinant for psoriasis susceptibility, with the Cw*0602 allele conferring significant disease risk in a wide range of populations. Despite the potential importance of HLA-C variation in psoriasis, either via an effect on peptide presentation or immuno-inhibitory activity, allele-specific expression patterns have not been investigated. Here, we used reporter assays to characterize two regulatory variants, which virtually abolished the response to tumor necrosis factor (TNF)-α (rs2524094) and IFN-γ (rs10657191) in HLA-Cw*0602 and a cluster of related alleles. We validated these findings through the analysis of HLA-Cw*0602 expression in primary keratinocytes treated with TNF-α and IFN-γ. Finally, we showed that HLA-Cw*0602 transcripts are not increased in psoriatic skin lesions, despite highly elevated TNF-α levels. Thus, our findings demonstrate the presence of allele-specific differences in HLA-C expression and indicate that HLA-Cw*0602 is unresponsive to upregulation by key proinflammatory cytokines in psoriasis. These data pave the way for functional studies into the pathogenic role of the major psoriasis susceptibility allele.

Allele-specific cytokine responses at the HLA-C locus, implications for psoriasis

PubMed Central

Hundhausen, Christian; Bertoni, Anna; Mak, Rose K; Botti, Elisabetta; Di Meglio, Paola; Clop, Alex; Laggner, Ute; Chimenti, Sergio; Hayday, Adrian C; Barker, Jonathan N; Trembath, Richard C; Capon, Francesca; Nestle, Frank O

2011-01-01

Psoriasis is an inflammatory skin disorder that is inherited as a complex trait. Genetic studies have repeatedly highlighted HLA-C as the major determinant for psoriasis susceptibility, with the Cw*0602 allele conferring significant disease risk in a wide-range of populations. Despite the potential importance of HLA-C variation in psoriasis, either via an effect on peptide presentation or immuno-inhibitory activity, allele-specific expression patterns have not been investigated. Here, we used reporter assays to characterize two regulatory variants, which virtually abolished the response to TNF-α (rs2524094) and IFN-γ (rs10657191) in HLA-Cw*0602 and a cluster of related alleles. We validated these findings through the analysis of HLA-Cw*0602 expression in primary keratinocytes treated with TNF-α and IFN-γ. Finally, we showed that HLA-Cw*0602 transcripts are not increased in psoriatic skin lesions, despite highly elevated TNF-α levels. Thus, our findings demonstrate the presence of allele-specific differences in HLA-C expression and indicate that HLA-Cw*0602 is unresponsive to up-regulation by key pro-inflammatory cytokines in psoriasis. These data pave the way for functional studies into the pathogenic role of the major psoriasis susceptibility allele. PMID:22113476

A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.

PubMed

Kemp, S J; Maillard, J C; Teale, A J

1993-04-01

A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.

The CpG island searcher: a new WWW resource.

PubMed

Takai, Daiya; Jones, Peter A

2003-01-01

Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

Population-specific documentation of pharmacogenomic markers and their allelic frequencies in FINDbase.

PubMed

Georgitsi, Marianthi; Viennas, Emmanouil; Gkantouna, Vassiliki; Christodoulopoulou, Elena; Zagoriti, Zoi; Tafrali, Christina; Ntellos, Fotios; Giannakopoulou, Olga; Boulakou, Athanassia; Vlahopoulou, Panagiota; Kyriacou, Eva; Tsaknakis, John; Tsakalidis, Athanassios; Poulas, Konstantinos; Tzimas, Giannis; Patrinos, George P

2011-01-01

Population and ethnic group-specific allele frequencies of pharmacogenomic markers are poorly documented and not systematically collected in structured data repositories. We developed the Frequency of Inherited Disorders Pharmacogenomics database (FINDbase-PGx), a separate module of the FINDbase, aiming to systematically document pharmacogenomic allele frequencies in various populations and ethnic groups worldwide. We critically collected and curated 214 scientific articles reporting pharmacogenomic markers allele frequencies in various populations and ethnic groups worldwide. Subsequently, in order to host the curated data, support data visualization and data mining, we developed a website application, utilizing Microsoft™ PivotViewer software. Curated allelic frequency data pertaining to 144 pharmacogenomic markers across 14 genes, representing approximately 87,000 individuals from 150 populations worldwide, are currently included in FINDbase-PGx. A user-friendly query interface allows for easy data querying, based on numerous content criteria, such as population, ethnic group, geographical region, gene, drug and rare allele frequency. FINDbase-PGx is a comprehensive database, which, unlike other pharmacogenomic knowledgebases, fulfills the much needed requirement to systematically document pharmacogenomic allelic frequencies in various populations and ethnic groups worldwide.

BRCA1 allele-specific expression in genetic predisposed breast/ovarian cancer.

PubMed

Jamard, Estelle; Volard, Bertrand; Dugué, Audrey Emmanuelle; Legros, Angelina; Leconte, Alexandra; Clarisse, Bénédicte; Davy, Grégoire; Polycarpe, Florence; Dugast, Catherine; Abadie, Caroline; Frebourg, Thierry; Tinat, Julie; Tennevet, Isabelle; Layet, Valérie; Joly, Florence; Castéra, Laurent; Berthet, Pascaline; Vaur, Dominique; Krieger, Sophie

2017-04-01

Germline allele specific expression (ASE), resulting in a lowered expression of one of the BRCA1 alleles, has been described as a possible predisposition marker in Hereditary Breast or Ovarian Cancer (HBOC), usable for molecular diagnosis in HBOC. The main objective of this prospective case-control study was to compare the proportion of ASE between controls without familial history of breast or ovarian cancer, and HBOC cases without BRCA1 or BRCA2 deleterious mutation. BRCA1 ASE evaluated on three SNPs among controls and HBOC patients without deleterious mutation were assessed by pyrosequencing. The allelic ratios and the proportion of ASE were compared between controls and cases using a Student's t test and a Fisher exact test, respectively. The linearity and reproducibility of the ASE dosage was demonstrated with R 2  > 0.99 and a coefficient of variation below 10 %, and ASE was detected in two positive controls harbouring BRCA1 truncated mutations. In the heterozygote population, composed of 99/264 controls (37.5 %) and 96/227 patients (42.3 %), we detected a 5 % ASE without truncated mutations, in each population. We failed to detect any significant difference of ASE between controls and patients. So far, BRCA1 Allelic specific expression is not usable in routine diagnosis as a possible predisposition marker in HBOC patients except for the detection of truncated mutations.

A Hybrid Approach for CpG Island Detection in the Human Genome.

PubMed

Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

2016-01-01

CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

PubMed

Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

2012-06-06

First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

NASA Technical Reports Server (NTRS)

Nillen, Jeannie L.; Smith, Scott M.

2003-01-01

A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

Japaneseplex: A forensic SNP assay for identification of Japanese people using Japanese-specific alleles.

PubMed

Yuasa, Isao; Akane, Atsushi; Yamamoto, Toshimichi; Matsusue, Aya; Endoh, Minoru; Nakagawa, Mayumi; Umetsu, Kazuo; Ishikawa, Takaki; Iino, Morio

2018-04-24

It is sometimes necessary to determine whether a forensic biological sample came from a Japanese person. In this study, we developed a 60-locus SNP assay designed for the differentiation of Japanese people from other East Asians using entirely and nearly Japanese-specific alleles. This multiplex assay consisted of 6 independent PCR reactions followed by single nucleotide extension. The average number and standard deviation of Japanese-specific alleles possessed by an individual were 0.81 ± 0.93 in 108 Koreans from Seoul, 8.87 ± 2.89 in 103 Japanese from Tottori, 17.20 ± 3.80 in 88 Japanese from Okinawa, and 0 in 220 Han Chinese from Wuxi and Changsha. The Koreans had 0-4 Japanese-specific alleles per individual, whereas the Japanese had 4-26 Japanese-specific alleles. Almost all Japanese were distinguished from the Koreans and other people by the factorial correspondence and principal component analyses. The Snipper program was also useful to estimate the degree of Japaneseness. The method described here was successfully applied to the differentiation of Japanese from non-Japanese people in forensic cases. This Japanese-specific SNP assay was named Japaneseplex. Copyright © 2018 Elsevier B.V. All rights reserved.

GeneiASE: Detection of condition-dependent and static allele-specific expression from RNA-seq data without haplotype information

PubMed Central

Edsgärd, Daniel; Iglesias, Maria Jesus; Reilly, Sarah-Jayne; Hamsten, Anders; Tornvall, Per; Odeberg, Jacob; Emanuelsson, Olof

2016-01-01

Allele-specific expression (ASE) is the imbalance in transcription between maternal and paternal alleles at a locus and can be probed in single individuals using massively parallel DNA sequencing technology. Assessing ASE within a single sample provides a static picture of the ASE, but the magnitude of ASE for a given transcript may vary between different biological conditions in an individual. Such condition-dependent ASE could indicate a genetic variation with a functional role in the phenotypic difference. We investigated ASE through RNA-sequencing of primary white blood cells from eight human individuals before and after the controlled induction of an inflammatory response, and detected condition-dependent and static ASE at 211 and 13021 variants, respectively. We developed a method, GeneiASE, to detect genes exhibiting static or condition-dependent ASE in single individuals. GeneiASE performed consistently over a range of read depths and ASE effect sizes, and did not require phasing of variants to estimate haplotypes. We observed condition-dependent ASE related to the inflammatory response in 19 genes, and static ASE in 1389 genes. Allele-specific expression was confirmed by validation of variants through real-time quantitative RT-PCR, with RNA-seq and RT-PCR ASE effect-size correlations r = 0.67 and r = 0.94 for static and condition-dependent ASE, respectively. PMID:26887787

Allelic divergence and cultivar-specific SSR alleles revealed by capillary electrophoresis using fluorescence-labeled SSR markers in sugarcane

USDA-ARS?s Scientific Manuscript database

Though sugarcane cultivars (Saccharum spp. hybrids) are complex aneu-polyploid hybrids, genetic evaluation and tracking of clone- or cultivar-specific alleles become possible due to capillary electrophoregrams (CE) using fluorescence-labeled SSR primer pairs. Twenty-four sugarcane cultivars, 12 each...

Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

NASA Astrophysics Data System (ADS)

Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

2012-09-01

CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7

Intraperitoneal prophylaxis with CpG oligodeoxynucleotides protects neutropenic mice against intracerebral Escherichia coli K1 infection.

PubMed

Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland

2014-01-23

Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.

Implementation and validation of an improved allele specific stutter filtering method for electropherogram interpretation.

PubMed

Kalafut, Tim; Schuerman, Curt; Sutton, Joel; Faris, Tom; Armogida, Luigi; Bright, Jo-Anne; Buckleton, John; Taylor, Duncan

2018-03-31

Modern probabilistic genotyping (PG) software is capable of modeling stutter as part of the profile weighting statistic. This allows for peaks in stutter positions to be considered as allelic or stutter or both. However, prior to running any sample through a PG calculator, the examiner must first interpret the sample, considering such things as artifacts and number of contributors (NOC or N). Stutter can play a major role both during the assignment of the number of contributors, and the assessment of inclusion and exclusion. If stutter peaks are not filtered when they should be, it can lead to the assignment of an additional contributor, causing N contributors to be assigned as N + 1. If peaks in the stutter position of a major contributor are filtered using a threshold that is too high, true alleles of minor contributors can be lost. Until now, the software used to view the electropherogram stutter filters are based on a locus specific model. Combined stutter peaks occur when a peak could be the result of both back stutter (stutter one repeat shorter than the allele) and forward stutter (stutter one repeat unit larger than the allele). This can challenge existing filters. We present here a novel stutter filter model in the ArmedXpert™ software package that uses a linear model based on allele for back stutter and applies an additive filter for combined stutter. We term this the allele specific stutter model (AM). We compared AM with a traditional model based on locus specific stutter filters (termed LM). This improved stutter model has the benefit of: Instances of over filtering were reduced 78% from 101 for a traditional model (LM) to 22 for the allele specific model (AM) when scored against each other. Instances of under filtering were reduced 80% from 85 (LM) to 17 (AM) when scored against ground truth mixtures. Published by Elsevier B.V.

Analysis of the methylation status of the KCNQ1OT and H19 genes in leukocyte DNA for the diagnosis and prognosis of Beckwith-Wiedemann syndrome.

PubMed

Gaston, V; Le Bouc, Y; Soupre, V; Burglen, L; Donadieu, J; Oro, H; Audry, G; Vazquez, M P; Gicquel, C

2001-06-01

Beckwith-Wiedemann syndrome (BWS) is an overgrowth disorder involving developmental abnormalities, tissue and organ hyperplasia and an increased risk of embryonal tumours (most commonly Wilms tumour). This multigenic disorder is caused by dysregulation of the expression of imprinted genes in the 11p15 chromosomal region. Molecular diagnosis of BWS is currently difficult, mostly due to the large spectrum of genetic and epigenetic abnormalities. The other difficulty in managing BWS is the identification of patients at risk of tumour. An imprinted antisense transcript within KCNQ1, called KCNQ1OT (also known as LIT1), was recently shown to be normally expressed from the paternal allele. A loss of imprinting of the KCNQ1OT gene, associated with the loss of maternal allele-specific methylation of the differentially methylated region KvDMR1 has been described in BWS patients. The principal aim of this study was to evaluate the usefulness of KvDMR1 methylation analysis of leukocyte DNA for the diagnosis of BWS. The allelic status of the 11p15 region and the methylation status of the KCNQ1OT and H19 genes were investigated in leukocyte DNA from 97 patients referred for BWS and classified into two groups according to clinical data: complete BWS (CBWS) (n=61) and incomplete BWS (IBWS) (n=36). Fifty-eight (60%) patients (39/61 CBWS and 19/36 IBWS) displayed abnormal demethylation of KvDMR1. In 11 of the 56 informative cases, demethylation of KvDMR1 was related to 11p15 uniparental disomy (UPD) (nine CBWS and two IBWS). Thirteen of the 39 patients with normal methylation of KvDMR1 displayed hypermethylation of the H19 gene. These 13 patients included two siblings with 11p15 trisomy. These results show that analysis of the methylation status of KvDMR1 and the H19 gene in leukocyte DNA is useful in the diagnosis of 11p15-related overgrowth syndromes, resulting in the diagnosis of BWS in more than 70% of investigated patients. We also evaluated clinical and molecular features as

Genome-wide identification of allele-specific expression (ASE) in response to Marek's disease virus infection using next generation sequencing.

PubMed

Maceachern, Sean; Muir, William M; Crosby, Seth; Cheng, Hans H

2011-06-03

Marek's disease (MD), a T cell lymphoma induced by the highly oncogenic α-herpesvirus Marek's disease virus (MDV), is the main chronic infectious disease concern threatening the poultry industry. Enhancing genetic resistance to MD in commercial poultry is an attractive method to augment MD vaccines, which is currently the control method of choice. In order to optimally implement this control strategy through marker-assisted selection (MAS) and to gain biological information, it is necessary to identify specific genes that influence MD incidence. A genome-wide screen for allele-specific expression (ASE) in response to MDV infection was conducted. The highly inbred ADOL chicken lines 6 (MD resistant) and 7 (MD susceptible) were inter-mated in reciprocal crosses and half of the progeny challenged with MDV. Splenic RNA pools at a single time after infection for each treatment group point were generated, sequenced using a next generation sequencer, then analyzed for allele-specific expression (ASE). To validate and extend the results, Illumina GoldenGate assays for selected cSNPs were developed and used on all RNA samples from all 6 time points following MDV challenge. RNA sequencing resulted in 11-13+ million mappable reads per treatment group, 1.7+ Gb total sequence, and 22,655 high-confidence cSNPs. Analysis of these cSNPs revealed that 5360 cSNPs in 3773 genes exhibited statistically significant allelic imbalance. Of the 1536 GoldenGate assays, 1465 were successfully scored with all but 19 exhibiting evidence for allelic imbalance. ASE is an efficient method to identify potentially all or most of the genes influencing this complex trait. The identified cSNPs can be further evaluated in resource populations to determine their allelic direction and size of effect on genetic resistance to MD as well as being directly implemented in genomic selection programs. The described method, although demonstrated in inbred chicken lines, is applicable to all traits in any

Complete Biallelic Insulation at the H19/Igf2 Imprinting Control Region Position Results in Fetal Growth Retardation and Perinatal Lethality

PubMed Central

Lee, Dong-Hoon; Singh, Purnima; Tsark, Walter M. K.; Szabó, Piroska E.

2010-01-01

Background The H19/Igf2 imprinting control region (ICR) functions as an insulator exclusively in the unmethylated maternal allele, where enhancer-blocking by CTCF protein prevents the interaction between the Igf2 promoter and the distant enhancers. DNA methylation inhibits CTCF binding in the paternal ICR allele. Two copies of the chicken β-globin insulator (ChβGI)2 are capable of substituting for the enhancer blocking function of the ICR. Insulation, however, now also occurs upon paternal inheritance, because unlike the H19 ICR, the (ChβGI)2 does not become methylated in fetal male germ cells. The (ChβGI)2 is a composite insulator, exhibiting enhancer blocking by CTCF and chromatin barrier functions by USF1 and VEZF1. We asked the question whether these barrier proteins protected the (ChβGI)2 sequences from methylation in the male germ line. Methodology/Principal Findings We genetically dissected the ChβGI in the mouse by deleting the binding sites USF1 and VEZF1. The methylation of the mutant versus normal (ChβGI)2 significantly increased from 11% to 32% in perinatal male germ cells, suggesting that the barrier proteins did have a role in protecting the (ChβGI)2 from methylation in the male germ line. Contrary to the H19 ICR, however, the mutant (mChβGI)2 lacked the potential to attain full de novo methylation in the germ line and to maintain methylation in the paternal allele in the soma, where it consequently functioned as a biallelic insulator. Unexpectedly, a stricter enhancer blocking was achieved by CTCF alone than by a combination of the CTCF, USF1 and VEZF1 sites, illustrated by undetectable Igf2 expression upon paternal transmission. Conclusions/Significance In this in vivo model, hypomethylation at the ICR position together with fetal growth retardation mimicked the human Silver-Russell syndrome. Importantly, late fetal/perinatal death occurred arguing that strict biallelic insulation at the H19/Igf2 ICR position is not tolerated in development

Multiple Nucleosome Positioning Sites Regulate the CTCF-Mediated Insulator Function of the H19 Imprinting Control Region†

PubMed Central

Kanduri, Meena; Kanduri, Chandrasekhar; Mariano, Piero; Vostrov, Alexander A.; Quitschke, Wolfgang; Lobanenkov, Victor; Ohlsson, Rolf

2002-01-01

The 5′ region of the H19 gene harbors a methylation-sensitive chromatin insulator within an imprinting control region (ICR). Insertional mutagenesis in combination with episomal assays identified nucleosome positioning sequences (NPSs) that set the stage for the remarkably precise distribution of the four target sites for the chromatin insulator protein CTCF to nucleosome linker sequences in the H19 ICR. Changing positions of the NPSs resulted in loss of both CTCF target site occupancy and insulator function, suggesting that the NPSs optimize the fidelity of the insulator function. We propose that the NPSs ensure the fidelity of the repressed status of the maternal Igf2 allele during development by constitutively maintaining availability of the CTCF target sites. PMID:11971967

Sex-specific allelic transmission bias suggests sexual conflict at MC1R.

PubMed

Ducret, Valérie; Gaigher, Arnaud; Simon, Céline; Goudet, Jérôme; Roulin, Alexandre

2016-09-01

Sexual conflict arises when selection in one sex causes the displacement of the other sex from its phenotypic optimum, leading to an inevitable tension within the genome - called intralocus sexual conflict. Although the autosomal melanocortin-1-receptor gene (MC1R) can generate colour variation in sexually dichromatic species, most previous studies have not considered the possibility that MC1R may be subject to sexual conflict. In the barn owl (Tyto alba), the allele MC1RWHITE is associated with whitish plumage coloration, typical of males, and the allele MC1RRUFOUS is associated with dark rufous coloration, typical of females, although each sex can express any phenotype. Because each colour variant is adapted to specific environmental conditions, the allele MC1RWHITE may be more strongly selected in males and the allele MC1RRUFOUS in females. We therefore investigated whether MC1R genotypes are in excess or deficit in male and female fledglings compared with the expected Hardy-Weinberg proportions. Our results show an overall deficit of 7.5% in the proportion of heterozygotes in males and of 12.9% in females. In males, interannual variation in assortative pairing with respect to MC1R explained the year-specific deviations from Hardy-Weinberg proportions, whereas in females, the deficit was better explained by the interannual variation in the probability of inheriting the MC1RWHITE or MC1RRUFOUS allele. Additionally, we observed that sons inherit the MC1RRUFOUS allele from their fathers on average slightly less often than expected under the first Mendelian law. Transmission ratio distortion may be adaptive in this sexually dichromatic species if males and females are, respectively, selected to display white and rufous plumages. © 2016 John Wiley & Sons Ltd.

A heterozygous IDH1R132H/WT mutation induces genome-wide alterations in DNA methylation.

PubMed

Duncan, Christopher G; Barwick, Benjamin G; Jin, Genglin; Rago, Carlo; Kapoor-Vazirani, Priya; Powell, Doris R; Chi, Jen-Tsan; Bigner, Darell D; Vertino, Paula M; Yan, Hai

2012-12-01

Monoallelic point mutations of the NADP(+)-dependent isocitrate dehydrogenases IDH1 and IDH2 occur frequently in gliomas, acute myeloid leukemias, and chondromas, and display robust association with specific DNA hypermethylation signatures. Here we show that heterozygous expression of the IDH1(R132H) allele is sufficient to induce the genome-wide alterations in DNA methylation characteristic of these tumors. Using a gene-targeting approach, we knocked-in a single copy of the most frequently observed IDH1 mutation, R132H, into a human cancer cell line and profiled changes in DNA methylation at over 27,000 CpG dinucleotides relative to wild-type parental cells. We find that IDH1(R132H/WT) mutation induces widespread alterations in DNA methylation, including hypermethylation of 2010 and hypomethylation of 842 CpG loci. We demonstrate that many of these alterations are consistent with those observed in IDH1-mutant and G-CIMP+ primary gliomas and can segregate IDH wild-type and mutated tumors as well as those exhibiting the G-CIMP phenotype in unsupervised analysis of two primary glioma cohorts. Further, we show that the direction of IDH1(R132H/WT)-mediated DNA methylation change is largely dependent upon preexisting DNA methylation levels, resulting in depletion of moderately methylated loci. Additionally, whereas the levels of multiple histone H3 and H4 methylation modifications were globally increased, consistent with broad inhibition of histone demethylation, hypermethylation at H3K9 in particular accompanied locus-specific DNA hypermethylation at several genes down-regulated in IDH1(R132H/WT) knock-in cells. These data provide insight on epigenetic alterations induced by IDH1 mutations and support a causal role for IDH1(R132H/WT) mutants in driving epigenetic instability in human cancer cells.

Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

PubMed

Najar, Hossain M; Dutz, Jan P

2008-09-01

Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

Elevated hepatic expression of H19 long noncoding RNA contributes to diabetic hyperglycemia.

PubMed

Zhang, Na; Geng, Tingting; Wang, Zhangsheng; Zhang, Ruling; Cao, Tiefeng; Camporez, Joao Paulo; Cai, Shi-Ying; Liu, Ya; Dandolo, Luisa; Shulman, Gerald I; Carmichael, Gordon G; Taylor, Hugh S; Huang, Yingqun

2018-05-17

Excessive hepatic glucose production (HGP) contributes significantly to the hyperglycemia of type 2 diabetes; however, the molecular mechanism underlying this dysregulation remains poorly understood. Here, we show that fasting temporally increases the expression of H19 long noncoding RNA (lncRNA) in nondiabetic mouse liver, whereas its level is chronically elevated in diet-induced diabetic mice, consistent with the previously reported chronic hepatic H19 increase in diabetic patients. Importantly, liver-specific H19 overexpression promotes HGP, hyperglycemia, and insulin resistance, while H19 depletion enhances insulin-dependent suppression of HGP. Using genome-wide methylation and transcriptome analyses, we demonstrate that H19 knockdown in hepatic cells alters promoter methylation and expression of Hnf4a, a master gluconeogenic transcription factor, and that this regulation is recapitulated in vivo. Our findings offer a mechanistic explanation of lncRNA H19's role in the pathogenesis of diabetic hyperglycemia and suggest that targeting hepatic H19 may hold the potential of new treatment for this disease.

Allelic exclusion of the immunoglobulin heavy chain locus is independent of its nuclear localization in mature B cells

PubMed Central

Holwerda, Sjoerd J. B.; van de Werken, Harmen J. G.; Ribeiro de Almeida, Claudia; Bergen, Ingrid M.; de Bruijn, Marjolein J. W.; Verstegen, Marjon J. A. M.; Simonis, Marieke; Splinter, Erik; Wijchers, Patrick J.; Hendriks, Rudi W.; de Laat, Wouter

2013-01-01

In developing B cells, the immunoglobulin heavy chain (IgH) locus is thought to move from repressive to permissive chromatin compartments to facilitate its scheduled rearrangement. In mature B cells, maintenance of allelic exclusion has been proposed to involve recruitment of the non-productive IgH allele to pericentromeric heterochromatin. Here, we used an allele-specific chromosome conformation capture combined with sequencing (4C-seq) approach to unambigously follow the individual IgH alleles in mature B lymphocytes. Despite their physical and functional difference, productive and non-productive IgH alleles in B cells and unrearranged IgH alleles in T cells share many chromosomal contacts and largely reside in active chromatin. In brain, however, the locus resides in a different repressive environment. We conclude that IgH adopts a lymphoid-specific nuclear location that is, however, unrelated to maintenance of allelic exclusion. We additionally find that in mature B cells—but not in T cells—the distal VH regions of both IgH alleles position themselves away from active chromatin. This, we speculate, may help to restrict enhancer activity to the productively rearranged VH promoter element. PMID:23748562

A small asparagine-rich protein required for S-allele-specific pollen rejection in Nicotiana.

PubMed

McClure, B; Mou, B; Canevascini, S; Bernatzky, R

1999-11-09

Although S-locus RNases (S-RNases) determine the specificity of pollen rejection in self-incompatible (SI) solanaceous plants, they alone are not sufficient to cause S-allele-specific pollen rejection. To identify non-S-RNase sequences that are required for pollen rejection, a Nicotiana alata cDNA library was screened by differential hybridization. One clone, designated HT, hybridized strongly to RNA from N. alata styles but not to RNA from Nicotiana plumbaginifolia, a species known to lack one or more factors necessary for S-allele-specific pollen rejection. Sequence analysis revealed a 101-residue ORF including a putative secretion signal and an asparagine-rich domain near the C terminus. RNA blot analysis showed that the HT-transcript accumulates in the stigma and style before anthesis. The timing of HT-expression lags slightly behind S(C10)-RNase in SI N. alata S(C10)S(C10) and is well correlated with the onset of S-allele-specific pollen rejection in the style. An antisense-HT construct was prepared to test for a role in pollen rejection. Transformed (N. plumbaginifolia x SI N. alata S(C10)S(C10)) hybrids with reduced levels of HT-protein continued to express S(C10)-RNase but failed to reject S(C10)-pollen. Control hybrids expressing both S(C10)-RNase and HT-protein showed a normal S-allele-specific pollen rejection response. We conclude that HT-protein is directly implicated in pollen rejection.

Gold nanoparticle–M2e conjugate coformulated with CpG induces protective immunity against influenza A virus

PubMed Central

Tao, Wenqian; Ziemer, Katherine S; Gill, Harvinder S

2014-01-01

Aim: This study aimed to develop a novel influenza A vaccine by conjugating the highly conserved extracellular region of the matrix 2 protein (M2e) of influenza A virus to gold nanoparticles (AuNPs) and to test the vaccine in a mouse influenza challenge model. Materials & methods: Citrate-reduced AuNPs (diameter: 12 nm) were synthesized, and characterized by transmission electron microscopy and dynamic light scattering. M2e was conjugated to AuNPs through thiol–gold interactions to form M2e–AuNP conjugates. Particle stability was confirmed by UV–visible spectra, and M2e conjugation was further characterized by x-ray photoelectron spectroscopy. Mice were immunized with M2e–AuNPs with or without CpG (cytosine-guanine rich oligonucleotide) as an adjuvant with appropriate control groups. Sera was collected and M2e-specific immunoglobulin (IgG) was measured, and immunized mice were challenged with PR8-H1N1 influenza virus. Results: M2e-capped AuNPs could be lyophilized and stably resuspended in water. Intranasal vaccination of mice with M2e–AuNP conjugates induced M2e-specific IgG serum antibodies, which significantly increased upon addition of soluble CpG as adjuvant. Upon challenge with lethal PR8, mice vaccinated with M2e-AuNP conjugates were only partially protected, while mice that received soluble CpG as adjuvant in addition to M2e–AuNP were fully protected. Conclusion: Overall, this study demonstrates the potential of using the M2e–AuNP conjugates with CpG as an adjuvant as a platform for developing an influenza A vaccine. PMID:23829488

[Allelic state of the molecular marker for the golden nematode (Globodera rostochiensis) resistance gene H1 among Ukrainian and world cultivars of potato (Solanum tuberosum ssp. tuberosum)].

PubMed

Karelov, A V; Pilipenko, L A; Kozub, N A; Bondus, R A; Borzykh, A U; Sozinov, I A; Blium, Ia B; Sozinov, A A

2013-01-01

The purpose of our investigation was determination of allelic state of the H1 resistance gene against the pathotypes Ro1 and Ro4 of golden potato cyst nematode (Globodera rostochiensis) among Ukrainian and world potato (Solanum tuberosum ssp. tuberosum) cultivars. The allelic condition of the TG689 marker was determined by PCR with DNA samples isolated from tubers of potato and primers, one pair of which flanks the allele-specific region and the other one was used for the control of DNA quality. Among analyzed 77 potato cultivars the allele of marker associated with the H1-type resistance was found in 74% of Ukrainian and 90% foreign ones although some of those cultivars proved to be susceptible to the golden potato nematode in field. The obtained data confirm the presence of H1-resistance against golden nematode pathotypes Ro1 and Ro4 among the Ukrainian potato cultivars and efficiency of the used marker within the accuracy that has been declared by its authors.

Maternal cell traffic bounds for immune modulation: tracking maternal H-2 alleles in spleens of baby mice by DNA fingerprinting.

PubMed

Wan, Wenhan; Shimizu, Shoji; Ikawa, Hiromichi; Sugiyama, Kiyosh; Yamaguchi, Nobuo

2002-10-01

We have previously reported that the immunization of pregnant mice with T-dependent antigens successfully induced suppression of the antigen-specific plaque-forming cell (PFC) response to the relevant antigens in the offspring. This suppression was not caused by the administered antigens, the antibodies produced by the pregnant mother, or lactational transfer, but was dependent on the presence of the intact maternal T cells. It was major histocompatibility complex (MHC)-restricted manner tolerance, which continued for at least one-sixth of the murine life. Traditionally, the placenta acts as a natural barrier, not allowing the cells to pass through. However, the results presented strongly suggested that maternal T cells pass through the placenta and subsequently induce tolerance. In this present study, we attempted to substantiate the presence of maternal cells in the fetal circulation through the use of molecular techniques. We found that a highly polymorphic microsatellite sequence within the class II Eb gene of the H-2 complex is useful for the molecular detection of various H-2 alleles. DNA polymorphic analysis was used for tracking maternal H-2 alleles in the spleens of baby mice. The main procedure involved polymerase chain reaction amplification and restriction fragment length polymorphism analysis of the DNA sequence encompassing the H-2-specific microsatellite from the genomic DNA of baby mice. The results indicated that maternal T cells of immunized pregnant mice cross the placenta into the fetus, eventually inducing antigen-specific immunological tolerance in the offspring.

Simultaneous genotyping of single-nucleotide polymorphisms in alcoholism-related genes using duplex and triplex allele-specific PCR with two-step thermal cycles.

PubMed

Shirasu, Naoto; Kuroki, Masahide

2014-01-01

We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.

Loss of RNA expression and allele-specific expression associated with congenital heart disease

PubMed Central

McKean, David M.; Homsy, Jason; Wakimoto, Hiroko; Patel, Neil; Gorham, Joshua; DePalma, Steven R.; Ware, James S.; Zaidi, Samir; Ma, Wenji; Patel, Nihir; Lifton, Richard P.; Chung, Wendy K.; Kim, Richard; Shen, Yufeng; Brueckner, Martina; Goldmuntz, Elizabeth; Sharp, Andrew J.; Seidman, Christine E.; Gelb, Bruce D.; Seidman, J. G.

2016-01-01

Congenital heart disease (CHD), a prevalent birth defect occurring in 1% of newborns, likely results from aberrant expression of cardiac developmental genes. Mutations in a variety of cardiac transcription factors, developmental signalling molecules and molecules that modify chromatin cause at least 20% of disease, but most CHD remains unexplained. We employ RNAseq analyses to assess allele-specific expression (ASE) and biallelic loss-of-expression (LOE) in 172 tissue samples from 144 surgically repaired CHD subjects. Here we show that only 5% of known imprinted genes with paternal allele silencing are monoallelic versus 56% with paternal allele expression—this cardiac-specific phenomenon seems unrelated to CHD. Further, compared with control subjects, CHD subjects have a significant burden of both LOE genes and ASE events associated with altered gene expression. These studies identify FGFBP2, LBH, RBFOX2, SGSM1 and ZBTB16 as candidate CHD genes because of significantly altered transcriptional expression. PMID:27670201

DNA methylation modulates H19 and IGF2 expression in porcine female eye

PubMed Central

Wang, Dongxu; Wang, Guodong; Yang, Hao; Liu, Haibo; Li, Cuie; Li, Xiaolan; Lin, Chao; Song, Yuning; Li, Zhanjun; Liu, Dianfeng

2017-01-01

Abstract The sexually dimorphic expression of H19/IGF2 is evolutionarily conserved. To investigate whether the expression of H19/IGF2 in the female porcine eye is sex-dependent, gene expression and methylation status were evaluated using quantitative real-time PCR (qPCR) and bisulfite sequencing PCR (BSP). We hypothesized that H19/IGF2 might exhibit a different DNA methylation status in the female eye. In order to evaluate our hypothesis, parthenogenetic (PA) cells were used for analysis by qPCR and BSP. Our results showed that H19 and IGF2 were over-expressed in the female eye compared with the male eye (3-fold and 2-fold, respectively). We observed a normal monoallelic methylation pattern for H19 differentially methylated regions (DMRs). Compared with H19 DMRs, IGF2 DMRs showed a different methylation pattern in the eye. Taken together, these results suggest that elevated expression of H19/IGF2 is caused by a specific chromatin structure that is regulated by the DNA methylation status of IGF2 DMRs in the female eye. PMID:28266684

Prediction of CpG-island function: CpG clustering vs. sliding-window methods

PubMed Central

2010-01-01

Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

Allele-specific gene expression in a wild nonhuman primate population

PubMed Central

Tung, J.; Akinyi, M. Y.; Mutura, S.; Altmann, J.; Wray, G. A.; Alberts, S. C.

2015-01-01

Natural populations hold enormous potential for evolutionary genetic studies, especially when phenotypic, genetic and environmental data are all available on the same individuals. However, untangling the genotype-phenotype relationship in natural populations remains a major challenge. Here, we describe results of an investigation of one class of phenotype, allele-specific gene expression (ASGE), in the well-studied natural population of baboons of the Amboseli basin, Kenya. ASGE measurements identify cases in which one allele of a gene is overexpressed relative to the alternative allele of the same gene, within individuals, thus providing a control for background genetic and environmental effects. Here, we characterize the incidence of ASGE in the Amboseli baboon population, focusing on the genetic and environmental contributions to ASGE in a set of eleven genes involved in immunity and defence. Within this set, we identify evidence for common ASGE in four genes. We also present examples of two relationships between cis-regulatory genetic variants and the ASGE phenotype. Finally, we identify one case in which this relationship is influenced by a novel gene-environment interaction. Specifically, the dominance rank of an individual’s mother during its early life (an aspect of that individual’s social environment) influences the expression of the gene CCL5 via an interaction with cis-regulatory genetic variation. These results illustrate how environmental and ecological data can be integrated into evolutionary genetic studies of functional variation in natural populations. They also highlight the potential importance of early life environmental variation in shaping the genetic architecture of complex traits in wild mammals. PMID:21226779

New prediction model for probe specificity in an allele-specific extension reaction for haplotype-specific extraction (HSE) of Y chromosome mixtures.

PubMed

Rothe, Jessica; Watkins, Norman E; Nagy, Marion

2012-01-01

Allele-specific extension reactions (ASERs) use 3' terminus-specific primers for the selective extension of completely annealed matches by polymerase. The ability of the polymerase to extend non-specific 3' terminal mismatches leads to a failure of the reaction, a process that is only partly understood and predictable, and often requires time-consuming assay design. In our studies we investigated haplotype-specific extraction (HSE) for the separation of male DNA mixtures. HSE is an ASER and provides the ability to distinguish between diploid chromosomes from one or more individuals. Here, we show that the success of HSE and allele-specific extension depend strongly on the concentration difference between complete match and 3' terminal mismatch. Using the oligonucleotide-modeling platform Visual Omp, we demonstrated the dependency of the discrimination power of the polymerase on match- and mismatch-target hybridization between different probe lengths. Therefore, the probe specificity in HSE could be predicted by performing a relative comparison of different probe designs with their simulated differences between the duplex concentration of target-probe match and mismatches. We tested this new model for probe design in more than 300 HSE reactions with 137 different probes and obtained an accordance of 88%.

Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

PubMed Central

Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

2014-01-01

Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

Linkage disequilibrium between the CYP2C19*2,*17 and CYP2C9*1 alleles and impact of VKORC1, CYP2C9, CYP2C19 gene polymorphisms and gene-gene interactions on warfarin therapy.

PubMed

Khalighi, Koroush; Cheng, Gang; Mirabbasi, Seyedabbas; Khalighi, Bahar; Wu, Yin; Fan, Wuqiang

2017-01-01

Warfarin therapy is complicated by its large inter-individual and intra-individual variability. Both genetic and non-genetic factors can affect warfarin therapy. This study aims to investigate the allele distribution of VKORC1, CYP2C9 and CYP2C19, contribution of different allele variants and possible gene-gene interaction on warfarin therapy. Four hundreds and ninety-two patients were enrolled and single nucleotide polymorphisms for vitamin K epoxide reductase complex subunit 1 (VKORC1), cytochrome P450 CYP2C9 and cytochrome P450 CYP2C19 were genotyped. CYP2C9*1 allele is in complete linkage disequilibrium with CYP2C19*2 and CYP2C19*17 (D' = 1) in our study population. Patient with VKORC1-1639 G > A, CYP2C9*2 and CYP2C9*3 genetic variants need significant lower warfarin dose than patient with wild type allele of VKORC1 1639 G or CYP2C9*1. There is no significant differences between CYP2C19 allele variants for warfarin stable dose and INR > 5 event. Because of the complete linkage disequilibrium between CYP2C19*2,*17 and CYP2C9*1, patient with CYP2C19 *2/*2, *2/*17 and *17/*17 genotypes tend to have higher warfarin dose than patient with CYP2C19*1/*1 genotype. Stepwise regression analysis showed that VKORC1, CYP2C9, body mass index (BMI), age and gender were included as a factor significantly contributing to warfarin dose, whereas CYP2C19 did not contribute to warfarin dose. No statistically significant interaction between CYP2C9 and VKORC1 on warfarin dose and INR > 5 event was detected in univariate general linear model analysis. Our study suggests that polymorphic variants of VKORC1 and CYP2C9 affect warfarin dose independently, whereas CYP2C19 did not contribute to warfarin therapy.

Allele-Specific Chromatin Recruitment and Therapeutic Vulnerabilities of ESR1 Activating Mutations.

PubMed

Jeselsohn, Rinath; Bergholz, Johann S; Pun, Matthew; Cornwell, MacIntosh; Liu, Weihan; Nardone, Agostina; Xiao, Tengfei; Li, Wei; Qiu, Xintao; Buchwalter, Gilles; Feiglin, Ariel; Abell-Hart, Kayley; Fei, Teng; Rao, Prakash; Long, Henry; Kwiatkowski, Nicholas; Zhang, Tinghu; Gray, Nathanael; Melchers, Diane; Houtman, Rene; Liu, X Shirley; Cohen, Ofir; Wagle, Nikhil; Winer, Eric P; Zhao, Jean; Brown, Myles

2018-02-12

Estrogen receptor α (ER) ligand-binding domain (LBD) mutations are found in a substantial number of endocrine treatment-resistant metastatic ER-positive (ER + ) breast cancers. We investigated the chromatin recruitment, transcriptional network, and genetic vulnerabilities in breast cancer models harboring the clinically relevant ER mutations. These mutants exhibit both ligand-independent functions that mimic estradiol-bound wild-type ER as well as allele-specific neomorphic properties that promote a pro-metastatic phenotype. Analysis of the genome-wide ER binding sites identified mutant ER unique recruitment mediating the allele-specific transcriptional program. Genetic screens identified genes that are essential for the ligand-independent growth driven by the mutants. These studies provide insights into the mechanism of endocrine therapy resistance engendered by ER mutations and potential therapeutic targets. Copyright © 2018 Elsevier Inc. All rights reserved.

GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

PubMed

Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

2017-05-24

As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

Allele-Specific PCR for Determination of IL28B Genotype

PubMed Central

Cook, Linda; Diem, Kurt; Kim, Woo; Scott, John D.

2012-01-01

The IL28B genotype is a critical determinant of interferon response in patients infected with hepatitis C virus genotype 1. We describe an allele-specific PCR assay for the IL28B genotype. The assay is simple and robust, uses commonly available real-time PCR instrumentation, and is well suited for clinical laboratories offering IL28B genotyping. PMID:23052312

Characterization of the differentially methylated region of the Impact gene that exhibits Glires-specific imprinting.

PubMed

Okamura, Kohji; Wintle, Richard F; Scherer, Stephen W

2008-01-01

Imprinted genes are exclusively expressed from one of the two parental alleles in a parent-of-origin-specific manner. In mammals, nearly 100 genes are documented to be imprinted. To understand the mechanism behind this gene regulation and to identify novel imprinted genes, common features of DNA sequences have been analyzed; however, the general features required for genomic imprinting have not yet been identified, possibly due to variability in underlying molecular mechanisms from locus to locus. We performed a thorough comparative genomic analysis of a single locus, Impact, which is imprinted only in Glires (rodents and lagomorphs). The fact that Glires and primates diverged from each other as recent as 70 million years ago makes comparisons between imprinted and non-imprinted orthologues relatively reliable. In species from the Glires clade, Impact bears a differentially methylated region, whereby the maternal allele is hypermethylated. Analysis of this region demonstrated that imprinting was not associated with the presence of direct tandem repeats nor with CpG dinucleotide density. In contrast, a CpG periodicity of 8 bp was observed in this region in species of the Glires clade compared to those of carnivores, artiodactyls, and primates. We show that tandem repeats are dispensable, establishment of the differentially methylated region does not rely on G+C content and CpG density, and the CpG periodicity of 8 bp is meaningful to the imprinting. This interval has recently been reported to be optimal for de novo methylation by the Dnmt3a-Dnmt3L complex, suggesting its importance in the establishment of imprinting in Impact and other genes.

Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

DTIC Science & Technology

2005-09-01

tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

Efficient CRISPR-rAAV engineering of endogenous genes to study protein function by allele-specific RNAi.

PubMed

Kaulich, Manuel; Lee, Yeon J; Lönn, Peter; Springer, Aaron D; Meade, Bryan R; Dowdy, Steven F

2015-04-20

Gene knockout strategies, RNAi and rescue experiments are all employed to study mammalian gene function. However, the disadvantages of these approaches include: loss of function adaptation, reduced viability and gene overexpression that rarely matches endogenous levels. Here, we developed an endogenous gene knockdown/rescue strategy that combines RNAi selectivity with a highly efficient CRISPR directed recombinant Adeno-Associated Virus (rAAV) mediated gene targeting approach to introduce allele-specific mutations plus an allele-selective siRNA Sensitive (siSN) site that allows for studying gene mutations while maintaining endogenous expression and regulation of the gene of interest. CRISPR/Cas9 plus rAAV targeted gene-replacement and introduction of allele-specific RNAi sensitivity mutations in the CDK2 and CDK1 genes resulted in a >85% site-specific recombination of Neo-resistant clones versus ∼8% for rAAV alone. RNAi knockdown of wild type (WT) Cdk2 with siWT in heterozygotic knockin cells resulted in the mutant Cdk2 phenotype cell cycle arrest, whereas allele specific knockdown of mutant CDK2 with siSN resulted in a wild type phenotype. Together, these observations demonstrate the ability of CRISPR plus rAAV to efficiently recombine a genomic locus and tag it with a selective siRNA sequence that allows for allele-selective phenotypic assays of the gene of interest while it remains expressed and regulated under endogenous control mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

CpG DNA in the prevention and treatment of infections.

PubMed

Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

2002-01-01

Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

New Prediction Model for Probe Specificity in an Allele-Specific Extension Reaction for Haplotype-Specific Extraction (HSE) of Y Chromosome Mixtures

PubMed Central

Rothe, Jessica; Watkins, Norman E.; Nagy, Marion

2012-01-01

Allele-specific extension reactions (ASERs) use 3′ terminus-specific primers for the selective extension of completely annealed matches by polymerase. The ability of the polymerase to extend non-specific 3′ terminal mismatches leads to a failure of the reaction, a process that is only partly understood and predictable, and often requires time-consuming assay design. In our studies we investigated haplotype-specific extraction (HSE) for the separation of male DNA mixtures. HSE is an ASER and provides the ability to distinguish between diploid chromosomes from one or more individuals. Here, we show that the success of HSE and allele-specific extension depend strongly on the concentration difference between complete match and 3′ terminal mismatch. Using the oligonucleotide-modeling platform Visual Omp, we demonstrated the dependency of the discrimination power of the polymerase on match- and mismatch-target hybridization between different probe lengths. Therefore, the probe specificity in HSE could be predicted by performing a relative comparison of different probe designs with their simulated differences between the duplex concentration of target-probe match and mismatches. We tested this new model for probe design in more than 300 HSE reactions with 137 different probes and obtained an accordance of 88%. PMID:23049901

Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

PubMed Central

Scheiermann, Julia; Klinman, Dennis M.

2014-01-01

Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

CPG2 Recruits Endophilin B2 to the Cytoskeleton for Activity-Dependent Endocytosis of Synaptic Glutamate Receptors.

PubMed

Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly

2016-02-08

Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.

PubMed

Kanai, T H; Ueda, S; Nakamura, T

2000-01-31

Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).

Detection of MPL mutations by a novel allele-specific PCR-based strategy.

PubMed

Furtado, Larissa V; Weigelin, Helmut C; Elenitoba-Johnson, Kojo S J; Betz, Bryan L

2013-11-01

MPL mutation testing is recommended in patients with suspected primary myelofibrosis or essential thrombocythemia who lack the JAK2 V617F mutation. MPL mutations can occur at allelic levels below 15%, which may escape detection by commonly used mutation screening methods such as Sanger sequencing. We developed a novel multiplexed allele-specific PCR assay capable of detecting most recurrent MPL exon 10 mutations associated with primary myelofibrosis and essential thrombocythemia (W515L, W515K, W515A, and S505N) down to a sensitivity of 2.5% mutant allele. Test results were reviewed from 15 reference cases and 1380 consecutive specimens referred to our laboratory for testing. Assay performance was compared to Sanger sequencing across a series of 58 specimens with MPL mutations. Positive cases consisted of 45 with W515L, 6 with S505N, 5 with W515K, 1 with W515A, and 1 with both W515L and S505N. Seven cases had mutations below 5% that were undetected by Sanger sequencing. Ten additional cases had mutation levels between 5% and 15% that were not consistently detected by sequencing. All results were easily interpreted in the allele-specific test. This assay offers a sensitive and reliable solution for MPL mutation testing. Sanger sequencing appears insufficiently sensitive for robust MPL mutation detection. Our data also suggest the relative frequency of S505N mutations may be underestimated, highlighting the necessity for inclusion of this mutation in MPL test platforms. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

DNA methylation analysis of phenotype specific stratified Indian population.

PubMed

Rotti, Harish; Mallya, Sandeep; Kabekkodu, Shama Prasada; Chakrabarty, Sanjiban; Bhale, Sameer; Bharadwaj, Ramachandra; Bhat, Balakrishna K; Dedge, Amrish P; Dhumal, Vikram Ram; Gangadharan, G G; Gopinath, Puthiya M; Govindaraj, Periyasamy; Joshi, Kalpana S; Kondaiah, Paturu; Nair, Sreekumaran; Nair, S N Venugopalan; Nayak, Jayakrishna; Prasanna, B V; Shintre, Pooja; Sule, Mayura; Thangaraj, Kumarasamy; Patwardhan, Bhushan; Valiathan, Marthanda Varma Sankaran; Satyamoorthy, Kapaettu

2015-05-08

DNA methylation and its perturbations are an established attribute to a wide spectrum of phenotypic variations and disease conditions. Indian traditional system practices personalized medicine through indigenous concept of distinctly descriptive physiological, psychological and anatomical features known as prakriti. Here we attempted to establish DNA methylation differences in these three prakriti phenotypes. Following structured and objective measurement of 3416 subjects, whole blood DNA of 147 healthy male individuals belonging to defined prakriti (Vata, Pitta and Kapha) between the age group of 20-30years were subjected to methylated DNA immunoprecipitation (MeDIP) and microarray analysis. After data analysis, prakriti specific signatures were validated through bisulfite DNA sequencing. Differentially methylated regions in CpG islands and shores were significantly enriched in promoters/UTRs and gene body regions. Phenotypes characterized by higher metabolism (Pitta prakriti) in individuals showed distinct promoter (34) and gene body methylation (204), followed by Vata prakriti which correlates to motion showed DNA methylation in 52 promoters and 139 CpG islands and finally individuals with structural attributes (Kapha prakriti) with 23 and 19 promoters and CpG islands respectively. Bisulfite DNA sequencing of prakriti specific multiple CpG sites in promoters and 5'-UTR such as; LHX1 (Vata prakriti), SOX11 (Pitta prakriti) and CDH22 (Kapha prakriti) were validated. Kapha prakriti specific CDH22 5'-UTR CpG methylation was also found to be associated with higher body mass index (BMI). Differential DNA methylation signatures in three distinct prakriti phenotypes demonstrate the epigenetic basis of Indian traditional human classification which may have relevance to personalized medicine.

Polymorphisms and Tissue Expression of the Feline Leukocyte Antigen Class I Loci FLAI-E, -H and -K

PubMed Central

Holmes, Jennifer C.; Holmer, Savannah G.; Ross, Peter; Buntzman, Adam S.; Frelinger, Jeffrey A.; Hess, Paul R.

2013-01-01

Cytotoxic CD8+ T-cell immunosurveillance for intracellular pathogens, such as viruses, is controlled by classical major histocompatibility complex (MHC) class Ia molecules, and ideally, these antiviral T-cell populations are defined by the specific peptide and restricting MHC allele. Surprisingly, despite the utility of the cat in modeling human viral immunity, little is known about the Feline Leukocyte Antigen class I complex (FLAI). Only a few coding sequences with uncertain locus origin and expression patterns have been reported. Of 19 class I genes, 3 loci - FLAI-E, -H and -K – are predicted to encode classical molecules, and our objective was to evaluate their status by analyzing polymorphisms and tissue expression. Using locus-specific, PCR-based genotyping, we amplified 33 FLAI-E, -H, and -K alleles from 12 cats of various breeds, identifying, for the first time, alleles across 3 distinct loci in a feline species. Alleles shared the expected polymorphic and invariant sites in the α1/α2 domains, and full-length cDNA clones possessed all characteristic class Ia exons. Alleles could be assigned to a specific locus with reasonable confidence, although there was evidence of potentially confounding interlocus recombination between FLAI-E and -K. Only FLAI-E, -H and -K-origin alleles were amplified from cDNAs of multiple tissue types. We also defined hypervariable regions across these genes, which permitted the assignment of names to both novel and established alleles. As predicted, FLAI-E, -H, and -K fulfill the major criteria of class Ia genes. These data represent a necessary prerequisite for studying epitope-specific antiviral CD8+ T-cell responses in cats. PMID:23812210

Base Excision Repair of Tandem Modifications in a Methylated CpG Dinucleotide*

PubMed Central

Sassa, Akira; Çağlayan, Melike; Dyrkheeva, Nadezhda S.; Beard, William A.; Wilson, Samuel H.

2014-01-01

Cytosine methylation and demethylation in tracks of CpG dinucleotides is an epigenetic mechanism for control of gene expression. The initial step in the demethylation process can be deamination of 5-methylcytosine producing the TpG alteration and T:G mispair, and this step is followed by thymine DNA glycosylase (TDG) initiated base excision repair (BER). A further consideration is that guanine in the CpG dinucleotide may become oxidized to 7,8-dihydro-8-oxoguanine (8-oxoG), and this could affect the demethylation process involving TDG-initiated BER. However, little is known about the enzymology of BER of altered in-tandem CpG dinucleotides; e.g. Tp8-oxoG. Here, we investigated interactions between this altered dinucleotide and purified BER enzymes, the DNA glycosylases TDG and 8-oxoG DNA glycosylase 1 (OGG1), apurinic/apyrimidinic (AP) endonuclease 1, DNA polymerase β, and DNA ligases. The overall TDG-initiated BER of the Tp8-oxoG dinucleotide is significantly reduced. Specifically, TDG and DNA ligase activities are reduced by a 3′-flanking 8-oxoG. In contrast, the OGG1-initiated BER pathway is blocked due to the 5′-flanking T:G mispair; this reduces OGG1, AP endonuclease 1, and DNA polymerase β activities. Furthermore, in TDG-initiated BER, TDG remains bound to its product AP site blocking OGG1 access to the adjacent 8-oxoG. These results reveal BER enzyme specificities enabling suppression of OGG1-initiated BER and coordination of TDG-initiated BER at this tandem alteration in the CpG dinucleotide. PMID:24695738

Allele-Specific Alternative mRNA processing (ASARP) | Informatics Technology for Cancer Research (ITCR)

Cancer.gov

A software pipeline for prediction of allele-specific alternative RNA processing events using single RNA-seq data. The current version focuses on prediction of alternative splicing and alternative polyadenylation modulated by genetic variants.

Allele-specific control of replication timing and genome organization during development.

PubMed

Rivera-Mulia, Juan Carlos; Dimond, Andrew; Vera, Daniel; Trevilla-Garcia, Claudia; Sasaki, Takayo; Zimmerman, Jared; Dupont, Catherine; Gribnau, Joost; Fraser, Peter; Gilbert, David M

2018-05-07

DNA replication occurs in a defined temporal order known as the replication-timing (RT) program. RT is regulated during development in discrete chromosomal units, coordinated with transcriptional activity and 3D genome organization. Here, we derived distinct cell types from F1 hybrid musculus X castaneus mouse crosses and exploited the high single nucleotide polymorphism (SNP) density to characterize allelic differences in RT (Repli-seq), genome organization (Hi-C and promoter-capture Hi-C), gene expression (total nuclear RNA-seq) and chromatin accessibility (ATAC-seq). We also present HARP: a new computational tool for sorting SNPs in phased genomes to efficiently measure allele-specific genome-wide data. Analysis of six different hybrid mESC clones with different genomes (C57BL/6, 129/sv and CAST/Ei), parental configurations and gender revealed significant RT asynchrony between alleles across ~12% of the autosomal genome linked to sub-species genomes but not to parental origin, growth conditions or gender. RT asynchrony in mESCs strongly correlated with changes in Hi-C compartments between alleles but not SNP density, gene expression, imprinting or chromatin accessibility. We then tracked mESC RT asynchronous regions during development by analyzing differentiated cell types including extraembryonic endoderm stem (XEN) cells, 4 male and female primary mouse embryonic fibroblasts (MEFs) and neural precursor cells (NPCs) differentiated in vitro from mESCs with opposite parental configurations. We found that RT asynchrony and allelic discordance in Hi-C compartments seen in mESCs was largely lost in all differentiated cell types, coordinated with a more uniform Hi-C compartment arrangement, suggesting that genome organization of homologues converges to similar folding patterns during cell fate commitment. Published by Cold Spring Harbor Laboratory Press.

Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

PubMed

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

2011-02-15

Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

Variant ribosomal RNA alleles are conserved and exhibit tissue-specific expression

PubMed Central

Parks, Matthew M.; Kurylo, Chad M.; Dass, Randall A.; Bojmar, Linda; Lyden, David; Vincent, C. Theresa; Blanchard, Scott C.

2018-01-01

The ribosome, the integration point for protein synthesis in the cell, is conventionally considered a homogeneous molecular assembly that only passively contributes to gene expression. Yet, epigenetic features of the ribosomal DNA (rDNA) operon and changes in the ribosome’s molecular composition have been associated with disease phenotypes, suggesting that the ribosome itself may possess inherent regulatory capacity. Analyzing whole-genome sequencing data from the 1000 Genomes Project and the Mouse Genomes Project, we find that rDNA copy number varies widely across individuals, and we identify pervasive intra- and interindividual nucleotide variation in the 5S, 5.8S, 18S, and 28S ribosomal RNA (rRNA) genes of both human and mouse. Conserved rRNA sequence heterogeneities map to functional centers of the assembled ribosome, variant rRNA alleles exhibit tissue-specific expression, and ribosomes bearing variant rRNA alleles are present in the actively translating ribosome pool. These findings provide a critical framework for exploring the possibility that the expression of genomically encoded variant rRNA alleles gives rise to physically and functionally heterogeneous ribosomes that contribute to mammalian physiology and human disease. PMID:29503865

DNA motifs associated with aberrant CpG island methylation.

PubMed

Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M

2006-05-01

Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

B-cell activation with CD40L or CpG measures the function of B-cell subsets and identifies specific defects in immunodeficient patients.

PubMed

Marasco, Emiliano; Farroni, Chiara; Cascioli, Simona; Marcellini, Valentina; Scarsella, Marco; Giorda, Ezio; Piano Mortari, Eva; Leonardi, Lucia; Scarselli, Alessia; Valentini, Diletta; Cancrini, Caterina; Duse, Marzia; Grimsholm, Ola; Carsetti, Rita

2017-01-01

Around 65% of primary immunodeficiencies are antibody deficiencies. Functional tests are useful tools to study B-cell functions in vitro. However, no accepted guidelines for performing and evaluating functional tests have been issued yet. Here, we report our experience on the study of B-cell functions in infancy and throughout childhood. We show that T-independent stimulation with CpG measures proliferation and differentiation potential of memory B cells. Switched memory B cells respond better than IgM memory B cells. On the other hand, CD40L, a T-dependent stimulus, does not induce plasma cell differentiation, but causes proliferation of naïve and memory B cells. During childhood, the production of plasmablasts in response to CpG increases with age mirroring the development of memory B cells. The response to CD40L does not change with age. In patients with selective IgA deficiency (SIgAD), we observed that switched memory B cells are reduced due to the absence of IgA memory B cells. In agreement, IgA plasma cells are not generated in response to CpG. Unexpectedly, B cells from SIgAD patients show a reduced proliferative response to CD40L. Our results demonstrate that functional tests are an important tool to assess the functions of the humoral immune system. © 2016 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Profile analysis and prediction of tissue-specific CpG island methylation classes

PubMed Central

2009-01-01

Background The computational prediction of DNA methylation has become an important topic in the recent years due to its role in the epigenetic control of normal and cancer-related processes. While previous prediction approaches focused merely on differences between methylated and unmethylated DNA sequences, recent experimental results have shown the presence of much more complex patterns of methylation across tissues and time in the human genome. These patterns are only partially described by a binary model of DNA methylation. In this work we propose a novel approach, based on profile analysis of tissue-specific methylation that uncovers significant differences in the sequences of CpG islands (CGIs) that predispose them to a tissue- specific methylation pattern. Results We defined CGI methylation profiles that separate not only between constitutively methylated and unmethylated CGIs, but also identify CGIs showing a differential degree of methylation across tissues and cell-types or a lack of methylation exclusively in sperm. These profiles are clearly distinguished by a number of CGI attributes including their evolutionary conservation, their significance, as well as the evolutionary evidence of prior methylation. Additionally, we assess profile functionality with respect to the different compartments of protein coding genes and their possible use in the prediction of DNA methylation. Conclusion Our approach provides new insights into the biological features that determine if a CGI has a functional role in the epigenetic control of gene expression and the features associated with CGI methylation susceptibility. Moreover, we show that the ability to predict CGI methylation is based primarily on the quality of the biological information used and the relationships uncovered between different sources of knowledge. The strategy presented here is able to predict, besides the constitutively methylated and unmethylated classes, two more tissue specific methylation classes

Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

NASA Astrophysics Data System (ADS)

Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

2015-08-01

In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

Assisted Reproductive Technology affects developmental kinetics, H19 Imprinting Control Region methylation and H19 gene expression in individual mouse embryos

PubMed Central

Fauque, Patricia; Jouannet, Pierre; Lesaffre, Corinne; Ripoche, Marie-Anne; Dandolo, Luisa; Vaiman, Daniel; Jammes, Hélène

2007-01-01

Background In the last few years, an increase in imprinting anomalies has been reported in children born from Assisted Reproductive Technology (ART). Various clinical and experimental studies also suggest alterations of embryo development after ART. Therefore, there is a need for studying early epigenetic anomalies which could result from ART manipulations, especially on single embryos. In this study, we evaluated the impact of superovulation, in vitro fertilization (IVF) and embryo culture conditions on proper genomic imprinting and blastocyst development in single mouse embryos. In this study, different experimental groups were established to obtain embryos from superovulated and non-superovulated females, either from in vivo or in vitro fertilized oocytes, themselves grown in vitro or not. The embryos were cultured either in M16 medium or in G1.2/G2.2 sequential medium. The methylation status of H19 Imprinting Control Region (ICR) and H19 promoter was assessed, as well as the gene expression level of H19, in individual blastocysts. In parallel, we have evaluated embryo cleavage kinetics and recorded morphological data. Results We show that: 1. The culture medium influences early embryo development with faster cleavage kinetics for culture in G1.2/G2.2 medium compared to M16 medium. 2. Epigenetic alterations of the H19 ICR and H19 PP are influenced by the fertilization method since methylation anomalies were observed only in the in vitro fertilized subgroup, however to different degrees according to the culture medium. 3. Superovulation clearly disrupted H19 gene expression in individual blastocysts. Moreover, when embryos were cultured in vitro after either in vivo or in vitro fertilization, the percentage of blastocysts which expressed H19 was higher in G1.2/G2.2 medium compared to M16. Conclusion Compared to previous reports utilizing pools of embryos, our study enables us to emphasize a high individual variability of blastocysts in the H19 ICR and H19

Assisted Reproductive Technology affects developmental kinetics, H19 Imprinting Control Region methylation and H19 gene expression in individual mouse embryos.

PubMed

Fauque, Patricia; Jouannet, Pierre; Lesaffre, Corinne; Ripoche, Marie-Anne; Dandolo, Luisa; Vaiman, Daniel; Jammes, Hélène

2007-10-18

In the last few years, an increase in imprinting anomalies has been reported in children born from Assisted Reproductive Technology (ART). Various clinical and experimental studies also suggest alterations of embryo development after ART. Therefore, there is a need for studying early epigenetic anomalies which could result from ART manipulations, especially on single embryos. In this study, we evaluated the impact of superovulation, in vitro fertilization (IVF) and embryo culture conditions on proper genomic imprinting and blastocyst development in single mouse embryos. In this study, different experimental groups were established to obtain embryos from superovulated and non-superovulated females, either from in vivo or in vitro fertilized oocytes, themselves grown in vitro or not. The embryos were cultured either in M16 medium or in G1.2/G2.2 sequential medium. The methylation status of H19 Imprinting Control Region (ICR) and H19 promoter was assessed, as well as the gene expression level of H19, in individual blastocysts. In parallel, we have evaluated embryo cleavage kinetics and recorded morphological data. We show that: 1. The culture medium influences early embryo development with faster cleavage kinetics for culture in G1.2/G2.2 medium compared to M16 medium. 2. Epigenetic alterations of the H19 ICR and H19 PP are influenced by the fertilization method since methylation anomalies were observed only in the in vitro fertilized subgroup, however to different degrees according to the culture medium. 3. Superovulation clearly disrupted H19 gene expression in individual blastocysts. Moreover, when embryos were cultured in vitro after either in vivo or in vitro fertilization, the percentage of blastocysts which expressed H19 was higher in G1.2/G2.2 medium compared to M16. Compared to previous reports utilizing pools of embryos, our study enables us to emphasize a high individual variability of blastocysts in the H19 ICR and H19 promoter methylation and H19 gene

Huntingtin Haplotypes Provide Prioritized Target Panels for Allele-specific Silencing in Huntington Disease Patients of European Ancestry

PubMed Central

Kay, Chris; Collins, Jennifer A; Skotte, Niels H; Southwell, Amber L; Warby, Simon C; Caron, Nicholas S; Doty, Crystal N; Nguyen, Betty; Griguoli, Annamaria; Ross, Colin J; Squitieri, Ferdinando; Hayden, Michael R

2015-01-01

Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin gene (HTT). Heterozygous polymorphisms in cis with the mutation allow for allele-specific suppression of the pathogenic HTT transcript as a therapeutic strategy. To prioritize target selection, precise heterozygosity estimates are needed across diverse HD patient populations. Here we present the first comprehensive investigation of all common target alleles across the HTT gene, using 738 reference haplotypes from the 1000 Genomes Project and 2364 haplotypes from HD patients and relatives in Canada, Sweden, France, and Italy. The most common HD haplotypes (A1, A2, and A3a) define mutually exclusive sets of polymorphisms for allele-specific therapy in the greatest number of patients. Across all four populations, a maximum of 80% are treatable using these three target haplotypes. We identify a novel deletion found exclusively on the A1 haplotype, enabling potent and selective silencing of mutant HTT in approximately 40% of the patients. Antisense oligonucleotides complementary to the deletion reduce mutant A1 HTT mRNA by 78% in patient cells while sparing wild-type HTT expression. By suppressing specific haplotypes on which expanded CAG occurs, we demonstrate a rational approach to the development of allele-specific therapy for a monogenic disorder. PMID:26201449

Geographically Distinct and Domain-Specific Sequence Variations in the Alleles of Rice Blast Resistance Gene Pib

PubMed Central

Vasudevan, Kumar; Vera Cruz, Casiana M.; Gruissem, Wilhelm; Bhullar, Navreet K.

2016-01-01

Rice blast is caused by Magnaporthe oryzae, which is the most destructive fungal pathogen affecting rice growing regions worldwide. The rice blast resistance gene Pib confers broad-spectrum resistance against Southeast Asian M. oryzae races. We investigated the allelic diversity of Pib in rice germplasm originating from 12 major rice growing countries. Twenty-five new Pib alleles were identified that have unique single nucleotide polymorphisms (SNPs), insertions and/or deletions, in addition to the polymorphic nucleotides that are shared between the different alleles. These partially or completely shared polymorphic nucleotides indicate frequent sequence exchange events between the Pib alleles. In some of the new Pib alleles, nucleotide diversity is high in the LRR domain, whereas, in others it is distributed among the NB-ARC and LRR domains. Most of the polymorphic amino acids in LRR and NB-ARC2 domains are predicted as solvent-exposed. Several of the alleles and the unique SNPs are country specific, suggesting a diversifying selection of alleles in various geographical locations in response to the locally prevalent M. oryzae population. Together, the new Pib alleles are an important genetic resource for rice blast resistance breeding programs and provide new information on rice-M. oryzae interactions at the molecular level. PMID:27446145

CpG Oligodeoxynucleotides Facilitate Delivery of Whole Inactivated H9N2 Influenza Virus via Transepithelial Dendrites of Dendritic Cells in Nasal Mucosa

PubMed Central

Qin, Tao; Yin, Yinyan; Yu, Qinghua; Huang, Lulu; Wang, Xiaoqing; Lin, Jian

2015-01-01

ABSTRACT The spread of the low-pathogenicity avian H9N2 influenza virus has seriously increased the risk of a new influenza pandemic. Although whole inactivated virus (WIV) vaccine via intranasal pathway is the effective method of blocking virus transmission, the mucosal barrier seems to be a major factor hampering its development. CpG oligodeoxynucleotides, a known adjuvant, can target downstream dendritic cells (DCs) and effectively enhance the mucosal and systemic immune responses. However, the ability of CpGs to assist H9N2 WIV in transepithelial transport remains unknown. Here, in vitro and in vivo, we showed that CpGs provided assistance for H9N2 WIV in recruiting DCs to the nasal epithelial cells (ECs) and forming transepithelial dendrites (TEDs) to capture luminal viruses. CD103+ DCs participated in this process. Chemokine CCL20 from nasal ECs played a key role in driving DC recruitment and TED formation. Virus-loaded DCs quickly migrated into the draining cervical lymph nodes (CLNs) for antigen presentation. In addition, the competence of CpGs was independent of direct epithelial transport via the transcellular or paracellular pathway. Taken together, our data demonstrated that CpGs enhanced the transport of H9N2 WIV via TEDs of nasal DCs, which might be a novel mechanism for optimal adaptive immune responses. IMPORTANCE This paper demonstrates by both an in vivo and an in vitro coculture model that CpG oligodeoxynucleotides, known as an adjuvant generally targeting downstream immune responses, also are crucial for the transport of H9N2 WIV across nasal epithelial cells (ECs) via the uptake of transepithelial dendrites (TEDs). Our results prove for the first time to our knowledge that the immune-potentiating mechanism of CpGs is based on strengthening the transepithelial uptake of H9N2 WIV in nasal mucosa. These findings provide a fresh perspective for further improvement of intranasal influenza vaccines, which are urgently needed in the face of the

Glucocorticoid receptor gene expression and promoter CpG modifications throughout the human brain.

PubMed

Cao-Lei, Lei; Suwansirikul, Songkiet; Jutavijittum, Prapan; Mériaux, Sophie B; Turner, Jonathan D; Muller, Claude P

2013-11-01

Glucocorticoids and the glucocorticoid (GR) and mineralocorticoid (MR) receptors have been implicated in many processes, particularly in negative feedback regulation of the hypothalamic-pituitary-adrenal axis. Epigenetically programmed GR alternative promoter usage underlies transcriptional control of GR levels, generation of GR 3' splice variants, and the overall GC response in the brain. No detailed analysis of GR first exons or GR transcript variants throughout the human brain has been reported. Therefore we investigated post mortem tissues from 28 brain regions of 5 individuals. GR first exons were expressed throughout the healthy human brain with no region-specific usage patterns. First exon levels were highly inter-correlated suggesting that they are co-regulated. GR 3' splice variants (GRα and GR-P) were equally distributed in all regions, and GRβ expression was always low. GR/MR ratios showed significant differences between the 28 tissues with the highest ratio in the pituitary gland. Modification levels of individual CpG dinucleotides, including 5-mC and 5-hmC, in promoters 1D, 1E, 1F, and 1H were low, and diffusely clustered; despite significant heterogeneity between the donors. In agreement with this clustering, sum modification levels rather than individual CpG modifications correlated with GR expression. Two-way ANOVA showed that this sum modification was both promoter and brain region specific, but that there was however no promoter*tissue interaction. The heterogeneity between donors may however hide such an interaction. In both promoters 1F and 1H modification levels correlated with GRα expression suggesting that 5-mC and 5-hmC play an important role in fine tuning GR expression levels throughout the brain. Copyright © 2013 Elsevier Ltd. All rights reserved.

Maternal treatment with a high dose of CpG ODN during gestation alters fetal craniofacial and distal limb development in C57BL/6 mice.

PubMed

Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D

2006-01-16

Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine

CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

PubMed Central

Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

2004-01-01

Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use

Molecular genetic mechanisms of allelic specific regulation of murine Comt expression

PubMed Central

Segall, Samantha K.; Shabalina, Svetlana A.; Meloto, Carolina B.; Wen, Xia; Cunningham, Danielle; Tarantino, Lisa M.; Wiltshire, Tim; Gauthier, Josée; Tohyama, Sarasa; Martin, Loren J.; Mogil, Jeffrey S.; Diatchenko, Luda

2015-01-01

Abstract A functional allele of the mouse catechol-O-methyltransferase (Comt) gene is defined by the insertion of a B2 short interspersed repeat element in its 3′-untranslated region (UTR). This allele has been associated with a number of phenotypes, such as pain and anxiety. In comparison with mice carrying the ancestral allele (Comt+), ComtB2i mice show higher Comt mRNA and enzymatic activity levels. Here, we investigated the molecular genetic mechanisms underlying this allelic specific regulation of Comt expression. Insertion of the B2 element introduces an early polyadenylation signal generating a shorter Comt transcript, in addition to the longer ancestral mRNA. Comparative analysis and in silico prediction of Comt mRNA potential targets within the transcript 3′ to the B2 element was performed and allowed choosing microRNA (miRNA) candidates for experimental screening: mmu-miR-3470a, mmu-miR-3470b, and mmu-miR-667. Cell transfection with each miRNA downregulated the expression of the ancestral transcript and COMT enzymatic activity. Our in vivo experiments showed that mmu-miR-667-3p is strongly correlated with decreasing amounts of Comt mRNA in the brain, and lentiviral injections of mmu-miR-3470a, mmu-miR-3470b, and mmu-miR-667 increase hypersensitivity in the mouse formalin model, consistent with reduced COMT activity. In summary, our data demonstrate that the Comt+ transcript contains regulatory miRNA signals in its 3′-untranslated region leading to mRNA degradation; these signals, however, are absent in the shorter transcript, resulting in higher mRNA expression and activity levels. PMID:26067582

Sequenza: allele-specific copy number and mutation profiles from tumor sequencing data.

PubMed

Favero, F; Joshi, T; Marquard, A M; Birkbak, N J; Krzystanek, M; Li, Q; Szallasi, Z; Eklund, A C

2015-01-01

Exome or whole-genome deep sequencing of tumor DNA along with paired normal DNA can potentially provide a detailed picture of the somatic mutations that characterize the tumor. However, analysis of such sequence data can be complicated by the presence of normal cells in the tumor specimen, by intratumor heterogeneity, and by the sheer size of the raw data. In particular, determination of copy number variations from exome sequencing data alone has proven difficult; thus, single nucleotide polymorphism (SNP) arrays have often been used for this task. Recently, algorithms to estimate absolute, but not allele-specific, copy number profiles from tumor sequencing data have been described. We developed Sequenza, a software package that uses paired tumor-normal DNA sequencing data to estimate tumor cellularity and ploidy, and to calculate allele-specific copy number profiles and mutation profiles. We applied Sequenza, as well as two previously published algorithms, to exome sequence data from 30 tumors from The Cancer Genome Atlas. We assessed the performance of these algorithms by comparing their results with those generated using matched SNP arrays and processed by the allele-specific copy number analysis of tumors (ASCAT) algorithm. Comparison between Sequenza/exome and SNP/ASCAT revealed strong correlation in cellularity (Pearson's r = 0.90) and ploidy estimates (r = 0.42, or r = 0.94 after manual inspecting alternative solutions). This performance was noticeably superior to previously published algorithms. In addition, in artificial data simulating normal-tumor admixtures, Sequenza detected the correct ploidy in samples with tumor content as low as 30%. The agreement between Sequenza and SNP array-based copy number profiles suggests that exome sequencing alone is sufficient not only for identifying small scale mutations but also for estimating cellularity and inferring DNA copy number aberrations. © The Author 2014. Published by Oxford University Press on behalf of

The effects of maternal anxiety during pregnancy on IGF2/H19 methylation in cord blood

PubMed Central

Mansell, T; Novakovic, B; Meyer, B; Rzehak, P; Vuillermin, P; Ponsonby, A-L; Collier, F; Burgner, D; Saffery, R; Ryan, J; Vuillermin, Peter; Ponsonby, Anne-Louise; Carlin, John B; Allen, Katie J; Tang, Mimi L; Saffery, Richard; Ranganathan, Sarath; Burgner, David; Dwyer, Terry; Jachno, Kim; Sly, Peter

2016-01-01

Compelling evidence suggests that maternal mental health in pregnancy can influence fetal development. The imprinted genes, insulin-like growth factor 2 (IGF2) and H19, are involved in fetal growth and each is regulated by DNA methylation. This study aimed to determine the association between maternal mental well-being during pregnancy and differentially methylated regions (DMRs) of IGF2 (DMR0) and the IGF2/H19 imprinting control region (ICR) in newborn offspring. Maternal depression, anxiety and perceived stress were assessed at 28 weeks of pregnancy in the Barwon Infant Study (n=576). DNA methylation was measured in purified cord blood mononuclear cells using the Sequenom MassArray Platform. Maternal anxiety was associated with a decrease in average ICR methylation (Δ=−2.23% 95% CI=−3.68 to −0.77%), and across all six of the individual CpG units in anxious compared with non-anxious groups. Birth weight and sex modified the association between prenatal anxiety and infant methylation. When stratified into lower (⩽3530 g) and higher (>3530 g) birth weight groups using the median birth weight, there was a stronger association between anxiety and ICR methylation in the lower birth weight group (Δ=−3.89% 95% CI=−6.06 to −1.72%), with no association in the higher birth weight group. When stratified by infant sex, there was a stronger association in female infants (Δ=−3.70% 95% CI=−5.90 to −1.51%) and no association in males. All the linear regression models were adjusted for maternal age, smoking and folate intake. These findings show that maternal anxiety in pregnancy is associated with decreased IGF2/H19 ICR DNA methylation in progeny at birth, particularly in female, low birth weight neonates. ICR methylation may help link poor maternal mental health and adverse birth outcomes, but further investigation is needed. PMID:27023171

Methylation variable position profiles of hMLH1 promoter CpG islands in human sporadic colorectal carcinoma.

PubMed

Huang, Qing; Huang, Jun-Fu; Zhang, Bo; Baum, Larry; Fu, Wei-Ling

2012-03-01

Aberrant hypermethylation of CpG islands (CGIs) in hMLH1 promoter regions has been well known to play an important role in the tumorigenesis of human sporadic colorectal carcinoma (SCRC). In this study, bisulfite sequencing was performed to analyze the methylation variable positions (MVPs) profiles of hMLH1 promoter CGIs in 30 clinical SCRC patients, and further analysis was carried out to evaluate the associations between the CGI methylation and the clinicopathological features in SCRC. Among the 2 CGIs in the hMLH1 promoter, that is, CGI-I and CGI-II, 20% (6/30) and 13% (4/30) of the patients had methylated CGI-I and CGI-II, respectively. Suppressed expression of hMLH1was significantly correlated with methylation of CGI-I but not CGI-II. Further analysis of the MVP profiles of CGI-I showed that most of the MVPs were hypermethylated and others were poorly methylated or unmethylated. The profiles could be classified into at least 4 groups based on the methylation status of 3 MVPs at positions 21 to 23 in CGI-I. All 6 patients with methylated CGI-I belonged to group I. This result suggests that the above 3 MVPs in CGI-I should be a targeted region to further analyze the epigenetic features of hMLH1 in human SCRC. Our results further suggest that MVP profiling is useful for identifying the aberrantly methylated CGIs associated with suppressed gene expression.

A mass spectrometry-based multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification.

PubMed

Park, Jung Hun; Jang, Hyowon; Jung, Yun Kyung; Jung, Ye Lim; Shin, Inkyung; Cho, Dae-Yeon; Park, Hyun Gyu

2017-05-15

We herein describe a new mass spectrometry-based method for multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification (SDA) reaction. In this method, allele-specific ligation is first performed to discriminate base sequence variations at the SNP site within the PCR-amplified target DNA. The primary ligation probe is extended by a universal primer annealing site while the secondary ligation probe has base sequences as an overhang with a nicking enzyme recognition site and complementary mass marker sequence. The ligation probe pairs are ligated by DNA ligase only at specific allele in the target DNA and the resulting ligated product serves as a template to promote the SDA reaction using a universal primer. This process isothermally amplifies short DNA fragments, called mass markers, to be analyzed by mass spectrometry. By varying the sizes of the mass markers, we successfully demonstrated the multiplex SNP genotyping capability of this method by reliably identifying several BRCA mutations in a multiplex manner with mass spectrometry. Copyright © 2016 Elsevier B.V. All rights reserved.

LncRNA H19 and Target Gene-mediated Cleft Palate Induced by TCDD.

PubMed

Gao, Li Yun; Zhang, Feng Quan; Zhao, Wei Hui; Han, Guang Liang; Wang, Xiao; Li, Qiang; Gao, Shan Shan; Wu, Wei Dong

2017-09-01

This study investigated the role of long non-coding RNAs (lncRNAs) in the development of the palatal tissues. Cleft palates in mice were induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Expression levels of long non-coding RNA H19 (lncRNA H19) and insulin-like growth factor 2 (IGF2) gene were measured by quantitative real-time polymerase chain reaction (qRT-PCR). The rate of occurrence of cleft palate was found to be 100% by TCDD exposure, and TCDD could cause short upper limb, cerebral fissure, webbed neck, and short neck. The expression levels of lncRNA H19 and IGF2 gene specifically showed embryo age-related differences on E13, E14, and E15 in the palatal tissues. The expression levels of lncRNA H19 and IGF2 gene showed an inverse relationship on E13, E14, and E15. These findings demonstrated that lncRNA H19 and IGF2 can mediate the development of mouse cleft palate. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Tapping natural variation at functional level reveals allele specific molecular characteristics of potato invertase Pain-1.

PubMed

Draffehn, Astrid M; Durek, Pawel; Nunes-Nesi, Adriano; Stich, Benjamin; Fernie, Alisdair R; Gebhardt, Christiane

2012-12-01

Biochemical, molecular and genetic studies emphasize the role of the potato vacuolar invertase Pain-1 in the accumulation of reducing sugars in potato tubers upon cold storage, and thereby its influence on the quality of potato chips and French fries. Previous studies showed that natural Pain-1 cDNA alleles were associated with better chip quality and higher tuber starch content. In this study, we focused on the functional characterization of these alleles. A genotype-dependent transient increase of total Pain-1 transcript levels in cold-stored tubers of six different genotypes as well as allele-specific expression patterns were detected. 3D modelling revealed putative structural differences between allelic Pain-1 proteins at the molecule's surface and at the substrate binding site. Furthermore, the yeast SUC2 mutant was complemented with Pain-1 cDNA alleles and enzymatic parameters of the heterologous expressed proteins were measured at 30 and 4 °C. Significant differences between the alleles were detected. The observed functional differences between Pain-1 alleles did not permit final conclusions on the mechanism of their association with tuber quality traits. Our results show that natural allelic variation at the functional level is present in potato, and that the heterozygous genetic background influences the manifestation of this variation. © 2012 Blackwell Publishing Ltd.

[A new human leukocyte antigen class I allele, HLA- B*52:11].

PubMed

Li, Xiao-feng; Zhang, Xu; Zhang, Kun-lian; Chen, Yang; Liu, Xian-zhi; Li, Jian-ping

2011-12-01

To identify and confirm a novel HLA allele. A new human leukocyte antigen class I allele was found during routine HLA genotyping by polymerase chain reaction-sequence specific oligonucleotide probes (PCR-SSOP) and sequencing-based typing (SBT). The novel HLA-B*52 allele was identical to B*52:01:01 with an exception of one base substitution at position 583 of exon 3 where a C was changed to T resulting in codon 195 changed from CAC(H) to TAC(Y). A new HLA class I allele, B*52:11, is identified, and is named officially by the WHO Nomenclature Committee.

Assessing CpG island methylator phenotype, 1p/19q codeletion, and MGMT promoter methylation from epigenome-wide data in the biomarker cohort of the NOA-04 trial

PubMed Central

Wiestler, Benedikt; Capper, David; Hovestadt, Volker; Sill, Martin; Jones, David T.W.; Hartmann, Christian; Felsberg, Joerg; Platten, Michael; Feiden, Wolfgang; Keyvani, Kathy; Pfister, Stefan M.; Wiestler, Otmar D.; Meyermann, Richard; Reifenberger, Guido; Pietsch, Thorsten; von Deimling, Andreas; Weller, Michael; Wick, Wolfgang

2014-01-01

Background Molecular biomarkers including isocitrate dehydrogenase 1 or 2 (IDH1/2) mutation, 1p/19q codeletion, and O6-methylguanine-DNA-methyltransferase (MGMT) promoter methylation may improve prognostication and guide treatment decisions for patients with World Health Organization (WHO) anaplastic gliomas. At present, each marker is individually tested by distinct assays. Illumina Infinium HumanMethylation450 BeadChip arrays (HM450) enable the determination of large-scale methylation profiles and genome-wide DNA copy number changes. Algorithms have been developed to detect the glioma CpG island methylator phenotype (G-CIMP) associated with IDH1/2 mutation, 1p/19q codeletion, and MGMT promoter methylation using a single assay. Methods Here, we retrospectively investigated the diagnostic and prognostic performance of these algorithms in comparison to individual marker testing and patient outcome in the biomarker cohort (n = 115 patients) of the NOA-04 trial. Results Concordance for IDH and 1p/19q status was very high: In 92% of samples, the HM450 and reference data agreed. In discordant samples, survival analysis by Kaplan-Meier and Cox regression analyses suggested a more accurate assessment of biological phenotype by the HM450 analysis. The HM450-derived MGMT-STP27 model to calculate MGMT promoter methylation probability revealed this aberration in a significantly higher fraction of samples than conventional methylation-specific PCR, with 87 of 91 G-CIMP tumors predicted as MGMT promoter-methylated. Pyrosequencing of discordant samples confirmed the HM450 assessment in 14 of 17 cases. Conclusions G-CIMP and 1p/19q codeletion are reliably detectable by HM450 analysis and are associated with prognosis in the NOA-04 trial. For MGMT, HM450 suggests promoter methylation in the vast majority of G-CIMP tumors, which is supported by pyrosequencing. PMID:25028501

CpG Distribution and Methylation Pattern in Porcine Parvovirus

PubMed Central

Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán

2013-01-01

Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033

Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.

PubMed

Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar

2013-10-01

Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.

Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

PubMed Central

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

2010-01-01

Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

Allele-specific siRNA knockdown as a personalized treatment strategy for vascular Ehlers-Danlos syndrome in human fibroblasts.

PubMed

Müller, Gerd A; Hansen, Uwe; Xu, Zhi; Griswold, Benjamin; Talan, Mark I; McDonnell, Nazli B; Briest, Wilfried

2012-02-01

The vascular type of the Ehlers-Danlos syndrome (vEDS) is caused by dominant-negative mutations in the procollagen type III (COL3A1) gene. Patients with this autosomal dominant disorder have a shortened life expectancy due to complications from ruptured vessels or hollow organs. We tested the effectiveness of allele-specific RNA interference (RNAi) to reduce the mutated phenotype in fibroblasts. Small-interfering RNAs (siRNAs) discriminating between wild-type and mutant COL3A1 allele were identified by a luciferase reporter gene assay and in primary fibroblasts from a normal donor and a patient with vEDS. The best discriminative siRNA with the mutation at position 10 resulted in >90% silencing of the mutant allele without affecting the wild-type allele. Transmission and immunogold electron microscopy of extracted extracellular matrices from untreated fibroblasts of the patient with vEDS revealed structurally abnormal fibrils. After siRNA treatment, collagen fibrils became similar to fibrils from fibroblasts of normal and COL3A1 haploinsufficient donors. In addition, it was shown that expression of mutated COL3A1 activates the unfolded protein response and that reduction of the amount of mutated protein by siRNA reduces cellular stress. Taken together, the results provide evidence that allele-specific siRNAs are able to reduce negative effects of mutated COL3A1 proteins. Thus, the application of allele-specific RNAi may be a promising direction for future personalized therapies to reduce the severity of vEDS.

Association of H2A{sup b} with resistance to collagen-induced arthritis in H2-recombinant mouse strains: An allele associated with reduction of several apparently unrelated responses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mitchison, N.A.; Brunner, M.C.

1995-02-01

HLA class II alleles can protect against immunological diseases. Seeking an animal model for a naturally occurring protective allele, we screened a panel of H2-congenic and recombinant mouse strains for ability to protect against collagen-induced arthritis. The strains were crossed with the susceptible strain DBA/1, and the F{sub 1} hybrids immunized with cattle and chicken type II collagen. Hybrids having the H2A{sup b} allele displayed a reduced incidence and duration of the disease. They also had a reduced level of pre-disease inflammation, but not of anti-collagen antibodies. The allele is already known to be associated with reduction of other apparentlymore » unrelated immune responses, suggesting that some form of functional differentiation may operate that is not exclusively related to epitope-binding. It is suggested that this may reflect allelic variation in the class II major histocompatibility complex promoter region. 42 refs., 7 figs., 1 tab.« less

Use of DNA from human stools to detect aberrant CpG island methylation of genes implicated in colorectal cancer.

PubMed

Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T

2004-09-01

Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.

Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles.

PubMed

Aiba, Toshiki; Saito, Toshiyuki; Hayashi, Akiko; Sato, Shinji; Yunokawa, Harunobu; Maruyama, Toru; Fujibuchi, Wataru; Kurita, Hisaka; Tohyama, Chiharu; Ohsako, Seiichiroh

2017-03-09

It has been pointed out that environmental factors or chemicals can cause diseases that are developmental in origin. To detect abnormal epigenetic alterations in DNA methylation, convenient and cost-effective methods are required for such research, in which multiple samples are processed simultaneously. We here present methylated site display (MSD), a unique technique for the preparation of DNA libraries. By combining it with amplified fragment length polymorphism (AFLP) analysis, we developed a new method, MSD-AFLP. Methylated site display libraries consist of only DNAs derived from DNA fragments that are CpG methylated at the 5' end in the original genomic DNA sample. To test the effectiveness of this method, CpG methylation levels in liver, kidney, and hippocampal tissues of mice were compared to examine if MSD-AFLP can detect subtle differences in the levels of tissue-specific differentially methylated CpGs. As a result, many CpG sites suspected to be tissue-specific differentially methylated were detected. Nucleotide sequences adjacent to these methyl-CpG sites were identified and we determined the methylation level by methylation-sensitive restriction endonuclease (MSRE)-PCR analysis to confirm the accuracy of AFLP analysis. The differences of the methylation level among tissues were almost identical among these methods. By MSD-AFLP analysis, we detected many CpGs showing less than 5% statistically significant tissue-specific difference and less than 10% degree of variability. Additionally, MSD-AFLP analysis could be used to identify CpG methylation sites in other organisms including humans. MSD-AFLP analysis can potentially be used to measure slight changes in CpG methylation level. Regarding the remarkable precision, sensitivity, and throughput of MSD-AFLP analysis studies, this method will be advantageous in a variety of epigenetics-based research.

Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

PubMed

Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

2018-01-01

ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

Nucleosome dynamics and maintenance of epigenetic states of CpG islands

NASA Astrophysics Data System (ADS)

Sneppen, Kim; Dodd, Ian B.

2016-06-01

Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

Specific destruction of islet transplants in NOD<-->C57BL/6 and NOD<-->C3H/Tif embryo aggregation chimeras irrespective of allelic differences in beta-cell antigens.

PubMed

Leijon, K; Hillörn, V; Bergqvist, I; Holmberg, D

1995-06-01

We have tested the hypothesis that allelic differences in the antigens expressed by the beta-cells of the islets of Langerhans influence the development of insulitis in the non-obese diabetic (NOD) mouse. Islets of Langerhans from NOD, C57BL/6 and C3H/Tif mice were transplanted under the kidney capsule of NOD<-->C57BL/6 and NOD<-->C3H/Tif embryo aggregation (EA) chimeras and the infiltration was scored 5-7 weeks later. Mononuclear cell infiltration of pancreatic islets was observed in 60% of the NOD<-->C57BL/6 and in 55% of the NOD<-->C3H/Tif EA chimeras. All transplanted EA chimeras that developed insulitis also displayed mononuclear cell infiltrates in the transplants, irrespective of the origin of the transplanted islets. In contrast, no infiltration of transplants was detected in EA chimeras scoring negative for insulitis. These results demonstrate that the specific destruction of islet transplants does not require the expression of NOD specific antigens by the islets. Moreover, the beta-cell destruction appears not to be restricted to NOD-MHC. The correlation between insulitis and transplant beta-cell destruction suggests the possibility that the development of insulitis is a prerequisite for transplant specific destruction. MHC restricted destruction may, therefore, precede the beta-cell destruction of transplanted islets. The chimerism among the mononuclear cells infiltrating the islet transplants was found to correlate with the overall haematopoetic chimerism in each of the individual EA chimeras. This observation suggests that NOD bone marrow, as well as non-NOD bone marrow, generates cells contributing to the beta-cell destruction process.

Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

PubMed

Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

2015-08-01

DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

Influence of cytochrome 2C19 allelic variants on on-treatment platelet reactivity evaluated by five different platelet function tests.

PubMed

Gremmel, Thomas; Kopp, Christoph W; Moertl, Deddo; Seidinger, Daniela; Koppensteiner, Renate; Panzer, Simon; Mannhalter, Christine; Steiner, Sabine

2012-05-01

The antiplatelet effect of clopidogrel has been linked to cytochrome P450 2C19 (CYP2C19) carrier status. The presence of loss of function and gain of function variants were found to have a gene-dose effect on clopidogrel metabolism. However, genotyping is only one aspect of predicting response to clopidogrel and several platelet function tests are available to measure platelet response. Patients and methods We studied the influence of CYP2C19 allelic variants on on-treatment platelet reactivity as assessed by light transmission aggregometry (LTA), the VerifyNow P2Y12 assay, the VASP assay, multiple electrode aggregometry (MEA), and the Impact-R in 288 patients after stenting for cardiovascular disease. Allelic variants of CYP2C19 were determined with the Infiniti® CYP450 2C19+ assay and categorized into four metabolizer states (ultrarapid, extensive, intermediate, poor). Platelet reactivity increased linearly from ultrarapid to poor metabolizers using the VerifyNow P2Y12 assay (P = 0.04), the VASP assay (P = 0.02) and the Impact-R (P = 0.04). The proportion of patients with high on-treatment residual platelet reactivity (HRPR) identified by LTA, the VerifyNow P2Y12 assay and the VASP assay increased when the metabolizer status decreased, while no such relationship could be identified for results of MEA and Impact-R. The presence of loss of function variants (*2/*2, *2-8*/wt, *2/*17) was an independent predictor of HRPR in LTA and the VASP assay while it did not reach statistical significance in the VerifyNow P2Y12 assay, MEA, and the Impact-R. Depending on the type of platelet function test differences in the association of on-treatment platelet reactivity with CYP2C19 carrier status are observed. Copyright © 2011 Elsevier Ltd. All rights reserved.

Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

PubMed

Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

2015-06-01

Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

Distribution of Diego blood group alleles and identification of four novel mutations on exon 19 of SLC4A1 gene in the Chinese Han population by polymerase chain reaction sequence-based typing.

PubMed

Xu, X G; He, J; He, Y M; Tao, S D; Ying, Y L; Zhu, F M; Lv, H J; Yan, L X

2011-04-01

The Diego blood group system plays an important role in transfusion medicine. Genotyping of DI1 and DI2 alleles is helpful for the investigation into haemolytic disease of the newborn (HDN) and for the development of rare blood group databases. Here, we set up a polymerase chain reaction sequence-based typing (PCR-SBT) method for genotyping of Diego blood group alleles. Specific primers for exon 19 of the solute carrier family 4, anion exchanger, member1 (SLC4A1) gene were designed, and our PCR-SBT method was established and optimized for Diego genotyping. A total of 1053 samples from the Chinese Han population and the family members of a rare proband with DI1/DI1 genotype were investigated by the PCR-SBT method. An allele-specific primer PCR (PCR-ASP) was used to verify the reliability of the PCR-SBT method. The frequencies of DI1 and DI2 alleles in the Chinese Han population were 0.0247 and 0.9753, respectively. Six new single nucleotide polymorphisms (SNPs) were found in the sequenced regions of the SLC4A1 gene, and four novel SNPs located in the exon 19, in which one SNP could cause an amino acid alteration of Ala858Ser on erythrocyte anion exchanger protein 1. The genotypes for Diego blood group were identical among 41 selected samples with PCR-ASP and PCR-SBT. The PCR-SBT method can be used in Diego genotyping as a substitute of serological technique when the antisera is lacking and was suitable for screening large numbers of donors in rare blood group databases. © 2010 The Author(s). Vox Sanguinis © 2010 International Society of Blood Transfusion.

Allele-specific expression of the MAOA gene and X chromosome inactivation in in vitro produced bovine embryos.

PubMed

Ferreira, A R; Machado, G M; Diesel, T O; Carvalho, J O; Rumpf, R; Melo, E O; Dode, M A N; Franco, M M

2010-07-01

During embryogenesis, one of the two X chromosomes is inactivated in embryos. The production of embryos in vitro may affect epigenetic mechanisms that could alter the expression of genes related to embryo development and X chromosome inactivation (XCI). The aim of this study was to understand XCI during in vitro, pre-implantation bovine embryo development by characterizing the allele-specific expression pattern of the X chromosome-linked gene, monoamine oxidase A (MAOA). Two pools of ten embryos, comprised of the 4-, 8- to 16-cell, morula, blastocyst, and expanded blastocyst stages, were collected. Total RNA from embryos was isolated, and the RT-PCR-RFLP technique was used to observe expression of the MAOA gene. The DNA amplicons were also sequenced using the dideoxy sequencing method. MAOA mRNA was detected, and allele-specific expression was identified in each pool of embryos. We showed the presence of both the maternal and paternal alleles in the 4-, 8- to 16-cell, blastocyst and expanded blastocyst embryos, but only the maternal allele was present in the morula stage. Therefore, we can affirm that the paternal X chromosome is totally inactivated at the morula stage and reactivated at the blastocyst stage. To our knowledge, this is the first report of allele-specific expression of an X-linked gene that is subject to XCI in in vitro bovine embryos from the 4-cell to expanded blastocyst stages. We have established a pattern of XCI in our in vitro embryo production system that can be useful as a marker to assist the development of new protocols for in vitro embryo production. (c) 2010 Wiley-Liss, Inc.

No association of CpG island methylator phenotype and colorectal cancer survival: population-based study.

PubMed

Jia, Min; Jansen, Lina; Walter, Viola; Tagscherer, Katrin; Roth, Wilfried; Herpel, Esther; Kloor, Matthias; Bläker, Hendrik; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael

2016-11-22

Previous studies have shown adverse effects of CpG island methylator phenotype (CIMP) on colorectal cancer (CRC) prognosis. However, sample sizes were often limited and only few studies were able to adjust for relevant molecular features associated with CIMP. The aim of this study was to investigate the impact of CIMP on CRC survival in a large population-based study with comprehensive adjustment. The CIMP status and other molecular tumour features were analysed in 1385 CRC patients diagnosed between 2003 and 2010. Detailed information were obtained from standardised personal interviews and medical records. During follow-up (median: 4.9 years), we assessed vital status, cause of death and therapy details. Cox proportional hazard regression models were used to estimate adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of survival after CRC. The CIMP-H occurred more frequently in patients with older age, female gender, cancer in the proximal colon, BRAF mutation and microsatellite instability-high (MSI-H). However, CIMP status was not associated with CRC prognosis in CRC patients (HR=1.00; 95% CI=0.72-1.40 for overall survival; HR=0.96; 95% CI=0.65-1.41 for disease-specific survival) or in any of the subgroups. Although CIMP status was associated with the presence of MSI-H and BRAF mutation, the prognostic effects of MSI-H (HR=0.49; 95% CI=0.27-0.90) and BRAF mutation (HR=1.78; 95% CI=1.10-2.84) were independent of CIMP status. Similar benefit of chemotherapy was found for CRC outcomes in both the CIMP-low/negative group and the CIMP-high group. CpG island methylator phenotype was not associated with CRC prognosis after adjusting for other important clinical factors and associated mutations.

No association of CpG island methylator phenotype and colorectal cancer survival: population-based study

PubMed Central

Jia, Min; Jansen, Lina; Walter, Viola; Tagscherer, Katrin; Roth, Wilfried; Herpel, Esther; Kloor, Matthias; Bläker, Hendrik; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael

2016-01-01

Background: Previous studies have shown adverse effects of CpG island methylator phenotype (CIMP) on colorectal cancer (CRC) prognosis. However, sample sizes were often limited and only few studies were able to adjust for relevant molecular features associated with CIMP. The aim of this study was to investigate the impact of CIMP on CRC survival in a large population-based study with comprehensive adjustment. Methods: The CIMP status and other molecular tumour features were analysed in 1385 CRC patients diagnosed between 2003 and 2010. Detailed information were obtained from standardised personal interviews and medical records. During follow-up (median: 4.9 years), we assessed vital status, cause of death and therapy details. Cox proportional hazard regression models were used to estimate adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of survival after CRC. Results: The CIMP-H occurred more frequently in patients with older age, female gender, cancer in the proximal colon, BRAF mutation and microsatellite instability-high (MSI-H). However, CIMP status was not associated with CRC prognosis in CRC patients (HR=1.00; 95% CI=0.72–1.40 for overall survival; HR=0.96; 95% CI=0.65–1.41 for disease-specific survival) or in any of the subgroups. Although CIMP status was associated with the presence of MSI-H and BRAF mutation, the prognostic effects of MSI-H (HR=0.49; 95% CI=0.27–0.90) and BRAF mutation (HR=1.78; 95% CI=1.10–2.84) were independent of CIMP status. Similar benefit of chemotherapy was found for CRC outcomes in both the CIMP-low/negative group and the CIMP-high group. Conclusions: CpG island methylator phenotype was not associated with CRC prognosis after adjusting for other important clinical factors and associated mutations. PMID:27811854

CpG island methylator phenotype (CIMP) in cancer: causes and implications.

PubMed

Teodoridis, Jens M; Hardie, Catriona; Brown, Robert

2008-09-18

Strong evidence exists for a subgroup of tumours, from a variety of tissue types, exhibiting concordant tumour specific DNA methylation: the "CpG island methylator phenotype" (CIMP). Occurrence of CIMP is associated with a range of genetic and environmental factors, although the molecular causes are not well-understood. Both increased expression and aberrant targeting of DNA methyltransferases (DNMTs) could contribute to the occurrence of CIMP. One under-explored area is the possibility that DNA damage may induce or select for CIMP during carcinogenesis or treatment of tumours with chemotherapy. DNA damaging agents can induce DNA damage at guanine rich regions throughout the genome, including CpG islands. This DNA damage can result in stalled DNA synthesis, which will lead to localised increased DNMT1 concentration and therefore potentially increased DNA methylation at these sites. Chemotherapy can select for cells which have increased tolerance to DNA damage due to increased lesion bypass, in some cases by mechanisms which involve inactivation of genes by CpG island methylation. CIMP has been associated with worse patient prognosis, probably due to increased epigenetic plasticity. Therefore, further clinical testing of the diagnostic and prognostic value of the current CIMP markers, as well as increasing our understanding of the molecular causes underlying CIMP are required.

CpG island methylation phenotype (CIMP) in oral cancer: associated with a marked inflammatory response and less aggressive tumour biology.

PubMed

Shaw, Richard J; Hall, Gillian L; Lowe, Derek; Bowers, Naomi L; Liloglou, Triantafillos; Field, John K; Woolgar, Julia A; Risk, Janet M

2007-10-01

Studies in several tumour sites highlight the significance of the CpG island methylation phenotype (CIMP), with distinct features of histology, biological aggression and outcome. We utilise pyrosequencing techniques of quantitative methylation analysis to investigate the presence of CIMP in oral squamous cell carcinoma (OSCC) for the first time, and evaluate its correlation with allelic imbalance, pathology and clinical behaviour. Tumour tissue, control tissue and PBLs were obtained from 74 patients with oral squamous cell carcinoma. Pyrosequencing was used to analyse methylation patterns in 75-200 bp regions of the CpG rich gene promoters of 10 genes with a broad range of cellular functions. Allelic imbalance was investigated using a multiplexed panel of 11 microsatellite markers. Corresponding variables, histopathological staging and grading were correlated with these genetic and epigenetic aberrations. A cluster of tumours with a greater degree of promoter methylation than would be predicted by chance alone (P=0.001) were designated CIMP+ve. This group had less aggressive tumour biology in terms of tumour thickness (p=0.015) and nodal metastasis (P=0.012), this being apparently independent of tumour diameter. Further, it seems that these CIMP+ve tumours excited a greater host inflammatory response (P=0.019). The exact mechanisms underlying CIMP remain obscure but the association with a greater inflammatory host response supports existing theories relating these features in other tumour sites. As CIMP has significant associations with other well documented prognostic indicators, it may prove beneficial to include methylation analyses in molecular risk modelling of tumours.

HLA-B40, B18, B27, and B37 allele discrimination using group-specific amplification and SSCP method.

PubMed

Bannai, M; Tokunaga, K; Lin, L; Ogawa, A; Fujisawa, K; Juji, T

1996-04-01

We developed a system for discriminating HLA-B40, B18, B27, and B37 alleles using a two-step PCR method followed by SSCP analysis. Fragments (0.8 kb) including exon 2, intron 2, and exon 3 were amplified in the first PCR. We used two sets of primers, one specific for HLA-B60-related alleles and the other specific for HLA-B61-related, B18, B27, and B37 alleles. No amplifications of other class I genes or pseudogenes were observed. In the second PCR, exon 2 and exon 3 were amplified separately, using diluents of the first PCR products as templates. HLA-B61-related, B18, B27, B37, and B60-related alleles were clearly discriminated in the SSCP analysis of the second PCR products. In a population study in which B61 alleles were analyzed, B*4003 was detected in two Japanese individuals in addition to two B61 alleles previously reported to occur in Japanese, B*4002 and B*4006. The relative frequencies of B*4002, B*4006, and B*4003 in Japanese were 58, 35, and 6%, respectively. The individuals having B*4003 are the first non-South Americans in whom this allele has been detected. The SSCP banding patterns of 18 HLA-B60-positive Japanese population samples were identical to those of a B*40012 sample for both exon 2 and exon 3. We also demonstrated that the B37 allele occurring in some Japanese is B*3701.

CpG oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by a goose parvovirus vaccine in ducks.

PubMed

Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen

2010-11-23

Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.

Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease.

PubMed

Liu, Yibin; Song, Chen; Ladas, Ioannis; Fitarelli-Kiehl, Mariana; Makrigiorgos, G Mike

2017-04-07

Aberrant methylation changes, often present in a minor allelic fraction in clinical samples such as plasma-circulating DNA (cfDNA), are potentially powerful prognostic and predictive biomarkers in human disease including cancer. We report on a novel, highly-multiplexed approach to facilitate analysis of clinically useful methylation changes in minor DNA populations. Methylation Specific Nuclease-assisted Minor-allele Enrichment (MS-NaME) employs a double-strand-specific DNA nuclease (DSN) to remove excess DNA with normal methylation patterns. The technique utilizes oligonucleotide-probes that direct DSN activity to multiple targets in bisulfite-treated DNA, simultaneously. Oligonucleotide probes targeting unmethylated sequences generate local double stranded regions resulting to digestion of unmethylated targets, and leaving methylated targets intact; and vice versa. Subsequent amplification of the targeted regions results in enrichment of the targeted methylated or unmethylated minority-epigenetic-alleles. We validate MS-NaME by demonstrating enrichment of RARb2, ATM, MGMT and GSTP1 promoters in multiplexed MS-NaME reactions (177-plex) using dilutions of methylated/unmethylated DNA and in DNA from clinical lung cancer samples and matched normal tissue. MS-NaME is a highly scalable single-step approach performed at the genomic DNA level in solution that combines with most downstream detection technologies including Sanger sequencing, methylation-sensitive-high-resolution melting (MS-HRM) and methylation-specific-Taqman-based-digital-PCR (digital Methylight) to boost detection of low-level aberrant methylation-changes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Impact of the Location of CpG Methylation within the GSTP1 Gene on Its Specificity as a DNA Marker for Hepatocellular Carcinoma

PubMed Central

Jain, Surbhi; Boldbaatar, Batbold; Hamilton, James P.; Lin, Selena Y.; Chang, Ting-Tsung; Chen, Shun-Hua; Song, Wei; Meltzer, Stephen J.; Block, Timothy M.; Su, Ying-Hsiu

2012-01-01

Hypermethylation of the glutathione S-transferase π 1 (GSTP1) gene promoter region has been reported to be a potential biomarker to distinguish hepatocellular carcinoma (HCC) from other liver diseases. However, reports regarding how specific a marker it is have ranged from 100% to 0%. We hypothesized that, to a large extent, the variation of specificity depends on the location of the CpG sites analyzed. To test this hypothesis, we compared the methylation status of the GSTP1 promoter region of the DNA isolated from HCC, cirrhosis, hepatitis, and normal liver tissues by bisulfite–PCR sequencing. We found that the 5′ region of the position −48 nt from the transcription start site of the GSTP1 gene is selectively methylated in HCC, whereas the 3′ region is methylated in all liver tissues examined, including normal liver and the HCC tissue. Interestingly, when DNA derived from fetal liver and 11 nonhepatic normal tissue was also examined by bisulfite-PCR sequencing, we found that methylation of the 3′ region of the promoter appeared to be liver-specific. A methylation-specific PCR assay targeting the 5′ region of the promoter was developed and used to quantify the methylated GSTP1 gene in various diseased liver tissues including HCC. When we used an assay targeting the 3′ region, we found that the methylation of the 5′-end of the GSTP1 promoter was significantly more specific than that of the 3′-end (97.1% vs. 60%, p<0.0001 by Fisher's exact test) for distinguishing HCC (n = 120) from hepatitis (n = 35) and cirrhosis (n = 35). Encouragingly, 33.8% of the AFP-negative HCC contained the methylated GSTP1 gene. This study clearly demonstrates the importance of the location of CpG site methylation for HCC specificity and how liver-specific DNA methylation should be considered when an epigenetic DNA marker is studied for detection of HCC. PMID:22536438

TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

PubMed Central

Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

2016-01-01

Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

Parallel gene analysis with allele-specific padlock probes and tag microarrays

PubMed Central

Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

2003-01-01

Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

Unique DNA methylome profiles in CpG island methylator phenotype colon cancers

PubMed Central

Xu, Yaomin; Hu, Bo; Choi, Ae-Jin; Gopalan, Banu; Lee, Byron H.; Kalady, Matthew F.; Church, James M.; Ting, Angela H.

2012-01-01

A subset of colorectal cancers was postulated to have the CpG island methylator phenotype (CIMP), a higher propensity for CpG island DNA methylation. The validity of CIMP, its molecular basis, and its prognostic value remain highly controversial. Using MBD-isolated genome sequencing, we mapped and compared genome-wide DNA methylation profiles of normal, non-CIMP, and CIMP colon specimens. Multidimensional scaling analysis revealed that each specimen could be clearly classified as normal, non-CIMP, and CIMP, thus signifying that these three groups have distinctly different global methylation patterns. We discovered 3780 sites in various genomic contexts that were hypermethylated in both non-CIMP and CIMP colon cancers when compared with normal colon. An additional 2026 sites were found to be hypermethylated in CIMP tumors only; and importantly, 80% of these sites were located in CpG islands. These data demonstrate on a genome-wide level that the additional hypermethylation seen in CIMP tumors occurs almost exclusively at CpG islands and support definitively that these tumors were appropriately named. When these sites were examined more closely, we found that 25% were adjacent to sites that were also hypermethylated in non-CIMP tumors. Thus, CIMP is also characterized by more extensive methylation of sites that are already prone to be hypermethylated in colon cancer. These observations indicate that CIMP tumors have specific defects in controlling both DNA methylation seeding and spreading and serve as an important first step in delineating molecular mechanisms that control these processes. PMID:21990380

Comprehensive analysis of CpG islands in human chromosomes 21 and 22

NASA Astrophysics Data System (ADS)

Takai, Daiya; Jones, Peter A.

2002-03-01

CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

30 CFR 19.6 - Specific requirements for approval.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Specific requirements for approval. 19.6 Section 19.6 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR TESTING, EVALUATION, AND APPROVAL OF MINING PRODUCTS ELECTRIC CAP LAMPS § 19.6 Specific requirements for approval. (a...

S genotyping in Japanese plum and sweet cherry by allele-specific hybridization using streptavidin-coated magnetic beads.

PubMed

Wang, Chun-Lei; Zhang, Zhi-Ping; Tonosaki, Kaoru; Kitashiba, Hiroyasu; Nishio, Takeshi

2013-04-01

We report a rapid and reliable method for S genotyping of Rosaceae fruit trees, which would to be useful for successful planting of cross-compatible cultivars in orchards. Japanese plum (Prunus salicina) and sweet cherry (Prunus avium), belonging to the family Rosaceae, possess gametophytic self-incompatibility controlled by a single polymorphic locus containing at least two linked genes, S-RNase and SFB (S-haplotype-specific F-box gene). For successful planting of cross-compatible cultivars of Rosaceae fruit trees in commercial orchards, it is necessary to obtain information on S genotypes of cultivars. Recently, a method of dot-blot analysis utilizing allele-specific oligonucleotides having sequences of SFB-HVa region has been developed for identification of S haplotypes in Japanese plum and sweet cherry. However, dot-blot hybridization requires considerable time and skill for analysis even of a small number of plant samples. Thus, a quick and efficient method for S genotyping was developed in this study. In this method, instead of a nylon membrane used for dot-blot hybridization, streptavidin-coated magnetic beads are used to immobilize PCR products, which are hybridized with allele-specific oligonucleotide probes. Our improved method allowed us to identify 10 S haplotypes (S-a, S-b, S-c, S-d, S-e, S-f, S-h, S-k, S-7 and S-10) of 13 Japanese plum cultivars and 10 S haplotypes (S-1, S-2, S-3, S-4, S-4', S-5, S-6, S-7, S-9 and S-16) of 13 sweet cherry cultivars utilizing SFB or S-RNase gene polymorphism. This method would be suitable for identification of S genotypes of a small number of plant samples.

An African Ancestry-Specific Allele of CTLA4 Confers Protection against Rheumatoid Arthritis in African Americans

PubMed Central

Kelley, James M.; Hughes, Laura B.; Faggard, Jeffrey D.; Danila, Maria I.; Crawford, Monica H.; Edberg, Yuanqing; Padilla, Miguel A.; Tiwari, Hemant K.; Westfall, Andrew O.; Alarcón, Graciela S.; Conn, Doyt L.; Jonas, Beth L.; Callahan, Leigh F.; Smith, Edwin A.; Brasington, Richard D.; Allison, David B.; Kimberly, Robert P.; Moreland, Larry W.; Edberg, Jeffrey C.; Bridges, S. Louis

2009-01-01

Cytotoxic T-lymphocyte associated protein 4 (CTLA4) is a negative regulator of T-cell proliferation. Polymorphisms in CTLA4 have been inconsistently associated with susceptibility to rheumatoid arthritis (RA) in populations of European ancestry but have not been examined in African Americans. The prevalence of RA in most populations of European and Asian ancestry is ∼1.0%; RA is purportedly less common in black Africans, with little known about its prevalence in African Americans. We sought to determine if CTLA4 polymorphisms are associated with RA in African Americans. We performed a 2-stage analysis of 12 haplotype tagging single nucleotide polymorphisms (SNPs) across CTLA4 in a total of 505 African American RA patients and 712 African American controls using Illumina and TaqMan platforms. The minor allele (G) of the rs231778 SNP was 0.054 in RA patients, compared to 0.209 in controls (4.462×10−26, Fisher's exact). The presence of the G allele was associated with a substantially reduced odds ratio (OR) of having RA (AG+GG genotypes vs. AA genotype, OR 0.19, 95% CI: 0.13–0.26, p = 2.4×10−28, Fisher's exact), suggesting a protective effect. This SNP is polymorphic in the African population (minor allele frequency [MAF] 0.09 in the Yoruba population), but is very rare in other groups (MAF = 0.002 in 530 Caucasians genotyped for this study). Markers associated with RA in populations of European ancestry (rs3087243 [+60C/T] and rs231775 [+49A/G]) were not replicated in African Americans. We found no confounding of association for rs231778 after stratifying for the HLA-DRB1 shared epitope, presence of anti-cyclic citrullinated peptide antibody, or degree of admixture from the European population. An African ancestry-specific genetic variant of CTLA4 appears to be associated with protection from RA in African Americans. This finding may explain, in part, the relatively low prevalence of RA in black African populations. PMID:19300490

48 CFR 19.202 - Specific policies.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Specific policies. 19.202 Section 19.202 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC... consider recommendations of the agency Director of Small and Disadvantaged Business Utilization, or the...

Association of HLA-A and Non-Classical HLA Class I Alleles

PubMed Central

Carlini, Federico; Ferreira, Virginia; Buhler, Stéphane; Tous, Audrey; Eliaou, Jean-François; René, Céline; Chiaroni, Jacques; Picard, Christophe; Di Cristofaro, Julie

2016-01-01

The HLA-A locus is surrounded by HLA class Ib genes: HLA-E, HLA-H, HLA-G and HLA-F. HLA class Ib molecules are involved in immuno-modulation with a central role for HLA-G and HLA-E, an emerging role for HLA-F and a yet unknown function for HLA-H. Thus, the principal objective of this study was to describe the main allelic associations between HLA-A and HLA-H, -G, -F and -E. Therefore, HLA-A, -E, -G, -H and -F coding polymorphisms, as well as HLA-G UnTranslated Region haplotypes (referred to as HLA-G UTRs), were explored in 191 voluntary blood donors. Allelic frequencies, Global Linkage Disequilibrium (GLD), Linkage Disequilibrium (LD) for specific pairs of alleles and two-loci haplotype frequencies were estimated. We showed that HLA-A, HLA-H, HLA-F, HLA-G and HLA-G UTRs were all in highly significant pairwise GLD, in contrast to HLA-E. Moreover, HLA-A displayed restricted associations with HLA-G UTR and HLA-H. We also confirmed several associations that were previously found to have a negative impact on transplantation outcome. In summary, our results suggest complex functional and clinical implications of the HLA-A genetic region. PMID:27701438

Genome-wide histone state profiling of fibroblasts from the opossum, Monodelphis domestica, identifies the first marsupial-specific imprinted gene

PubMed Central

2014-01-01

Background Imprinted genes have been extensively documented in eutherian mammals and found to exhibit significant interspecific variation in the suites of genes that are imprinted and in their regulation between tissues and developmental stages. Much less is known about imprinted loci in metatherian (marsupial) mammals, wherein studies have been limited to a small number of genes previously known to be imprinted in eutherians. We describe the first ab initio search for imprinted marsupial genes, in fibroblasts from the opossum, Monodelphis domestica, based on a genome-wide ChIP-seq strategy to identify promoters that are simultaneously marked by mutually exclusive, transcriptionally opposing histone modifications. Results We identified a novel imprinted gene (Meis1) and two additional monoallelically expressed genes, one of which (Cstb) showed allele-specific, but non-imprinted expression. Imprinted vs. allele-specific expression could not be resolved for the third monoallelically expressed gene (Rpl17). Transcriptionally opposing histone modifications H3K4me3, H3K9Ac, and H3K9me3 were found at the promoters of all three genes, but differential DNA methylation was not detected at CpG islands at any of these promoters. Conclusions In generating the first genome-wide histone modification profiles for a marsupial, we identified the first gene that is imprinted in a marsupial but not in eutherian mammals. This outcome demonstrates the practicality of an ab initio discovery strategy and implicates histone modification, but not differential DNA methylation, as a conserved mechanism for marking imprinted genes in all therian mammals. Our findings suggest that marsupials use multiple epigenetic mechanisms for imprinting and support the concept that lineage-specific selective forces can produce sets of imprinted genes that differ between metatherian and eutherian lines. PMID:24484454

Activation of the Early B-Cell-Specific mb-1 (Ig-α) Gene by Pax-5 Is Dependent on an Unmethylated Ets Binding Site

PubMed Central

Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James

2003-01-01

Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069

Analysis of RET promoter CpG island methylation using methylation-specific PCR (MSP), pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM): impact on stage II colon cancer patient outcome.

PubMed

Draht, Muriel X G; Smits, Kim M; Jooste, Valérie; Tournier, Benjamin; Vervoort, Martijn; Ramaekers, Chantal; Chapusot, Caroline; Weijenberg, Matty P; van Engeland, Manon; Melotte, Veerle

2016-01-01

Already since the 1990s, promoter CpG island methylation markers have been considered promising diagnostic, prognostic, and predictive cancer biomarkers. However, so far, only a limited number of DNA methylation markers have been introduced into clinical practice. One reason why the vast majority of methylation markers do not translate into clinical applications is lack of independent validation of methylation markers, often caused by differences in methylation analysis techniques. We recently described RET promoter CpG island methylation as a potential prognostic marker in stage II colorectal cancer (CRC) patients of two independent series. In the current study, we analyzed the RET promoter CpG island methylation of 241 stage II colon cancer patients by direct methylation-specific PCR (MSP), nested-MSP, pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM). All primers were designed as close as possible to the same genomic region. In order to investigate the effect of different DNA methylation assays on patient outcome, we assessed the clinical sensitivity and specificity as well as the association of RET methylation with overall survival for three and five years of follow-up. Using direct-MSP and nested-MSP, 12.0 % (25/209) and 29.6 % (71/240) of the patients showed RET promoter CpG island methylation. Methylation frequencies detected by pyrosequencing were related to the threshold for positivity that defined RET methylation. Methylation frequencies obtained by pyrosequencing (threshold for positivity at 20 %) and MS-HRM were 13.3 % (32/240) and 13.8 % (33/239), respectively. The pyrosequencing threshold for positivity of 20 % showed the best correlation with MS-HRM and direct-MSP results. Nested-MSP detected RET promoter CpG island methylation in deceased patients with a higher sensitivity (33.1 %) compared to direct-MSP (10.7 %), pyrosequencing (14.4 %), and MS-HRM (15.4 %). While RET methylation frequencies detected by nested

Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

PubMed Central

Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

2013-01-01

Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

CpG Island Methylator Phenotype and Prognosis of Colorectal Cancer in Northeast China

PubMed Central

Li, Xia; Hu, Fulan; Yao, Xiaoping; Zhang, Zuoming; Wang, Fan; Sun, Guizhi; Cui, Bin-Bin; Dong, Xinshu; Zhao, Yashuang

2014-01-01

Purpose. To investigate the association between CpG island methylator phenotype (CIMP) and the overall survival of sporadic colorectal cancer (CRC) in Northeast China. Methods. 282 sporadic CRC patients were recruited in this study. We selected MLH1, MGMT, p16, APC, MINT1, MINT31, and RUNX3 as the CIMP panel markers. The promoter methylation was assessed by methylation sensitive high resolution melting (MS-HRM). Proportional hazards-regression models were fitted with computing hazard ratios (HR) and the corresponding 95% confidence intervals (95% CI). Results. 12.77% (36/282) of patients were CIMP-0, 74.1% (209/282) of patients were CIMP-L, and 13.12% (37/282) of patients were CIMP-H. The five-year survival of the 282 CRC patients was 58%. There was significant association between APC gene promoter methylation and CRC overall survival (HR = 1.61; 95% CI: 1.05–2.46; P = 0.03). CIMP-H was significantly associated with worse prognosis compared to CIMP-0 (HR = 3.06; 95% CI: 1.19–7.89; P = 0.02) and CIMP-L (HR = 1.97; 95% CI: 1.11–3.48; P = 0.02), respectively. While comparing with the combine of CIMP-L and CIMP-0 (CIMP-L/0), CIMP-H also presented a worse prognosis (HR = 2.31; 95% CI: 1.02–5.24; P = 0.04). Conclusion. CIMP-H may be a predictor of a poor prognosis of CRC in Northeast China patients. PMID:25243122

CpG island methylator phenotype and prognosis of colorectal cancer in Northeast China.

PubMed

Li, Xia; Hu, Fulan; Wang, Yibaina; Yao, Xiaoping; Zhang, Zuoming; Wang, Fan; Sun, Guizhi; Cui, Bin-Bin; Dong, Xinshu; Zhao, Yashuang

2014-01-01

To investigate the association between CpG island methylator phenotype (CIMP) and the overall survival of sporadic colorectal cancer (CRC) in Northeast China. 282 sporadic CRC patients were recruited in this study. We selected MLH1, MGMT, p16, APC, MINT1, MINT31, and RUNX3 as the CIMP panel markers. The promoter methylation was assessed by methylation sensitive high resolution melting (MS-HRM). Proportional hazards-regression models were fitted with computing hazard ratios (HR) and the corresponding 95% confidence intervals (95% CI). 12.77% (36/282) of patients were CIMP-0, 74.1% (209/282) of patients were CIMP-L, and 13.12% (37/282) of patients were CIMP-H. The five-year survival of the 282 CRC patients was 58%. There was significant association between APC gene promoter methylation and CRC overall survival (HR = 1.61; 95% CI: 1.05-2.46; P = 0.03). CIMP-H was significantly associated with worse prognosis compared to CIMP-0 (HR = 3.06; 95% CI: 1.19-7.89; P = 0.02) and CIMP-L (HR = 1.97; 95% CI: 1.11-3.48; P = 0.02), respectively. While comparing with the combine of CIMP-L and CIMP-0 (CIMP-L/0), CIMP-H also presented a worse prognosis (HR = 2.31; 95% CI: 1.02-5.24; P = 0.04). CIMP-H may be a predictor of a poor prognosis of CRC in Northeast China patients.

Pan-cancer stratification of solid human epithelial tumors and cancer cell lines reveals commonalities and tissue-specific features of the CpG island methylator phenotype.

PubMed

Sánchez-Vega, Francisco; Gotea, Valer; Margolin, Gennady; Elnitski, Laura

2015-01-01

The term CpG island methylator phenotype (CIMP) has been used to describe widespread DNA hypermethylation at CpG-rich genomic regions affecting clinically distinct subsets of cancer patients. Even though there have been numerous studies of CIMP in individual cancer types, a uniform analysis across tissues is still lacking. We analyze genome-wide patterns of CpG island hypermethylation in 5,253 solid epithelial tumors from 15 cancer types from TCGA and 23 cancer cell lines from ENCODE. We identify differentially methylated loci that define CIMP+ and CIMP- samples, and we use unsupervised clustering to provide a robust molecular stratification of tumor methylomes for 12 cancer types and all cancer cell lines. With a minimal set of 89 discriminative loci, we demonstrate accurate pan-cancer separation of the 12 CIMP+/- subpopulations, based on their average levels of methylation. Tumor samples in different CIMP subclasses show distinctive correlations with gene expression profiles and recurrence of somatic mutations, copy number variations, and epigenetic silencing. Enrichment analyses indicate shared canonical pathways and upstream regulators for CIMP-targeted regions across cancer types. Furthermore, genomic alterations showing consistent associations with CIMP+/- status include genes involved in DNA repair, chromatin remodeling genes, and several histone methyltransferases. Associations of CIMP status with specific clinical features, including overall survival in several cancer types, highlight the importance of the CIMP+/- designation for individual tumor evaluation and personalized medicine. We present a comprehensive computational study of CIMP that reveals pan-cancer commonalities and tissue-specific differences underlying concurrent hypermethylation of CpG islands across tumors. Our stratification of solid tumors and cancer cell lines based on CIMP status is data-driven and agnostic to tumor type by design, which protects against known biases that have hindered

A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro

PubMed Central

2013-01-01

Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769

Development of a Web Tool for Escherichia coli Subtyping Based on fimH Alleles.

PubMed

Roer, Louise; Tchesnokova, Veronika; Allesøe, Rosa; Muradova, Mariya; Chattopadhyay, Sujay; Ahrenfeldt, Johanne; Thomsen, Martin C F; Lund, Ole; Hansen, Frank; Hammerum, Anette M; Sokurenko, Evgeni; Hasman, Henrik

2017-08-01

The aim of this study was to construct a valid publicly available method for in silico fimH subtyping of Escherichia coli particularly suitable for differentiation of fine-resolution subgroups within clonal groups defined by standard multilocus sequence typing (MLST). FimTyper was constructed as a FASTA database containing all currently known fimH alleles. The software source code is publicly available at https://bitbucket.org/genomicepidemiology/fimtyper, the database is freely available at https://bitbucket.org/genomicepidemiology/fimtyper_db, and a service implementing the software is available at https://cge.cbs.dtu.dk/services/FimTyper FimTyper was validated on three data sets: one containing Sanger sequences of fimH alleles of 42 E. coli isolates generated prior to the current study (data set 1), one containing whole-genome sequence (WGS) data of 243 third-generation-cephalosporin-resistant E. coli isolates (data set 2), and one containing a randomly chosen subset of 40 E. coli isolates from data set 2 that were subjected to conventional fimH subtyping (data set 3). The combination of the three data sets enabled an evaluation and comparison of FimTyper on both Sanger sequences and WGS data. FimTyper correctly predicted all 42 fimH subtypes from the Sanger sequences from data set 1 and successfully analyzed all 243 draft genomes from data set 2. FimTyper subtyping of the Sanger sequences and WGS data from data set 3 were in complete agreement. Additionally, fimH subtyping was evaluated on a phylogenetic network of 122 sequence type 131 (ST131) E. coli isolates. There was perfect concordance between the typology and fimH -based subclones within ST131, with accurate identification of the pandemic multidrug-resistant clonal subgroup ST131- H 30. FimTyper provides a standardized tool, as a rapid alternative to conventional fimH subtyping, highly suitable for surveillance and outbreak detection. Copyright © 2017 American Society for Microbiology.

Allele-Specific Polymerase Chain Reaction for the Imatinib-Resistant KIT D816V and D816F Mutations in Mastocytosis and Acute Myelogenous Leukemia

PubMed Central

Corless, Christopher L.; Harrell, Patina; Lacouture, Mario; Bainbridge, Troy; Le, Claudia; Gatter, Ken; White, Clifton; Granter, Scott; Heinrich, Michael C.

2006-01-01

Oncogenic mutations of the receptor tyrosine kinase KIT contribute to the pathogenesis of gastrointestinal stromal tumors, systemic mastocytosis (SM), and some cases of acute myelogenous leukemia (AML). The D816V substitution in the activation loop of KIT results in relative resistance to the kinase inhibitor imatinib (Gleevec). Because this mutation occurs in 80 to 95% of adult SM, its detection has diagnostic and predictive significance. Unfortunately, the fraction of mutation-positive cells in clinical SM samples is often below the 20 to 30% threshold needed for detection by direct DNA sequencing. We have developed an allele-specific polymerase chain reaction assay using a mutation-specific primer combined with a wild-type blocking oligonucleotide that amplifies D816V at the level of 1% mutant allele in DNA extracted from formalin-fixed, paraffin-embedded tissue. There were no amplifications among 64 KIT wild-type tumors and cell lines, whereas all D816V-mutant samples (eight AML and 11 mast cell disease) were positive. Other D816 substitutions associated with resistance to imatinib in vitro are rare in SM. Among these D816F was detectable with the assay whereas D816H, D816Y, and D816G did not amplify. Nine biopsies (bone marrow, skin, or colon) with suspected SM were negative by denaturing high performance liquid chromatography and/or DNA sequencing but positive by allele-specific polymerase chain reaction. Thus, the assay may be useful in confirming the diagnosis of SM. PMID:17065430

Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

PubMed

Upadhyay, Mohita; Vivekanandan, Perumal

2015-01-01

Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our

Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

PubMed Central

Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

2013-01-01

Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the

Enrichment of individual KIR2DL4 sequences from genomic DNA using long-template PCR and allele-specific hybridization to magnetic bead-bound oligonucleotide probes.

PubMed

Roberts, C H; Turino, C; Madrigal, J A; Marsh, S G E

2007-06-01

DNA enrichment by allele-specific hybridization (DEASH) was used as a means to isolate individual alleles of the killer cell immunoglobulin-like receptor (KIR2DL4) gene from heterozygous genomic DNA. Using long-template polymerase chain reaction (LT-PCR), the complete KIR2DL4 gene was amplified from a cell line that had previously been characterized for its KIR gene content by PCR using sequence-specific primers (PCR-SSP). The whole gene amplicons were sequenced and we identified two heterozygous positions in accordance with the predictions of the PCR-SSP. The amplicons were then hybridized to allele-specific, biotinylated oligonucleotide probes and through binding to streptavidin-coated beads, the targeted alleles were enriched. A second PCR amplified only the exonic regions of the enriched allele, and these were then sequenced in full. We show DEASH to be capable of enriching single alleles from a heterozygous PCR product, and through sequencing the enriched DNA, we are able to produce complete coding sequences of the KIR2DL4 alleles in accordance with the typing predicted by PCR-SSP.

H19 promotes endometrial cancer progression by modulating epithelial-mesenchymal transition

PubMed Central

Zhao, Le; Li, Zhen; Chen, Wei; Zhai, Wen; Pan, Jingjing; Pang, Huan; Li, Xu

2017-01-01

Endometrial cancer is one of the most common types of gynecological malignancy worldwide. Novel biomarkers and therapeutic targets are imperative for improving patients' survival. Previous studies have suggested the long non-coding RNA H19 as a potential cancer biomarker. To investigate the role of H19 in endometrial cancer, the present study examined the expression pattern of H19 in endometrial cancer tissues by quantitative polymerase chain reaction, and characterized its function in the endometrial cancer cell line via knocking down its expression with small interfering RNAs. It was found that H19 level was significantly higher in tumor tissues than in paratumoral tissues. Knockdown of H19 did not affect the growth rate of HEC-1-B endometrial cancer cells, but significantly suppressed in vitro migration and invasion of HEC-1-B cells. Furthermore, H19 downregulation decreased Snail level and increased E-cadherin expression without affecting vimentin level, indicating partial reversion of epithelial-mesenchymal transition (EMT). The present findings suggested that H19 contributed to the aggressiveness of endometrial cancer by modulating EMT process. PMID:28123568

Effect of read-mapping biases on detecting allele-specific expression from RNA-sequencing data

PubMed Central

Degner, Jacob F.; Marioni, John C.; Pai, Athma A.; Pickrell, Joseph K.; Nkadori, Everlyne; Gilad, Yoav; Pritchard, Jonathan K.

2009-01-01

Motivation: Next-generation sequencing has become an important tool for genome-wide quantification of DNA and RNA. However, a major technical hurdle lies in the need to map short sequence reads back to their correct locations in a reference genome. Here, we investigate the impact of SNP variation on the reliability of read-mapping in the context of detecting allele-specific expression (ASE). Results: We generated 16 million 35 bp reads from mRNA of each of two HapMap Yoruba individuals. When we mapped these reads to the human genome we found that, at heterozygous SNPs, there was a significant bias toward higher mapping rates of the allele in the reference sequence, compared with the alternative allele. Masking known SNP positions in the genome sequence eliminated the reference bias but, surprisingly, did not lead to more reliable results overall. We find that even after masking, ∼5–10% of SNPs still have an inherent bias toward more effective mapping of one allele. Filtering out inherently biased SNPs removes 40% of the top signals of ASE. The remaining SNPs showing ASE are enriched in genes previously known to harbor cis-regulatory variation or known to show uniparental imprinting. Our results have implications for a variety of applications involving detection of alternate alleles from short-read sequence data. Availability: Scripts, written in Perl and R, for simulating short reads, masking SNP variation in a reference genome and analyzing the simulation output are available upon request from JFD. Raw short read data were deposited in GEO (http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE18156. Contact: jdegner@uchicago.edu; marioni@uchicago.edu; gilad@uchicago.edu; pritch@uchicago.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:19808877

CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

PubMed Central

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

2013-01-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

PubMed

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

2013-12-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

A multifamily study on the relationship between CYP2C19 genotype and s-mephenytoin oxidation phenotype.

PubMed

Brøsen, K; de Morais, S M; Meyer, U A; Goldstein, J A

1995-10-01

It has recently been shown that the most common mutation (named m1) in both Caucasian and Japanese poor metabolizers (PM) of S-mephenytoin is a single base pair mutation (G-->A) in exon 5 of the CYP2C19 gene. In Japanese, a second defective allele of CYP2C19 named m2 consists of a G-->A mutation in exon 4. In the present study, we have investigated the inheritance of the CYP2C19 wild type allele (wt) and the two defective alleles (m1 and m2) in families of 11 Danish PM probands. The study was carried out for two principal reasons. First, we wanted to confirm the autosomal recessive inheritance of the defective alleles, and second, we wanted to examine the specificity and sensitivity of the CYP2C19 genotyping test. Individuals were phenotyped by measuring the ratio of S/R mephenytoin excreted in the urine after administration of mephenytoin, and genotyping was carried out by a PCR-based DNA amplification procedure. The genotypes of nine of the 11 probands were consistent with their phenotypes. Eight were homozygous m1/m1, and one was heterozygous m1/m2. The genotypes of two putative PM probands (wt/m1) were not consistent with their phenotypes. On the basis of extended phenotyping (additional late urine collections (24-36 h) and acidification of urine), one of these could probably be reclassified as an extensive metabolizer (EM) while the other was considered to be a true PM. This suggests the presence of an additional unknown mutant allele in the latter. Seven of the 41 phenotyped relatives in the 11 families were phenotyped as PMs, and with the exception of the father of family 10, their genotypes (m1/m1) were consistent with their phenotypes. Extended phenotyping (acidification of urine) suggested that the father of family 10 in fact is an EM and hence that his genotype (wt/m1) is concordant with his phenotype. Thus, the specificity of genotyping tests for PM was 100%, while the sensitivity was 15/16 or 94%. Our study provides unequivocal evidence for autosomal

Collapsing glomerulopathy in a young woman with APOL1 risk alleles following acute parvovirus B19 infection: a case report investigation.

PubMed

Besse, Whitney; Mansour, Sherry; Jatwani, Karan; Nast, Cynthia C; Brewster, Ursula C

2016-09-06

Collapsing Glomerulopathy (CG), also known as the collapsing variant of Focal Segmental Glomerulosclerosis (FSGS), is distinct in both its clinical severity and its pathophysiologic characteristics from other forms of FSGS. This lesion occurs disproportionally in patients carrying two APOL1 risk alleles, and is the classic histologic lesion resulting from Human Immunodeficiency Virus (HIV) infection of podocytes. Other viral infections, including parvovirus B19, and drugs such as interferon that perturb the immune system, have also been associated with CG. Despite significant advances, explaining such genetic and immune/infectious associations with causative mechanisms and supporting evidence has proven challenging. We report the case of a healthy (HIV-negative) pregnant 36 year-old Caribbean-American woman who presented with nephrotic syndrome and fetal demise in the setting of acute parvovirus B19 infection. A series of three renal biopsies and rapid clinical course showed progression from significant podocyte injury with mild light microscopy findings to classic viral-associated CG to ESRD in less than 3 months. Genetic analysis revealed two APOL1 G1 risk alleles. This is the first published case report of CG in the setting of acute parvovirus infection in a patient with two APOL1 risk allelles, and parvoviral proteins identified in renal epithelium on kidney biopsy. These findings support the causative role of parvovirus B19 infection in the development of CG on the background of APOL1 genetic risk.

Enhancement of infectious disease vaccines through TLR9-dependent recognition of CpG DNA.

PubMed

McCluskie, M J; Krieg, A M

2006-01-01

The adaptive immune system-with its remarkable ability to generate antigen-specific antibodies and T lymphocytes against pathogens never before "seen" by an organism-is one of the marvels of evolution. However, to generate these responses, the adaptive immune system requires activation by the innate immune system. Toll-like receptors (TLRs) are perhaps the best-understood family of innate immune receptors for detecting infections and stimulating adaptive immune responses. TLR9 appears to have evolved to recognize infections by a subtle structural difference between eukaryotic and prokaryotic/viral DNA; only the former frequently methylates CpG dinucleotides. Used as vaccine adjuvants, synthetic oligodeoxynucleotide (ODN) ligands for TLR9--CpG ODN--greatly enhance the speed and strength of the immune responses to vaccination.

Grade-specific prostate cancer associations of IGF1 (CA)19 repeats and IGFBP3-202A/C in blacks and whites.

PubMed

Hoyo, Cathrine; Grubber, Janet; Demark-Wahnefried, Wendy; Marks, Jeffrey R; Freedland, Stephen J; Jeffreys, Amy S; Grambow, Steven C; Wenham, Robert M; Walther, Philip J; Schildkraut, Joellen M

2007-07-01

Carrying the cytosine-adenosine (CA)19 repeat polymorphism in insulin-like growth factor-1 (IGF1) is associated with lower serum proteins and decreased prostate cancer risk. Carrying the -202A/C genotype in insulin-like growth factor binding protein-3 (IGFBP3) also has been associated with lower serum levels of the binding protein. However, the association between this variant and prostate cancer is inconsistent. To test the hypothesis that inconsistencies are partly due to cancer grade-specific differences in strength and direction of associations, we reanalyzed data from our previous Durham Veterans Administration Hospital study of blacks and whites comprising 47 cases (19 African Americans) with Gleason sum > or = 7, 50 cases (30 African Americans) with Gleason sum < 7 and 93 controls (49 African Americans). Compared to controls, the association between carrying the IGFBP3 C allele and prostate cancer risk was in OR(Low-Gleason) = 4.0; 95% CI: 1.4-12.3 compared to OR(High-Gleason) = 1.0; 95% CI: 0.4-2.2. Association patterns were similar in African Americans (OR(Low-Gleason) = 3.6; 95% CI: 1.0-13.2 vs. OR(High-Gleason) = 1.4; 95% CI: 0.4-2.3) and whites (OR(Low-Gleason) = 5.6; 95% CI: 0.6-49.0 vs. OR(High-Gleason) = 0.6; 95% CI: 0.2-2.2). The inverse association between carrying the IGF1 (CA)19 repeat variant did not vary by grade or ethnicity. If confirmed in larger studies, these findings support the hypothesis that the association between IGFBP3 C allele and prostate cancer is grade specific in both ethnic groups.

Grade-specific prostate cancer associations of IGF1 (CA)19 repeats and IGFBP3-202A/C in blacks and whites.

PubMed Central

Hoyo, Cathrine; Grubber, Janet; Demark-Wahnefried, Wendy; Marks, Jeffrey R.; Freedland, Stephen J.; Jeffreys, Amy S.; Grambow, Steven C.; Wenham, Robert M.; Walther, Philip J.; Schildkraut, Joellen M.

2007-01-01

Carrying the cytosine-adenosine (CA)19 repeat polymorphism in insulin-like growth factor-1 (IGF1) is associated with lower serum proteins and decreased prostate cancer risk. Carrying the -202A/C genotype in insulin-like growth factor binding protein-3 (IGFBP3) also has been associated with lower serum levels of the binding protein. However, the association between this variant and prostate cancer is inconsistent. To test the hypothesis that inconsistencies are partly due to cancer grade-specific differences in strength and direction of associations, we reanalyzed data from our previous Durham Veterans Administration Hospital study of blacks and whites comprising 47 cases (19 African Americans) with Gleason sum > or = 7, 50 cases (30 African Americans) with Gleason sum < 7 and 93 controls (49 African Americans). Compared to controls, the association between carrying the IGFBP3 C allele and prostate cancer risk was in OR(Low-Gleason) = 4.0; 95% CI: 1.4-12.3 compared to OR(High-Gleason) = 1.0; 95% CI: 0.4-2.2. Association patterns were similar in African Americans (OR(Low-Gleason) = 3.6; 95% CI: 1.0-13.2 vs. OR(High-Gleason) = 1.4; 95% CI: 0.4-2.3) and whites (OR(Low-Gleason) = 5.6; 95% CI: 0.6-49.0 vs. OR(High-Gleason) = 0.6; 95% CI: 0.2-2.2). The inverse association between carrying the IGF1 (CA)19 repeat variant did not vary by grade or ethnicity. If confirmed in larger studies, these findings support the hypothesis that the association between IGFBP3 C allele and prostate cancer is grade specific in both ethnic groups. PMID:17668637

pH-Responsive Nanoparticle Vaccines for Dual-Delivery of Antigens and Immunostimulatory Oligonucleotides

PubMed Central

Wilson, John T.; Keller, Salka; Manganiello, Matthew J.; Cheng, Connie; Lee, Chen-Chang; Opara, Chinonso; Convertine, Anthony; Stayton, Patrick S.

2013-01-01

Protein subunit vaccines offer important potential advantages over live vaccine vectors, but generally elicit weaker and shorter-lived cellular immune responses. Here we investigate the use of pH-responsive, endosomolytic polymer nanoparticles that were originally developed for RNA delivery as vaccine delivery vehicles for enhancing cellular and humoral immune responses. Micellar nanoparticles were assembled from amphiphilic diblock copolymers composed of an ampholytic core-forming block and a re-designed polycationic corona block doped with thiol-reactive pyridyl disulfide groups to enable dual-delivery of antigens and immunostimulatory CpG oligodeoxynucleotide (CpG ODN) adjuvants. Polymers assembled into 23 nm particles with simultaneous packaging of CpG ODN and a thiolated protein antigen, ovalbumin (ova). Conjugation of ova to nanoparticles significantly enhanced antigen cross-presentation in vitro relative to free ova or an unconjugated, physical mixture of the parent compounds. Subcutaneous vaccination of mice with ova-nanoparticle conjugates elicited a significantly higher CD8+ T cell response (0.5% IFN-ɣ+ of CD8+) compared to mice vaccinated with free ova or a physical mixture of the two components. Significantly, immunization with ova-nanoparticle conjugates electrostatically complexed with CpG ODN (dual-delivery) enhanced CD8+ T cell responses (3.4% IFN-ɣ+ of CD8+) 7-, 18-, and 8-fold relative to immunization with conjugates, ova administered with free CpG, or a formulation containing free ova and CpG complexed to micelles, respectively. Similarly, dual-delivery carriers significantly increased CD4+IFN-ɣ+ (Th1) responses, and elicited a balanced IgG1/IgG2c antibody response. Intradermal administration further augmented cellular immune responses, with dual-delivery carriers inducing ~7% antigen-specific CD8+ T cells. This work demonstrates the ability of pH-responsive, endosomolytic nanoparticles to actively promote antigen cross-presentation and

Immunogenicity of porcine circovirus type 2 nucleic acid vaccine containing CpG motif for mice.

PubMed

Li, Jun; Yu, Jiang; Xu, Shaojian; Shi, Jianli; Xu, Shengnan; Wu, Xiaoyan; Fu, Fang; Peng, Zhe; Zhang, Lingling; Zheng, Shuxuan; Yuan, Xiaoyuan; Cong, Xiaoyan; Sun, Wenbo; Cheng, Kaihui; Du, Yijun; Wu, Jiaqiang; Wang, Jinbao

2016-11-14

This study aimed at reseaching the immune effect of porcine circovirus type 2 (PCV2) DNA vaccine containing CpG motif on mice. A total of 40 6-week-old female BALB/c mice were randomly divided into four groups which were immunized by 18CpG-pVAX1-ORF2, pVAX1-ORF2, pVAX1 and PBS, respectively, and immunized again 2 weeks later. All mice were challenged with 0.2 mL PCV2 cells virulent strain SD (10 6.0 TCID 50 /mL) after 4 weeks. Average daily gain, blood antibody levels, microscopic changes and viremia were detected to estimate the effect of DNA vaccine. The results showed that compared to those of the control mice, groups immunized with pVAX1-ORF2 and 18CpG-pVAX1-ORF2 could induce PCV2-specific antibodies. The PCV2-specific antibodies level of 18 CpG-pVAX1-ORF2 groups was higher significantly than other groups and decreased slowly along with time. There was no distinct pathological damage and viremia occurring in mice that inoculated with CpG motif DNA vaccines. The results demonstrated that the DNA vaccine containing 18 CpG could build up resistibility immunity and reduce immune organ damage on mice.

Allelic Imbalance Is a Prevalent and Tissue-Specific Feature of the Mouse Transcriptome

PubMed Central

Pinter, Stefan F.; Colognori, David; Beliveau, Brian J.; Sadreyev, Ruslan I.; Payer, Bernhard; Yildirim, Eda; Wu, Chao-ting; Lee, Jeannie T.

2015-01-01

In mammals, several classes of monoallelic genes have been identified, including those subject to X-chromosome inactivation (XCI), genomic imprinting, and random monoallelic expression (RMAE). However, the extent to which these epigenetic phenomena are influenced by underlying genetic variation is unknown. Here we perform a systematic classification of allelic imbalance in mouse hybrids derived from reciprocal crosses of divergent strains. We observe that deviation from balanced biallelic expression is common, occurring in ∼20% of the mouse transcriptome in a given tissue. Allelic imbalance attributed to genotypic variation is by far the most prevalent class and typically is tissue-specific. However, some genotype-based imbalance is maintained across tissues and is associated with greater genetic variation, especially in 5′ and 3′ termini of transcripts. We further identify novel random monoallelic and imprinted genes and find that genotype can modify penetrance of parental origin even in the setting of large imprinted regions. Examination of nascent transcripts in single cells from inbred parental strains reveals that genes showing genotype-based imbalance in hybrids can also exhibit monoallelic expression in isogenic backgrounds. This surprising observation may suggest a competition between alleles and/or reflect the combined impact of cis- and trans-acting variation on expression of a given gene. Our findings provide novel insights into gene regulation and may be relevant to human genetic variation and disease. PMID:25858912

Oral immunization with F4 fimbriae and CpG formulated with carboxymethyl starch enhances F4-specific mucosal immune response and modulates Th1 and Th2 cytokines in weaned pigs.

PubMed

Delisle, Benjamin; Calinescu, Carmen; Mateescu, Mircea Alexandru; Fairbrother, John Morris; Nadeau, Éric

2012-01-01

F4 fimbriae are a potential candidate for an oral subunit vaccine for prevention of post-weaning diarrhea in swine due to infection with F4-positive enterotoxigenic Escherichia coli. However, large quantities of F4 fimbriae are required to induce a specific antibody response. The aim of the present study was to evaluate the effect of supplementation of F4 fimbriae with Cytosine-phosphate-Guanosine-oligodeoxynucleotide (CpG-A D19) or with complete cholera toxin (CT) as adjuvants on the F4-specific antibody response and cytokine production in weaned pigs following oral administration of F4 fimbrial antigen formulated with Carboxymethyl Starch (CMS). Oral dosage forms of F4 fimbriae alone or supplemented with CpG-A D19 or with CT were formulated with CMS as monolithic tablets, obtained by direct compression, and administered to weaned pigs. Blood and faecal samples were collected to determine the systemic and mucosal immune status of animals at various times until necropsy. During necropsy, contents of the jejunum and ileum were collected for determination of mucosal F4 specific antibodies. Segments of jejunum and ileum were also used to measure mRNA cytokine production. The presence of CpG in the formulation of the fimbriae significantly increased F4-specific immunoglobulin (Ig) IgM and IgG levels in intestinal secretions, and enhanced Th1 (Interferon-gamma / IFN-γ, Tumour Necrosis Factor-alpha / TNF-α, Interleukin-12p40 / IL-12p40, IL-1β) and Th2 (IL-4, IL-6) cytokine production in intestinal tissues. Supplementation with CT did not result in induction of F4-specific antibodies in secretions, although a significant Th1 response (IFN-α, IFN-γ, IL-18) was detected in tissues. Neither F4-specific systemic antibodies, nor intestinally secreted IgA were detected throughout the immunization trial for all groups. CpG-A D19 appeared to be a promising adjuvant for an oral F4 subunit vaccine formulated with CMS excipient as monolithic tablets. This matrix afforded gastro

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

PubMed

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

2017-10-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

PubMed Central

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

2017-01-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

Increased carrier prevalence of deficient CYP2C9, CYP2C19 and CYP2D6 alleles in depressed patients referred to a tertiary psychiatric hospital.

PubMed

Ruaño, Gualberto; Villagra, David; Rahim, Umme Salma; Windemuth, Andreas; Kocherla, Mohan; Bower, Bruce; Szarek, Bonnie L; Goethe, John W

2008-11-01

This study compared the types and carrier prevalences of clinically significant DNA polymorphisms in the cytochrome P450 (CYP450) genes CYP2C9, CYP2C19 and CYP2D6 in major depressive disorder patients with a control group of nonpsychiatrically ill, medical outpatients. We conducted a case-control study using 73 psychiatric outpatients diagnosed with depression and referred to a tertiary center, The Institute of Living (Hartford, CT, USA), for treatment resistance or intolerable side-effects to psychotropic drugs. The controls were 120 cardiovascular patients from Hartford Hospital being treated for dyslipidemia but otherwise healthy and not psychiatrically ill. DNA typing to detect polymorphisms in the genes CYP2C9, CYP2C19 and CYP2D6 was accomplished with the Tag-It™ mutation detection assay and the Luminex xMAP ® system. The percentage of individuals in psychiatric versus control groups with two wild-type alleles for CYP2C9, CYP2C19 and CYP2D6 genes, were 50 versus 74% (p < 0.001), 71 versus 73% (not statistically significant) and 36 versus 43% (trend, p < 0.2), respectively. Within the psychiatric population, 57% of individuals were carriers of non-wild-type alleles for 2-3 genes, compared with 36% in the control population (p < 0.0001). The balance, 43% in the psychiatric population and 64% in the control, were carriers of non-wild-type alleles for none or one gene. These findings reveal that clinically relevant CYP2C9 polymorphisms occur more frequently in depressed psychiatric patients than in nonpsychiatric controls. The same trend was found for polymorphisms in the CYP2D6 gene. We found a significant cumulative metabolic deficiency in the psychiatric population for combinations of the CYP2C9, CYP2C19 and CYP2D6 genes. The significant enrichment of CYP2C9-deficient alleles in the psychiatric population validates a previously reported association of this gene with the risk for depression disorders. The high prevalence of carriers with deficient and null

[The effect of entrapment of CpG sequence with cationic PLG nanoparticles on the immune responses of mice to pig paratyphoid vaccine].

PubMed

Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong

2005-10-01

Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.

Silencing of GSTP1 gene by CpG island DNA hypermethylation in HBV-associated hepatocellular carcinomas.

PubMed

Zhong, Sheng; Tang, Mandy W; Yeo, Winnie; Liu, Cuiling; Lo, Y M Dennis; Johnson, Philip J

2002-04-01

Glutathione S-transferases, enzymes that defend cells against damage mediated by oxidant and electrophilic carcinogens, may be critical determinants of cancer pathogenesis. In this report, we assess the role of epigenetic silencing of the GSTP1 gene, a gene encoding the pi-class glutathione S-transferase, in the pathogenesis of hepatitis B virus (HBV)-associated hepatocellular carcinomas (HCC). The cell lines Hep3B, HepG2, and a cohort of 43 HBV-associated HCC tissue specimens and corresponding nontumor tissues were subjected to analysis for GSTP1 epigenetic alteration and expression. GSTP1 "CpG" island DNA hypermethylation in the liver cell lines, and the tissue specimens were determined by methylation-specific PCR and correlated with expression of the gene using reverse-transcription PCR, immunoblotting, and immunohistochemistry. GSTP1 CpG island DNA hypermethylation was detected in 28 of 43 (65.1%) HCC tissues and 4 of 40 (10%) corresponding nontumor tissues. GSTP1 protein was absent in those cases showing hypermethylation of the gene. Similarly, DNA from Hep3B and HepG2 cell lines displayed complete GSTP1 hypermethylation in the CpG island, and they failed to express GSTP1 mRNA and the corresponding protein product. Treatment of the cell lines with the DNA methyltransferase inhibitor 5-aza-deoxycytidine reversed the hypermethylation, and restored GSTP1 mRNA and polypeptide expression. These data indicate that epigenetic silencing of GSTP1 gene expression by CpG island DNA hypermethylation is common in human HBV-associated HCC. In addition, somatic GSTP1 inactivation via CpG island hypermethylation may contribute to the pathogenesis of this malignancy.

Overexpression of lncRNA H19 enhances carcinogenesis and metastasis of gastric cancer

PubMed Central

Li, Hao; Yu, Beiqin; Li, Jianfang; Su, Liping; Yan, Min; Zhu, Zhenggang; Liu, Bingya

2014-01-01

Long non-coding RNAs (lncRNAs) play key roles in the progression and metastasis of some carcinomas. We previously showed that the expression of lncRNA H19 (H19) was higher in gastric cancer (GC) tissues than that in paired noncanerous tissues. However, the underlying mechanisms remain unclear. In this study, H19/miR-675 knockdown models in the MKN45 cell line and ectopic expression models in the SGC7901 cell line were established, and a co-expression network of H19 was generated to identify target genes by RIP and DLR. The results showed that overexpression of H19 promoted the features of GC including proliferation, migration, invasion and metastasis. An H19 co-expression network identified ISM1 as a binding protein of H19, and its expression was positively correlated with that of H19. CALN1 was identified as a target gene of miR-675 and its expression was negatively correlated with that of miR-675. H19 and MiR-675 function in a similar manner. However, H19 RNA actively binds to ISM1 and miR-675 targets CALN1. These differences suggest that H19 plays other roles besides encoding miR-675 in GC. Our results suggest that the effect of H19 in GC is mediated by the direct upregulation of ISM1 and the indirect suppression of CALN1 expression via miR-675. PMID:24810858

Overexpression of lncRNA H19 enhances carcinogenesis and metastasis of gastric cancer.

PubMed

Li, Hao; Yu, Beiqin; Li, Jianfang; Su, Liping; Yan, Min; Zhu, Zhenggang; Liu, Bingya

2014-04-30

Long non-coding RNAs (lncRNAs) play key roles in the progression and metastasis of some carcinomas. We previously showed that the expression of lncRNA H19 (H19) was higher in gastric cancer (GC) tissues than that in paired noncanerous tissues. However, the underlying mechanisms remain unclear. In this study, H19/miR-675 knockdown models in the MKN45 cell line and ectopic expression models in the SGC7901 cell line were established, and a co-expression network of H19 was generated to identify target genes by RIP and DLR. The results showed that overexpression of H19 promoted the features of GC including proliferation, migration, invasion and metastasis. An H19 co-expression network identified ISM1 as a binding protein of H19, and its expression was positively correlated with that of H19. CALN1 was identified as a target gene of miR-675 and its expression was negatively correlated with that of miR-675. H19 and MiR-675 function in a similar manner. However, H19 RNA actively binds to ISM1 and miR-675 targets CALN1. These differences suggest that H19 plays other roles besides encoding miR-675 in GC. Our results suggest that the effect of H19 in GC is mediated by the direct upregulation of ISM1 and the indirect suppression of CALN1 expression via miR-675.

New class of 19F pH indicators: fluoroanilines.

PubMed Central

Deutsch, C J; Taylor, J S

1989-01-01

The pH dependence of the 19F chemical shift has been characterized for a number of fluorine-substituted aniline derivatives. These compounds constitute a new class of 19F nuclear magnetic resonance (NMR) pH indicators, characterized by single 19F resonance lines with sensitivities ranging from 2 to 7 ppm/pH unit near the aniline pKa; total shifts between conjugate acid and base of 5-15 ppm; and pKas ranging from 1 to 7. One compound, N,N-(methyl-2-carboxyisopropyl)-4-fluoroaniline, has a pKa of 6.8 and a sensitivity of 5 ppm/pH unit. This compound displays significant broadening of its 19F resonance near the aniline pKa (6.8), due to a decreased rate of exchange between conjugate acid and base species. Our results are consistent with slow dissociation of an intramolecular hydrogen bond in the zwitterionic species that limits the exchange rate between protonated and unprotonated forms for N,N-(methyl-2-carboxyisopropyl)-4-fluoroaniline. PMID:2720073

DNA activates human immune cells through a CpG sequence-dependent manner

PubMed Central

Bauer, M; Heeg, K; Wagner, H; Lipford, G B

1999-01-01

While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

PubMed

Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

2010-08-01

Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

PubMed

Hanagata, Nobutaka

2017-01-01

Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

Y-chromosome specific alleles and haplotypes in European and Asian populations: linkage disequilibrium and geographic diversity.

PubMed

Mitchell, R J; Earl, L; Fricke, B

1997-10-01

Variation on the Y chromosome may permit our understanding the evolution of the human paternal lineage and male gene flow. This study reports upon the distribution and non random association of alleles at four Y-chromosome specific loci in four populations, three Caucasoid (Italian, Greek and Slav) and one Asian. The markers include insertion/deletion (p12f), point mutation (92R7 and pY alpha I), and repeat sequence (p21A1) polymorphisms. Our data confirm that the p12f/TaqI 8 kb allele is a Caucasoid marker and that Asians are monomorphic at three of the loci (p12f, 92R7, and pY alpha I). The alleles at 92R7 and pY alpha I were found to be in complete disequilibrium in Europeans. Y-haplotype diversity was highly significant between Asians and all three European groups (P < 0.001), but the Greeks and Italians were also significantly different with respect to some alleles and haplotypes (P < 0.02). We find strong evidence that the p12f/TaqI 8 kb allele may have arisen only once, as a deletion event, and, additionally, that the present-day frequency distribution of Y chromosomes carrying the p12f/8 kb allele suggests that it may have been spread by colonising sea-faring peoples from the Near East, possibly the Phoenicians, rather than by expansion of Neolithic farmers into continental Europe. The p12f deletion is the key marker of a unique Y chromosome, found only in Caucasians to date, labelled 'Mediterranean' and this further increases the level of Y-chromosome diversity seen among Caucasoids when compared to the other major population groups.

CpG islands: algorithms and applications in methylation studies.

PubMed

Zhao, Zhongming; Han, Leng

2009-05-15

Methylation occurs frequently at 5'-cytosine of the CpG dinucleotides in vertebrate genomes; however, this epigenetic feature is rarely observed in CpG islands (CGIs) or CpG clusters in the promoter regions of genes. Aberrant methylation of the promoter-associated CGIs might influence gene expression and cause carcinogenesis. Because of the functional importance, multiple algorithms have been available for identifying CGIs in a genome or a sequence. They can be categorized into the traditional algorithms (e.g., Gardiner-Garden and Frommer (1987), Takai and Jones (2002), and CpGPRoD (2002)) or statistical property based algorithms (CpGcluster (2006) and CG cluster (2007)). We reviewed the features of these algorithms and evaluated their performance on identifying functional CGIs using genome-wide methylation data. Moreover, identification of CGIs is an initial step in many recent studies for predicting methylation status as well as in the design of methylation detection platforms. We reviewed the benchmarks and features used in these studies.

Detection of Turner syndrome using X-chromosome inactivation specific differentially methylated CpG sites: A pilot study.

PubMed

Zhang, Qiang; Guo, Xiaohong; Tian, Tian; Wang, Teng; Li, Qiaoli; Wang, Lei; Liu, Yun; Xing, Qinghe; He, Lin; Zhao, Xinzhi

2017-05-01

Early diagnosis of Turner syndrome (TS) may improve preventive measures and treatment. X-chromosome inactivation specific differentially methylated CpG sites (XIDMSs) that are high methylated in inactive X chromosomes (Xi) and unmethylated in active X chromosomes (Xa) may be potential makers for TS detection. The candidate XIDMSs were screened from 9 male and 12 female DNA samples with normal karyotypes using the Illumina 450k array and validated by bisulfite sequencing PCR and pyrosequencing assay. X chromosome dosage was calculated according to the methylation level of multiple XIDMSs. Overall, 108 candidate XIDMSs were screened by the 450k array. Validations indicated that XIDMSs gathered and formed the X-chromosome inactivation specific differentially methylated regions (XIDMRs). Using 3 XIDMRs at SAT1, UXT and UTP14A loci, 36 TS, 22 normal female and 6 male samples were analyzed. Methylation levels of the 20 XIDMSs in the XIDMRs could distinguish between TS and normal female DNA samples, the X chromosome dosage was consistent with karyotyping data. Analyzing samples of 2 triple X syndrome and 3 Klinefelter syndrome patients suggested that this method could be used to detect X chromosome aneuploids other than TS. XIDMSs are widely spread along the X chromosome and might be effective markers for detection of TS and other X chromosome aneuploids. Copyright © 2017 Elsevier B.V. All rights reserved.

Gene silencing of Nox4 by CpG island methylation during hepatocarcinogenesis in rats

PubMed Central

López-Álvarez, Guadalupe S.; Wojdacz, Tomasz K.; García-Cuellar, Claudia M.; Monroy-Ramírez, Hugo C.; Rodríguez-Segura, Miguel A.; Pacheco-Rivera, Ruth A.; Valencia-Antúnez, Carlos A.; Cervantes-Anaya, Nancy; Soto-Reyes, Ernesto; Vásquez-Garzón, Verónica R.; Sánchez-Pérez, Yesennia; Villa-Treviño, Saúl

2017-01-01

ABSTRACT The association between the downregulation of genes and DNA methylation in their CpG islands has been extensively studied as a mechanism that favors carcinogenesis. The objective of this study was to analyze the methylation of a set of genes selected based on their microarray expression profiles during the process of hepatocarcinogenesis. Rats were euthanized at: 24 h, 7, 11, 16 and 30 days and 5, 9, 12 and 18 months post-treatment. We evaluated the methylation status in the CpG islands of four deregulated genes (Casp3, Cldn1, Pex11a and Nox4) using methylation-sensitive high-resolution melting technology for the samples obtained from different stages of hepatocarcinogenesis. We did not observe methylation in Casp3, Cldn1 or Pex11a. However, Nox4 exhibited altered methylation patterns, reaching a maximum of 10%, even during the early stages of hepatocarcinogenesis. We observed downregulation of mRNA and protein of Nox4 (97.5% and 40%, respectively) after the first carcinogenic stimulus relative to the untreated samples. Our results suggest that Nox4 downregulation is associated with DNA methylation of the CpG island in its promoter. We propose that methylation is a mechanism that can silence the expression of Nox4, which could contribute to the acquisition of neoplastic characteristics during hepatocarcinogenesis in rats. PMID:27895046

Mechanisms and Disease Associations of Haplotype-Dependent Allele-Specific DNA Methylation

PubMed Central

Do, Catherine; Lang, Charles F.; Lin, John; Darbary, Huferesh; Krupska, Izabela; Gaba, Aulona; Petukhova, Lynn; Vonsattel, Jean-Paul; Gallagher, Mary P.; Goland, Robin S.; Clynes, Raphael A.; Dwork, Andrew; Kral, John G.; Monk, Catherine; Christiano, Angela M.; Tycko, Benjamin

2016-01-01

Haplotype-dependent allele-specific methylation (hap-ASM) can impact disease susceptibility, but maps of this phenomenon using stringent criteria in disease-relevant tissues remain sparse. Here we apply array-based and Methyl-Seq approaches to multiple human tissues and cell types, including brain, purified neurons and glia, T lymphocytes, and placenta, and identify 795 hap-ASM differentially methylated regions (DMRs) and 3,082 strong methylation quantitative trait loci (mQTLs), most not previously reported. More than half of these DMRs have cell type-restricted ASM, and among them are 188 hap-ASM DMRs and 933 mQTLs located near GWAS signals for immune and neurological disorders. Targeted bis-seq confirmed hap-ASM in 12/13 loci tested, including CCDC155, CD69, FRMD1, IRF1, KBTBD11, and S100A∗-ILF2, associated with immune phenotypes, MYT1L, PTPRN2, CMTM8 and CELF2, associated with neurological disorders, NGFR and HLA-DRB6, associated with both immunological and brain disorders, and ZFP57, a trans-acting regulator of genomic imprinting. Polymorphic CTCF and transcription factor (TF) binding sites were over-represented among hap-ASM DMRs and mQTLs, and analysis of the human data, supplemented by cross-species comparisons to macaques, indicated that CTCF and TF binding likelihood predicts the strength and direction of the allelic methylation asymmetry. These results show that hap-ASM is highly tissue specific; an important trans-acting regulator of genomic imprinting is regulated by this phenomenon; and variation in CTCF and TF binding sites is an underlying mechanism, and maps of hap-ASM and mQTLs reveal regulatory sequences underlying supra- and sub-threshold GWAS peaks in immunological and neurological disorders. PMID:27153397

ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

PubMed

Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

2016-01-01

Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.

Long Noncoding RNA H19 Promotes Neuroinflammation in Ischemic Stroke by Driving Histone Deacetylase 1-Dependent M1 Microglial Polarization.

PubMed

Wang, Jue; Zhao, Haiping; Fan, Zhibin; Li, Guangwen; Ma, Qingfeng; Tao, Zhen; Wang, Rongliang; Feng, Juan; Luo, Yumin

2017-08-01

Long noncoding RNA H19 is repressed after birth, but can be induced by hypoxia. We aim to investigate the impact on and underlying mechanism of H19 induction after ischemic stroke. Circulating H19 levels in stroke patients and mice subjected to middle cerebral artery occlusion were assessed using real-time polymerase chain reaction. H19 siRNA and histone deacetylase 1 (HDAC1) plasmid were used to knock down H19 and overexpress HDAC1, respectively. Microglial polarization and ischemic outcomes were assessed in middle cerebral artery occlusion mice and BV2 microglial cells subjected to oxygen-glucose deprivation. Circulating H19 levels were significantly higher in stroke patients compared with healthy controls, indicating high diagnostic sensitivity and specificity. Moreover, plasma H19 levels showed a positive correlation with National Institute of Health Stroke Scale score and tumor necrosis factor-α levels. After middle cerebral artery occlusion in mice, H19 levels increased in plasma, white blood cells, and brain. Intracerebroventricular injection of H19 siRNA reduced infarct volume and brain edema, decreased tumor necrosis factor-α and interleukin-1β levels in brain tissue and plasma, and increased plasma interleukin-10 concentrations 24 hours poststroke. Additionally, H19 knockdown attenuated brain tissue loss and neurological deficits 14 days poststroke. BV2 cell-based experiments showed that H19 knockdown blocked oxygen-glucose deprivation-driven M1 microglial polarization, decreased production of tumor necrosis factor-α and CD11b, and increased the expression of Arg-1 and CD206. Furthermore, H19 knockdown reversed oxygen-glucose deprivation-induced upregulation of HDAC1 and downregulation of acetyl-histone H3 and acetyl-histone H4. In contrast, HDAC1 overexpression negated the effects of H19 knockdown. Our findings indicate that H19 promotes neuroinflammation by driving HDAC1-dependent M1 microglial polarization, suggesting a novel H19-based diagnosis

Association between the CpG island methylator phenotype and its prognostic significance in primary pulmonary adenocarcinoma.

PubMed

Koh, Young Wha; Chun, Sung-Min; Park, Young-Soo; Song, Joon Seon; Lee, Geon Kook; Khang, Shin Kwang; Jang, Se Jin

2016-08-01

Aberrant methylation of promoter CpG islands is one of the most important inactivation mechanisms for tumor suppressor and tumor-related genes. Previous studies using genome-wide DNA methylation microarray analysis have suggested the existence of a CpG island methylator phenotype (CIMP) in lung adenocarcinomas. Although the biological behavior of these tumors varies according to tumor stage, no large-scale study has examined the CIMP in lung adenocarcinoma patients according to tumor stage. Furthermore, there have been no reported results regarding the clinical significance of each of the six CIMP markers. To examine the CIMP in patients with pulmonary adenocarcinoma after a surgical resection, we performed methylation analysis of six genes (CCNA1, ACAN, GFRA1, EDARADD, MGC45800, and p16 (INK4A)) in 230 pulmonary adenocarcinoma cases using the SEQUENOM MassARRAY platform. Fifty-four patients (28 %, 54/191) were in the CIMP-high (CIMP-H) group associated with high nodal stage (P = 0.007), the presence of micropapillary or solid histology (P = 0.003), and the absence of an epidermal growth factor receptor (EGFR) mutation (P = 0.002). By multivariate analysis, CIMP was an independent prognostic marker for overall survival (OS) and disease-specific survival (P = 0.03 and P = 0.43, respectively). In the stage I subgroups alone, CIMP-H patients had lower OS rates than the CIMP-low (CIMP-L) group (P = 0.041). Of the six CIMP markers, ACAN alone was significantly associated with patient survival. CIMP predicted the risk of progression independently of clinicopathological variables and enables the stratification of pulmonary adenocarcinoma patients, particularly among stage I cases.

Compositional searching of CpG islands in the human genome

NASA Astrophysics Data System (ADS)

Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón

2005-06-01

We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.

Reinforcement learning for a biped robot based on a CPG-actor-critic method.

PubMed

Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin

2007-08-01

Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.

MPT-51/CpG DNA vaccine protects mice against Mycobacterium tuberculosis.

PubMed

Silva, Bruna Daniella de Souza; da Silva, Ediane Batista; do Nascimento, Ivan Pereira; Dos Reis, Michelle Cristina Guerreiro; Kipnis, André; Junqueira-Kipnis, Ana Paula

2009-07-16

Tuberculosis (TB) is a severe infectious disease that kills approximately two million people worldwide every year. Because BCG protection is variable and does not protects adults, there is a great need for a new vaccine against TB that does not represent a risk for immunocompromised patients and that is also capable of protecting adult individuals. MPT-51 is a protein found in the genome of mycobacteria and binds to the fibronectin of the extracellular matrix, which may have a role in host tissue attachment and virulence. In order to test the usefulness of MPT-51 as a subunit vaccine, BALB/c were vaccinated and challenged with Mycobacterium tuberculosis. The infection of BALB/c with M. tuberculosis increased the number of IFN-gamma(+) T lymphocytes specific to MPT-51 in the spleen and lungs. Inoculation with rMPT-51/FIA and with rMPT-51/CpG DNA in non-infected BALB/c increased the amounts of IFN-gamma(+) T lymphocytes. Inoculation with rMPT-51/FIA also induced a humoral response specific to MPT-51. CFU counts of lung tissues done 60 days after infection showed a reduction of about 2 log in the bacteria load in the group of animals inoculated with rMPT-51/CpG DNA. These results make MPT-51 a valuable component to be further evaluated in the development of other subunit vaccines.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Association Between CYP2C19 Loss-of-Function Allele Status and Efficacy of Clopidogrel for Risk Reduction Among Patients With Minor Stroke or Transient Ischemic Attack.

PubMed

Wang, Yilong; Zhao, Xingquan; Lin, Jinxi; Li, Hao; Johnston, S Claiborne; Lin, Yi; Pan, Yuesong; Liu, Liping; Wang, David; Wang, Chunxue; Meng, Xia; Xu, Jianfeng; Wang, Yongjun

2016-07-05

Data are limited regarding the association between CYP2C19 genetic variants and clinical outcomes of patients with minor stroke or transient ischemic attack treated with clopidogrel. To estimate the association between CYP2C19 genetic variants and clinical outcomes of clopidogrel-treated patients with minor stroke or transient ischemic attack. Three CYP2C19 major alleles (*2, *3, *17) were genotyped among 2933 Chinese patients from 73 sites who were enrolled in the Clopidogrel in High-Risk Patients with Acute Nondisabling Cerebrovascular Events (CHANCE) randomized trial conducted from January 2, 2010, to March 20, 2012. Patients with acute minor ischemic stroke or transient ischemic attack in the trial were randomized to treatment with clopidogrel combined with aspirin or to aspirin alone. The primary efficacy outcome was new stroke. The secondary efficacy outcome was a composite of new composite vascular events (ischemic stroke, hemorrhagic stroke, myocardial infarction, or vascular death). Bleeding was the safety outcome. Among 2933 patients, 1948 (66.4%) were men, with a mean age of 62.4 years. Overall, 1207 patients (41.2%) were noncarriers and 1726 patients (58.8%) were carriers of loss-of-function alleles (*2, *3). After day 90 follow-up, clopidogrel-aspirin reduced the rate of new stroke in the noncarriers but not in the carriers of the loss-of-function alleles (P = .02 for interaction; events among noncarriers, 41 [6.7%] with clopidogrel-aspirin vs 74 [12.4%] with aspirin; hazard ratio [HR], 0.51 [95% CI, 0.35-0.75]; events among carriers, 80 [9.4%] with clopidogrel-aspirin vs 94 [10.8%] with aspirin; HR, 0.93 [95% CI, 0.69 to 1.26]). Similar results were observed for the secondary composite efficacy outcome (noncarriers: 41 [6.7%] with clopidogrel-aspirin vs 75 [12.5%] with aspirin; HR, 0.50 [95% CI, 0.34-0.74]; carriers: 80 [9.4%] with clopidogrel-aspirin vs 95 [10.9%] with aspirin; HR, 0.92 [95% CI, 0.68-1.24]; P = .02 for interaction). The

Measuring (19)F shift anisotropies and (1)H-(19)F dipolar interactions with ultrafast MAS NMR.

PubMed

Martini, Francesca; Miah, Habeeba K; Iuga, Dinu; Geppi, Marco; Titman, Jeremy J

2015-10-01

A new (19)F anisotropic-isotropic shift correlation experiment is described that operates with ultrafast MAS, resulting in good resolution of isotropic (19)F shifts in the detection dimension. The new experiment makes use of a recoupling sequence designed using symmetry principles that reintroduces the (19)F chemical shift anisotropy in the indirect dimension. The situations in which the new experiment is appropriate are discussed, and the (19)F shift anisotropy parameters in poly(difluoroethylene) (PVDF) are measured. In addition, similar recoupling sequences are shown to be effective for measuring (1)H-(19)F distances via the heteronuclear dipolar interaction. This is demonstrated by application to a recently synthesized zirconium phosphonate material that contains one-dimensional chains linked by H-F hydrogen bonds. Copyright © 2015 Elsevier Inc. All rights reserved.

The evolution of CpG density and lifespan in conserved primate and mammalian promoters

PubMed Central

McLain, Adam T.

2018-01-01

Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

PubMed Central

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

PubMed

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

PubMed

Kava, Hieronimus W; Murray, Vincent

2016-10-01

This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

PubMed

Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

2014-10-20

The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

CpG Island Methylator Phenotype-High Colorectal Cancers and Their Prognostic Implications and Relationships with the Serrated Neoplasia Pathway

PubMed Central

Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon

2017-01-01

The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway. PMID:27885175

CpG Island Methylator Phenotype-High Colorectal Cancers and Their Prognostic Implications and Relationships with the Serrated Neoplasia Pathway.

PubMed

Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon

2017-01-15

The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway.

Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene.

PubMed

Ohtsuki, Shozo; Takahashi, Yuki; Inoue, Takao; Takakura, Yoshinobu; Nishikawa, Makiya

2017-10-20

We used human Toll-like receptor 9 (hTLR9)-expressing HEK-Blue hTLR9 cells, which release secreted embryonic alkaline phosphatase (SEAP) upon response to CpG DNA, to evaluate the immunological properties of nucleic acid drug candidates. Our preliminary studies showed that phosphodiester CpG DNA hardly induced any SEAP secretion in HEK-Blue hTLR9 cells. In the current study, therefore, we developed HEK-Blue hTLR9 cells transduced with human macrophage scavenger receptor-1 (hMSR1), a cell-surface DNA receptor, and determined whether HEK-Blue hTLR9/hMSR1 cells respond to phosphorothioate (PS) CpG DNA and phosphodiester (PO) CpG DNA. We selected PS CpG2006, a single-stranded PO CpG DNA (ssCpG), and a tetrapod-like structured DNA (tetrapodna) containing ssCpG (tetraCpG) as model TLR9 ligands. Alexa Fluor 488-labeled ligands were used for flow cytometry. Unlike the mock-transfected HEK-Blue hTLR9 cells, the HEK-Blue hTLR9/hMSR1 cells efficiently took up all three CpG DNAs. SEAP release was almost proportional to the uptake. Treatment of HEK-Blue hTLR9/hMSR1 cells with an anti-hMSR1 antibody significantly reduced the uptake of ssCpG and tetraCpG. Collectively, reconstruction of TLR9-mediated responses to CpG DNA in HEK-Blue hTLR9 cells can be used to evaluate the toxicity of nucleic acid drug candidates with diverse physicochemical properties.

Allele-specific Col1a1 silencing reduces mutant collagen in fibroblasts from Brtl mouse, a model for classical osteogenesis imperfecta

PubMed Central

Rousseau, Julie; Gioia, Roberta; Layrolle, Pierre; Lieubeau, Blandine; Heymann, Dominique; Rossi, Antonio; Marini, Joan C; Trichet, Valerie; Forlino, Antonella

2014-01-01

Gene silencing approaches have the potential to become a powerful curative tool for a variety of monogenic diseases caused by gain-of-function mutations. Classical osteogenesis imperfecta (OI), a dominantly inherited bone dysplasia, is characterized in its more severe forms by synthesis of structurally abnormal type I collagen, which exerts a negative effect on extracellular matrix. Specific suppression of the mutant (Mut) allele would convert severe OI forms to the mild type caused by a quantitative defect in normal collagen. Here, we describe the in vitro and ex vivo investigation of a small interfering RNA (siRNA) approach to allele-specific gene silencing using Mut Col1a1 from the Brtl mouse, a well-characterized model for classical human OI. A human embryonic kidney cell line, which expresses the firefly luciferase gene, combined with either wild-type or Mut Brtl Col1a1 exon 23 sequences, was used for the first screening. The siRNAs selected based on their specificity and the corresponding short hairpin RNAs (shRNAs) subcloned in a lentiviral vector were evaluated ex vivo in Brtl fibroblasts for their effect on collagen transcripts and protein. A preferential reduction of the Mut allele of up to 52% was associated with about 40% decrease of the Mut protein, with no alteration of cell proliferation. Interestingly, a downregulation of HSP47, a specific collagen chaperone known to be upregulated in some OI cases, was detected. Our data support further testing of shRNAs and their delivery by lentivirus as a strategy to specifically suppress the Mut allele in mesenchymal stem cells of OI patients for autologous transplantation. PMID:24022296

Distinct genetic profiles in colorectal tumors with or without the CpG island methylator phenotype

PubMed Central

Toyota, Minoru; Ohe-Toyota, Mutsumi; Ahuja, Nita; Issa, Jean-Pierre J.

2000-01-01

Colorectal cancers (CRCs) are characterized by multiple genetic (mutations) and epigenetic (CpG island methylation) alterations, but it is not known whether these evolve independently through stochastic processes. We have recently described a novel pathway termed CpG island methylator phenotype (CIMP) in CRC, which is characterized by the simultaneous methylation of multiple CpG islands, including several known genes, such as p16, hMLH1, and THBS1. We have now studied mutations in K-RAS, p53, DPC4, and TGFβRII in a panel of colorectal tumors with or without CIMP. We find that CIMP defines two groups of tumors with significantly different genetic lesions: frequent K-RAS mutations were found in CIMP+ CRCs (28/41, 68%) compared with CIMP− cases (14/47, 30%, P = 0.0005). By contrast, p53 mutations were found in 24% (10/41) of CIMP+ CRCs vs. 60% (30/46) of CIMP− cases (P = 0.002). Both of these differences were independent of microsatellite instability. These interactions between CIMP, K-RAS mutations, and p53 mutations were preserved in colorectal adenomas, suggesting that they occur early in carcinogenesis. The distinct combinations of epigenetic and genetic alterations in each group suggest that activation of oncogenes and inactivation of tumor suppressor genes is related to the underlying mechanism of generating molecular diversity in cancer, rather than simply accumulate stochastically during cancer development. PMID:10639144

Allelic Variants of Complement Genes Associated with Dense Deposit Disease

PubMed Central

Abrera-Abeleda, Maria Asuncion; Nishimura, Carla; Frees, Kathy; Jones, Michael; Maga, Tara; Katz, Louis M.; Zhang, Yuzhou

2011-01-01

The alternative pathway of the complement cascade plays a role in the pathogenesis of dense deposit disease (DDD). Deficiency of complement factor H and mutations in CFH associate with the development of DDD, but it is unknown whether allelic variants in other complement genes also associate with this disease. We studied patients with DDD and identified previously unreported sequence alterations in several genes in addition to allelic variants and haplotypes common to patients with DDD. We found that the likelihood of developing DDD increases with the presence of two or more risk alleles in CFH and C3. To determine the functional consequence of this finding, we measured the activity of the alternative pathway in serum samples from phenotypically normal controls genotyped for variants in CFH and C3. Alternative pathway activity was higher in the presence of variants associated with DDD. Taken together, these data confirm that DDD is a complex genetic disease and may provide targets for the development of disease-specific therapies. PMID:21784901

[Distribution of DRD4 and DAT1 alleles from dopaminergic system in a mixed Chilean population].

PubMed

Vieyra, Gonzalo; Moraga, Mauricio; Henríquez, Hugo; Aboitiz, Francisco; Rothhammer, Francisco

2003-02-01

Genes for dopamine receptor DRD4 and dopamine transporter DAT1 are highly polymorphic. Two alleles of these genes, namely the DRD4.7 and the DAT1*9 are frequently associated to the attention deficit disorder with hyperactivity. In Europe, the allele for DRD4 receptor with four repetitions (DRD4.4) has the highest frequency, with a median of 69%, followed by DRD4.7, with a frequency of 15%. South American indigenous populations have higher frequencies for DRD4.7 (61%) than for DRD4.4 (29%). The ten repetition allele for DAT1 transporter has a high frequency among Europeans (72%) and Amerindians (100%). The allele DAT1*9 is the second most frequent allele. To study the frequency of DRD4 and DAT1 alleles in a Chilean population sample. One hundred serum samples were obtained from blood donors in two public hospitals in Santiago. Polymorphic regions for DRD4 and DAT1 were amplified by polymerase chain reaction. The allele DRD4.4 had a frequency of 59% and DRD4.7 a frequency of 27%. The allele DAT1*10 had a frequency of 74%, followed by DAT 1*9, with a frequency of 23%. In a Chilean population sample, the frequency of DRD4 and DAT1 alleles was very similar to that of European populations.

Chimeric Antigen Receptor (CAR)-Specific Monoclonal Antibody to Detect CD19-Specific T Cells in Clinical Trials

PubMed Central

Jena, Bipulendu; Maiti, Sourindra; Huls, Helen; Singh, Harjeet; Lee, Dean A.; Champlin, Richard E.; Cooper, Laurence J. N.

2013-01-01

Clinical trials targeting CD19 on B-cell malignancies are underway with encouraging anti-tumor responses. Most infuse T cells genetically modified to express a chimeric antigen receptor (CAR) with specificity derived from the scFv region of a CD19-specific mouse monoclonal antibody (mAb, clone FMC63). We describe a novel anti-idiotype monoclonal antibody (mAb) to detect CD19-specific CAR+ T cells before and after their adoptive transfer. This mouse mAb was generated by immunizing with a cellular vaccine expressing the antigen-recognition domain of FMC63. The specificity of the mAb (clone no. 136.20.1) was confined to the scFv region of the CAR as validated by inhibiting CAR-dependent lysis of CD19+ tumor targets. This clone can be used to detect CD19-specific CAR+ T cells in peripheral blood mononuclear cells at a sensitivity of 1∶1,000. In clinical settings the mAb is used to inform on the immunophenotype and persistence of administered CD19-specific T cells. Thus, our CD19-specific CAR mAb (clone no. 136.20.1) will be useful to investigators implementing CD19-specific CAR+ T cells to treat B-lineage malignancies. The methodology described to develop a CAR-specific anti-idiotypic mAb could be extended to other gene therapy trials targeting different tumor associated antigens in the context of CAR-based adoptive T-cell therapy. PMID:23469246

Bayesian Inference of Allele-Specific Gene Expression Indicates Abundant Cis-Regulatory Variation in Natural Flycatcher Populations

PubMed Central

Wang, Mi

2017-01-01

Abstract Polymorphism in cis-regulatory sequences can lead to different levels of expression for the two alleles of a gene, providing a starting point for the evolution of gene expression. Little is known about the genome-wide abundance of genetic variation in gene regulation in natural populations but analysis of allele-specific expression (ASE) provides a means for investigating such variation. We performed RNA-seq of multiple tissues from population samples of two closely related flycatcher species and developed a Bayesian algorithm that maximizes data usage by borrowing information from the whole data set and combines several SNPs per transcript to detect ASE. Of 2,576 transcripts analyzed in collared flycatcher, ASE was detected in 185 (7.2%) and a similar frequency was seen in the pied flycatcher. Transcripts with statistically significant ASE commonly showed the major allele in >90% of the reads, reflecting that power was highest when expression was heavily biased toward one of the alleles. This would suggest that the observed frequencies of ASE likely are underestimates. The proportion of ASE transcripts varied among tissues, being lowest in testis and highest in muscle. Individuals often showed ASE of particular transcripts in more than one tissue (73.4%), consistent with a genetic basis for regulation of gene expression. The results suggest that genetic variation in regulatory sequences commonly affects gene expression in natural populations and that it provides a seedbed for phenotypic evolution via divergence in gene expression. PMID:28453623

Forensic genetic informativeness of an SNP panel consisting of 19 multi-allelic SNPs.

PubMed

Gao, Zehua; Chen, Xiaogang; Zhao, Yuancun; Zhao, Xiaohong; Zhang, Shu; Yang, Yiwen; Wang, Yufang; Zhang, Ji

2018-05-01

Current research focusing on forensic personal identification, phenotype inference and ancestry information on single-nucleotide polymorphisms (SNPs) has been widely reported. In the present study, we focused on tetra-allelic SNPs in the Chinese Han population. A total of 48 tetra-allelic SNPs were screened out from the Chinese Han population of the 1000 Genomes Database, including Chinese Han in Beijing (CHB) and Chinese Han South (CHS). Considering the forensic genetic requirement for the polymorphisms, only 11 tetra-allelic SNPs with a heterozygosity >0.06 were selected for further multiplex panel construction. In order to meet the demands of personal identification and parentage identification, an additional 8 tri-allelic SNPs were combined into the final multiplex panel. To ensure application in the degraded DNA analysis, all the PCR products were designed to be 87-188 bp. Employing multiple PCR reactions and SNaPshot minisequencing, 511 unrelated Chinese Han individuals from Sichuan were genotyped. The combined match probability (CMP), combined discrimination power (CDP), and cumulative probability of exclusion (CPE) of the panel were 6.07 × 10 -11 , 0.9999999999393 and 0.996764, respectively. Based on the population data retrieved from the 1000 Genomes Project, Fst values between Chinese Han in Sichuan (SCH) and all the populations included in the 1000 Genomes Project were calculated. The results indicated that two SNPs in this panel may contain ancestry information and may be used as markers of forensic biogeographical ancestry inference. Copyright © 2018 Elsevier B.V. All rights reserved.

Allelic variation in Salmonella: an underappreciated driver of adaptation and virulence

PubMed Central

Yue, Min; Schifferli, Dieter M.

2014-01-01

Salmonella enterica causes substantial morbidity and mortality in humans and animals. Infection and intestinal colonization by S. enterica require virulence factors that mediate bacterial binding and invasion of enterocytes and innate immune cells. Some S. enterica colonization factors and their alleles are host restricted, suggesting a potential role in regulation of host specificity. Recent data also suggest that colonization factors promote horizontal gene transfer of antimicrobial resistance genes by increasing the local density of Salmonella in colonized intestines. Although a profusion of genes are involved in Salmonella pathogenesis, the relative importance of their allelic variation has only been studied intensely in the type 1 fimbrial adhesin FimH. Although other Salmonella virulence factors demonstrate allelic variation, their association with specific metadata (e.g., host species, disease or carrier state, time and geographic place of isolation, antibiotic resistance profile, etc.) remains to be interrogated. To date, genome-wide association studies (GWAS) in bacteriology have been limited by the paucity of relevant metadata. In addition, due to the many variables amid metadata categories, a very large number of strains must be assessed to attain statistically significant results. However, targeted approaches in which genes of interest (e.g., virulence factors) are specifically sequenced alleviates the time-consuming and costly statistical GWAS analysis and increases statistical power, as larger numbers of strains can be screened for non-synonymous single nucleotide polymorphisms (SNPs) that are associated with available metadata. Congruence of specific allelic variants with specific metadata from strains that have a relevant clinical and epidemiological history will help to prioritize functional wet-lab and animal studies aimed at determining cause-effect relationships. Such an approach should be applicable to other pathogens that are being collected

Development of a novel allele-specific Rfo marker and creation of Ogura CMS fertility-restored interspecific hybrids in Brassica oleracea.

PubMed

Yu, Hai-Long; Fang, Zhi-Yuan; Liu, Yu-Mei; Yang, Li-Mei; Zhuang, Mu; Lv, Hong-Hao; Li, Zhan-Sheng; Han, Feng-Qing; Liu, Xiao-Ping; Zhang, Yang-Yong

2016-08-01

A novel allele-specific Rfo marker was developed and proved to be effective for MAS of Rfo gene in B. oleracea background and six Ogu-CMS fertility-restored interspecific hybrids were created for the first time. Ogura cytoplasmic male sterility (Ogu-CMS) has been extensively used for Brassica oleracea hybrid production. However, because of maternal inheritance, all the hybrids produced by CMS lines are male sterile and cannot be self-pollinated, which prohibits germplasm maintenance and innovation. This problem can be overcome by using the Ogu-CMS restorer line, but restorer material is absent in B. oleracea crops. Here, Rfo, a fertility-restored gene of Ogu-CMS, was transferred from rapeseed restorer lines into a Chinese kale Ogu-CMS line using interspecific hybridization combined with embryo rescue. Nine interspecific, triploid plant progenies were identified at morphological and ploidy level, with phenotypes intermediate between those of rapeseed and Chinese kale. Because the Rfo marker (Hu et al., Mol Breeding 22:663-674, 2008) cannot distinguish the Rfo and its homologies under a B. oleracea background, a novel allele-specific Rfo marker was developed based on the BLAST analysis of highly homologous Rfo sequences in B. oleracea. Screening using the novel Rfo marker found that six interspecific hybrids carrying Rfo were also fertile, although fertility varied during different flowering periods. Furthermore, BC1 offsprings with the Rfo gene were selected with the allele-specific Rfo marker and showed restored fertility. These results indicated that the novel allele-specific marker could be used for the MAS of Rfo gene in B. oleracea, and this study lays the foundation for the development of Ogu-CMS restorer material in cabbage and its related other subspecies.

[Molecular authentication of Jinyinhua formula granule by using allele-specific PCR].

PubMed

Jiang, Chao; Tu, Li-Chan; Yuan, Yuan; Huang, Lu-Qi; Gao, Wei; Jin, Yan

2017-07-01

Traditional authentication method is hard to identify herb's authenticity of traditional Chinese medicine(TCM) formula granules because they have lost all their morphological characteristics. In this study, a new allele-specific PCR method was established for identifying the authentication of Jinyinhua formula granule (made from Lonicerae Japonicae Flos) based on an SNP site in trnL-trnF fragment. Genomic DNA was successfully extracted from Lonicerae Japonicae Flos and its formula granules by using an improved spin column method and then PCR was performed with the designed primer. Approximately 110 bp specific bands was obtained only in the authentic Lonicerae Japonicae Flos and its formula granules, while no bands were found in fake mixed products. In addition, the PCR product sequence was proved from Lonicerae Japonicae Flos trnL-trnF sequence by using BLAST method. Therefore, DNA molecular authentication method could make up the limitations of character identification method and microscopic identification, and quickly identify herb's authenticity of TCM formula granules, with enormous potential for market supervision and quality control. Copyright© by the Chinese Pharmaceutical Association.

Collaborations between CpG sites in DNA methylation

NASA Astrophysics Data System (ADS)

Song, You; Ren, Honglei; Lei, Jinzhi

2017-08-01

DNA methylation patterns have profound impacts on genome stability, gene expression and development. The molecular base of DNA methylation patterns has long been focused at single CpG sites level. Here, we construct a kinetic model of DNA methylation with collaborations between CpG sites, from which a correlation function was established based on experimental data. The function consists of three parts that suggest three possible sources of the correlation: movement of enzymes along DNA, collaboration between DNA methylation and nucleosome modification, and global enzyme concentrations within a cell. Moreover, the collaboration strength between DNA methylation and nucleosome modification is universal for mouse early embryo cells. The obtained correlation function provides insightful understanding for the mechanisms of inheritance of DNA methylation patterns.

Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

DOE PAGES

Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

2015-09-21

An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes.

PubMed

Matsa, Elena; Dixon, James E; Medway, Christopher; Georgiou, Orestis; Patel, Minal J; Morgan, Kevin; Kemp, Paul J; Staniforth, Andrew; Mellor, Ian; Denning, Chris

2014-04-01

Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K(+) currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart.

Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes

PubMed Central

Matsa, Elena; Dixon, James E.; Medway, Christopher; Georgiou, Orestis; Patel, Minal J.; Morgan, Kevin; Kemp, Paul J.; Staniforth, Andrew; Mellor, Ian; Denning, Chris

2014-01-01

Aims Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. Methods and results We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K+ currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). Conclusions These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart. PMID:23470493

High lncRNA H19 expression as prognostic indicator: data mining in female cancers and polling analysis in non-female cancers.

PubMed

Peng, Li; Yuan, Xiao-Qing; Liu, Zhao-Yang; Li, Wen-Ling; Zhang, Chao-Yang; Zhang, Ya-Qin; Pan, Xi; Chen, Jun; Li, Yue-Hui; Li, Guan-Cheng

2017-01-03

Upregulation of lncRNA H19 expression is associated with an unfavorable prognosis in some cancers. However, the prognostic value of H19 in female-specific cancers has remained uncharacterized. In this study, the prognostic power of high H19 expression in female cancer patients from the TCGA datasets was analyzed using Kaplan-Meier survival curves and Cox's proportional hazard modeling. In addition, in a meta-analysis of non-female cancer patients from TCGA datasets and 12 independent studies, hazard ratios (HRs) with 95% confidence interval (CI) for overall survival (OS) and disease-free survival (DFS)/relapse-free survival (RFS)/metastasis-free survival (MFS)/progression-free survival (PFS) were pooled to assess the prognostic value of high H19 expression. Kaplan-Meier analysis revealed that patients with uterine corpus cancer and higher H19 expression had a shorter OS (HR=2.710, p<0.05), while females with cervical cancer and increased H19 expression had a shorter RFS (HR=2.261, p<0.05). Multivariate Cox regression analysis showed that high H19 expression could independently predict a poorer prognosis in cervical cancer patients (HR=4.099, p<0.05). In the meta-analysis, patients with high H19 expression showed a poorer outcome in non-female cancer (p<0.05). These results suggest that high lncRNA H19 expression is predictive of an unfavorable prognosis in two female cancers (uterine corpus endometrioid cancer and cervical cancer) as well as in non-female cancer patients.

Powerful Identification of Cis-regulatory SNPs in Human Primary Monocytes Using Allele-Specific Gene Expression

PubMed Central

Almlöf, Jonas Carlsson; Lundmark, Per; Lundmark, Anders; Ge, Bing; Maouche, Seraya; Göring, Harald H. H.; Liljedahl, Ulrika; Enström, Camilla; Brocheton, Jessy; Proust, Carole; Godefroy, Tiphaine; Sambrook, Jennifer G.; Jolley, Jennifer; Crisp-Hihn, Abigail; Foad, Nicola; Lloyd-Jones, Heather; Stephens, Jonathan; Gwilliam, Rhian; Rice, Catherine M.; Hengstenberg, Christian; Samani, Nilesh J.; Erdmann, Jeanette; Schunkert, Heribert; Pastinen, Tomi; Deloukas, Panos; Goodall, Alison H.; Ouwehand, Willem H.; Cambien, François; Syvänen, Ann-Christine

2012-01-01

A large number of genome-wide association studies have been performed during the past five years to identify associations between SNPs and human complex diseases and traits. The assignment of a functional role for the identified disease-associated SNP is not straight-forward. Genome-wide expression quantitative trait locus (eQTL) analysis is frequently used as the initial step to define a function while allele-specific gene expression (ASE) analysis has not yet gained a wide-spread use in disease mapping studies. We compared the power to identify cis-acting regulatory SNPs (cis-rSNPs) by genome-wide allele-specific gene expression (ASE) analysis with that of traditional expression quantitative trait locus (eQTL) mapping. Our study included 395 healthy blood donors for whom global gene expression profiles in circulating monocytes were determined by Illumina BeadArrays. ASE was assessed in a subset of these monocytes from 188 donors by quantitative genotyping of mRNA using a genome-wide panel of SNP markers. The performance of the two methods for detecting cis-rSNPs was evaluated by comparing associations between SNP genotypes and gene expression levels in sample sets of varying size. We found that up to 8-fold more samples are required for eQTL mapping to reach the same statistical power as that obtained by ASE analysis for the same rSNPs. The performance of ASE is insensitive to SNPs with low minor allele frequencies and detects a larger number of significantly associated rSNPs using the same sample size as eQTL mapping. An unequivocal conclusion from our comparison is that ASE analysis is more sensitive for detecting cis-rSNPs than standard eQTL mapping. Our study shows the potential of ASE mapping in tissue samples and primary cells which are difficult to obtain in large numbers. PMID:23300628

Long Non-Coding RNA H19 Protects H9c2 Cells against Hypoxia-Induced Injury by Targeting MicroRNA-139.

PubMed

Gong, Li-Cheng; Xu, Hai-Ming; Guo, Gong-Liang; Zhang, Tao; Shi, Jing-Wei; Chang, Chang

2017-01-01

Acute myocardial infarction (AMI) occurs when blood supply to the heart is diminished (ischemia) for long time; ischemia is primarily caused due to hypoxia. The present study evaluated the effects of long non-coding RNA H19 on hypoxic rat H9c2 cells and mouse HL-1 cells. Hypoxic injury was confirmed by measuring cell viability, migration and invasion, and apoptosis using MTT, Transwell and flow cytometry assays, respectively. H19 expression after hypoxia was estimated by qRT-PCR. We then measured the effects of non-physiologically expressed H19, knockdown of miR-139 with or without H19 silence, and abnormally expressed Sox8 on hypoxia-induced H9c2 cells. Moreover, the interacted miRNA for H19 and downstream target gene were virtually screened and verified. The involved signaling pathways and the effects of abnormally expressed H19 on contractility of HL-1 cells were explored via Western blot analysis. Hypoxia induced decreases of cell viability, migration and invasion, increase of cell apoptosis and up-regulation of H19. Knockdown of H19 increased hypoxia-induced injury in H9c2 cells. H19 acted as a sponge for miR-139 and H19 knockdown aggravated hypoxia-induced injury by up-regulating miR-139. Sox8 was identified as a target of miR-139, and its expression was negatively regulated by miR-139. The mechanistic studies revealed that overexpression of Sox8 might decrease hypoxia-induced cell injury by activating the PI3K/AKT/mTOR pathway and MAPK. Besides, H19 promoted contractility of HL-1 cells. These findings suggest that H19 alleviates hypoxia-induced myocardial cell injury by miR-139-mediated up-regulation of Sox8, along with activation of the PI3K/AKT/mTOR pathway and MAPK. © 2017 The Author(s). Published by S. Karger AG, Basel.

A powerful and flexible statistical framework for testing hypotheses of allele-specific gene expression from RNA-seq data

PubMed Central

Skelly, Daniel A.; Johansson, Marnie; Madeoy, Jennifer; Wakefield, Jon; Akey, Joshua M.

2011-01-01

Variation in gene expression is thought to make a significant contribution to phenotypic diversity among individuals within populations. Although high-throughput cDNA sequencing offers a unique opportunity to delineate the genome-wide architecture of regulatory variation, new statistical methods need to be developed to capitalize on the wealth of information contained in RNA-seq data sets. To this end, we developed a powerful and flexible hierarchical Bayesian model that combines information across loci to allow both global and locus-specific inferences about allele-specific expression (ASE). We applied our methodology to a large RNA-seq data set obtained in a diploid hybrid of two diverse Saccharomyces cerevisiae strains, as well as to RNA-seq data from an individual human genome. Our statistical framework accurately quantifies levels of ASE with specified false-discovery rates, achieving high reproducibility between independent sequencing platforms. We pinpoint loci that show unusual and biologically interesting patterns of ASE, including allele-specific alternative splicing and transcription termination sites. Our methodology provides a rigorous, quantitative, and high-resolution tool for profiling ASE across whole genomes. PMID:21873452

Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

PubMed

Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

2002-12-20

A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.

Fast and simultaneous determination of 1 H-1 H and 1 H-19 F scalar couplings in complex spin systems: Application of PSYCHE homonuclear broadband decoupling.

PubMed

Kakita, Veera Mohana Rao; Rachineni, Kavitha; Hosur, Ramakrishna V

2017-07-21

The present manuscript focuses on fast and simultaneous determination of 1 H- 1 H and 1 H- 19 F scalar couplings in fluorinated complex steroid molecules. Incorporation of broadband PSYCHE homonuclear decoupling in the indirect dimension of zero-quantum filtered diagonal experiments (F1-PSYCHE-DIAG) suppresses 1 H- 1 H scalar couplings; however, it retains 1 H- 19 F scalar couplings (along F1 dimension) for the 19 F coupled protons while preserving the pure-shift nature for 1 H resonances uncoupled to 19 F. In such cases, along the direct dimensions, 1 H- 1 H scalar coupling multiplets deconvolute and they appear as duplicated multiplets for the 19 F coupled protons, which facilitates unambiguous discrimination of 19 F coupled 1 H chemical sites from the others. Further, as an added advantage, data acquisition has been accelerated by invoking the known ideas of spectral aliasing in the F1-PSYCHE-DIAG scheme and experiments demand only ~10 min of spectrometer times. Copyright © 2017 John Wiley & Sons, Ltd.

Epigenetic control of alternative mRNA processing at the imprinted Herc3/Nap1l5 locus

PubMed Central

Cowley, Michael; Wood, Andrew J.; Böhm, Sabrina; Schulz, Reiner; Oakey, Rebecca J.

2012-01-01

Alternative polyadenylation increases transcriptome diversity by generating multiple transcript isoforms from a single gene. It is thought that this process can be subject to epigenetic regulation, but few specific examples of this have been reported. We previously showed that the Mcts2/H13 locus is subject to genomic imprinting and that alternative polyadenylation of H13 transcripts occurs in an allele-specific manner, regulated by epigenetic mechanisms. Here, we demonstrate that allele-specific polyadenylation occurs at another imprinted locus with similar features. Nap1l5 is a retrogene expressed from the paternally inherited allele, is situated within an intron of a ‘host’ gene Herc3, and overlaps a CpG island that is differentially methylated between the parental alleles. In mouse brain, internal Herc3 polyadenylation sites upstream of Nap1l5 are used on the paternally derived chromosome, from which Nap1l5 is expressed, whereas a downstream site is used more frequently on the maternally derived chromosome. Ablating DNA methylation on the maternal allele at the Nap1l5 promoter increases the use of an internal Herc3 polyadenylation site and alters exon splicing. These changes demonstrate the influence of epigenetic mechanisms in regulating Herc3 alternative mRNA processing. Internal Herc3 polyadenylation correlates with expression levels of Nap1l5, suggesting a possible role for transcriptional interference. Similar mechanisms may regulate alternative polyadenylation elsewhere in the genome. PMID:22790983

In vitro induction of T regulatory cells by a methylated CpG DNA sequence in humans: Potential therapeutic applications in allergic and autoimmune diseases.

PubMed

Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo

2018-03-01

Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen

Immunostimulatory CpG on Carbon Nanotubes Selectively Inhibits Migration of Brain Tumor Cells.

PubMed

Alizadeh, Darya; White, Ethan E; Sanchez, Teresa C; Liu, Shunan; Zhang, Leying; Badie, Behnam; Berlin, Jacob M

2018-05-16

Even when treated with aggressive current therapies, patients with glioblastoma usually survive less than two years and exhibit a high rate of recurrence. CpG is an oligonucleotide that activates the innate immune system via Toll-like receptor 9 (TLR9) activation. Injection of CpG into glioblastoma tumors showed promise as an immunotherapy in mouse models but proved disappointing in human trials. One aspect of glioma that is not addressed by CpG therapy alone is the highly invasive nature of glioma cells, which is associated with resistance to radiation and chemotherapy. Here, we demonstrate that single-walled carbon nanotubes noncovalently functionalized with CpG (SWNT/CpG), which retain the immunostimulatory property of the CpG, selectively inhibit the migration of glioma cells and not macrophages without affecting cell viability or proliferation. SWNT/CpG also selectively decreased NF-κB activation in glioma cells, while activating macrophages by induction of the TLR9/NF-κB pathway, as we have previously reported. The migration inhibition of glioma cells was correlated with selective reduction of intracellular levels of reactive oxygen species (ROS), suggesting that an antioxidant-based mechanism mediates the observed effects. To the best of our knowledge, SWNT/CpG is the first nanomaterial that inhibits the migration of cancer cells while stimulating the immune system.

Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias

PubMed Central

Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.

2013-01-01

Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644

Differential methylation of tissue- and cancer-specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic stem cells and fibroblasts

PubMed Central

Doi, Akiko; Park, In-Hyun; Wen, Bo; Murakami, Peter; Aryee, Martin J; Irizarry, Rafael; Herb, Brian; Ladd-Acosta, Christine; Rho, Junsung; Loewer, Sabine; Miller, Justine; Schlaeger, Thorsten; Daley, George Q; Feinberg, Andrew P

2010-01-01

Induced pluripotent stem (iPS) cells are derived by epigenetic reprogramming, but their DNA methylation patterns have not yet been analyzed on a genome-wide scale. Here, we find substantial hypermethylation and hypomethylation of cytosine-phosphate-guanine (CpG) island shores in nine human iPS cell lines as compared to their parental fibroblasts. The differentially methylated regions (DMRs) in the reprogrammed cells (denoted R-DMRs) were significantly enriched in tissue-specific (T-DMRs; 2.6-fold, P < 10−4) and cancer-specific DMRs (C-DMRs; 3.6-fold, P < 10−4). Notably, even though the iPS cells are derived from fibroblasts, their R-DMRs can distinguish between normal brain, liver and spleen cells and between colon cancer and normal colon cells. Thus, many DMRs are broadly involved in tissue differentiation, epigenetic reprogramming and cancer. We observed colocalization of hypomethylated R-DMRs with hypermethylated C-DMRs and bivalent chromatin marks, and colocalization of hypermethylated R-DMRs with hypomethylated C-DMRs and the absence of bivalent marks, suggesting two mechanisms for epigenetic reprogramming in iPS cells and cancer. PMID:19881528

The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

PubMed

Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

2014-01-01

DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

High lncRNA H19 expression as prognostic indicator: data mining in female cancers and polling analysis in non-female cancers

PubMed Central

Peng, Li; Liu, Zhao-Yang; Li, Wen-Ling; Zhang, Chao-Yang; Zhang, Ya-Qin; Pan, Xi; Chen, Jun; Li, Yue-Hui

2017-01-01

Upregulation of lncRNA H19 expression is associated with an unfavorable prognosis in some cancers. However, the prognostic value of H19 in female-specific cancers has remained uncharacterized. In this study, the prognostic power of high H19 expression in female cancer patients from the TCGA datasets was analyzed using Kaplan-Meier survival curves and Cox's proportional hazard modeling. In addition, in a meta-analysis of non-female cancer patients from TCGA datasets and 12 independent studies, hazard ratios (HRs) with 95% confidence interval (CI) for overall survival (OS) and disease-free survival (DFS)/relapse-free survival (RFS)/metastasis-free survival (MFS)/progression-free survival (PFS) were pooled to assess the prognostic value of high H19 expression. Kaplan-Meier analysis revealed that patients with uterine corpus cancer and higher H19 expression had a shorter OS (HR=2.710, p<0.05), while females with cervical cancer and increased H19 expression had a shorter RFS (HR=2.261, p<0.05). Multivariate Cox regression analysis showed that high H19 expression could independently predict a poorer prognosis in cervical cancer patients (HR=4.099, p<0.05). In the meta-analysis, patients with high H19 expression showed a poorer outcome in non-female cancer (p<0.05). These results suggest that high lncRNA H19 expression is predictive of an unfavorable prognosis in two female cancers (uterine corpus endometrioid cancer and cervical cancer) as well as in non-female cancer patients. PMID:27926484

Adherence to Clinical Practice Guidelines (CPG) management of dengue infection in adults (revised 2nd edition)

PubMed Central

Suli, Zailiza; Singh Gill, Balvinder; Rudra Deva, Shanti; Abdullah Sani, Ana Fizalinda; Romli, Erni Zurina; Mohamed Ghazali, Izzuna Mudla; Mohd. Yusof, Mohd. Aminuddin; Ahmad Lutfi, Nafisah; Shuib, Shahril Effendi; Mohd Darus, Noormah; Bakri, Rugayah

2017-01-01

The Malaysian Dengue Clinical Practice Guidelines (CPG) have been developed to provide evidence-based guidance in the management of dengue infections. The use of these guidelines is essential to ensure its recommendations are being practiced. However, the adherence to the guidelines for management of dengue (revised 2nd edition) by healthcare providers still remains unknown. Therefore, the aim of this study was to evaluate the proportion among healthcare providers that adhere to this Dengue CPG. A retrospective cohort study of dengue cases registered from 1 January 2014 to 1 June 2015 was conducted in public hospitals and health clinics in Selangor, Putrajaya and Kuala Lumpur. Adherence to the CPG recommendations were recorded by reviewing patients’ case notes. Overall proportion of adherence in clinical components of the recommendation were (7.1 to 100.0% versus 7.7 to 73.8%) in history taking, (6.7 to 100.0% versus 12.3 to 60.0%) in physical examinations, (18.4 to 100.0% versus 23.1 to 83.2%) in assessment of warning signs, (0.6 to 100.0% versus 12.3 to 87.7%) in assessment of haemodynamic status, (60.0 to 100.0% versus 27.7 to 40.0%) in diagnosis, (46.6 to 80.0% versus 52.3%) in case notifications, (73.2 to 100.0% versus 89.2 to 96.9%) in performing specific laboratory investigations and (7.9 to 100.0% versus 21.5%) in monitoring, for outpatient versus inpatient, respectively. Adherence trends were demonstrated to be higher in hospital settings compared to outpatient settings. Adherence to this Dengue CPG varies widely with overall good clinical outcomes observed. PMID:29095822

Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved

PubMed Central

Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.

2016-01-01

DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945

Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages

PubMed Central

Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.

2015-01-01

Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245

Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.

PubMed

Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L

2015-08-01

Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

PubMed Central

Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

2006-01-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

PubMed

Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

2006-03-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

dbCPG: A web resource for cancer predisposition genes.

PubMed

Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

2016-06-21

Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes.

dbCPG: A web resource for cancer predisposition genes

PubMed Central

Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

2016-01-01

Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes. PMID:27192119

Specific β-Turns Precede PPIIL Structures Binding to Allele-Specific HLA-DRβ1* PBRs in Fully-Protective Malaria Vaccine Components

PubMed Central

Bermudez, Adriana; Alba, Martha P.; Vanegas, Magnolia; Patarroyo, Manuel A.; Patarroyo, Manuel E.

2018-01-01

The 3D structural analysis of 62 peptides derived from highly pathogenic Plasmodium falciparum malaria parasite proteins involved in host cell invasion led to finding a striking association between particular β-turn types located in the N-terminal peripheral flanking residue region (preceding the polyproline II left-handed structures fitting into the HLA-DRβ* allele family) and modified immune protection-inducing protein structure induced long-lasting protective immunity. This is the first time association between two different secondary structures associated with a specific immunological function has been described: full, long-lasting protective immunity. PMID:29682500

Specific β-Turns Precede PPIIL Structures Binding to Allele-Specific HLA-DRβ1* PBRs in Fully-Protective Malaria Vaccine Components.

PubMed

Bermudez, Adriana; Alba, Martha P; Vanegas, Magnolia; Patarroyo, Manuel A; Patarroyo, Manuel E

2018-01-01

The 3D structural analysis of 62 peptides derived from highly pathogenic Plasmodium falciparum malaria parasite proteins involved in host cell invasion led to finding a striking association between particular β-turn types located in the N-terminal peripheral flanking residue region (preceding the polyproline II left-handed structures fitting into the HLA-DRβ * allele family) and modified i mmune protection-inducing protein structure induced long-lasting protective immunity. This is the first time association between two different secondary structures associated with a specific immunological function has been described: full, long-lasting protective immunity.

Specific β-turns precede PPIIL structures binding to allele-specific HLA-DRβ1* PBRs in fully-protective malaria vaccine components

NASA Astrophysics Data System (ADS)

Bermudez, Adriana; Alba, Martha P.; Vanegas, Magnolia; Patarroyo, Manuel A.; Patarroyo, Manuel E.

2018-04-01

The 3D structural analysis of 62 peptides derived from highly pathogenic Plasmodium falciparum malaria parasite proteins involved in host cell invasion led to finding a striking association between particular β-turn types located in the N-terminal peripheral flanking residue region (preceding the polyproline II left-handed structures fitting into the HLA-DRβ* allele family) and modified immune protection-inducing protein structure induced long-lasting protective immunity. This is the first time association between two different secondary structures associated with a specific immunological function has been described: full, long-lasting protective immunity.

Functional mechanisms underlying pleiotropic risk alleles at the 19p13.1 breast–ovarian cancer susceptibility locus

PubMed Central

Lawrenson, Kate; Kar, Siddhartha; McCue, Karen; Kuchenbaeker, Karoline; Michailidou, Kyriaki; Tyrer, Jonathan; Beesley, Jonathan; Ramus, Susan J.; Li, Qiyuan; Delgado, Melissa K.; Lee, Janet M.; Aittomäki, Kristiina; Andrulis, Irene L.; Anton-Culver, Hoda; Arndt, Volker; Arun, Banu K.; Arver, Brita; Bandera, Elisa V.; Barile, Monica; Barkardottir, Rosa B.; Barrowdale, Daniel; Beckmann, Matthias W.; Benitez, Javier; Berchuck, Andrew; Bisogna, Maria; Bjorge, Line; Blomqvist, Carl; Blot, William; Bogdanova, Natalia; Bojesen, Anders; Bojesen, Stig E.; Bolla, Manjeet K.; Bonanni, Bernardo; Børresen-Dale, Anne-Lise; Brauch, Hiltrud; Brennan, Paul; Brenner, Hermann; Bruinsma, Fiona; Brunet, Joan; Buhari, Shaik Ahmad; Burwinkel, Barbara; Butzow, Ralf; Buys, Saundra S.; Cai, Qiuyin; Caldes, Trinidad; Campbell, Ian; Canniotto, Rikki; Chang-Claude, Jenny; Chiquette, Jocelyne; Choi, Ji-Yeob; Claes, Kathleen B. M.; Collonge-Rame, Marie- Agnès; Damette, Alexandre; Barouk-Simonet, Emmanuelle; Bonnet, Françoise; Bubien, Virginie; Sevenet, Nicolas; Longy, Michel; Berthet, Pascaline; Vaur, Dominique; Castera, Laurent; Ferrer, Sandra Fert; Bignon, Yves-Jean; Uhrhammer, Nancy; Coron, Fanny; Faivre, Laurence; Baurand, Amandine; Jacquot, Caroline; Bertolone, Geoffrey; Lizard, Sarab; Leroux, Dominique; Dreyfus, Hélène; Rebischung, Christine; Peysselon, Magalie; Peyrat, Jean-Philippe; Fournier, Joëlle; Révillion, Françoise; Adenis, Claude; Vénat-Bouvet, Laurence; Léone, Mélanie; Boutry-Kryza, Nadia; Calender, Alain; Giraud, Sophie; Verny-Pierre, Carole; Lasset, Christine; Bonadona, Valérie; Barjhoux, Laure; Sobol, Hagay; Bourdon, Violaine; Noguchi, Tetsuro; Remenieras, Audrey; Coupier, Isabelle; Pujol, Pascal; Sokolowska, Johanna; Bronner, Myriam; Delnatte, Capucine; Bézieau, Stéphane; Mari, Véronique; Gauthier-Villars, Marion; Buecher, Bruno; Rouleau, Etienne; Golmard, Lisa; Moncoutier, Virginie; Belotti, Muriel; de Pauw, Antoine; Elan, Camille; Fourme, Emmanuelle; Birot, Anne-Marie; Saule, Claire; Laurent, Maïté; Houdayer, Claude; Lesueur, Fabienne; Mebirouk, Noura; Coulet, Florence; Colas, Chrystelle; Soubrier, Florent; Warcoin, Mathilde; Prieur, Fabienne; Lebrun, Marine; Kientz, Caroline; Muller, Danièle; Fricker, Jean-Pierre; Toulas, Christine; Guimbaud, Rosine; Gladieff, Laurence; Feillel, Viviane; Mortemousque, Isabelle; Bressac-de-Paillerets, Brigitte; Caron, Olivier; Guillaud-Bataille, Marine; Cook, Linda S.; Cox, Angela; Cramer, Daniel W.; Cross, Simon S.; Cybulski, Cezary; Czene, Kamila; Daly, Mary B.; Damiola, Francesca; Dansonka-Mieszkowska, Agnieszka; Darabi, Hatef; Dennis, Joe; Devilee, Peter; Diez, Orland; Doherty, Jennifer A.; Domchek, Susan M.; Dorfling, Cecilia M.; Dörk, Thilo; Dumont, Martine; Ehrencrona, Hans; Ejlertsen, Bent; Ellis, Steve; Gregory, Helen; Miedzybrodzka, Zosia; Morrison, Patrick J.; Donaldson, Alan; Rogers, Mark T.; Kennedy, M. John; Porteous, Mary E.; Brady, Angela; Barwell, Julian; Foo, Claire; Lalloo, Fiona; Side, Lucy E.; Eason, Jacqueline; Henderson, Alex; Walker, Lisa; Cook, Jackie; Snape, Katie; Murray, Alex; McCann, Emma; Engel, Christoph; Lee, Eunjung; Evans, D. Gareth; Fasching, Peter A.; Feliubadalo, Lidia; Figueroa, Jonine; Flesch-Janys, Dieter; Fletcher, Olivia; Flyger, Henrik; Foretova, Lenka; Fostira, Florentia; Foulkes, William D.; Fridley, Brooke L.; Friedman, Eitan; Frost, Debra; Gambino, Gaetana; Ganz, Patricia A.; Garber, Judy; García-Closas, Montserrat; Gentry-Maharaj, Aleksandra; Ghoussaini, Maya; Giles, Graham G.; Glasspool, Rosalind; Godwin, Andrew K.; Goldberg, Mark S.; Goldgar, David E.; González-Neira, Anna; Goode, Ellen L.; Goodman, Marc T.; Greene, Mark H.; Gronwald, Jacek; Guénel, Pascal; Haiman, Christopher A.; Hall, Per; Hallberg, Emily; Hamann, Ute; Hansen, Thomas V. O.; Harrington, Patricia A.; Hartman, Mikael; Hassan, Norhashimah; Healey, Sue; Rookus, M. A.; van Leeuwen, F. E.; van der Kolk, L. E.; Schmidt, M. K.; Russell, N. S.; de Lange, J. L.; Wijnands, R.; Collée, J. M.; Hooning, M. J.; Seynaeve, C.; van Deurzen, C. H. M.; Obdeijn, I. M.; van Asperen, C. J.; Tollenaar, R. A. E. M.; van Cronenburg, T. C. T. E. F.; Kets, C. M.; Ausems, M. G. E. M.; van der Pol, C. C.; van Os, T. A. M.; Waisfisz, Q.; Meijers-Heijboer, H. E. J.; Gómez-Garcia, E. B.; Oosterwijk, J. C.; Mourits, M. J.; de Bock, G. H.; Vasen, H. F.; Siesling, S.; Verloop, J.; Overbeek, L. I. H.; Heitz, Florian; Herzog, Josef; Høgdall, Estrid; Høgdall, Claus K.; Hogervorst, Frans B. L.; Hollestelle, Antoinette; Hopper, John L.; Hulick, Peter J.; Huzarski, Tomasz; Imyanitov, Evgeny N.; Fox, Stephen; Kirk, Judy; Lindeman, Geoff; Price, Melanie; Bowtell, David; deFazio, Anna; Webb, Penny; Isaacs, Claudine; Ito, Hidemi; Jakubowska, Anna; Janavicius, Ramunas; Jensen, Allan; John, Esther M.; Johnson, Nichola; Kabisch, Maria; Kang, Daehee; Kapuscinski, Miroslav; Karlan, Beth Y.; Khan, Sofia; Kiemeney, Lambertus A.; Kjaer, Susanne Kruger; Knight, Julia A.; Konstantopoulou, Irene; Kosma, Veli-Matti; Kristensen, Vessela; Kupryjanczyk, Jolanta; Kwong, Ava; de la Hoya, Miguel; Laitman, Yael; Lambrechts, Diether; Le, Nhu; De Leeneer, Kim; Lester, Jenny; Levine, Douglas A.; Li, Jingmei; Lindblom, Annika; Long, Jirong; Lophatananon, Artitaya; Loud, Jennifer T.; Lu, Karen; Lubinski, Jan; Mannermaa, Arto; Manoukian, Siranoush; Le Marchand, Loic; Margolin, Sara; Marme, Frederik; Massuger, Leon F. A. G.; Matsuo, Keitaro; Mazoyer, Sylvie; McGuffog, Lesley; McLean, Catriona; McNeish, Iain; Meindl, Alfons; Menon, Usha; Mensenkamp, Arjen R.; Milne, Roger L.; Montagna, Marco; Moysich, Kirsten B.; Muir, Kenneth; Mulligan, Anna Marie; Nathanson, Katherine L.; Ness, Roberta B.; Neuhausen, Susan L.; Nevanlinna, Heli; Nord, Silje; Nussbaum, Robert L.; Odunsi, Kunle; Offit, Kenneth; Olah, Edith; Olopade, Olufunmilayo I.; Olson, Janet E.; Olswold, Curtis; O'Malley, David; Orlow, Irene; Orr, Nick; Osorio, Ana; Park, Sue Kyung; Pearce, Celeste L.; Pejovic, Tanja; Peterlongo, Paolo; Pfeiler, Georg; Phelan, Catherine M.; Poole, Elizabeth M.; Pylkäs, Katri; Radice, Paolo; Rantala, Johanna; Rashid, Muhammad Usman; Rennert, Gad; Rhenius, Valerie; Rhiem, Kerstin; Risch, Harvey A.; Rodriguez, Gus; Rossing, Mary Anne; Rudolph, Anja; Salvesen, Helga B.; Sangrajrang, Suleeporn; Sawyer, Elinor J.; Schildkraut, Joellen M.; Schmidt, Marjanka K.; Schmutzler, Rita K.; Sellers, Thomas A.; Seynaeve, Caroline; Shah, Mitul; Shen, Chen-Yang; Shu, Xiao-Ou; Sieh, Weiva; Singer, Christian F.; Sinilnikova, Olga M.; Slager, Susan; Song, Honglin; Soucy, Penny; Southey, Melissa C.; Stenmark-Askmalm, Marie; Stoppa-Lyonnet, Dominique; Sutter, Christian; Swerdlow, Anthony; Tchatchou, Sandrine; Teixeira, Manuel R.; Teo, Soo H.; Terry, Kathryn L.; Terry, Mary Beth; Thomassen, Mads; Tibiletti, Maria Grazia; Tihomirova, Laima; Tognazzo, Silvia; Toland, Amanda Ewart; Tomlinson, Ian; Torres, Diana; Truong, Thérèse; Tseng, Chiu-chen; Tung, Nadine; Tworoger, Shelley S.; Vachon, Celine; van den Ouweland, Ans M. W.; van Doorn, Helena C.; van Rensburg, Elizabeth J.; Van't Veer, Laura J.; Vanderstichele, Adriaan; Vergote, Ignace; Vijai, Joseph; Wang, Qin; Wang-Gohrke, Shan; Weitzel, Jeffrey N.; Wentzensen, Nicolas; Whittemore, Alice S.; Wildiers, Hans; Winqvist, Robert; Wu, Anna H.; Yannoukakos, Drakoulis; Yoon, Sook-Yee; Yu, Jyh-Cherng; Zheng, Wei; Zheng, Ying; Khanna, Kum Kum; Simard, Jacques; Monteiro, Alvaro N.; French, Juliet D.; Couch, Fergus J.; Freedman, Matthew L.; Easton, Douglas F.; Dunning, Alison M.; Pharoah, Paul D.; Edwards, Stacey L.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Gayther, Simon A.

2016-01-01

A locus at 19p13 is associated with breast cancer (BC) and ovarian cancer (OC) risk. Here we analyse 438 SNPs in this region in 46,451 BC and 15,438 OC cases, 15,252 BRCA1 mutation carriers and 73,444 controls and identify 13 candidate causal SNPs associated with serous OC (P=9.2 × 10−20), ER-negative BC (P=1.1 × 10−13), BRCA1-associated BC (P=7.7 × 10−16) and triple negative BC (P-diff=2 × 10−5). Genotype-gene expression associations are identified for candidate target genes ANKLE1 (P=2 × 10−3) and ABHD8 (P<2 × 10−3). Chromosome conformation capture identifies interactions between four candidate SNPs and ABHD8, and luciferase assays indicate six risk alleles increased transactivation of the ADHD8 promoter. Targeted deletion of a region containing risk SNP rs56069439 in a putative enhancer induces ANKLE1 downregulation; and mRNA stability assays indicate functional effects for an ANKLE1 3′-UTR SNP. Altogether, these data suggest that multiple SNPs at 19p13 regulate ABHD8 and perhaps ANKLE1 expression, and indicate common mechanisms underlying breast and ovarian cancer risk. PMID:27601076

Functional mechanisms underlying pleiotropic risk alleles at the 19p13.1 breast-ovarian cancer susceptibility locus.

PubMed

Lawrenson, Kate; Kar, Siddhartha; McCue, Karen; Kuchenbaeker, Karoline; Michailidou, Kyriaki; Tyrer, Jonathan; Beesley, Jonathan; Ramus, Susan J; Li, Qiyuan; Delgado, Melissa K; Lee, Janet M; Aittomäki, Kristiina; Andrulis, Irene L; Anton-Culver, Hoda; Arndt, Volker; Arun, Banu K; Arver, Brita; Bandera, Elisa V; Barile, Monica; Barkardottir, Rosa B; Barrowdale, Daniel; Beckmann, Matthias W; Benitez, Javier; Berchuck, Andrew; Bisogna, Maria; Bjorge, Line; Blomqvist, Carl; Blot, William; Bogdanova, Natalia; Bojesen, Anders; Bojesen, Stig E; Bolla, Manjeet K; Bonanni, Bernardo; Børresen-Dale, Anne-Lise; Brauch, Hiltrud; Brennan, Paul; Brenner, Hermann; Bruinsma, Fiona; Brunet, Joan; Buhari, Shaik Ahmad; Burwinkel, Barbara; Butzow, Ralf; Buys, Saundra S; Cai, Qiuyin; Caldes, Trinidad; Campbell, Ian; Canniotto, Rikki; Chang-Claude, Jenny; Chiquette, Jocelyne; Choi, Ji-Yeob; Claes, Kathleen B M; Cook, Linda S; Cox, Angela; Cramer, Daniel W; Cross, Simon S; Cybulski, Cezary; Czene, Kamila; Daly, Mary B; Damiola, Francesca; Dansonka-Mieszkowska, Agnieszka; Darabi, Hatef; Dennis, Joe; Devilee, Peter; Diez, Orland; Doherty, Jennifer A; Domchek, Susan M; Dorfling, Cecilia M; Dörk, Thilo; Dumont, Martine; Ehrencrona, Hans; Ejlertsen, Bent; Ellis, Steve; Engel, Christoph; Lee, Eunjung; Evans, D Gareth; Fasching, Peter A; Feliubadalo, Lidia; Figueroa, Jonine; Flesch-Janys, Dieter; Fletcher, Olivia; Flyger, Henrik; Foretova, Lenka; Fostira, Florentia; Foulkes, William D; Fridley, Brooke L; Friedman, Eitan; Frost, Debra; Gambino, Gaetana; Ganz, Patricia A; Garber, Judy; García-Closas, Montserrat; Gentry-Maharaj, Aleksandra; Ghoussaini, Maya; Giles, Graham G; Glasspool, Rosalind; Godwin, Andrew K; Goldberg, Mark S; Goldgar, David E; González-Neira, Anna; Goode, Ellen L; Goodman, Marc T; Greene, Mark H; Gronwald, Jacek; Guénel, Pascal; Haiman, Christopher A; Hall, Per; Hallberg, Emily; Hamann, Ute; Hansen, Thomas V O; Harrington, Patricia A; Hartman, Mikael; Hassan, Norhashimah; Healey, Sue; Heitz, Florian; Herzog, Josef; Høgdall, Estrid; Høgdall, Claus K; Hogervorst, Frans B L; Hollestelle, Antoinette; Hopper, John L; Hulick, Peter J; Huzarski, Tomasz; Imyanitov, Evgeny N; Isaacs, Claudine; Ito, Hidemi; Jakubowska, Anna; Janavicius, Ramunas; Jensen, Allan; John, Esther M; Johnson, Nichola; Kabisch, Maria; Kang, Daehee; Kapuscinski, Miroslav; Karlan, Beth Y; Khan, Sofia; Kiemeney, Lambertus A; Kjaer, Susanne Kruger; Knight, Julia A; Konstantopoulou, Irene; Kosma, Veli-Matti; Kristensen, Vessela; Kupryjanczyk, Jolanta; Kwong, Ava; de la Hoya, Miguel; Laitman, Yael; Lambrechts, Diether; Le, Nhu; De Leeneer, Kim; Lester, Jenny; Levine, Douglas A; Li, Jingmei; Lindblom, Annika; Long, Jirong; Lophatananon, Artitaya; Loud, Jennifer T; Lu, Karen; Lubinski, Jan; Mannermaa, Arto; Manoukian, Siranoush; Le Marchand, Loic; Margolin, Sara; Marme, Frederik; Massuger, Leon F A G; Matsuo, Keitaro; Mazoyer, Sylvie; McGuffog, Lesley; McLean, Catriona; McNeish, Iain; Meindl, Alfons; Menon, Usha; Mensenkamp, Arjen R; Milne, Roger L; Montagna, Marco; Moysich, Kirsten B; Muir, Kenneth; Mulligan, Anna Marie; Nathanson, Katherine L; Ness, Roberta B; Neuhausen, Susan L; Nevanlinna, Heli; Nord, Silje; Nussbaum, Robert L; Odunsi, Kunle; Offit, Kenneth; Olah, Edith; Olopade, Olufunmilayo I; Olson, Janet E; Olswold, Curtis; O'Malley, David; Orlow, Irene; Orr, Nick; Osorio, Ana; Park, Sue Kyung; Pearce, Celeste L; Pejovic, Tanja; Peterlongo, Paolo; Pfeiler, Georg; Phelan, Catherine M; Poole, Elizabeth M; Pylkäs, Katri; Radice, Paolo; Rantala, Johanna; Rashid, Muhammad Usman; Rennert, Gad; Rhenius, Valerie; Rhiem, Kerstin; Risch, Harvey A; Rodriguez, Gus; Rossing, Mary Anne; Rudolph, Anja; Salvesen, Helga B; Sangrajrang, Suleeporn; Sawyer, Elinor J; Schildkraut, Joellen M; Schmidt, Marjanka K; Schmutzler, Rita K; Sellers, Thomas A; Seynaeve, Caroline; Shah, Mitul; Shen, Chen-Yang; Shu, Xiao-Ou; Sieh, Weiva; Singer, Christian F; Sinilnikova, Olga M; Slager, Susan; Song, Honglin; Soucy, Penny; Southey, Melissa C; Stenmark-Askmalm, Marie; Stoppa-Lyonnet, Dominique; Sutter, Christian; Swerdlow, Anthony; Tchatchou, Sandrine; Teixeira, Manuel R; Teo, Soo H; Terry, Kathryn L; Terry, Mary Beth; Thomassen, Mads; Tibiletti, Maria Grazia; Tihomirova, Laima; Tognazzo, Silvia; Toland, Amanda Ewart; Tomlinson, Ian; Torres, Diana; Truong, Thérèse; Tseng, Chiu-Chen; Tung, Nadine; Tworoger, Shelley S; Vachon, Celine; van den Ouweland, Ans M W; van Doorn, Helena C; van Rensburg, Elizabeth J; Van't Veer, Laura J; Vanderstichele, Adriaan; Vergote, Ignace; Vijai, Joseph; Wang, Qin; Wang-Gohrke, Shan; Weitzel, Jeffrey N; Wentzensen, Nicolas; Whittemore, Alice S; Wildiers, Hans; Winqvist, Robert; Wu, Anna H; Yannoukakos, Drakoulis; Yoon, Sook-Yee; Yu, Jyh-Cherng; Zheng, Wei; Zheng, Ying; Khanna, Kum Kum; Simard, Jacques; Monteiro, Alvaro N; French, Juliet D; Couch, Fergus J; Freedman, Matthew L; Easton, Douglas F; Dunning, Alison M; Pharoah, Paul D; Edwards, Stacey L; Chenevix-Trench, Georgia; Antoniou, Antonis C; Gayther, Simon A

2016-09-07

A locus at 19p13 is associated with breast cancer (BC) and ovarian cancer (OC) risk. Here we analyse 438 SNPs in this region in 46,451 BC and 15,438 OC cases, 15,252 BRCA1 mutation carriers and 73,444 controls and identify 13 candidate causal SNPs associated with serous OC (P=9.2 × 10(-20)), ER-negative BC (P=1.1 × 10(-13)), BRCA1-associated BC (P=7.7 × 10(-16)) and triple negative BC (P-diff=2 × 10(-5)). Genotype-gene expression associations are identified for candidate target genes ANKLE1 (P=2 × 10(-3)) and ABHD8 (P<2 × 10(-3)). Chromosome conformation capture identifies interactions between four candidate SNPs and ABHD8, and luciferase assays indicate six risk alleles increased transactivation of the ADHD8 promoter. Targeted deletion of a region containing risk SNP rs56069439 in a putative enhancer induces ANKLE1 downregulation; and mRNA stability assays indicate functional effects for an ANKLE1 3'-UTR SNP. Altogether, these data suggest that multiple SNPs at 19p13 regulate ABHD8 and perhaps ANKLE1 expression, and indicate common mechanisms underlying breast and ovarian cancer risk.

Combined Analysis of COX-2 and p53 Expressions Reveals Synergistic Inverse Correlations with Microsatellite Instability and CpG Island Methylator Phenotype in Colorectal Cancer1

PubMed Central

Ogino, Shuji; Brahmandam, Mohan; Kawasaki, Takako; Kirkner, Gregory J; Loda, Massimo; Fuchs, Charles S

2006-01-01

Abstract Cyclooxygenase-2 (COX-2) overexpression and mutations of p53 (a known COX-2 regulator) are inversely associated with microsatellite instability—high (MSI-H) and CpG island methylator phenotype (CIMP), characterized by extensive promoter methylation, is associated with MSI-H. However, no studies have comprehensively examined interrelations between COX-2, p53, MSI, and CIMP. Using MethyLight, we measured DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16/INK4A), CRABP1, MLH1, and NEUROG1] in relatively unbiased samples of 751 colorectal cancer cases obtained from two large prospective cohorts; 115 (15%) tumors were CIMP-high (≥ 4 of 5 methylated promoters), 251 (33%) were CIMP-low (1 to 3 methylated promoters), and the remaining 385 (51%) were CIMP-0 (no methylated promoters). CIMP-high tumors were much less frequent in COX-2+/p53+ tumors (4.6%) than in COX-2+/p53- tumors (19%; P < .0001), COX-2-/p53+ tumors (17%; P= .04), and COX-2-/p53- tumors (28%; P < .0001). In addition, COX-2+/p53+ tumors were significantly less common in MSI-H CIMP-high tumors (9.7%) than in non-MSI-H CIMP-low/CIMP-0 tumors (44–47%; P< .0001). In conclusion, COX-2 and p53 alterations were synergistically inversely correlated with both MSI-H and CIMP-high. Our data suggest that a combined analysis of COX-2 and p53 may be more useful for the molecular classification of colorectal cancer than either COX-2 or p53 analysis alone. PMID:16820091

Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells

PubMed Central

Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.

2005-01-01

Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623

Two Orangutan Species Have Evolved Different KIR Alleles and Haplotypes1

PubMed Central

Guethlein, Lisbeth A.; Norman, Paul J.; Heijmans, Corinne M. C.; de Groot, Natasja G.; Hilton, Hugo G.; Babrzadeh, Farbod; Abi-Rached, Laurent; Bontrop, Ronald E.; Parham, Peter

2017-01-01

The immune and reproductive functions of human Natural Killer (NK) cells are regulated by interactions of the C1 and C2 epitopes of HLA-C with C1-specific and C2-specific lineage III killer cell immunoglobulin-like receptors (KIR). This rapidly evolving and diverse system of ligands and receptors is restricted to humans and great apes. In this context, the orangutan has particular relevance because it represents an evolutionary intermediate, one having the C1 epitope and corresponding KIR, but lacking the C2 epitope. Through a combination of direct sequencing, KIR genotyping and data mining from the Great Ape Genome Project (GAGP) we characterized the KIR alleles and haplotypes for panels of ten Bornean orangutans and 19 Sumatran orangutans. The orangutan KIR haplotypes have between five and ten KIR genes. The seven orangutan lineage III KIR genes all locate to the centromeric region of the KIR locus, whereas their human counterparts also populate the telomeric region. One lineage III KIR gene is Bornean-specific, one is Sumatran-specific and five are shared. Of twelve KIR gene-content haplotypes five are Bornean-specific, five are Sumatran-specific and two are shared. The haplotypes have different combinations of genes encoding activating and inhibitory C1 receptors that can be of higher or lower affinity. All haplotypes encode an inhibitory C1 receptor, but only some haplotypes encode an activating C1 receptor. Of 130 KIR alleles, 55 are Bornean-specific, 65 are Sumatran specific and ten are shared. PMID:28264973

Tumour specific promoter region methylation of the human homologue of the Drosophila Roundabout gene DUTT1 (ROBO1) in human cancers.

PubMed

Dallol, Ashraf; Forgacs, Eva; Martinez, Alonso; Sekido, Yoshitaka; Walker, Rosemary; Kishida, Takeshi; Rabbitts, Pamela; Maher, Eamonn R; Minna, John D; Latif, Farida

2002-05-02

The human homologue of the Drosophila Roundabout gene DUTT1 (Deleted in U Twenty Twenty) or ROBO1 (Locus Link ID 6091), a member of the NCAM family of receptors, was recently cloned from the lung cancer tumour suppressor gene region 2 (LCTSGR2 or U2020 region) at 3p12. DUTT1 maps within a region of overlapping homozygous deletions characterized in both small cell lung cancer lines (SCLC) and in a breast cancer line. In this report we (a) defined the genomic organization of the DUTT1 gene, (b) performed mutation and expression analysis of DUTT1 in lung, breast and kidney cancers, (c) identified tumour specific promoter region methylation of DUTT1 in human cancers. The gene was found to contain 29 exons and spans at least 240 kb of genomic sequence. The 5' region contains a CpG island, and the poly(A)(+) tail has an atypical 5'-GATAAA-3' signal. We analysed DUTT1 for mutations in lung, breast and kidney cancers, no inactivating mutations were detected by PCR-SSCP. However, seven germline missense changes were found and characterized. DUTT1 expression was not detectable in one out of 18 breast tumour lines analysed by RT-PCR. Bisulfite sequencing of the promoter region of DUTT1 gene in the HTB-19 breast tumour cell line (not expressing DUTT1) showed complete hypermethylation of CpG sites within the promoter region of the DUTT1 gene (-244 to +27 relative to the translation start site). The expression of DUTT1 gene was reactivated in HTB-19 after treatment with the demethylating agent 5-aza-2'-deoxycytidine. The same region was also found to be hypermethylated in six out of 32 (19%) primary invasive breast carcinomas and eight out of 44 (18%) primary clear cell renal cell carcinomas (CC-RCC) and in one out of 26 (4%) primary NSCLC tumours. Furthermore 80% of breast and 75% of CC-RCC tumours showing DUTT1 methylation had allelic losses for 3p12 markers hence obeying Knudson's two hit hypothesis. Our findings suggest that DUTT1 warrants further analysis as a candidate for

CPG-inspired workspace trajectory generation and adaptive locomotion control for quadruped robots.

PubMed

Liu, Chengju; Chen, Qijun; Wang, Danwei

2011-06-01

This paper deals with the locomotion control of quadruped robots inspired by the biological concept of central pattern generator (CPG). A control architecture is proposed with a 3-D workspace trajectory generator and a motion engine. The workspace trajectory generator generates adaptive workspace trajectories based on CPGs, and the motion engine realizes joint motion imputes. The proposed architecture is able to generate adaptive workspace trajectories online by tuning the parameters of the CPG network to adapt to various terrains. With feedback information, a quadruped robot can walk through various terrains with adaptive joint control signals. A quadruped platform AIBO is used to validate the proposed locomotion control system. The experimental results confirm the effectiveness of the proposed control architecture. A comparison by experiments shows the superiority of the proposed method against the traditional CPG-joint-space control method.

The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

PubMed

Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

2017-02-14

The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

PubMed Central

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

The role of the oncofetal H19 lncRNA in tumor metastasis: orchestrating the EMT-MET decision

PubMed Central

Matouk, Imad J.; Halle, David; Raveh, Eli; Gilon, Michal; Sorin, Vladimir; Hochberg, Avraham

2016-01-01

Long non-coding RNA (lncRNA) genes are emerging as key players in the metastatic cascade. Current evidence indicate that H19 lncRNA and the microRNA(miRNA) miR-675, which is processed from it, play crucial roles in metastasis, through the regulation of critical events specifically the epithelial to mesenchymal (EMT) and the mesenchymal to epithelial transitions (MET). This review summarizes recent mechanistic pathways and tries to put together seemingly conflicting data from different reports under one proposed general scheme underlying the various roles of H19/miR-675 in the metastatic cascade. We propose several approaches to harnessing this knowledge for translational medicine. PMID:26623562

CpG DNA: A pathogenic factor in systemic lupus erythematosus?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krieg, A.M.

1995-11-01

Systemic lupus erythematosus (SLE) is a multifactorial disease of unknown etiology. Characteristic features of SLE include (1) polyclonal B cell activation, (2) overexpression of the immune stimulatory cytokine interleukin-6 (IL-6), (3) defective tolerance to self antigens, and (4) production of anti-DNA antibodies (Ab). Bacterial infection has been suspected as a triggering factor for lupus. Bacterial DNA differs from vertebrate DNA in the frequency and methylation of CpG dinucleotides. These CpG motifs in bacterial DNA induce a variety of immune effects, including (1) polyclonal activation of murine and human B cells, (2) IL-6 secretion, and (3) resistance to apoptosis, thereby potentiallymore » allowing the survival of autoreactive cells. These results suggest that microbial DNA could therefore be a pathogenic factor in SLE. SLE patients have elevated levels of circulating plasma DNA which is reportedly enriched in hypomethylated CpGs. Genomic DNA is also hypomethylated in SLE. The purpose of this review is to summarize the immune effects of CpG motifs and to present the evidence for their possible involvement in the pathogenesis of SLE. 77 refs.« less

H19/let-7/LIN28 reciprocal negative regulatory circuit promotes breast cancer stem cell maintenance

PubMed Central

Peng, Fei; Li, Ting-Ting; Wang, Kai-Li; Xiao, Guo-Qing; Wang, Ju-Hong; Zhao, Hai-Dong; Kang, Zhi-Jie; Fan, Wen-Jun; Zhu, Li-Li; Li, Mei; Cui, Bai; Zheng, Fei-Meng; Wang, Hong-Jiang; Lam, Eric W-F; Wang, Bo; Xu, Jie; Liu, Quentin

2017-01-01

Long noncoding RNA-H19 (H19), an imprinted oncofetal gene, has a central role in carcinogenesis. Hitherto, the mechanism by which H19 regulates cancer stem cells, remains elusive. Here we show that breast cancer stem cells (BCSCs) express high levels of H19, and ectopic overexpression of H19 significantly promotes breast cancer cell clonogenicity, migration and mammosphere-forming ability. Conversely, silencing of H19 represses these BCSC properties. In concordance, knockdown of H19 markedly inhibits tumor growth and suppresses tumorigenesis in nude mice. Mechanistically, we found that H19 functions as a competing endogenous RNA to sponge miRNA let-7, leading to an increase in expression of a let-7 target, the core pluripotency factor LIN28, which is enriched in BCSC populations and breast patient samples. Intriguingly, this gain of LIN28 expression can also feedback to reverse the H19 loss-mediated suppression of BCSC properties. Our data also reveal that LIN28 blocks mature let-7 production and, thereby, de-represses H19 expression in breast cancer cells. Appropriately, H19 and LIN28 expression exhibits strong correlations in primary breast carcinomas. Collectively, these findings reveal that lncRNA H19, miRNA let-7 and transcriptional factor LIN28 form a double-negative feedback loop, which has a critical role in the maintenance of BCSCs. Consequently, disrupting this pathway provides a novel therapeutic strategy for breast cancer. PMID:28102845

Synthetic Poly(L-Glutamic Acid)-conjugated CpG Exhibits Antitumor Efficacy With Increased Retention in Tumor and Draining Lymph Nodes After Intratumoral Injection in a Mouse Model of Melanoma.

PubMed

Ma, Qing; Zhou, Dapeng; DeLyria, Elizabeth S; Wen, Xiaoxia; Lu, Wei; Thapa, Prakash; Liu, Chengwen; Li, Dan; Bassett, Roland L; Overwijk, Willem W; Hwu, Patrick; Li, Chun

2017-01-01

There is an urgent need for new clinically applicable drug-delivery methods to enhance accumulation of immune-activating drugs in tumors. We synthesized a poly(L-glutamic acid)-CpG ODN2216 conjugate (PG-CpG) and injected it intratumorally into C57BL/6 mice bearing subcutaneous B16-ovalbumin melanoma. PG-CpG elicited the same potent antitumoral activity as CpG with respect to reducing tumor growth and triggering antigen-specific CD8 T-cell responses in this well-established solid tumor model. Moreover, PG-CpG was retained significantly longer in both tumor and draining lymph nodes than was free CpG after intratumoral injection. Specifically, 48 hours after injection, 26.5%±16.9% of the injected PG-CpG dose versus 4.72%±2.61% of free CpG remained at the tumor, and 1.53%±1.22% of the injected PG-CpG versus 0.37%±0.33% of free CpG was retained in the draining inguinal lymph nodes. These findings indicate that PG is an effective synthetic polymeric carrier for delivery of immunostimulatory agents to tumors and lymph nodes.

A and MdMYB1 allele-specific markers controlling apple (Malus x domestica Borkh.) skin color and suitability for marker-assisted selection.

PubMed

Zhang, X J; Wang, L X; Chen, X X; Liu, Y L; Meng, R; Wang, Y J; Zhao, Z Y

2014-10-31

Pre-selection for fruit skin color at the seedling stage would be highly advantageous, with marker-assisted selection offering a potential method for apple pre-selection. A and MdMYB1 alleles are allele-specific DNA markers that are potentially associated with apple skin color, and co-segregate with the Rf and Rni loci, respectively. Here, we assessed the potential application of these 2 alleles for marker-assisted breeding across 30 diverse cultivars and 2 apple seedling progenies. The red skin color phenotype was usually associated with the MdMYB1-1 allele and A(1) allele, respectively, while the 2 molecular markers provided approximately 91% predictability in the 'Fuji' x 'Cripps Pink' and 'Fuji' x 'Gala' progenies. The results obtained from the 30 cultivars and 2 progenies were consistent for the 2 molecular markers. Hence, the results supported that Rf and Rni could be located in a gene cluster, or even correspond to alleles of the same gene. Our results are consistent with the hypothesis that red/yellow dimorphism is controlled by a monogenic system, with the presence of the red anthocyanin pigmentation being dominant. In addition, our results supported that the practical utilization of the 2 function markers to efficiently and accurately select red-skinned apple cultivars in apple scion breeding programs.

Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

PubMed Central

Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

2009-01-01

Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

[Study on correlation between HLA-A, B, DR alleles and Duchenne muscular dystrophy].

PubMed

Chen, Wei; Xiao, Lulu; Zhang, Cheng; Wu, Hong-ling

2007-10-01

To analyze the polymorphism of HLA-A, B and DR alleles of Duchenne muscular dystrophy (DMD) patients in Han nationality of South China and to discuss the role of immune and genetic factors in the pathogenesis of DMD and muscular fiber necrosis. Polymerase chain reaction-reverse sequence specific oligonucleotide (PCR-RSSO) and National Marrow Donor Program (NMDP) were used to analyze the polymorphism of HLA-A,B and DR alleles of 113 DMD patients and 406 normal controls in Han nationality of South China. The frequencies of HLA-A24, A30 alleles in DMD group were 11.25% and 5.46% respectively, indicating notable difference (P=0.001, < 0.01) from 22.16% and 0.87% of control group; the frequencies of HLA-B13, B15, B61 and B62 alleles in DMD group were 12.26%, 16.92%, 0.44% and 0.44%, indicating a notable difference (P=0.016, < 0.01, 0.001) from 6.76%, 1.49%, 4.79% and 5.05% of control group; the frequencies of HLA-DR04, DR07, DR12 alleles in DMD group were 17.45%, 6.40% and 19.62%, indicating a notable difference (P=0.018, < 0.01, 0.012) from 10.67%, 2.24% and 11.92% of control group. There are significant differences in the HLA gene frequencies between DMD patients and normal controls. These results suggest that HLA genotype relates to the muscular necrosis and the pathogenesis of DMD.

Genome-wide methylation analysis identifies differentially methylated CpG loci associated with severe obesity in childhood.

PubMed

Huang, R C; Garratt, E S; Pan, H; Wu, Y; Davis, E A; Barton, S J; Burdge, G C; Godfrey, K M; Holbrook, J D; Lillycrop, K A

2015-01-01

Childhood obesity is a major public health issue. Here we investigated whether differential DNA methylation was associated with childhood obesity. We studied DNA methylation profiles in whole blood from 78 obese children (mean BMI Z-score: 2.6) and 71 age- and sex-matched controls (mean BMI Z-score: 0.1). DNA samples from obese and control groups were pooled and analyzed using the Infinium HumanMethylation450 BeadChip array. Comparison of the methylation profiles between obese and control subjects revealed 129 differentially methylated CpG (DMCpG) loci associated with 80 unique genes that had a greater than 10% difference in methylation (P-value < 0.05). The top pathways enriched among the DMCpGs included developmental processes, immune system regulation, regulation of cell signaling, and small GTPase-mediated signal transduction. The associations between the methylation of selected DMCpGs with childhood obesity were validated using sodium bisulfite pyrosequencing across loci within the FYN, PIWIL4, and TAOK3 genes in individual subjects. Three CpG loci within FYN were hypermethylated in obese individuals (all P < 0.01), while obesity was associated with lower methylation of CpG loci within PIWIL4 (P = 0.003) and TAOK3 (P = 0.001). After building logistic regression models, we determined that a 1% increase in methylation in TAOK3, multiplicatively decreased the odds of being obese by 0.91 (95% CI: 0.86 - 0.97), and an increase of 1% methylation in FYN CpG3, multiplicatively increased the odds of being obese by 1.03 (95% CI: 0.99 - 1.07). In conclusion, these findings provide evidence that childhood obesity is associated with specific DNA methylation changes in whole blood, which may have utility as biomarkers of obesity risk.

Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration.

PubMed

Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju

2017-06-27

Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.

Long non-coding RNA H19 suppresses retinoblastoma progression via counteracting miR-17-92 cluster.

PubMed

Zhang, Aihui; Shang, Weiwei; Nie, Qiaoli; Li, Ting; Li, Suhui

2018-04-01

Long non-coding RNAs (lncRNAs) are frequently dysregulated and play important roles in many cancers. lncRNA H19 is one of the earliest discovered lncRNAs which has diverse roles in different cancers. However, the expression, roles, and action mechanisms of H19 in retinoblastoma are still largely unknown. In this study, we found that H19 is downregulated in retinoblastoma tissues and cell lines. Gain-of-function and loss-of-function assays showed that H19 inhibits retinoblastoma cell proliferation, induces retinoblastoma cell cycle arrest and cell apoptosis. Mechanistically, we identified seven miR-17-92 cluster binding sites on H19, and found that H19 directly bound to miR-17-92 cluster via these seven binding sites. Through binding to miR-17-92 cluster, H19 relieves the suppressing roles of miR-17-92 cluster on p21. Furthermore, H19 represses STAT3 activation induced by miR-17-92 cluster. Hence, our results revealed that H19 upregulates p21 expression, inhibits STAT3 phosphorylation, and downregulates the expression of STAT3 target genes BCL2, BCL2L1, and BIRC5. In addition, functional assays demonstrated that the mutation of miR-17-92 cluster binding sites on H19 abolished the proliferation inhibiting, cell cycle arrest and cell apoptosis inducing roles of H19 in retinoblastoma. In conclusion, our data suggested that H19 inhibits retinoblastoma progression via counteracting the roles of miR-17-92 cluster, and implied that enhancing the action of H19 may be a promising therapeutic strategy for retinoblastoma. © 2017 Wiley Periodicals, Inc.

Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants

PubMed Central

Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo

2017-01-01

Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871

Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

PubMed

Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

2008-10-09

Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

Allele-specific HLA-DR typing by mass spectrometry: an alternative to hybridization-based typing methods.

PubMed

Worrall, T A; Schmeckpeper, B J; Corvera, J S; Cotter, R J

2000-11-01

The primer oligomer base extension (PROBE) reaction, combined with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, is used to characterize HLA-DR2 polymorphism. Alleles are distinguished rapidly and accurately by measuring the mass of primer extension products at every known variable region of HLA-DR2 alleles. Since differentiation of alleles by PROBE relies on measuring differences in extension product mass rather than differences in hybridization properties, mistyped alleles resulting from nonspecific hybridization are absent. The method shows considerable potential for high-throughput screening of HLA-DR polymorphism in a chip-based format, including rapid tissue typing of unrelated volunteer donors.

Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved.

PubMed

Long, Hannah K; King, Hamish W; Patient, Roger K; Odom, Duncan T; Klose, Robert J

2016-08-19

DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

The potential of immunostimulatory CpG DNA for inducing immunity against genital herpes: opportunities and challenges.

PubMed

Harandi, Ali M

2004-07-01

Herpes simplex virus type 2 (HSV-2) invades human genital tract mucosa and following local replications can be rapidly transmitted via peripheral nerve axons to the sacral ganglia where it can establish latency. Reactivation of the latent viral reservoir results in recurrent ulcers in the genital region. Innate immunity, the first line of defence during both primary and recurrent genital herpes infections, is crucial during the period of acute infection to limit early virus replication and to facilitate the development of an appropriate specific acquired immunity. Recent developments in immunology reveal that the mammalian innate immune systems use Toll-like receptor (TLR) to specifically sense evolutionary conserved molecules such as bacterial DNA in pathogens. Recently, local-vaginal delivery of CpG containing oligodeoxynucleotide (ODN), a synthetic mimic of bacterial DNA, holds substantial promise as a strong inducer of innate immunity against genital herpes infections in the animal models of the disease. These preclinical observations provide a scientific ground work for introduction of this novel intervention strategy to clinic. This review aims to highlight recent developments and future challenges in use of immunostimulatory CpG ODN for inducing immunity against genital herpes infection and disease.

H19 mediates methotrexate resistance in colorectal cancer through activating Wnt/β-catenin pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Ke-feng; Liang, Wei-Cheng; Feng, Lu

Colorectal cancer (CRC) is a common malignancy, most of which remain unresponsive to chemotherapy. As one of the earliest cytotoxic drugs, methotrexate (MTX) serves as an anti-metabolite and anti-folate chemotherapy for various cancers. Unfortunately, MTX resistance prevents its clinical application in cancer therapy. Thereby, overcoming the drug resistance is an alternative strategy to maximize the therapeutic efficacy of MTX in clinics. Long noncoding RNAs (lncRNAs) have gained widespread attention in recent years. More and more emerging evidences have demonstrated that they play important regulatory roles in various biological activities and disease progression including drug resistance. In the present study, amore » MTX-resistant colorectal cell line HT-29 (HT-29-R) was developed, which displayed the active proliferation and shortened cell cycle. LncRNA H19 was found to be significantly upregulated in this resistant cell line. Further investigation showed that H19 knockdown sensitized the MTX resistance in HT-29-R cells while its overexpression improved the MTX resistance in the parental cells, suggesting that H19 mediate MTX resistance. The Wnt/β-catenin signaling was activated in HT-29-R cells, and H19 knockdown suppressed this signaling in the parental cells. In conclusion, H19 mediated MTX resistance via activating Wnt/β-catenin signaling, which help to develop H19 as a promising therapeutic target for MTX resistant CRC. - Highlights: • A methotrexate (MTX) -resistant colorectal cancer cell line HT-29 (HT-29-R) has been developed. • H19 was upregulated in HT-29-R cells. • H19 mediated MTX resistance in colorectal cancer (CRC). • Wnt/β-catenin pathway was involved in the H19-mediated MTX resistance in CRC cells.« less

Overexpression of long noncoding RNA H19 indicates a poor prognosis for cholangiocarcinoma and promotes cell migration and invasion by affecting epithelial-mesenchymal transition.

PubMed

Xu, Yi; Wang, Zhidong; Jiang, Xingming; Cui, Yunfu

2017-08-01

Cholangiocarcinoma (CCA) is a deadly disease that poorly responds to chemotherapy and radiotherapy and whose incidence has increased worldwide. Furthermore, long noncoding RNAs (lncRNAs) play important roles in multiple biological processes, including tumorigenesis. Specifically, H19, the first discovered lncRNA, has been reported to be overexpressed in diverse human carcinomas, but the overall biological role and clinical significance of H19 in CCA remains unknown. In the present study, expression levels of H19 were investigated in CCA tissues and cell lines and were correlated with clinicopathological features. Moreover, we explored the functional roles of H19 depletion in QBC939 and RBE cells, including cell proliferation, apoptosis, migration, invasion and epithelial-to-mesenchymal transition (EMT). The results indicated that H19 was upregulated in CCA tissue samples and cell lines, and this upregulation was associated with tumor size, TNM stage, postoperative recurrence and overall survival in 56 patients with CCA. Moreover, knockdown of H19 followed by RNA silencing restrained cell proliferation and promoted apoptosis. In addition, H19 suppression impaired migration and invasion potential by reversing EMT. Overall, our findings may help to develop diagnostic biomarkers and therapeutics that target H19 for the treatment of CCA. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

75 FR 13555 - Compliance Policy Guide Sec. 540.375 Canned Salmon - Adulteration Involving Decomposition (CPG...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-22

...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...

A multiplex allele-specific real-time PCR assay for screening of ESR1 mutations in metastatic breast cancer.

PubMed

Wang, Ting; Liu, Jin-Hui; Zhang, Jie; Wang, Le; Chen, Chao; Dai, Peng-Gao

2015-04-01

Acquired resistance to endocrine-based therapies occurs in virtually all estrogen receptor-α (ERα, encoded by ESR1) positive breast cancer patients. The underlying molecular mechanism is attributed to the activating mutations in ESR1. These mutations provide an exciting opportunity for the development of new antagonists that specifically inhibit the mutant proteins. Therefore, accurate detection of ESR1 mutations is of critical importance in clinical practice. We carried out a single tube, multiplex allele-specific real-time PCR assay for the detection of four ESR1 mutations (Y537S, Y537C, Y537N, and D538G). The assay was found to be highly specific and sensitive. With this assay, as low as 1% mutant DNA template in wild type DNA could be detected. Fifteen DNA samples were prepared from archived formalin-fixed paraffin-embedded metastatic breast cancer biopsies. They were further screened with this assay, and three samples were identified as ESR1 mutant. The results were validated with pyrosequencing and complete concordance was observed between the two assays. The multiplex allele-specific real-time PCR assay provides a rapid and reliable diagnostic tool for accurate detection of ESR1 mutations. This procedure may be used in the clinical treatment of breast cancer. Copyright © 2015 Elsevier Inc. All rights reserved.

Association of in vitro fertilization with global and IGF2/H19 methylation variation in newborn twins.

PubMed

Loke, Y J; Galati, J C; Saffery, R; Craig, J M

2015-04-01

In vitro fertilization (IVF) and its subset intracytoplasmic sperm injection (ICSI), are widely used medical treatments for conception. There has been controversy over whether IVF is associated with adverse short- and long-term health outcomes of offspring. As with other prenatal factors, epigenetic change is thought to be a molecular mediator of any in utero programming effects. Most studies focused on DNA methylation at gene-specific and genomic level, with only a few on associations between DNA methylation and IVF. Using buccal epithelium from 208 twin pairs from the Peri/Postnatal Epigenetic Twin Study (PETS), we investigated associations between IVF and DNA methylation on a global level, using the proxies of Alu and LINE-1 interspersed repeats in addition to two locus-specific regulatory regions within IGF2/H19, controlling for 13 potentially confounding factors. Using multiple correction testing, we found strong evidence that IVF-conceived twins have lower DNA methylation in Alu, and weak evidence of lower methylation in one of the two IGF2/H19 regulatory regions and LINE-1, compared with naturally conceived twins. Weak evidence of a relationship between ICSI and DNA methylation within IGF2/H19 regulatory region was found, suggesting that one or more of the processes associated with IVF/ICSI may contribute to these methylation differences. Lower within- and between-pair DNA methylation variation was also found in IVF-conceived twins for LINE-1, Alu and one IGF2/H19 regulatory region. Although larger sample sizes are needed, our results provide additional insight to the possible influence of IVF and ICSI on DNA methylation. To our knowledge, this is the largest study to date investigating the association of IVF and DNA methylation.

CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

PubMed

Jung, Myung-Hwa; Jung, Sung-Ju

2017-10-01

Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

Systematic evaluation of the impact of ChIP-seq read designs on genome coverage, peak identification, and allele-specific binding detection.

PubMed

Zhang, Qi; Zeng, Xin; Younkin, Sam; Kawli, Trupti; Snyder, Michael P; Keleş, Sündüz

2016-02-24

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) experiments revolutionized genome-wide profiling of transcription factors and histone modifications. Although maturing sequencing technologies allow these experiments to be carried out with short (36-50 bps), long (75-100 bps), single-end, or paired-end reads, the impact of these read parameters on the downstream data analysis are not well understood. In this paper, we evaluate the effects of different read parameters on genome sequence alignment, coverage of different classes of genomic features, peak identification, and allele-specific binding detection. We generated 101 bps paired-end ChIP-seq data for many transcription factors from human GM12878 and MCF7 cell lines. Systematic evaluations using in silico variations of these data as well as fully simulated data, revealed complex interplay between the sequencing parameters and analysis tools, and indicated clear advantages of paired-end designs in several aspects such as alignment accuracy, peak resolution, and most notably, allele-specific binding detection. Our work elucidates the effect of design on the downstream analysis and provides insights to investigators in deciding sequencing parameters in ChIP-seq experiments. We present the first systematic evaluation of the impact of ChIP-seq designs on allele-specific binding detection and highlights the power of pair-end designs in such studies.

Associations between gastric dilatation-volvulus in Great Danes and specific alleles of the canine immune-system genes DLA88, DRB1, and TLR5.

PubMed

Harkey, Michael A; Villagran, Alexandra M; Venkataraman, Gopalakrishnan M; Leisenring, Wendy M; Hullar, Meredith A J; Torok-Storb, Beverly J

2017-08-01

OBJECTIVE To determine whether specific alleles of candidate genes of the major histocompatibility complex (MHC) and innate immune system were associated with gastric dilatation-volvulus (GDV) in Great Danes. ANIMALS 42 healthy Great Danes (control group) and 39 Great Danes with ≥ 1 GDV episode. PROCEDURES Variable regions of the 2 most polymorphic MHC genes (DLA88 and DRB1) were amplified and sequenced from the dogs in each group. Similarly, regions of 3 genes associated with the innate immune system (TLR5, NOD2, and ATG16L1), which have been linked to inflammatory bowel disease, were amplified and sequenced. Alleles were evaluated for associations with GDV, controlling for age and dog family. RESULTS Specific alleles of genes DLA88, DRB1, and TLR5 were significantly associated with GDV. One allele of each gene had an OR > 2 in the unadjusted univariate analyses and retained a hazard ratio > 2 after controlling for temperament, age, and familial association in the multivariate analysis. CONCLUSIONS AND CLINICAL RELEVANCE The 3 GDV-associated alleles identified in this study may serve as diagnostic markers for identification of Great Danes at risk for GDV. Additional research is needed to determine whether other dog breeds have the same genetic associations. These findings also provided a new target for research into the etiology of, and potential treatments for, GDV in dogs.

Recommendations for Accurate Resolution of Gene and Isoform Allele-Specific Expression in RNA-Seq Data

PubMed Central

Wood, David L. A.; Nones, Katia; Steptoe, Anita; Christ, Angelika; Harliwong, Ivon; Newell, Felicity; Bruxner, Timothy J. C.; Miller, David; Cloonan, Nicole; Grimmond, Sean M.

2015-01-01

Genetic variation modulates gene expression transcriptionally or post-transcriptionally, and can profoundly alter an individual’s phenotype. Measuring allelic differential expression at heterozygous loci within an individual, a phenomenon called allele-specific expression (ASE), can assist in identifying such factors. Massively parallel DNA and RNA sequencing and advances in bioinformatic methodologies provide an outstanding opportunity to measure ASE genome-wide. In this study, matched DNA and RNA sequencing, genotyping arrays and computationally phased haplotypes were integrated to comprehensively and conservatively quantify ASE in a single human brain and liver tissue sample. We describe a methodological evaluation and assessment of common bioinformatic steps for ASE quantification, and recommend a robust approach to accurately measure SNP, gene and isoform ASE through the use of personalized haplotype genome alignment, strict alignment quality control and intragenic SNP aggregation. Our results indicate that accurate ASE quantification requires careful bioinformatic analyses and is adversely affected by sample specific alignment confounders and random sampling even at moderate sequence depths. We identified multiple known and several novel ASE genes in liver, including WDR72, DSP and UBD, as well as genes that contained ASE SNPs with imbalance direction discordant with haplotype phase, explainable by annotated transcript structure, suggesting isoform derived ASE. The methods evaluated in this study will be of use to researchers performing highly conservative quantification of ASE, and the genes and isoforms identified as ASE of interest to researchers studying those loci. PMID:25965996

Association between the DRD2 A1 allele and response to methadone and buprenorphine maintenance treatments.

PubMed

Barratt, Daniel T; Coller, Janet K; Somogyi, Andrew A

2006-06-05

The TaqI A polymorphism (A(1)) of the dopamine D(2) receptor gene (DRD2), although not a specific predictor of opioid dependence, has been strongly associated with high levels of prior heroin use and poor treatment outcomes among methadone maintenance patients. The aims of this study were to confirm these findings via a retrospective analysis of A(1) allele frequency in methadone (n = 46) and buprenorphine (n = 25) patients, and non-opioid-dependent controls (n = 95). Subjects were genotyped at the DRD2 TaqI A locus using PCR amplification followed by TaqI restriction enzyme digestion and gel electrophoresis. For methadone and buprenorphine subjects, heroin use (prior to treatment), treatment outcomes, and withdrawal occurrence were determined from comprehensive case notes. No significant differences in A(1) allele frequency (%) were observed between: methadone (19.6%), buprenorphine (18.0%), and control (17.9%) groups (P > 0.7); successful and poor treatment outcome groups, methadone: 20.0% and 19.2%, respectively (P = 1.0); buprenorphine: 18.4% and 20.0%, respectively (P = 1.0). Also, there were no significant relationships between TaqI A genotype and prior heroin use (P = 0.47). However, among the successful methadone subjects, significantly fewer A(1) allele carriers experienced withdrawal than non-A(1) carriers (P = 0.04). In conclusion, the DRD2 genotype effects did not affect opioid maintenance treatment outcomes. This suggests the need for a further prospective investigation into the role of the DRD2 A(1) allele in heroin use and response to maintenance pharmacotherapies for opioid dependence.

19 CFR 12.104h - Exempt materials and articles.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 19 Customs Duties 1 2013-04-01 2013-04-01 false Exempt materials and articles. 12.104h Section 12... THE TREASURY SPECIAL CLASSES OF MERCHANDISE Cultural Property § 12.104h Exempt materials and articles... material or any article of cultural property which is imported into the U.S. for temporary exhibition or...

19 CFR 12.104h - Exempt materials and articles.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 19 Customs Duties 1 2010-04-01 2010-04-01 false Exempt materials and articles. 12.104h Section 12... THE TREASURY SPECIAL CLASSES OF MERCHANDISE Cultural Property § 12.104h Exempt materials and articles... material or any article of cultural property which is imported into the U.S. for temporary exhibition or...

19 CFR 12.104h - Exempt materials and articles.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 19 Customs Duties 1 2012-04-01 2012-04-01 false Exempt materials and articles. 12.104h Section 12... THE TREASURY SPECIAL CLASSES OF MERCHANDISE Cultural Property § 12.104h Exempt materials and articles... material or any article of cultural property which is imported into the U.S. for temporary exhibition or...

19 CFR 12.104h - Exempt materials and articles.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 19 Customs Duties 1 2014-04-01 2014-04-01 false Exempt materials and articles. 12.104h Section 12... THE TREASURY SPECIAL CLASSES OF MERCHANDISE Cultural Property § 12.104h Exempt materials and articles... material or any article of cultural property which is imported into the U.S. for temporary exhibition or...

19 CFR 12.104h - Exempt materials and articles.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 19 Customs Duties 1 2011-04-01 2011-04-01 false Exempt materials and articles. 12.104h Section 12... THE TREASURY SPECIAL CLASSES OF MERCHANDISE Cultural Property § 12.104h Exempt materials and articles... material or any article of cultural property which is imported into the U.S. for temporary exhibition or...

On the Role of Sensory Feedbacks in Rowat–Selverston CPG to Improve Robot Legged Locomotion

PubMed Central

Amrollah, Elmira; Henaff, Patrick

2010-01-01

This paper presents the use of Rowat and Selverston-type of central pattern generator (CPG) to control locomotion. It focuses on the role of afferent exteroceptive and proprioceptive signals in the dynamic phase synchronization in CPG legged robots. The sensori-motor neural network architecture is evaluated to control a two-joint planar robot leg that slips on a rail. Then, the closed loop between the CPG and the mechanical system allows to study the modulation of rhythmic patterns and the effect of the sensing loop via sensory neurons during the locomotion task. Firstly simulations show that the proposed architecture easily allows to modulate rhythmic patterns of the leg, and therefore the velocity of the robot. Secondly, simulations show that sensori-feedbacks from foot/ground contact of the leg make the hip velocity smoother and larger. The results show that the Rowat–Selverston-type CPG with sensory feedbacks is an effective choice for building adaptive neural CPGs for legged robots. PMID:21228904

Independent regulation of the two Pax5 alleles during B-cell development.

PubMed

Nutt, S L; Vambrie, S; Steinlein, P; Kozmik, Z; Rolink, A; Weith, A; Busslinger, M

1999-04-01

The developmental control genes of the Pax family are frequently associated with mouse mutants and human disease syndromes. The function of these transcription factors is sensitive to gene dosage, as mutation of one allele or a modest increase in gene number results in phenotypic abnormalities. Pax5 has an important role in B-cell and midbrain development. By following the expression of individual Pax5 alleles at the single-cell level, we demonstrate here that Pax5 is subject to allele-specific regulation during B-lymphopoiesis. Pax5 is predominantly transcribed from only one allele in early progenitors and mature B cells, whereas it switches to a biallelic transcription mode in immature B cells. The allele-specific regulation of Pax5 is stochastic, reversible, independent of parental origin and correlates with synchronous replication, in contrast with imprinted and other monoallelically expressed genes. As a consequence, B-lymphoid tissues are mosaics with respect to the transcribed Pax5 allele, and thus mutation of one allele in heterozygous mice results in deletion of the cell population expressing the mutant allele due to loss of Pax5 function at the single-cell level. Similar allele-specific regulation may be a common mechanism causing the haploinsufficiency and frequent association of other Pax genes with human disease.

Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model.

PubMed

Cho, Hyeon Cheol; Kim, Bo Hwan; Kim, Kyunghoon; Park, Ju Youn; Chang, Jae-Ho; Kim, Soo-Ki

2008-10-01

While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the number of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation.

Diverse vacA allelic types of Helicobacter pylori in Korea and clinical correlation.

PubMed

Choe, Yon Ho; Kim, Pum Soo; Lee, Don Haeng; Kim, Hyung Kil; Kim, Young Soo; Shin, Yong Woon; Hwang, Tae Sook; Kim, Hyeon Joo; Song, Sun Uk; Choi, Mi Sook

2002-06-01

Helicobacter pylori has a diversity of vacA allelic types. The purpose of this study was to correlate the vacA status and the clinical outcome. After constructing specific primers for the vacA signal sequence, H. pylori-positive antral biopsy specimens were examined for the vacA status in 25 gastric ulcers, 31 duodenal ulcers, 22 gastric cancers, 42 chronic gastritis, and 8 gastroduodenal ulcers. The relationship between the vacA allele and the clinical disease was examined. The vacA genotype s1c/m1 is predominant in Korea (71/128, 55.5%). Other strains including s1b or s2 were not found in this study. s1c/m1 was more prominent in duodenal ulcers, than in gastric ulcers (p=0.041) and cancer (p=0.029). Seven out of 8 patients with gastric and coexistent duodenal ulcers had the s1c/m1 allele. No statistical differences in the positive rates of the s1a/m1, s1a/m2, and s1c/m2 alleles among the disease groups were found. In conclusion, s1c/m1 is the main vacA allele in Korea and it is particularly associated with duodenal ulcers.

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

PubMed

Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

2010-02-05

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

Allele specific expression analysis identifies regulatory variation associated with stress-related genes in the Mexican highland maize landrace Palomero Toluqueño

PubMed Central

González-Segovia, Eric; Ross-Ibarra, Jeffrey; Simpson, June K.

2017-01-01

Background Gene regulatory variation has been proposed to play an important role in the adaptation of plants to environmental stress. In the central highlands of Mexico, farmer selection has generated a unique group of maize landraces adapted to the challenges of the highland niche. In this study, gene expression in Mexican highland maize and a reference maize breeding line were compared to identify evidence of regulatory variation in stress-related genes. It was hypothesised that local adaptation in Mexican highland maize would be associated with a transcriptional signature observable even under benign conditions. Methods Allele specific expression analysis was performed using the seedling-leaf transcriptome of an F1 individual generated from the cross between the highland adapted Mexican landrace Palomero Toluqueño and the reference line B73, grown under benign conditions. Results were compared with a published dataset describing the transcriptional response of B73 seedlings to cold, heat, salt and UV treatments. Results A total of 2,386 genes were identified to show allele specific expression. Of these, 277 showed an expression difference between Palomero Toluqueño and B73 alleles under benign conditions that anticipated the response of B73 cold, heat, salt and/or UV treatments, and, as such, were considered to display a prior stress response. Prior stress response candidates included genes associated with plant hormone signaling and a number of transcription factors. Construction of a gene co-expression network revealed further signaling and stress-related genes to be among the potential targets of the transcription factors candidates. Discussion Prior activation of responses may represent the best strategy when stresses are severe but predictable. Expression differences observed here between Palomero Toluqueño and B73 alleles indicate the presence of cis-acting regulatory variation linked to stress-related genes in Palomero Toluqueño. Considered alongside

Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture.

PubMed

Li, Cai; Lowe, Robert; Ziemke, Tom

2013-01-01

The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value.

Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture

PubMed Central

Li, Cai; Lowe, Robert; Ziemke, Tom

2013-01-01

The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value. PMID:23675345

Neural networks underlying trait aggression depend on MAOA gene alleles.

PubMed

Klasen, Martin; Wolf, Dhana; Eisner, Patrick D; Habel, Ute; Repple, Jonathan; Vernaleken, Ingo; Schlüter, Thorben; Eggermann, Thomas; Zerres, Klaus; Zepf, Florian D; Mathiak, Klaus

2018-03-01

Low expressing alleles of the MAOA gene (MAOA-L) have been associated with an increased risk for developing an aggressive personality. This suggests an MAOA-L-specific neurobiological vulnerability associated with trait aggression. The neural networks underlying this vulnerability are unknown. The present study investigated genotype-specific associations between resting state brain networks and trait aggression (Buss-Perry Aggression Questionnaire) in 82 healthy Caucasian males. Genotype influences on aggression-related networks were studied for intrinsic and seed-based brain connectivity. Intrinsic connectivity was higher in the ventromedial prefrontal cortex (VMPFC) of MAOA-L compared to high expressing allele (MAOA-H) carriers. Seed-based connectivity analyses revealed genotype differences in the functional involvement of this region. MAOA genotype modulated the relationship between trait aggression and VMPFC connectivity with supramarginal gyrus (SMG) and areas of the default mode network (DMN). Separate analyses for the two groups were performed to better understand how the genotype modulated the relationship between aggression and brain networks. They revealed a positive correlation between VMPFC connectivity and aggression in right angular gyrus (AG) and a negative correlation in right SMG in the MAOA-L group. No such effect emerged in the MAOA-H carriers. The results indicate a particular relevance of VMPFC for aggression in MAOA-L carriers; in specific, a detachment from the DMN along with a strengthened coupling to the AG seems to go along with lower trait aggression. MAOA-L carriers may thus depend on a synchronization of emotion regulation systems (VMPFC) with core areas of empathy (SMG) to prevent aggression.

27 CFR 19.386 - Adjusting pH of denatured spirits.

Code of Federal Regulations, 2014 CFR

2014-04-01

... will counteract or reduce the effect of the denaturants. A proprietor who adjusts the pH of denatured... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Adjusting pH of denatured... of Articles Rules for Denaturing Spirits and Testing Denaturants § 19.386 Adjusting pH of denatured...

27 CFR 19.386 - Adjusting pH of denatured spirits.

Code of Federal Regulations, 2011 CFR

2011-04-01

... will counteract or reduce the effect of the denaturants. A proprietor who adjusts the pH of denatured... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Adjusting pH of denatured... of Articles Rules for Denaturing Spirits and Testing Denaturants § 19.386 Adjusting pH of denatured...

27 CFR 19.386 - Adjusting pH of denatured spirits.

Code of Federal Regulations, 2012 CFR

2012-04-01

... will counteract or reduce the effect of the denaturants. A proprietor who adjusts the pH of denatured... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Adjusting pH of denatured... of Articles Rules for Denaturing Spirits and Testing Denaturants § 19.386 Adjusting pH of denatured...

27 CFR 19.386 - Adjusting pH of denatured spirits.

Code of Federal Regulations, 2013 CFR

2013-04-01

... will counteract or reduce the effect of the denaturants. A proprietor who adjusts the pH of denatured... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Adjusting pH of denatured... of Articles Rules for Denaturing Spirits and Testing Denaturants § 19.386 Adjusting pH of denatured...

Role of the B Allele of Influenza A Virus Segment 8 in Setting Mammalian Host Range and Pathogenicity

PubMed Central

Turnbull, Matthew L.; Wise, Helen M.; Nicol, Marlynne Q.; Smith, Nikki; Dunfee, Rebecca L.; Beard, Philippa M.; Jagger, Brett W.; Ligertwood, Yvonne; Hardisty, Gareth R.; Xiao, Haixia; Benton, Donald J.; Coburn, Alice M.; Paulo, Joao A.; Gygi, Steven P.; McCauley, John W.; Taubenberger, Jeffery K.; Lycett, Samantha J.; Weekes, Michael P.; Dutia, Bernadette M.

2016-01-01

great socioeconomic burden on farming and health care sectors. Host adaptation likely involves multiple viral factors. Here, we investigated the role of IAV segment 8. Segment 8 has evolved into two distinct clades: the A and B alleles. The B-allele genes have previously been suggested to be restricted to avian virus species. We introduced a selection of avian virus A- and B-allele segment 8s into human H1N1 and H3N2 virus backgrounds and found that these reassortant viruses were fully competent in mammalian host systems. We also analyzed the currently available public data on the segment 8 gene distribution and found surprisingly little evidence for specific avian host restriction of the B-clade segment. We conclude that B-allele segment 8 genes are, in fact, capable of supporting infection in mammals and that they should be considered during the assessment of the pandemic risk of zoonotic influenza A viruses. PMID:27489273

Role of the B Allele of Influenza A Virus Segment 8 in Setting Mammalian Host Range and Pathogenicity.

PubMed

Turnbull, Matthew L; Wise, Helen M; Nicol, Marlynne Q; Smith, Nikki; Dunfee, Rebecca L; Beard, Philippa M; Jagger, Brett W; Ligertwood, Yvonne; Hardisty, Gareth R; Xiao, Haixia; Benton, Donald J; Coburn, Alice M; Paulo, Joao A; Gygi, Steven P; McCauley, John W; Taubenberger, Jeffery K; Lycett, Samantha J; Weekes, Michael P; Dutia, Bernadette M; Digard, Paul

2016-10-15

burden on farming and health care sectors. Host adaptation likely involves multiple viral factors. Here, we investigated the role of IAV segment 8. Segment 8 has evolved into two distinct clades: the A and B alleles. The B-allele genes have previously been suggested to be restricted to avian virus species. We introduced a selection of avian virus A- and B-allele segment 8s into human H1N1 and H3N2 virus backgrounds and found that these reassortant viruses were fully competent in mammalian host systems. We also analyzed the currently available public data on the segment 8 gene distribution and found surprisingly little evidence for specific avian host restriction of the B-clade segment. We conclude that B-allele segment 8 genes are, in fact, capable of supporting infection in mammals and that they should be considered during the assessment of the pandemic risk of zoonotic influenza A viruses. Copyright © 2016 Turnbull et al.

[Mifepristone inhibites the migration of endometrial cancer cells through regulating H19 methylation].

PubMed

Lu, Z Z; Yan, L; Zhang, H; Li, M J; Zhang, X H; Zhao, X X

2016-06-23

To investigate the effect and mechanism of mifepristone on the migration of human endometrial carcinoma cells. A human endometrial carcinoma cell line, Ishikawa cells, was cultured in vitro and treated with mifepristone at different concentrations. Wound healing assay was applied to detect the migration of Ishikawa cells. RT-PCR and methylation-specific PCR (MSP) were used to detect the levels of H19 mRNA and its DNA methylation. Western-blot was used to detect the expressions of HMGA2 and epithelial to mesenchymal transition (EMT) related proteins. When treated with different concentrations of mifepristone for 48 hours, the width of scratch of the the control group, the 5 mg/L and the 10 mg/L mifepristone treatment groups were (4.18±0.07)mm, (4.68±0.07)mm, and(4.99±0.07)mm, respectively (P<0.05 for all) and treated with mifepristone for 72 hours, those were(3.46±0.07)mm, (4.29±0.07)mm, and(4.78±0.04)mm, respectively (P<0.05 for all). In the Ishikawa cells, mifepristone suppressed the transcriptional level of H19 through enhancing its promoter methylation, which resulted in inhibited expressions of HMGA2 and vimentin and increased expression of E-cadherin in a time- and concentration-dependent manner. Mifepristone inhibits the migration of endometrial carcinoma cells partially through methylation-induced of transcriptional inhibition of H19, which results in the down-regulation of HMGA2 and vimentin and upregulation of E-cadherin.

Long non-coding RNA H19 regulates viability and metastasis, and is upregulated in retinoblastoma.

PubMed

Li, Li; Chen, Wei; Wang, Yuchuan; Tang, Luosheng; Han, Mei

2018-06-01

Retinoblastoma is the most common type of intraocular pediatric malignant tumor, which typically affects children <6 years of age. However, the underlying molecular mechanisms of retinoblastoma progression remain unclear. The aim of the present study was to investigate the function of long non-coding RNA (lncRNA) H19 in retinoblastoma clinical samples and cell lines, using reverse transcription-quantitative polymerase chain reaction, western blotting, colony formation, MTT, fluorescence activated cell sorting, cell invasion and migration, and in vivo growth assays. The results demonstrated that H19 may serve a critical oncogenic function in the progression of retinoblastoma, as lncRNA H19 levels were markedly increased in retinoblastoma cells and tissues compared with corresponding controls. In addition, patients with retinoblastoma with increased lncRNA H19 expression experienced poorer survival time compared with those with decreased lncRNA H19 levels. Knockdown of lncRNA H19 significantly suppressed retinoblastoma cell proliferation, migration and invasion in vitro and in vivo . Furthermore, lncRNA H19 expression was also associated with multiple proteins, including cyclin-dependent kinase 1, B-cell lymphoma-associated X protein, apoptosis regulator, tumor protein p53, vimentin, cadherin 13 and matrix metallopeptidase 9. In conclusion, lncRNA H19 may serve an important function in tumorigenesis and may be a potential target for therapy and prognosis in retinoblastoma.

Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine

CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

PubMed Central

Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

2011-01-01

The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

Comparison of sensitivity and specificity of 4 methods for detection of Giardia duodenalis in feces: immunofluorescence and PCR are superior to microscopy of concentrated iodine-stained samples.

PubMed

Gotfred-Rasmussen, Helle; Lund, Marianne; Enemark, Heidi L; Erlandsen, Mogens; Petersen, Eskild

2016-03-01

For decades, microscopy of feces after formol-ethylacetate (FEA) concentration and iodine staining has been the routine test for intestinal protozoa. Lately, polymerase chain reaction or fluorescence-labeled parasite-specific antibodies have been introduced, but their place in everyday routine diagnostics has not yet been established. We compared FEA and salt-sugar flotation (SSF) concentration followed by microscopy of iodine-stained concentrate and immunofluorescence assay (IFA) and real-time polymerase chain reaction (qPCR) for detection of Giardia duodenalis in human feces. The median number of Giardia cysts found by FEA in 19 Giardia-positive samples was 50 cysts per gram (CPG), by SSF 350 CPG, by IFA 76,700 CPG, and by qPCR 316,000 CPG. We next tested 455 consecutive samples for presence of Giardia cysts. Using IFA as reference, qPCR had a sensitivity of 91%, specificity of 95.1%, a false-positive rate of 50%, a false-negative rate of 0.48%, a positive predictive value of 50%, and a negative predictive value of 99.5%. In conclusion, qPCR and IFA were significantly more sensitive than microscopy of iodine-stained concentrates using either FEA or SSF. We suggest, when using qPCR, that positive samples are verified by IFA to prevent false-positive results. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Epigenetic modifications during sex change repress gonadotropin stimulation of cyp19a1a in a teleost ricefield eel (Monopterus albus).

PubMed

Zhang, Yang; Zhang, Shen; Liu, Zhixin; Zhang, Lihong; Zhang, Weimin

2013-08-01

In vertebrates, cytochrome P450 aromatase, encoded by cyp19a1, converts androgens to estrogens and plays important roles in gonadal differentiation and development. The present study examines whether epigenetic mechanisms are involved in cyp19a1a expression and subsequent gonadal development in the hermaphroditic ricefield eel. The expression of the ricefield eel cyp19a1a was stimulated by gonadotropin via the cAMP pathway in the ovary but not the ovotestis or testis. The CpG within the cAMP response element (CRE) of the cyp19a1a promoter was hypermethylated in the ovotestis and testis compared with the ovary. The methylation levels of CpG sites around CRE in the distal region (region II) and around steroidogenic factor 1/adrenal 4 binding protein sites and TATA box in the proximal region (region I) were inversely correlated with cyp19a1a expression during the natural sex change from female to male. In vitro DNA methylation decreased the basal and forskolin-induced activities of cyp19a1a promoter. Chromatin immunoprecipitation assays indicated that histone 3 (Lys9) in both regions I and II of the cyp19a1a promoter were deacetylated and trimethylated in the testis, and in contrast to the ovary, phosphorylated CRE-binding protein failed to bind to these regions. Lastly, the DNA methylation inhibitor 5-aza-2'-deoxycytidine reversed the natural sex change of ricefield eels. These results suggested that epigenetic mechanisms involving DNA methylation and histone deacetylation and methylation may abrogate the stimulation of cyp19a1a by gonadotropins in a male-specific fashion. This may be a mechanism widely used to drive natural sex change in teleosts as well as gonadal differentiation in other vertebrates.

Assigning breed origin to alleles in crossbred animals.

PubMed

Vandenplas, Jérémie; Calus, Mario P L; Sevillano, Claudia A; Windig, Jack J; Bastiaansen, John W M

2016-08-22

For some species, animal production systems are based on the use of crossbreeding to take advantage of the increased performance of crossbred compared to purebred animals. Effects of single nucleotide polymorphisms (SNPs) may differ between purebred and crossbred animals for several reasons: (1) differences in linkage disequilibrium between SNP alleles and a quantitative trait locus; (2) differences in genetic backgrounds (e.g., dominance and epistatic interactions); and (3) differences in environmental conditions, which result in genotype-by-environment interactions. Thus, SNP effects may be breed-specific, which has led to the development of genomic evaluations for crossbred performance that take such effects into account. However, to estimate breed-specific effects, it is necessary to know breed origin of alleles in crossbred animals. Therefore, our aim was to develop an approach for assigning breed origin to alleles of crossbred animals (termed BOA) without information on pedigree and to study its accuracy by considering various factors, including distance between breeds. The BOA approach consists of: (1) phasing genotypes of purebred and crossbred animals; (2) assigning breed origin to phased haplotypes; and (3) assigning breed origin to alleles of crossbred animals based on a library of assigned haplotypes, the breed composition of crossbred animals, and their SNP genotypes. The accuracy of allele assignments was determined for simulated datasets that include crosses between closely-related, distantly-related and unrelated breeds. Across these scenarios, the percentage of alleles of a crossbred animal that were correctly assigned to their breed origin was greater than 90 %, and increased with increasing distance between breeds, while the percentage of incorrectly assigned alleles was always less than 2 %. For the remaining alleles, i.e. 0 to 10 % of all alleles of a crossbred animal, breed origin could not be assigned. The BOA approach accurately assigns

Epicutaneous immunization with ovalbumin and CpG induces TH1/TH17 cytokines, which regulate IgE and IgG2a production

PubMed Central

Majewska-Szczepanik, Monika; Askenase, Philip W.; Lobo, Francis M.; Marcińska, Katarzyna; Wen, Li; Szczepanik, Marian

2017-01-01

Background Subcutaneous allergen-specific immunotherapy is a standard route for the immunotherapy of allergic diseases. It modulates the course of allergy and can generate long-term remission. However, subcutaneous allergen-specific immunotherapy can also induce anaphylaxis in some patients, and therefore additional routes of administration should be investigated to improve the safety and tolerability of immunotherapy. Objective We sought to determine whether epicutaneous treatment with antigen in the presence of a Toll-like receptor 9 agonist can suppress TH2-mediated responses in an antigen-specific manner. Methods Epicutaneous immunization was performed by applying a skin patch soaked with ovalbumin (OVA) plus CpG, and its suppressor activity was determined by using the mouse model of atopic dermatitis. Finally, adoptive cell transfers were implemented to characterize the regulatory cells that are induced by epicutaneous immunization. Results Epicutaneous immunization with OVA and CpG reduces the production of OVA-specific IgE and increases the synthesis of OVA-specific IgG2a antibodies in an antigen-specific manner. Moreover, eosinophil peroxidase activity in the skin and production of IL-4, IL-5, IL-10, and IL-13 are suppressed. The observed reduction of IgE synthesis is transferable with T-cell receptor (TCR) αβ+CD4+CD25− cells, whereas IgG2a production is dependent on both TCRαβ+ and TCRγδ+ T cells. Further experiments show that the described phenomenon is myeloid differentiation primary response 88, IFN-γ, and IL-17A dependent. Finally, the results suggest that epicutaneous immunization with OVA and CpG decreases the synthesis of OVA-specific IgE and skin eosinophil peroxidase activity in mice with ongoing skin allergy. Conclusion Epicutaneous application of protein antigen in the presence of adjuvant could be an attractive needle-free and self-administered immunotherapy for allergic diseases. PMID:26810716

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols

PubMed Central

2010-01-01

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102

Miniaturised optical fiber pH sensor for gastro-esophageal applications

NASA Astrophysics Data System (ADS)

Baldini, F.; Chiavaioli, F.; Cosi, F.; Giannetti, A.; Tombelli, S.; Trono, C.

2013-05-01

Monitoring pH for long periods, usually 24 h, in the stomach and in the esophagus may be essential in the diagnosis of gastro-esophageal diseases. The clinical range of interest is quite extended, between 1 to 8 pH units. Methyl red, after its covalent immobilization on controlled pore glass (CPG), is characterized by a working range which fits well with the clinical one. A novel probe, suitable for gastro-esophageal applications, was designed in order to optimize the performances of the colored CPG. This leads to a very simple probe configuration characterized by a very fast response.

Term placenta shows methylation independent down regulation of Cyp19 gene in animals with retained fetal membranes.

PubMed

Ghai, Sandeep; Monga, Rachna; Mohanty, T K; Chauhan, M S; Singh, Dheer

2012-02-01

Retention of fetal membranes (RFM) is the major post-partum disorder in dairy cattle. Cyp19 gene encodes the aromatase enzyme responsible for catalyzing the rate limiting step in estrogen biosynthesis, an important hormone for placental maturation and expulsion. The present study was aimed for comparative analysis of Cyp19 gene expression and its epigenetic regulation in placental cotyledons of animals with and without RFM. Significantly lower expression of Cyp19 gene was found in placental samples of RFM affected animals in comparison to normal animals. Methylation analysis of 5 CpG dinucleotides of placenta specific Cyp19 gene promoter I.1 and proximal promoter, PII showed hypo-methylation of both PI.1 and PII in term placenta of normal and diseased animals. In conclusion, a mechanism other than promoter methylation is responsible for decreased aromatase expression in placental cotyledons of animals suffering from RFM. Copyright © 2010 Elsevier Ltd. All rights reserved.

Dynamic Ligand Modulation of EPO Receptor Pools, and Dysregulation by Polycythemia-Associated EPOR Alleles

PubMed Central

Singh, Seema; Verma, Rakesh; Pradeep, Anamika; Leu, Karen; Mortensen, R. Bruce; Young, Peter R.; Oyasu, Miho; Schatz, Peter J.; Green, Jennifer M.; Wojchowski, Don M.

2012-01-01

Erythropoietin (EPO) and its cell surface receptor (EPOR) are essential for erythropoiesis; can modulate non-erythroid target tissues; and have been reported to affect the progression of certain cancers. Basic studies of EPOR expression and trafficking, however, have been hindered by low-level EPOR occurrence, and the limited specificity of anti-EPOR antibodies. Consequently, these aspects of EPOR biology are not well defined, nor are actions of polycythemia- associated mutated EPOR alleles. Using novel rabbit monoclonal antibodies to intracellular, PY- activated and extracellular EPOR domains, the following properties of the endogenous hEPOR in erythroid progenitors first are unambiguously defined. 1) High- Mr EPOR forms become obviously expressed only when EPO is limited. 2) EPOR-68K plus -70K species sequentially accumulate, and EPOR-70K comprises an apparent cell surface EPOR population. 3) Brefeldin A, N-glycanase and associated analyses point to EPOR-68K as a core-glycosylated intracellular EPOR pool (of modest size). 4) In contrast to recent reports, EPOR inward trafficking is shown (in UT7epo cells, and primary proerythroblasts) to be sharply ligand-dependent. Beyond this, when C-terminal truncated hEPOR-T mutant alleles as harbored by polycythemia patients are co-expressed with the wild-type EPOR in EPO-dependent erythroid progenitors, several specific events become altered. First, EPOR-T alleles are persistently activated upon EPO- challenge, yet are also subject to apparent turn-over (to low-Mr EPOR products). Furthermore, during exponential cell growth EPOR-T species become both over-represented, and hyper-activated. Interestingly, EPOR-T expression also results in an EPO dose-dependent loss of endogenous wild-type EPOR's (and, therefore, a squelching of EPOR C-terminal- mediated negative feedback effects). New knowledge concerning regulated EPOR expression and trafficking therefore is provided, together with new insight into mechanisms via which

Competitive allele-specific TaqMan PCR (Cast-PCR) is a sensitive, specific and fast method for BRAF V600 mutation detection in Melanoma patients

PubMed Central

Barbano, Raffaela; Pasculli, Barbara; Coco, Michelina; Fontana, Andrea; Copetti, Massimiliano; Rendina, Michelina; Valori, Vanna Maria; Graziano, Paolo; Maiello, Evaristo; Fazio, Vito Michele; Parrella, Paola

2015-01-01

BRAF codon 600 mutation testing of melanoma patients is mandatory for the choice of the most appropriate therapy in the clinical setting. Competitive allele specific TaqMan PCR (Cast-PCR) technology allows not only the selective amplification of minor alleles, but it also blocks the amplification of non-mutant allele. We genotyped codon 600 of the BRAF gene in 54 patients’ samples by Cast-PCR and bidirectional direct sequence analysis. All the mutations detected by sequencing were also identified by Cast-PCR. In addition, Cast-PCR assay detected four samples carrying mutations and was able to clearly identify two mutations of uncertain interpretation by Sanger sequencing. The limit of detection of Cast-PCR was evaluated by constructing dilution curves of BRAFV600E and BRAFV600K mutated clinical samples mixed with a not-mutated specimens. Both mutations could be detected until a 1:100 mutated/not mutated ratio. Cloning and sequencing of the clones was used to confirm mutations on representative discrepant cases. Cast PCR performances were not affected by intratumour heterogeneity, and less affected by melanin content. Our results indicate that Cast-PCR is a reliable diagnostic tool for the identification of melanoma patients as eligible to be treated with TKIs and might be implemented in the clinical setting as elective screening method. PMID:26690267

Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

PubMed

Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

2016-01-01

Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in

Analysis of S-RNase alleles of almond (Prunus dulcis): characterization of new sequences, resolution of synonyms and evidence of intragenic recombination.

PubMed

Ortega, Encarnación; Bosković, Radovan I; Sargent, Daniel J; Tobutt, Kenneth R

2006-11-01

Cross-compatibility relationships in almond are controlled by a gametophytically expressed incompatibility system partly mediated by stylar RNases, of which 29 have been reported. To resolve possible synonyms and to provide data for phylogenetic analysis, 21 almond S-RNase alleles were cloned and sequenced from SP (signal peptide region) or C1 (first conserved region) to C5, except for the S29 allele, which could be cloned only from SP to C1. Nineteen sequences (S4, S6, S11-S22, S25-S29)) were potentially new whereas S10 and S24 had previously been published but with different labels. The sequences for S16 and S17 were identical to that for S1, published previously; likewise, S15 was identical to S5. In addition, S4 and S20 were identical, as were S13 and S19. A revised version of the standard table of almond incompatibility genotypes is presented. Several alleles had AT or GA tandem repeats in their introns. Sequences of the 23 distinct newly cloned or already published alleles were aligned. Sliding windows analysis of Ka/Ks identified regions where positive selection may operate; in contrast to the Maloideae, most of the region from the beginning of C3 to the beginning of RC4 appeared not to be under positive selection. Phylogenetic analysis indicated four pairs of alleles had "bootstrap" support > 80%: S5/S10, S4/S8, S11/S24, and S3/S6. Various motifs up to 19 residues long occurred in at least two alleles, and their distributions were consistent with intragenic recombination, as were separate phylogenetic analyses of the 5' and 3' sections. Sequence comparison of phylogenetically related alleles indicated the significance of the region between RC4 and C5 in defining specificity.

Allele-specific programming of Npy and epigenetic effects of physical activity in a genetic model of depression.

PubMed

Melas, P A; Lennartsson, A; Vakifahmetoglu-Norberg, H; Wei, Y; Åberg, E; Werme, M; Rogdaki, M; Mannervik, M; Wegener, G; Brené, S; Mathé, A A; Lavebratt, C

2013-05-07

Neuropeptide Y (NPY) has been implicated in depression, emotional processing and stress response. Part of this evidence originates from human single-nucleotide polymorphism (SNP) studies. In the present study, we report that a SNP in the rat Npy promoter (C/T; rs105431668) affects in vitro transcription and DNA-protein interactions. Genotyping studies showed that the C-allele of rs105431668 is present in a genetic rat model of depression (Flinders sensitive line; FSL), while the SNP's T-allele is present in its controls (Flinders resistant line; FRL). In vivo experiments revealed binding of a transcription factor (CREB2) and a histone acetyltransferase (Ep300) only at the SNP locus of the FRL. Accordingly, the FRL had increased hippocampal levels of Npy mRNA and H3K18 acetylation; a gene-activating histone modification maintained by Ep300. Next, based on previous studies showing antidepressant-like effects of physical activity in the FSL, we hypothesized that physical activity may affect Npy's epigenetic status. In line with this assumption, physical activity was associated with increased levels of Npy mRNA and H3K18 acetylation. Physical activity was also associated with reduced mRNA levels of a histone deacetylase (Hdac5). Conclusively, the rat rs105431668 appears to be a functional Npy SNP that may underlie depression-like characteristics. In addition, the achieved epigenetic reprogramming of Npy provides molecular support for the putative effectiveness of physical activity as a non-pharmacological antidepressant.

Allele-specific programming of Npy and epigenetic effects of physical activity in a genetic model of depression

PubMed Central

Melas, P A; Lennartsson, A; Vakifahmetoglu-Norberg, H; Wei, Y; Åberg, E; Werme, M; Rogdaki, M; Mannervik, M; Wegener, G; Brené, S; Mathé, A A; Lavebratt, C

2013-01-01

Neuropeptide Y (NPY) has been implicated in depression, emotional processing and stress response. Part of this evidence originates from human single-nucleotide polymorphism (SNP) studies. In the present study, we report that a SNP in the rat Npy promoter (C/T; rs105431668) affects in vitro transcription and DNA–protein interactions. Genotyping studies showed that the C-allele of rs105431668 is present in a genetic rat model of depression (Flinders sensitive line; FSL), while the SNP's T-allele is present in its controls (Flinders resistant line; FRL). In vivo experiments revealed binding of a transcription factor (CREB2) and a histone acetyltransferase (Ep300) only at the SNP locus of the FRL. Accordingly, the FRL had increased hippocampal levels of Npy mRNA and H3K18 acetylation; a gene-activating histone modification maintained by Ep300. Next, based on previous studies showing antidepressant-like effects of physical activity in the FSL, we hypothesized that physical activity may affect Npy's epigenetic status. In line with this assumption, physical activity was associated with increased levels of Npy mRNA and H3K18 acetylation. Physical activity was also associated with reduced mRNA levels of a histone deacetylase (Hdac5). Conclusively, the rat rs105431668 appears to be a functional Npy SNP that may underlie depression-like characteristics. In addition, the achieved epigenetic reprogramming of Npy provides molecular support for the putative effectiveness of physical activity as a non-pharmacological antidepressant. PMID:23652932

KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands

PubMed Central

Farcas, Anca M; Blackledge, Neil P; Sudbery, Ian; Long, Hannah K; McGouran, Joanna F; Rose, Nathan R; Lee, Sheena; Sims, David; Cerase, Andrea; Sheahan, Thomas W; Koseki, Haruhiko; Brockdorff, Neil; Ponting, Chris P; Kessler, Benedikt M; Klose, Robert J

2012-01-01

CpG islands (CGIs) are associated with most mammalian gene promoters. A subset of CGIs act as polycomb response elements (PREs) and are recognized by the polycomb silencing systems to regulate expression of genes involved in early development. How CGIs function mechanistically as nucleation sites for polycomb repressive complexes remains unknown. Here we discover that KDM2B (FBXL10) specifically recognizes non-methylated DNA in CGIs and recruits the polycomb repressive complex 1 (PRC1). This contributes to histone H2A lysine 119 ubiquitylation (H2AK119ub1) and gene repression. Unexpectedly, we also find that CGIs are occupied by low levels of PRC1 throughout the genome, suggesting that the KDM2B-PRC1 complex may sample CGI-associated genes for susceptibility to polycomb-mediated silencing. These observations demonstrate an unexpected and direct link between recognition of CGIs by KDM2B and targeting of the polycomb repressive system. This provides the basis for a new model describing the functionality of CGIs as mammalian PREs. DOI: http://dx.doi.org/10.7554/eLife.00205.001 PMID:23256043

Rolling Thunder -- Integration of the Solo 161 Stirling engine with the CPG-460 solar concentrator at Ft. Huachuca

DOE Office of Scientific and Technical Information (OSTI.GOV)

Diver, R.B.; Moss, T.A.; Goldberg, V.

Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less

Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference

PubMed Central

Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara

2011-01-01

RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198

Fundamental differences in promoter CpG island DNA hypermethylation between human cancer and genetically engineered mouse models of cancer.

PubMed

Diede, Scott J; Yao, Zizhen; Keyes, C Chip; Tyler, Ashlee E; Dey, Joyoti; Hackett, Christopher S; Elsaesser, Katrina; Kemp, Christopher J; Neiman, Paul E; Weiss, William A; Olson, James M; Tapscott, Stephen J

2013-12-01

Genetic and epigenetic alterations are essential for the initiation and progression of human cancer. We previously reported that primary human medulloblastomas showed extensive cancer-specific CpG island DNA hypermethylation in critical developmental pathways. To determine whether genetically engineered mouse models (GEMMs) of medulloblastoma have comparable epigenetic changes, we assessed genome-wide DNA methylation in three mouse models of medulloblastoma. In contrast to human samples, very few loci with cancer-specific DNA hypermethylation were detected, and in almost all cases the degree of methylation was relatively modest compared with the dense hypermethylation in the human cancers. To determine if this finding was common to other GEMMs, we examined a Burkitt lymphoma and breast cancer model and did not detect promoter CpG island DNA hypermethylation, suggesting that human cancers and at least some GEMMs are fundamentally different with respect to this epigenetic modification. These findings provide an opportunity to both better understand the mechanism of aberrant DNA methylation in human cancer and construct better GEMMs to serve as preclinical platforms for therapy development.

Triglyceride associated polymorphisms of the APOA5 gene have very different allele frequencies in Pune, India compared to Europeans

PubMed Central

Chandak, Giriraj R; Ward, Kirsten J; Yajnik, Chittaranjan S; Pandit, Anand N; Bavdekar, Ashish; Joglekar, Charu V; Fall, Caroline HD; Mohankrishna, P; Wilkin, Terence J; Metcalf, Bradley S; Weedon, Michael N; Frayling, Timothy M; Hattersley, Andrew T

2006-01-01

Background The APOA5 gene variants, -1131T>C and S19W, are associated with altered triglyceride concentrations in studies of subjects of Caucasian and East Asian descent. There are few studies of these variants in South Asians. We investigated whether the two APOA5 variants also show similar association with various lipid parameters in Indian population as in the UK white subjects. Methods We genotyped 557 Indian adults from Pune, India, and 237 UK white adults for -1131T>C and S19W variants in the APOA5 gene, compared their allelic and genotype frequency and determined their association with fasting serum triglycerides, total cholesterol, HDL and LDL cholesterol levels using univariate general linear analysis. APOC3 SstI polymorphism was also analyzed in 175 Pune Indian subjects for analysis of linkage disequilibrium with the APOA5 variants. Results The APOA5 -1131C allele was more prevalent in Indians from Pune (Pune Indians) compared to UK white subjects (allele frequency 20% vs. 4%, p = 0.00001), whereas the 19W allele was less prevalent (3% vs. 6% p = 0.0015). Patterns of linkage disequilibrium between the two variants were similar between the two populations and confirmed that they occur on two different haplotypes. In Pune Indians, the presence of -1131C allele and the 19W allele was associated with a 19% and 15% increase respectively in triglyceride concentrations although only -1131C was significant (p = 0.0003). This effect size was similar to that seen in the UK white subjects. Analysis of the APOC3 SstI polymorphism in 175 Pune Indian subjects showed that this variant is not in appreciable linkage disequilibrium with the APOA5 -1131T>C variant (r2 = 0.07). Conclusion This is the first study to look at the role of APOA5 in Asian Indian subjects that reside in India. The -1131C allele is more prevalent and the 19W allele is less prevalent in Pune Indians compared to UK Caucasians. We confirm that the APOA5 variants are associated with triglyceride levels

Gender-specific association of exposure to non-dioxin-like polychlorinated biphenyls during pregnancy with methylation levels of H19 and long interspersed nuclear element-1 in cord blood in the Hokkaido study.

PubMed

Kobayashi, Sumitaka; Sata, Fumihiro; Miyashita, Chihiro; Miura, Ryu; Azumi, Kaoru; Kobayashi, Sachiko; Goudarzi, Houman; Araki, Atsuko; Ishizuka, Mayumi; Todaka, Takashi; Kajiwara, Jumboku; Hori, Tsuguhide; Kishi, Reiko

2017-09-01

methylation levels among female infants (P value for trend=0.015). Moreover, these associations were only observed among infants of primiparous women. Our results suggest that the dose-dependent association between prenatal exposure to specific non-dioxin-like PCBs and increases in the H19 and LINE-1 methylation levels in cord blood might be more predominant in females than in males. Copyright © 2017 Elsevier B.V. All rights reserved.

Caucasian and Asian Specific Rheumatoid Arthritis Risk Loci Reveal Limited Replication and Apparent Allelic Heterogeneity in North Indians

PubMed Central

Prasad, Pushplata; Kumar, Ashok; Gupta, Rajiva; Juyal, Ramesh C.; B. K., Thelma

2012-01-01

Genome-wide association studies and meta-analysis indicate that several genes/loci are consistently associated with rheumatoid arthritis (RA) in European and Asian populations. To evaluate the transferability status of these findings to an ethnically diverse north Indian population, we performed a replication analysis. We investigated the association of 47 single-nucleotide polymorphisms (SNPs) at 43 of these genes/loci with RA in a north Indian cohort comprising 983 RA cases and 1007 age and gender matched controls. Genotyping was done using Infinium human 660w-quad. Association analysis by chi-square test implemented in plink was carried out in two steps. Firstly, association of the index or surrogate SNP (r2>0.8, calculated from reference GIH Hap-Map population) was tested. In the second step, evidence for allelic/locus heterogeneity at aforementioned genes/loci was assessed for by testing additional flanking SNPs in linkage equilibrium with index/surrogate marker. Of the 44 European specific index SNPs, neither index nor surrogate SNPs were present for nine SNPs in the genotyping array. Of the remaining 35, associations were replicated at seven genes namely PTPN22 (rs1217407, p = 3×10−3); IL2–21 (rs13119723, p = 0.008); HLA-DRB1 (rs660895, p = 2.56×10−5; rs6457617, p = 1.6×10−09; rs13192471, p = 6.7×10−16); TNFA1P3 (rs9321637, p = 0.03); CCL21 (rs13293020, p = 0.01); IL2RA (rs2104286, p = 1.9×10−4) and ZEB1 (rs2793108, p = 0.006). Of the three Asian specific loci tested, rs2977227 in PADI4 showed modest association (p<0.02). Further, of the 140 SNPs (in LE with index/surrogate variant) tested, association was observed at 11 additional genes: PTPRC, AFF3, CD28, CTLA4, PXK, ANKRD55, TAGAP, CCR6, BLK, CD40 and IL2RB. This study indicates limited replication of European and Asian index SNPs and apparent allelic heterogeneity in RA etiology among north Indians warranting independent GWAS in this population

Allele-Specific HLA Loss and Immune Escape in Lung Cancer Evolution.

PubMed

McGranahan, Nicholas; Rosenthal, Rachel; Hiley, Crispin T; Rowan, Andrew J; Watkins, Thomas B K; Wilson, Gareth A; Birkbak, Nicolai J; Veeriah, Selvaraju; Van Loo, Peter; Herrero, Javier; Swanton, Charles

2017-11-30

Immune evasion is a hallmark of cancer. Losing the ability to present neoantigens through human leukocyte antigen (HLA) loss may facilitate immune evasion. However, the polymorphic nature of the locus has precluded accurate HLA copy-number analysis. Here, we present loss of heterozygosity in human leukocyte antigen (LOHHLA), a computational tool to determine HLA allele-specific copy number from sequencing data. Using LOHHLA, we find that HLA LOH occurs in 40% of non-small-cell lung cancers (NSCLCs) and is associated with a high subclonal neoantigen burden, APOBEC-mediated mutagenesis, upregulation of cytolytic activity, and PD-L1 positivity. The focal nature of HLA LOH alterations, their subclonal frequencies, enrichment in metastatic sites, and occurrence as parallel events suggests that HLA LOH is an immune escape mechanism that is subject to strong microenvironmental selection pressures later in tumor evolution. Characterizing HLA LOH with LOHHLA refines neoantigen prediction and may have implications for our understanding of resistance mechanisms and immunotherapeutic approaches targeting neoantigens. VIDEO ABSTRACT. Copyright © 2017 The Francis Crick Institute. Published by Elsevier Inc. All rights reserved.

H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

PubMed

Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

1996-03-01

H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19.

H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

PubMed Central

Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

1996-01-01

H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19. PMID:8636440

Genetic characterization of an alloalbumin, albumin Kashmir, using gene amplification and allele-specific oligonucleotides.

PubMed Central

Savva, D; Tárnoky, A L; Vickers, M F

1990-01-01

The molecular basis for albumin Kashmir was studied using the polymerase chain reaction to amplify a DNA fragment containing codon 501 in exon 12 of the human albumin gene. Southern blots of the amplified DNA were hybridized to oligonucleotide probes specific either for the normal allele of albumin or for albumin Kashmir. The results provide strong evidence that codon 501 in albumin Kashmir is AAG (lysine) instead of GAG (glutamic acid), thus confirming the protein sequences reported. This approach was used to characterize a bisalbuminaemic individual as a carrier for albumin Kashmir. Similar strategies may be devised to study the molecular basis and to identify carriers of other alloalbumins. Images Fig. 1. Fig. 2. PMID:2317208

Encapsulating Immunostimulatory CpG Oligonucleotides in Listeriolysin O-Liposomes Promotes a Th1-Type Response and CTL Activity

PubMed Central

Andrews, Chasity D.; Huh, Myung-Sook; Patton, Kathryn; Higgins, Debbie; Van Nest, Gary; Ott, Gary; Lee, Kyung-Dall

2013-01-01

Immunostimulatory sequences (ISS) are short DNA sequences containing unmethylated CpG dimers that have multiple effects on the host immune system, including the ability to stimulate antigen-specific cytotoxic T lymphocytes (CTLs) and drive Th1-type immune responses. Listeriolysin O (LLO)-containing pH-sensitive liposomes have been shown to efficiently deliver macromolecules to the cytosol of APCs and efficiently stimulate CTLs. We hypothesized that encapsulating ISS-oligodeoxyribonucleotides (ODNs) in this delivery system would enhance the cell-mediated immune response and skew Th1-type responses in protein antigen-based vaccination utilizing LLO-liposomes. In vitro studies indicated that co-encapsulation of ISS in LLO-liposomes engendered activation of the NF-κB pathway while maintaining the efficient cytosolic delivery of antigen mediated by the co-encapsulated LLO. Antigen-specific CTL responses monitored by using the model antigen ovalbumin (OVA) in mice were enhanced when mice were immunized with OVA and ISS-ODN-containing LLO-liposomes compared with those immunized with either OVA-containing LLO-liposomes or OVA-ISS conjugates. The enhanced immune responses were of the Th1-type as monitored by the robust OVA-specific IgG2a induction and the OVA CD8 peptide-stimulated IFN-γ secretion. Our study suggests that including ISS-ODN in LLO-containing pH-sensitive liposomes yields a vaccine delivery system that enhances the cell-mediated immune response and skews this response toward the Th1-type. PMID:22376145

Authentication of an endangered herb Changium smyrnioides from different producing areas based on rDNA ITS sequences and allele-specific PCR.

PubMed

Sun, Xiaoqin; Wei, Yanglian; Qin, Minjian; Guo, Qiaosheng; Guo, Jianlin; Zhou, Yifeng; Hang, Yueyu

2012-03-01

The rDNA ITS region of 18 samples of Changium smyrnioides from 7 areas and of 2 samples of Chuanminshen violaceum were sequenced and analyzed. The amplified ITS region of the samples, including a partial sequence of ITS1 and complete sequences of 5.8S and ITS2, had a total length of 555 bp. After complete alignment, there were 49 variable sites, of which 45 were informative, when gaps were treated as missing data. Samples of C. smyrnioides from different locations could be identified exactly based on the variable sites. The maximum parsimony (MP) and neighbor joining (NJ) tree constructed from the ITS sequences based on Kumar's two-parameter model showed that the genetic distances of the C. smyrnioides samples from different locations were not always related to their geographical distances. A specific primer set for Allele-specific PCR authentication of C. violaceum from Jurong of Jiangsu was designed based on the SNP in the ITS sequence alignment. C. violaceum from the major genuine producing area in Jurong of Jiangsu could be identified exactly and quickly by Allele-specific PCR.

9 CFR 351.19 - Refusal of certification for specific lots.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Refusal of certification for specific lots. 351.19 Section 351.19 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION...

19 CFR 134.43 - Methods of marking specific articles.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 19 Customs Duties 1 2010-04-01 2010-04-01 false Methods of marking specific articles. 134.43...; DEPARTMENT OF THE TREASURY COUNTRY OF ORIGIN MARKING Method and Location of Marking Imported Articles § 134.43 Methods of marking specific articles. (a) Marking previously required by certain provisions of the...

19 CFR 134.43 - Methods of marking specific articles.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 19 Customs Duties 1 2011-04-01 2011-04-01 false Methods of marking specific articles. 134.43...; DEPARTMENT OF THE TREASURY COUNTRY OF ORIGIN MARKING Method and Location of Marking Imported Articles § 134.43 Methods of marking specific articles. (a) Marking previously required by certain provisions of the...

19 CFR 134.43 - Methods of marking specific articles.