Slime mould processors, logic gates and sensors.

PubMed

Adamatzky, A

2015-07-28

A heterotic, or hybrid, computation implies that two or more substrates of different physical nature are merged into a single device with indistinguishable parts. These hybrid devices then undertake coherent acts on programmable and sensible processing of information. We study the potential of heterotic computers using slime mould acting under the guidance of chemical, mechanical and optical stimuli. Plasmodium of acellular slime mould Physarum polycephalum is a gigantic single cell visible to the unaided eye. The cell shows a rich spectrum of behavioural morphological patterns in response to changing environmental conditions. Given data represented by chemical or physical stimuli, we can employ and modify the behaviour of the slime mould to make it solve a range of computing and sensing tasks. We overview results of laboratory experimental studies on prototyping of the slime mould morphological processors for approximation of Voronoi diagrams, planar shapes and solving mazes, and discuss logic gates implemented via collision of active growing zones and tactile responses of P. polycephalum. We also overview a range of electronic components--memristor, chemical, tactile and colour sensors-made of the slime mould. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

A would-be nervous system made from a slime mold.

PubMed

Adamatzky, Andrew

2015-01-01

The slime mold Physarum polycephalum is a huge single cell that has proved to be a fruitful material for designing novel computing architectures. The slime mold is capable of sensing tactile, chemical, and optical stimuli and converting them to characteristic patterns of its electrical potential oscillations. The electrical responses to stimuli may propagate along protoplasmic tubes for distances exceeding tens of centimeters, as impulses in neural pathways do. A slime mold makes decisions about its propagation direction based on information fusion from thousands of spatially extended protoplasmic loci, similarly to a neuron collecting information from its dendritic tree. The analogy is distant yet inspiring. We speculate on whether alternative-would-be-nervous systems can be developed and practically implemented from the slime mold. We uncover analogies between the slime mold and neurons, and demonstrate that the slime mold can play the roles of primitive mechanoreceptors, photoreceptors, and chemoreceptors; we also show how the Physarum neural pathways develop. The results constituted the first step towards experimental laboratory studies of nervous system implementation in slime molds.

Thread gauge for tapered threads

DOEpatents

Brewster, Albert L.

1994-01-11

The thread gauge permits the user to determine the pitch diameter of tapered threads at the intersection of the pitch cone and the end face of the object being measured. A pair of opposed anvils having lines of threads which match the configuration and taper of the threads on the part being measured are brought into meshing engagement with the threads on opposite sides of the part. The anvils are located linearly into their proper positions by stop fingers on the anvils that are brought into abutting engagement with the end face of the part. This places predetermined reference points of the pitch cone of the thread anvils in registration with corresponding points on the end face of the part being measured, resulting in an accurate determination of the pitch diameter at that location. The thread anvils can be arranged for measuring either internal or external threads.

Thread gauge for tapered threads

DOEpatents

Brewster, A.L.

1994-01-11

The thread gauge permits the user to determine the pitch diameter of tapered threads at the intersection of the pitch cone and the end face of the object being measured. A pair of opposed anvils having lines of threads which match the configuration and taper of the threads on the part being measured are brought into meshing engagement with the threads on opposite sides of the part. The anvils are located linearly into their proper positions by stop fingers on the anvils that are brought into abutting engagement with the end face of the part. This places predetermined reference points of the pitch cone of the thread anvils in registration with corresponding points on the end face of the part being measured, resulting in an accurate determination of the pitch diameter at that location. The thread anvils can be arranged for measuring either internal or external threads. 13 figures.

Introducing the slime mold graph repository

NASA Astrophysics Data System (ADS)

Dirnberger, M.; Mehlhorn, K.; Mehlhorn, T.

2017-07-01

We introduce the slime mold graph repository or SMGR, a novel data collection promoting the visibility, accessibility and reuse of experimental data revolving around network-forming slime molds. By making data readily available to researchers across multiple disciplines, the SMGR promotes novel research as well as the reproduction of original results. While SMGR data may take various forms, we stress the importance of graph representations of slime mold networks due to their ease of handling and their large potential for reuse. Data added to the SMGR stands to gain impact beyond initial publications or even beyond its domain of origin. We initiate the SMGR with the comprehensive Kist Europe data set focusing on the slime mold Physarum polycephalum, which we obtained in the course of our original research. It contains sequences of images documenting growth and network formation of the organism under constant conditions. Suitable image sequences depicting the typical P. polycephalum network structures are used to compute sequences of graphs faithfully capturing them. Given such sequences, node identities are computed, tracking the development of nodes over time. Based on this information we demonstrate two out of many possible ways to begin exploring the data. The entire data set is well-documented, self-contained and ready for inspection at http://smgr.mpi-inf.mpg.de.

Antiphagocytic Effect of Slime from a Mucoid Strain of Pseudomonas aeruginosa

PubMed Central

Schwarzmann, Stephen; Boring, John R.

1971-01-01

Mucoid strains of Pseudomonas aeruginosa produce a viscid slime when grown on the surface of agar media. These strains are known to colonize persistently the tracheobronchial tree of children with cystic fibrosis. Colonization may result from inhibition of phagocytosis due to slime produced by the organism. Slime separated from one mucoid strain was examined to determine whether it possessed antiphagocytic activity in vitro. Cells of P. aeruginosa, Escherichia coli, and Staphylococcus aureus were rapidly phagocytized by rabbit polymorphonuclear leukocytes when mixtures were rotated for 2 hr at 37 C in the absence of slime. The addition of relatively small amounts of slime to bacteria and leukocytes inhibited phagocytosis as measured by phagocytic killing of the organisms. Inhibition was found to be most complete with P. aeruginosa. PMID:16558051

Slime mould foraging behaviour as optically coupled logical operations

NASA Astrophysics Data System (ADS)

Mayne, R.; Adamatzky, A.

2015-04-01

Physarum polycephalum is a macroscopic plasmodial slime mould whose apparently 'intelligent' behaviour patterns may be interpreted as computation. We employ plasmodial phototactic responses to construct laboratory prototypes of NOT and NAND logical gates with electrical inputs/outputs and optical coupling in which the slime mould plays dual roles of computing device and electrical conductor. Slime mould logical gates are fault tolerant and resettable. The results presented here demonstrate the malleability and resilience of biological systems and highlight how the innate behaviour patterns of living substrates may be used to implement useful computation.

No support for Heincke's law in hagfish (Myxinidae): lack of an association between body size and the depth of species occurrence.

PubMed

Schumacher, E L; Owens, B D; Uyeno, T A; Clark, A J; Reece, J S

2017-08-01

This study tests for interspecific evidence of Heincke's law among hagfishes and advances the field of research on body size and depth of occurrence in fishes by including a phylogenetic correction and by examining depth in four ways: maximum depth, minimum depth, mean depth of recorded specimens and the average of maximum and minimum depths of occurrence. Results yield no evidence for Heincke's law in hagfishes, no phylogenetic signal for the depth at which species occur, but moderate to weak phylogenetic signal for body size, suggesting that phylogeny may play a role in determining body size in this group. © 2017 The Fisheries Society of the British Isles.

Thread gauge for measuring thread pitch diameters

DOEpatents

Brewster, A.L.

1985-11-19

A thread gauge which attaches to a vernier caliper to measure the thread pitch diameter of both externally threaded and internally threaded parts is disclosed. A pair of anvils are externally threaded with threads having the same pitch as those of the threaded part. Each anvil is mounted on a stem having a ball on which the anvil can rotate to properly mate with the parts to which the anvils are applied. The stems are detachably secured to the caliper blades by attachment collars having keyhole openings for receiving the stems and caliper blades. A set screw is used to secure each collar on its caliper blade. 2 figs.

Thread gauge for measuring thread pitch diameters

DOEpatents

Brewster, Albert L.

1985-01-01

A thread gauge which attaches to a vernier caliper to measure the thread pitch diameter of both externally threaded and internally threaded parts. A pair of anvils are externally threaded with threads having the same pitch as those of the threaded part. Each anvil is mounted on a stem having a ball on which the anvil can rotate to properly mate with the parts to which the anvils are applied. The stems are detachably secured to the caliper blades by attachment collars having keyhole openings for receiving the stems and caliper blades. A set screw is used to secure each collar on its caliper blade.

Slime coating of kaolinite on chalcopyrite in saline water flotation

NASA Astrophysics Data System (ADS)

Li, Zhi-li; Rao, Feng; Song, Shao-xian; Li, Yan-mei; Liu, Wen-biao

2018-05-01

In saline water flotation, the salinity can cause a distinguishable slime coating of clay minerals on chalcopyrite particles through its effect on their electrical double layers in aqueous solutions. In this work, kaolinite was used as a representative clay mineral for studying slime coating during chalcopyrite flotation. The flotation of chalcopyrite in the presence and absence of kaolinite in tap water, seawater, and gypsum-saturated water and the stability of chalcopyrite and kaolinite particles in slurries are presented. Zeta-potential distributions and scanning electron microscopy images were used to characterize and explain the different slime coating degrees and the different flotation performances. Kaolinite particles induced slime coating on chalcopyrite surfaces and reduced chalcopyrite floatability to the greatest extent when the pH value was in the alkaline range. At 0.24wt% of kaolinite, the chalcopyrite floatability was depressed by more than 10% at alkaline pH levels in tap water. Salinity in seawater and gypsum-saturated water compressed the electrical double layers and resulted in extensive slime coating.

Using Cellular Slime Molds in the High School Laboratory

ERIC Educational Resources Information Center

Haskins, P. B.

1977-01-01

Described is the life cycle of the cellular slime molds Acrasiales. Experiments that can be used to explore the aggregation, migration, and culmination activities of the organism are suggested. Laboratory procedures for culturing these slime molds and listings of biological supply houses and literature references are also given. (MA)

Physarum attraction: Why slime mold behaves as cats do?

PubMed

Adamatzky, Andrew; Costello, Ben De Lacy

2012-05-01

We discuss potential chemical substances responsible for attracting acellular slime mold Physarun polycephalum to valerian root. The contributes toward fundamental research into pheromones and chemo-attracts of primitive organisms such as slime molds. The results show that significant information could be gained about the action of compounds on higher organisms.

Physarum attraction: Why slime mold behaves as cats do?

PubMed Central

Adamatzky, Andrew; Costello, Ben De Lacy

2012-01-01

We discuss potential chemical substances responsible for attracting acellular slime mold Physarun polycephalum to valerian root. The contributes toward fundamental research into pheromones and chemo-attracts of primitive organisms such as slime molds. The results show that significant information could be gained about the action of compounds on higher organisms. PMID:22896798

[Enzymatic activity, slime production and antifungal agent sensitivity of Candida sp].

PubMed

Silva, Jaqueline Otero; Ferreira, Joseane Cristina; Candido, Regina Célia

2007-01-01

Abilith of Candida spp to secrete extracellular enzymes and slime has been associated as pathogenicity factors. Out of a total of 37 strains of Candida sp, 100% were proteinase producers, 83.8% were phospholipase producers, 64.9% were slime producers and 100% were sensitive to fluconazole and itraconazole. Seventeen typings (enzymes/slime) were found. This methodology presented a good discrimination rate (D=0.93) and could be used for phenotypic characterization of yeasts.

Recovery of Silver and Gold from Copper Anode Slimes

NASA Astrophysics Data System (ADS)

Chen, Ailiang; Peng, Zhiwei; Hwang, Jiann-Yang; Ma, Yutian; Liu, Xuheng; Chen, Xingyu

2015-02-01

Copper anode slimes, produced from copper electrolytic refining, are important industrial by-products containing several valuable metals, particularly silver and gold. This article provides a comprehensive overview of the development of the extraction processes for recovering silver and gold from conventional copper anode slimes. Existing processes, namely pyrometallurgical processes, hydrometallurgical processes, and hybrid processes involving the combination of pyrometallurgical and hydrometallurgical technologies, are discussed based in part on a review of the form and characteristics of silver and gold in copper anode slimes. The recovery of silver and gold in pyrometallurgical processes is influenced in part by the slag and matte/metal chemistry and related characteristics, whereas the extraction of these metals in hydrometallurgical processes depends on the leaching reagents used to break the structure of the silver- and gold-bearing phases, such as selenides. By taking advantage of both pyrometallurgical and hydrometallurgical techniques, high extraction yields of silver and gold can be obtained using such combined approaches that appear promising for efficient extraction of silver and gold from copper anode slimes.

Production and Characterization of the Slime Polysaccharide of Pseudomonas aeruginosa

PubMed Central

Evans, Leigh R.; Linker, Alfred

1973-01-01

The slime polysaccharides produced by Pseudomonas aeruginosa isolated from a variety of human infections were investigated. Slime production in culture seemed optimal when adequate amounts of carbohydrate were present and under conditions of either high osmotic pressure or inadequate protein supply. The polysaccharides produced by the organisms were similar to each other, to the slime of Azotobacter vinelandii, and to seaweed alginic acids. They were composed of β-1,4-linked d-mannuronic acid residues and variable amounts of its 5-epimer l-guluronic acid. All bacterial polymers contained o-acetyl groups which are absent in the alginates. The polysaccharides differed considerably in the ratio of mannuronic to guluronic acid content and in the number of o-acetyl groups. The particular composition of the slime was not found to be characteristic for the disease process from which the mucoid variants of P. aeruginosa were obtained. PMID:4200860

Dedicated memory structure holding data for detecting available worker thread(s) and informing available worker thread(s) of task(s) to execute

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiu, George L.; Eichenberger, Alexandre E.; O'Brien, John K. P.

The present disclosure relates generally to a dedicated memory structure (that is, hardware device) holding data for detecting available worker thread(s) and informing available worker thread(s) of task(s) to execute.

Characterization of Raw and Decopperized Anode Slimes from a Chilean Refinery

NASA Astrophysics Data System (ADS)

Melo Aguilera, Evelyn; Hernández Vera, María Cecilia; Viñals, Joan; Graber Seguel, Teófilo

2016-04-01

This work characterizes raw and decopperized slimes, with the objective of identifying the phases in these two sub-products. The main phases in copper anodes are metallic copper, including CuO, which are present in free form or associated with the presence of copper selenide or tellurides (Cu2(Se,Te)) and several Cu-Pb-Sb-As-Bi oxides. During electrorefining, the impurities in the anode release and are not deposited in the cathode, part of them dissolving and concentrated in the electrolyte, and others form a raw anode slime that contains Au, Ag, Cu, As, Se, Te and PGM, depending on the composition of the anode. There are several recovery processes, most of which involve acid leaching in the first step to dissolve copper, whose product is decopperized anode slime. SEM analysis revealed that the mineralogical species present in the raw anode slime under study were mainly eucarite (CuAgSe), naumannite (Ag2Se), antimony arsenate (SbAsO4), and lead sulfate (PbSO4). In the case of decopperized slime, the particles were mainly composed of SbAsO4 (crystalline appearance), non-stoichiometric silver selenide (Ag(2- x)Se), and chlorargyrite (AgCl).

Two species of myxomycetes causing slime mold of sweet potato.

PubMed

Kim, Wan Gyu; Lee, Sang Yeob; Cho, Weon Dae

2007-06-01

Specimens collected from sweet potato plants with slime mold symptoms in fields in Daejeon, Korea were examined. Two species of Myxomycetes, Fuligo septica and Stemonitis herbatica were identified based on their morphological characteristics. This is the first report that the two species of Myxomycetes cause slime mold of sweet potato in Korea.

Occurrence of Fuligo gyrosa Causing Slime Mold of Oriental Melon.

PubMed

Kim, Wan Gyu; Choi, Hyo Won; Hong, Sung Kee; Lee, Young Kee; Lee, Su Heon

2009-09-01

Recently, a severe slime mold infestation affected oriental melon plants in fields in Chilgok county, Gyeongbuk province, Korea. Specimens were collected from the fields and examined for identification. A species of Myxomycetes, Fuligo gyrosa, was identified based on its morphological characteristics. This is the first report that F. gyrosa causes slime mold of oriental melon.

Two Species of Myxomycetes Causing Slime Mold of Sweet Potato

PubMed Central

Lee, Sang Yeob; Cho, Weon Dae

2007-01-01

Specimens collected from sweet potato plants with slime mold symptoms in fields in Daejeon, Korea were examined. Two species of Myxomycetes, Fuligo septica and Stemonitis herbatica were identified based on their morphological characteristics. This is the first report that the two species of Myxomycetes cause slime mold of sweet potato in Korea. PMID:24015079

On chirality of slime mould.

PubMed

Dimonte, Alice; Adamatzky, Andrew; Erokhin, Victor; Levin, Michael

2016-02-01

Left-right patterning and lateralised behaviour is an ubiquitous aspect of plants and animals. The mechanisms linking cellular chirality to the large-scale asymmetry of multicellular structures are incompletely understood, and it has been suggested that the chirality of living cells is hardwired in their cytoskeleton. We examined the question of biased asymmetry in a unique organism: the slime mould Physarum polycephalum, which is unicellular yet possesses macroscopic, complex structure and behaviour. In laboratory experiment using a T-shape, we found that Physarum turns right in more than 74% of trials. The results are in agreement with previously published studies on asymmetric movement of muscle cells, neutrophils, liver cells and growing neural filaments, and for the first time reveal the presence of consistently-biased laterality in the fungi kingdom. Exact mechanisms of the slime mould's direction preference remain unknown. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Occurrence of Fuligo gyrosa Causing Slime Mold of Oriental Melon

PubMed Central

Choi, Hyo Won; Hong, Sung Kee; Lee, Young Kee; Lee, Su Heon

2009-01-01

Recently, a severe slime mold infestation affected oriental melon plants in fields in Chilgok county, Gyeongbuk province, Korea. Specimens were collected from the fields and examined for identification. A species of Myxomycetes, Fuligo gyrosa, was identified based on its morphological characteristics. This is the first report that F. gyrosa causes slime mold of oriental melon. PMID:23983540

Pigment gallstone pathogenesis: slime production by biliary bacteria is more important than beta-glucuronidase production.

PubMed

Stewart, L; Ponce, R; Oesterle, A L; Griffiss, J M; Way, L W

2000-01-01

Pigment stones are thought to form as a result of deconjugation of bilirubin by bacterial beta-glucuronidase, which results in precipitation of calcium bilirubinate. Calcium bilirubinate is then aggregated into stones by an anionic glycoprotein. Slime (glycocalyx), an anionic glycoprotein produced by bacteria causing foreign body infections, has been implicated in the formation of the precipitate that blocks biliary stents. We previously showed that bacteria are present within the pigment portions of gallstones and postulated a bacterial role in pigment stone formation through beta-glucuronidase or slime production. Ninety-one biliary bacterial isolates from 61 patients and 12 control stool organisms were tested for their production of beta-glucuronidase and slime. The average slime production was 42 for biliary bacteria and 2.5 for stool bacteria (P <0.001). Overall, 73% of biliary bacteria and 8% of stool bacteria produced slime (optical density >3). In contrast, only 38% of biliary bacteria produced beta-glucuronidase. Eighty-two percent of all patients, 90% of patients with common bile duct (CBD) stones, 100% of patients with primary CBD stones, and 93% of patients with biliary tubes had one or more bacterial species in their stones that produced slime. By comparison, only 47% of all patients, 60% of patients with CBD stones, 62% of patients with primary CBD stones, and 50% of patients with biliary tubes had one or more bacteria that produced beta-glucuronidase. Most biliary bacteria produced slime, and slime production correlated better than beta-glucuronidase production did with stone formation and the presence of biliary tubes or stents. Patients with primary CBD stones and biliary tubes had the highest incidence of slime production. These findings suggest that bacterial slime is important in gallstone formation and the blockage of biliary tubes.

Detection of methicillin resistance and slime factor production of Staphylococcus aureus in bovine mastitis

PubMed Central

Ciftci, Alper; Findik, Arzu; Onuk, Ertan Emek; Savasan, Serap

2009-01-01

This study aimed to detect methicillin resistant and slime producing Staphylococcus aureus in cases of bovine mastitis. A triplex PCR was optimized targetting 16S rRNA, nuc and mecA genes for detection of Staphylococcus species, S. aureus and methicillin resistance, respectively. Furthermore, for detection of slime producing strains, a PCR assay targetting icaA and icaD genes was performed. In this study, 59 strains were detected as S. aureus by both conventional tests and PCR, and 13 of them were found to be methicillin resistant and 4 (30.7%) were positive for mecA gene. Although 22 of 59 (37.2%) S. aureus isolates were slime-producing in Congo Red Agar, in PCR analysis only 15 were positive for both icaA and icaD genes. Sixteen and 38 out of 59 strains were positive for icaA and icaD gene, respectively. Only 2 of 59 strains were positive for both methicillin resistance and slime producing, phenotypically, suggesting lack of correlation between methicillin resistance and slime production in these isolates. In conclusion, the optimized triplex PCR in this study was useful for rapid and reliable detection of methicillin resistant S. aureus. Furthermore, only PCR targetting icaA and icaD may not sufficient to detect slime production and further studies targetting other ica genes should be conducted for accurate evaluation of slime production characters of S. aureus strains. PMID:24031354

Determination of Calorific Ability of Fuel Briquettes on the Basis of Oil and Oil Slimes

NASA Astrophysics Data System (ADS)

Fedyaeva, O. A.; Poshelyuzhnaya, E. G.; Rakhmatulina, E. M.; Zakharov, V. A.; Fisenko, T. E.

2018-01-01

Utilization and neutralization of oil slimes is one of important environmental problems of the oil-extracting, oil-processing and petrochemical industry. The easiest and economic way of utilization of oil slimes is their use as a part of the bricketed boiler fuel. In this work the highest calorific ability of crude oil, the oil slimes and fuel briquettes made on their basis is defined. A research problem was carrying out the technical analysis of oil fuels on the content in them analytical moisture, the cindery rest and volatiles. It is established that in comparison with oil slimes crude oil possesses bigger highest calorific ability, has smaller humidity and an ash-content. The highest calorific abilities of the boiler briquettes made of samples of crude oil, oil slimes and peat made 14 - 26 MJ/kg.

Questioning hagfish affinities of the enigmatic Devonian vertebrate Palaeospondylus

NASA Astrophysics Data System (ADS)

Johanson, Zerina; Smith, Moya; Sanchez, Sophie; Senden, Tim; Trinajstic, Kate; Pfaff, Cathrin

2017-07-01

Palaeospondylus gunni Traquair, 1890 is an enigmatic Devonian vertebrate whose taxonomic affinities have been debated since it was first described. Most recently, Palaeospondylus has been identified as a stem-group hagfish (Myxinoidea). However, one character questioning this assignment is the presence of three semicircular canals in the otic region of the cartilaginous skull, a feature of jawed vertebrates. Additionally, new tomographic data reveal that the following characters of crown-group gnathostomes (chondrichthyans + osteichthyans) are present in Palaeospondylus: a longer telencephalic region of the braincase, separation of otic and occipital regions by the otico-occipital fissure, and vertebral centra. As well, a precerebral fontanelle and postorbital articulation of the palatoquadrate are characteristic of certain chondrichthyans. Similarities in the structure of the postorbital process to taxa such as Pucapampella, and possible presence of the ventral cranial fissure, both support a resolution of Pa. gunni as a stem chondrichthyan. The internally mineralized cartilaginous skeleton in Palaeospondylus may represent a stage in the loss of bone characteristic of the Chondrichthyes.

Rheological effects of micropolar slime on the gliding motility of bacteria with slip boundary condition

NASA Astrophysics Data System (ADS)

Asghar, Z.; Ali, N.; Anwar Bég, O.; Javed, T.

2018-06-01

Gliding bacteria are virtually everywhere. These organisms are phylogenetically diverse with their hundreds of types, different shapes and several modes of motility. One possible mode of gliding motility in the rod shaped bacteria is that they propel themselves by producing undulating waves in their body. Few bacteria glides near the solid surface over the slime without any aid of flagella so the classical Navier-Stokes equations are incapable of explaining the slime rheology at the microscopic level. Micropolar fluid dynamics however provides a solid framework for mimicking bacterial physical phenomena at both micro and nano-scales, and therefore we use the micropolar fluid to characterize the rheology of a thin layer of slime and its dominant microrotation effects. It is also assumed that there is a certain degree of slip between slime and bacterial undulating surface and also between slime and solid substrate. The flow equations are formulated under long wavelength and low Reynolds number assumptions. Exact expressions for stream function and pressure gradient are obtained. The speed of the gliding bacteria is numerically calculated by using a modified Newton-Raphson method. Slip effects and effects of non-Newtonian slime parameters on bacterial speed and power are also quantified. In addition, when the glider is fixed, the effects of slip and rheological properties of micropolar slime parameters on the velocity, micro-rotation (angular velocity) of spherical slime particles, pressure rise per wavelength, pumping and trapping phenomena are also shown graphically and discussed in detail. The study is relevant to emerging biofuel cell technologies and also bacterial biophysics.

Feeding Behaviors in Cellular Slime Molds: A Microbial System To Study Competition.

ERIC Educational Resources Information Center

Bozzone, Donna M.

1997-01-01

Describes a laboratory project for first-year biology students that examines competition among various cellular slime molds. After a brief introduction to the topic of competition and basic life history information about cellular slime molds, students choose a question and design original experiments to seek an answer. (Author/AIM)

Introducing a novel mechanism to control heart rate in the ancestral Pacific hagfish.

PubMed

Wilson, Christopher M; Roa, Jinae N; Cox, Georgina K; Tresguerres, Martin; Farrell, Anthony P

2016-10-15

Although neural modulation of heart rate is well established among chordate animals, the Pacific hagfish (Eptatretus stoutii) lacks any cardiac innervation, yet it can increase its heart rate from the steady, depressed heart rate seen in prolonged anoxia to almost double its normal normoxic heart rate, an almost fourfold overall change during the 1-h recovery from anoxia. The present study sought mechanistic explanations for these regulatory changes in heart rate. We provide evidence for a bicarbonate-activated, soluble adenylyl cyclase (sAC)-dependent mechanism to control heart rate, a mechanism never previously implicated in chordate cardiac control. © 2016. Published by The Company of Biologists Ltd.

Comparison of slime-producing coagulase-negative Staphylococcus colonization rates on vinyl and ceramic tile flooring materials.

PubMed

Yazgi, H; Uyanik, M H; Ayyildiz, A

2009-01-01

This study investigated the colonization of slime-producing coagulase-negative Staphylococcus (CoNS) in 80 patient wards in Turkey (40 vinyl and 40 ceramic tile floors). A total of 480 samples that included 557 CoNS isolates were obtained. Slime production was investigated with the Christensen method and methicillin-susceptibility was tested by the disk-diffusion method. There was a significant difference in the percentage of slime-producing CoNS isolates on vinyl (12.4%) versus ceramic tile flooring (4.4%). From vinyl flooring, the percentage of slime producing methicillin-resistant CoNS (MRCoNS) (8.9%) was significantly higher than for methicillin-sensitive CoNS (MSCoNS) (3.6%), whereas there was no difference from ceramic tile flooring (2.5% MRCoNS versus 1.8% MSCoNS). The most commonly isolated slime-producing CoNS species was S. epidermidis on both types of flooring. It is concluded that vinyl flooring seems to be a more suitable colonization surface for slime-producing CoNS than ceramic tile floors. Further studies are needed to investigate bacterial strains colonized on flooring materials, which are potential pathogens for nosocomial infections.

Slime-producing Staphylococcus epidermidis and S. aureus in acute bacterial conjunctivitis in soft contact lens wearers.

PubMed

Catalanotti, Piergiorgio; Lanza, Michele; Del Prete, Antonio; Lucido, Maria; Catania, Maria Rosaria; Gallè, Francesca; Boggia, Daniela; Perfetto, Brunella; Rossano, Fabio

2005-10-01

In recent years, an increase in ocular pathologies related to soft contact lens has been observed. The most common infectious agents were Staphylococcus spp. Some strains produce an extracellular polysaccharidic slime that can cause severe infections. Polysaccharide synthesis is under genetic control and involves a specific intercellular adhesion (ica) locus, in particular, icaA and icaD genes. Conjunctival swabs from 97 patients with presumably bacterial bilateral conjunctivitis, wearers of soft contact lenses were examined. We determined the ability of staphylococci to produce slime, relating it to the presence of icaA and icaD genes. We also investigated the antibiotic susceptibility and Pulsed Field Gel Electrophoresis (PFGE) patterns of the clinical isolates. We found that 74.1% of the S. epidermidis strains and 61.1% of the S. aureus strains isolated were slime producers and showed icaA and icaD genes. Both S. epidermidis and S. aureus slime-producing strains exhibited more surface hydrophobicity than non-producing slime strains. The PFGE patterns overlapped in S. epidermidis strains with high hydrophobicity. The similar PFGE patterns were not related to biofilm production. We found scarce matching among the Staphylococcus spp. studied, slime production, surface hydrophobicity and antibiotic susceptibility.

Hänsel, Gretel and the slime mould—how an external spatial memory aids navigation in complex environments

NASA Astrophysics Data System (ADS)

Smith-Ferguson, Jules; Reid, Chris R.; Latty, Tanya; Beekman, Madeleine

2017-10-01

The ability to navigate through an environment is critical to most organisms’ ability to survive and reproduce. The presence of a memory system greatly enhances navigational success. Therefore, natural selection is likely to drive the creation of memory systems, even in non-neuronal organisms, if having such a system is adaptive. Here we examine if the external spatial memory system present in the acellular slime mould, Physarum polycephalum, provides an adaptive advantage for resource acquisition. P. polycephalum lays tracks of extracellular slime as it moves through its environment. Previous work has shown that the presence of extracellular slime allows the organism to escape from a trap in laboratory experiments simply by avoiding areas previously explored. Here we further investigate the benefits of using extracellular slime as an external spatial memory by testing the organism’s ability to navigate through environments of differing complexity with and without the ability to use its external memory. Our results suggest that the external memory has an adaptive advantage in ‘open’ and simple bounded environments. However, in a complex bounded environment, the extracellular slime provides no advantage, and may even negatively affect the organism’s navigational abilities. Our results indicate that the exact experimental set up matters if one wants to fully understand how the presence of extracellular slime affects the slime mould’s search behaviour.

Beyond input-output computings: error-driven emergence with parallel non-distributed slime mold computer.

PubMed

Aono, Masashi; Gunji, Yukio-Pegio

2003-10-01

The emergence derived from errors is the key importance for both novel computing and novel usage of the computer. In this paper, we propose an implementable experimental plan for the biological computing so as to elicit the emergent property of complex systems. An individual plasmodium of the true slime mold Physarum polycephalum acts in the slime mold computer. Modifying the Elementary Cellular Automaton as it entails the global synchronization problem upon the parallel computing provides the NP-complete problem solved by the slime mold computer. The possibility to solve the problem by giving neither all possible results nor explicit prescription of solution-seeking is discussed. In slime mold computing, the distributivity in the local computing logic can change dynamically, and its parallel non-distributed computing cannot be reduced into the spatial addition of multiple serial computings. The computing system based on exhaustive absence of the super-system may produce, something more than filling the vacancy.

Stanley Corrsin Award Talk: Fluid Mechanics of Fungi and Slime

NASA Astrophysics Data System (ADS)

Brenner, Michael

2013-11-01

There are interesting fluid mechanics problems everywhere, even in the most lowly and hidden corners of forest floors. Here I discuss some questions we have been working on in recent years involving fungi and slime. A critical issue for the ecology of fungi and slime is nutrient availability: nutrient sources are highly heterogeneous, and strategies are necessary to find food when it runs out. In the fungal phylum Ascomycota, spore dispersal is the primary mechanism for finding new food sources. The defining feature of this phylum is the ascus, a fluid filled sac from which spores are ejected, through a build up in osmotic pressure. We outline the (largely fluid mechanical) design constraints on this ejection strategy, and demonstrate how it provides strong constraints for the diverse morphologies of spores and asci found in nature. The core of the argument revisits a classical problem in elastohydrodynamic lubrication from a different perspective. A completely different strategy for finding new nutrient is found by slime molds and fungi that stretch out - as a single organism- over enormous areas (up to hectares) over forest floors. As a model problem we study the slime mold Physarum polycephalum, which forages with a large network of connected tubes on the forest floors. Localized regions in the network find nutrient sources and then pump the nutrients throughout the entire organism. We discuss fluid mechanical mechanisms for coordinating this transport, which generalize peristalsis to pumping in a heterogeneous network. We give a preliminary discussion to how physarum can detect a nutrient source and pump the nutrient throughout the organism.

Self-locking threaded fasteners

DOEpatents

Glovan, Ronald J.; Tierney, John C.; McLean, Leroy L.; Johnson, Lawrence L.

1996-01-01

A threaded fastener with a shape memory alloy (SMA) coatings on its threads is disclosed. The fastener has special usefulness in high temperature applications where high reliability is important. The SMA coated fastener is threaded into or onto a mating threaded part at room temperature to produce a fastened object. The SMA coating is distorted during the assembly. At elevated temperatures the coating tries to recover its original shape and thereby exerts locking forces on the threads. When the fastened object is returned to room temperature the locking forces dissipate. Consequently the threaded fasteners can be readily disassembled at room temperature but remains securely fastened at high temperatures. A spray technique is disclosed as a particularly useful method of coating of threads of a fastener with a shape memory alloy.

Self-locking threaded fasteners

DOEpatents

Glovan, R.J.; Tierney, J.C.; McLean, L.L.; Johnson, L.L.

1996-01-16

A threaded fastener with a shape memory alloy (SMA) coatings on its threads is disclosed. The fastener has special usefulness in high temperature applications where high reliability is important. The SMA coated fastener is threaded into or onto a mating threaded part at room temperature to produce a fastened object. The SMA coating is distorted during the assembly. At elevated temperatures the coating tries to recover its original shape and thereby exerts locking forces on the threads. When the fastened object is returned to room temperature the locking forces dissipate. Consequently the threaded fasteners can be readily disassembled at room temperature but remains securely fastened at high temperatures. A spray technique is disclosed as a particularly useful method of coating of threads of a fastener with a shape memory alloy. 13 figs.

Thread scheduling for GPU-based OPC simulation on multi-thread

NASA Astrophysics Data System (ADS)

Lee, Heejun; Kim, Sangwook; Hong, Jisuk; Lee, Sooryong; Han, Hwansoo

2018-03-01

As semiconductor product development based on shrinkage continues, the accuracy and difficulty required for the model based optical proximity correction (MBOPC) is increasing. OPC simulation time, which is the most timeconsuming part of MBOPC, is rapidly increasing due to high pattern density in a layout and complex OPC model. To reduce OPC simulation time, we attempt to apply graphic processing unit (GPU) to MBOPC because OPC process is good to be programmed in parallel. We address some issues that may typically happen during GPU-based OPC simulation in multi thread system, such as "out of memory" and "GPU idle time". To overcome these problems, we propose a thread scheduling method, which manages OPC jobs in multiple threads in such a way that simulations jobs from multiple threads are alternatively executed on GPU while correction jobs are executed at the same time in each CPU cores. It was observed that the amount of GPU peak memory usage decreases by up to 35%, and MBOPC runtime also decreases by 4%. In cases where out of memory issues occur in a multi-threaded environment, the thread scheduler was used to improve MBOPC runtime up to 23%.

Gallstones containing bacteria are biofilms: bacterial slime production and ability to form pigment solids determines infection severity and bacteremia.

PubMed

Stewart, Lygia; Griffiss, J McLeod; Jarvis, Gary A; Way, Lawrence W

2007-08-01

Gallstone bacteria provide a reservoir for biliary infections. Slime production facilitates adherence, whereas beta-glucuronidase and phospholipase generate colonization surface. These factors facilitate gallstone formation, but their influence on infection severity is unknown. Two hundred ninety-two patients were studied. Gallstones, bile, and blood (as applicable) were cultured. Bacteria were tested for beta-glucuronidase/phospholipase production and quantitative slime production. Infection severity was correlated with bacterial factors. Bacteria were present in 43% of cases, 13% with bacteremia. Severe infections correlated directly with beta-glucuronidase/phospholipase (55% with vs 13% without, P < 0.0001), but inversely with slime production (55 vs 8%, slime <75 or >75, P = 0.008). Low slime production and beta-glucuronidase/phospholipase production were additive: Severe infections were present in 76% with both, but 10% with either or none (P < 0.0001). beta-Glucuronidase/phospholipase production facilitated bactibilia (86% with vs 62% without, P = 0.03). Slime production was 19 (+/-8) vs 50 (+/-10) for bacteria that did or did not cause bacteremia (P = 0.004). No bacteria with slime >75 demonstrated bacteremia. Bacteria-laden gallstones are biofilms whose characteristics influence illness severity. Factors creating colonization surface (beta-glucuronidase/phospholipase) facilitated bacteremia and severe infections; but abundant slime production, while facilitating colonization, inhibited detachment and cholangiovenous reflux. This shows how properties of the gallstone biofilm determine the severity of the associated illness.

Improved Screw-Thread Lock

NASA Technical Reports Server (NTRS)

Macmartin, Malcolm

1995-01-01

Improved screw-thread lock engaged after screw tightened in nut or other mating threaded part. Device does not release contaminating material during tightening of screw. Includes pellet of soft material encased in screw and retained by pin. Hammer blow on pin extrudes pellet into slot, engaging threads in threaded hole or in nut.

Cutting thread at flexible endoscopy.

PubMed

Gong, F; Swain, P; Kadirkamanathan, S; Hepworth, C; Laufer, J; Shelton, J; Mills, T

1996-12-01

New thread-cutting techniques were developed for use at flexible endoscopy. A guillotine was designed to follow and cut thread at the endoscope tip. A new method was developed for guiding suture cutters. Efficacy of Nd: YAG laser cutting of threads was studied. Experimental and clinical experience with thread-cutting methods is presented. A 2.4 mm diameter flexible thread-cutting guillotine was constructed featuring two lateral holes with sharp edges through which sutures to be cut are passed. Standard suture cutters were guided by backloading thread through the cutters extracorporeally. A snare cutter was constructed to retrieve objects sewn to tissue. Efficacy and speed of Nd: YAG laser in cutting twelve different threads were studied. The guillotine cut thread faster (p < 0.05) than standard suture cutters. Backloading thread shortened time taken to cut thread (p < 0.001) compared with free-hand cutting. Nd: YAG laser was ineffective in cutting uncolored threads and slower than mechanical cutters. Results of thread cutting in clinical studies using sewing machine (n = 77 cutting episodes in 21 patients), in-vivo experiments (n = 156), and postsurgical cases (n = 15 over 15 years) are presented. New thread-cutting methods are described and their efficacy demonstrated in experimental and clinical studies.

Slime production by clinical isolates of Blastoschizomyces capitatus from patients with hematological malignancies and catheter-related fungemia.

PubMed

D'Antonio, D; Parruti, G; Pontieri, E; Di Bonaventura, G; Manzoli, L; Sferra, R; Vetuschi, A; Piccolomini, R; Romano, F; Staniscia, T

2004-10-01

In order to expand the present knowledge of the pathogenic potential of Blastoschizomyces capitatus in central venous catheter (CVC)-related bloodstream infections, six strains of the organism recovered from three leukemic patients with CVC-related fungemia in different years were investigated. Isolates and control strains were tested for their genetic relatedness and for their ability to produce slime in glucose-containing solutions. DNA restriction enzyme analysis revealed that all strains of B. capitatus were identical, whereas slime production assays and examination of ex vivo material showed that they were able to produce large amounts of slime. Slime production may therefore play a relevant pathogenic role in cases of CVC-related fungemia caused by B. capitatus.

Chemotaxis in the Plasmodial Slime Mold, Physarum polycephalum.

ERIC Educational Resources Information Center

Bozzone, Donna M.; Martin, Denise A.

1998-01-01

Describes a biology unit designed so that students pose their own questions and perform experiments to answer these questions. Plasmodial slime mold is employed as the focus of the study with background information about the mold provided. (DDR)

Killing effect of peppermint vapor against pink-slime forming microorganisms.

PubMed

Ihara, Nozomi; Sakamoto, Jin; Yoshida, Munehiro; Tsuchido, Tetsuaki

2015-01-01

The killing effect of peppermint vapor (PMV) against pink-slime forming microorganisms, Methylobacterium mesophilicum as a bacterium and Rhodotorula mucilaginosa as a yeast, was investigated by the agar vapor assay. In this method, microbial cells were spread over the agar surface exposed to PMV in a petri dish, and then transferred into a recovery liquid. When 60μl of the peppermint liquid was added to a paper disc, a marked killing effect of PMV was observed after 48h against M. mesophilicum and after 168h against R. mucilaginosa. M. mesophilicum and R. mucilaginosa were found to be more resistant to PMV than Escherichia coli and Candida albicans, used as reference microorganisms, respectively. With the addition of 0.03% sodium pyruvate as a hydrogen peroxide scavenger in agar, the killing effect of PMV against E. coli and C. albicans was decreased, whereas it was little changed against M. mesophilicum and R. mucilaginosa. In fact, the properties of the killing effect of hydrogen peroxide solution at 0.2-1.0mM was in accord with those of PMV. M. mesophilicum and R. mucilaginosa were more resistant to the oxidant than E. coli and C. albicans, respectively. Results obtained suggested that reactive oxygen species (ROS) may be involved in the killing action of PMV and therefore pink-slime formers are more resistant to PMV than non-pink-slime formers because of the presence of carotenoids as an antioxidant in cells. We also suggest that the use of PMV appeared to be a potential tool for the control of pink-slime forming microorganisms occurring in wet areas of houses such as the bathroom and washing room.

Slime mold uses an externalized spatial "memory" to navigate in complex environments.

PubMed

Reid, Chris R; Latty, Tanya; Dussutour, Audrey; Beekman, Madeleine

2012-10-23

Spatial memory enhances an organism's navigational ability. Memory typically resides within the brain, but what if an organism has no brain? We show that the brainless slime mold Physarum polycephalum constructs a form of spatial memory by avoiding areas it has previously explored. This mechanism allows the slime mold to solve the U-shaped trap problem--a classic test of autonomous navigational ability commonly used in robotics--requiring the slime mold to reach a chemoattractive goal behind a U-shaped barrier. Drawn into the trap, the organism must rely on other methods than gradient-following to escape and reach the goal. Our data show that spatial memory enhances the organism's ability to navigate in complex environments. We provide a unique demonstration of a spatial memory system in a nonneuronal organism, supporting the theory that an externalized spatial memory may be the functional precursor to the internal memory of higher organisms.

[Influence of slime production and adhesion of Candida sp. on biofilm formation].

PubMed

Ciok-Pater, Emilia; Smolak, Przemysław; Wróblewska, Joanna; Gospodarek, Eugenia

2011-01-01

The increase of fungal infections in recent years is connected with the progress in medicine. The vast usage of biomaterials is an inseparable element of contemporary medicine but it also leads to development of infections. Yeast-like fungi Candida albicans are still the main pathogen of candidiasis. The ability to slime production and adhesion to polystyrene of Candida sp. on different surfaces can cause to form biofilm on surfaces of biomaterials used in production of catheters, drains and prosthesis. The aim of the study was to evaluate the influence of slime production and adhesion to polystyrene, of Candida sp. on biofilm formation on different biomaterials. 50 strains of Candida sp. were examined. They isolated from ill to Clinics of Anesthesiology and Intensive Therapy University Hospital No 1 of dr. A. Jurasza in Bydgoszcz. The ability to slime production was evaluated by Christensen method in modification Davenport and Branchini methods. The adhesion to polystyrene was evaluated by Richards et el method. The ability to produce biofilm biomaterials by the studied fungi was measured after 72 hours of incubation at 37 degrees C on different biomaterials. Yeast-like fungi Candida sp. fabricating slime and adhesion forming frequently biofilm on surface researched of biomaterials. Influence of chosen biological specificity ascertain on the ability to produce biofilm on surfaces of siliconized latex and polyvinylchloride.

Recovering selenium from copper refinery slimes

NASA Astrophysics Data System (ADS)

Hyvärinen, Olli; Lindroos, Leo; Yllö, Erkki

1989-07-01

The selenium contained within copper refinery slimes may be recovered advantageously by roasting at about 600°C. While roasting in air is inefficient, roasting in a sulfating atmosphere enables practically complete selenium recovery. Based on laboratory tests, a new selenium recovery process was adopted at Outokumpu Copper Refinery. In this process, sulfation is achieved by feeding sulfur dioxide and oxygen into the roasting furnace.

Cytochemical study of the nucleolus of the slime mold Dictyostelium discoideum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Benichou, J.C.; Quiviger, B.; Ryter, A.

1983-07-01

The nucleus of the slime mold Dictyostelium discoideum is characterized by the presence of several large dense masses which are all in tight contact with the nuclear membrane. These dense masses, considered as nucleoli, present a rather homogeneous texture, in which dense chromatin, fibrillar, and granular material are not easily detected. The autoradiographic study of (/sup 3/H)uridine pulse-labeled cells showed that the majority of the silver grains were located inside these masses. The use of EDTA regressive-staining, acetylation and enzymatic digestion indicated that they are mostly composed of RNP and are totally devoid of dense chromatin as the rest ofmore » the nucleus is. After treatment with actinomycin D, fibrillar and granular material segregated but no chromatin could be found. All these observations confirmed that the dense masses correspond to nucleoli despite their peculiar ultrastructure. It can also be concluded that this type of nucleoli cannot be considered as a taxonomic character of the slime molds because it does not exist in all slime molds and was observed in some dinoflagellates, and ascomycetes.« less

Thread bonds in molecules

NASA Astrophysics Data System (ADS)

Ivlev, B.

2017-07-01

Unusual chemical bonds are proposed. Each bond is characterized by the thread of a small radius, 10-11 cm, extended between two nuclei in a molecule. An analogue of a potential well, of the depth of MeV scale, is formed within the thread. This occurs due to the local reduction of zero point electromagnetic energy. This is similar to formation of the Casimir well. The electron-photon interaction only is not sufficient for formation of thread state. The mechanism of electron mass generation is involved in the close vicinity, 10-16 cm, of the thread. Thread bonds are stable and cannot be created or destructed in chemical or optical processes.

Novel chlorinated dibenzofurans isolated from the cellular slime mold, Polysphondylium filamentosum, and their biological activities.

PubMed

Kikuchi, Haruhisa; Kubohara, Yuzuru; Nguyen, Van Hai; Katou, Yasuhiro; Oshima, Yoshiteru

2013-08-01

Cellular slime molds are expected to have the huge potential for producing secondary metabolites including polyketides, and we have studied the diversity of secondary metabolites of cellular slime molds for their potential utilization as new biological resources for natural product chemistry. From the methanol extract of fruiting bodies of Polysphondylium filamentosum, we obtained new chlorinated benzofurans Pf-1 (4) and Pf-2 (5) which display multiple biological activities; these include stalk cell differentiation-inducing activity in the well-studied cellular slime mold, Dictyostelium discoideum, and inhibitory activities on cell proliferation in mammalian cells and gene expression in Drosophila melanogaster. Copyright © 2013 Elsevier Ltd. All rights reserved.

The cellular slime mold: eukaryotic model microorganism.

PubMed

Urushihara, Hideko

2009-04-01

Cellular slime molds are eukaryotic microorganisms in the soil. They feed on bacteria as solitary amoebae but conditionally construct multicellular forms in which cell differentiation takes place. Therefore, they are attractive for the study of fundamental biological phenomena such as phagocytosis, cell division, chemotactic movements, intercellular communication, cell differentiation, and morphogenesis. The most widely used species, Dictyostelium discoideum, is highly amenable to experimental manipulation and can be used with most recent molecular biological techniques. Its genome and cDNA analyses have been completed and well-annotated data are publicly available. A larger number of orthologues of human disease-related genes were found in D. discoideum than in yeast. Moreover, some pathogenic bacteria infect Dictyostelium amoebae. Thus, this microorganism can also offer a good experimental system for biomedical research. The resources of cellular slime molds, standard strains, mutants, and genes are maintained and distributed upon request by the core center of the National BioResource Project (NBRP-nenkin) to support Dictyostelium community users as well as new users interested in new platforms for research and/or phylogenic consideration.

Modified locking thread form for fastener

NASA Technical Reports Server (NTRS)

Roopnarine, (Inventor); Vranish, John D. (Inventor)

1998-01-01

A threaded fastener has a standard part with a standard thread form characterized by thread walls with a standard included angle, and a modified part complementary to the standard part having a modified thread form characterized by thread walls which are symmetrically inclined with a modified included angle that is different from the standard included angle of the standard part's thread walls, such that the threads of one part make pre-loaded edge contact with the thread walls of the other part. The thread form of the modified part can have an included angle that is greater, less, or compound as compared to the included angle of the standard part. The standard part may be a bolt and the modified part a nut, or vice versa. The modified thread form holds securely even under large vibrational forces, it permits bi-directional use of standard mating threads, is impervious to the build up of tolerances and can be manufactured with a wider range of tolerances without loss of functionality, and distributes loading stresses (per thread) in a manner that decreases the possibility of single thread failure.

Threaded average temperature thermocouple

NASA Technical Reports Server (NTRS)

Ward, Stanley W. (Inventor)

1990-01-01

A threaded average temperature thermocouple 11 is provided to measure the average temperature of a test situs of a test material 30. A ceramic insulator rod 15 with two parallel holes 17 and 18 through the length thereof is securely fitted in a cylinder 16, which is bored along the longitudinal axis of symmetry of threaded bolt 12. Threaded bolt 12 is composed of material having thermal properties similar to those of test material 30. Leads of a thermocouple wire 20 leading from a remotely situated temperature sensing device 35 are each fed through one of the holes 17 or 18, secured at head end 13 of ceramic insulator rod 15, and exit at tip end 14. Each lead of thermocouple wire 20 is bent into and secured in an opposite radial groove 25 in tip end 14 of threaded bolt 12. Resulting threaded average temperature thermocouple 11 is ready to be inserted into cylindrical receptacle 32. The tip end 14 of the threaded average temperature thermocouple 11 is in intimate contact with receptacle 32. A jam nut 36 secures the threaded average temperature thermocouple 11 to test material 30.

Demonstration of the Coagulation and Diffusion of Homemade Slime Prepared under Acidic Conditions without Borate

ERIC Educational Resources Information Center

Isokawa, Naho; Fueda, Kazuki; Miyagawa, Korin; Kanno, Kenichi

2015-01-01

Poly(vinyl alcohol) (PVA) precipitates in many kinds of aqueous salt solutions. While sodium sulfate, a coagulant for PVA fiber, precipitates PVA to yield a white rigid gel, coagulation of PVA with aluminum sulfate, a coagulant for water treatment, yields a slime-like viscoelastic fluid. One type of homemade slime is prepared under basic…

Tool Removes Coil-Spring Thread Inserts

NASA Technical Reports Server (NTRS)

Collins, Gerald J., Jr.; Swenson, Gary J.; Mcclellan, J. Scott

1991-01-01

Tool removes coil-spring thread inserts from threaded holes. Threads into hole, pries insert loose, grips insert, then pulls insert to thread it out of hole. Effects essentially reverse of insertion process to ease removal and avoid further damage to threaded inner surface of hole.

Evolution of myelin sheaths: both lamprey and hagfish lack myelin.

PubMed

Bullock, T H; Moore, J K; Fields, R D

1984-07-27

Modern views of agnathan phylogeny consider Petromyzoniformes and Myxiniformes to belong to distinct classes that diverged from a common ancestor at a remote period, perhaps in the lower Cambrian, greater than 600 million years ago. Both are more primitive than elasmobranchs, holocephalans and bony fishes. Myelin is well developed in elasmobranchs and other fishes but was reported to be lacking in the spinal cord of lampreys. In order to search further for possible early myelin in some part of the nervous system of one of the agnathan stems, or for further evidence that it first appeared in chondrichthians, we extended the sampling to many parts of the brain and cord of hagfish. Transmission electron microscopy was used as a nearly ideal criterion. We find no trace or forerunner of the spiral, multilaminate glial wrapping. Many axons are embedded within one or more glial cells, like unmyelinated fibers in other vertebrates, or lie contiguously in bundles without an obviously complete glial investment. True myelin must be presumed to have been invented within the vertebrates, in ancestors of the living cartilaginous fishes after the agnathans branched from the vertebrate stem.

Cribellate thread production in spiders: Complex processing of nano-fibres into a functional capture thread.

PubMed

Joel, Anna-Christin; Kappel, Peter; Adamova, Hana; Baumgartner, Werner; Scholz, Ingo

2015-11-01

Spider silk production has been studied intensively in the last years. However, capture threads of cribellate spiders employ an until now often unnoticed alternative of thread production. This thread in general is highly interesting, as it not only involves a controlled arrangement of three types of threads with one being nano-scale fibres (cribellate fibres), but also a special comb-like structure on the metatarsus of the fourth leg (calamistrum) for its production. We found the cribellate fibres organized as a mat, enclosing two parallel larger fibres (axial fibres) and forming the typical puffy structure of cribellate threads. Mat and axial fibres are punctiform connected to each other between two puffs, presumably by the action of the median spinnerets. However, this connection alone does not lead to the typical puffy shape of a cribellate thread. Removing the calamistrum, we found a functional capture thread still being produced, but the puffy shape of the thread was lost. Therefore, the calamistrum is not necessary for the extraction or combination of fibres, but for further processing of the nano-scale cribellate fibres. Using data from Uloborus plumipes we were able to develop a model of the cribellate thread production, probably universally valid for cribellate spiders. Copyright © 2015 Elsevier Ltd. All rights reserved.

Slime mold uses an externalized spatial “memory” to navigate in complex environments

PubMed Central

Reid, Chris R.; Latty, Tanya; Dussutour, Audrey; Beekman, Madeleine

2012-01-01

Spatial memory enhances an organism’s navigational ability. Memory typically resides within the brain, but what if an organism has no brain? We show that the brainless slime mold Physarum polycephalum constructs a form of spatial memory by avoiding areas it has previously explored. This mechanism allows the slime mold to solve the U-shaped trap problem—a classic test of autonomous navigational ability commonly used in robotics—requiring the slime mold to reach a chemoattractive goal behind a U-shaped barrier. Drawn into the trap, the organism must rely on other methods than gradient-following to escape and reach the goal. Our data show that spatial memory enhances the organism’s ability to navigate in complex environments. We provide a unique demonstration of a spatial memory system in a nonneuronal organism, supporting the theory that an externalized spatial memory may be the functional precursor to the internal memory of higher organisms. PMID:23045640

Morphological analysis of the hagfish heart. I. The ventricle, the arterial connection and the ventral aorta.

PubMed

Icardo, José M; Colvee, Elvira; Schorno, Sarah; Lauriano, Eugenia R; Fudge, Douglas S; Glover, Chris N; Zaccone, Giacomo

2016-03-01

We have studied the heart in three species of hagfish: Myxine glutinosa, Eptatretus stoutii, and Eptatretus cirrhatus and report about the morphology of the ventricle, the arterial connection and the ventral aorta. On the whole, the hagfish heart lacks outflow tract components, the ventricle and atrium adopt a dorso-caudal rather than a ventro-dorsal relationship, and the sinus venosus opens into the left side of the atrium. This may indicate a "defective" cardiac looping during embryogenesis. The ventral aorta is elongated in M. glutinosa and E. stoutii but sac-like in E. cirrhatus. The ventricles are entirely trabeculated. The myocytes show a low myofibrillar content and junctional complexes formed by fascia adherens and desmosomes. Gap junctions could not be demonstrated. Myocardial cells in M. glutinosa contain numerous lipid droplets. These droplets are less numerous in E. stoutii and practically absent in E. cirrhatus, suggesting different metabolic requirements. Other cell types present in the ventricle are chromaffin cells and granular leukocytes that contain rod-shaped granules. The ventricle-aorta connection is guarded by a bicuspid valve with left and right, pocket-like leaflets. The leaflets extend from the cranial end of the ventricle into the aorta but the junction is asymmetrical. This junction contains a ganglion-like structure in E. cirrhatus. The ventral aorta shows endothelial, media, and adventitial layers. The media contains smooth muscle cells surrounded by dense bands formed by tightly-packed extracellular filaments. In addition, a short number of elastic fibers are observed in M. glutinosa and E. stoutii. Cellular and extracellular elements are more loosely organized in the aorta of E. cirrhatus. The collagenous adventitia contains ganglion-like cells in the three species. In the absence of nerves, chromaffin and ganglion-like cells may control the activity of the myocardium and that of the aortic smooth muscle cells, respectively. © 2015

Mobile Thread Task Manager

NASA Technical Reports Server (NTRS)

Clement, Bradley J.; Estlin, Tara A.; Bornstein, Benjamin J.

2013-01-01

The Mobile Thread Task Manager (MTTM) is being applied to parallelizing existing flight software to understand the benefits and to develop new techniques and architectural concepts for adapting software to multicore architectures. It allocates and load-balances tasks for a group of threads that migrate across processors to improve cache performance. In order to balance-load across threads, the MTTM augments a basic map-reduce strategy to draw jobs from a global queue. In a multicore processor, memory may be "homed" to the cache of a specific processor and must be accessed from that processor. The MTTB architecture wraps access to data with thread management to move threads to the home processor for that data so that the computation follows the data in an attempt to avoid L2 cache misses. Cache homing is also handled by a memory manager that translates identifiers to processor IDs where the data will be homed (according to rules defined by the user). The user can also specify the number of threads and processors separately, which is important for tuning performance for different patterns of computation and memory access. MTTM efficiently processes tasks in parallel on a multiprocessor computer. It also provides an interface to make it easier to adapt existing software to a multiprocessor environment.

Interaction of gliding motion of bacteria with rheological properties of the slime.

PubMed

Asghar, Z; Ali, N; Sajid, M

2017-08-01

Bacteria which do not have organelles of motility, such as flagella, adopt gliding as a mode of locomotion. In gliding motility bacterium moves under its own power by secreting a layer of slime on the substrate. The exact mechanism by which a glider achieves motility is yet in controversy but there are evidences which support the wave-like undulation on the surface of the organism, as a possible mechanism of motility. Based on this observation, a model of undulating sheet over a layer of slime is examined as a possible model of the gliding motion of a bacterium. Three different non-Newtonian constitutive equations namely, finite extendable nonlinear elastic-peterline (FENE-P), Simplified Phan-Thien-Tanner (SPTT) and Rabinowitsch equations are used to capture the rheological properties of the slime. It is found that the governing equation describing the fluid mechanics of the model under lubrication approximation is same for all the considered three constitutive equations. In fact, it involves a single non-Newtonian parameter which assumes different values for each of the considered constitutive relations. This differential equation is solved using both perturbation and semi-analytic procedure. The perturbation solution is exploited to get an estimate of the speed of the glider for different values of the non-Newtonian parameter. The solution obtained via semi-analytic procedure is used to investigate the important features of the flow field in the layer of the slime beneath the glider when the glider is held fixed. The expression of forces generated by the organism and power required for propulsion are also derived based on the perturbation analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

Multi-element sewer slime impact pattern--a quantitative characteristic enabling identification of the source of heavy metal discharges into sewer systems.

PubMed

Kintrup, J; Wünsch, G

2001-11-01

The capability of sewer slime to accumulate heavy metals from municipal wastewater can be exploited to identify the sources of sewage sludge pollution. Former investigations of sewer slime looked for a few elements only and could, therefore, not account for deviations of the enrichment efficiency of the slime or for irregularities from sampling. Results of ICP-MS multi element determinations were analyzed by multivariate statistical methods. A new dimensionless characteristic "sewer slime impact" is proposed, which is zero for unloaded samples. Patterns expressed in this data format specifically extract the information required to identify the type of pollution and polluter quicker and with less effort and cost than hitherto.

Measurement of Sound Speed in Thread

NASA Astrophysics Data System (ADS)

Saito, Shigemi; Shibata, Yasuhiro; Ichiki, Akira; Miyazaki, Akiho

2006-05-01

By employing thin wires, human hairs and threads, the measurement of sound speed in a thread whose diameter is smaller than 0.2 mm has been attempted. Preparing two cylindrical ceramic transducers with a 300 kHz resonance frequency, a perforated glass bead to be knotted by a sample thread is bonded to the center of the end surface of each transducer. After connecting these transducers with a sample thread, a receiving transducer is attached at a ceiling so as to hang another transmitting transducer with the thread. A glass bead is bonded to another end surface of the transmitting transducer so that tension, varied with a hanged plumb, can be applied to the sample thread. The time delay of the received signal relative to the transmitting pulse is measured while gradually shortening the thread. Sound speed is determined by the proportionality of time delay with thread length. Although the measured values for metallic wires are somewhat different from the values derived from the density and Young’s modulus cited in references, they are reproducible. The sound speed for human hairs of over twenty samples, which varies between 2000 and 2500 m/s, seems to depend on hair quality. Sound speed in a cotton thread is found to approach a constant value under large tension. An advanced measurement system available for uncut threads is also presented, where semi cylindrical transducers pinch the thread.

FR/HR Sewing Thread

DTIC Science & Technology

2015-09-01

position unless so designated by other authorized documents. Citation of trade names in this report does not constitute an official endorsement or...project to design and develop a Fire Resistant (FR) and Heat Resistant (HR) sewing thread. The main goal of the project is to produce sewing threads made...addresses the design , development and testing of various Fire Resistant (FR)/Heat Resistant (HR) sewing threads for US Army applications. Such a sewing

Constant time worker thread allocation via configuration caching

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eichenberger, Alexandre E; O'Brien, John K. P.

Mechanisms are provided for allocating threads for execution of a parallel region of code. A request for allocation of worker threads to execute the parallel region of code is received from a master thread. Cached thread allocation information identifying prior thread allocations that have been performed for the master thread are accessed. Worker threads are allocated to the master thread based on the cached thread allocation information. The parallel region of code is executed using the allocated worker threads.

Stable isotope composition (δ(13)C and δ(15)N values) of slime molds: placing bacterivorous soil protozoans in the food web context.

PubMed

Tiunov, Alexei V; Semenina, Eugenia E; Aleksandrova, Alina V; Tsurikov, Sergey M; Anichkin, Alexander E; Novozhilov, Yuri K

2015-08-30

Data on the bulk stable isotope composition of soil bacteria and bacterivorous soil animals are required to estimate the nutrient and energy fluxes via bacterial channels within detrital food webs. We measured the isotopic composition of slime molds (Myxogastria, Amoebozoa), a group of soil protozoans forming macroscopic spore-bearing fruiting bodies. An analysis of largely bacterivorous slime molds can provide information on the bulk stable isotope composition of soil bacteria. Fruiting bodies of slime molds were collected in a monsoon tropical forest of Cat Tien National Park, Vietnam, and analyzed by continuous-flow isotope ratio mass spectrometry. Prior to stable isotope analysis, carbonates were removed from a subset of samples by acidification. To estimate the trophic position of slime molds, their δ(13) C and δ(15) N values were compared with those of plant debris, soil, microbial destructors (litter-decomposing, humus-decomposing, and ectomycorrhizal fungi) and members of higher trophic levels (oribatid mites, termites, predatory macroinvertebrates). Eight species of slime molds represented by at least three independent samples were 3-6‰ enriched in (13) C and (15) N relative to plant litter. A small but significant difference in the δ(13) C and δ(15) N values suggests that different species of myxomycetes can differ in feeding behavior. The slime molds were enriched in (15) N compared with litter-decomposing fungi, and depleted in (15) N compared with mycorrhizal or humus-decomposing fungi. Slime mold sporocarps and plasmodia largely overlapped with oribatid mites in the isotopic bi-plot, but were depleted in (15) N compared with predatory invertebrates and humiphagous termites. A comparison with reference groups of soil organisms suggests strong trophic links of slime molds to saprotrophic microorganisms which decompose plant litter, but not to humus-decomposing microorganisms or to mycorrhizal fungi. Under the assumption that slime molds are

Laboratory evaluation of different formulations of Stress Coat® for slime production in goldfish (Carassius auratus) and koi (Cyprinus carpio).

PubMed

Shivappa, Raghunath B; Christian, Larry S; Law, Jerry M; Lewbart, Gregory A

2017-01-01

A study was carried out to assess the effect of Stress Coat ® on slime production in goldfish ( Carassius auratus) and koi ( Cyprinus carpio ). The study also investigated histological changes that might be associated with slime producing cells, and wound healing in koi. Several formulations of Stress Coat ® were investigated and the results showed that polyvinylpyrrolidone (PVP), also known as povidone, an ingredient of Stress Coat ® , when used alone, showed significantly higher slime production in goldfish than salt and Stress Coat ® without PVP after 25 h. The results also showed that koi treated with compounds containing PVP showed better wound healing than those not exposed to PVP. Histology results showed no difference between compounds tested with regards to density and number of slime producing cells.

Two years' outcome of thread lifting with absorbable barbed PDO threads: Innovative score for objective and subjective assessment.

PubMed

Ali, Yasser Helmy

2018-02-01

Thread-lifting rejuvenation procedures have evolved again, with the development of absorbable threads. Although they have gained popularity among plastic surgeons and dermatologists, very few articles have been written in literature about absorbable threads. This study aims to evaluate two years' outcome of thread lifting using absorbable barbed threads for facial rejuvenation. Prospective comparative stud both objectively and subjectively and follow-up assessment for 24 months. Thread lifting for face rejuvenation has significant long-lasting effects that include skin lifting from 3-10 mm and high degree of patients' satisfaction with less incidence rate of complications, about 4.8%. Augmented results are obtained when thread lifting is combined with other lifting and rejuvenation modalities. Significant facial rejuvenation is achieved by thread lifting and highly augmented results are observed when they are combined with Botox, fillers, and/or platelet rich plasma (PRP) rejuvenations.

Adaptations for scavenging by three diverse bathyla species, Eptatretus stouti, Neptunea amianta and Orchomene obtusus

NASA Astrophysics Data System (ADS)

Tamburri, Mario N.; Barry, James P.

1999-12-01

Many deep-sea animals derive part of their nutrition from rare and unpredictable food falls. However, traits that allow organisms inhabiting the sea floor to exploit carrion are poorly understood. We found in laboratory experiments that hagfish ( Eptatretus stouti), gastropods ( Neptunea amianta) and amphipods ( Orchomene obtusus) survived extended periods of starvation, in some cases for more than a year. When exposed to odors emitted from carrion, most individuals of E. stouti and O. obtusus began searching for food within seconds, whereas none responded to the scent of the live prey. In contrast, the slow crawling N. amianta readily consumed carrion but showed no apparent response to any odor solutions tested. Because more motile animals exhibited lower thresholds for response to signal molecules, sensitivity to chemical cues appears related to species mobility. Hagfish were also found to defend carrion from some competitors by releasing slime when feeding. Though varying dramatically in size, morphology, locomotive ability, and phylogeny, these three species all possess traits well suited for a scavenging lifestyle.

Regulation of aggregate size and pattern by adenosine and caffeine in cellular slime molds

PubMed Central

2012-01-01

Background Multicellularity in cellular slime molds is achieved by aggregation of several hundreds to thousands of cells. In the model slime mold Dictyostelium discoideum, adenosine is known to increase the aggregate size and its antagonist caffeine reduces the aggregate size. However, it is not clear if the actions of adenosine and caffeine are evolutionarily conserved among other slime molds known to use structurally unrelated chemoattractants. We have examined how the known factors affecting aggregate size are modulated by adenosine and caffeine. Result Adenosine and caffeine induced the formation of large and small aggregates respectively, in evolutionarily distinct slime molds known to use diverse chemoattractants for their aggregation. Due to its genetic tractability, we chose D. discoideum to further investigate the factors affecting aggregate size. The changes in aggregate size are caused by the effect of the compounds on several parameters such as cell number and size, cell-cell adhesion, cAMP signal relay and cell counting mechanisms. While some of the effects of these two compounds are opposite to each other, interestingly, both compounds increase the intracellular glucose level and strengthen cell-cell adhesion. These compounds also inhibit the synthesis of cAMP phosphodiesterase (PdsA), weakening the relay of extracellular cAMP signal. Adenosine as well as caffeine rescue mutants impaired in stream formation (pde4- and pdiA-) and colony size (smlA- and ctnA-) and restore their parental aggregate size. Conclusion Adenosine increased the cell division timings thereby making large number of cells available for aggregation and also it marginally increased the cell size contributing to large aggregate size. Reduced cell division rates and decreased cell size in the presence of caffeine makes the aggregates smaller than controls. Both the compounds altered the speed of the chemotactic amoebae causing a variation in aggregate size. Our data strongly suggests

Regulation of aggregate size and pattern by adenosine and caffeine in cellular slime molds.

PubMed

Jaiswal, Pundrik; Soldati, Thierry; Thewes, Sascha; Baskar, Ramamurthy

2012-01-23

Multicellularity in cellular slime molds is achieved by aggregation of several hundreds to thousands of cells. In the model slime mold Dictyostelium discoideum, adenosine is known to increase the aggregate size and its antagonist caffeine reduces the aggregate size. However, it is not clear if the actions of adenosine and caffeine are evolutionarily conserved among other slime molds known to use structurally unrelated chemoattractants. We have examined how the known factors affecting aggregate size are modulated by adenosine and caffeine. Adenosine and caffeine induced the formation of large and small aggregates respectively, in evolutionarily distinct slime molds known to use diverse chemoattractants for their aggregation. Due to its genetic tractability, we chose D. discoideum to further investigate the factors affecting aggregate size. The changes in aggregate size are caused by the effect of the compounds on several parameters such as cell number and size, cell-cell adhesion, cAMP signal relay and cell counting mechanisms. While some of the effects of these two compounds are opposite to each other, interestingly, both compounds increase the intracellular glucose level and strengthen cell-cell adhesion. These compounds also inhibit the synthesis of cAMP phosphodiesterase (PdsA), weakening the relay of extracellular cAMP signal. Adenosine as well as caffeine rescue mutants impaired in stream formation (pde4- and pdiA-) and colony size (smlA- and ctnA-) and restore their parental aggregate size. Adenosine increased the cell division timings thereby making large number of cells available for aggregation and also it marginally increased the cell size contributing to large aggregate size. Reduced cell division rates and decreased cell size in the presence of caffeine makes the aggregates smaller than controls. Both the compounds altered the speed of the chemotactic amoebae causing a variation in aggregate size. Our data strongly suggests that cytosolic glucose and

Lack of ubiquitin immunoreactivities at both ends of neuropil threads. Possible bidirectional growth of neuropil threads.

PubMed

Iwatsubo, T; Hasegawa, M; Esaki, Y; Ihara, Y

1992-02-01

Immunocytochemically, neuropil threads (curly fibers) were investigated in the Alzheimer's disease brain using a confocal laser scanning fluorescence microscope by double labeling with tau/ubiquitin antibodies. Ubiquitin immunoreactivities were found to be lacking at one or both ends in more than 40% of tau-positive threads. Immunoelectron microscopy showed that bundles of paired helical filaments, which constitute neuropil threads, were positive for ubiquitin around their midportions, but often negative at their ends. Since it is reasonable to postulate that tau deposition as paired helical filaments precedes ubiquitination, the aforementioned observation suggests that the ends of the threads are newly formed portions, and thus the threads are often growing bidirectionally in small neuronal processes.

Method for molding threads in graphite panels

DOEpatents

Short, W.W.; Spencer, C.

1994-11-29

A graphite panel with a hole having a damaged thread is repaired by drilling the hole to remove all of the thread and making a new hole of larger diameter. A bolt with a lubricated thread is placed in the new hole and the hole is packed with graphite cement to fill the hole and the thread on the bolt. The graphite cement is cured, and the bolt is unscrewed therefrom to leave a thread in the cement which is at least as strong as that of the original thread. 8 figures.

Real-time inextensible surgical thread simulation.

PubMed

Xu, Lang; Liu, Qian

2018-03-27

This paper discusses a real-time simulation method of inextensible surgical thread based on the Cosserat rod theory using position-based dynamics (PBD). The method realizes stable twining and knotting of surgical thread while including inextensibility, bending, twisting and coupling effects. The Cosserat rod theory is used to model the nonlinear elastic behavior of surgical thread. The surgical thread model is solved with PBD to achieve a real-time, extremely stable simulation. Due to the one-dimensional linear structure of surgical thread, the direct solution of the distance constraint based on tridiagonal matrix algorithm is used to enhance stretching resistance in every constraint projection iteration. In addition, continuous collision detection and collision response guarantee a large time step and high performance. Furthermore, friction is integrated into the constraint projection process to stabilize the twining of multiple threads and complex contact situations. Through comparisons with existing methods, the surgical thread maintains constant length under large deformation after applying the direct distance constraint in our method. The twining and knotting of multiple threads correspond to stable solutions to contact and friction forces. A surgical suture scene is also modeled to demonstrate the practicality and simplicity of our method. Our method achieves stable and fast simulation of inextensible surgical thread. Benefiting from the unified particle framework, the rigid body, elastic rod, and soft body can be simultaneously simulated. The method is appropriate for applications in virtual surgery that require multiple dynamic bodies.

Material Implementation of Hyperincursive Field on Slime Mold Computer

NASA Astrophysics Data System (ADS)

Aono, Masashi; Gunji, Yukio-Pegio

2004-08-01

"Elementary Conflictable Cellular Automaton (ECCA)" was introduced by Aono and Gunji as a problematic computational syntax embracing the non-deterministic/non-algorithmic property due to its hyperincursivity and nonlocality. Although ECCA's hyperincursive evolution equation indicates the occurrence of the deadlock/infinite-loop, we do not consider that this problem declares the fundamental impossibility of implementing ECCA materially. Dubois proposed to call a computing system where uncertainty/contradiction occurs "the hyperincursive field". In this paper we introduce a material implementation of the hyperincursive field by using plasmodia of the true slime mold Physarum polycephalum. The amoeboid organism is adopted as a computing media of ECCA slime mold computer (ECCA-SMC) mainly because; it is a parallel non-distributed system whose locally branched tips (components) can act in parallel with asynchronism and nonlocal correlation. A notable characteristic of ECCA-SMC is that a cell representing a spatio-temporal segment of computation is occupied (overlapped) redundantly by multiple spatially adjacent computing operations and by temporally successive computing events. The overlapped time representation may contribute to the progression of discussions on unconventional notions of the time.

Growth and reproduction of laboratory-reared neanurid Collembola using a novel slime mould diet

PubMed Central

Hoskins, Jessica L.; Janion-Scheepers, Charlene; Chown, Steven L.; Duffy, Grant A.

2015-01-01

Although significant progress has been made using insect taxa as model organisms, non-tracheated terrestrial arthropods, such as Collembola, are underrepresented as model species. This underrepresentation reflects the difficulty in maintaining populations of specialist Collembola species in the laboratory. Until now, no species from the family Neanuridae have been successfully reared. Here we use controlled growth experiments to provide explicit evidence that the species Neanura muscorum can be raised under laboratory conditions when its diet is supplemented with slime mould. Significant gains in growth were observed in Collembola given slime mould rather than a standard diet of algae-covered bark. These benefits are further highlighted by the reproductive success of the experimental group and persistence of laboratory breeding stocks of this species and others in the family. The necessity for slime mould in the diet is attributed to the ‘suctorial’ mouthpart morphology characteristic of the Neanuridae. Maintaining laboratory populations of neanurid Collembola species will facilitate their use as model organisms, paving the way for studies that will broaden the current understanding of the environmental physiology of arthropods. PMID:26153104

Lack of ubiquitin immunoreactivities at both ends of neuropil threads. Possible bidirectional growth of neuropil threads.

PubMed Central

Iwatsubo, T.; Hasegawa, M.; Esaki, Y.; Ihara, Y.

1992-01-01

Immunocytochemically, neuropil threads (curly fibers) were investigated in the Alzheimer's disease brain using a confocal laser scanning fluorescence microscope by double labeling with tau/ubiquitin antibodies. Ubiquitin immunoreactivities were found to be lacking at one or both ends in more than 40% of tau-positive threads. Immunoelectron microscopy showed that bundles of paired helical filaments, which constitute neuropil threads, were positive for ubiquitin around their midportions, but often negative at their ends. Since it is reasonable to postulate that tau deposition as paired helical filaments precedes ubiquitination, the aforementioned observation suggests that the ends of the threads are newly formed portions, and thus the threads are often growing bidirectionally in small neuronal processes. Images Figure 1 Figure 2 PMID:1310831

Thread-Mounted Thermocouple

NASA Technical Reports Server (NTRS)

Ward, Stanley W.

1988-01-01

Thread-mounted thermocouple developed to accurately measure temperature of surrounding material. Comprised of threaded rod or bolt drilled along length, dual-hole ceramic insulator rod, thermocouple wire, optional ceramic filler, and epoxy resin. In contact with and takes average temperature of, surrounding material. Fabricated easily in size and metal to suit particular application. Because of simplicity and ability to measure average temperature, widespread use of design foreseen in varity of applications.

Genetic algorithms for protein threading.

PubMed

Yadgari, J; Amir, A; Unger, R

1998-01-01

Despite many years of efforts, a direct prediction of protein structure from sequence is still not possible. As a result, in the last few years researchers have started to address the "inverse folding problem": Identifying and aligning a sequence to the fold with which it is most compatible, a process known as "threading". In two meetings in which protein folding predictions were objectively evaluated, it became clear that threading as a concept promises a real breakthrough, but that much improvement is still needed in the technique itself. Threading is a NP-hard problem, and thus no general polynomial solution can be expected. Still a practical approach with demonstrated ability to find optimal solutions in many cases, and acceptable solutions in other cases, is needed. We applied the technique of Genetic Algorithms in order to significantly improve the ability of threading algorithms to find the optimal alignment of a sequence to a structure, i.e. the alignment with the minimum free energy. A major progress reported here is the design of a representation of the threading alignment as a string of fixed length. With this representation validation of alignments and genetic operators are effectively implemented. Appropriate data structure and parameters have been selected. It is shown that Genetic Algorithm threading is effective and is able to find the optimal alignment in a few test cases. Furthermore, the described algorithm is shown to perform well even without pre-definition of core elements. Existing threading methods are dependent on such constraints to make their calculations feasible. But the concept of core elements is inherently arbitrary and should be avoided if possible. While a rigorous proof is hard to submit yet an, we present indications that indeed Genetic Algorithm threading is capable of finding consistently good solutions of full alignments in search spaces of size up to 10(70).

Method for molding threads in graphite panels

DOEpatents

Short, William W.; Spencer, Cecil

1994-01-01

A graphite panel (10) with a hole (11) having a damaged thread (12) is repaired by drilling the hole (11) to remove all of the thread and make a new hole (13) of larger diameter. A bolt (14) with a lubricated thread (17) is placed in the new hole (13) and the hole (13) is packed with graphite cement (16) to fill the hole and the thread on the bolt. The graphite cement (16) is cured, and the bolt is unscrewed therefrom to leave a thread (20) in the cement (16) which is at least as strong as that of the original thread (12).

A software bus for thread objects

NASA Technical Reports Server (NTRS)

Callahan, John R.; Li, Dehuai

1995-01-01

The authors have implemented a software bus for lightweight threads in an object-oriented programming environment that allows for rapid reconfiguration and reuse of thread objects in discrete-event simulation experiments. While previous research in object-oriented, parallel programming environments has focused on direct communication between threads, our lightweight software bus, called the MiniBus, provides a means to isolate threads from their contexts of execution by restricting communications between threads to message-passing via their local ports only. The software bus maintains a topology of connections between these ports. It routes, queues, and delivers messages according to this topology. This approach allows for rapid reconfiguration and reuse of thread objects in other systems without making changes to the specifications or source code. A layered approach that provides the needed transparency to developers is presented. Examples of using the MiniBus are given, and the value of bus architectures in building and conducting simulations of discrete-event systems is discussed.

The effect of thread pattern upon implant osseointegration.

PubMed

Abuhussein, Heba; Pagni, Giorgio; Rebaudi, Alberto; Wang, Hom-Lay

2010-02-01

Implant design features such as macro- and micro-design may influence overall implant success. Limited information is currently available. Therefore, it is the purpose of this paper to examine these factors such as thread pitch, thread geometry, helix angle, thread depth and width as well as implant crestal module may affect implant stability. A literature search was conducted using MEDLINE to identify studies, from simulated laboratory models, animal, to human, related to this topic using the keywords of implant thread, implant macrodesign, thread pitch, thread geometry, helix angle, thread depth, thread width and implant crestal module. The results showed how thread geometry affects the distribution of stress forces around the implant. A decreased thread pitch may positively influence implant stability. Excess helix angles in spite of a faster insertion may jeopardize the ability of implants to sustain axial load. Deeper threads seem to have an important effect on the stabilization in poorer bone quality situations. The addition of threads or microthreads up to the crestal module of an implant might provide a potential positive contribution on bone-to to-implant contact as well as on the preservation of marginal bone; nonetheless this remains to be determined. Appraising the current literature on this subject and combining existing data to verify the presence of any association between the selected characteristics may be critical in the achievement of overall implant success.

Experimental Studies of the Effects of Anode Composition and Process Parameters on Anode Slime Adhesion and Cathode Copper Purity by Performing Copper Electrorefining in a Pilot-Scale Cell

NASA Astrophysics Data System (ADS)

Zeng, Weizhi; Wang, Shijie; Free, Michael L.

2016-10-01

Copper electrorefining tests were conducted in a pilot-scale cell under commercial tankhouse environment to study the effects of anode compositions, current density, cathode blank width, and flow rate on anode slime behavior and cathode copper purity. Three different types of anodes (high, mid, and low impurity levels) were used in the tests and were analyzed under SEM/EDS. The harvested copper cathodes were weighed and analyzed for impurities concentrations using DC Arc. The adhered slimes and released slimes were collected, weighed, and analyzed for compositions using ICP. It was shown that the lead-to-arsenic ratio in the anodes affects the sintering and coalescence of slime particles. High current density condition can improve anode slime adhesion and cathode purity by intensifying slime particles' coalescence and dissolving part of the particles. Wide cathode blanks can raise the anodic current densities significantly and result in massive release of large slime particle aggregates, which are not likely to contaminate the cathode copper. Low flow rate can cause anode passivation and increase local temperatures in front of the anode, which leads to very intense sintering and coalescence of slime particles. The results and analyses of the tests present potential solutions for industrial copper electrorefining process.

A multi-threaded version of MCFM

DOE Office of Scientific and Technical Information (OSTI.GOV)

Campbell, John M.; Ellis, R. Keith; Giele, Walter T.

We report on our findings modifying MCFM using OpenMP to implement multi-threading. By using OpenMP, the modified MCFM will execute on any processor, automatically adjusting to the number of available threads. We then modified the integration routine VEGAS to distribute the event evaluation over the threads, while combining all events at the end of every iteration to optimize the numerical integration. Furthermore, we took special care so that the results of the Monte Carlo integration were independent of the number of threads used, to facilitate the validation of the OpenMP version of MCFM.

A Moiré Pattern-Based Thread Counter

ERIC Educational Resources Information Center

Reich, Gary

2017-01-01

Thread count is a term used in the textile industry as a measure of how closely woven a fabric is. It is usually defined as the sum of the number of warp threads per inch (or cm) and the number of weft threads per inch. (It is sometimes confusingly described as the number of threads per square inch.) In recent years it has also become a subject of…

A Moiré Pattern-Based Thread Counter

NASA Astrophysics Data System (ADS)

Reich, Gary

2017-10-01

Thread count is a term used in the textile industry as a measure of how closely woven a fabric is. It is usually defined as the sum of the number of warp threads per inch (or cm) and the number of weft threads per inch. (It is sometimes confusingly described as the number of threads per square inch.) In recent years it has also become a subject of considerable interest and some controversy among consumers. Many consumers consider thread count to be a key measure of the quality or fineness of a fabric, especially bed sheets, and they seek out fabrics that advertise high counts. Manufacturers in turn have responded to this interest by offering fabrics with ever higher claimed thread counts (sold at ever higher prices), sometime achieving the higher counts by distorting the definition of the term with some "creative math." In 2005 the Federal Trade Commission noted the growing use of thread count in advertising at the retail level and warned of the potential for consumers to be misled by distortions of the definition.

Thread Migration in the Presence of Pointers

NASA Technical Reports Server (NTRS)

Cronk, David; Haines, Matthew; Mehrotra, Piyush

1996-01-01

Dynamic migration of lightweight threads supports both data locality and load balancing. However, migrating threads that contain pointers referencing data in both the stack and heap remains an open problem. In this paper we describe a technique by which threads with pointers referencing both stack and non-shared heap data can be migrated such that the pointers remain valid after migration. As a result, threads containing pointers can now be migrated between processors in a homogeneous distributed memory environment.

On Designing Lightweight Threads for Substrate Software

NASA Technical Reports Server (NTRS)

Haines, Matthew

1997-01-01

Existing user-level thread packages employ a 'black box' design approach, where the implementation of the threads is hidden from the user. While this approach is often sufficient for application-level programmers, it hides critical design decisions that system-level programmers must be able to change in order to provide efficient service for high-level systems. By applying the principles of Open Implementation Analysis and Design, we construct a new user-level threads package that supports common thread abstractions and a well-defined meta-interface for altering the behavior of these abstractions. As a result, system-level programmers will have the advantages of using high-level thread abstractions without having to sacrifice performance, flexibility or portability.

Habituation in non-neural organisms: evidence from slime moulds.

PubMed

Boisseau, Romain P; Vogel, David; Dussutour, Audrey

2016-04-27

Learning, defined as a change in behaviour evoked by experience, has hitherto been investigated almost exclusively in multicellular neural organisms. Evidence for learning in non-neural multicellular organisms is scant, and only a few unequivocal reports of learning have been described in single-celled organisms. Here we demonstrate habituation, an unmistakable form of learning, in the non-neural organism Physarum polycephalum In our experiment, using chemotaxis as the behavioural output and quinine or caffeine as the stimulus, we showed that P. polycephalum learnt to ignore quinine or caffeine when the stimuli were repeated, but responded again when the stimulus was withheld for a certain time. Our results meet the principle criteria that have been used to demonstrate habituation: responsiveness decline and spontaneous recovery. To distinguish habituation from sensory adaptation or motor fatigue, we also show stimulus specificity. Our results point to the diversity of organisms lacking neurons, which likely display a hitherto unrecognized capacity for learning, and suggest that slime moulds may be an ideal model system in which to investigate fundamental mechanisms underlying learning processes. Besides, documenting learning in non-neural organisms such as slime moulds is centrally important to a comprehensive, phylogenetic understanding of when and where in the tree of life the earliest manifestations of learning evolved. © 2016 The Author(s).

Habituation in non-neural organisms: evidence from slime moulds

PubMed Central

Boisseau, Romain P.; Vogel, David; Dussutour, Audrey

2016-01-01

Learning, defined as a change in behaviour evoked by experience, has hitherto been investigated almost exclusively in multicellular neural organisms. Evidence for learning in non-neural multicellular organisms is scant, and only a few unequivocal reports of learning have been described in single-celled organisms. Here we demonstrate habituation, an unmistakable form of learning, in the non-neural organism Physarum polycephalum. In our experiment, using chemotaxis as the behavioural output and quinine or caffeine as the stimulus, we showed that P. polycephalum learnt to ignore quinine or caffeine when the stimuli were repeated, but responded again when the stimulus was withheld for a certain time. Our results meet the principle criteria that have been used to demonstrate habituation: responsiveness decline and spontaneous recovery. To distinguish habituation from sensory adaptation or motor fatigue, we also show stimulus specificity. Our results point to the diversity of organisms lacking neurons, which likely display a hitherto unrecognized capacity for learning, and suggest that slime moulds may be an ideal model system in which to investigate fundamental mechanisms underlying learning processes. Besides, documenting learning in non-neural organisms such as slime moulds is centrally important to a comprehensive, phylogenetic understanding of when and where in the tree of life the earliest manifestations of learning evolved. PMID:27122563

Ropes: Support for collective opertions among distributed threads

NASA Technical Reports Server (NTRS)

Haines, Matthew; Mehrotra, Piyush; Cronk, David

1995-01-01

Lightweight threads are becoming increasingly useful in supporting parallelism and asynchronous control structures in applications and language implementations. Recently, systems have been designed and implemented to support interprocessor communication between lightweight threads so that threads can be exploited in a distributed memory system. Their use, in this setting, has been largely restricted to supporting latency hiding techniques and functional parallelism within a single application. However, to execute data parallel codes independent of other threads in the system, collective operations and relative indexing among threads are required. This paper describes the design of ropes: a scoping mechanism for collective operations and relative indexing among threads. We present the design of ropes in the context of the Chant system, and provide performance results evaluating our initial design decisions.

Smart behavior of true slime mold in a labyrinth.

PubMed

Nakagaki, T

2001-11-01

Even for humans it is not easy to solve a maze. But the plasmodium of true slime mold, an amoeba-like unicellular organism, has shown an amazing ability to do so. This implies that an algorithm and a high computing capacity are included in the unicellular organism. In this report, we discuss information processing in the microorganism to focus on the issue as to whether the maze-solving behavior is akin to primitive intelligence.

Pink slimed: Media framing of novel food technologies and risk related to ground beef and processed foods in the U.S.

PubMed

Runge, Kristin K; Chung, Jennifer H; Su, Leona Yi-Fan; Brossard, Dominique; Scheufele, Dietram A

2018-09-01

In March 2012 ABC World News Report aired a series of reports on lean finely textured beef (LFTB) that resulted in a 10-year low for beef prices and the bankruptcy of a major firm that produced LFTB. Using a random sample survey, we tested the effects of the media frame "pink slime" and industry frame "lean finely textured beef," alongside media use, food-related knowledge, trust in food-related institutions and preference for local, fresh, organic and GMO-free foods on perceptions of risk related to ground beef containing pink slime/LFTB, processed foods and red meat. The "pink slime" frame was strongly and positively associated with risk related to ground beef, but not risk related to red meat or processed foods. Attention to news stories about pink slime/LFTB was strongly associated with risk related to ground beef and processed foods, but not red meat. We found varying effects of food values, knowledge and trust on all three dependent variables. Implications are discussed. Copyright © 2018 Elsevier Ltd. All rights reserved.

Synthesis of Messenger RNA and Chromosome Structure in the Cellular Slime Mold*

PubMed Central

Lodish, Harvey F.; Jacobson, Allan; Firtel, Richard; Alton, Tom; Tuchman, Jessica

1974-01-01

This paper summarizes our knowledge of the structure and biosynthesis of messenger RNA in the slime mold Dictyostelium discoideum, the arrangement of DNA sequences in the Dictyostelium chromosome, and the changes in the pattern of predominant polypeptides synthesized during Dictyostelium development. Images PMID:4531041

AN MHD AVALANCHE IN A MULTI-THREADED CORONAL LOOP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hood, A. W.; Cargill, P. J.; Tam, K. V.

For the first time, we demonstrate how an MHD avalanche might occur in a multithreaded coronal loop. Considering 23 non-potential magnetic threads within a loop, we use 3D MHD simulations to show that only one thread needs to be unstable in order to start an avalanche even when the others are below marginal stability. This has significant implications for coronal heating in that it provides for energy dissipation with a trigger mechanism. The instability of the unstable thread follows the evolution determined in many earlier investigations. However, once one stable thread is disrupted, it coalesces with a neighboring thread andmore » this process disrupts other nearby threads. Coalescence with these disrupted threads then occurs leading to the disruption of yet more threads as the avalanche develops. Magnetic energy is released in discrete bursts as the surrounding stable threads are disrupted. The volume integrated heating, as a function of time, shows short spikes suggesting that the temporal form of the heating is more like that of nanoflares than of constant heating.« less

40 CFR 721.10636 - Slimes and sludges, automotive coating, wastewater treatment, solid waste.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., wastewater treatment, solid waste. 721.10636 Section 721.10636 Protection of Environment ENVIRONMENTAL..., wastewater treatment, solid waste. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as slimes and sludges, automotive coating, wastewater treatment...

40 CFR 721.10636 - Slimes and sludges, automotive coating, wastewater treatment, solid waste.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., wastewater treatment, solid waste. 721.10636 Section 721.10636 Protection of Environment ENVIRONMENTAL..., wastewater treatment, solid waste. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as slimes and sludges, automotive coating, wastewater treatment...

Bending and buckling of viscoplastic threads

NASA Astrophysics Data System (ADS)

Hewitt, Ian; Balmforth, Neil

2012-11-01

We use a slender body theory to describe the dynamics of a thin viscoplastic thread undergoing extrusion, such as occurs when squeezing toothpaste from a tube. The theory adopts the Bingham model for a yield stress fluid, together with an asymptotic approximation for the stress and strain-rate profiles across the narrow width of the thread, which imply that the thread must either be rigid or fully yielded across its entire width. A compact description of the resultant longitudinal stress and moment acting on the thread allows these yielded and unyielded regions to be identified for given external forces. The theory is applied to extrusion flows; the yield stress prevents any deformation until a critical length of extrusion is reached, after which the dynamically evolving yielded regions mediate a distinctive drooping of a horizontal beam, or a catastrophic collapse of an upright beam.

SWAYING THREADS OF A SOLAR FILAMENT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Y.; Engvold, O.; Langangen, Oe.

From recent high-resolution observations obtained with the Swedish 1 m Solar Telescope in La Palma, we detect swaying motions of individual filament threads in the plane of the sky. The oscillatory characters of these motions are comparable with oscillatory Doppler signals obtained from corresponding filament threads. Simultaneous recordings of motions in the line of sight and in the plane of the sky give information about the orientation of the oscillatory plane. These oscillations are interpreted in the context of the magnetohydrodynamic (MHD) theory. Kink MHD waves supported by the thread body are proposed as an explanation of the observed threadmore » oscillations. On the basis of this interpretation and by means of seismological arguments, we give an estimation of the thread Alfven speed and magnetic field strength by means of seismological arguments.« less

Wet-surface–enhanced ellipsometric contrast microscopy identifies slime as a major adhesion factor during bacterial surface motility

PubMed Central

Ducret, Adrien; Valignat, Marie-Pierre; Mouhamar, Fabrice; Mignot, Tâm; Theodoly, Olivier

2012-01-01

In biology, the extracellular matrix (ECM) promotes both cell adhesion and specific recognition, which is essential for central developmental processes in both eukaryotes and prokaryotes. However, live studies of the dynamic interactions between cells and the ECM, for example during motility, have been greatly impaired by imaging limitations: mostly the ability to observe the ECM at high resolution in absence of specific staining by live microscopy. To solve this problem, we developed a unique technique, wet-surface enhanced ellipsometry contrast (Wet-SEEC), which magnifies the contrast of transparent organic materials deposited on a substrate (called Wet-surf) with exquisite sensitivity. We show that Wet-SEEC allows both the observation of unprocessed nanofilms as low as 0.2 nm thick and their accurate 3D topographic reconstructions, directly by standard light microscopy. We next used Wet-SEEC to image slime secretion, a poorly defined property of many prokaryotic and eukaryotic organisms that move across solid surfaces in absence of obvious extracellular appendages (gliding). Using combined Wet-SEEC and fluorescent-staining experiments, we observed slime deposition by gliding Myxococcus xanthus cells at unprecedented resolution. Altogether, the results revealed that in this bacterium, slime associates preferentially with the outermost components of the motility machinery and promotes its adhesion to the substrate on the ventral side of the cell. Strikingly, analogous roles have been proposed for the extracellular proteoglycans of gliding diatoms and apicomplexa, suggesting that slime deposition is a general means for gliding organisms to adhere and move over surfaces. PMID:22665761

Red Thread Found on Bermuda Grass

Treesearch

T. H. Filer

1966-01-01

Red thread fungus (Corticium fuciforme (Berk.) Wakef.) was observed in 1965 and 1966 on Bermuda grass (Cynodon dactylon) on lawns in Leland, Mississippi. Red thread is a serious disease on fescues but has not previously been reported on Bermuda grass.

Vibrios from Fish Pen Slime Which Mimic Escherichia coli on Violet Red Bile Agar

PubMed Central

Rosen, A.; Levin, R. E.

1970-01-01

Organisms from fish pen slime which mimicked coliforms and Escherichia coli on Violet Red Bile Agar were identified as members of the genus Vibrio on the basis of metabolic and morphological characteristics. Images PMID:4195607

THE THERMAL INSTABILITY OF SOLAR PROMINENCE THREADS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soler, R.; Goossens, M.; Ballester, J. L., E-mail: roberto.soler@wis.kuleuven.be

The fine structure of solar prominences and filaments appears as thin and long threads in high-resolution images. In H{alpha} observations of filaments, some threads can be observed for only 5-20 minutes before they seem to fade and eventually disappear, suggesting that these threads may have very short lifetimes. The presence of an instability might be the cause of this quick disappearance. Here, we study the thermal instability of prominence threads as an explanation of their sudden disappearance from H{alpha} observations. We model a prominence thread as a magnetic tube with prominence conditions embedded in a coronal environment. We assume amore » variation of the physical properties in the transverse direction so that the temperature and density continuously change from internal to external values in an inhomogeneous transitional layer representing the particular prominence-corona transition region (PCTR) of the thread. We use the nonadiabatic and resistive magnetohydrodynamic equations, which include terms due to thermal conduction parallel and perpendicular to the magnetic field, radiative losses, heating, and magnetic diffusion. We combine both analytical and numerical methods to study linear perturbations from the equilibrium state, focusing on unstable thermal solutions. We find that thermal modes are unstable in the PCTR for temperatures higher than 80,000 K, approximately. These modes are related to temperature disturbances that can lead to changes in the equilibrium due to rapid plasma heating or cooling. For typical prominence parameters, the instability timescale is of the order of a few minutes and is independent of the form of the temperature profile within the PCTR of the thread. This result indicates that thermal instability may play an important role for the short lifetimes of threads in the observations.« less

Silicon carbide sewing thread

NASA Technical Reports Server (NTRS)

Sawko, Paul M. (Inventor)

1995-01-01

Composite flexible multilayer insulation systems (MLI) were evaluated for thermal performance and compared with currently used fibrous silica (baseline) insulation system. The systems described are multilayer insulations consisting of alternating layers of metal foil and scrim ceramic cloth or vacuum metallized polymeric films quilted together using ceramic thread. A silicon carbide thread for use in the quilting and the method of making it are also described. These systems provide lightweight thermal insulation for a variety of uses, particularly on the surface of aerospace vehicles subject to very high temperatures during flight.

On the utility of threads for data parallel programming

NASA Technical Reports Server (NTRS)

Fahringer, Thomas; Haines, Matthew; Mehrotra, Piyush

1995-01-01

Threads provide a useful programming model for asynchronous behavior because of their ability to encapsulate units of work that can then be scheduled for execution at runtime, based on the dynamic state of a system. Recently, the threaded model has been applied to the domain of data parallel scientific codes, and initial reports indicate that the threaded model can produce performance gains over non-threaded approaches, primarily through the use of overlapping useful computation with communication latency. However, overlapping computation with communication is possible without the benefit of threads if the communication system supports asynchronous primitives, and this comparison has not been made in previous papers. This paper provides a critical look at the utility of lightweight threads as applied to data parallel scientific programming.

Threaded Cognition: An Integrated Theory of Concurrent Multitasking

ERIC Educational Resources Information Center

Salvucci, Dario D.; Taatgen, Niels A.

2008-01-01

The authors propose the idea of threaded cognition, an integrated theory of concurrent multitasking--that is, performing 2 or more tasks at once. Threaded cognition posits that streams of thought can be represented as threads of processing coordinated by a serial procedural resource and executed across other available resources (e.g., perceptual…

Multi-threading: A new dimension to massively parallel scientific computation

NASA Astrophysics Data System (ADS)

Nielsen, Ida M. B.; Janssen, Curtis L.

2000-06-01

Multi-threading is becoming widely available for Unix-like operating systems, and the application of multi-threading opens new ways for performing parallel computations with greater efficiency. We here briefly discuss the principles of multi-threading and illustrate the application of multi-threading for a massively parallel direct four-index transformation of electron repulsion integrals. Finally, other potential applications of multi-threading in scientific computing are outlined.

Screw-Thread Inserts As Temporary Flow Restrictors

NASA Technical Reports Server (NTRS)

Trimarchi, Paul

1992-01-01

Coil-spring screw-thread inserts found useful as temporary flow restrictors. Inserts placed in holes through which flow restricted, effectively reducing cross sections available for flow. Friction alone holds inserts against moderate upstream pressures. Use of coil-spring thread inserts as flow restrictors conceived as inexpensive solution to problem of adjusting flow of oxygen through orifices in faceplate into hydrogen/oxygen combustion chamber. Installation and removal of threaded inserts gentle enough not to deform orifice tubes.

Gravity related behavior of the acellular slime mold Physarum polycephalum (7-IML-1)

NASA Technical Reports Server (NTRS)

Block, I.

1992-01-01

The objective of the experiment is to investigate the effect of near weightlessness on a single cell. The test object is the acellular slime mold Physarum polycephalum. This cell is composed of a network of protoplastic strands which perform rhythmic contractions in the minute range. These contractions of the strands' ectoplastic walls generate the force to drive the vigorous shuttle streaming of fluid protoplasm inside the strands (hydrostatic pressure flow). A net transport of protoplasm in one direction determines the direction of the cell's locomotion itself. In this way, gravity modifies the contraction rhythm of the strands, the streaming velocity of protoplasm in the strands, and the direction of locomotion of the whole slime mold (geotaxis). The other parts of this experiment will address the major question of how this cell, which does not possess any specialized gravireceptors, gets the information about the direction of the gravity vector. Details of the experimental setup are given.

Maternal inheritance of mitochondria: multipolarity, multiallelism and hierarchical transmission of mitochondrial DNA in the true slime mold Physarum polycephalum.

PubMed

Moriyama, Yohsuke; Kawano, Shigeyuki

2010-03-01

Direct evidence of digestion of paternal mitochondrial DNA (mtDNA) has been found in the true slime mold Physarum polycephalum. This is the first report on the selective digestion of mtDNA inside the zygote, and is striking evidence for the mechanism of maternal inheritance of mitochondria. Moreover, two mitochondrial nuclease activities were detected in this organism as-candidates for the nucleases responsible for selective digestion of mtDNA. In the true slime mold, there is an additional-feature of the uniparental inheritance of mitochondria.Although mitochondria are believed to be inherited from the maternal lineage in nearly all eukaryotes, the mating types of the true slime mold P. polycephalum is not restricted to two: there are three mating loci--matA, matB,and matC--and these loci have 16, 15, and 3 alleles,-respectively. Interestingly, the transmission patterns of mtDNA are determined by the matA locus, in a hierarchical-fashion (matA hierarchy) as follows: matA7[matA2[matA11[matA12[matA15/matA16[matA1[matA6.The strain possessing the higher status of matA would be the mtDNA donor in crosses. Furthermore, we have found that some crosses showed biparental inheritance of mitochondria.This review describes the phenomenon of hierarchical transmission of mtDNA in true slime molds, and discusses the presumed molecular mechanism of maternal and biparental inheritance.

High precision optomechanical assembly using threads as mechanical reference

NASA Astrophysics Data System (ADS)

Lamontagne, Frédéric; Desnoyers, Nichola; Bergeron, Guy; Cantin, Mario

2016-09-01

A convenient method to assemble optomechanical components is to use threaded interface. For example, lenses are often secured inside barrels using threaded rings. In other cases, multiple optical sub-assemblies such as lens barrels can be threaded to each other. Threads have the advantage to provide a simple assembly method, to be easy to manufacture, and to offer a compact mechanical design. On the other hand, threads are not considered to provide accurate centering between parts because of the assembly clearance between the inner and outer threads. For that reason, threads are often used in conjunction with precision cylindrical surfaces to limit the radial clearance between the parts to be centered. Therefore, tight manufacturing tolerances are needed on these pilot diameters, which affect the cost of the optical assembly. This paper presents a new optomechanical approach that uses threads as mechanical reference. This innovative method relies on geometric principles to auto-center parts to each other with a very low centering error that is usually less than 5 μm. The method allows to auto-center an optical group in a main barrel, to perform an axial adjustment of an optical group inside a main barrel, and to perform stacking of multiple barrels. In conjunction with the lens auto-centering method that also used threads as a mechanical reference, this novel solution opens new possibilities to realize a variety of different high precision optomechanical assemblies at lower cost.

Long-term effect of the insoluble thread-lifting technique.

PubMed

Fukaya, Mototsugu

2017-01-01

Although the thread-lifting technique for sagging faces has become more common and popular, medical literature evaluating its effects is scarce. Studies on its long-term prognosis are particularly uncommon. One hundred individuals who had previously undergone insoluble thread-lifting were retrospectively investigated. Photos in frontal and oblique views from the first and last visits were evaluated by six female individuals by guessing the patients' ages. The mean guessed age was defined as the apparent age, and the difference between the real and apparent ages was defined as the youth value. The difference between the youth values before and after the thread-lift was defined as the rejuvenation effect and analyzed in relation to the time since the operation, the number of threads used and the number of thread-lift operations performed. The rejuvenation effect decreased over the first year after the operation, but showed an increasing trend thereafter. The rejuvenation effect increased with the number of threads used and the number of thread-lift operations performed. The insoluble thread-lifting technique appears to be associated with both early and late effects. The rejuvenation effect appeared to decrease during the first year, but increased thereafter. A multicenter trial is necessary to confirm these findings.

CNT coated thread micro-electro-mechanical system for finger proprioception sensing

NASA Astrophysics Data System (ADS)

Shafi, A. A.; Wicaksono, D. H. B.

2017-04-01

In this paper, we aim to fabricate cotton thread based sensor for proprioceptive application. Cotton threads are utilized as the structural component of flexible sensors. The thread is coated with multi-walled carbon nanotube (MWCNT) dispersion by using facile conventional dipping-drying method. The electrical characterization of the coated thread found that the resistance per meter of the coated thread decreased with increasing the number of dipping. The CNT coated thread sensor works based on piezoresistive theory in which the resistance of the coated thread changes when force is applied. This thread sensor is sewed on glove at the index finger between middle and proximal phalanx parts and the resistance change is measured upon grasping mechanism. The thread based microelectromechanical system (MEMS) enables the flexible sensor to easily fit perfectly on the finger joint and gives reliable response as proprioceptive sensing.

Slime production and proteinase activity of Candida species isolated from blood samples and the comparison of these activities with minimum inhibitory concentration values of antifungal agents.

PubMed

Ozkan, Semiha; Kaynak, Fatma; Kalkanci, Ayse; Abbasoglu, Ufuk; Kustimur, Semra

2005-05-01

Slime and proteinase activity of 54 strains consisting of 19 Candida parapsilosis and 35 C. albicans strains isolated from blood samples were investigated in this study. Ketoconazole, amphothericin B, and fluconazole susceptibility of Candida species were compared with slime production and proteinase activity of these species. For both Candida species, no correlation was detected between the slime activity and minimum inhibitory concentration (MIC) values of the three antifungal agents. For both Candida species no correlation was detected between the proteinase activity and the MIC values of amphothericin B, and fluconazole however, statistically significant difference, was determined between the proteinase activity and MIC values of ketoconazole (p = 0.007). Slime production was determined by using modified Christensen macrotube method and proteinase activity was measured by the method of Staib. Antifungal susceptibility was determined through the guidelines of National Committee for Laboratory Standards (NCCLS M27-A).

THREADED ADAPTOR FOR LUGGED PIPE ENDS

DOEpatents

Robb, J.E.

1962-06-01

An adaptor is designed for enabling a threaded part to be connected to a member at a region having lugs normally receiving bayonet slots of another part for attachment of the latter. It has been found desirable to replace a closure cap connected in a bayonet joint to the end of a coolant tube containing nuclear- reactor fuel elements, with a threaded valve. An adaptor is used which has J- slots receiving lugs on the end of the reactor tube, a thread for connection with the valve, and gear-tooth section enabling a gear-type of tool to rotate the adaptor to seal the valve to the end of the reactor tube. (AEC)

Screw-Thread Standards for Federal Services, 1957. Handbook H28 (1957), Part 3

DTIC Science & Technology

1957-09-01

MOUNTING THREADS PHOTOGRAPHIC EQUIPMENT THREADS ISO METRIC THREADS; MISCELLANEOUS THREADS CLASS 5 INTERFERENCE-FIT THREADS, TRIAL STANDARD WRENCH...Bibliography on measurement of pitch diameter by means of wires 60 Appendix 14. Metric screw-thread standards 61 1. ISO thread profiles...61 2. Standard series for ISO metric threads 62 3. Designations for ISO metric threads 62 Tables Page Table XII. 1.—Basic

Thread selection according to power characteristics during context switching on compute nodes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Archer, Charles J.; Blocksome, Michael A.; Randles, Amanda E.

Methods, apparatus, and products are disclosed for thread selection during context switching on a plurality of compute nodes that includes: executing, by a compute node, an application using a plurality of threads of execution, including executing one or more of the threads of execution; selecting, by the compute node from a plurality of available threads of execution for the application, a next thread of execution in dependence upon power characteristics for each of the available threads; determining, by the compute node, whether criteria for a thread context switch are satisfied; and performing, by the compute node, the thread context switchmore » if the criteria for a thread context switch are satisfied, including executing the next thread of execution.« less

The Organization of Movement in Slime Mold Plasmodia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stewart, Peter A.

1963-04-22

At first sight, the noncellular slime mold plasmodia appear to be ideal organisms in which to study protoplasmic movement. They are large, easily manipulated, and display high speed protoplasmic streaming. After some experience with them, however, one is likely to become discouraged by the complexity and lability of their movement patterns. While the streaming movements necessarily follow the laws of hydrodynamics, it has not so far been possible to explain them satisfactorily in terms of any simple mechanism. The characteristics of plasmodial streaming which lead to confusion and frustration are outlined below as a substitute for direct observations and cine-photographicmore » records.« less

Influence of pH and Metal Cations on Aggregative Growth of Non-Slime-forming Strains of Zoogloea ramigera

PubMed Central

Angelbeck, Donald I.; Kirsch, Edwin J.

1969-01-01

Aggregative growth of non-slime-forming strains of Zoogloea ramigera was induced by growing the organisms at a depressed pH. Calcium and magnesium ion was found to reverse aggregative growth of the organisms. Conversely, aggregation was stimulated when the available inorganic cation concentration of the growth medium was lowered by the use of a chelating agent. The aggregative effects of pH depression or cation depletion and the dispersal effects of cation supplementation were observed only during cellular growth. The data suggest that aggregate formation of non-slime-forming strains of Z. ramigera may be related to the calcium or magnesium metabolism of the organisms, or both. Images PMID:4976326

Performance of an adjustable, threaded inertance tube

NASA Astrophysics Data System (ADS)

Zhou, W. J.; Pfotenhauer, J. M.; Nellis, G. F.; Liu, S. Y.

2015-12-01

The performance of the Stirling type pulse tube cryocooler depends strongly on the design of the inertance tube. The phase angle produced by the inertance tube is very sensitive to its diameter and length. Recent developments are reported here regarding an adjustable inertance device that can be adjusted in real time. The inertance passage is formed by the root of a concentric cylindrical threaded device. The depth of the threads installed on the outer screw varies. In this device, the outer screw can be rotated four and half turns. At the zero turn position the length of the passage is 1.74 m and the hydraulic diameter is 7 mm. By rotating the outer screw, the inner threaded rod engages with additional, larger depth threads. Therefore, at its upper limit of rotation, the inertance passage includes both the original 1.74 m length with 7mm hydraulic diameter plus an additional 1.86 m length with a 10 mm hydraulic diameter. A phase shift change of 24° has been experimentally measured by changing the position of outer screw while operating the device at a frequency of 60 Hz. This phase angle shift is less than the theoretically predicted value due to the presence of a relatively large leak through the thread clearance. Therefore, the distributed component model of the inertance tube was modified to account for the leak path causing the data to agree with the model. Further, the application of vacuum grease to the threads causes the performance of the device to improve substantially.

Topical perspective on massive threading and parallelism.

PubMed

Farber, Robert M

2011-09-01

Unquestionably computer architectures have undergone a recent and noteworthy paradigm shift that now delivers multi- and many-core systems with tens to many thousands of concurrent hardware processing elements per workstation or supercomputer node. GPGPU (General Purpose Graphics Processor Unit) technology in particular has attracted significant attention as new software development capabilities, namely CUDA (Compute Unified Device Architecture) and OpenCL™, have made it possible for students as well as small and large research organizations to achieve excellent speedup for many applications over more conventional computing architectures. The current scientific literature reflects this shift with numerous examples of GPGPU applications that have achieved one, two, and in some special cases, three-orders of magnitude increased computational performance through the use of massive threading to exploit parallelism. Multi-core architectures are also evolving quickly to exploit both massive-threading and massive-parallelism such as the 1.3 million threads Blue Waters supercomputer. The challenge confronting scientists in planning future experimental and theoretical research efforts--be they individual efforts with one computer or collaborative efforts proposing to use the largest supercomputers in the world is how to capitalize on these new massively threaded computational architectures--especially as not all computational problems will scale to massive parallelism. In particular, the costs associated with restructuring software (and potentially redesigning algorithms) to exploit the parallelism of these multi- and many-threaded machines must be considered along with application scalability and lifespan. This perspective is an overview of the current state of threading and parallelize with some insight into the future. Published by Elsevier Inc.

Gold thread implantation promotes hair growth in human and mice

PubMed Central

Kim, Jong-Hwan; Cho, Eun-Young; Kwon, Euna; Kim, Woo-Ho; Park, Jin-Sung; Lee, Yong-Soon

2017-01-01

Thread-embedding therapy has been widely applied for cosmetic purposes such as wrinkle reduction and skin tightening. Particularly, gold thread was reported to support connective tissue regeneration, but, its role in hair biology remains largely unknown due to lack of investigation. When we implanted gold thread and Happy Lift™ in human patient for facial lifting, we unexpectedly found an increase of hair regrowth in spite of no use of hair growth medications. When embedded into the depilated dorsal skin of mice, gold thread or polyglycolic acid (PGA) thread, similarly to 5% minoxidil, significantly increased the number of hair follicles on day 14 after implantation. And, hair re-growth promotion in the gold threadimplanted mice were significantly higher than that in PGA thread group on day 11 after depilation. In particular, the skin tissue of gold thread-implanted mice showed stronger PCNA staining and higher collagen density compared with control mice. These results indicate that gold thread implantation can be an effective way to promote hair re-growth although further confirmatory study is needed for more information on therapeutic mechanisms and long-term safety. PMID:29399026

Carbon Nanotube Thread Electrochemical Cell: Detection of Heavy Metals.

PubMed

Zhao, Daoli; Siebold, David; Alvarez, Noe T; Shanov, Vesselin N; Heineman, William R

2017-09-19

In this work, all three electrodes in an electrochemical cell were fabricated based on carbon nanotube (CNT) thread. CNT thread partially insulated with a thin polystyrene coating to define the microelectrode area was used as the working electrode; bare CNT thread was used as the auxiliary electrode; and a micro quasi-reference electrode was fabricated by electroplating CNT thread with Ag and then anodizing it in chloride solution to form a layer of AgCl. The Ag|AgCl coated CNT thread electrode provided a stable potential comparable to the conventional liquid-junction type Ag|AgCl reference electrode. The CNT thread auxiliary electrode provided a stable current, which is comparable to a Pt wire auxiliary electrode. This all-CNT thread three electrode cell has been evaluated as a microsensor for the simultaneous determination of trace levels of heavy metal ions by anodic stripping voltammetry (ASV). Hg 2+ , Cu 2+ , and Pb 2+ were used as a representative system for this study. The calculated detection limits (based on the 3σ method) with a 120 s deposition time are 1.05, 0.53, and 0.57 nM for Hg 2+ , Cu 2+ , and Pb 2+ , respectively. These electrodes significantly reduce the dimensions of the conventional three electrode electrochemical cell to the microscale.

Threaded Discussion Instructional Strategies and Student Performance

ERIC Educational Resources Information Center

Krull, Rodger Pratt

2013-01-01

Educators need insight into what instructional strategies are effective in the online environment, but few researchers have contrasted threaded discussion strategies and measures of student performance using a quantitative approach. Also, the effectiveness of threaded discussion strategies across all student generation groups or between genders is…

46 CFR 164.023-7 - Performance; non-standard thread.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 46 Shipping 6 2010-10-01 2010-10-01 false Performance; non-standard thread. 164.023-7 Section 164... Performance; non-standard thread. (a) Use Codes 1, 2, 3, 4BC, 4RB, 5 (any). Each non-standard thread which...) testing machine. (2) Single strand breaking strength (after weathering). After exposure in a sunshine...

46 CFR 164.023-7 - Performance; non-standard thread.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 46 Shipping 6 2011-10-01 2011-10-01 false Performance; non-standard thread. 164.023-7 Section 164... Performance; non-standard thread. (a) Use Codes 1, 2, 3, 4BC, 4RB, 5 (any). Each non-standard thread which...) testing machine. (2) Single strand breaking strength (after weathering). After exposure in a sunshine...

Mass Culture of a Slime Mold, Physarum polycephalum1

PubMed Central

Brewer, E. N.; Kuraishi, S.; Garver, J. C.; Strong, F. M.

1964-01-01

The slime mold, Physarum polycephalum, was cultivated in a soluble natural medium in shake flasks and in 30-liter and 50-gal conventional baffled fermentors. Yields of 6 to 10 g (dry weight) per liter were obtained in the large-scale fermentations. Because of the slow growth of the myxomycete, particular attention had to be paid to aseptic technique. The inability of this organism to withstand the normal degree of agitation employed with most aerobic fermentations made it difficult to obtain adequate aeration. Conditions for growth of the organism on a pilot-plant scale are presented. PMID:14131366

Enteridinines A and B from slime mold Enteridium lycoperdon.

PubMed

Rezanka, Tomás; Dvoráková, Radmila; Hanus, Lumír O; Dembitsky, Valery M

2004-02-01

Two novel deoxysugar esters, named enteridinines A and B, were isolated from the slime mold Enteridium lycoperdon. Their structures, including the absolute configurations of the hydroxyl and methyl groups, were determined by means of extensive spectroscopic data such as UV, IR, MS, 1D and 2D NMR spectra. Enteridinines A and B have unique structures containing 1,7-dioxaspiro[5.5]undecanes with an O-beta-D-mycarosyl-(1-->4)-beta-D-olivosyl and an O-beta-L-olivomycosyl-(1-->4)-beta-D-amicetosyl-(1-->4)-beta-L-digitoxosyl unit, respectively, and showed growth inhibitory activities against Gram positive bacteria.

A C++ Thread Package for Concurrent and Parallel Programming

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jie Chen; William Watson

1999-11-01

Recently thread libraries have become a common entity on various operating systems such as Unix, Windows NT and VxWorks. Those thread libraries offer significant performance enhancement by allowing applications to use multiple threads running either concurrently or in parallel on multiprocessors. However, the incompatibilities between native libraries introduces challenges for those who wish to develop portable applications.

Self-cleaning threaded rod spinneret for high-efficiency needleless electrospinning

NASA Astrophysics Data System (ADS)

Zheng, Gaofeng; Jiang, Jiaxin; Wang, Xiang; Li, Wenwang; Zhong, Weizheng; Guo, Shumin

2018-07-01

High-efficiency production of nanofibers is the key to the application of electrospinning technology. This work focuses on multi-jet electrospinning, in which a threaded rod electrode is utilized as the needless spinneret to achieve high-efficiency production of nanofibers. A slipper block, which fits into and moves through the threaded rod, is designed to transfer polymer solution evenly to the surface of the rod spinneret. The relative motion between the slipper block and the threaded rod electrode promotes the instable fluctuation of the solution surface, thus the rotation of threaded rod electrode decreases the critical voltage for the initial multi-jet ejection and the diameter of nanofibers. The residual solution on the surface of threaded rod is cleaned up by the moving slipper block, showing a great self-cleaning ability, which ensures the stable multi-jet ejection and increases the productivity of nanofibers. Each thread of the threaded rod electrode serves as an independent spinneret, which enhances the electric field strength and constrains the position of the Taylor cone, resulting in high productivity of uniform nanofibers. The diameter of nanofibers decreases with the increase of threaded rod rotation speed, and the productivity increases with the solution flow rate. The rotation of electrode provides an excess force for the ejection of charged jets, which also contributes to the high-efficiency production of nanofibers. The maximum productivity of nanofibers from the threaded rod spinneret is 5-6 g/h, about 250-300 times as high as that from the single-needle spinneret. The self-cleaning threaded rod spinneret is an effective way to realize continuous multi-jet electrospinning, which promotes industrial applications of uniform nanofibrous membrane.

Thread selection according to predefined power characteristics during context switching on compute nodes

DOE Office of Scientific and Technical Information (OSTI.GOV)

None, None

Methods, apparatus, and products are disclosed for thread selection during context switching on a plurality of compute nodes that includes: executing, by a compute node, an application using a plurality of threads of execution, including executing one or more of the threads of execution; selecting, by the compute node from a plurality of available threads of execution for the application, a next thread of execution in dependence upon power characteristics for each of the available threads; determining, by the compute node, whether criteria for a thread context switch are satisfied; and performing, by the compute node, the thread context switchmore » if the criteria for a thread context switch are satisfied, including executing the next thread of execution.« less

An MPI-1 Compliant Thread-Based Implementation

NASA Astrophysics Data System (ADS)

Díaz Martín, J. C.; Rico Gallego, J. A.; Álvarez Llorente, J. M.; Perogil Duque, J. F.

This work presents AzequiaMPI, the first full compliant implementation of the MPI-1 standard where the MPI node is a thread. Performance comparisons with MPICH2-Nemesis show that thread-based implementations exploit adequately the multicore architectures under oversubscription, what could make MPI competitive with OpenMP-like solutions.

SEM and fractography analysis of screw thread loosening in dental implants.

PubMed

Scarano, A; Quaranta, M; Traini, T; Piattelli, M; Piattelli, A

2007-01-01

Biological and technical failures of implants have already been reported. Mechanical factors are certainly of importance in implant failures, even if their exact nature has not yet been established. The abutment screw fracture or loosening represents a rare, but quite unpleasant failure. The aim of the present research is an analysis and structural examination of screw thread or abutment loosening compared with screw threads or abutment without loosening. The loosening of screw threads was compared to screw thread without loosening of three different implant systems; Branemark (Nobel Biocare, Gothenburg, Sweden), T.B.R. implant systems (Benax, Ancona, Italy) and Restore (Lifecore Biomedical, Chaska, Minnesota, USA). In this study broken screws were excluded. A total of 16 screw thread loosenings were observed (Group I) (4 Branemark, 4 T.B.R and 5 Restore), 10 screw threads without loosening were removed (Group II), and 6 screw threads as received by the manufacturer (unused) (Group III) were used as control (2 Branemark, 2 T.B.R and 2 Restore). The loosened abutment screws were retrieved and analyzed under SEM. Many alterations and deformations were present in concavities and convexities of screw threads in group I. No macroscopic alterations or deformations were observed in groups II and III. A statistical difference of the presence of microcracks were observed between screw threads with an abutment loosening and screw threads without an abutment loosening.

Thread angle dependency on flame spread shape over kenaf/polyester combined fabric

NASA Astrophysics Data System (ADS)

Azahari Razali, Mohd; Sapit, Azwan; Nizam Mohammed, Akmal; Nor Anuar Mohamad, Md; Nordin, Normayati; Sadikin, Azmahani; Faisal Hushim, Mohd; Jaat, Norrizam; Khalid, Amir

2017-09-01

Understanding flame spread behavior is crucial to Fire Safety Engineering. It is noted that the natural fiber exhibits different flame spread behavior than the one of the synthetic fiber. This different may influences the flame spread behavior over combined fabric. There is a research has been done to examined the flame spread behavior over kenaf/polyester fabric. It is seen that the flame spread shape is dependent on the thread angle dependency. However, the explanation of this phenomenon is not described in detail in that research. In this study, explanation about this phenomenon is given in detail. Results show that the flame spread shape is dependent on the position of synthetic thread. For thread angle, θ = 0°, the polyester thread is breaking when the flame approach to the thread and the kenaf thread tends to move to the breaking direction. This behavior produces flame to be ‘V’ shape. However, for thread angle, θ = 90°, the polyester thread melts while the kenaf thread decomposed and burned. At this angle, the distance between kenaf threads remains constant as flame approaches.

Magnetic field effects on mitochondrion-activity-related optical properties in slime mold and bone forming cells.

PubMed

Mizukawa, Yuri; Iwasaka, Masakazu

2013-01-01

In the present study, a cellular level response of Cyto-aa3 oxidation was investigated in real time under both time-varying and strong static magnetic fields of 5 T. Two kinds of cells, a slime mold, Physarum polycephalum, and bone forming cells, MC-3T3-E1, were used for the experiments. The oxidation level of the Cyto-aa3 was calculated by optical absorptions at 690 nm, 780 nm and 830 nm. The sample, fiber-optics and an additional optical fiber for light stimulation were set in a solenoidal coil or the bore of a 5-T superconducting magnet. The solenoidal coil for time-varying magnetic fields produced sinusoidal magnetic fields of 6 mT. The slime mold showed a periodic change in Cyto-aa3 oxidation, and the oxidation-reduction cycle of Cyto-aa3 was apparently changed when visible-light irradiated the slime mold. Similarly to the case with light, time-varying magnetic stimulations changed the oxidation-reduction cycle during and after the stimulation for 10 minutes. The same phenomena were observed in the MC-3T3-E1 cell assembly, although their cycle rhythm was comparatively random. Finally, magnetic field exposure of up to 5 T exhibited a distinct suppression of Cyto-aa3 oscillation in the bone forming cells. Exposure up to 5 T was repeated five times, and the change in Cyto-aa3 oxidation reproducibly occurred.

High Efficiency Carbon Nanotube Thread Antennas

NASA Astrophysics Data System (ADS)

Bengio, Elie; Senic, Damir; Taylor, Lauren; Tsentalovich, Dmitri; Chen, Peiyu; Holloway, Christopher; Novotny, David; Babakhani, Aydin; Long, Christopher; Booth, James; Orloff, Nathan; Pasquali, Matteo

Although previous research has explored the underlying theory of high-frequency behavior of carbon nanotubes (CNTs) and CNT bundles for antennas, there is a gap in the literature for direct experimental measurements of radiation efficiency. Here we report a novel measurement technique to accurately characterize the radiation efficiency of quarter-wavelength monopole antennas made from CNT thread. At medical device (1 GHz) and Wi-Fi (2.4 GHz) frequencies, we measured the highest absolute values of radiation efficiency in the literature for CNT antennas, matching that of copper wire. We also report the first direct experimental observation that, contrary to metals, the radiation efficiency of the CNT thread improves significantly at higher frequencies. These results pave the way for practical applications of CNT thread antennas, particularly in the aerospace and wearable electronics industries where weight saving is a priority.

Thread concept for automatic task parallelization in image analysis

NASA Astrophysics Data System (ADS)

Lueckenhaus, Maximilian; Eckstein, Wolfgang

1998-09-01

Parallel processing of image analysis tasks is an essential method to speed up image processing and helps to exploit the full capacity of distributed systems. However, writing parallel code is a difficult and time-consuming process and often leads to an architecture-dependent program that has to be re-implemented when changing the hardware. Therefore it is highly desirable to do the parallelization automatically. For this we have developed a special kind of thread concept for image analysis tasks. Threads derivated from one subtask may share objects and run in the same context but may process different threads of execution and work on different data in parallel. In this paper we describe the basics of our thread concept and show how it can be used as basis of an automatic task parallelization to speed up image processing. We further illustrate the design and implementation of an agent-based system that uses image analysis threads for generating and processing parallel programs by taking into account the available hardware. The tests made with our system prototype show that the thread concept combined with the agent paradigm is suitable to speed up image processing by an automatic parallelization of image analysis tasks.

Do dual-thread orthodontic mini-implants improve bone/tissue mechanical retention?

PubMed

Lin, Yang-Sung; Chang, Yau-Zen; Yu, Jian-Hong; Lin, Chun-Li

2014-12-01

The aim of this study was to understand whether the pitch relationship between micro and macro thread designs with a parametrical relationship in a dual-thread mini-implant can improve primary stability. Three types of mini-implants consisting of single-thread (ST) (0.75 mm pitch in whole length), dual-thread A (DTA) with double-start 0.375 mm pitch, and dual-thread B (DTB) with single-start 0.2 mm pitch in upper 2-mm micro thread region for performing insertion and pull-out testing. Histomorphometric analysis was performed in these specimens in evaluating peri-implant bone defects using a non-contact vision measuring system. The maximum inserted torque (Tmax) in type DTA was found to be the smallest significantly, but corresponding values found no significant difference between ST and DTB. The largest pull-out strength (Fmax) in the DTA mini-implant was found significantly greater than that for the ST mini-implant regardless of implant insertion orientation. Mini-implant engaged the cortical bone well as observed in ST and DTA types. Dual-thread mini-implant with correct micro thread pitch (parametrical relationship with macro thread pitch) in the cortical bone region can improve primary stability and enhanced mechanical retention.

Cellular Motility--Experiments on Contractile and Motile Mechanisms in the Slime Mould, Physarum Polycephalum

ERIC Educational Resources Information Center

Holmes, R. P.; Stewart, P. R.

1977-01-01

Actin and myosin have now been demonstrated to be important constituents of many eukaryotic cells. Their role is primarily that of a contractile system underlying all aspects of cellular motility. Described here is a simple experimental system to demonstrate quantitatively aspects of motility and its regulation in a slime mold. (Author/MA)

Development of Thread-compatible Open Source Stack

NASA Astrophysics Data System (ADS)

Zimmermann, Lukas; Mars, Nidhal; Schappacher, Manuel; Sikora, Axel

2017-07-01

The Thread protocol is a recent development based on 6LoWPAN (IPv6 over IEEE 802.15.4), but with extensions regarding a more media independent approach, which - additionally - also promises true interoperability. To evaluate and analyse the operation of a Thread network a given open source 6LoWPAN stack for embedded devices (emb::6) has been extended in order to comply with the Thread specification. The implementation covers Mesh Link Establishment (MLE) and network layer functionality as well as 6LoWPAN mesh under routing mechanism based on MAC short addresses. The development has been verified on a virtualization platform and allows dynamical establishment of network topologies based on Thread’s partitioning algorithm.

The measure method of internal screw thread and the measure device design

NASA Astrophysics Data System (ADS)

Hu, Dachao; Chen, Jianguo

2008-12-01

In accordance with the principle of Three-Line, this paper analyzed the correlation of every main parameter of internal screw thread, and then designed a device to measure the main parameters of internal screw thread. Basis on the measured value and corresponding formula calculation, we can get the internal thread parameters, such as the pitch diameter, thread angle and screw-pitch of common screw thread, terraced screw thread, zigzag screw thread and some else. The practical application has proved that this operation of this device is convenience, and the measured dates have a high accuracy. Meanwhile, the application of this device's patent of invention is accepted by the Patent Office. (The filing number: 200710044081.5)

Supporting Graduate Student Writers with VoiceThread

ERIC Educational Resources Information Center

Gonzalez, Michelle; Moore, Noreen S.

2018-01-01

This qualitative case study examined the influence of the use of VoiceThread technology on the feedback process for thesis writing in two online asynchronous graduate courses. The influence on instructor feedback process and graduate student writers' perceptions of the use of VoiceThread were the foci of the study. Master's-level students (n = 18)…

Using the CMS threaded framework in a production environment

DOE PAGES

Jones, C. D.; Contreras, L.; Gartung, P.; ...

2015-12-23

During 2014, the CMS Offline and Computing Organization completed the necessary changes to use the CMS threaded framework in the full production environment. We will briefly discuss the design of the CMS Threaded Framework, in particular how the design affects scaling performance. We will then cover the effort involved in getting both the CMSSW application software and the workflow management system ready for using multiple threads for production. Finally, we will present metrics on the performance of the application and workflow system as well as the difficulties which were uncovered. As a result, we will end with CMS' plans formore » using the threaded framework to do production for LHC Run 2.« less

Neuropil threads occur in dendrites of tangle-bearing nerve cells.

PubMed

Braak, H; Braak, E

1988-01-01

Transparent Golgi preparations counterstained for Alzheimer's neurofibrillary changes rendered possible the demonstration of neuropil threads in defined cellular processes. Only dendrites of tangle-bearing cortical nerve cells were found to contain neuropil threads. Processes of glial cells as well as axons present in the material were devoid of neuropil threads.

A Primer on the Effective Use of Threaded Discussion Forums.

ERIC Educational Resources Information Center

Kirk, James J.; Orr, Robert L.

Threaded discussion forums are asynchronous, World Wide Web-based discussions occurring under a number of different topics called threads. By allowing students to post, read, and respond to messages independently of time or place, threaded discussion forums give students an opportunity for deeper reflection and more thoughtful replies than chat…

Method for Estimating Thread Strength Reduction of Damaged Parent Holes with Inserts

NASA Technical Reports Server (NTRS)

Johnson, David L.; Stratton, Troy C.

2005-01-01

During normal assembly and disassembly of bolted-joint components, thread damage and/or deformation may occur. If threads are overloaded, thread damage/deformation can also be anticipated. Typical inspection techniques (e.g. using GO-NO GO gages) may not provide adequate visibility of the extent of thread damage. More detailed inspection techniques have provided actual pitch-diameter profiles of damaged-hardware holes. A method to predict the reduction in thread shear-out capacity of damaged threaded holes has been developed. This method was based on testing and analytical modeling. Test samples were machined to simulate damaged holes in the hardware of interest. Test samples containing pristine parent-holes were also manufactured from the same bar-stock material to provide baseline results for comparison purposes. After the particular parent-hole thread profile was machined into each sample a helical insert was installed into the threaded hole. These samples were tested in a specially designed fixture to determine the maximum load required to shear out the parent threads. It was determined from the pristine-hole samples that, for the specific material tested, each individual thread could resist an average load of 3980 pounds. The shear-out loads of the holes having modified pitch diameters were compared to the ultimate loads of the specimens with pristine holes. An equivalent number of missing helical coil threads was then determined based on the ratio of shear-out loads for each thread configuration. These data were compared with the results from a finite element model (FEM). The model gave insights into the ability of the thread loads to redistribute for both pristine and simulated damage configurations. In this case, it was determined that the overall potential reduction in thread load-carrying capability in the hardware of interest was equal to having up to three fewer threads in the hole that bolt threads could engage. One- half of this potential reduction

Fatigue acceptance test limit criterion for larger diameter rolled thread fasteners

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kephart, A.R.

1997-05-01

This document describes a fatigue lifetime acceptance test criterion by which studs having rolled threads, larger than 1.0 inches in diameter, can be assured to meet minimum quality attributes associated with a controlled rolling process. This criterion is derived from a stress dependent, room temperature air fatigue database for test studs having a 0.625 inch diameter threads of Alloys X-750 HTH and direct aged 625. Anticipated fatigue lives of larger threads are based on thread root elastic stress concentration factors which increase with increasing thread diameters. Over the thread size range of interest, a 30% increase in notch stress ismore » equivalent to a factor of five (5X) reduction in fatigue life. The resulting diameter dependent fatigue acceptance criterion is normalized to the aerospace rolled thread acceptance standards for a 1.0 inch diameter, 0.125 inch pitch, Unified National thread with a controlled Root radius (UNR). Testing was conducted at a stress of 50% of the minimum specified material ultimate strength, 80 Ksi, and at a stress ratio (R) of 0.10. Limited test data for fastener diameters of 1.00 to 2.25 inches are compared to the acceptance criterion. Sensitivity of fatigue life of threads to test nut geometry variables was also shown to be dependent on notch stress conditions. Bearing surface concavity of the compression nuts and thread flank contact mismatch conditions can significantly affect the fastener fatigue life. Without improved controls these conditions could potentially provide misleading acceptance data. Alternate test nut geometry features are described and implemented in the rolled thread stud specification, MIL-DTL-24789(SH), to mitigate the potential effects on fatigue acceptance data.« less

Meandering instability of a viscous thread

NASA Astrophysics Data System (ADS)

Morris, Stephen W.; Dawes, Jonathan H. P.; Ribe, Neil M.; Lister, John R.

2008-06-01

A viscous thread falling from a nozzle onto a surface exhibits the famous rope-coiling effect, in which the thread buckles to form loops. If the surface is replaced by a belt moving with speed U , the rotational symmetry of the buckling instability is broken and a wealth of interesting states are observed [see S. Chiu-Webster and J. R. Lister, J. Fluid Mech. 569, 89 (2006)]. We experimentally studied this “fluid-mechanical sewing machine” in a more precise apparatus. As U is reduced, the steady catenary thread bifurcates into a meandering state in which the thread displacements are only transverse to the motion of the belt. We measured the amplitude and frequency ω of the meandering close to the bifurcation. For smaller U , single-frequency meandering bifurcates to a two-frequency “figure-8” state, which contains a significant 2ω component and parallel as well as transverse displacements. This eventually reverts to single-frequency coiling at still smaller U . More complex, highly hysteretic states with additional frequencies are observed for larger nozzle heights. We propose to understand this zoology in terms of the generic amplitude equations appropriate for resonant interactions between two oscillatory modes with frequencies ω and 2ω . The form of the amplitude equations captures both the axisymmetry of the U=0 coiling state and the symmetry-breaking effects induced by the moving belt.

Meandering instability of a viscous thread.

PubMed

Morris, Stephen W; Dawes, Jonathan H P; Ribe, Neil M; Lister, John R

2008-06-01

A viscous thread falling from a nozzle onto a surface exhibits the famous rope-coiling effect, in which the thread buckles to form loops. If the surface is replaced by a belt moving with speed U , the rotational symmetry of the buckling instability is broken and a wealth of interesting states are observed [see S. Chiu-Webster and J. R. Lister, J. Fluid Mech. 569, 89 (2006)]. We experimentally studied this "fluid-mechanical sewing machine" in a more precise apparatus. As U is reduced, the steady catenary thread bifurcates into a meandering state in which the thread displacements are only transverse to the motion of the belt. We measured the amplitude and frequency omega of the meandering close to the bifurcation. For smaller U , single-frequency meandering bifurcates to a two-frequency "figure-8" state, which contains a significant 2omega component and parallel as well as transverse displacements. This eventually reverts to single-frequency coiling at still smaller U . More complex, highly hysteretic states with additional frequencies are observed for larger nozzle heights. We propose to understand this zoology in terms of the generic amplitude equations appropriate for resonant interactions between two oscillatory modes with frequencies omega and 2omega . The form of the amplitude equations captures both the axisymmetry of the U=0 coiling state and the symmetry-breaking effects induced by the moving belt.

Threaded cognition: an integrated theory of concurrent multitasking.

PubMed

Salvucci, Dario D; Taatgen, Niels A

2008-01-01

The authors propose the idea of threaded cognition, an integrated theory of concurrent multitasking--that is, performing 2 or more tasks at once. Threaded cognition posits that streams of thought can be represented as threads of processing coordinated by a serial procedural resource and executed across other available resources (e.g., perceptual and motor resources). The theory specifies a parsimonious mechanism that allows for concurrent execution, resource acquisition, and resolution of resource conflicts, without the need for specialized executive processes. By instantiating this mechanism as a computational model, threaded cognition provides explicit predictions of how multitasking behavior can result in interference, or lack thereof, for a given set of tasks. The authors illustrate the theory in model simulations of several representative domains ranging from simple laboratory tasks such as dual-choice tasks to complex real-world domains such as driving and driver distraction. (c) 2008 APA, all rights reserved

Slime Analysis of Painted Steel Panels Immersed in Biscayne Bay, Miami Beach, Florida.

DTIC Science & Technology

1981-03-30

site ploratory tests on materials under consideration for water. Since the sample panels are curved to fit the heat exchangers was undertaken to... tested in this program were standard and experimental Navy materials and a selection of proprietary coatings supplied by coinrcial manufacturers. Navy...of marine microbial slime fouling filims. Application Is described to fouling of metal heat exchanger pipe in the Ocean Thermal Enrgy Conversion

Effect of thread shape on screw stress concentration by photoelastic measurements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dragoni, E.

1994-11-01

The screw stress concentration for six nut-bolt connections embodying three different thread profiles and two nut shapes is measured photoelastically. Buttress (nearly zero flank angle), trapezoidal (15-deg flank angle), and triangular (30-deg flank angle) thread forms are examined in combination with standard and lip-type nuts. The effect of the thread profile on the screw stress concentration appears to be dependent upon the kind of nut considered. If the fastening incorporates a standard nut, the buttress thread is stronger than the triangular one, which, in turn, behaves better than the trapezoidal contour. The improvement is roughly a 20% reduction in themore » stress concentration factor from the trapezoidal to the buttress thread. In the case of lip nut, conversely, this tendency is somewhat reversed, with the trapezoidal thread performing slightly (but not decidedly) better than the other two shapes. Finally, averaged over all three thread forms, the lip nut exhibits a stress concentration factor which is about 50% lower than that of the standard nut.« less

Life in the dark: metagenomic evidence that a microbial slime community is driven by inorganic nitrogen metabolism.

PubMed

Tetu, Sasha G; Breakwell, Katy; Elbourne, Liam D H; Holmes, Andrew J; Gillings, Michael R; Paulsen, Ian T

2013-06-01

Beneath Australia's large, dry Nullarbor Plain lies an extensive underwater cave system, where dense microbial communities known as 'slime curtains' are found. These communities exist in isolation from photosynthetically derived carbon and are presumed to be chemoautotrophic. Earlier work found high levels of nitrite and nitrate in the cave waters and a high relative abundance of Nitrospirae in bacterial 16S rRNA clone libraries. This suggested that these communities may be supported by nitrite oxidation, however, details of the inorganic nitrogen cycling in these communities remained unclear. Here we report analysis of 16S rRNA amplicon and metagenomic sequence data from the Weebubbie cave slime curtain community. The microbial community is comprised of a diverse assortment of bacterial and archaeal genera, including an abundant population of Thaumarchaeota. Sufficient thaumarchaeotal sequence was recovered to enable a partial genome sequence to be assembled, which showed considerable synteny with the corresponding regions in the genome of the autotrophic ammonia oxidiser Nitrosopumilus maritimus SCM1. This partial genome sequence, contained regions with high sequence identity to the ammonia mono-oxygenase operon and carbon fixing 3-hydroxypropionate/4-hydroxybutyrate cycle genes of N. maritimus SCM1. Additionally, the community, as a whole, included genes encoding key enzymes for inorganic nitrogen transformations, including nitrification and denitrification. We propose that the Weebubbie slime curtain community represents a distinctive microbial ecosystem, in which primary productivity is due to the combined activity of archaeal ammonia-oxidisers and bacterial nitrite oxidisers.

Multi-threaded Event Processing with DANA

DOE Office of Scientific and Technical Information (OSTI.GOV)

David Lawrence; Elliott Wolin

2007-05-14

The C++ data analysis framework DANA has been written to support the next generation of Nuclear Physics experiments at Jefferson Lab commensurate with the anticipated 12GeV upgrade. The DANA framework was designed to allow multi-threaded event processing with a minimal impact on developers of reconstruction software. This document describes how DANA implements multi-threaded event processing and compares it to simply running multiple instances of a program. Also presented are relative reconstruction rates for Pentium4, Xeon, and Opteron based machines.

Shared prefetching to reduce execution skew in multi-threaded systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eichenberger, Alexandre E; Gunnels, John A

Mechanisms are provided for optimizing code to perform prefetching of data into a shared memory of a computing device that is shared by a plurality of threads that execute on the computing device. A memory stream of a portion of code that is shared by the plurality of threads is identified. A set of prefetch instructions is distributed across the plurality of threads. Prefetch instructions are inserted into the instruction sequences of the plurality of threads such that each instruction sequence has a separate sub-portion of the set of prefetch instructions, thereby generating optimized code. Executable code is generated basedmore » on the optimized code and stored in a storage device. The executable code, when executed, performs the prefetches associated with the distributed set of prefetch instructions in a shared manner across the plurality of threads.« less

Thread safe astronomy

NASA Astrophysics Data System (ADS)

Seaman, R.

2008-03-01

Observational astronomy is the beneficiary of an ancient chain of apprenticeship. Kepler's laws required Tycho's data. As the pace of discoveries has increased over the centuries, so has the cadence of tutelage (literally, "watching over"). Naked eye astronomy is thousands of years old, the telescope hundreds, digital imaging a few decades, but today's undergraduates will use instrumentation yet unbuilt - and thus, unfamiliar to their professors - to complete their doctoral dissertations. Not only has the quickening cadence of astronomical data-taking overrun the apprehension of the science within, but the contingent pace of experimental design threatens our capacity to learn new techniques and apply them productively. Virtual technologies are necessary to accelerate our human processes of perception and comprehension to keep up with astronomical instrumentation and pipelined dataflows. Necessary, but not sufficient. Computers can confuse us as efficiently as they illuminate. Rather, as with neural pathways evolved to meet competitive ecological challenges, astronomical software and data must become organized into ever more coherent `threads' of execution. These are the same threaded constructs as understood by computer science. No datum is an island.

Efficient Thread Labeling for Monitoring Programs with Nested Parallelism

NASA Astrophysics Data System (ADS)

Ha, Ok-Kyoon; Kim, Sun-Sook; Jun, Yong-Kee

It is difficult and cumbersome to detect data races occurred in an execution of parallel programs. Any on-the-fly race detection techniques using Lamport's happened-before relation needs a thread labeling scheme for generating unique identifiers which maintain logical concurrency information for the parallel threads. NR labeling is an efficient thread labeling scheme for the fork-join program model with nested parallelism, because its efficiency depends only on the nesting depth for every fork and join operation. This paper presents an improved NR labeling, called e-NR labeling, in which every thread generates its label by inheriting the pointer to its ancestor list from the parent threads or by updating the pointer in a constant amount of time and space. This labeling is more efficient than the NR labeling, because its efficiency does not depend on the nesting depth for every fork and join operation. Some experiments were performed with OpenMP programs having nesting depths of three or four and maximum parallelisms varying from 10,000 to 1,000,000. The results show that e-NR is 5 times faster than NR labeling and 4.3 times faster than OS labeling in the average time for creating and maintaining the thread labels. In average space required for labeling, it is 3.5 times smaller than NR labeling and 3 times smaller than OS labeling.

Star Mapping with Slime Mold Physarum Polycephalum

NASA Astrophysics Data System (ADS)

Mihklepp, M.; Domnitch, E.; Gelfand, D.; Foing, B. H.; van der Heide, E.

2014-04-01

Human curiosity and exploration towards outer space has led to many fantastic inventions and given way to alternative scenarios about the origins of life. In the Space Science in the Arts course together with ESTEC with support from ILEWG. I got interested about unicellular slime mold Physarum polycephalum. There has been and still is a lot of research on Physarum polycephalum. This brainless eucaryotic microbe has its smartness and external memory strategies. Physarum can navigate through a maze made of agar using the shortest route possible when two pieces of food are placed at two separate exits of the maze. It can build efficient networks - Physarum created network similar to the existing Tokyo train system. It is being used to control a robot, in USB-sensor and in sound synthesis. Right now there is a lot of research about using Physarum in bio-computing.

Modification of Upper Thread Tensioner of Sewing Machine

NASA Astrophysics Data System (ADS)

Klouček, P.; Škop, P.

Standard mechanical upper thread tensioner of sewing machines is more and more limited in use for industrial sewing machines due to increasing requests for quality and raising velocity of machines. If we omit mostly manual settings of force made only by sense, the most problematic things are influence of different friction coefficient of the different batch of threads and strong relation between thread tension and sewing machine velocity. The article describes the development focused to the elimination of the most significant disadvantages of a standard tensioner and mainly finding of new conception of the tensioner with electromagnetic brake, development and testing of its prototype.

Attenuation of the tip vortex flow using a flexible thread

NASA Astrophysics Data System (ADS)

Lee, Seung-Jae; Shin, Jin-Woo; Arndt, Roger E. A.; Suh, Jung-Chun

2018-01-01

Tip vortex cavitation (TVC) is important in a number of practical engineering applications. The onset of TVC is a critical concern for navy surface ships and submarines that aim to increase their capability to evade detection. A flexible thread attachment at blade tips was recently suggested as a new method to delay the onset of TVC. Although the occurrence of TVC can be reduced using a flexible thread, no scientific investigation focusing on its mechanisms has been undertaken. Thus, herein, we experimentally investigated the use of the flexible thread to suppress TVC from an elliptical wing. These investigations were performed in a cavitation tunnel and involved an observation of TVC using high-speed cameras, motion tracking of the thread using image-processing techniques, and near-field flow measurements performed using stereoscopic particle image velocimetry. The experimental data suggested that the flexible thread affects the axial velocity field more than the circumferential velocity field around the TVC axis. Furthermore, we observed no clear dependence of the vortex core size, circulation, and flow unsteadiness on TVC suppression. However, the presence of the thread at the wing tip led to a notable reduction in the streamwise velocity field, thereby alleviating TVC.

78 FR 76815 - Steel Threaded Rod From India: Preliminary Affirmative Countervailing Duty Determination and...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-19

... DEPARTMENT OF COMMERCE International Trade Administration [C-533-856] Steel Threaded Rod From... exporters of steel threaded rod from India. The period of investigation (``POI'') is January 1, 2012... this investigation is steel threaded rod. Steel threaded rod is certain threaded rod, bar, or studs, of...

High efficiency carbon nanotube thread antennas

NASA Astrophysics Data System (ADS)

Amram Bengio, E.; Senic, Damir; Taylor, Lauren W.; Tsentalovich, Dmitri E.; Chen, Peiyu; Holloway, Christopher L.; Babakhani, Aydin; Long, Christian J.; Novotny, David R.; Booth, James C.; Orloff, Nathan D.; Pasquali, Matteo

2017-10-01

Although previous research has explored the underlying theory of high-frequency behavior of carbon nanotubes (CNTs) and CNT bundles for antennas, there is a gap in the literature for direct experimental measurements of radiation efficiency. These measurements are crucial for any practical application of CNT materials in wireless communication. In this letter, we report a measurement technique to accurately characterize the radiation efficiency of λ/4 monopole antennas made from the CNT thread. We measure the highest absolute values of radiation efficiency for CNT antennas of any type, matching that of copper wire. To capture the weight savings, we propose a specific radiation efficiency metric and show that these CNT antennas exceed copper's performance by over an order of magnitude at 1 GHz and 2.4 GHz. We also report direct experimental observation that, contrary to metals, the radiation efficiency of the CNT thread improves significantly at higher frequencies. These results pave the way for practical applications of CNT thread antennas, particularly in the aerospace and wearable electronics industries where weight saving is a priority.

Understanding thread properties for red blood cell antigen assays: weak ABO blood typing.

PubMed

Nilghaz, Azadeh; Zhang, Liyuan; Li, Miaosi; Ballerini, David R; Shen, Wei

2014-12-24

"Thread-based microfluidics" research has so far focused on utilizing and manipulating the wicking properties of threads to form controllable microfluidic channels. In this study we aim to understand the separation properties of threads, which are important to their microfluidic detection applications for blood analysis. Confocal microscopy was utilized to investigate the effect of the microscale surface morphologies of fibers on the thread's separation efficiency of red blood cells. We demonstrated the remarkably different separation properties of threads made using silk and cotton fibers. Thread separation properties dominate the clarity of blood typing assays of the ABO groups and some of their weak subgroups (Ax and A3). The microfluidic thread-based analytical devices (μTADs) designed in this work were used to accurately type different blood samples, including 89 normal ABO and 6 weak A subgroups. By selecting thread with the right surface morphology, we were able to build μTADs capable of providing rapid and accurate typing of the weak blood groups with high clarity.

Does Simultaneous Liposuction Adversely Affect the Outcome of Thread Lifts? A Preliminary Result.

PubMed

Lee, Yong Woo; Park, Tae Hwan

2018-04-11

Along with advances in thread lift techniques and materials, ancillary procedures such as fat grafting, liposuction, or filler injections have been performed simultaneously. Some surgeons think that these ancillary procedures might affect the aesthetic outcomes of thread lifting possibly due to inadvertent injury to threads or loosening of soft tissue via passing the cannula in the surgical plane of the thread lifts. The purpose of the current study is to determine the effect of such ancillary procedures on the outcome of thread lifts in the human and cadaveric setting. We used human abdominal tissue after abdominoplasty and cadaveric faces. In the abdominal tissue, liposuction parallel to the parallel axis was performed in one area for 5 min. We counted 30 passes when liposuction was performed in one direction. This was repeated as we changed the direction of passages. The plane of thread lifts (dermal vs subcutaneous) and angle between liposuction and thread lifts (parallel vs perpendicular) were differentiated in this abdominal tissue study group. Then, we performed parallel or perpendicular thread lifts using a small slit incision. Using a tensiometer, the maximum holding strength was measured when pulling the thread out of the skin as much as possible. We also used faces of cadavers to prove whether the finding in human abdominal tissue is really valid with corresponding techniques. Our pilot study using abdominal tissue showed that liposuction after thread lifts adversely affects it regardless of the vector of thread lifts. In the cadaveric study, however, liposuction prior to thread lifting does not significantly affect the holding strength of thread lifts. Liposuction or fat grafting in the appropriate layer would not be a hurdle to safely performing simultaneous thread lifts if the target lift tissue is intra-SMAS or just above the SMAS layer. This journal requires that authors assign a level of evidence to each article. For a full description of these

Design of internal screw thread measuring device based on the Three-Line method principle

NASA Astrophysics Data System (ADS)

Hu, Dachao; Chen, Jianguo

2010-08-01

In accordance with the principle of Three-Line, this paper analyze the correlation of every main parameter of internal screw thread, and then designed a device to measure the main parameters of internal screw thread. Internal thread parameters, such as the pitch diameter, thread angle and screw-pitch of common screw thread, terraced screw thread, zigzag screw thread were obtained through calculation and measurement. The practical applications have proved that this device is convenience to use, and the measurements have a high accuracy. Meanwhile, the application for the patent of invention has been accepted by the Patent Office (Filing number: 200710044081.5).

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

Servicing a globally broadcast interrupt signal in a multi-threaded computer

DOEpatents

Attinella, John E.; Davis, Kristan D.; Musselman, Roy G.; Satterfield, David L.

2015-12-29

Methods, apparatuses, and computer program products for servicing a globally broadcast interrupt signal in a multi-threaded computer comprising a plurality of processor threads. Embodiments include an interrupt controller indicating in a plurality of local interrupt status locations that a globally broadcast interrupt signal has been received by the interrupt controller. Embodiments also include a thread determining that a local interrupt status location corresponding to the thread indicates that the globally broadcast interrupt signal has been received by the interrupt controller. Embodiments also include the thread processing one or more entries in a global interrupt status bit queue based on whether global interrupt status bits associated with the globally broadcast interrupt signal are locked. Each entry in the global interrupt status bit queue corresponds to a queued global interrupt.

How to control bio-slime in condenser cooling system water

DOE Office of Scientific and Technical Information (OSTI.GOV)

Freymark, S.

1979-08-01

A number of oxidizing and non-oxidizing biocides are currently used for biocontrol. However, yesterday's solution to slime-fouling problems may not apply today in view of tightening effluent restrictions on chlorine. Thus, selection of biocontrol compounds can not be made indiscriminately. In selecting alternative biocontrol compounds, consideration should be given not only to costs but to effectiveness of the biocide in each particular application, taking into consideration cooling water quality, type of microbiological fouling and discharge restrictions. Thoughtful selection of the biocontrol compound(s), alone or in combination with surface-active agents, is essential for maintaining maximum microbiological control in condenser cooling watermore » systems.« less

Polypropionate lactones of deoxysugars glycosides from slime mold Lycogala epidendrum.

PubMed

Rezanka, Tomás; Dvoráková, Radmila

2003-08-01

Two novel polypropionate lactone glycosides (1 and 2, i.e. lycogalinosides A and B) were isolated from the slime mold Lycogala epidendrum. Their structures, including the absolute configurations of the hydroxyl and methyls groups, were determined by means of extensive spectroscopic data such as mass, IR, UV, and 1D and 2D NMR spectra and chemical degradation followed by spectroscopic and chromatographic analysis. Compounds 1 and 2 are unique in structure containing a 2-deoxy-alpha-L-fucopyranosyl-(1-4)-6-deoxy-beta-D-gulopyranosyl unit and a beta-D-olivopyranosyl-(1-4)-beta-D-fucopyranosyl unit, respectively, and showed growth inhibitory activities against Gram-positive bacteria.

The Digital Thread as the Key Enabler

DTIC Science & Technology

2016-11-01

17 Defense AT&L: November-December 2016 The Digital Thread as the Key Enabler Col. Keith Bearden, USAF Bearden is the deputy director of...enabling you to do your job better, faster and cheaper. There is one initiative, the key enabler, to accomplish this goal—the digital thread . But let’s... process that would allow for rapid cross- domain analysis and technology transition prior to bending metal. • Re-establish a culture of “hands-on

Metallic nut for use with ceramic threads

DOEpatents

Norton, Paul F.; Shaffer, James E.

1996-01-01

A nozzle guide vane assembly has ceramic components therein having a conventional thread thereon including a preestablished pitch and having a preestablished rate of thermal expansion. The nozzle guide vane assembly has a metallic components therein having a preestablished rate of thermal expansion being greater that the rate of thermal expansion of the ceramic components is positioned in a gas turbine engine. The metallic component, a nut, has a thread therein including a plurality of crests being spaced on a pitch equal to that of the ceramic component and has a pair of contacting surfaces extending from the plurality of crests. A notch spirally extends intermediate adjacent ones of the plurality of crests and has a preestablished depth which is at least twice the size of the conventional pitch. Furthermore, the pair of contacting surfaces are in contact with only a portion of the threaded surface of the ceramic components.

ERUPTION OF A SOLAR FILAMENT CONSISTING OF TWO THREADS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bi Yi; Jiang Yunchun; Li Haidong

The trigger and driving mechanism for the eruption of a filament consisting of two dark threads was studied with unprecedented high cadence and resolution of He II 304 A observations made by the Atmospheric Imagining Assembly (AIA) on board the Solar Dynamics Observatory (SDO) and the observations made by the Solar Magnetic Activity Research Telescope and the Extreme Ultraviolet Imager (EUVI) telescope on board the Solar Terrestrial Relations Observatory Ahead (STEREO-A). The filament was located at the periphery of the active region NOAA 11228 and erupted on 2011 June 6. At the onset of the eruption, a turbulent filament threadmore » was found to be heated and to elongate in stride over a second one. After it rose slowly, most interestingly, the elongating thread was driven to contact and interact with the second one, and it then erupted with its southern leg being wrapped by a newly formed thread produced by the magnetic reconnection between fields carried by the two threads. Combining the observations from STEREO-A/EUVI and SDO/AIA 304 A images, the three-dimensional shape of the axis of the filament was obtained and it was found that only the southern leg of the eruptive filament underwent rotation. We suggest that the eruption was triggered by the reconnection of the turbulent filament thread and the surrounding magnetic field, and that it was mainly driven by the kink instability of the southern leg of the eruptive filament that possessed a more twisted field introduced by the reconnection-produced thread.« less

SEROLOGICAL ANALYSES OF CELLULAR SLIME-MOLD DEVELOPMENT I.

PubMed Central

Sonneborn, D. R.; Sussman, M.; Levine, L.

1964-01-01

Sonneborn, D. R. (Brandeis University, Waltham, Mass.), M. Sussman, and L. Levine. Serological analysis of cellular slime-mold development. I. Changes in antigenic activity during cell aggregation. J. Bacteriol. 87:1321–1329. 1964.—During aggregation in Dictyostelium discoideum, the concentration of a single antigenic determinant increased markedly, starting from very low or undetectable levels. Subsequently, the determinant appeared to segregate preferentially into the stalks of terminal fruiting bodies. Sera containing the antibody specific for this determinant inhibited the aggregation of D. discoideum without disturbing cell viability. The properties of the antigen during fractionation are consistent with the supposition that it may be a protein associated with the cell membrane. The ability or inability of three species to coaggregate with D. discoideum was correlated with the presence or absence of the antigenic determinant in aggregates of these species. PMID:14188709

SPATIAL DAMPING OF PROPAGATING KINK WAVES IN PROMINENCE THREADS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soler, R.; Oliver, R.; Ballester, J. L., E-mail: roberto.soler@wis.kuleuven.be

Transverse oscillations and propagating waves are frequently observed in threads of solar prominences/filaments and have been interpreted as kink magnetohydrodynamic (MHD) modes. We investigate the spatial damping of propagating kink MHD waves in transversely nonuniform and partially ionized prominence threads. Resonant absorption and ion-neutral collisions (Cowling's diffusion) are the damping mechanisms taken into account. The dispersion relation of resonant kink waves in a partially ionized magnetic flux tube is numerically solved by considering prominence conditions. Analytical expressions of the wavelength and damping length as functions of the kink mode frequency are obtained in the thin tube and thin boundary approximations.more » For typically reported periods of thread oscillations, resonant absorption is an efficient mechanism for the kink mode spatial damping, while ion-neutral collisions have a minor role. Cowling's diffusion dominates both the propagation and damping for periods much shorter than those observed. Resonant absorption may explain the observed spatial damping of kink waves in prominence threads. The transverse inhomogeneity length scale of the threads can be estimated by comparing the observed wavelengths and damping lengths with the theoretically predicted values. However, the ignorance of the form of the density profile in the transversely nonuniform layer introduces inaccuracies in the determination of the inhomogeneity length scale.« less

Bit Threads and Holographic Entanglement

NASA Astrophysics Data System (ADS)

Freedman, Michael; Headrick, Matthew

2017-05-01

The Ryu-Takayanagi (RT) formula relates the entanglement entropy of a region in a holographic theory to the area of a corresponding bulk minimal surface. Using the max flow-min cut principle, a theorem from network theory, we rewrite the RT formula in a way that does not make reference to the minimal surface. Instead, we invoke the notion of a "flow", defined as a divergenceless norm-bounded vector field, or equivalently a set of Planck-thickness "bit threads". The entanglement entropy of a boundary region is given by the maximum flux out of it of any flow, or equivalently the maximum number of bit threads that can emanate from it. The threads thus represent entanglement between points on the boundary, and naturally implement the holographic principle. As we explain, this new picture clarifies several conceptual puzzles surrounding the RT formula. We give flow-based proofs of strong subadditivity and related properties; unlike the ones based on minimal surfaces, these proofs correspond in a transparent manner to the properties' information-theoretic meanings. We also briefly discuss certain technical advantages that the flows offer over minimal surfaces. In a mathematical appendix, we review the max flow-min cut theorem on networks and on Riemannian manifolds, and prove in the network case that the set of max flows varies Lipshitz continuously in the network parameters.

VoiceThread as a Peer Review and Dissemination Tool for Undergraduate Research

NASA Astrophysics Data System (ADS)

Guertin, L. A.

2012-12-01

VoiceThread has been utilized in an undergraduate research methods course for peer review and final research project dissemination. VoiceThread (http://www.voicethread.com) can be considered a social media tool, as it is a web-based technology with the capacity to enable interactive dialogue. VoiceThread is an application that allows a user to place a media collection online containing images, audio, videos, documents, and/or presentations in an interface that facilitates asynchronous communication. Participants in a VoiceThread can be passive viewers of the online content or engaged commenters via text, audio, video, with slide annotations via a doodle tool. The VoiceThread, which runs across browsers and operating systems, can be public or private for viewing and commenting and can be embedded into any website. Although few university students are aware of the VoiceThread platform (only 10% of the students surveyed by Ng (2012)), the 2009 K-12 edition of The Horizon Report (Johnson et al., 2009) lists VoiceThread as a tool to watch because of the opportunities it provides as a collaborative learning environment. In Fall 2011, eleven students enrolled in an undergraduate research methods course at Penn State Brandywine each conducted their own small-scale research project. Upon conclusion of the projects, students were required to create a poster summarizing their work for peer review. To facilitate the peer review process outside of class, each student-created PowerPoint file was placed in a VoiceThread with private access to only the class members and instructor. Each student was assigned to peer review five different student posters (i.e., VoiceThread images) with the audio and doodle tools to comment on formatting, clarity of content, etc. After the peer reviews were complete, the students were allowed to edit their PowerPoint poster files for a new VoiceThread. In the new VoiceThread, students were required to video record themselves describing their research

A Review of Lightweight Thread Approaches for High Performance Computing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Castello, Adrian; Pena, Antonio J.; Seo, Sangmin

High-level, directive-based solutions are becoming the programming models (PMs) of the multi/many-core architectures. Several solutions relying on operating system (OS) threads perfectly work with a moderate number of cores. However, exascale systems will spawn hundreds of thousands of threads in order to exploit their massive parallel architectures and thus conventional OS threads are too heavy for that purpose. Several lightweight thread (LWT) libraries have recently appeared offering lighter mechanisms to tackle massive concurrency. In order to examine the suitability of LWTs in high-level runtimes, we develop a set of microbenchmarks consisting of commonlyfound patterns in current parallel codes. Moreover, wemore » study the semantics offered by some LWT libraries in order to expose the similarities between different LWT application programming interfaces. This study reveals that a reduced set of LWT functions can be sufficient to cover the common parallel code patterns and that those LWT libraries perform better than OS threads-based solutions in cases where task and nested parallelism are becoming more popular with new architectures.« less

Conversation Threads Hidden within Email Server Logs

NASA Astrophysics Data System (ADS)

Palus, Sebastian; Kazienko, Przemysław

Email server logs contain records of all email Exchange through this server. Often we would like to analyze those emails not separately but in conversation thread, especially when we need to analyze social network extracted from those email logs. Unfortunately each mail is in different record and those record are not tided to each other in any obvious way. In this paper method for discussion threads extraction was proposed together with experiments on two different data sets - Enron and WrUT..

Exploration of microfluidic devices based on multi-filament threads and textiles: A review

PubMed Central

Nilghaz, A.; Ballerini, D. R.; Shen, W.

2013-01-01

In this paper, we review the recent progress in the development of low-cost microfluidic devices based on multifilament threads and textiles for semi-quantitative diagnostic and environmental assays. Hydrophilic multifilament threads are capable of transporting aqueous and non-aqueous fluids via capillary action and possess desirable properties for building fluid transport pathways in microfluidic devices. Thread can be sewn onto various support materials to form fluid transport channels without the need for the patterned hydrophobic barriers essential for paper-based microfluidic devices. Thread can also be used to manufacture fabrics which can be patterned to achieve suitable hydrophilic-hydrophobic contrast, creating hydrophilic channels which allow the control of fluids flow. Furthermore, well established textile patterning methods and combination of hydrophilic and hydrophobic threads can be applied to fabricate low-cost microfluidic devices that meet the low-cost and low-volume requirements. In this paper, we review the current limitations and shortcomings of multifilament thread and textile-based microfluidics, and the research efforts to date on the development of fluid flow control concepts and fabrication methods. We also present a summary of different methods for modelling the fluid capillary flow in microfluidic thread and textile-based systems. Finally, we summarized the published works of thread surface treatment methods and the potential of combining multifilament thread with other materials to construct devices with greater functionality. We believe these will be important research focuses of thread- and textile-based microfluidics in future. PMID:24086179

Development of Fire Resistant/Heat Resistant Sewing Thread

DTIC Science & Technology

2016-03-01

Final 3. DATES COVERED (From - To) October 2014 – June 2015 4. TITLE AND SUBTITLE DEVELOPMENT OF FIRE RESISTANT /HEAT RESISTANT SEWING THREAD 5a...core to sheath ratio of 70:30 will offer a high performance, low cost sewing thread with required fire resistant /heat resistant properties. 15...Properties ............................................................................... 18        1      DEVELOPMENT OF  FIRE   RESISTANT /HEAT

Ground Testing of the EMCS Seed Cassette for Biocompatibility with the Cellular Slime Mold, Dictyostelium Discoideum

NASA Technical Reports Server (NTRS)

Hanely, Julia C.; Reinsch, Sigrid; Myers, Zachary A.; Freeman, John; Steele, Marianne K.; Sun, Gwo-Shing; Heathcote, David G.

2014-01-01

The European Modular Cultivation System, EMCS, was developed by ESA for plant experiments. To expand the use of flight verified hardware for various model organisms, we performed ground experiments to determine whether ARC EMCS Seed Cassettes could be adapted for use with cellular slime mold for future space flight experiments. Dictyostelium is a cellular slime mold that can exist both as a single-celled independent organism and as a part of a multicellular colony which functions as a unit (pseudoplasmodium). Under certain stress conditions, individual amoebae will aggregate to form multicellular structures. Developmental pathways are very similar to those found in Eukaryotic organisms, making this a uniquely interesting organism for use in genetic studies. Dictyostelium has been used as a genetic model organism for prior space flight experiments. Due to the formation of spores that are resistant to unfavorable conditions such as desiccation, Dictyostelium is also a good candidate for use in the EMCS Seed Cassettes. The growth substratum in the cassettes is a gridded polyether sulfone (PES) membrane. A blotter beneath the PES membranes contains dried growth medium. The goals of this study were to (1) verify that Dictyostelium are capable of normal growth and development on PES membranes, (2) develop a method for dehydration of Dictyostelium spores with successful recovery and development after rehydration, and (3) successful mock rehydration experiments in cassettes. Our results show normal developmental progression in two strains of Dictyostelium discoideum on PES membranes with a bacterial food source. We have successfully performed a mock rehydration of spores with developmental progression from aggregation to slug formation, and production of morphologically normal spores within 9 days of rehydration. Our results indicate that experiments on the ISS using the slime mold, Dictyostelium discoideum could potentially be performed in the flight verified hardware of

Identification of substrates for transglutaminase in Physarum polycephalum, an acellular slime mold, upon cellular mechanical damage.

PubMed

Wada, Fumitaka; Hasegawa, Hiroki; Nakamura, Akio; Sugimura, Yoshiaki; Kawai, Yoshiki; Sasaki, Narie; Shibata, Hideki; Maki, Masatoshi; Hitomi, Kiyotaka

2007-06-01

Transglutaminases are Ca(2+)-dependent enzymes that post-translationally modify proteins by crosslinking or polyamination at specific polypeptide-bound glutamine residues. Physarum polycephalum, an acellular slime mold, is the evolutionarily lowest organism expressing a transglutimase whose primary structure is similar to that of mammalian transglutimases. We observed transglutimase reaction products at injured sites in Physarum macroplasmodia upon mechanical damage. With use of a biotin-labeled primary amine, three major proteins constituting possible transglutimase substrates were affinity-purified from the damaged slime mold. The purified proteins were Physarum actin, a 40 kDa Ca(2+)-binding protein with four EF-hand motifs (CBP40), and a novel 33 kDa protein highly homologous to the eukaryotic adenine nucleotide translocator, which is expressed in mitochondria. Immunochemical analysis of extracts from the damaged macroplasmodia indicated that CBP40 is partly dimerized, whereas the other proteins migrated as monomers on SDS/PAGE. Of the three proteins, CBP40 accumulated most significantly around injured areas, as observed by immunofluoresence. These results suggested that transglutimase reactions function in the response to mechanical injury.

Cellular automaton model of crowd evacuation inspired by slime mould

NASA Astrophysics Data System (ADS)

Kalogeiton, V. S.; Papadopoulos, D. P.; Georgilas, I. P.; Sirakoulis, G. Ch.; Adamatzky, A. I.

2015-04-01

In all the living organisms, the self-preservation behaviour is almost universal. Even the most simple of living organisms, like slime mould, is typically under intense selective pressure to evolve a response to ensure their evolution and safety in the best possible way. On the other hand, evacuation of a place can be easily characterized as one of the most stressful situations for the individuals taking part on it. Taking inspiration from the slime mould behaviour, we are introducing a computational bio-inspired model crowd evacuation model. Cellular Automata (CA) were selected as a fully parallel advanced computation tool able to mimic the Physarum's behaviour. In particular, the proposed CA model takes into account while mimicking the Physarum foraging process, the food diffusion, the organism's growth, the creation of tubes for each organism, the selection of optimum tube for each human in correspondence to the crowd evacuation under study and finally, the movement of all humans at each time step towards near exit. To test the model's efficiency and robustness, several simulation scenarios were proposed both in virtual and real-life indoor environments (namely, the first floor of office building B of the Department of Electrical and Computer Engineering of Democritus University of Thrace). The proposed model is further evaluated in a purely quantitative way by comparing the simulation results with the corresponding ones from the bibliography taken by real data. The examined fundamental diagrams of velocity-density and flow-density are found in full agreement with many of the already published corresponding results proving the adequacy, the fitness and the resulting dynamics of the model. Finally, several real Physarum experiments were conducted in an archetype of the aforementioned real-life environment proving at last that the proposed model succeeded in reproducing sufficiently the Physarum's recorded behaviour derived from observation of the aforementioned

Exploiting Thread Parallelism for Ocean Modeling on Cray XC Supercomputers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sarje, Abhinav; Jacobsen, Douglas W.; Williams, Samuel W.

The incorporation of increasing core counts in modern processors used to build state-of-the-art supercomputers is driving application development towards exploitation of thread parallelism, in addition to distributed memory parallelism, with the goal of delivering efficient high-performance codes. In this work we describe the exploitation of threading and our experiences with it with respect to a real-world ocean modeling application code, MPAS-Ocean. We present detailed performance analysis and comparisons of various approaches and configurations for threading on the Cray XC series supercomputers.

THE EFFECT OF ACTIDIONE ON MITOSIS IN THE SLIME MOLD PHYSARUM POLYCEPHALUM

PubMed Central

Cummins, J. E.; Brewer, E. N.; Rusch, H. P.

1965-01-01

Actidione, reportedly a specific inhibitor of protein synthesis, was found to reduce the incorporation of labeled amino acids into proteins of the slime mold Physarum polycephalum without drastically inhibiting the incorporation of nucleic acid precursors into RNA. This inhibitor was found to completely block the ensuing mitosis if it was added at any time between telophase and late prophase. Plasmodia given Actidione in late prophase (about the time of nucleolar dissolution) went on through telophase to reconstruction even though nuclear amino acid incorporation was drastically reduced during that period. PMID:5894452

Argobots: A Lightweight Low-Level Threading and Tasking Framework

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seo, Sangmin; Amer, Abdelhalim; Balaji, Pavan

In the past few decades, a number of user-level threading and tasking models have been proposed in the literature to address the shortcomings of OS-level threads, primarily with respect to cost and flexibility. Current state-of-the-art user-level threading and tasking models, however, are either too specific to applications or architectures or are not as powerful or flexible. In this paper, we present Argobots, a lightweight, low-level threading and tasking framework that is designed as a portable and performant substrate for high-level programming models or runtime systems. Argobots offers a carefully designed execution model that balances generality of functionality with providing amore » rich set of controls to allow specialization by the user or high-level programming model. We describe the design, implementation, and optimization of Argobots and present integrations with three example high-level models: OpenMP, MPI, and co-located I/O service. Evaluations show that (1) Argobots outperforms existing generic threading runtimes; (2) our OpenMP runtime offers more efficient interoperability capabilities than production OpenMP runtimes do; (3) when MPI interoperates with Argobots instead of Pthreads, it enjoys reduced synchronization costs and better latency hiding capabilities; and (4) I/O service with Argobots reduces interference with co-located applications, achieving performance competitive with that of the Pthreads version.« less

Argobots: A Lightweight Low-Level Threading and Tasking Framework

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seo, Sangmin; Amer, Abdelhalim; Balaji, Pavan

In the past few decades, a number of user-level threading and tasking models have been proposed in the literature to address the shortcomings of OS-level threads, primarily with respect to cost and flexibility. Current state-of-the-art user-level threading and tasking models, however, either are too specific to applications or architectures or are not as powerful or flexible. In this paper, we present Argobots, a lightweight, low-level threading and tasking framework that is designed as a portable and performant substrate for high-level programming models or runtime systems. Argobots offers a carefully designed execution model that balances generality of functionality with providing amore » rich set of controls to allow specialization by end users or high-level programming models. We describe the design, implementation, and performance characterization of Argobots and present integrations with three high-level models: OpenMP, MPI, and colocated I/O services. Evaluations show that (1) Argobots, while providing richer capabilities, is competitive with existing simpler generic threading runtimes; (2) our OpenMP runtime offers more efficient interoperability capabilities than production OpenMP runtimes do; (3) when MPI interoperates with Argobots instead of Pthreads, it enjoys reduced synchronization costs and better latency-hiding capabilities; and (4) I/O services with Argobots reduce interference with colocated applications while achieving performance competitive with that of a Pthreads approach.« less

Argobots: A Lightweight Low-Level Threading and Tasking Framework

DOE PAGES

Seo, Sangmin; Amer, Abdelhalim; Balaji, Pavan; ...

2017-10-24

In the past few decades, a number of user-level threading and tasking models have been proposed in the literature to address the shortcomings of OS-level threads, primarily with respect to cost and flexibility. Current state-of-the-art user-level threading and tasking models, however, are either too specific to applications or architectures or are not as powerful or flexible. In this article, we present Argobots, a lightweight, low-level threading and tasking framework that is designed as a portable and performant substrate for high-level programming models or runtime systems. Argobots offers a carefully designed execution model that balances generality of functionality with providing amore » rich set of controls to allow specialization by the user or high-level programming model. Here, we describe the design, implementation, and optimization of Argobots and present integrations with three example high-level models: OpenMP, MPI, and co-located I/O service. Evaluations show that (1) Argobots outperforms existing generic threading runtimes; (2) our OpenMP runtime offers more efficient interoperability capabilities than production OpenMP runtimes do; (3) when MPI interoperates with Argobots instead of Pthreads, it enjoys reduced synchronization costs and better latency hiding capabilities; and (4) I/O service with Argobots reduces interference with co-located applications, achieving performance competitive with that of the Pthreads version.« less

Argobots: A Lightweight Low-Level Threading and Tasking Framework

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seo, Sangmin; Amer, Abdelhalim; Balaji, Pavan

In the past few decades, a number of user-level threading and tasking models have been proposed in the literature to address the shortcomings of OS-level threads, primarily with respect to cost and flexibility. Current state-of-the-art user-level threading and tasking models, however, are either too specific to applications or architectures or are not as powerful or flexible. In this article, we present Argobots, a lightweight, low-level threading and tasking framework that is designed as a portable and performant substrate for high-level programming models or runtime systems. Argobots offers a carefully designed execution model that balances generality of functionality with providing amore » rich set of controls to allow specialization by the user or high-level programming model. Here, we describe the design, implementation, and optimization of Argobots and present integrations with three example high-level models: OpenMP, MPI, and co-located I/O service. Evaluations show that (1) Argobots outperforms existing generic threading runtimes; (2) our OpenMP runtime offers more efficient interoperability capabilities than production OpenMP runtimes do; (3) when MPI interoperates with Argobots instead of Pthreads, it enjoys reduced synchronization costs and better latency hiding capabilities; and (4) I/O service with Argobots reduces interference with co-located applications, achieving performance competitive with that of the Pthreads version.« less

You say "lean finely textured beef," I say "pink slime".

PubMed

Reid, Rita-Marie Cain

2014-01-01

In 2012, American Broadcasting Companies, Inc. (ABC) broadcast a segment on its evening news show regarding the manufacture of "lean finely textured beef" by Beef Products, Inc. (BPI). The broadcast, as well as follow-up reports and social media communications, repeatedly referred to the product as "pink slime," a term originated by a United States Department of Agriculture (USDA) employee for the processed meat. The market backlash against the product was immediate and intense. Ultimately, BPI closed three processing plants, cut hundreds of jobs, and filed for bankruptcy. BPI sued ABC and others for food libel, defamation, and tortious interference. This research analyzes those claims and defenses and discusses the future of such cases.

Mechanical Strength Improvements of Carbon Nanotube Threads through Epoxy Cross-Linking

PubMed Central

Yu, Qingyue; Alvarez, Noe T.; Miller, Peter; Malik, Rachit; Haase, Mark R.; Schulz, Mark; Shanov, Vesselin; Zhu, Xinbao

2016-01-01

Individual Carbon Nanotubes (CNTs) have a great mechanical strength that needs to be transferred into macroscopic fiber assemblies. One approach to improve the mechanical strength of the CNT assemblies is by creating covalent bonding among their individual CNT building blocks. Chemical cross-linking of multiwall CNTs (MWCNTs) within the fiber has significantly improved the strength of MWCNT thread. Results reported in this work show that the cross-linked thread had a tensile strength six times greater than the strength of its control counterpart, a pristine MWCNT thread (1192 MPa and 194 MPa, respectively). Additionally, electrical conductivity changes were observed, revealing 2123.40 S·cm−1 for cross-linked thread, and 3984.26 S·cm−1 for pristine CNT thread. Characterization suggests that the obtained high tensile strength is due to the cross-linking reaction of amine groups from ethylenediamine plasma-functionalized CNT with the epoxy groups of the cross-linking agent, 4,4-methylenebis(N,N-diglycidylaniline). PMID:28787868

Platform-Independence and Scheduling In a Multi-Threaded Real-Time Simulation

NASA Technical Reports Server (NTRS)

Sugden, Paul P.; Rau, Melissa A.; Kenney, P. Sean

2001-01-01

Aviation research often relies on real-time, pilot-in-the-loop flight simulation as a means to develop new flight software, flight hardware, or pilot procedures. Often these simulations become so complex that a single processor is incapable of performing the necessary computations within a fixed time-step. Threads are an elegant means to distribute the computational work-load when running on a symmetric multi-processor machine. However, programming with threads often requires operating system specific calls that reduce code portability and maintainability. While a multi-threaded simulation allows a significant increase in the simulation complexity, it also increases the workload of a simulation operator by requiring that the operator determine which models run on which thread. To address these concerns an object-oriented design was implemented in the NASA Langley Standard Real-Time Simulation in C++ (LaSRS++) application framework. The design provides a portable and maintainable means to use threads and also provides a mechanism to automatically load balance the simulation models.

Drill pipe threaded nipple connection design development

NASA Astrophysics Data System (ADS)

Saruev, A. L.; Saruev, L. A.; Vasenin, S. S.

2015-11-01

The paper presents the analysis of the behavior of the drill pipe nipple connection under the additional load generated by power pulses. The strain wave propagation through the nipple thread connection of drill pipes to the bottomhole is studied in this paper. The improved design of the nipple thread connection is suggested using the obtained experimental and theoretical data. The suggested connection design allows not only the efficient transmission of strain wave energy to a drill bit but also the automation of making-up and breaking-out drill pipes.

Spatiotemporal Symmetry in Rings of Coupled Biological Oscillators of Physarum Plasmodial Slime Mold

NASA Astrophysics Data System (ADS)

Takamatsu, Atsuko; Tanaka, Reiko; Yamada, Hiroyasu; Nakagaki, Toshiyuki; Fujii, Teruo; Endo, Isao

2001-08-01

Spatiotemporal patterns in rings of coupled biological oscillators of the plasmodial slime mold, Physarum polycephalum, were investigated by comparing with results analyzed by the symmetric Hopf bifurcation theory based on group theory. In three-, four-, and five-oscillator systems, all types of oscillation modes predicted by the theory were observed including a novel oscillation mode, a half period oscillation, which has not been reported anywhere in practical systems. Our results support the effectiveness of the symmetric Hopf bifurcation theory in practical systems.

Spatiotemporal symmetry in rings of coupled biological oscillators of Physarum plasmodial slime mold.

PubMed

Takamatsu, A; Tanaka, R; Yamada, H; Nakagaki, T; Fujii, T; Endo, I

2001-08-13

Spatiotemporal patterns in rings of coupled biological oscillators of the plasmodial slime mold, Physarum polycephalum, were investigated by comparing with results analyzed by the symmetric Hopf bifurcation theory based on group theory. In three-, four-, and five-oscillator systems, all types of oscillation modes predicted by the theory were observed including a novel oscillation mode, a half period oscillation, which has not been reported anywhere in practical systems. Our results support the effectiveness of the symmetric Hopf bifurcation theory in practical systems.

Conceptual Design Study on Bolts for Self-Loosing Preventable Threaded Fasteners

NASA Astrophysics Data System (ADS)

Noma, Atsushi; He, Jianmei

2017-11-01

Threaded fasteners using bolts is widely applied in industrial field as well as various fields. However, threaded fasteners using bolts have loosing problems and cause many accidents. In this study, the purpose is to obtain self-loosing preventable threaded fasteners by applying spring characteristic effects on bolt structures. Helical-cutting applied bolt structures is introduced through three dimensional (3D) CAD modeling tools. Analytical approaches for evaluations on the spring characteristic effects helical-cutting applied bolt structures and self-loosing preventable performance of threaded fasteners were performed using finite element method and results are reported. Comparing slackness test results with analytical results and more details on evaluating mechanical properties will be executed in future study.

Threading on ADI Cast Iron, Developing Tools and Conditions

NASA Astrophysics Data System (ADS)

Elósegui, I.; de Lacalle, L. N. López

2011-01-01

The present work is focussed on the improvement of the design and performance of the taps used for making threaded holes in ADI (Austempered Ductile Iron). It is divided in two steps: a) The development of a method valid to compare the taps wear without reaching the end of their life, measuring the required torque to make one threaded hole, after having made previously a significant number of threaded holes. The tap wear causes some teeth geometrical changes, that supposes an increase in the required torque and axial force. b) The taps wear comparison method is open to apply on different PVD coated taps, AlTiN, AlCrSiN, AlTiSiN, , and to different geometries.

Potassium Loss during Galvanotaxis of Slime Mold

PubMed Central

Anderson, John D.

1962-01-01

The posterior reticulated regions of the plasmodia of the slime mold, Physarum polycephalum, whose migration has been oriented by direct current (3.0 to 5.0 µa/mm2 in the agar substrate), contain 30 per cent less potassium than the advancing non-reticulated region. The anterior regions have the same potassium concentration as that of the controls, approximately 32 meq/kg wet weight. Differences in potassium concentration between anterior and posterior regions of control plasmodia, not oriented by electric current, are less than 5 per cent. Sodium, in contrast to potassium, is generally less concentrated in the anterior than in the posterior regions of electrically oriented plasmodia, but sodium concentrations are extremely variable. No significant difference in protein concentration was found between oriented and control plasmodia. Thirty-five per cent of the total potassium, but none of the sodium, is found in acidified ethanol precipitates from plasmodial homogenates. Potassium, but not sodium, appears to be closely associated with processes which differentiate anterior from posterior in an oriented plasmodium. PMID:13861244

The asymptotic structure of a slender coiling fluid thread

NASA Astrophysics Data System (ADS)

Blount, Maurice; Lister, John

2010-11-01

The buckling of a viscous fluid thread as it falls through air onto a stationary surface is a well-known breakfast-time phenomenon which exhibits a rich variety of dynamical regimes [1]. Since the bending resistance of a slender thread is small, bending motion is largely confined to a short region of coiling near the surface. If the height of fall is large enough, then the thread above the coiling region forms a `tail' that falls nearly vertically under gravity but is deflected slightly due to forces exerted on it by the coil. Although it is possible to use force balances in the coil to estimate scalings for the coiling frequency, we analyse the solution structure of the entire thread in the asymptotic limit of a very slender thread and thereby include the dynamic interaction between the coil and the tail. Quantitative predictions of the coiling frequency are obtained which demonstrate the existence of leading-order corrections to scalings previously derived. In particular, we show that in the regime where the deflection of the tail is governed by a balance between centrifugal acceleration, hoop stress and gravity, the tail behaves as a flexible circular pendulum that is forced by bending stress exerted by the coil. The amplitude of the response is calculated and the previously observed resonance when the coiling frequency coincides with one of the eigenfrequencies of a free flexible pendulum is thereby explained. [1] N.M. Ribe et al., J. Fluid Mech. 555, 275-297.

Polycephalin B and C: Unusual Tetramic Acids from Plasmodia of the Slime Mold Physarum polycephalum (Myxomycetes).

PubMed

Nowak, Alexander; Steffan, Bert

1998-12-04

Illumination results in increased formation of metabolites 1 and 2 in the plasmodia of the slime mold Physarum polycephalum. This was determined from HPLC studies undertaken in the search for the photoactive substances involved in the "blue-light phenomenon". The isolation and structure elucidation of 1 and 2 is described. © 1998 WILEY-VCH Verlag GmbH, Weinheim, Fed. Rep. of Germany.

Optimized FPGA Implementation of Multi-Rate FIR Filters Through Thread Decomposition

NASA Technical Reports Server (NTRS)

Kobayashi, Kayla N.; He, Yutao; Zheng, Jason X.

2011-01-01

Multi-rate finite impulse response (MRFIR) filters are among the essential signal-processing components in spaceborne instruments where finite impulse response filters are often used to minimize nonlinear group delay and finite precision effects. Cascaded (multistage) designs of MRFIR filters are further used for large rate change ratio in order to lower the required throughput, while simultaneously achieving comparable or better performance than single-stage designs. Traditional representation and implementation of MRFIR employ polyphase decomposition of the original filter structure, whose main purpose is to compute only the needed output at the lowest possible sampling rate. In this innovation, an alternative representation and implementation technique called TD-MRFIR (Thread Decomposition MRFIR) is presented. The basic idea is to decompose MRFIR into output computational threads, in contrast to a structural decomposition of the original filter as done in the polyphase decomposition. A naive implementation of a decimation filter consisting of a full FIR followed by a downsampling stage is very inefficient, as most of the computations performed by the FIR state are discarded through downsampling. In fact, only 1/M of the total computations are useful (M being the decimation factor). Polyphase decomposition provides an alternative view of decimation filters, where the downsampling occurs before the FIR stage, and the outputs are viewed as the sum of M sub-filters with length of N/M taps. Although this approach leads to more efficient filter designs, in general the implementation is not straightforward if the numbers of multipliers need to be minimized. In TD-MRFIR, each thread represents an instance of the finite convolution required to produce a single output of the MRFIR. The filter is thus viewed as a finite collection of concurrent threads. Each of the threads completes when a convolution result (filter output value) is computed, and activated when the first

Slowing down of ring polymer diffusion caused by inter-ring threading.

PubMed

Lee, Eunsang; Kim, Soree; Jung, YounJoon

2015-06-01

Diffusion of long ring polymers in a melt is much slower than the reorganization of their internal structures. While direct evidence for entanglements has not been observed in the long ring polymers unlike linear polymer melts, threading between the rings is suspected to be the main reason for slowing down of ring polymer diffusion. It is, however, difficult to define the threading configuration between two rings because the rings have no chain end. In this work, evidence for threading dynamics of ring polymers is presented by using molecular dynamics simulation and applying a novel analysis method. The simulation results are analyzed in terms of the statistics of persistence and exchange times that have proved useful in studying heterogeneous dynamics of glassy systems. It is found that the threading time of ring polymer melts increases more rapidly with the degree of polymerization than that of linear polymer melts. This indicates that threaded ring polymers cannot diffuse until an unthreading event occurs, which results in the slowing down of ring polymer diffusion. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A microfluidic glucose sensor incorporating a novel thread-based electrode system.

PubMed

Gaines, Michelle; Gonzalez-Guerrero, Maria Jose; Uchida, Kathryn; Gomez, Frank A

2018-05-01

An electrochemical sensor for the detection of glucose using thread-based electrodes and fabric is described. This device is relatively simple to fabricate and can be used for multiple readings after washing with ethanol. The fabrication of the chip consisted of two steps. First, three thread-based electrodes (reference, working, and counter) were fabricated by painting pieces of nylon thread with either layered silver ink and carbon ink or silver/silver chloride ink. The threads were then woven into a fabric chip with a beeswax barrier molded around the edges in order to prevent leaks from the tested solutions. A thread-based working electrode consisting of one layer of silver underneath two layers of carbon was selected to fabricate the final sensor system. Using the chip, a PBS solution containing glucose oxidase (GOx) (10 mg/mL), potassium ferricyanide (K 3 [Fe(CN) 6 ]) (10 mg/mL) as mediator, and different concentrations of glucose (0-25 mM), was measured by cyclic voltammetry (CV). It was found that the current output from the oxidation of glucose was proportional to the glucose concentrations. This thread-based electrode system is a viable sensor platform for detecting glucose in the physiological range. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Manufacture of threads with variable pitch by using noncircular gears

NASA Astrophysics Data System (ADS)

Slătineanu, L.; Dodun, O.; Coteață, M.; Coman, I.; Nagîț, G.; Beșliu, I.

2016-08-01

There are mechanical equipments in which shafts threaded with variable pitch are included. Such a shaft could be met in the case of worm specific to the double enveloping worm gearing. Over the years, the researchers investigated some possibilities to geometrically define and manufacture the shaft zones characterized by a variable pitch. One of the methods able to facilitate the manufacture of threads with variable pitch is based on the use of noncircular gears in the threading kinematic chain for threading by cutting. In order to design the noncircular gears, the mathematical law of pitch variation has to be known. An analysis of pitch variation based on geometrical considerations was developed in the case of a double enveloping globoid worm. Subsequently, on the bases of a proper situation, a numerical model was determined. In this way, an approximately law of pitch variation was determined and it could be taken into consideration when designing the noncircular gears included in the kinematic chain of the cutting machine tool.

PICH and BLM limit histone association with anaphase centromeric DNA threads and promote their resolution

PubMed Central

Ke, Yuwen; Huh, Jae-Wan; Warrington, Ross; Li, Bing; Wu, Nan; Leng, Mei; Zhang, Junmei; Ball, Haydn L; Li, Bing; Yu, Hongtao

2011-01-01

Centromeres nucleate the formation of kinetochores and are vital for chromosome segregation during mitosis. The SNF2 family helicase PICH (Plk1-interacting checkpoint helicase) and the BLM (the Bloom's syndrome protein) helicase decorate ultrafine histone-negative DNA threads that link the segregating sister centromeres during anaphase. The functions of PICH and BLM at these threads are not understood, however. Here, we show that PICH binds to BLM and enables BLM localization to anaphase centromeric threads. PICH- or BLM-RNAi cells fail to resolve these threads in anaphase. The fragmented threads form centromeric-chromatin-containing micronuclei in daughter cells. Anaphase threads in PICH- and BLM-RNAi cells contain histones and centromere markers. Recombinant purified PICH has nucleosome remodelling activities in vitro. We propose that PICH and BLM unravel centromeric chromatin and keep anaphase DNA threads mostly free of nucleosomes, thus allowing these threads to span long distances between rapidly segregating centromeres without breakage and providing a spatiotemporal window for their resolution. PMID:21743438

Fully decentralized control of a soft-bodied robot inspired by true slime mold.

PubMed

Umedachi, Takuya; Takeda, Koichi; Nakagaki, Toshiyuki; Kobayashi, Ryo; Ishiguro, Akio

2010-03-01

Animals exhibit astoundingly adaptive and supple locomotion under real world constraints. In order to endow robots with similar capabilities, we must implement many degrees of freedom, equivalent to animals, into the robots' bodies. For taming many degrees of freedom, the concept of autonomous decentralized control plays a pivotal role. However a systematic way of designing such autonomous decentralized control system is still missing. Aiming at understanding the principles that underlie animals' locomotion, we have focused on a true slime mold, a primitive living organism, and extracted a design scheme for autonomous decentralized control system. In order to validate this design scheme, this article presents a soft-bodied amoeboid robot inspired by the true slime mold. Significant features of this robot are twofold: (1) the robot has a truly soft and deformable body stemming from real-time tunable springs and protoplasm, the former is used for an outer skin of the body and the latter is to satisfy the law of conservation of mass; and (2) fully decentralized control using coupled oscillators with completely local sensory feedback mechanism is realized by exploiting the long-distance physical interaction between the body parts stemming from the law of conservation of protoplasmic mass. Simulation results show that this robot exhibits highly supple and adaptive locomotion without relying on any hierarchical structure. The results obtained are expected to shed new light on design methodology for autonomous decentralized control system.

Mechanochemical symmetric breaking in cell motility of slime mold

NASA Astrophysics Data System (ADS)

Guy, Robert; Zhang, Shun; Del Alamo, Juan Carlos

2016-11-01

The cytoplasm of the true slime mold Physarum polycephalum exhibits regular rhythmic periodic shuttle streaming though the cell in the direction of motion. The fluid motion is driven by the periodic contraction of an actin-myosin gel that is regulated by a calcium oscillation. When the organism is small (< 100 microns) there is no shuttle streaming, but beyond this size, regular back-and-forth streaming appears and the cell begins to migrate. In this talk we analyze a mechanochemical model of the cell which includes the intracellular fluid, the active contractile cytoskeleton, the adhesion to the substrate, and the dynamics of a chemical oscillator. We use this analysis along with experimental data to identify the instability related to the onset of streaming in order to bring insight into how contraction, flow, and adhesion are coordinated during locomotion.

Comparison of in-vivo failure of single-thread and dual-thread temporary anchorage devices over 18 months: A split-mouth randomized controlled trial.

PubMed

Durrani, Owais Khalid; Shaheed, Sohrab; Khan, Arsalan; Bashir, Ulfat

2017-10-01

The purpose of this study was to compare the in-vivo failure rates of single-thread and dual-thread temporary anchorage device (TAD) designs over 18 months. Thirty patients with skeletal Class II Division 1 malocclusion requiring anchorage from TADs for retraction of maxillary incisors into the extracted premolar space were recruited in this parallel group, split-mouth, randomized controlled trial. A block randomization sequence was generated with Random Allocation Software (version 2.0; Isfahan, Iran) with the allocations concealed in sequentially numbered, opaque, sealed envelopes. A total of 60 TADs (diameter, 2 mm; length, 10 mm) were placed in the maxillary arches of these patients with random allocation of the 2 types to the left and the right sides in a 1:1 ratio. All TADs were placed between the roots of the second premolar and the first molar and were immediately loaded. Patients were followed for a minimum of 12 months and a maximum of 18 months for the failure of the TADs. Data were analyzed blindly on an intention-to-treat basis. Four TADs (13.3%) failed in the single-thread group, and 6 TADs (20%) failed in the dual-thread group. The McNemar test showed an insignificant difference (P = 0.72) between the 2 groups. An odds ratio of 1.6 (95% confidence interval, 0.39-6.97) showed no significant associations among the variables. Most TADs failed in the first month after insertion (50%). The failure rate of dual-thread TADs compared with single-thread TADs is statistically insignificant when placed in the maxilla for retraction of the anterior segment. Registration: The trial was not registered before commencement. The protocol was not published before the trial. Copyright © 2016 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

A coupled-oscillator model with a conservation law for the rhythmic amoeboid movements of plasmodial slime molds

NASA Astrophysics Data System (ADS)

Tero, A.; Kobayashi, R.; Nakagaki, T.

2005-06-01

Experiments on the fusion and partial separation of plasmodia of the true slime mold Physarum polycephalum are described, concentrating on the spatio-temporal phase patterns of rhythmic amoeboid movement. On the basis of these experimental results we introduce a new model of coupled oscillators with one conserved quantity. Simulations using the model equations reproduce the experimental results well.

Three-dimensional optimization and sensitivity analysis of dental implant thread parameters using finite element analysis.

PubMed

Geramizadeh, Maryam; Katoozian, Hamidreza; Amid, Reza; Kadkhodazadeh, Mahdi

2018-04-01

This study aimed to optimize the thread depth and pitch of a recently designed dental implant to provide uniform stress distribution by means of a response surface optimization method available in finite element (FE) software. The sensitivity of simulation to different mechanical parameters was also evaluated. A three-dimensional model of a tapered dental implant with micro-threads in the upper area and V-shaped threads in the rest of the body was modeled and analyzed using finite element analysis (FEA). An axial load of 100 N was applied to the top of the implants. The model was optimized for thread depth and pitch to determine the optimal stress distribution. In this analysis, micro-threads had 0.25 to 0.3 mm depth and 0.27 to 0.33 mm pitch, and V-shaped threads had 0.405 to 0.495 mm depth and 0.66 to 0.8 mm pitch. The optimized depth and pitch were 0.307 and 0.286 mm for micro-threads and 0.405 and 0.808 mm for V-shaped threads, respectively. In this design, the most effective parameters on stress distribution were the depth and pitch of the micro-threads based on sensitivity analysis results. Based on the results of this study, the optimal implant design has micro-threads with 0.307 and 0.286 mm depth and pitch, respectively, in the upper area and V-shaped threads with 0.405 and 0.808 mm depth and pitch in the rest of the body. These results indicate that micro-thread parameters have a greater effect on stress and strain values.

The Gelation of Polyvinyl Alcohol with Borax: A Novel Class Participation Experiment Involving the Preparation and Properties of a "Slime."

ERIC Educational Resources Information Center

Casassa, E. Z.; And Others

1986-01-01

Background information, procedures used, and typical results obtained are provided for an experiment in which students prepare and study the characteristics of a "slime." A list of general, inorganic, and polymer chemistry concepts fostered in the experiment is included. (JN)

Constructing Visually-Based Digital Conversations in EFL with VoiceThread

ERIC Educational Resources Information Center

Kent, David

2017-01-01

VoiceThread holds potential to provide students who rarely speak in class a means to create visually-based digital conversations. In light of this, pedagogical affordances of the tool are considered, along with efficacy behind VoiceThread development within English as a Foreign Language contexts. Instructional strategies, supported by examples,…

46 CFR 56.90-10 - Threaded piping (modifies 135.5).

Code of Federal Regulations, 2010 CFR

2010-10-01

... 46 Shipping 2 2010-10-01 2010-10-01 false Threaded piping (modifies 135.5). 56.90-10 Section 56.90-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING PIPING SYSTEMS AND APPURTENANCES Assembly § 56.90-10 Threaded piping (modifies 135.5). (a) Any compound or...

Final report on EURAMET.L-S21: `Supplementary comparison of parallel thread gauges'

NASA Astrophysics Data System (ADS)

Mudronja, Vedran; Šimunovic, Vedran; Acko, Bojan; Matus, Michael; Bánréti, Edit; István, Dicso; Thalmann, Rudolf; Lassila, Antti; Lillepea, Lauri; Bartolo Picotto, Gian; Bellotti, Roberto; Pometto, Marco; Ganioglu, Okhan; Meral, Ilker; Salgado, José Antonio; Georges, Vailleau

2015-01-01

The results of the comparison of parallel thread gauges between ten European countries are presented. Three thread plugs and three thread rings were calibrated in one loop. Croatian National Laboratory for Length (HMI/FSB-LPMD) acted as the coordinator and pilot laboratory of the comparison. Thread angle, thread pitch, simple pitch diameter and pitch diameter were measured. Pitch diameters were calibrated within 1a, 2a, 1b and 2b calibration categories in accordance with the EURAMET cg-10 calibration guide. A good agreement between the measurement results and differences due to different calibration categories are analysed in this paper. This comparison was a first EURAMET comparison of parallel thread gauges based on the EURAMET ctg-10 calibration guide, and has made a step towards the harmonization of future comparisons with the registration of CMC values for thread gauges. Main text. To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCL, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

Crafting threads of diblock copolymer micelles via flow-enabled self-assembly.

PubMed

Li, Bo; Han, Wei; Jiang, Beibei; Lin, Zhiqun

2014-03-25

Hierarchically assembled amphiphilic diblock copolymer micelles were exquisitely crafted over large areas by capitalizing on two concurrent self-assembling processes at different length scales, namely, the periodic threads composed of a monolayer or a bilayer of diblock copolymer micelles precisely positioned by flow-enabled self-assembly (FESA) on the microscopic scale and the self-assembly of amphiphilic diblock copolymer micelles into ordered arrays within an individual thread on the nanometer scale. A minimum spacing between two adjacent threads λmin was observed. A model was proposed to rationalize the relationship between the thread width and λmin. Such FESA of diblock copolymer micelles is remarkably controllable and easy to implement. It opens up possibilities for lithography-free positioning and patterning of diblock copolymer micelles for various applications in template fabrication of periodic inorganic nanostructures, nanoelectronics, optoelectronics, magnetic devices, and biotechnology.

Incremental Drag due to Grooves and Threads for KE (Kinetic Energy) Projectiles

DTIC Science & Technology

1989-03-01

RFI • CTsB TF * - MF (3a) q L where TF1 is the Thread Factor defined as: TF 0.84 + 0.117 P - o (3b) where p is the groove pitch in inches, MF1 is...g2) MF RF CD (4) where TF11 and TF1 2 are the thread factors for the threads of pitch p, and P2, respectively. 5 One can notice the large

Aerospace Threaded Fastener Strength in Combined Shear and Tension Loading

NASA Technical Reports Server (NTRS)

Steeve, B. E.; Wingate, R. J.

2012-01-01

A test program was initiated by Marshall Space Flight Center and sponsored by the NASA Engineering and Safety Center to characterize the failure behavior of a typical high-strength aerospace threaded fastener under a range of shear to tension loading ratios for both a nut and an insert configuration where the shear plane passes through the body and threads, respectively. The testing was performed with a customized test fixture designed to test a bolt with a single shear plane at a discrete range of loading angles. The results provide data to compare against existing combined loading failure criteria and to quantify the bolt strength when the shear plane passes through the threads.

Extended Eden model reproduces growth of an acellular slime mold.

PubMed

Wagner, G; Halvorsrud, R; Meakin, P

1999-11-01

A stochastic growth model was used to simulate the growth of the acellular slime mold Physarum polycephalum on substrates where the nutrients were confined in separate drops. Growth of Physarum on such substrates was previously studied experimentally and found to produce a range of different growth patterns [Phys. Rev. E 57, 941 (1998)]. The model represented the aging of cluster sites and differed from the original Eden model in that the occupation probability of perimeter sites depended on the time of occupation of adjacent cluster sites. This feature led to a bias in the selection of growth directions. A moderate degree of persistence was found to be crucial to reproduce the biological growth patterns under various conditions. Persistence in growth combined quick propagation in heterogeneous environments with a high probability of locating sources of nutrients.

Extended Eden model reproduces growth of an acellular slime mold

NASA Astrophysics Data System (ADS)

Wagner, Geri; Halvorsrud, Ragnhild; Meakin, Paul

1999-11-01

A stochastic growth model was used to simulate the growth of the acellular slime mold Physarum polycephalum on substrates where the nutrients were confined in separate drops. Growth of Physarum on such substrates was previously studied experimentally and found to produce a range of different growth patterns [Phys. Rev. E 57, 941 (1998)]. The model represented the aging of cluster sites and differed from the original Eden model in that the occupation probability of perimeter sites depended on the time of occupation of adjacent cluster sites. This feature led to a bias in the selection of growth directions. A moderate degree of persistence was found to be crucial to reproduce the biological growth patterns under various conditions. Persistence in growth combined quick propagation in heterogeneous environments with a high probability of locating sources of nutrients.

Model for threading dislocations in metamorphic tandem solar cells on GaAs (001) substrates

NASA Astrophysics Data System (ADS)

Song, Yifei; Kujofsa, Tedi; Ayers, John E.

2018-02-01

We present an approximate model for the threading dislocations in III-V heterostructures and have applied this model to study the defect behavior in metamorphic triple-junction solar cells. This model represents a new approach in which the coefficient for second-order threading dislocation annihilation and coalescence reactions is considered to be determined by the length of misfit dislocations, LMD, in the structure, and we therefore refer to it as the LMD model. On the basis of this model we have compared the average threading dislocation densities in the active layers of triple junction solar cells using linearly-graded buffers of varying thicknesses as well as S-graded (complementary error function) buffers with varying thicknesses and standard deviation parameters. We have shown that the threading dislocation densities in the active regions of metamorphic tandem solar cells depend not only on the thicknesses of the buffer layers but on their compositional grading profiles. The use of S-graded buffer layers instead of linear buffers resulted in lower threading dislocation densities. Moreover, the threading dislocation densities depended strongly on the standard deviation parameters used in the S-graded buffers, with smaller values providing lower threading dislocation densities.

Effects of thread interruptions on tool pins in friction stir welding of AA6061

DOE PAGES

Reza-E-Rabby, Md.; Tang, Wei; Reynolds, Anthony P.

2017-06-21

In this paper, effects of pin thread and thread interruptions (flats) on weld quality and process response parameters during friction stir welding (FSW) of 6061 aluminium alloy were quantified. Otherwise, identical smooth and threaded pins with zero to four flats were adopted for FSW. Weldability and process response variables were examined. Results showed that threads with flats significantly improved weld quality and reduced in-plane forces. A three-flat threaded pin led to production of defect-free welds under all examined welding conditions. Spectral analyses of in-plane forces and weld cross-sectional analysis were performed to establish correlation among pin flats, force dynamics andmore » defect formation. Finally, the lowest in-plane force spectra amplitudes were consistently observed for defect-free welds.« less

Effects of thread interruptions on tool pins in friction stir welding of AA6061

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reza-E-Rabby, Md.; Tang, Wei; Reynolds, Anthony P.

In this paper, effects of pin thread and thread interruptions (flats) on weld quality and process response parameters during friction stir welding (FSW) of 6061 aluminium alloy were quantified. Otherwise, identical smooth and threaded pins with zero to four flats were adopted for FSW. Weldability and process response variables were examined. Results showed that threads with flats significantly improved weld quality and reduced in-plane forces. A three-flat threaded pin led to production of defect-free welds under all examined welding conditions. Spectral analyses of in-plane forces and weld cross-sectional analysis were performed to establish correlation among pin flats, force dynamics andmore » defect formation. Finally, the lowest in-plane force spectra amplitudes were consistently observed for defect-free welds.« less

Reshaping the Energy Landscape Transforms the Mechanism and Binding Kinetics of DNA Threading Intercalation.

PubMed

Clark, Andrew G; Naufer, M Nabuan; Westerlund, Fredrik; Lincoln, Per; Rouzina, Ioulia; Paramanathan, Thayaparan; Williams, Mark C

2018-02-06

Molecules that bind DNA via threading intercalation show high binding affinity as well as slow dissociation kinetics, properties ideal for the development of anticancer drugs. To this end, it is critical to identify the specific molecular characteristics of threading intercalators that result in optimal DNA interactions. Using single-molecule techniques, we quantify the binding of a small metal-organic ruthenium threading intercalator (Δ,Δ-B) and compare its binding characteristics to a similar molecule with significantly larger threading moieties (Δ,Δ-P). The binding affinities of the two molecules are the same, while comparison of the binding kinetics reveals significantly faster kinetics for Δ,Δ-B. However, the kinetics is still much slower than that observed for conventional intercalators. Comparison of the two threading intercalators shows that the binding affinity is modulated independently by the intercalating section and the binding kinetics is modulated by the threading moiety. In order to thread DNA, Δ,Δ-P requires a "lock mechanism", in which a large length increase of the DNA duplex is required for both association and dissociation. In contrast, measurements of the force-dependent binding kinetics show that Δ,Δ-B requires a large DNA length increase for association but no length increase for dissociation from DNA. This contrasts strongly with conventional intercalators, for which almost no DNA length change is required for association but a large DNA length change must occur for dissociation. This result illustrates the fundamentally different mechanism of threading intercalation compared with conventional intercalation and will pave the way for the rational design of therapeutic drugs based on DNA threading intercalation.

Implementation of a multi-threaded framework for large-scale scientific applications

DOE PAGES

Sexton-Kennedy, E.; Gartung, Patrick; Jones, C. D.; ...

2015-05-22

The CMS experiment has recently completed the development of a multi-threaded capable application framework. In this paper, we will discuss the design, implementation and application of this framework to production applications in CMS. For the 2015 LHC run, this functionality is particularly critical for both our online and offline production applications, which depend on faster turn-around times and a reduced memory footprint relative to before. These applications are complex codes, each including a large number of physics-driven algorithms. While the framework is capable of running a mix of thread-safe and 'legacy' modules, algorithms running in our production applications need tomore » be thread-safe for optimal use of this multi-threaded framework at a large scale. Towards this end, we discuss the types of changes, which were necessary for our algorithms to achieve good performance of our multithreaded applications in a full-scale application. Lastly performance numbers for what has been achieved for the 2015 run are presented.« less

Phylogeny of the "forgotten" cellular slime mold, Fonticula alba, reveals a key evolutionary branch within Opisthokonta.

PubMed

Brown, Matthew W; Spiegel, Frederick W; Silberman, Jeffrey D

2009-12-01

The shared ancestry between Fungi and animals has been unequivocally demonstrated by abundant molecular and morphological data for well over a decade. Along with the animals and Fungi, multiple protists have been placed in the supergroup Opisthokonta making it exceptionally diverse. In an effort to place the cellular slime mold Fonticula alba, an amoeboid protist with aggregative, multicellular fruiting, we sequenced five nuclear encoded genes; small subunit ribosomal RNA, actin, beta-tubulin, elongation factor 1-alpha, and the cytosolic isoform of heat shock protein 70 for phylogenetic analyses. Molecular trees demonstrate that Fonticula is an opisthokont that branches sister to filose amoebae in the genus Nuclearia. Fonticula plus Nuclearia are sister to Fungi. We propose a new name for this well-supported clade, Nucletmycea, incorporating Nuclearia, Fonticula, and Fungi. Fonticula represents the first example of a cellular slime mold morphology within Opisthokonta. Thus, there are four types of multicellularity in the supergroup-animal, fungal, colonial, and now aggregative. Our data indicate that multicellularity in Fonticula evolved independent of that found in the fungal and animal radiations. With the rapidly expanding sequence and genomic data becoming available from many opisthokont lineages, Fonticula may be fundamental to understanding opisthokont evolution as well as any possible commonalities involved with the evolution of multicellularity.

Research of thread rolling on difficult-to-cut material workpieces

NASA Astrophysics Data System (ADS)

Popov, A. Yu; Bugay, I. A.; Nazarov, P. V.; Evdokimova, O. P.; Popov, P. E.; Vasilyev, E. V.

2018-01-01

In medicine production Ti-6Al-4V Grade 5 alloys are used. One of the most important tasks is to increase the strength of the products and decrease in value. The possibility to roll special thread on Ti-6Al-4V Grade 5 alloy workpiece on 2-roller thread rolling machine has been studied. This is wrought alloy, treatment of which in cold condition causes difficulties due to low plasticity. To obtain Ti-6Al-4V Grade 5 alloy product with thread by rolling is rather difficult. This is due to large axial workpiece displacements resulting from large alloy resistance to cold plastic deformation. The provision of adequate kinematics requires experimental researches and the selection of modes - speed of rolling and pressure on the movable roller. The purpose of the work is to determine the optimal modes for rolling thread on titanium alloy workpiece. It has been stated that, after rolling, the product strength has increased up to 30%. As a result of the work, the unit has been made and recommendations to choose the optimal rolling process modes have been offered.

Application Of Laser Induced Breakdown Spectroscopy (LIBS) Technique In Investigation Of Historical Metal Threads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abdel-Kareem, O.; Khedr, A.; Abdelhamid, M.

Analysis of the composition of an object is a necessary step in the documentation of the properties of this object for estimating its condition. Also this is an important task for establishing an appropriate conservation treatment of an object or to follow up the result of the application of the suggested treatments. There has been an important evolution in the methods used for analysis of metal threads since the second half of the twentieth century. Today, the main considerations of selecting a method are based on the diagnostic power, representative sampling, reproducibility, destructive nature/invasiveness of analysis and accessibility to themore » appropriate instrument. This study aims at evaluating the usefulness of the use of Laser Induced Breakdown Spectroscopy (LIBS) Technique for analysis of historical metal threads. In this study various historical metal threads collected from different museums were investigated using (LIBS) technique. For evaluating usefulness of the suggested analytical protocol of this technique, the same investigated metal thread samples were investigated with Scanning Electron Microscope (SEM) with energy-dispersive x-ray analyzer (EDX) which is reported in conservation field as the best method, to determine the chemical composition, and corrosion of investigated metal threads. The results show that all investigated metal threads in the present study are too dirty, strongly damaged and corroded with different types of corrosion products. Laser Induced Breakdown Spectroscopy (LIBS) Technique is considered very useful technique that can be used safely for investigating historical metal threads. It is, in fact, very useful tool as a noninvasive method for analysis of historical metal threads. The first few laser shots are very useful for the investigation of the corrosion and dirt layer, while the following shots are very useful and effective for investigating the coating layer. Higher number of laser shots are very useful for the

Three-dimensional imaging of threading dislocations in GaN crystals using two-photon excitation photoluminescence

NASA Astrophysics Data System (ADS)

Tanikawa, Tomoyuki; Ohnishi, Kazuki; Kanoh, Masaya; Mukai, Takashi; Matsuoka, Takashi

2018-03-01

The three-dimensional imaging of threading dislocations in GaN films was demonstrated using two-photon excitation photoluminescence. The threading dislocations were shown as dark lines. The spatial resolutions near the surface were about 0.32 and 3.2 µm for the in-plane and depth directions, respectively. The threading dislocations with a density less than 108 cm-2 were resolved, although the aberration induced by the refractive index mismatch was observed. The decrease in threading dislocation density was clearly observed by increasing the GaN film thickness. This can be considered a novel method for characterizing threading dislocations in GaN films without any destructive preparations.

Degradation of slime extracellular polymeric substances and inhibited sludge flocs destruction contribute to sludge dewaterability enhancement during fungal treatment of sludge using filamentous fungus Mucor sp. GY-1.

PubMed

Wang, Zhenyu; Zheng, Guanyu; Zhou, Lixiang

2015-09-01

Mechanisms responsible for the sludge dewaterability enhanced by filamentous fungi during fungal treatment of sludge were investigated in the present study. The filamentous fungus Mucor sp. GY-1, isolated from waste activated sludge, enhanced sludge dewaterability by 82.1% to achieve the lowest value of normalized sludge specific resistance to filtration (SRF), 8.18 × 10(10) m · L/kg · g-TSS. During the fungal treatment of sludge, 57.8% of slime extracellular polymeric substances (EPS) and 51.1% of polysaccharide in slime EPS were degraded, respectively, by Mucor sp. GY-1, contributing to the improvement of sludge dewaterability. Slime EPS is much more available for Mucor sp. GY-1 than either LB-EPS or TB-EPS that bound with microbial cells. In addition, filamentous fungus Mucor sp. GY-1 entrapped small sludge particles and inhibited the destruction of sludge flocs larger than 100 μm, thus enhancing sludge dewaterability, during fungal treatment of sludge using Mucor sp. GY-1. Copyright © 2015 Elsevier Ltd. All rights reserved.

TENOGENIC DIFFERENTIATION OF HUMAN MSCs INDUCED BY THE TOPOGRAPHY OF ELECTROCHEMICALLY ALIGNED COLLAGEN THREADS

PubMed Central

Kishore, Vipuil; Bullock, Whitney; Sun, Xuanhao; Van Dyke, William Scott; Akkus, Ozan

2011-01-01

Topographical cues from the extracellular microenvironment can influence cellular activity including proliferation and differentiation. Information on the effects of material topography on tenogenic differentiation of human mesenchymal stem cells (human MSCs) is limited. A methodology using the principles of isoelectric focusing has previously been developed in our laboratory to synthesize electrochemically aligned collagen (ELAC) threads that mimics the packing density, alignment and strength of collagen dense connective tissues. In the current study, human MSCs were cultured on ELAC and randomly-oriented collagen threads and the effect of collagen orientation on cell morphology, proliferation and tenogenic differentiation was investigated. The results indicate that higher rates of proliferation were observed on randomly oriented collagen threads compared to ELAC threads. On the other hand, tendon specific markers such as scleraxis, tenomodulin, tenascin-C and collagen-III were significantly increased on ELAC threads compared to randomly oriented collagen threads. Additionally, osteocalcin, a specific marker of bone differentiation was suppressed on ELAC threads. Previous studies have reported that BMP-12 is a key growth factor to induce tenogenic differentiation of human MSCs. To evaluate the synergistic effect of BMP-12 and collagen orientation, human MSCs were cultured on ELAC threads in culture medium supplemented with and without BMP-12. The results revealed that BMP-12 did not have an additional effect on the tenogenic differentiation of human MSCs on ELAC threads. Together, these results suggest that ELAC induces tenogenic differentiation of human MSCs by presenting an aligned and dense collagen substrate, akin to the tendon itself. In conclusion, ELAC has a significant potential to be used as a tendon replacement and in the development of an osteotendinous construct towards the regeneration of bone-tendon interfaces. PMID:22177622

Experiments in Aligning Threaded Parts Using a Robot Hand

NASA Technical Reports Server (NTRS)

Diftler, M. A.; Walker, I. D.

1999-01-01

Techniques for determining and correcting threaded part alignment using force and angular position data are developed to augment currently limited techniques for align- ing threaded parts. These new techniques are based on backspinning a nut with respect to a bolt and measuring the force change that occurs when the bolt "falls" into the nut. Kinematic models that describe the relationship between threaded parts during backspinning are introduced and are used to show how angular alignment may be determined. The models indicate how to distinguish between the aligned and misaligned cases of a bolt and a nut connection by using axial force data only. In addition, by tracking the in-plane relative attitude of the bolt during spinning, data can be obtained on the direction of the angular misalignment which, in turn, is used to correct the misalignment. Results from experiments using a bolt held in a specialized fixture and a three fingers Stanford/JPL hand are presented.

Bending at the base of a dragged-out viscous thread

NASA Astrophysics Data System (ADS)

Blount, Maurice; Lister, John

2007-11-01

We consider steady flow of a slender viscous thread falling from a nozzle onto a moving horizontal belt. We analyse the asymptotic limit of a very slender thread, and show that it has a boundary-layer structure in which bending stresses only become important near the belt, where they support a vertical stress and allow the velocity and rolling conditions to be satisfied. The outer solution is analogous to a viscous catenary, with velocity fixed at the belt and at the nozzle. There are three asymptotic regimes, with distinct structures, corresponding to the cases that the belt speed is larger than, smaller than, or close to the velocity of a freely falling thread. The implications for the onset and amplitude of meanders in the `fluid-mechanical sewing machine' are explored.

Salvaging an angled implant abutment with damaged internal threads: a clinical report.

PubMed

Imam, Ahmad Y; Yilmaz, Burak; Özçelik, Tuncer Burak; McGlumphy, Edwin

2013-05-01

This clinical report describes a technique to fit an existing fixed detachable implant-supported prosthesis to a zygomatic implant abutment with stripped internal threads. The threads of the abutment were retapped and a wide diameter/wide head retaining screw was used to secure the existing prosthesis on the abutment. Care is needed in the retrieval of broken screws so as not to damage the internal threads of the implants, which might lead to irreversible complications. Copyright © 2013 The Editorial Council of the Journal of Prosthetic Dentistry. Published by Mosby, Inc. All rights reserved.

Parallel Lattice Basis Reduction Using a Multi-threaded Schnorr-Euchner LLL Algorithm

NASA Astrophysics Data System (ADS)

Backes, Werner; Wetzel, Susanne

In this paper, we introduce a new parallel variant of the LLL lattice basis reduction algorithm. Our new, multi-threaded algorithm is the first to provide an efficient, parallel implementation of the Schorr-Euchner algorithm for today’s multi-processor, multi-core computer architectures. Experiments with sparse and dense lattice bases show a speed-up factor of about 1.8 for the 2-thread and about factor 3.2 for the 4-thread version of our new parallel lattice basis reduction algorithm in comparison to the traditional non-parallel algorithm.

21 CFR 888.3040 - Smooth or threaded metallic bone fixation fastener.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Smooth or threaded metallic bone fixation fastener... metallic bone fixation fastener. (a) Identification. A smooth or threaded metallic bone fixation fastener..., slotted head on the end. It may be used for fixation of bone fractures, for bone reconstructions, as a...

21 CFR 888.3040 - Smooth or threaded metallic bone fixation fastener.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Smooth or threaded metallic bone fixation fastener... metallic bone fixation fastener. (a) Identification. A smooth or threaded metallic bone fixation fastener..., slotted head on the end. It may be used for fixation of bone fractures, for bone reconstructions, as a...

21 CFR 888.3040 - Smooth or threaded metallic bone fixation fastener.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Smooth or threaded metallic bone fixation fastener... metallic bone fixation fastener. (a) Identification. A smooth or threaded metallic bone fixation fastener..., slotted head on the end. It may be used for fixation of bone fractures, for bone reconstructions, as a...

21 CFR 888.3040 - Smooth or threaded metallic bone fixation fastener.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Smooth or threaded metallic bone fixation fastener... metallic bone fixation fastener. (a) Identification. A smooth or threaded metallic bone fixation fastener..., slotted head on the end. It may be used for fixation of bone fractures, for bone reconstructions, as a...

21 CFR 888.3040 - Smooth or threaded metallic bone fixation fastener.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Smooth or threaded metallic bone fixation fastener... metallic bone fixation fastener. (a) Identification. A smooth or threaded metallic bone fixation fastener..., slotted head on the end. It may be used for fixation of bone fractures, for bone reconstructions, as a...

Form and function of cnidarian spirocysts. III. Ultrastructure of the thread and the function of spirocysts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mariscal, R.N.; McLean, R.B.; Hand, C.

1977-01-01

Unlike most nematocysts, undischarged spirocyst threads bear hollow tubules rather than spines. The undischarged tubules are interconnected in hexagonal arrays and appear to be arranged in bundles along the length of the thread. Although the wall of the thread is folded in length and width, the tubules are not. Upon discharge and contact with sea water, the tubules solubilize and adhere to various substrates and prey. Traction between such objects and the everting thread causes the tubules to spin out into a web or meshwork of fine microfibrillae. Lack of contact of the everting thread with objects results in themore » tubules forming small droplets of partially solubilized material, some of which appear to be arranged in a helical pattern around the thread. The web or meshwork formed by the solubilized tubules in contact with various substrates probably serves to increase significantly the surface area and adhesive properties of the everted spirocyst thread.« less

Formation and Evolution of a Multi-Threaded Prominence

NASA Technical Reports Server (NTRS)

Luna, M.; Karpen, J. T.; DeVore, C. R.

2012-01-01

We investigate the process of formation and subsequent evolution of prominence plasma in a filament channel and its overlying arcade. We construct a three-dimensional time-dependent model of a filament-channel prominence suitable to be compared with observations. We combine this magnetic field structure with one-dimensional independent simulations of many flux tubes. The magnetic structure is a three-dimensional sheared double arcade, and the thermal non-equilibrium process governs the plasma evolution. We have found that the condensations in the corona can be divided into two populations: threads and blobs. Threads are massive condensations that linger in the field line dips. Blobs are ubiquitous small condensations that are produced throughout the filament and overlying arcade magnetic structure, and rapidly fall to the chromosphere. The total prominence mass is in agreement with observations. The threads are the principal contributors to the total mass, whereas the blob contribution is small. The motion of the threads is basically horizontal, while blobs move in all directions along the field. The peak velocities for both populations are comparable, but there is a weak tendency for the velocity to increase with the inclination, and the blobs with motion near vertical have the largest values of the velocity. We have generated synthetic images of the whole structure in an H proxy and in two EUV channels of the AIA instrument aboard SDO. These images show the plasma at cool, warm and hot temperatures. The theoretical differential emission measure of our system agrees very well with observations in the temperature range log T = 4.6-5.7. We conclude that the sheared-arcade magnetic structure and plasma dynamics fit well the abundant observational evidence.

Simulation of LHC events on a millions threads

NASA Astrophysics Data System (ADS)

Childers, J. T.; Uram, T. D.; LeCompte, T. J.; Papka, M. E.; Benjamin, D. P.

2015-12-01

Demand for Grid resources is expected to double during LHC Run II as compared to Run I; the capacity of the Grid, however, will not double. The HEP community must consider how to bridge this computing gap by targeting larger compute resources and using the available compute resources as efficiently as possible. Argonne's Mira, the fifth fastest supercomputer in the world, can run roughly five times the number of parallel processes that the ATLAS experiment typically uses on the Grid. We ported Alpgen, a serial x86 code, to run as a parallel application under MPI on the Blue Gene/Q architecture. By analysis of the Alpgen code, we reduced the memory footprint to allow running 64 threads per node, utilizing the four hardware threads available per core on the PowerPC A2 processor. Event generation and unweighting, typically run as independent serial phases, are coupled together in a single job in this scenario, reducing intermediate writes to the filesystem. By these optimizations, we have successfully run LHC proton-proton physics event generation at the scale of a million threads, filling two-thirds of Mira.

HELICAL MOTIONS OF FINE-STRUCTURE PROMINENCE THREADS OBSERVED BY HINODE AND IRIS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Okamoto, Takenori J.; Liu, Wei; Tsuneta, Saku, E-mail: joten.okamoto@nao.ac.jp

Fine-structure dynamics in solar prominences holds critical clues to understanding their physical nature of significant space-weather implications. We report evidence of rotational motions of horizontal helical threads in two active-region prominences observed by the Hinode and/or Interface Region Imaging Spectrograph satellites at high resolution. In the first event, we found transverse motions of brightening threads at speeds up to 55 km s{sup -1} seen in the plane of the sky. Such motions appeared as sinusoidal space–time trajectories with a typical period of ∼390 s, which is consistent with plane-of-sky projections of rotational motions. Phase delays at different locations suggest themore » propagation of twists along the threads at phase speeds of 90–270 km s{sup -1}. At least 15 episodes of such motions occurred in two days, none associated with an eruption. For these episodes, the plane-of-sky speed is linearly correlated with the vertical travel distance, suggestive of a constant angular speed. In the second event, we found Doppler velocities of 30–40 km s{sup -1} in opposite directions in the top and bottom portions of the prominence, comparable to the plane-of-sky speed. The moving threads have about twice broader line widths than stationary threads. These observations, when taken together, provide strong evidence for rotations of helical prominence threads, which were likely driven by unwinding twists triggered by magnetic reconnection between twisted prominence magnetic fields and ambient coronal fields.« less

Thread-like supercapacitors based on one-step spun nanocomposite yarns.

PubMed

Meng, Qinghai; Wang, Kai; Guo, Wei; Fang, Jin; Wei, Zhixiang; She, Xilin

2014-08-13

Thread-like electronic devices have attracted great interest because of their potential applications in wearable electronics. To produce high-performance, thread-like supercapacitors, a mixture of stable dispersions of single-walled carbon nanotubes and conducting polyaniline nanowires are prepared. Then, the mixture is spun into flexible yarns with a polyvinyl alcohol outer sheath by a one-step spinning process. The composite yarns show excellent mechanical properties and high electrical conductivities after sufficient washing to remove surfactants. After applying a further coating layer of gel electrolyte, two flexible yarns are twisted together to form a thread-like supercapacitor. The supercapacitor based on these two yarns (SWCNTs and PAniNWs) possesses a much higher specific capacitance than that based only on pure SWCNTs yarns, making it an ideal energy-storage device for wearable electronics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Bioglass incorporation improves mechanical properties and enhances cell-mediated mineralization on electrochemically aligned collagen threads.

PubMed

Nijsure, Madhura P; Pastakia, Meet; Spano, Joseph; Fenn, Michael B; Kishore, Vipuil

2017-09-01

Bone tissue engineering mandates the development of a functional scaffold that mimics the physicochemical properties of native bone. Bioglass 45S5 (BG) is a highly bioactive material known to augment bone formation and restoration. Hybrid scaffolds fabricated using collagen type I and BG resemble the organic and inorganic composition of the bone extracellular matrix and hence have been extensively investigated for bone tissue engineering applications. However, collagen-BG scaffolds developed thus far do not recapitulate the aligned structure of collagen found in native bone. In this study, an electrochemical fabrication method was employed to synthesize BG-incorporated electrochemically aligned collagen (BG-ELAC) threads that are compositionally similar to native bone. Further, aligned collagen fibrils within BG-ELAC threads mimic the anisotropic arrangement of collagen fibrils in native bone. The effect of BG incorporation on the mechanical properties and cell-mediated mineralization on ELAC threads was investigated. The results indicated that BG can be successfully incorporated within ELAC threads, without disturbing collagen fibril alignment. Further, BG incorporation significantly increased the ultimate tensile stress (UTS) and modulus of ELAC threads (p < 0.05). SBF conditioning showed extensive mineralization on BG-ELAC threads that increased over time demonstrating the bone bioactivity of BG-ELAC threads. Additionally, BG incorporation into ELAC threads resulted in increased cell proliferation (p < 0.05) and deposition of a highly dense and continuous mineralized matrix. In conclusion, incorporation of BG into ELAC threads is a viable strategy for the development of an osteoconductive material for bone tissue engineering applications. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2429-2440, 2017. © 2017 Wiley Periodicals, Inc.

Developing eThread pipeline using SAGA-pilot abstraction for large-scale structural bioinformatics.

PubMed

Ragothaman, Anjani; Boddu, Sairam Chowdary; Kim, Nayong; Feinstein, Wei; Brylinski, Michal; Jha, Shantenu; Kim, Joohyun

2014-01-01

While most of computational annotation approaches are sequence-based, threading methods are becoming increasingly attractive because of predicted structural information that could uncover the underlying function. However, threading tools are generally compute-intensive and the number of protein sequences from even small genomes such as prokaryotes is large typically containing many thousands, prohibiting their application as a genome-wide structural systems biology tool. To leverage its utility, we have developed a pipeline for eThread--a meta-threading protein structure modeling tool, that can use computational resources efficiently and effectively. We employ a pilot-based approach that supports seamless data and task-level parallelism and manages large variation in workload and computational requirements. Our scalable pipeline is deployed on Amazon EC2 and can efficiently select resources based upon task requirements. We present runtime analysis to characterize computational complexity of eThread and EC2 infrastructure. Based on results, we suggest a pathway to an optimized solution with respect to metrics such as time-to-solution or cost-to-solution. Our eThread pipeline can scale to support a large number of sequences and is expected to be a viable solution for genome-scale structural bioinformatics and structure-based annotation, particularly, amenable for small genomes such as prokaryotes. The developed pipeline is easily extensible to other types of distributed cyberinfrastructure.

Fabrication of drug-loaded electrospun aligned fibrous threads for suture applications.

PubMed

He, Chuang-Long; Huang, Zheng-Ming; Han, Xiao-Jian

2009-04-01

In this work, drug-loaded fibers and threads were successfully fabricated by combining electrospinning with aligned fibers collection. Two different electrospinning processes, that is, blend and coaxial electrospinning, to incorporate a model drug tetracycline hydrochloride (TCH) into poly(L-lactic acid) (PLLA) fibers have been used and compared with each other. The resulting composite ultrafine fibers and threads were characterized through scanning electron microscopy, transmission electron microscopy, Fourier transform infrared spectroscopy, X-ray diffraction, differential scanning calorimetry, and tensile testing. It has been shown that average diameters of the fibers made from the same polymer concentration depended on the processing method. The blend TCH/PLLA fibers showed the smallest fiber diameter, whereas neat PLLA fibers and core-shell TCH-PLLA fibers showed a larger proximal average diameter. Higher rotating speed of a wheel collector is helpful for obtaining better-aligned fibers. Both the polymer and the drug in the electrospun fibers have poor crystalline property. In vitro release study indicated that threads made from the core-shell fibers could suppress the initial burst release and provide a sustained drug release useful for the release of growth factor or other therapeutic drugs. On the other hand, the threads from the blend fibers produced a large initial burst release that may be used to prevent bacteria infection. A combination of these results suggests that electrospinning technique provides a novel way to fabricate medical agents-loaded fibrous threads for tissue suturing and tissue regeneration applications. Copyright 2008 Wiley Periodicals, Inc.

Inertia Compensation While Scanning Screw Threads on Coordinate Measuring Machines

NASA Astrophysics Data System (ADS)

Kosarevsky, Sergey; Latypov, Viktor

2010-01-01

Usage of scanning coordinate-measuring machines for inspection of screw threads has become a common practice nowadays. Compared to touch trigger probing, scanning capabilities allow to speed up the measuring process while still maintaining high accuracy. However, in some cases accuracy drastically depends on the scanning speed. In this paper a compensation method is proposed allowing to reduce the influence of inertia of the probing system while scanning screw threads on coordinate-measuring machines.

Risk management in spatio-temporally varying field by true slime mold

NASA Astrophysics Data System (ADS)

Ito, Kentaro; Sumpter, David; Nakagaki, Toshiyuki

Revealing how lower organisms solve complicated problems is a challenging research area, which could reveal the evolutionary origin of biological information processing. Here we report on the ability of a single-celled organism, true slime mold, to find a smart solution of risk management under spatio-temporally varying conditions. We designed test conditions under which there were three food-locations at vertices of equilateral triangle and a toxic light illuminated the organism on alternating halves of the triangle. We found that the organism behavior depended on the period of the repeated illumination, even though the total exposure time was kept the same . A simple mathematical model for the experimental results is proposed from a dynamical system point of view. We discuss our results in the context of a strategy of risk management by Physarum.

Fragmentation mechanisms of confined co-flowing capillary threads revealed by active flow focusing

NASA Astrophysics Data System (ADS)

Robert de Saint Vincent, Matthieu; Delville, Jean-Pierre

2016-08-01

The control over stationary liquid thread fragmentation in confined co-flows is a key issue for the processing and transport of fluids in (micro-)ducts. Confinement indeed strongly enhances the stability of capillary threads, and also induces steric and hydrodynamic feedback effects on diphasic flows. We investigate the thread-to-droplet transition within the confined environment of a microchannel by using optocapillarity, i.e., interface stresses driven by light, as a wall-free constriction to locally flow focus stable threads in a tunable way, pinch them, and force their fragmentation. Above some flow-dependent onset in optical forcing, we observe a dynamic transition alternating between continuous (thread) and fragmented (droplets) states and show a surprisingly gradual thread-to-droplet transition when increasing the amplitude of the thread constriction. This transition is interpreted as an evolution from a convective to an absolute instability. Depending on the forcing amplitude, we then identify and characterize several stable fragmented regimes of single and multiple droplet periodicity (up to period-8). These droplet regimes build a robust flow-independent bifurcation diagram that eventually closes up, due to the flow confinement, to a monodisperse droplet size, independent of the forcing and close to the most unstable mode expected from the Rayleigh-Plateau instability. This fixed monodispersity can be circumvented by temporally modulating the optocapillary coupling, as we show that fragmentation can then occur either by triggering again the Rayleigh-Plateau instability when the largest excitable wavelength is larger than that of the most unstable mode, or as a pure consequence of a sufficiently strong optocapillary pinching. When properly adjusted, this modulation allows us to avoid the transient reforming and multidisperse regimes, and thereby to reversibly produce stable monodisperse droplet trains of controlled size. By actuating local flow focusing in

Innovative Uses of Threaded Discussion Groups.

ERIC Educational Resources Information Center

Bailey, Yardley Selwyn; Wright, Vivian H.

This paper explores how faculty from various disciplines at one southeastern university used the threaded discussion group feature of such integrated Web packages as FrontPage, Blackboard, and WebCT. Ten faculty members from the colleges of Arts and Sciences, Business, Education, Communication, Engineering, and Nursing were surveyed. Qualitative…

A discrete geometric approach for simulating the dynamics of thin viscous threads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Audoly, B., E-mail: audoly@lmm.jussieu.fr; Clauvelin, N.; Brun, P.-T.

We present a numerical model for the dynamics of thin viscous threads based on a discrete, Lagrangian formulation of the smooth equations. The model makes use of a condensed set of coordinates, called the centerline/spin representation: the kinematic constraints linking the centerline's tangent to the orientation of the material frame is used to eliminate two out of three degrees of freedom associated with rotations. Based on a description of twist inspired from discrete differential geometry and from variational principles, we build a full-fledged discrete viscous thread model, which includes in particular a discrete representation of the internal viscous stress. Consistencymore » of the discrete model with the classical, smooth equations for thin threads is established formally. Our numerical method is validated against reference solutions for steady coiling. The method makes it possible to simulate the unsteady behavior of thin viscous threads in a robust and efficient way, including the combined effects of inertia, stretching, bending, twisting, large rotations and surface tension.« less

AthenaMT: upgrading the ATLAS software framework for the many-core world with multi-threading

NASA Astrophysics Data System (ADS)

Leggett, Charles; Baines, John; Bold, Tomasz; Calafiura, Paolo; Farrell, Steven; van Gemmeren, Peter; Malon, David; Ritsch, Elmar; Stewart, Graeme; Snyder, Scott; Tsulaia, Vakhtang; Wynne, Benjamin; ATLAS Collaboration

2017-10-01

ATLAS’s current software framework, Gaudi/Athena, has been very successful for the experiment in LHC Runs 1 and 2. However, its single threaded design has been recognized for some time to be increasingly problematic as CPUs have increased core counts and decreased available memory per core. Even the multi-process version of Athena, AthenaMP, will not scale to the range of architectures we expect to use beyond Run2. After concluding a rigorous requirements phase, where many design components were examined in detail, ATLAS has begun the migration to a new data-flow driven, multi-threaded framework, which enables the simultaneous processing of singleton, thread unsafe legacy Algorithms, cloned Algorithms that execute concurrently in their own threads with different Event contexts, and fully re-entrant, thread safe Algorithms. In this paper we report on the process of modifying the framework to safely process multiple concurrent events in different threads, which entails significant changes in the underlying handling of features such as event and time dependent data, asynchronous callbacks, metadata, integration with the online High Level Trigger for partial processing in certain regions of interest, concurrent I/O, as well as ensuring thread safety of core services. We also report on upgrading the framework to handle Algorithms that are fully re-entrant.

Plant hairy root cultures as plasmodium modulators of the slime mold emergent computing substrate Physarum polycephalum.

PubMed

Ricigliano, Vincent; Chitaman, Javed; Tong, Jingjing; Adamatzky, Andrew; Howarth, Dianella G

2015-01-01

Roots of the medicinal plant Valeriana officinalis are well-studied for their various biological activities. We applied genetically transformed V. officinalis root biomass to exert control of Physarum polycephalum, an amoeba-based emergent computing substrate. The plasmodial stage of the P. polycephalum life cycle constitutes a single, multinucleate cell visible by unaided eye. The plasmodium modifies its network of oscillating protoplasm in response to spatial configurations of attractants and repellents, a behavior that is interpreted as biological computation. To program the computing behavior of P. polycephalum, a diverse and sustainable library of plasmodium modulators is required. Hairy roots produced by genetic transformation with Agrobacterium rhizogenes are a metabolically stable source of bioactive compounds. Adventitious roots were induced on in vitro V. officinalis plants following infection with A. rhizogenes. A single hairy root clone was selected for massive propagation and the biomass was characterized in P. polycephalum chemotaxis, maze-solving, and electrical activity assays. The Agrobacterium-derived roots of V. officinalis elicited a positive chemotactic response and augmented maze-solving behavior. In a simple plasmodium circuit, introduction of hairy root biomass stimulated the oscillation patterns of slime mold's surface electrical activity. We propose that manipulation of P. polycephalum with the plant root culture platform can be applied to the development of slime mold microfluidic devices as well as future models for engineering the plant rhizosphere.

Plant hairy root cultures as plasmodium modulators of the slime mold emergent computing substrate Physarum polycephalum

PubMed Central

Ricigliano, Vincent; Chitaman, Javed; Tong, Jingjing; Adamatzky, Andrew; Howarth, Dianella G.

2015-01-01

Roots of the medicinal plant Valeriana officinalis are well-studied for their various biological activities. We applied genetically transformed V. officinalis root biomass to exert control of Physarum polycephalum, an amoeba-based emergent computing substrate. The plasmodial stage of the P. polycephalum life cycle constitutes a single, multinucleate cell visible by unaided eye. The plasmodium modifies its network of oscillating protoplasm in response to spatial configurations of attractants and repellents, a behavior that is interpreted as biological computation. To program the computing behavior of P. polycephalum, a diverse and sustainable library of plasmodium modulators is required. Hairy roots produced by genetic transformation with Agrobacterium rhizogenes are a metabolically stable source of bioactive compounds. Adventitious roots were induced on in vitro V. officinalis plants following infection with A. rhizogenes. A single hairy root clone was selected for massive propagation and the biomass was characterized in P. polycephalum chemotaxis, maze-solving, and electrical activity assays. The Agrobacterium-derived roots of V. officinalis elicited a positive chemotactic response and augmented maze-solving behavior. In a simple plasmodium circuit, introduction of hairy root biomass stimulated the oscillation patterns of slime mold's surface electrical activity. We propose that manipulation of P. polycephalum with the plant root culture platform can be applied to the development of slime mold microfluidic devices as well as future models for engineering the plant rhizosphere. PMID:26236301

Threaded biliary inside stents are a safe and effective therapeutic option in cases of malignant hilar obstruction.

PubMed

Inatomi, Osamu; Bamba, Shigeki; Shioya, Makoto; Mochizuki, Yosuke; Ban, Hiromitsu; Tsujikawa, Tomoyuki; Saito, Yasuharu; Andoh, Akira; Fujiyama, Yoshihide

2013-02-14

Although endoscopic biliary stents have been accepted as part of palliative therapy for cases of malignant hilar obstruction, the optimal endoscopic management regime remains controversial. In this study, we evaluated the safety and efficacy of placing a threaded stent above the sphincter of Oddi (threaded inside plastic stents, threaded PS) and compared the results with those of other stent types. Patients with malignant hilar obstruction, including those requiring biliary drainage for stent occlusion, were selected. Patients received either one of the following endoscopic indwelling stents: threaded PS, conventional plastic stents (conventional PS), or metallic stents (MS). Duration of stent patency and the incident of complication were compared in these patients. Forty-two patients underwent placement of endoscopic indwelling stents (threaded PS = 12, conventional PS = 17, MS = 13). The median duration of threaded PS patency was significantly longer than that of conventional PS patency (142 vs. 32 days; P = 0.04, logrank test). The median duration of threaded PS and MS patency was not significantly different (142 vs. 150 days, P = 0.83). Stent migration did not occur in any group. Among patients who underwent threaded PS placement as a salvage therapy after MS obstruction due to tumor ingrowth, the median duration of MS patency was significantly shorter than that of threaded PS patency (123 vs. 240 days). Threaded PS are safe and effective in cases of malignant hilar obstruction; moreover, it is a suitable therapeutic option not only for initial drainage but also for salvage therapy.

78 FR 79670 - Steel Threaded Rod From Thailand: Preliminary Determination of Sales at Less Than Fair Value and...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-31

... DEPARTMENT OF COMMERCE International Trade Administration [A-549-831] Steel Threaded Rod From... ``Department'') preliminarily determines that steel threaded rod from Thailand is being, or is likely to be... Investigation The merchandise covered by this investigation is steel threaded rod. Steel threaded rod is certain...

78 FR 12718 - Certain Steel Threaded Rod From the People's Republic of China: Affirmative Final Determination...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-02-25

... DEPARTMENT OF COMMERCE International Trade Administration [A-570-932] Certain Steel Threaded Rod... Preliminary Determination of the circumvention inquiry concerning the antidumping duty order on certain steel threaded rod (``steel threaded rod'') from the People's Republic of China (``PRC'').\\1\\ The period of...

MACHINING ELIMINATION THROUGH APPLICATION OF THREAD FORMING FASTENERS IN NET SHAPED CAST HOLES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cleaver, Ryan J; Cleaver, Todd H; Talbott, Richard

The ultimate objective of this work was to eliminate approximately 30% of the machining performed in typical automotive engine and transmission plants by using thread forming fasteners in as-cast holes of aluminum and magnesium cast components. The primary issues at the source of engineers reluctance to implementing thread forming fasteners in lightweight castings are: * Little proof of consistency of clamp load vs. input torque in either aluminum or magnesium castings. * No known data to understand the effect on consistency of clamp load as casting dies wear. The clamp load consistency concern is founded in the fact that amore » portion of the input torque used to create clamp load is also used to create threads. The torque used for thread forming may not be consistent due to variations in casting material, hole size and shape due to tooling wear and process variation (thermal and mechanical). There is little data available to understand the magnitude of this concern or to form the basis of potential solutions if the range of clamp load variation is very high (> +/- 30%). The range of variation that can be expected in as-cast hole size and shape over the full life cycle of a high pressure die casting die was established in previous work completed by Pacific Northwest National Laboratory, (PNNL). This established range of variation was captured in a set of 12 cast bosses by designing core pins at the size and draft angles identified in the sited previous work. The cast bosses were cut into nuts that could be used in the Ford Fastener Laboratory test-cell to measure clamp load when a thread forming fastener was driven into a cast nut. There were two sets of experiments run. First, a series of cast aluminum nuts were made reflecting the range of shape and size variations to be expected over the life cycle of a die casting die. Taptite thread forming fasteners, (a widely used thread forming fastener suitable for aluminum applications), were driven into the various

EventThread: Visual Summarization and Stage Analysis of Event Sequence Data.

PubMed

Guo, Shunan; Xu, Ke; Zhao, Rongwen; Gotz, David; Zha, Hongyuan; Cao, Nan

2018-01-01

Event sequence data such as electronic health records, a person's academic records, or car service records, are ordered series of events which have occurred over a period of time. Analyzing collections of event sequences can reveal common or semantically important sequential patterns. For example, event sequence analysis might reveal frequently used care plans for treating a disease, typical publishing patterns of professors, and the patterns of service that result in a well-maintained car. It is challenging, however, to visually explore large numbers of event sequences, or sequences with large numbers of event types. Existing methods focus on extracting explicitly matching patterns of events using statistical analysis to create stages of event progression over time. However, these methods fail to capture latent clusters of similar but not identical evolutions of event sequences. In this paper, we introduce a novel visualization system named EventThread which clusters event sequences into threads based on tensor analysis and visualizes the latent stage categories and evolution patterns by interactively grouping the threads by similarity into time-specific clusters. We demonstrate the effectiveness of EventThread through usage scenarios in three different application domains and via interviews with an expert user.

Three-dimensional investigations of the threading regime in a microfluidic flow-focusing channel

NASA Astrophysics Data System (ADS)

Gowda, Krishne; Brouzet, Christophe; Lefranc, Thibault; Soderberg, L. Daniel; Lundell, Fredrik

2017-11-01

We study the flow dynamics of the threading regime in a microfluidic flow-focusing channel through 3D numerical simulations and experiments. Making strong filaments from cellulose nano-fibrils (CNF) could potentially steer to new high-performance bio-based composites competing with conventional glass fibre composites. CNF filaments can be obtained through hydrodynamic alignment of dispersed CNF by using the concept of flow-focusing. The aligned structure is locked by diffusion of ions resulting in a dispersion-gel transition. Flow-focusing typically refers to a microfluidic channel system where the core fluid is focused by the two sheath fluids, thereby creating an extensional flow at the intersection. In this study, threading regime corresponds to an extensional flow field generated by the water sheath fluid stretching the dispersed CNF core fluid and leading to formation of long threads. The experimental measurements are performed using optical coherence tomography (OCT) and 3D numerical simulations with OpenFOAM. The prime focus is laid on the 3D characteristics of thread formation such as wetting length of core fluid, shape, aspect ratio of the thread and velocity flow-field in the microfluidic channel.

During Threaded Discussions Are Non-Native English Speakers Always at a Disadvantage?

ERIC Educational Resources Information Center

Shafer Willner, Lynn

2014-01-01

When participating in threaded discussions, under what conditions might non¬native speakers of English (NNSE) be at a comparative disadvantage to their classmates who are native speakers of English (NSE)? This study compares the threaded discussion perspectives of closely-matched NNSE and NSE adult students having different levels of threaded…

Thread amplitudes and frequencies in a fluid mechanical `sewing machine'

NASA Astrophysics Data System (ADS)

Morris, Stephen W.; Dawes, J. H. P.; Lister, John; Dalziel, Stuart

2006-11-01

A viscous thread falling on a surface exhibits the famous rope- coiling effect, in which the thread buckles to form loops. If the surface is replaced by a belt moving at speed U, the rotational symmetry of the buckling instability is broken and a wealth of interesting states are observed (1). We experimentally studied this fluid mechanical `sewing machine' in a new, more precise apparatus. As U is reduced, the stretched thread bifurcates into a meandering state in which the thread displacements are only transverse to the motion of the belt. We measured the amplitudes A and frequency φ of the meandering close to the bifurcation. For small U, single- frequency meandering bifurcates to a two-frequency `figure 8' state, which contains a significant 2φ component and parallel as well as transverse displacements. This eventually reverts to single-frequency coiling at smaller U. More complex, highly hysteretic states with additional harmonics are observed for larger nozzle heights. We propose to understand this zoology in terms of the generic amplitude equations appropriate for resonant interactions between three oscillatory modes with frequencies φ, 2φ and 3φ. The form of the amplitude equations captures both the axisymmetry of the U=0 coiling state and the symmetry-breaking effects induced by the moving belt.(1) Chiu-Webster and Lister, J. Fluid Mech., in press.

Common Threads: Quilt-Making and Teaching.

ERIC Educational Resources Information Center

Levine, Phoebe M.

A teacher educator and artist explores alternate ways to think of teaching as a creative endeavor. This paper brings together the voices of Appalachian craftswomen and the wisdom of educator and philosopher John Dewey to create a patchwork that celebrates the common threads of quiltmaking and teaching. Interviews with West Virginia craftswomen and…

Threaded biliary inside stents are a safe and effective therapeutic option in cases of malignant hilar obstruction

PubMed Central

2013-01-01

Background Although endoscopic biliary stents have been accepted as part of palliative therapy for cases of malignant hilar obstruction, the optimal endoscopic management regime remains controversial. In this study, we evaluated the safety and efficacy of placing a threaded stent above the sphincter of Oddi (threaded inside plastic stents, threaded PS) and compared the results with those of other stent types. Methods Patients with malignant hilar obstruction, including those requiring biliary drainage for stent occlusion, were selected. Patients received either one of the following endoscopic indwelling stents: threaded PS, conventional plastic stents (conventional PS), or metallic stents (MS). Duration of stent patency and the incident of complication were compared in these patients. Results Forty-two patients underwent placement of endoscopic indwelling stents (threaded PS = 12, conventional PS = 17, MS = 13). The median duration of threaded PS patency was significantly longer than that of conventional PS patency (142 vs. 32 days; P = 0.04, logrank test). The median duration of threaded PS and MS patency was not significantly different (142 vs. 150 days, P = 0.83). Stent migration did not occur in any group. Among patients who underwent threaded PS placement as a salvage therapy after MS obstruction due to tumor ingrowth, the median duration of MS patency was significantly shorter than that of threaded PS patency (123 vs. 240 days). Conclusions Threaded PS are safe and effective in cases of malignant hilar obstruction; moreover, it is a suitable therapeutic option not only for initial drainage but also for salvage therapy. PMID:23410217

Parallel Implementation of 3-D Iterative Reconstruction With Intra-Thread Update for the jPET-D4

NASA Astrophysics Data System (ADS)

Lam, Chih Fung; Yamaya, Taiga; Obi, Takashi; Yoshida, Eiji; Inadama, Naoko; Shibuya, Kengo; Nishikido, Fumihiko; Murayama, Hideo

2009-02-01

One way to speed-up iterative image reconstruction is by parallel computing with a computer cluster. However, as the number of computing threads increases, parallel efficiency decreases due to network transfer delay. In this paper, we proposed a method to reduce data transfer between computing threads by introducing an intra-thread update. The update factor is collected from each slave thread and a global image is updated as usual in the first K sub-iteration. In the rest of the sub-iterations, the global image is only updated at an interval which is controlled by a parameter L. In between that interval, the intra-thread update is carried out whereby an image update is performed in each slave thread locally. We investigated combinations of K and L parameters based on parallel implementation of RAMLA for the jPET-D4 scanner. Our evaluation used four workstations with a total of 16 slave threads. Each slave thread calculated a different set of LORs which are divided according to ring difference numbers. We assessed image quality of the proposed method with a hotspot simulation phantom. The figure of merit was the full-width-half-maximum of hotspots and the background normalized standard deviation. At an optimum K and L setting, we did not find significant change in the output images. We also applied the proposed method to a Hoffman phantom experiment and found the difference due to intra-thread update was negligible. With the intra-thread update, computation time could be reduced by about 23%.

Multi-threading performance of Geant4, MCNP6, and PHITS Monte Carlo codes for tetrahedral-mesh geometry.

PubMed

Han, Min Cheol; Yeom, Yeon Soo; Lee, Hyun Su; Shin, Bangho; Kim, Chan Hyeong; Furuta, Takuya

2018-05-04

In this study, the multi-threading performance of the Geant4, MCNP6, and PHITS codes was evaluated as a function of the number of threads (N) and the complexity of the tetrahedral-mesh phantom. For this, three tetrahedral-mesh phantoms of varying complexity (simple, moderately complex, and highly complex) were prepared and implemented in the three different Monte Carlo codes, in photon and neutron transport simulations. Subsequently, for each case, the initialization time, calculation time, and memory usage were measured as a function of the number of threads used in the simulation. It was found that for all codes, the initialization time significantly increased with the complexity of the phantom, but not with the number of threads. Geant4 exhibited much longer initialization time than the other codes, especially for the complex phantom (MRCP). The improvement of computation speed due to the use of a multi-threaded code was calculated as the speed-up factor, the ratio of the computation speed on a multi-threaded code to the computation speed on a single-threaded code. Geant4 showed the best multi-threading performance among the codes considered in this study, with the speed-up factor almost linearly increasing with the number of threads, reaching ~30 when N  =  40. PHITS and MCNP6 showed a much smaller increase of the speed-up factor with the number of threads. For PHITS, the speed-up factors were low when N  =  40. For MCNP6, the increase of the speed-up factors was better, but they were still less than ~10 when N  =  40. As for memory usage, Geant4 was found to use more memory than the other codes. In addition, compared to that of the other codes, the memory usage of Geant4 more rapidly increased with the number of threads, reaching as high as ~74 GB when N  =  40 for the complex phantom (MRCP). It is notable that compared to that of the other codes, the memory usage of PHITS was much lower, regardless of both the complexity of the

Linking consistency with object/thread semantics - An approach to robust computation

NASA Technical Reports Server (NTRS)

Chen, Raymond C.; Dasgupta, Partha

1989-01-01

This paper presents an object/thread based paradigm that links data consistency with object/thread semantics. The paradigm can be used to achieve a wide range of consistency semantics from strict atomic transactions to standard process semantics. The paradigm supports three types of data consistency. Object programmers indicate the type of consistency desired on a per-operation basis and the system performs automatic concurrency control and recovery management to ensure that those consistency requirements are met. This allows programmers to customize consistency and recovery on a per-application basis without having to supply complicated, custom recovery management schemes. The paradigm allows robust and nonrobust computation to operate concurrently on the same data in a well defined manner. The operating system needs to support only one vehicle of computation - the thread.

Genetic heterogeneity in wild isolates of cellular slime mold social groups.

PubMed

Sathe, Santosh; Kaushik, Sonia; Lalremruata, Albert; Aggarwal, Ramesh K; Cavender, James C; Nanjundiah, Vidyanand

2010-07-01

This study addresses the issues of spatial distribution, dispersal, and genetic heterogeneity in social groups of the cellular slime molds (CSMs). The CSMs are soil amoebae with an unusual life cycle that consists of alternating solitary and social phases. Because the social phase involves division of labor with what appears to be an extreme form of "altruism", the CSMs raise interesting evolutionary questions regarding the origin and maintenance of sociality. Knowledge of the genetic structure of social groups in the wild is necessary for answering these questions. We confirm that CSMs are widespread in undisturbed forest soil from South India. They are dispersed over long distances via the dung of a variety of large mammals. Consistent with this mode of dispersal, most social groups in the two species examined for detailed study, Dictyostelium giganteum and Dictyostelium purpureum, are multi-clonal.

78 FR 44532 - Steel Threaded Rod From India: Initiation of Countervailing Duty Investigation

Federal Register 2010, 2011, 2012, 2013, 2014

2013-07-24

... DEPARTMENT OF COMMERCE International Trade Administration [C-533-856] Steel Threaded Rod From... Commerce (``Department'') received a countervailing duty (``CVD'') petition concerning imports of steel...\\ Petitioners are domestic producers of steel threaded rod. On July 2, and July 3, 2013, the Department...

Unpicking the signal thread of the sector web spider Zygiella x-notata

PubMed Central

Mortimer, Beth; Holland, Chris; Windmill, James F. C.; Vollrath, Fritz

2015-01-01

Remote sensing allows an animal to extend its morphology with appropriate conductive materials and sensors providing environmental feedback from spatially removed locations. For example, the sector web spider Zygiella x-notata uses a specialized thread as both a structural bridge and signal transmitter to monitor web vibrations from its retreat at the web perimeter. To unravel this model multifunctional system, we investigated Zygiella's signal thread structure with a range of techniques, including tensile testing, laser vibrometry, electron microscopy and behavioural analysis. We found that signal threads varied significantly in the number of filaments; a result of the spider adding a lifeline each time it runs along the bridge. Our mechanical property analysis suggests that while the structure varies, its normalized load does not. We propose that the signal thread represents a complex and fully integrated multifunctional structure where filaments can be added, thus increasing absolute load-bearing capacity while maintaining signal fidelity. We conclude that such structures may serve as inspiration for remote sensing design strategies. PMID:26674191

The research and development of the non-contact detection of the tubing internal thread with a line structured light

NASA Astrophysics Data System (ADS)

Hu, Yuanyuan; Xu, Yingying; Hao, Qun; Hu, Yao

2013-12-01

The tubing internal thread plays an irreplaceable role in the petroleum equipment. The unqualified tubing can directly lead to leakage, slippage and bring huge losses for oil industry. For the purpose of improving efficiency and precision of tubing internal thread detection, we develop a new non-contact tubing internal thread measurement system based on the laser triangulation principle. Firstly, considering that the tubing thread had a small diameter and relatively smooth surface, we built a set of optical system with a line structured light to irradiate the internal thread surface and obtain an image which contains the internal thread profile information through photoelectric sensor. Secondly, image processing techniques were used to do the edge detection of the internal thread from the obtained image. One key method was the sub-pixel technique which greatly improved the detection accuracy under the same hardware conditions. Finally, we restored the real internal thread contour information on the basis of laser triangulation method and calculated tubing thread parameters such as the pitch, taper and tooth type angle. In this system, the profile of several thread teeth can be obtained at the same time. Compared with other existing scanning methods using point light and stepper motor, this system greatly improves the detection efficiency. Experiment results indicate that this system can achieve the high precision and non-contact measurement of the tubing internal thread.

Cell-laden composite suture threads for repairing damaged tendons.

PubMed

Costa-Almeida, Raquel; Domingues, Rui M A; Fallahi, Afsoon; Avci, Huseyin; Yazdi, Iman K; Akbari, Mohsen; Reis, Rui L; Tamayol, Ali; Gomes, Manuela E; Khademhosseini, Ali

2018-04-01

Tendons have limited regenerative capacity due to their low cellularity and hypovascular nature, which results in poor clinical outcomes of presently used therapies. As tendon injuries are often observed in active adults, it poses an increasing socio-economic burden on healthcare systems. Currently, suture threads are used during surgical repair to anchor the tissue graft or to connect injured ends. Here, we created composite suture threads coated with a layer of cell-laden hydrogel that can be used for bridging the injured tissue aiming at tendon regeneration. In addition, the fibres can be used to engineer 3-dimensional constructs through textile processes mimicking the architecture and mechanical properties of soft tissues, including tendons and ligaments. Encapsulated human tendon-derived cells migrated within the hydrogel and aligned at the surface of the core thread. An up-regulation of tendon-related genes (scleraxis and tenascin C) and genes involved in matrix remodelling (matrix metalloproteinases 1, matrix metalloproteinases 2) was observed. Cells were able to produce a collagen-rich matrix, remodelling their micro-environment, which is structurally comparable to native tendon tissue. Copyright © 2017 John Wiley & Sons, Ltd.

Modeling Cooperative Threads to Project GPU Performance for Adaptive Parallelism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meng, Jiayuan; Uram, Thomas; Morozov, Vitali A.

Most accelerators, such as graphics processing units (GPUs) and vector processors, are particularly suitable for accelerating massively parallel workloads. On the other hand, conventional workloads are developed for multi-core parallelism, which often scale to only a few dozen OpenMP threads. When hardware threads significantly outnumber the degree of parallelism in the outer loop, programmers are challenged with efficient hardware utilization. A common solution is to further exploit the parallelism hidden deep in the code structure. Such parallelism is less structured: parallel and sequential loops may be imperfectly nested within each other, neigh boring inner loops may exhibit different concurrency patternsmore » (e.g. Reduction vs. Forall), yet have to be parallelized in the same parallel section. Many input-dependent transformations have to be explored. A programmer often employs a larger group of hardware threads to cooperatively walk through a smaller outer loop partition and adaptively exploit any encountered parallelism. This process is time-consuming and error-prone, yet the risk of gaining little or no performance remains high for such workloads. To reduce risk and guide implementation, we propose a technique to model workloads with limited parallelism that can automatically explore and evaluate transformations involving cooperative threads. Eventually, our framework projects the best achievable performance and the most promising transformations without implementing GPU code or using physical hardware. We envision our technique to be integrated into future compilers or optimization frameworks for autotuning.« less

Mapping virtual addresses to different physical addresses for value disambiguation for thread memory access requests

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gala, Alan; Ohmacht, Martin

A multiprocessor system includes nodes. Each node includes a data path that includes a core, a TLB, and a first level cache implementing disambiguation. The system also includes at least one second level cache and a main memory. For thread memory access requests, the core uses an address associated with an instruction format of the core. The first level cache uses an address format related to the size of the main memory plus an offset corresponding to hardware thread meta data. The second level cache uses a physical main memory address plus software thread meta data to store the memorymore » access request. The second level cache accesses the main memory using the physical address with neither the offset nor the thread meta data after resolving speculation. In short, this system includes mapping of a virtual address to a different physical addresses for value disambiguation for different threads.« less

Effect of Thread and Rotating Speed on Material Flow Behavior and Mechanical Properties of Friction Stir Lap Welding Joints

NASA Astrophysics Data System (ADS)

Ji, Shude; Li, Zhengwei; Zhou, Zhenlu; Wu, Baosheng

2017-10-01

This study focused on the effects of thread on hook and cold lap formation, lap shear property and impact toughness of alclad 2024-T4 friction stir lap welding (FSLW) joints. Except the traditional threaded pin tool (TR-tool), three new tools with different thread locations and orientations were designed. Results showed that thread significantly affected hook, cold lap morphologies and lap shear properties. The tool with tip-threaded pin (T-tool) fabricated joint with flat hook and cold lap, which resulted in shear fracture mode. The tools with bottom-threaded pin (B-tool) eliminated the hook. The tool with reverse-threaded pin (R-tool) widened the stir zone width. When using configuration A, the joints fabricated by the three new tools showed higher failure loads than the joint fabricated by the TR-tool. The joint using the T-tool owned the optimum impact toughness. This study demonstrated the significance of thread during FSLW and provided a reference to optimize tool geometry.

Why Is There a Glass Ceiling for Threading Based Protein Structure Prediction Methods?

PubMed

Skolnick, Jeffrey; Zhou, Hongyi

2017-04-20

Despite their different implementations, comparison of the best threading approaches to the prediction of evolutionary distant protein structures reveals that they tend to succeed or fail on the same protein targets. This is true despite the fact that the structural template library has good templates for all cases. Thus, a key question is why are certain protein structures threadable while others are not. Comparison with threading results on a set of artificial sequences selected for stability further argues that the failure of threading is due to the nature of the protein structures themselves. Using a new contact map based alignment algorithm, we demonstrate that certain folds are highly degenerate in that they can have very similar coarse grained fractions of native contacts aligned and yet differ significantly from the native structure. For threadable proteins, this is not the case. Thus, contemporary threading approaches appear to have reached a plateau, and new approaches to structure prediction are required.

Microbial Variants from Iron Ore Slimes: Mineral Specificity and pH Tolerance.

PubMed

Abhilash; Ghosh, A; Pandey, B D; Sarkar, S

2015-12-01

This paper describes the isolation of the native bacterial strains from the iron ore mines slime pond and its extremophilic characteristics. The two microbial isolates designated as CNIOS-1 and CNIOS-2 were grown in selective silicate broth at pH 7.0 and the organisms were tested for their selective adhesion on silicate and alumina minerals. The silicate bacteria with their exopolymers are very potent to grow over aluminosilicates. It was established that CNIOS-1 grew preferentially in the presence of silicate mineral compared to CNIOS-2 which grew in the presence of alumina. The organisms were tested for growth at various pH and trials were carried to define their efficacy for eventual applications to remove gangue minerals of silica and alumina from the raw material.

Implications of Thermal Annealing on the Benzene Vapor Sensing Behavior of PEVA-Graphene Nanocomposite Threads.

PubMed

Patel, Sanjay V; Cemalovic, Sabina; Tolley, William K; Hobson, Stephen T; Anderson, Ryan; Fruhberger, Bernd

2018-03-23

The effect of thermal treatments, on the benzene vapor sensitivity of polyethylene (co-)vinylacetate (PEVA)/graphene nanocomposite threads, used as chemiresistive sensors, was investigated using DC resistance measurements, differential scanning calorimetry (DSC), and scanning electron microscopy (SEM). These flexible threads are being developed as low-cost, easy-to-measure chemical sensors that can be incorporated into smart clothing or disposable sensing patches. Chemiresistive threads were solution-cast or extruded from PEVA and <10% graphene nanoplatelets (by mass) in toluene. Threads were annealed at various temperatures and showed up to 2 orders of magnitude decrease in resistance with successive anneals. Threads heated to ≥80 °C showed improved limits of detection, resulting from improved signal-noise, when exposed to benzene vapor in dry air. In addition, annealing increased the speed of response and recovery upon exposure to and removal of benzene vapor. DSC results showed that the presence of graphene raises the freezing point, and may allow greater crystallinity, in the nanocomposite after annealing. SEM images confirm increased surface roughness/area, which may account for the increase response speed after annealing. Benzene vapor detection at 5 ppm is demonstrated with limits of detection estimated to be as low as 1.5 ppm, reflecting an order of magnitude improvement over unannealed threads.

Evaluating the use of laser radiation in cleaning of copper embroidery threads on archaeological Egyptian textiles

NASA Astrophysics Data System (ADS)

Abdel-Kareem, Omar; Harith, M. A.

2008-07-01

Cleaning of copper embroidery threads on archaeological textiles is still a complicated conservation process, as most textile conservators believe that the advantages of using traditional cleaning techniques are less than their disadvantages. In this study, the uses of laser cleaning method and two modified recipes of wet cleaning methods were evaluated for cleaning of the corroded archaeological Egyptian copper embroidery threads on an archaeological Egyptian textile fabric. Some corroded copper thread samples were cleaned using modified recipes of wet cleaning method; other corroded copper thread samples were cleaned with Q-switched Nd:YAG laser radiation of wavelength 532 nm. All tested metal thread samples before and after cleaning were investigated using a light microscope and a scanning electron microscope with an energy dispersive X-ray analysis unit. Also the laser-induced breakdown spectroscopy (LIBS) technique was used for the elemental analysis of laser-cleaned samples to follow up the laser cleaning procedure. The results show that laser cleaning is the most effective method among all tested methods in the cleaning of corroded copper threads. It can be used safely in removing the corrosion products without any damage to both metal strips and fibrous core. The tested laser cleaning technique has solved the problems caused by other traditional cleaning techniques that are commonly used in the cleaning of metal threads on museum textiles.

Press-fit versus threaded acetabular cups in total hip arthroplasty: Functional and radiological results after five years.

PubMed

Ellenrieder, Martin; Bader, Rainer; Bergschmidt, Philipp; Mittelmeier, Wolfram

2016-03-01

Prospectively the outcome after total hip replacement with a new threaded acetabular cup design was compared to an established press-fit cup. After 1, 2 and 5 years, the 36-item Short Form Health Survey, Western Ontario and McMaster University Osteoarthritis Index and Harris Hip Score revealed no significant differences between the two groups (each group: n=42 patients), except for a higher Harris Hip Score in the threaded cup group after five years (p=0.02). After five years, one threaded cup had a mild radiolucent line without further signs of loosening. All other cups of both groups (98.6%) showed a full osseous integration. The cup inclination angle ranged from 41-58° (threaded cups) to 39-77° (press-fit cups). The new threaded cup provides equivalent clinical outcomes and osseous integration but more precise implant positioning compared to the press-fit design. No complications typically ascribed to threaded cups (acetabular fractures, bone resorption, nerve impairment) occurred.

Exon–intron organization of genes in the slime mold Physarum polycephalum

PubMed Central

Trzcinska-Danielewicz, Joanna; Fronk, Jan

2000-01-01

The slime mold Physarum polycephalum is a morphologically simple organism with a large and complex genome. The exon–intron organization of its genes exhibits features typical for protists and fungi as well as those characteristic for the evolutionarily more advanced species. This indicates that both the taxonomic position as well as the size of the genome shape the exon–intron organization of an organism. The average gene has 3.7 introns which are on average 138 bp, with a rather narrow size distribution. Introns are enriched in AT base pairs by 13% relative to exons. The consensus sequences at exon–intron boundaries resemble those found for other species, with minor differences between short and long introns. A unique feature of P.polycephalum introns is the strong preference for pyrimidines in the coding strand throughout their length, without a particular enrichment at the 3′-ends. PMID:10982858

Dynamics of threading dislocations in porous heteroepitaxial GaN films

NASA Astrophysics Data System (ADS)

Gutkin, M. Yu.; Rzhavtsev, E. A.

2017-12-01

Behavior of threading dislocations in porous heteroepitaxial gallium nitride (GaN) films has been studied using computer simulation by the two-dimensional discrete dislocation dynamics approach. A computational scheme, where pores are modeled as cross sections of cylindrical cavities, elastically interacting with unidirectional parallel edge dislocations, which imitate threading dislocations, is used. Time dependences of coordinates and velocities of each dislocation from dislocation ensembles under investigation are obtained. Visualization of current structure of dislocation ensemble is performed in the form of a location map of dislocations at any time. It has been shown that the density of appearing dislocation structures significantly depends on the ratio of area of a pore cross section to area of the simulation region. In particular, increasing the portion of pores surface on the layer surface up to 2% should lead to about a 1.5-times decrease of the final density of threading dislocations, and increase of this portion up to 15% should lead to approximately a 4.5-times decrease of it.

Coupled Oscillators System in the True Slime Mold

NASA Astrophysics Data System (ADS)

Takamatsu, A.; Fujii, T.; Endo, I.

The Plasmodium of true slime mold, Physarum polycephalum, which shows various oscillatory phenomena, can be regarded as a coupled nonlinear oscillators system. The partial bodies of the Plasmodium are interconnected by microscale tubes, whose dimension can be related to the coupling strength between the plasmodial oscillators. Investigation on the collective behavior of the oscillators under the condition that the configuration of the tube structure can be manipulated gives significant information on the characteristics of the Plasmodium from the viewpoint of nonlinear dynamics. In this study, we propose a living coupled oscillators system. Using a microfabricated structure, we patterned the geometry and the dimensions of the microscale tube structure of the Plasmodium. As the first step, the Plasmodium was grown in the microstructure for coupled two oscillators system that has two wells (oscillator part) and a microchannel (coupling part). We investigated the oscillation bahavior by monitoring the thickness oscillation of Plasmodium in the strucutre with various width (W) and length (L) of microchannel. We found that there are various types of oscillation bahavior, such as anti-phase and in-phase oscillations depending on the channel dimension W and L. The present method is suitable for further studies of the network of the Plasmodium as a collective nonlinear oscillators system.

Developing eThread Pipeline Using SAGA-Pilot Abstraction for Large-Scale Structural Bioinformatics

PubMed Central

Ragothaman, Anjani; Feinstein, Wei; Jha, Shantenu; Kim, Joohyun

2014-01-01

While most of computational annotation approaches are sequence-based, threading methods are becoming increasingly attractive because of predicted structural information that could uncover the underlying function. However, threading tools are generally compute-intensive and the number of protein sequences from even small genomes such as prokaryotes is large typically containing many thousands, prohibiting their application as a genome-wide structural systems biology tool. To leverage its utility, we have developed a pipeline for eThread—a meta-threading protein structure modeling tool, that can use computational resources efficiently and effectively. We employ a pilot-based approach that supports seamless data and task-level parallelism and manages large variation in workload and computational requirements. Our scalable pipeline is deployed on Amazon EC2 and can efficiently select resources based upon task requirements. We present runtime analysis to characterize computational complexity of eThread and EC2 infrastructure. Based on results, we suggest a pathway to an optimized solution with respect to metrics such as time-to-solution or cost-to-solution. Our eThread pipeline can scale to support a large number of sequences and is expected to be a viable solution for genome-scale structural bioinformatics and structure-based annotation, particularly, amenable for small genomes such as prokaryotes. The developed pipeline is easily extensible to other types of distributed cyberinfrastructure. PMID:24995285

Protein Structure Prediction by Protein Threading

NASA Astrophysics Data System (ADS)

Xu, Ying; Liu, Zhijie; Cai, Liming; Xu, Dong

The seminal work of Bowie, Lüthy, and Eisenberg (Bowie et al., 1991) on "the inverse protein folding problem" laid the foundation of protein structure prediction by protein threading. By using simple measures for fitness of different amino acid types to local structural environments defined in terms of solvent accessibility and protein secondary structure, the authors derived a simple and yet profoundly novel approach to assessing if a protein sequence fits well with a given protein structural fold. Their follow-up work (Elofsson et al., 1996; Fischer and Eisenberg, 1996; Fischer et al., 1996a,b) and the work by Jones, Taylor, and Thornton (Jones et al., 1992) on protein fold recognition led to the development of a new brand of powerful tools for protein structure prediction, which we now term "protein threading." These computational tools have played a key role in extending the utility of all the experimentally solved structures by X-ray crystallography and nuclear magnetic resonance (NMR), providing structural models and functional predictions for many of the proteins encoded in the hundreds of genomes that have been sequenced up to now.

Rapid and reliable protein structure determination via chemical shift threading.

PubMed

Hafsa, Noor E; Berjanskii, Mark V; Arndt, David; Wishart, David S

2018-01-01

Protein structure determination using nuclear magnetic resonance (NMR) spectroscopy can be both time-consuming and labor intensive. Here we demonstrate how chemical shift threading can permit rapid, robust, and accurate protein structure determination using only chemical shift data. Threading is a relatively old bioinformatics technique that uses a combination of sequence information and predicted (or experimentally acquired) low-resolution structural data to generate high-resolution 3D protein structures. The key motivations behind using NMR chemical shifts for protein threading lie in the fact that they are easy to measure, they are available prior to 3D structure determination, and they contain vital structural information. The method we have developed uses not only sequence and chemical shift similarity but also chemical shift-derived secondary structure, shift-derived super-secondary structure, and shift-derived accessible surface area to generate a high quality protein structure regardless of the sequence similarity (or lack thereof) to a known structure already in the PDB. The method (called E-Thrifty) was found to be very fast (often < 10 min/structure) and to significantly outperform other shift-based or threading-based structure determination methods (in terms of top template model accuracy)-with an average TM-score performance of 0.68 (vs. 0.50-0.62 for other methods). Coupled with recent developments in chemical shift refinement, these results suggest that protein structure determination, using only NMR chemical shifts, is becoming increasingly practical and reliable. E-Thrifty is available as a web server at http://ethrifty.ca .

Compliant threads maximize spider silk connection strength and toughness

PubMed Central

Meyer, Avery; Pugno, Nicola M.; Cranford, Steven W.

2014-01-01

Millions of years of evolution have adapted spider webs to achieve a range of functionalities, including the well-known capture of prey, with efficient use of material. One feature that has escaped extensive investigation is the silk-on-silk connection joints within spider webs, particularly from a structural mechanics perspective. We report a joint theoretical and computational analysis of an idealized silk-on-silk fibre junction. By modifying the theory of multiple peeling, we quantitatively compare the performance of the system while systematically increasing the rigidity of the anchor thread, by both scaling the stress–strain response and the introduction of an applied pre-strain. The results of our study indicate that compliance is a virtue—the more extensible the anchorage, the tougher and stronger the connection becomes. In consideration of the theoretical model, in comparison with rigid substrates, a compliant anchorage enormously increases the effective adhesion strength (work required to detach), independent of the adhered thread itself, attributed to a nonlinear alignment between thread and anchor (contact peeling angle). The results can direct novel engineering design principles to achieve possible load transfer from compliant fibre-to-fibre anchorages, be they silk-on-silk or another, as-yet undeveloped, system. PMID:25008083

Integrating end-to-end threads of control into object-oriented analysis and design

NASA Technical Reports Server (NTRS)

Mccandlish, Janet E.; Macdonald, James R.; Graves, Sara J.

1993-01-01

Current object-oriented analysis and design methodologies fall short in their use of mechanisms for identifying threads of control for the system being developed. The scenarios which typically describe a system are more global than looking at the individual objects and representing their behavior. Unlike conventional methodologies that use data flow and process-dependency diagrams, object-oriented methodologies do not provide a model for representing these global threads end-to-end. Tracing through threads of control is key to ensuring that a system is complete and timing constraints are addressed. The existence of multiple threads of control in a system necessitates a partitioning of the system into processes. This paper describes the application and representation of end-to-end threads of control to the object-oriented analysis and design process using object-oriented constructs. The issue of representation is viewed as a grouping problem, that is, how to group classes/objects at a higher level of abstraction so that the system may be viewed as a whole with both classes/objects and their associated dynamic behavior. Existing object-oriented development methodology techniques are extended by adding design-level constructs termed logical composite classes and process composite classes. Logical composite classes are design-level classes which group classes/objects both logically and by thread of control information. Process composite classes further refine the logical composite class groupings by using process partitioning criteria to produce optimum concurrent execution results. The goal of these design-level constructs is to ultimately provide the basis for a mechanism that can support the creation of process composite classes in an automated way. Using an automated mechanism makes it easier to partition a system into concurrently executing elements that can be run in parallel on multiple processors.

Potential sites for the perception of gravity in the acellular slime mold Physarum polycephalum.

PubMed

Block, I; Briegleb, W

1989-01-01

Recently a gravisensitivity of the acellular slime mold Physarum polycephalum, which possesses no specialized gravireceptor, could be established by conducting experiments under simulated and under real near weightlessness. In these experiments macroplasmodia showed a modulation of their contraction rhythm followed by regulation phenomena. Until now the perception mechanism for the gravistimulus is unknown, but several findings indicate the involvement of mitochondria: A) During the impediment of respiration the 0g-reaction is inhibited and the regulation is reduced. B) The response to a light stimulus and the following regulation phenomena strongly resemble the behavior during exposure to 0g, the only difference is that the two reactions are directed into opposite directions. In the blue-light reaction a flavin of the mitochondrial matrix seems to be involved in the light perception. C) The contraction rhythm as well as its modulations are coupled to rhythmic changes in the levels of ATP and calcium ions, involving the mitochondria as sites of energy production and of Ca(++)-storage. So the mitochondria could be the site of the regulation and they possibly are the receptor sites for the light and gravity stimuli. Also the observation of a morphologic polarity of the slime mold's plasmodial strands has to be considered: Cross-sections reveal that the ectoplasmic wall surrounding the streaming endoplasm is much thinner on the physically lower side than on the upper side of the strand--this applies to strands lying on or hanging on a horizontal surface. So, in addition to the mitochondria, also the morphologic polarity may be involved in the perception mechanism of the observed gravisensitivity and of the recently established geotaxis. The potential role of the nuclei and of the contractile elements in the perception of gravity is also discussed.

Improving threading algorithms for remote homology modeling by combining fragment and template comparisons

PubMed Central

Zhou, Hongyi; Skolnick, Jeffrey

2010-01-01

In this work, we develop a method called FTCOM for assessing the global quality of protein structural models for targets of medium and hard difficulty (remote homology) produced by structure prediction approaches such as threading or ab initio structure prediction. FTCOM requires the Cα coordinates of full length models and assesses model quality based on fragment comparison and a score derived from comparison of the model to top threading templates. On a set of 361 medium/hard targets, FTCOM was applied to and assessed for its ability to improve upon the results from the SP3, SPARKS, PROSPECTOR_3, and PRO-SP3-TASSER threading algorithms. The average TM-score improves by 5%–10% for the first selected model by the new method over models obtained by the original selection procedure in the respective threading methods. Moreover the number of foldable targets (TM-score ≥0.4) increases from least 7.6% for SP3 to 54% for SPARKS. Thus, FTCOM is a promising approach to template selection. PMID:20455261

Study of Measurement Strategies of Geometric Deviation of the Position of the Threaded Holes

NASA Astrophysics Data System (ADS)

Drbul, Mário; Martikan, Pavol; Sajgalik, Michal; Czan, Andrej; Broncek, Jozef; Babik, Ondrej

2017-12-01

Verification of product and quality control is an integral part of current production process. In terms of functional requirements and product interoperability, it is necessary to analyze their dimensional and also geometric specifications. Threaded holes are verified elements too, which are a substantial part of detachable screw connections and have a broad presence in engineering products. This paper deals with on the analysing of measurement strategies of verification geometric deviation of the position of the threaded holes, which are the indirect method of measuring threaded pins when applying different measurement strategies which can affect the result of the verification of the product..

VoiceThread: A Useful Program Evaluation Tool

ERIC Educational Resources Information Center

Mott, Rebecca

2018-01-01

With today's technology, Extension professionals have a variety of tools available for program evaluation. This article describes an innovative platform called VoiceThread that has been used in many classrooms but also is useful for conducting virtual focus group research. I explain how this tool can be used to collect qualitative participant…

Red blood cell transport mechanisms in polyester thread-based blood typing devices.

PubMed

Nilghaz, Azadeh; Ballerini, David R; Guan, Liyun; Li, Lizi; Shen, Wei

2016-02-01

A recently developed blood typing diagnostic based on a polyester thread substrate has shown great promise for use in medical emergencies and in impoverished regions. The device is easy to use and transport, while also being inexpensive, accurate, and rapid. This study used a fluorescent confocal microscope to delve deeper into how red blood cells were behaving within the polyester thread-based diagnostic at the cellular level, and how plasma separation could be made to visibly occur on the thread, making it possible to identify blood type in a single step. Red blood cells were stained and the plasma phase dyed with fluorescent compounds to enable them to be visualised under the confocal microscope at high magnification. The mechanisms uncovered were in surprising contrast with those found for a similar, paper-based method. Red blood cell aggregates did not flow over each other within the thread substrate as expected, but suffered from a restriction to their flow which resulted in the chromatographic separation of the RBCs from the liquid phase of the blood. It is hoped that these results will lead to the optimisation of the method to enable more accurate and sensitive detection, increasing the range of blood systems that can be detected.

Quick-connect threaded attachment joint

NASA Technical Reports Server (NTRS)

Lucy, M. H.; Messick, W. R.; Vasquez, P.

1979-01-01

Joint is self-aligning and tightens with only sixty-five degrees of rotation for quick connects and disconnects. Made of injection-molded plastics or cast or machined aluminum, joint can carry wires, tubes, liquids, or gases. When two parts of joint are brought together, their shapes align them. Small projections on male section and slots on female section further aid alignment; slight rotation of male form engages projections in slots. At this point, threads engage and male section is rotated until joint is fully engaged.

Developmental and Spatial Expression of sir2 Genes in the Cellular Slime Mold Dictyostelium discoideum.

PubMed

Katayama, Takahiro; Yasukawa, Hiro

2008-01-01

The cellular slime mold Dictyostelium discoideum grows as unicellular free-living amoebae in the presence of nutrients. Upon starvation, the amoebae aggregate and form multicellular structures that each consist of a stalk and spores. D. discoideum encodes at least four proteins (Sir2A, Sir2B, Sir2C, and Sir2D) homologous to human SIRT. RT-PCR and WISH analyses showed that the genes for Sir2A, Sir2C, and Sir2D were expressed at high levels in growing cells but at decreased levels in developing cells, whereas the gene encoding Sir2B was expressed in the prestalk-cell region in the developmental phase.

Oscillation of the velvet worm slime jet by passive hydrodynamic instability

PubMed Central

Concha, Andrés; Mellado, Paula; Morera-Brenes, Bernal; Sampaio Costa, Cristiano; Mahadevan, L; Monge-Nájera, Julián

2015-01-01

The rapid squirt of a proteinaceous slime jet endows velvet worms (Onychophora) with a unique mechanism for defence from predators and for capturing prey by entangling them in a disordered web that immobilizes their target. However, to date, neither qualitative nor quantitative descriptions have been provided for this unique adaptation. Here we investigate the fast oscillatory motion of the oral papillae and the exiting liquid jet that oscillates with frequencies f~30–60 Hz. Using anatomical images, high-speed videography, theoretical analysis and a physical simulacrum, we show that this fast oscillatory motion is the result of an elastohydrodynamic instability driven by the interplay between the elasticity of oral papillae and the fast unsteady flow during squirting. Our results demonstrate how passive strategies can be cleverly harnessed by organisms, while suggesting future oscillating microfluidic devices, as well as novel ways for micro and nanofibre production using bioinspired strategies. PMID:25780995

Identification of cysteine protease inhibitors that belong to cystatin family 1 in the cellular slime mold Dictyostelium discoideum.

PubMed

El-Halawany, Medhat S; Ohkouchi, Susumu; Shibata, Hideki; Hitomi, Kiyotaka; Maki, Masatoshi

2004-06-01

Family 1 cystatins are cytosolic inhibitors of cysteine proteases, and they are conserved in higher eukaryotes. We characterized two newly identified family 1 cystatins of the cellular slime mold Dictyostelium discoideum, cystatin A1 and A2. Their recombinant proteins showed specific inhibitory activity against papain and cathepsin B, respectively. Using specific polyclonal antibodies, we found that cystatin A1 is stably expressed throughout the life cycle of Dictyostelium, whereas cystatin A2 expression is up-regulated during the course of development.

Synergistic mixtures for control of slime-forming bacteria and other delete rious micro-organisms and processes using same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tant, C.O.; Turner, N.E.; Bennett, E.O.

1969-09-30

Microbiocide compositions are described having a synergistic biocide effect on microorganisms, such as slime- forming bateria and other microorganisms considered to be deleterious or troublesome in water and especially in waterflooding operations, such as are used in the secondary recovery of petroleum oil in subterranean formations. The synergistic compositions consist of paired or multiple combinations of at least one of each of (1) compounds having furan, dihydrofuran or tetrahydrofuran nuclei, and (2) compounds having phenol nuclei or chloroanilines. (17 claims)

Thread mapping using system-level model for shared memory multicores

NASA Astrophysics Data System (ADS)

Mitra, Reshmi

Exploring thread-to-core mapping options for a parallel application on a multicore architecture is computationally very expensive. For the same algorithm, the mapping strategy (MS) with the best response time may change with data size and thread counts. The primary challenge is to design a fast, accurate and automatic framework for exploring these MSs for large data-intensive applications. This is to ensure that the users can explore the design space within reasonable machine hours, without thorough understanding on how the code interacts with the platform. Response time is related to the cycles per instructions retired (CPI), taking into account both active and sleep states of the pipeline. This work establishes a hybrid approach, based on Markov Chain Model (MCM) and Model Tree (MT) for system-level steady state CPI prediction. It is designed for shared memory multicore processors with coarse-grained multithreading. The thread status is represented by the MCM states. The program characteristics are modeled as the transition probabilities, representing the system moving between active and suspended thread states. The MT model extrapolates these probabilities for the actual application size (AS) from the smaller AS performance. This aspect of the framework, along with, the use of mathematical expressions for the actual AS performance information, results in a tremendous reduction in the CPI prediction time. The framework is validated using an electromagnetics application. The average performance prediction error for steady state CPI results with 12 different MSs is less than 1%. The total run time of model is of the order of minutes, whereas the actual application execution time is in terms of days.

46 CFR 56.30-20 - Threaded joints.

Code of Federal Regulations, 2014 CFR

2014-10-01

..., inches Maximum pressure, p.s.i.g. Above 2″ (Not permitted in Class I piping service.) Above 1″ up to 2... joints appear in the low temperature piping section. 2 Threaded joints in hydraulic systems are permitted above the pressures indicated for the nominal sizes shown when commercially available components such as...

46 CFR 56.30-20 - Threaded joints.

Code of Federal Regulations, 2011 CFR

2011-10-01

..., inches Maximum pressure, p.s.i.g. Above 2″ (Not permitted in Class I piping service.) Above 1″ up to 2... joints appear in the low temperature piping section. 2 Threaded joints in hydraulic systems are permitted above the pressures indicated for the nominal sizes shown when commercially available components such as...

46 CFR 56.30-20 - Threaded joints.

Code of Federal Regulations, 2013 CFR

2013-10-01

..., inches Maximum pressure, p.s.i.g. Above 2″ (Not permitted in Class I piping service.) Above 1″ up to 2... joints appear in the low temperature piping section. 2 Threaded joints in hydraulic systems are permitted above the pressures indicated for the nominal sizes shown when commercially available components such as...

46 CFR 56.30-20 - Threaded joints.

Code of Federal Regulations, 2012 CFR

2012-10-01

..., inches Maximum pressure, p.s.i.g. Above 2″ (Not permitted in Class I piping service.) Above 1″ up to 2... joints appear in the low temperature piping section. 2 Threaded joints in hydraulic systems are permitted above the pressures indicated for the nominal sizes shown when commercially available components such as...

46 CFR 56.30-20 - Threaded joints.

Code of Federal Regulations, 2010 CFR

2010-10-01

..., inches Maximum pressure, p.s.i.g. Above 2″ (Not permitted in Class I piping service.) Above 1″ up to 2... joints appear in the low temperature piping section. 2 Threaded joints in hydraulic systems are permitted above the pressures indicated for the nominal sizes shown when commercially available components such as...

A knittable fiber-shaped supercapacitor based on natural cotton thread for wearable electronics

NASA Astrophysics Data System (ADS)

Zhou, Qianlong; Jia, Chunyang; Ye, Xingke; Tang, Zhonghua; Wan, Zhongquan

2016-09-01

At present, the topic of building high-performance, miniaturized and mechanically flexible energy storage modules which can be directly integrated into textile based wearable electronics is a hotspot in the wearable technology field. In this paper, we reported a highly flexible fiber-shaped electrode fabricated through a one-step convenient hydrothermal process. The prepared graphene hydrogels/multi-walled carbon nanotubes-cotton thread derived from natural cotton thread is electrochemically active and mechanically strong. Fiber-shaped supercapacitor based on the prepared fiber electrodes and polyvinyl alcohol-H3PO4 gel electrolyte exhibits good capacitive performance (97.73 μF cm-1 at scan rate of 2 mV s-1), long cycle life (95.51% capacitance retention after 8000 charge-discharge cycles) and considerable stability (90.75% capacitance retention after 500 continuous bending cycles). Due to its good mechanical and electrochemical properties, the graphene hydrogels/multi-walled carbon nanotubes-cotton thread based all-solid fiber-shaped supercapacitor can be directly knitted into fabrics and maintain its original capacitive performance. Such a low-cost textile thread based versatile energy storage device may hold great potential for future wearable electronics applications.

Successive Two-sided Loop Jets Caused by Magnetic Reconnection between Two Adjacent Filamentary Threads

NASA Astrophysics Data System (ADS)

Tian, Zhanjun; Liu, Yu; Shen, Yuandeng; Elmhamdi, Abouazza; Su, Jiangtao; Liu, Ying D.; Kordi, Ayman. S.

2017-08-01

We present observational analysis of two successive two-sided loop jets observed by the ground-based New Vacuum Solar Telescope and the space-borne Solar Dynamics Observatory. The two successive two-sided loop jets manifested similar evolution processes and both were associated with the interaction of two small-scale adjacent filamentary threads, magnetic emerging, and cancellation processes at the jet’s source region. High temporal and high spatial resolution observations reveal that the two adjacent ends of the two filamentary threads are rooted in opposite magnetic polarities within the source region. The two threads approached each other, and then an obvious brightening patch is observed at the interaction position. Subsequently, a pair of hot plasma ejections are observed heading in opposite directions along the paths of the two filamentary threads at a typical speed for two-sided loop jets of the order 150 km s-1. Close to the end of the second jet, we report the formation of a bright hot loop structure at the source region, which suggests the formation of new loops during the interaction. Based on the observational results, we propose that the observed two-sided loop jets are caused by magnetic reconnection between the two adjacent filamentary threads, largely different from the previous scenario that a two-sided loop jet is generated by magnetic reconnection between an emerging bipole and the overlying horizontal magnetic fields.

Comparative analysis of textile metal threads from liturgical vestments and folk costumes in Croatia

NASA Astrophysics Data System (ADS)

Šimić, Kristina; Zamboni, Ivana; Fazinić, Stjepko; Mudronja, Domagoj; Sović, Lea; Gouasmia, Sabrina; Soljačić, Ivo

2018-02-01

Textile is essential for everyday life in all societies. It is used in clothes for protection and warmth but also to indicate class and position, show wealth and social status. Threads from precious metals have also been used in combination with fibres for decoration in order to create luxury fabrics for secular and religious elites. We performed elemental analysis of 17th to 20th century metal threads from various textile articles of liturgical vestments and festive folk costumes collected in the museums of northern, southern and central Croatian regions. In order to determine elemental concentrations in threads we performed comparative X-ray Spectroscopy measurements using: (i) Scanning Electron Microscopy with Energy Dispersive X-ray Spectroscopy (SEM-EDX) at the Faculty of Textile Technology, (ii) X-ray Fluorescence Spectroscopy (XRF) at the Croatian Conservation Institute and (iii) Particle Induced X-ray Spectroscopy (PIXE) at the Ruđer Bošković Institute Tandem Accelerator Facility using ion micro beam. Rutherford Backscattering Spectroscopy (RBS) was performed as well on selected samples. SEM-EDX investigations of cross-sections along with the surfaces were also performed. In this work we report and discuss the results obtained by the three X-ray methods and RBS for major (gold, silver, copper) and minor elements on different threads like stripes, wires and "srma" (metal thread wrapped around textile yarn).

Dissecting the Dynamic Pathways of Stereoselective DNA Threading Intercalation

PubMed Central

Almaqwashi, Ali A.; Andersson, Johanna; Lincoln, Per; Rouzina, Ioulia; Westerlund, Fredrik; Williams, Mark C.

2016-01-01

DNA intercalators that have high affinity and slow kinetics are developed for potential DNA-targeted therapeutics. Although many natural intercalators contain multiple chiral subunits, only intercalators with a single chiral unit have been quantitatively probed. Dumbbell-shaped DNA threading intercalators represent the next order of structural complexity relative to simple intercalators, and can provide significant insights into the stereoselectivity of DNA-ligand intercalation. We investigated DNA threading intercalation by binuclear ruthenium complex [μ-dppzip(phen)4Ru2]4+ (Piz). Four Piz stereoisomers are defined by the chirality of the intercalating subunit (Ru(phen)2dppz) and the distal subunit (Ru(phen)2ip), respectively, each of which can be either right-handed (Δ) or left-handed (Λ). We used optical tweezers to measure single DNA molecule elongation due to threading intercalation, revealing force-dependent DNA intercalation rates and equilibrium dissociation constants. The force spectroscopy analysis provided the zero-force DNA binding affinity, the equilibrium DNA-ligand elongation Δxeq, and the dynamic DNA structural deformations during ligand association xon and dissociation xoff. We found that Piz stereoisomers exhibit over 20-fold differences in DNA binding affinity, from a Kd of 27 ± 3 nM for (Δ,Λ)-Piz to a Kd of 622 ± 55 nM for (Λ,Δ)-Piz. The striking affinity decrease is correlated with increasing Δxeq from 0.30 ± 0.02 to 0.48 ± 0.02 nm and xon from 0.25 ± 0.01 to 0.46 ± 0.02 nm, but limited xoff changes. Notably, the affinity and threading kinetics is 10-fold enhanced for right-handed intercalating subunits, and 2- to 5-fold enhanced for left-handed distal subunits. These findings demonstrate sterically dispersed transition pathways and robust DNA structural recognition of chiral intercalators, which are critical for optimizing DNA binding affinity and kinetics. PMID:27028636

78 FR 71565 - Steel Threaded Rod from India: Postponement of Preliminary Determination of Antidumping Duty...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-11-29

... India: Postponement of Preliminary Determination of Antidumping Duty Investigation AGENCY: Enforcement... antidumping duty investigation of steel threaded rod from India.\\1\\ The notice of initiation stated that the... Steel Threaded Rod From India and Thailand: Initiation of Antidumping Duty Investigations, 78 FR 44526...

Multi-thread parallel algorithm for reconstructing 3D large-scale porous structures

NASA Astrophysics Data System (ADS)

Ju, Yang; Huang, Yaohui; Zheng, Jiangtao; Qian, Xu; Xie, Heping; Zhao, Xi

2017-04-01

Geomaterials inherently contain many discontinuous, multi-scale, geometrically irregular pores, forming a complex porous structure that governs their mechanical and transport properties. The development of an efficient reconstruction method for representing porous structures can significantly contribute toward providing a better understanding of the governing effects of porous structures on the properties of porous materials. In order to improve the efficiency of reconstructing large-scale porous structures, a multi-thread parallel scheme was incorporated into the simulated annealing reconstruction method. In the method, four correlation functions, which include the two-point probability function, the linear-path functions for the pore phase and the solid phase, and the fractal system function for the solid phase, were employed for better reproduction of the complex well-connected porous structures. In addition, a random sphere packing method and a self-developed pre-conditioning method were incorporated to cast the initial reconstructed model and select independent interchanging pairs for parallel multi-thread calculation, respectively. The accuracy of the proposed algorithm was evaluated by examining the similarity between the reconstructed structure and a prototype in terms of their geometrical, topological, and mechanical properties. Comparisons of the reconstruction efficiency of porous models with various scales indicated that the parallel multi-thread scheme significantly shortened the execution time for reconstruction of a large-scale well-connected porous model compared to a sequential single-thread procedure.

Influence of thread shape and inclination on the biomechanical behaviour of plateau implant systems.

PubMed

Calì, Michele; Zanetti, Elisabetta Maria; Oliveri, Salvatore Massimo; Asero, Riccardo; Ciaramella, Stefano; Martorelli, Massimo; Bignardi, Cristina

2018-03-01

To assess the influence of implant thread shape and inclination on the mechanical behaviour of bone-implant systems. The study assesses which factors influence the initial and full osseointegration stages. Point clouds of the original implant were created using a non-contact reverse engineering technique. A 3D tessellated surface was created using Geomagic Studio ® software. From cross-section curves, generated by intersecting the tessellated model and cutting-planes, a 3D parametric CAD model was created using SolidWorks ® 2017. By the permutation of three thread shapes (rectangular, 30° trapezoidal, 45° trapezoidal) and three thread inclinations (0°, 3° or 6°), nine geometric configurations were obtained. Two different osseointegration stages were analysed: the initial osseointegration and a full osseointegration. In total, 18 different FE models were analysed and two load conditions were applied to each model. The mechanical behaviour of the models was analysed by Finite Element (FE) Analysis using ANSYS ® v. 17.0. Static linear analyses were also carried out. ANOVA was used to assess the influence of each factor. Models with a rectangular thread and 6° inclination provided the best results and reduced displacement in the initial osseointegration stages up to 4.58%. This configuration also reduced equivalent VM stress peaks up to 54%. The same effect was confirmed for the full osseointegration stage, where 6° inclination reduced stress peaks by up to 62%. The FE analysis confirmed the beneficial effect of thread inclination, reducing the displacement in immediate post-operative conditions and equivalent VM stress peaks. Thread shape does not significantly influence the mechanical behaviour of bone-implant systems but contributes to reducing stress peaks in the trabecular bone in both the initial and full osseointegration stages. Copyright © 2018 The Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

Vegetative Incompatibility and the Mating-Type Locus in the Cellular Slime Mold DICTYOSTELIUM DISCOIDEUM

PubMed Central

Robson, Gillian E.; Williams, Keith L.

1979-01-01

The genetic basis of vegetative incompatibility in the cellular slime mold, Dictyostelium discoideum, is elucidated. Vegetatively compatible haploid strains from parasexual diploids at a frequency of between 10-6 and 10-5, whereas "escaped" diploids are formed between vegetatively incompatible strains at a frequency of ∼10-8. There is probably only a single vegetative incompatibility site, which appears to be located at, or closely linked to, the mating-type locus. The nature of the vegetative incompatibility is deduced from parasexual diploid formation between wild isolates and tester strains of each mating type, examination of the frequency of formation of "escaped" diploids formed between vegetatively incompatible strains, and examination of the mating type and vegetative incompatibility of haploid segregants obtained from "escaped" diploids. PMID:17248984

Threading Dislocations in InGaAs/GaAs (001) Buffer Layers for Metamorphic High Electron Mobility Transistors

NASA Astrophysics Data System (ADS)

Song, Yifei; Kujofsa, Tedi; Ayers, John E.

2018-07-01

In order to evaluate various buffer layers for metamorphic devices, threading dislocation densities have been calculated for uniform composition In x Ga1- x As device layers deposited on GaAs (001) substrates with an intermediate graded buffer layer using the L MD model, where L MD is the average length of misfit dislocations. On this basis, we compare the relative effectiveness of buffer layers with linear, exponential, and S-graded compositional profiles. In the case of a 2 μm thick buffer layer linear grading results in higher threading dislocation densities in the device layer compared to either exponential or S-grading. When exponential grading is used, lower threading dislocation densities are obtained with a smaller length constant. In the S-graded case, lower threading dislocation densities result when a smaller standard deviation parameter is used. As the buffer layer thickness is decreased from 2 μm to 0.1 μm all of the above effects are diminished, and the absolute threading dislocation densities increase.

a Spatiotemporal Aggregation Query Method Using Multi-Thread Parallel Technique Based on Regional Division

NASA Astrophysics Data System (ADS)

Liao, S.; Chen, L.; Li, J.; Xiong, W.; Wu, Q.

2015-07-01

Existing spatiotemporal database supports spatiotemporal aggregation query over massive moving objects datasets. Due to the large amounts of data and single-thread processing method, the query speed cannot meet the application requirements. On the other hand, the query efficiency is more sensitive to spatial variation then temporal variation. In this paper, we proposed a spatiotemporal aggregation query method using multi-thread parallel technique based on regional divison and implemented it on the server. Concretely, we divided the spatiotemporal domain into several spatiotemporal cubes, computed spatiotemporal aggregation on all cubes using the technique of multi-thread parallel processing, and then integrated the query results. By testing and analyzing on the real datasets, this method has improved the query speed significantly.

Inchworm movement of two rings switching onto a thread by biased Brownian diffusion represent a three-body problem.

PubMed

Benson, Christopher R; Maffeo, Christopher; Fatila, Elisabeth M; Liu, Yun; Sheetz, Edward G; Aksimentiev, Aleksei; Singharoy, Abhishek; Flood, Amar H

2018-05-07

The coordinated motion of many individual components underpins the operation of all machines. However, despite generations of experience in engineering, understanding the motion of three or more coupled components remains a challenge, known since the time of Newton as the "three-body problem." Here, we describe, quantify, and simulate a molecular three-body problem of threading two molecular rings onto a linear molecular thread. Specifically, we use voltage-triggered reduction of a tetrazine-based thread to capture two cyanostar macrocycles and form a [3]pseudorotaxane product. As a consequence of the noncovalent coupling between the cyanostar rings, we find the threading occurs by an unexpected and rare inchworm-like motion where one ring follows the other. The mechanism was derived from controls, analysis of cyclic voltammetry (CV) traces, and Brownian dynamics simulations. CVs from two noncovalently interacting rings match that of two covalently linked rings designed to thread via the inchworm pathway, and they deviate considerably from the CV of a macrocycle designed to thread via a stepwise pathway. Time-dependent electrochemistry provides estimates of rate constants for threading. Experimentally derived parameters (energy wells, barriers, diffusion coefficients) helped determine likely pathways of motion with rate-kinetics and Brownian dynamics simulations. Simulations verified intercomponent coupling could be separated into ring-thread interactions for kinetics, and ring-ring interactions for thermodynamics to reduce the three-body problem to a two-body one. Our findings provide a basis for high-throughput design of molecular machinery with multiple components undergoing coupled motion.

THREAD: A programming environment for interactive planning-level robotics applications

NASA Technical Reports Server (NTRS)

Beahan, John J., Jr.

1989-01-01

THREAD programming language, which was developed to meet the needs of researchers in developing robotics applications that perform such tasks as grasp, trajectory design, sensor data analysis, and interfacing with external subsystems in order to perform servo-level control of manipulators and real time sensing is discussed. The philosophy behind THREAD, the issues which entered into its design, and the features of the language are discussed from the viewpoint of researchers who want to develop algorithms in a simulation environment, and from those who want to implement physical robotics systems. The detailed functions of the many complex robotics algorithms and tools which are part of the language are not explained, but an overall impression of their capability is given.

A Method for Growing Bio-memristors from Slime Mold.

PubMed

Miranda, Eduardo Reck; Braund, Edward

2017-11-02

Our research is aimed at gaining a better understanding of the electronic properties of organisms in order to engineer novel bioelectronic systems and computing architectures based on biology. This specific paper focuses on harnessing the unicellular slime mold Physarum polycephalum to develop bio-memristors (or biological memristors) and bio-computing devices. The memristor is a resistor that possesses memory. It is the 4th fundamental passive circuit element (the other three are the resistor, the capacitor, and the inductor), which is paving the way for the design of new kinds of computing systems; e.g., computers that might relinquish the distinction between storage and a central processing unit. When applied with an AC voltage, the current vs. voltage characteristic of a memristor is a pinched hysteresis loop. It has been shown that P. polycephalum produces pinched hysteresis loops under AC voltages and displays adaptive behavior that is comparable with the functioning of a memristor. This paper presents the method that we developed for implementing bio-memristors with P. polycephalum and introduces the development of a receptacle to culture the organism, which facilitates its deployment as an electronic circuit component. Our method has proven to decrease growth time, increase component lifespan, and standardize electrical observations.

A Method for Growing Bio-memristors from Slime Mold

PubMed Central

Miranda, Eduardo Reck; Braund, Edward

2017-01-01

Our research is aimed at gaining a better understanding of the electronic properties of organisms in order to engineer novel bioelectronic systems and computing architectures based on biology. This specific paper focuses on harnessing the unicellular slime mold Physarum polycephalum to develop bio-memristors (or biological memristors) and bio-computing devices. The memristor is a resistor that possesses memory. It is the 4th fundamental passive circuit element (the other three are the resistor, the capacitor, and the inductor), which is paving the way for the design of new kinds of computing systems; e.g., computers that might relinquish the distinction between storage and a central processing unit. When applied with an AC voltage, the current vs. voltage characteristic of a memristor is a pinched hysteresis loop. It has been shown that P. polycephalum produces pinched hysteresis loops under AC voltages and displays adaptive behavior that is comparable with the functioning of a memristor. This paper presents the method that we developed for implementing bio-memristors with P. polycephalum and introduces the development of a receptacle to culture the organism, which facilitates its deployment as an electronic circuit component. Our method has proven to decrease growth time, increase component lifespan, and standardize electrical observations. PMID:29155754

Successive Two-sided Loop Jets Caused by Magnetic Reconnection between Two Adjacent Filamentary Threads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tian, Zhanjun; Liu, Yu; Shen, Yuandeng

We present observational analysis of two successive two-sided loop jets observed by the ground-based New Vacuum Solar Telescope and the space-borne Solar Dynamics Observatory . The two successive two-sided loop jets manifested similar evolution processes and both were associated with the interaction of two small-scale adjacent filamentary threads, magnetic emerging, and cancellation processes at the jet’s source region. High temporal and high spatial resolution observations reveal that the two adjacent ends of the two filamentary threads are rooted in opposite magnetic polarities within the source region. The two threads approached each other, and then an obvious brightening patch is observedmore » at the interaction position. Subsequently, a pair of hot plasma ejections are observed heading in opposite directions along the paths of the two filamentary threads at a typical speed for two-sided loop jets of the order 150 km s{sup −1}. Close to the end of the second jet, we report the formation of a bright hot loop structure at the source region, which suggests the formation of new loops during the interaction. Based on the observational results, we propose that the observed two-sided loop jets are caused by magnetic reconnection between the two adjacent filamentary threads, largely different from the previous scenario that a two-sided loop jet is generated by magnetic reconnection between an emerging bipole and the overlying horizontal magnetic fields.« less

Hierarchical resilience with lightweight threads.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wheeler, Kyle Bruce

2011-10-01

This paper proposes methodology for providing robustness and resilience for a highly threaded distributed- and shared-memory environment based on well-defined inputs and outputs to lightweight tasks. These inputs and outputs form a failure 'barrier', allowing tasks to be restarted or duplicated as necessary. These barriers must be expanded based on task behavior, such as communication between tasks, but do not prohibit any given behavior. One of the trends in high-performance computing codes seems to be a trend toward self-contained functions that mimic functional programming. Software designers are trending toward a model of software design where their core functions are specifiedmore » in side-effect free or low-side-effect ways, wherein the inputs and outputs of the functions are well-defined. This provides the ability to copy the inputs to wherever they need to be - whether that's the other side of the PCI bus or the other side of the network - do work on that input using local memory, and then copy the outputs back (as needed). This design pattern is popular among new distributed threading environment designs. Such designs include the Barcelona STARS system, distributed OpenMP systems, the Habanero-C and Habanero-Java systems from Vivek Sarkar at Rice University, the HPX/ParalleX model from LSU, as well as our own Scalable Parallel Runtime effort (SPR) and the Trilinos stateless kernels. This design pattern is also shared by CUDA and several OpenMP extensions for GPU-type accelerators (e.g. the PGI OpenMP extensions).« less

Experimental Verification of Fully Decentralized Control Inspired by Plasmodium of True Slime Mold

NASA Astrophysics Data System (ADS)

Umedachi, Takuya; Takeda, Koichi; Nakagaki, Toshiyuki; Kobayashi, Ryo; Ishiguro, Akio

This paper presents a fully decentralized control inspired by plasmodium of true slime mold and its validity using a soft-bodied amoeboid robot. The notable features of this paper are twofold: (1) the robot has truly soft and deformable body stemming from real-time tunable springs and a balloon, the former is utilized as an outer skin of the body and the latter serves as protoplasm; and (2) a fully decentralized control using coupled oscillators with completely local sensory feedback mechanism is realized by exploiting the long-distance physical interaction between the body parts induced by the law of conservation of protoplasmic mass. Experimental results show that this robot exhibits truly supple locomotion without relying on any hierarchical structure. The results obtained are expected to shed new light on design scheme for autonomous decentralized control system.

Tangled Threads: Mentoring within a Community of Practice

ERIC Educational Resources Information Center

Tarr, Patricia

2010-01-01

Tangled Threads, a case study of a group of women art educators, examines the nature of mentoring relationships within the context of a professional association. Grounded in literature on "community of practice," relational and peer mentoring, and an ethic of care, the study uncovers the complex interconnections between women's professional and…

Electronic and optical properties of GaN/AlN quantum dots with adjacent threading dislocations

NASA Astrophysics Data System (ADS)

Ye, Han; Lu, Peng-Fei; Yu, Zhong-Yuan; Yao, Wen-Jie; Chen, Zhi-Hui; Jia, Bo-Yong; Liu, Yu-Min

2010-04-01

We present a theory to simulate a coherent GaN QD with an adjacent pure edge threading dislocation by using a finite element method. The piezoelectric effects and the strain modified band edges are investigated in the framework of multi-band k · p theory to calculate the electron and the heavy hole energy levels. The linear optical absorption coefficients corresponding to the interband ground state transition are obtained via the density matrix approach and perturbation expansion method. The results indicate that the strain distribution of the threading dislocation affects the electronic structure. Moreover, the ground state transition behaviour is also influenced by the position of the adjacent threading dislocation.

Use of Nitrocarburizing for Strengthening Threaded Joints of Drill Pipes from Medium-Carbon Alloy Steels

NASA Astrophysics Data System (ADS)

Priymak, E. Yu.; Stepanchukova, A. V.; Yakovleva, I. L.; Tereshchenko, N. A.

2015-05-01

Nitrocarburizing is tested at the Drill Equipment Plant for reinforcing threaded joints of drill pipes for units with retrievable core receiver (RCR). The effect of the nitrocarburizing on the mechanical properties of steels of different alloying systems is considered. Steels for the production of threaded joints of drill pipes are recommended.

Optimized FPGA Implementation of Multi-Rate FIR Filters Through Thread Decomposition

NASA Technical Reports Server (NTRS)

Zheng, Jason Xin; Nguyen, Kayla; He, Yutao

2010-01-01

Multirate (decimation/interpolation) filters are among the essential signal processing components in spaceborne instruments where Finite Impulse Response (FIR) filters are often used to minimize nonlinear group delay and finite-precision effects. Cascaded (multi-stage) designs of Multi-Rate FIR (MRFIR) filters are further used for large rate change ratio, in order to lower the required throughput while simultaneously achieving comparable or better performance than single-stage designs. Traditional representation and implementation of MRFIR employ polyphase decomposition of the original filter structure, whose main purpose is to compute only the needed output at the lowest possible sampling rate. In this paper, an alternative representation and implementation technique, called TD-MRFIR (Thread Decomposition MRFIR), is presented. The basic idea is to decompose MRFIR into output computational threads, in contrast to a structural decomposition of the original filter as done in the polyphase decomposition. Each thread represents an instance of the finite convolution required to produce a single output of the MRFIR. The filter is thus viewed as a finite collection of concurrent threads. The technical details of TD-MRFIR will be explained, first showing its applicability to the implementation of downsampling, upsampling, and resampling FIR filters, and then describing a general strategy to optimally allocate the number of filter taps. A particular FPGA design of multi-stage TD-MRFIR for the L-band radar of NASA's SMAP (Soil Moisture Active Passive) instrument is demonstrated; and its implementation results in several targeted FPGA devices are summarized in terms of the functional (bit width, fixed-point error) and performance (time closure, resource usage, and power estimation) parameters.

Present Situation of the Anti-Fatigue Processing of High-Strength Steel Internal Thread Based on Cold Extrusion Technology: A Review

NASA Astrophysics Data System (ADS)

Miao, Hong; Jiang, Cheng; Liu, Sixing; Zhang, Shanwen; Zhang, Yanjun

2017-03-01

The adoption of cold-extrusion forming for internal thread net forming becomes an important component of anti-fatigue processing with the development of internal thread processing towards high performance, low cost and low energy consumption. It has vast application foreground in the field of aviation, spaceflight, high speed train and etc. The internal thread processing and anti-fatigue manufacture technology are summarized. In terms of the perspective of processing quality and fatigue serving life, the advantages and disadvantages of the processing methods from are compared. The internal thread cold-extrusion processing technology is investigated for the purpose of improving the anti-fatigue serving life of internal thread. The superiorities of the plastic deformation law and surface integrity of the metal layer in the course of cold extrusion for improving its stability and economy are summed up. The proposed research forecasts the development tendency of the internal thread anti-fatigue manufacturing technology.

Effect of thread size on the implant neck area: preliminary results at 1 year of function.

PubMed

Kang, Young-Il; Lee, Dong-Won; Park, Kwang-Ho; Moon, Ik-Sang

2012-10-01

To evaluate and compare the effect of the coronal thread size on the marginal bone loss around the fixtures, when both implants were provided with threads to the top of fixture. Two groups of implants, one with a macro-thread to the top of the fixture (A) and the other with a micro-thread to the top of the fixture (B), were placed adjacent to each other in the partially edentulous areas of 20 patients. Bone loss around each implant was analyzed after 1 year of functional loading. The bone losses after loading were compared using Wilcoxon's signed-rank test. The mean marginal bone losses (A, 0.154 ± 0.144 mm; B, 0.125 ± 0.136 mm) were not statistically significant between the two groups (P = 0.669). There was no significant difference between implant with macro- and micro-neck thread in terms of marginal bone loss after 1 year of loading. © 2011 John Wiley & Sons A/S.

Species-specific cell mobility of bacteria-feeding myxamoebae in plasmodial slime molds.

PubMed

Hoppe, Thomas; Kutschera, Ulrich

2015-01-01

On decaying wood or litter in forests, plasmodial slime molds (myxomycetes) represent a large fraction of eukaryotic protists that feed on bacteria. In his seminal book Experimental Physiology of Plants (1865), Julius Sachs referred to the multinucleate plasmodium of myxomycetes, which were considered at that time as primitive plants (or fungi). Today it is well established that myxomycetes are members of the Amoebozoa (Protista). In this study we compare the mobility of myxamoebae of 3 European species, Lycogala epidendrum (order Liceales), Tubulifera arachnoidea, and Trichia decipiens (order Trichiales). Using agar plates, on which 3 separate bacterial species were cultivated as prey organisms (Methylobacterium mesophilicum, Escherichia coli, Agrobacterium tumefaciens), we document large differences in cell motility between the myxomycetes investigated. In addition, we show that the 3 species of myxamoebae can be distinguished based on their average cell size. These data shed light on the mode of co-occurrence via differential substrate utilization in these members of the Amoebozoa.

Species-specific cell mobility of bacteria-feeding myxamoebae in plasmodial slime molds

PubMed Central

Hoppe, Thomas; Kutschera, Ulrich

2015-01-01

On decaying wood or litter in forests, plasmodial slime molds (myxomycetes) represent a large fraction of eukaryotic protists that feed on bacteria. In his seminal book Experimental Physiology of Plants (1865), Julius Sachs referred to the multinucleate plasmodium of myxomycetes, which were considered at that time as primitive plants (or fungi). Today it is well established that myxomycetes are members of the Amoebozoa (Protista). In this study we compare the mobility of myxamoebae of 3 European species, Lycogala epidendrum (order Liceales), Tubulifera arachnoidea, and Trichia decipiens (order Trichiales). Using agar plates, on which 3 separate bacterial species were cultivated as prey organisms (Methylobacterium mesophilicum, Escherichia coli, Agrobacterium tumefaciens), we document large differences in cell motility between the myxomycetes investigated. In addition, we show that the 3 species of myxamoebae can be distinguished based on their average cell size. These data shed light on the mode of co-occurrence via differential substrate utilization in these members of the Amoebozoa. PMID:26357877

Multi-Threaded DNA Tag/Anti-Tag Library Generator for Multi-Core Platforms

DTIC Science & Technology

2009-05-01

base pair)  Watson ‐ Crick  strand pairs that bind perfectly within pairs, but poorly across pairs. A variety  of  DNA  strand hybridization metrics...AFRL-RI-RS-TR-2009-131 Final Technical Report May 2009 MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE PLATFORMS...TYPE Final 3. DATES COVERED (From - To) Jun 08 – Feb 09 4. TITLE AND SUBTITLE MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE

Mathematical model for rhythmic protoplasmic movement in the true slime mold.

PubMed

Kobayashi, Ryo; Tero, Atsushi; Nakagaki, Toshiyuki

2006-08-01

The plasmodium of the true slime mold Physarum polycephalum is a large amoeboid organism that displays "smart" behavior such as chemotaxis and the ability to solve mazes and geometrical puzzles. These amoeboid behaviors are based on the dynamics of the viscoelastic protoplasm and its biochemical rhythms. By incorporating both these aspects, we constructed a mathematical model for the dynamics of the organism as a first step towards understanding the relation between protoplasmic movement and its unusual abilities. We tested the validity of the model by comparing it with physiological observation. Our model reproduces fundamental characteristics of the spatio-temporal pattern of the rhythmic movement: (1) the antiphase oscillation between frontal tip and rear when the front is freely extending; (2) the asynchronous oscillation pattern when the front is not freely extending; and (3) the formation of protoplasmic mounds over a longer time scale. Both our model and physiological observation suggest that cell stiffness plays a primary role in plasmodial behaviors, in contrast to the conventional theory of coupled oscillator systems.

Influence of Micro Threads Alteration on Osseointegration and Primary Stability of Implants: An FEA and In Vivo Analysis in Rabbits.

PubMed

Chowdhary, Ramesh; Halldin, Anders; Jimbo, Ryo; Wennerberg, Ann

2015-06-01

To describe the early bone tissue response to implants with and without micro threads designed to the full length of an oxidized titanium implant. A pair of two-dimensional finite element models was designed using a computer aided three-dimensional interactive application files of an implant model with micro threads in between macro threads and one without micro threads. Oxidized titanium implants with (test implants n=20) and without (control implants n=20) micro thread were prepared. A total of 12 rabbits were used and each received four implants. Insertion torque while implant placement and removal torque analysis after 4 weeks was performed in nine rabbits, and histomorphometric analysis in three rabbits, respectively. Finite element analysis showed less stress accumulation in test implant models with 31Mpa when compared with 62.2 Mpa in control implant model. Insertion and removal torque analysis did not show any statistical significance between the two implant designs. At 4 weeks, there was a significant difference between the two groups in the percentage of new bone volume and bone-to-implant contact in the femur (p< .05); however, not in the tibia. The effect of micro threads was prominent in the femur suggesting that micro threads promote bone formation. The stress distribution supported by the micro threads was especially effective in the cancellous bone. © 2013 Wiley Periodicals, Inc.

A Multi-Threaded Cryptographic Pseudorandom Number Generator Test Suite

DTIC Science & Technology

2016-09-01

bitcoin thieves, Google releases patch. (2013, Aug. 16). SiliconANGLE. [Online]. Available: http://siliconangle.com/blog/2013/ 08/16/android-crypto-prng...flaw-aided- bitcoin -thieves-google-releases-patch/ [5] M. Gondree. (2014, Sep. 28). NPS POSIX thread pool library. [Online]. Available: https

78 FR 40170 - Certain Steel Threaded Rod From India and Thailand; Institution of Antidumping and Countervailing...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-07-03

... INTERNATIONAL TRADE COMMISSION [Investigation Nos. 701-TA-498 and 731-TA-1213-1214 (Preliminary)] Certain Steel Threaded Rod From India and Thailand; Institution of Antidumping and Countervailing Duty... Thailand of certain steel threaded rod, provided for primarily in subheading 7318.15.50 of the Harmonized...

Molecular threading: mechanical extraction, stretching and placement of DNA molecules from a liquid-air interface.

PubMed

Payne, Andrew C; Andregg, Michael; Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S; Andregg, William

2013-01-01

We present "molecular threading", a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers.

Pearling Instabilities of a Viscoelastic Thread

NASA Astrophysics Data System (ADS)

Deblais, A.; Velikov, K. P.; Bonn, D.

2018-05-01

Pearling instabilities of slender viscoelastic threads have received much attention, but remain incompletely understood. We study the instabilities in polymer solutions subject to uniaxial elongational flow. Two distinctly different instabilites are observed: beads on a string and blistering. The beads-on-a-string structure arises from a capillary instability whereas the blistering instability has a different origin: it is due to a coupling between stress and polymer concentration. By varying the temperature to change the solution properties we elucidate the interplay between flow and phase separation.

Biomechanical investigation of thread designs and interface conditions of zirconia and titanium dental implants with bone: three-dimensional numeric analysis.

PubMed

Fuh, Lih-Jyh; Hsu, Jui-Ting; Huang, Heng-Li; Chen, Michael Y C; Shen, Yen-Wen

2013-01-01

Bone stress and interfacial sliding at the bone-implant interface (BII) were analyzed in zirconia and titanium implants with various thread designs and interface conditions (bonded BII and contact BIIs with different frictional coefficients) for both conventional and immediately loaded treatments. A total of 18 finite element models comprising two implant materials (zirconia and titanium), three thread designs (different shapes and pitches), and three interface conditions (bonded and contact BIIs) were analyzed to assess the effects on bone stresses and on sliding at the BII. The material properties of the bone model were anisotropic, and a lateral force of 130 N was applied as the loading condition. In the immediately loaded implant, the stress was highly concentrated at one site of the peri-implant bone. The peak bone stress was more than 20% lower in zirconia implants than in titanium implants for a bonded BII and 14% to 20% lower for a contact BII. The bone stresses did not differ significantly between implants with V-shaped threads and square threads. However, sliding at the BII was more than 25% lower with square-thread implants than with V-shaped-thread implants for titanium implants and 36% lower for zirconia implants. Reducing the thread size and pitch in cortical bone (via two V-shaped threads with different pitches) decreased the bone stress by 13%. Increasing the frictional coefficient reduced sliding at the BII in both zirconia and titanium implants. As an implant material, zirconia can reduce the bone stress in the crestal cortical region. Bone stress and sliding at the BII are heavily dependent on the thread design and the frictional coefficient at the BII of immediately loaded implants.

Using a source-to-source transformation to introduce multi-threading into the AliRoot framework for a parallel event reconstruction

NASA Astrophysics Data System (ADS)

Lohn, Stefan B.; Dong, Xin; Carminati, Federico

2012-12-01

Chip-Multiprocessors are going to support massive parallelism by many additional physical and logical cores. Improving performance can no longer be obtained by increasing clock-frequency because the technical limits are almost reached. Instead, parallel execution must be used to gain performance. Resources like main memory, the cache hierarchy, bandwidth of the memory bus or links between cores and sockets are not going to be improved as fast. Hence, parallelism can only result into performance gains if the memory usage is optimized and the communication between threads is minimized. Besides concurrent programming has become a domain for experts. Implementing multi-threading is error prone and labor-intensive. A full reimplementation of the whole AliRoot source-code is unaffordable. This paper describes the effort to evaluate the adaption of AliRoot to the needs of multi-threading and to provide the capability of parallel processing by using a semi-automatic source-to-source transformation to address the problems as described before and to provide a straight-forward way of parallelization with almost no interference between threads. This makes the approach simple and reduces the required manual changes in the code. In a first step, unconditional thread-safety will be introduced to bring the original sequential and thread unaware source-code into the position of utilizing multi-threading. Afterwards further investigations have to be performed to point out candidates of classes that are useful to share amongst threads. Then in a second step, the transformation has to change the code to share these classes and finally to verify if there are anymore invalid interferences between threads.

How Cognitive Requirement of Prompt and Time in Course Are Correlated with Intersubjectivity within Threaded Discussions

ERIC Educational Resources Information Center

Hall, Barbara M.

2011-01-01

Threaded discussions represent conversational turn-taking in asynchronous, online learning environments. Given the crucial role that discussions play in the construction of knowledge within an online course, the quality of the interaction that occurs within threaded discussions is important to achieving the learning objectives of the designed…

Incorporation of a Decorin Biomimetic Enhances the Mechanical Properties of Electrochemically Aligned Collagen Threads

PubMed Central

Kishore, Vipuil; Paderi, John E.; Akkus, Anna; Smith, Katie M.; Balachandran, Dave; Beaudoin, Stephen; Panitch, Alyssa; Akkus, Ozan

2011-01-01

Orientational anisotropy of collagen molecules is integral for the mechanical strength of collagen-rich tissues. We have previously reported a novel methodology to synthesize highly oriented electrochemically aligned collagen (ELAC) threads with mechanical properties converging upon those of native tendon. Decorin, a small leucine rich proteoglycan (SLRP), binds to fibrillar collagen and has been suggested to enhance the mechanical properties of tendon. Based on the structure of natural decorin, we have previously designed and synthesized a peptidoglycan (DS-SILY) that mimics decorin both structurally and functionally. In this study, we investigated the effect of the incorporation of DS-SILY on the mechanical properties and structural organization of ELAC threads. The results indicated that the addition of DS-SILY at a molar ratio of 30:1 (Collagen:DS-SILY) significantly enhanced the ultimate stress and ultimate strain of the ELAC threads. Furthermore, differential scanning calorimetry revealed that the addition of DS-SILY at a molar ratio of 30:1 resulted in a more thermally stable collagen structure. However, addition of DS-SILY at a higher concentration (10:1 Collagen:DS-SILY) yielded weaker threads with mechanical properties comparable to collagen control threads. Transmission emission microscopy revealed that the addition of DS-SILY at a higher concentration (10:1) resulted in pronounced aggregation of collagen fibrils. More importantly, these aggregates were not aligned along the long axis of the ELAC thereby compromising on the overall tensile properties of the material. We conclude that incorporation of an optimal amount of DS-SILY is a promising approach to synthesize mechanically competent collagen based biomaterials for tendon tissue engineering applications. PMID:21356334

Adhesion enhancement of cribellate capture threads by epicuticular waxes of the insect prey sheds new light on spider web evolution

PubMed Central

Bott, Raya A.; Bräunig, Peter

2017-01-01

To survive, web-building spiders rely on their capture threads to restrain prey. Many species use special adhesives for this task, and again the majority of those species cover their threads with viscoelastic glue droplets. Cribellate spiders, by contrast, use a wool of nanofibres as adhesive. Previous studies hypothesized that prey is restrained by van der Waals' forces and entrapment in the nanofibres. A large discrepancy when comparing the adhesive force on artificial surfaces versus prey implied that the real mechanism was still elusive. We observed that insect prey's epicuticular waxes infiltrate the wool of nanofibres, probably induced by capillary forces. The fibre-reinforced composite thus formed led to an adhesion between prey and thread eight times stronger than that between thread and wax-free surfaces. Thus, cribellate spiders employ the originally protective coating of their insect prey as a fatal component of their adhesive and the insect promotes its own capture. We suggest an evolutionary arms race with prey changing the properties of their cuticular waxes to escape the cribellate capture threads that eventually favoured spider threads with viscous glue. PMID:28566485

Role of Marangoni stress during breakup of surfactant-covered liquid threads: Reduced rates of thinning and microthread cascades

NASA Astrophysics Data System (ADS)

Kamat, Pritish M.; Wagoner, Brayden W.; Thete, Sumeet S.; Basaran, Osman A.

2018-04-01

Adsorption onto and lowering of surface tension σ of fluid interfaces by surfactants is exploited in drop formation (e.g., inkjet printing) where a thinning liquid thread (radius h ) connects an about-to-form drop to the liquid that remains hanging from the nozzle when the former falls from it. Surfactants can affect thread pinch-off in two ways: first, by lowering σ , they lower capillary pressure (σ /h ), and second, as surfactant concentration along the interface can be nonuniform, they cause the interface to be subjected to a surface tension gradient or Marangoni stress. Recent studies show that the location where the thread breaks is devoid of surfactant, and others assert that the influence of Marangoni stress on pinch-off is negligible. We demonstrate by simulations and experiments that surfactants play a major role in drop formation and that Marangoni stresses acting near but not at the pinch point give rise to reduced rates of thread thinning and formation of multiple microthreads that distinguish pinch-off of surfactant-covered threads from surfactant-free ones. Thinning at finite Reynolds and Peclet numbers, Re and Pe, is shown to exhibit intermediate scaling regimes that have heretofore only been observed during pinch-off of threads undergoing creeping flow (Re=0 ) while convection of surfactant is weak compared to its diffusion (Pe<1 ).

Using VoiceThread for Communication in Mathematics Writing

ERIC Educational Resources Information Center

McKane, Patricia

2011-01-01

'This action research study was conducted on a fourth grade rural classroom in Orange County, N.Y. for the purpose of determining if the use of the VoiceThread program will affect student performance in mathematics writing. A baseline of student performance on this measure was administered in the fall of 2010 using the NYS Holistic rubric of a 3…

Real-time SHVC software decoding with multi-threaded parallel processing

NASA Astrophysics Data System (ADS)

Gudumasu, Srinivas; He, Yuwen; Ye, Yan; He, Yong; Ryu, Eun-Seok; Dong, Jie; Xiu, Xiaoyu

2014-09-01

This paper proposes a parallel decoding framework for scalable HEVC (SHVC). Various optimization technologies are implemented on the basis of SHVC reference software SHM-2.0 to achieve real-time decoding speed for the two layer spatial scalability configuration. SHVC decoder complexity is analyzed with profiling information. The decoding process at each layer and the up-sampling process are designed in parallel and scheduled by a high level application task manager. Within each layer, multi-threaded decoding is applied to accelerate the layer decoding speed. Entropy decoding, reconstruction, and in-loop processing are pipeline designed with multiple threads based on groups of coding tree units (CTU). A group of CTUs is treated as a processing unit in each pipeline stage to achieve a better trade-off between parallelism and synchronization. Motion compensation, inverse quantization, and inverse transform modules are further optimized with SSE4 SIMD instructions. Simulations on a desktop with an Intel i7 processor 2600 running at 3.4 GHz show that the parallel SHVC software decoder is able to decode 1080p spatial 2x at up to 60 fps (frames per second) and 1080p spatial 1.5x at up to 50 fps for those bitstreams generated with SHVC common test conditions in the JCT-VC standardization group. The decoding performance at various bitrates with different optimization technologies and different numbers of threads are compared in terms of decoding speed and resource usage, including processor and memory.

Large Scale Document Inversion using a Multi-threaded Computing System.

PubMed

Jung, Sungbo; Chang, Dar-Jen; Park, Juw Won

2017-06-01

Current microprocessor architecture is moving towards multi-core/multi-threaded systems. This trend has led to a surge of interest in using multi-threaded computing devices, such as the Graphics Processing Unit (GPU), for general purpose computing. We can utilize the GPU in computation as a massive parallel coprocessor because the GPU consists of multiple cores. The GPU is also an affordable, attractive, and user-programmable commodity. Nowadays a lot of information has been flooded into the digital domain around the world. Huge volume of data, such as digital libraries, social networking services, e-commerce product data, and reviews, etc., is produced or collected every moment with dramatic growth in size. Although the inverted index is a useful data structure that can be used for full text searches or document retrieval, a large number of documents will require a tremendous amount of time to create the index. The performance of document inversion can be improved by multi-thread or multi-core GPU. Our approach is to implement a linear-time, hash-based, single program multiple data (SPMD), document inversion algorithm on the NVIDIA GPU/CUDA programming platform utilizing the huge computational power of the GPU, to develop high performance solutions for document indexing. Our proposed parallel document inversion system shows 2-3 times faster performance than a sequential system on two different test datasets from PubMed abstract and e-commerce product reviews. •Information systems➝Information retrieval • Computing methodologies➝Massively parallel and high-performance simulations.

Influence of fine threads and platform-switching on crestal bone stress around implant-a three-dimensional finite element analysis.

PubMed

Khurana, Pardeep; Sharma, Arun; Sodhi, Kiranmeet Kaur

2013-12-01

The aims of this study were to investigate the effect of implant fine threads on crestal bone stress compared to a standard smooth implant collar and to analyze how different abutment diameters influenced the crestal bone stress level. Three-dimensional finite element imaging was used to create a cross-sectional model in SolidWorks 2007 software of an implant (5-mm platform and 10 mm in length) placed in the premolar region of the mandible. The implant model was created to resemble a commercially available fine thread implant. Abutments of different diameters (5.0 mm: standard, 4.5 mm, 4.0 mm, and 3.5 mm) were loaded with a force of 100 N at 90° vertical and 40° oblique angles. Finite element analysis was done in COSMOSWorks software, which was used to analyze the stress patterns in bone, especially in the crestal region. Upon loading, the fine thread implant model had greater stress at the crestal bone adjacent to the implant than the smooth neck implant in both vertical and oblique loading. When the abutment diameter decreased progressively from 5.0 mm to 4.5 mm to 4 mm and to 3.5 mm the thread model showed a reduction of stress at the crestal bone level from 23.2 MPa to 15.02 MPa for fine thread and from 22.7 to 13.5 MPa for smooth collar implant group after vertical loading and from 43.7 MPa to 33.1 MPa in fine thread model and from 36.9 to 20.5 MPa in smooth collar implant model after oblique loading. Fine threads increase crestal stress upon loading. Reduced abutment diameter that is platform switching resulted in less stress translated to the crestal bone in the fine thread and smooth neck.

Organophosphorus acid anhydrolase in slime mold, duckweed and mung bean: a continuing search for a physiological role and a natural substrate.

PubMed

Hoskin, F C; Walker, J E; Mello, C M

1999-05-14

Recently, and for the first time, a diisopropylphosphorofluoridate (DFP)-hydrolyzing enzyme, i.e. an organophosphorus acid anhydrolase (OPAA), has been reported in a plant-source. Based on this and other suggestive evidence, the ability of three plant sources and a protist to hydrolyze DFP and 1,2,2-trimethylpropyl methylphosphonofluoridate (Soman) were tested, and the effects of Mn2+ and ethylenediamine tetraacetate (EDTA) on this activity. The plants are duckweed (Lemna minor), giant duckweed (Spirodela oligorhiza), and germinated mung bean (Vigna radiata); the protist is a slime mold (Dictyostelium discoidium). The tests are based on a crude classification of OPAAs as 'squid type' (DFP hydrolyzed more rapidly than Soman) and all of the others termed by us, with questionable justification, as 'Mazur type' (Soman hydrolyzed more rapidly than DFP). Of the two duckweeds, Spirodela oligorhiza hydrolyzes Soman but not DFP, and Lemna minor does not hydrolyze either substrate. In contrast to the report of Yu and Sakurai, mung bean does not hydrolyze DFP and hydrolyzes Soman with a 5-fold stimulation by Mn2+ and a marked inhibition by EDTA. The slime mold hydrolyzes Soman more rapidly than DFP (but does hydrolyze DFP) and the hydrolysis is Mn2+ stimulated. The failure of these plant sources to hydrolyze DFP is similar to the behavior of OPAA from Bacillus stearothermophilus.

Looking north at the threading machine of the no. 1 ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Looking north at the threading machine of the no. 1 seamless line in bay 11 of the main pipe mill building - U.S. Steel National Tube Works, Main Pipe Mill Building, Along Monongahela River, McKeesport, Allegheny County, PA

Testing the Digital Thread in Support of Model-Based Manufacturing and Inspection

PubMed Central

Hedberg, Thomas; Lubell, Joshua; Fischer, Lyle; Maggiano, Larry; Feeney, Allison Barnard

2016-01-01

A number of manufacturing companies have reported anecdotal evidence describing the benefits of Model-Based Enterprise (MBE). Based on this evidence, major players in industry have embraced a vision to deploy MBE. In our view, the best chance of realizing this vision is the creation of a single “digital thread.” Under MBE, there exists a Model-Based Definition (MBD), created by the Engineering function, that downstream functions reuse to complete Model-Based Manufacturing and Model-Based Inspection activities. The ensemble of data that enables the combination of model-based definition, manufacturing, and inspection defines this digital thread. Such a digital thread would enable real-time design and analysis, collaborative process-flow development, automated artifact creation, and full-process traceability in a seamless real-time collaborative development among project participants. This paper documents the strengths and weaknesses in the current, industry strategies for implementing MBE. It also identifies gaps in the transition and/or exchange of data between various manufacturing processes. Lastly, this paper presents measured results from a study of model-based processes compared to drawing-based processes and provides evidence to support the anecdotal evidence and vision made by industry. PMID:27325911

Analysis of a thread used in the Kshara Sutra treatment in the Ayurvedic medicinal system.

PubMed

Gewali, M B; Pilapitiya, U; Hattori, M; Namba, T

1990-05-01

From a Kshara Sutra thread which is used in the therapy of fistula in the Ayurvedic medicinal system, euphol, 3,12-di-O-acetyl-8-O-benzoylingol, 3,12-di-O-acetyl-8-O-tigloylingol, curcumin, p-coumaroylferuloylmethane and di-p-courmaroylmethane were isolated and characterized. In addition, GLC and GC/MS confirmed the presence of euphol, antiquol B, cycloeucalenol and 24-methylene cycloartanol in the thread.

Thread-Lift Sutures: Still in the Lift? A Systematic Review of the Literature.

PubMed

Gülbitti, Haydar Aslan; Colebunders, Britt; Pirayesh, Ali; Bertossi, Dario; van der Lei, Berend

2018-03-01

In 2006, Villa et al. published a review article concerning the use of thread-lift sutures and concluded that the technique was still in its infancy but had great potential to become a useful and effective procedure for nonsurgical lifting of sagged facial tissues. As 11 years have passed, the authors now performed again a systematic review to determine the real scientific current state of the art on the use of thread-lift sutures. A systematic review was performed according to Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines using the PubMed database and using the Medical Subject Headings search term "Rhytidoplasty." "Rhytidoplasty" and the following entry terms were included by this Medical Subject Headings term: "facelift," "facelifts," "face Lift," "Face Lifts," "Lift," "Face," "Lifts," "Platysmotomy," "Platysmotomies," "Rhytidectomy," "Rhytidectomies," "Platysmaplasty," "and "Platysmaplasties." The Medical Subject Headings term "Rhytidoplasty" was combined with the following search terms: "Barbed suture," "Thread lift," "APTOS," "Suture suspension," "Percutaneous," and "Silhouette suture." RefWorks was used to filter duplicates. Three of the authors (H.A.G., B.C., and B.L.) performed the search independently. The initial search with all search terms resulted in 188 articles. After filtering the duplicates and the articles about open procedures, a total of 41 articles remained. Of these, the review articles, case reports, and letters to the editor were subsequently excluded, as were reports dealing with nonbarbed sutures, such as Vicryl and Prolene with Gore-Tex. This resulted in a total of 12 articles, seven additional articles since the five articles reviewed by Villa et al. The authors' review demonstrated that, within the past decade, little or no substantial evidence has been added to the peer-reviewed literature to support or sustain the promising statement about thread-lift sutures as made by Villa et al. in 2006 in terms of

OpenGeoSys-GEMS: Hybrid parallelization of a reactive transport code with MPI and threads

NASA Astrophysics Data System (ADS)

Kosakowski, G.; Kulik, D. A.; Shao, H.

2012-04-01

element nodes with calls to GEMS3K and consecutive calculations of changed material parameters. In a first step the existing MPI implementation was utilized to parallelize this loop. Calculations were split between the MPI processes and afterwards data was synchronized by using MPI communication routines. Furthermore, multi-threaded calculation of the loop was implemented with help of the boost thread library (http://www.boost.org). This implementation provides a flexible environment to distribute calculations between several threads. For each MPI process at least one and up to several dozens of worker threads are spawned. These threads do not replicate the complete OGS-GEM data structure and use only a limited amount of memory. Calculation of the central geochemical loop is shared between all threads. Synchronization between the threads is done by barrier commands. The overall number of local threads times MPI processes should match the number of available computing nodes. The combination of multi-threading and MPI provides an effective and flexible environment to speed up OGS-GEMS calculations while limiting the required memory use. Test calculations on different hardware show that for certain types of applications tremendous speedups are possible.

RHYTHMICITY IN THE PROTOPLASMIC STREAMING OF A SLIME MOLD, PHYSARUM POLYCEPHALUM

PubMed Central

Kishimoto, Uichiro

1958-01-01

The electric potential difference (1 to 15 mv.) between two loci of the slime mold connected with a strand of protoplasm changes rhythmically with the same period (60 to 180 seconds) as that of the back and forth protoplasmic streaming along the strand. Generally some phase difference is observed between them. Periods of the electric potential rhythm show a Gaussian distribution. Amplitudes give a somewhat different distribution curve. Wave forms are not always simple harmonic ones, but are distorted more or less. However, auto-correlation analysis proves that there is a dominant rhythm of a nearly constant period which coincides with the mean period of the Gaussian distribution curve. Calculations made on an assumption that the electric potential rhythm is the result of many elementary rhythms (i.e., same periodicity, arbitrary phase angles) distributed throughout the plasmodium, give a satisfactory coincidence with the observed distribution for the amplitude. The predominance of a rhythm of a nearly constant periodicity suggests the existence of well organized interactions among components of a contractile protein network, the rhythmic deformation of which is supposed to be responsible for the protoplasmic streaming and for the electric potential rhythm. PMID:13563808

Effects of Pre-Structuring Discussion Threads on Group Interaction and Group Performance in Computer-Supported Collaborative Argumentation

ERIC Educational Resources Information Center

Brooks, C. Darren; Jeong, Allan

2006-01-01

This study examined the effects of pre-structuring discussion threads on group performance in computer-supported collaborative argumentation where students labeled their messages as arguments, challenges, supporting evidence, and explanations on a threaded discussion board. In the pre-structured group students were required to post supporting and…

Survival of biofilm-forming Salmonella on stainless steel bolt threads under dry conditions.

PubMed

Morita, Yukio; Komoda, Emiko; Ono, Kazuaki; Kumagai, Susumu

2011-01-01

We examined the survival of two biofilm-forming strains and two biofilm-deficient strains of non typhoid Salmonella (NTS) on stainless steel bolt threads under dry conditions. Five µL of tryptone soya broth or egg yolke mulsion containing NTS strains at a concentration of 9 log cfu/mL was dropped onto the thread surfaces of hexagonal bolts. After inoculation, the bolts were screwed into the nuts, and then removed (Separate type) or not removed (Unit type). The two types of samples were kept in a dry environment (20.0-25.0°C, 2-15% humidity) and bacteria on the surfaces were periodically counted. Biofilm-forming strains were recovered from all samples after 336 days of incubation, but biofilm-deficient strains were isolated from only two of 8 samples after 336 days. This finding demonstrates that NTS can survive for approximately one year on bolt threads, providing direct evidence of the potential risk of constructions having crevices or uneven surfaces as possible contamination sources. The risk of cross-contamination may be higher for biofilm-forming strains than for biofilm-deficient strains.

Anti-parallel EUV Flows Observed along Active Region Filament Threads with Hi-C

NASA Astrophysics Data System (ADS)

Alexander, Caroline E.; Walsh, Robert W.; Régnier, Stéphane; Cirtain, Jonathan; Winebarger, Amy R.; Golub, Leon; Kobayashi, Ken; Platt, Simon; Mitchell, Nick; Korreck, Kelly; DePontieu, Bart; DeForest, Craig; Weber, Mark; Title, Alan; Kuzin, Sergey

2013-09-01

Plasma flows within prominences/filaments have been observed for many years and hold valuable clues concerning the mass and energy balance within these structures. Previous observations of these flows primarily come from Hα and cool extreme-ultraviolet (EUV) lines (e.g., 304 Å) where estimates of the size of the prominence threads has been limited by the resolution of the available instrumentation. Evidence of "counter-steaming" flows has previously been inferred from these cool plasma observations, but now, for the first time, these flows have been directly imaged along fundamental filament threads within the million degree corona (at 193 Å). In this work, we present observations of an AR filament observed with the High-resolution Coronal Imager (Hi-C) that exhibits anti-parallel flows along adjacent filament threads. Complementary data from the Solar Dynamics Observatory (SDO)/Atmospheric Imaging Assembly (AIA) and Helioseismic and Magnetic Imager are presented. The ultra-high spatial and temporal resolution of Hi-C allow the anti-parallel flow velocities to be measured (70-80 km s-1) and gives an indication of the resolvable thickness of the individual strands (0.''8 ± 0.''1). The temperature of the plasma flows was estimated to be log T (K) = 5.45 ± 0.10 using Emission Measure loci analysis. We find that SDO/AIA cannot clearly observe these anti-parallel flows or measure their velocity or thread width due to its larger pixel size. We suggest that anti-parallel/counter-streaming flows are likely commonplace within all filaments and are currently not observed in EUV due to current instrument spatial resolution.

A new species of cellular slime mold from southern Portugal based on morphology, ITS and SSU sequences.

PubMed

Romeralo, M; Baldauf, S L; Cavender, J C

2009-01-01

Sampling soils to look for dictyostelids in southern Portugal we found an isolate that has a morphology that differed from any previously described species of the group. We sequenced the internally transcribed spacer (ITS) and small subunit (SSU) genes of the nuclear ribosomal RNA and found that both sequences are distinct from all previously described sequences. Phylogenetic analyses place the new species in dictyostelid Group 3 (Rhizostelids) together with D. potamoides, with which it shares 65.8% identity for ITS and 96.6% for SSU. In this paper we describe a new species of cellular slime mold, Dictyostelium ibericum, based on morphological and molecular characters. It is a small species with polar granules in its spores.

Furanodictine A and B: amino sugar analogues produced by cellular slime mold Dictyostelium discoideum showing neuronal differentiation activity.

PubMed

Kikuchi, H; Saito, Y; Komiya, J; Takaya, Y; Honma, S; Nakahata, N; Ito, A; Oshima, Y

2001-10-19

We investigated the constituents of Dictyostelium discoideum to clarify the diversity of secondary metabolites of Dictyostelium cellular slime molds and to explore biologically active substances that could be useful in the development of novel drugs. From a methanol extract of the multicellular fruit body of D. discoideum, we isolated two novel amino sugar analogues, furanodictine A (1) and B (2). They are the first 3,6-anhydrosugars to be isolated from natural sources. Their relative structures were elucidated by spectral means, and the absolute configurations were confirmed by asymmetric syntheses of 1 and 2. These furanodictines potently induce neuronal differentiation of rat pheochromocytoma (PC-12) cells.

Human stem cell decorated nanocellulose threads for biomedical applications.

PubMed

Mertaniemi, Henrikki; Escobedo-Lucea, Carmen; Sanz-Garcia, Andres; Gandía, Carolina; Mäkitie, Antti; Partanen, Jouni; Ikkala, Olli; Yliperttula, Marjo

2016-03-01

Upon surgery, local inflammatory reactions and postoperative infections cause complications, morbidity, and mortality. Delivery of human adipose mesenchymal stem cells (hASC) into the wounds is an efficient and safe means to reduce inflammation and promote wound healing. However, administration of stem cells by injection often results in low cell retention, and the cells deposit in other organs, reducing the efficiency of the therapy. Thus, it is essential to improve cell delivery to the target area using carriers to which the cells have a high affinity. Moreover, the application of hASC in surgery has typically relied on animal-origin components, which may induce immune reactions or even transmit infections due to pathogens. To solve these issues, we first show that native cellulose nanofibers (nanofibrillated cellulose, NFC) extracted from plants allow preparation of glutaraldehyde cross-linked threads (NFC-X) with high mechanical strength even under the wet cell culture or surgery conditions, characteristically challenging for cellulosic materials. Secondly, using a xenogeneic free protocol for isolation and maintenance of hASC, we demonstrate that cells adhere, migrate and proliferate on the NFC-X, even without surface modifiers. Cross-linked threads were not found to induce toxicity on the cells and, importantly, hASC attached on NFC-X maintained their undifferentiated state and preserved their bioactivity. After intradermal suturing with the hASC decorated NFC-X threads in an ex vivo experiment, cells remained attached to the multifilament sutures without displaying morphological changes or reducing their metabolic activity. Finally, as NFC-X optionally allows facile surface tailoring if needed, we anticipate that stem-cell-decorated NFC-X opens a versatile generic platform as a surgical bionanomaterial for fighting postoperative inflammation and chronic wound healing problems. Copyright © 2015 Elsevier Ltd. All rights reserved.

Large Scale Document Inversion using a Multi-threaded Computing System

PubMed Central

Jung, Sungbo; Chang, Dar-Jen; Park, Juw Won

2018-01-01

Current microprocessor architecture is moving towards multi-core/multi-threaded systems. This trend has led to a surge of interest in using multi-threaded computing devices, such as the Graphics Processing Unit (GPU), for general purpose computing. We can utilize the GPU in computation as a massive parallel coprocessor because the GPU consists of multiple cores. The GPU is also an affordable, attractive, and user-programmable commodity. Nowadays a lot of information has been flooded into the digital domain around the world. Huge volume of data, such as digital libraries, social networking services, e-commerce product data, and reviews, etc., is produced or collected every moment with dramatic growth in size. Although the inverted index is a useful data structure that can be used for full text searches or document retrieval, a large number of documents will require a tremendous amount of time to create the index. The performance of document inversion can be improved by multi-thread or multi-core GPU. Our approach is to implement a linear-time, hash-based, single program multiple data (SPMD), document inversion algorithm on the NVIDIA GPU/CUDA programming platform utilizing the huge computational power of the GPU, to develop high performance solutions for document indexing. Our proposed parallel document inversion system shows 2-3 times faster performance than a sequential system on two different test datasets from PubMed abstract and e-commerce product reviews. CCS Concepts •Information systems➝Information retrieval • Computing methodologies➝Massively parallel and high-performance simulations. PMID:29861701

Clinical leadership as an integral curriculum thread in pre-registration nursing programmes.

PubMed

Brown, Angela; Dewing, Jan; Crookes, Patrick

2016-03-01

In recent years there has been a growth in leadership development frameworks in health for the existing workforce. There has also been a related abundance of leadership programmes developed specifically for qualified nurses. There is a groundswell of opinion that clinical leadership preparation needs to extend to preparatory programmes leading to registration as a nurse. To this end a doctoral research study has been completed that focused specifically on the identification and verification of the antecedents of clinical leadership (leadership and management) so they can shape the curriculum content and the best way to deliver the curriculum content as a curriculum thread. To conceptualise how the curriculum content, identified and verified empirically, can be structured within a curriculum thread and to contribute to the discussion on effective pedagogical approaches and educational strategies for learning and teaching of clinical leadership. A multi-method design was utilised in the research in Australia. Drawing on core principles in critical social theory, an integral curriculum thread is proposed for pre-registration nursing programmes that identifies the antecedents of clinical leadership; the core concepts, together with the continuum of enlightenment, empowerment, and emancipation. The curriculum content, the effective pedagogical approaches and the educational strategies are supported theoretically and we believe this offers a design template for action and a way of thinking about this important aspect of preparatory nursing education. Moreover, we hope to have created a process contributing to a heighten sense of awareness in the nursing student (and other key stakeholders) of the what, how and when of clinical leadership for a novice registered nurse. The next stage is to further test through research the proposed integral curriculum thread. Copyright © 2015 Elsevier Ltd. All rights reserved.

Real and Non-Real Time Interaction: Unraveling Multiple Threads of Discourse.

ERIC Educational Resources Information Center

Black, Steven D.; And Others

1983-01-01

Compares discourse in several different media and finds that strict sequentiality is not a universal feature of discourse. Concludes that discourse in nonreal time media, such as electronic message systems, has multiple threads. (FL)

Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.

PubMed

Saito, T; Ochiai, H

1999-10-01

cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.

SURVEY AND SUMMARY: exon-intron organization of genes in the slime mold Physarum polycephalum.

PubMed

Trzcinska-Danielewicz, J; Fronk, J

2000-09-15

The slime mold Physarum polycephalum is a morphologically simple organism with a large and complex genome. The exon-intron organization of its genes exhibits features typical for protists and fungi as well as those characteristic for the evolutionarily more advanced species. This indicates that both the taxonomic position as well as the size of the genome shape the exon-intron organization of an organism. The average gene has 3.7 introns which are on average 138 bp, with a rather narrow size distribution. Introns are enriched in AT base pairs by 13% relative to exons. The consensus sequences at exon-intron boundaries resemble those found for other species, with minor differences between short and long introns. A unique feature of P.polycephalum introns is the strong preference for pyrimidines in the coding strand throughout their length, without a particular enrichment at the 3'-ends.

From Primary to Secondary Science: Keeping the Threads Intact

ERIC Educational Resources Information Center

Mould, Kirsten

2015-01-01

There are many transition points in the school life of a child, but the move from primary to secondary school is a particularly significant one. How can both the social and academic threads remain intact? In this article, Kristen Mould discusses the main issues relating to transition from primary to secondary science. She cites the primary factors…

Succinoglycan Is Required for Initiation and Elongation of Infection Threads during Nodulation of Alfalfa by Rhizobium meliloti

PubMed Central

Cheng, Hai-Ping; Walker, Graham C.

1998-01-01

Rhizobium meliloti Rm1021 must be able to synthesize succinoglycan in order to invade successfully the nodules which it elicits on alfalfa and to establish an effective nitrogen-fixing symbiosis. Using R. meliloti cells that express green fluorescent protein (GFP), we have examined the nature of the symbiotic deficiency of exo mutants that are defective or altered in succinoglycan production. Our observations indicate that an exoY mutant, which does not produce succinoglycan, is symbiotically defective because it cannot initiate the formation of infection threads. An exoZ mutant, which produces succinoglycan without the acetyl modification, forms nitrogen-fixing nodules on plants, but it exhibits a reduced efficiency in the initiation and elongation of infection threads. An exoH mutant, which produces symbiotically nonfunctional high-molecular-weight succinoglycan that lacks the succinyl modification, cannot form extended infection threads. Infection threads initiate at a reduced rate and then abort before they reach the base of the root hairs. Overproduction of succinoglycan by the exoS96::Tn5 mutant does not reduce the efficiency of infection thread initiation and elongation, but it does significantly reduce the ability of this mutant to colonize the curled root hairs, which is the first step of the invasion process. The exoR95::Tn5 mutant, which overproduces succinoglycan to an even greater extent than the exoS96::Tn5 mutant, has completely lost its ability to colonize the curled root hairs. These new observations lead us to propose that succinoglycan is required for both the initiation and elongation of infection threads during nodule invasion and that excess production of succinoglycan interferes with the ability of the rhizobia to colonize curled root hairs. PMID:9748453

A Locality-Based Threading Algorithm for the Configuration-Interaction Method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shan, Hongzhang; Williams, Samuel; Johnson, Calvin

The Configuration Interaction (CI) method has been widely used to solve the non-relativistic many-body Schrodinger equation. One great challenge to implementing it efficiently on manycore architectures is its immense memory and data movement requirements. To address this issue, within each node, we exploit a hybrid MPI+OpenMP programming model in lieu of the traditional flat MPI programming model. Here in this paper, we develop optimizations that partition the workloads among OpenMP threads based on data locality,-which is essential in ensuring applications with complex data access patterns scale well on manycore architectures. The new algorithm scales to 256 threadson the 64-core Intelmore » Knights Landing (KNL) manycore processor and 24 threads on dual-socket Ivy Bridge (Xeon) nodes. Compared with the original implementation, the performance has been improved by up to 7× on theKnights Landing processor and 3× on the dual-socket Ivy Bridge node.« less

A Locality-Based Threading Algorithm for the Configuration-Interaction Method

DOE PAGES

Shan, Hongzhang; Williams, Samuel; Johnson, Calvin; ...

2017-07-03

The Configuration Interaction (CI) method has been widely used to solve the non-relativistic many-body Schrodinger equation. One great challenge to implementing it efficiently on manycore architectures is its immense memory and data movement requirements. To address this issue, within each node, we exploit a hybrid MPI+OpenMP programming model in lieu of the traditional flat MPI programming model. Here in this paper, we develop optimizations that partition the workloads among OpenMP threads based on data locality,-which is essential in ensuring applications with complex data access patterns scale well on manycore architectures. The new algorithm scales to 256 threadson the 64-core Intelmore » Knights Landing (KNL) manycore processor and 24 threads on dual-socket Ivy Bridge (Xeon) nodes. Compared with the original implementation, the performance has been improved by up to 7× on theKnights Landing processor and 3× on the dual-socket Ivy Bridge node.« less

Theoretical prediction of pullout strengths for dental and orthopaedic screws with conical profile and buttress threads.

PubMed

Shih, Kao-Shang; Hou, Sheng-Mou; Lin, Shang-Chih

2017-12-01

The pullout strength of a screw is an indicator of how secure bone fragments are being held in place. Such bone-purchasing ability is sensitive to bone quality, thread design, and the pilot hole, and is often evaluated by experimental and numerical methods. Historically, there are some mathematical formulae to simulate the screw withdrawal from the synthetic bone. There are great variations in screw specifications. However, extensive investigation of the correlation between experimental and analytical results has not been reported in literature. Referring to the literature formulae, this study aims to evaluate the differences in the calculated pullout strengths. The pullout tests of the surgical screws are measured and the sawbone is used as the testing block. The absolute errors and correlation coefficients of the experimental and analytical results are calculated as the comparison baselines of the formulae. The absolute error of the dental, traumatic, and spinal groups are 21.7%, 95.5%, and 37.0%, respectively. For the screws with a conical profile and/or tiny threads, the calculated and measured results are not well correlated. The formulae are not accurate indicators of the pullout strengths of the screws where the design parameters are slightly varied. However, the experimental and numerical results are highly correlated for the cylindrical screws. The pullout strength of a conical screw is higher than that of its counterpart, but all formulae consistently predict the opposite results. In general, the bony purchase of the buttress threads is securer than that of the symmetric thread. An absolute error of up to 51.4% indicates the theoretical results cannot predict the actual value of the pullout strength. Only thread diameter, pitch, and depth are considered in the investigated formulae. The thread profile and shape should be formulated to modify the slippage mechanism at the bone-screw interfaces and simulate the strength change in the squeezed bones

76 FR 68400 - Certain Steel Threaded Rod From the People's Republic of China: Final Results and Final Partial...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-11-04

... DEPARTMENT OF COMMERCE International Trade Administration [A-570-932] Certain Steel Threaded Rod... the first administrative review of the antidumping duty order on certain steel threaded rod (``steel... notice. The period of review (``POR'') is October 8, 2008, through March 31, 2010. \\1\\ See Certain Steel...

Stability of a dragged viscous thread: Onset of ``stitching'' in a fluid-mechanical ``sewing machine''

NASA Astrophysics Data System (ADS)

Ribe, Neil M.; Lister, John R.; Chiu-Webster, Sunny

2006-12-01

A thin thread of viscous fluid that falls on a moving belt acts like a fluid-mechanical "sewing machine," exhibiting a rich variety of "stitch" patterns including meanders, translated coiling, slanted loops, braiding, figures-of-eight, W-patterns, side kicks, and period-doubled patterns. Using a numerical linear stability analysis, we determine the critical belt speed and oscillation frequency of the first bifurcation, at which a steady dragged viscous thread becomes unstable to transverse oscillations or "meandering." The predictions of the stability analysis agree closely with the experimental measurements of Chiu-Webster and Lister [J. Fluid Mech. 569, 89 (2006)]. Moreover, the critical belt speed and onset frequency for meandering are nearly identical to the contact-point migration speed and angular frequency, respectively, of steady coiling of a viscous thread on a stationary surface, implying a remarkable degree of dynamical similarity between the two phenomena.

ANTI-PARALLEL EUV FLOWS OBSERVED ALONG ACTIVE REGION FILAMENT THREADS WITH HI-C

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexander, Caroline E.; Walsh, Robert W.; Régnier, Stéphane

Plasma flows within prominences/filaments have been observed for many years and hold valuable clues concerning the mass and energy balance within these structures. Previous observations of these flows primarily come from Hα and cool extreme-ultraviolet (EUV) lines (e.g., 304 Å) where estimates of the size of the prominence threads has been limited by the resolution of the available instrumentation. Evidence of 'counter-steaming' flows has previously been inferred from these cool plasma observations, but now, for the first time, these flows have been directly imaged along fundamental filament threads within the million degree corona (at 193 Å). In this work, wemore » present observations of an AR filament observed with the High-resolution Coronal Imager (Hi-C) that exhibits anti-parallel flows along adjacent filament threads. Complementary data from the Solar Dynamics Observatory (SDO)/Atmospheric Imaging Assembly (AIA) and Helioseismic and Magnetic Imager are presented. The ultra-high spatial and temporal resolution of Hi-C allow the anti-parallel flow velocities to be measured (70-80 km s{sup –1}) and gives an indication of the resolvable thickness of the individual strands (0.''8 ± 0.''1). The temperature of the plasma flows was estimated to be log T (K) = 5.45 ± 0.10 using Emission Measure loci analysis. We find that SDO/AIA cannot clearly observe these anti-parallel flows or measure their velocity or thread width due to its larger pixel size. We suggest that anti-parallel/counter-streaming flows are likely commonplace within all filaments and are currently not observed in EUV due to current instrument spatial resolution.« less

Electrical Current Leakage and Open-Core Threading Dislocations in AlGaN-Based Deep Ultraviolet Light-Emitting Diodes.

DOE PAGES

Moseley, Michael William; Allerman, Andrew A.; Crawford, Mary H.; ...

2014-08-04

Electrical current transport through leakage paths in AlGaN-based deep ultraviolet (DUV) lightemitting diodes (LEDs) and their effect on LED performance are investigated. Open-core threading dislocations, or nanopipes, are found to conduct current through nominally insulating Al0.7Ga0.3N layers and limit the performance of DUV-LEDs. A defect-sensitive phosphoric acid etch reveals these opencore threading dislocations in the form of large, micron-scale hexagonal etch pits visible with optical microscopy, while closed-core screw-, edge-, and mixed-type threading dislocations are represented by smaller and more numerous nanometer-scale pits visible by atomic-force microscopy. The electrical and optical performances of DUV-LEDs fabricated on similar Si-doped Al0.7Ga0.3N templatesmore » are found to have a strong correlation to the density of these nanopipes, despite their small fraction (<0.1% in this study) of the total density of threading dislocations.« less

Cardiac metabolism in the Myxinidae: physiological and phylogenetic considerations.

PubMed

Sidell, B D

1983-01-01

Cardiac muscle hearts of Atlantic hagfish continuously function under hypoxic conditions that would lead to cardiac failure in most other vertebrates. Contractile performance of hagfish systemic hearts is resistant to anoxia and respiratory poisons but shows a significant decrement when carbohydrate catabolism is blocked by 0.5 mM iodoacetic acid. Enzyme activity profiles of hagfish ventricle reveal a robust capacity for glycolysis of carbohydrate in comparison to that for general aerobic metabolism and catabolism of alternate metabolic fuels. Isolated working hagfish ventricles preferentially oxidize radiolabeled glucose even when fatty acid fuels are present in the incubation medium. Work output of the isolated ventricular preparation is maintained only in the presence of exogenous glucose. The results indicate that energy metabolism of the hagfish myocardium is predominantly carbohydrate-based and that energy demand of the tissue can be sustained by anaerobic glycolysis during extended periods of extreme hypoxia. Cardiac metabolism of this primitive species is compared with that of hearts from higher vertebrates and an evolutionary hypothesis relating cardiac workload to preferred metabolic fuel is discussed.

Personality Types and Learners' Interaction in Web-Based Threaded Discussion

ERIC Educational Resources Information Center

Lee, JeongMin; Lee, Youngmin

2006-01-01

This study examined the effects of group composition based on the learners' personality types as measured by the Myers-Briggs type indicator as they interacted in threaded discussions. Three groups comprised introverts, extroverts, and mixed introvert-extrovert classifications. Ninety-six participants were divided into 24 groups of 4 participants…

Preload, Coefficient of Friction, and Thread Friction in an Implant-Abutment-Screw Complex.

PubMed

Wentaschek, Stefan; Tomalla, Sven; Schmidtmann, Irene; Lehmann, Karl Martin

To examine the screw preload, coefficient of friction (COF), and tightening torque needed to overcome the thread friction of an implant-abutment-screw complex. In a customized load frame, 25 new implant-abutment-screw complexes including uncoated titanium alloy screws were torqued and untorqued 10 times each, applying 25 Ncm. Mean preload values decreased significantly from 209.8 N to 129.5 N according to the number of repetitions. The overall COF increased correspondingly. There was no comparable trend for the thread friction component. These results suggest that the application of a used implant-abutment-screw complex may be unfavorable for obtaining optimal screw preload.

Protein structure recognition: From eigenvector analysis to structural threading method

NASA Astrophysics Data System (ADS)

Cao, Haibo

In this work, we try to understand the protein folding problem using pair-wise hydrophobic interaction as the dominant interaction for the protein folding process. We found a strong correlation between amino acid sequence and the corresponding native structure of the protein. Some applications of this correlation were discussed in this dissertation include the domain partition and a new structural threading method as well as the performance of this method in the CASP5 competition. In the first part, we give a brief introduction to the protein folding problem. Some essential knowledge and progress from other research groups was discussed. This part include discussions of interactions among amino acids residues, lattice HP model, and the designablity principle. In the second part, we try to establish the correlation between amino acid sequence and the corresponding native structure of the protein. This correlation was observed in our eigenvector study of protein contact matrix. We believe the correlation is universal, thus it can be used in automatic partition of protein structures into folding domains. In the third part, we discuss a threading method based on the correlation between amino acid sequence and ominant eigenvector of the structure contact-matrix. A mathematically straightforward iteration scheme provides a self-consistent optimum global sequence-structure alignment. The computational efficiency of this method makes it possible to search whole protein structure databases for structural homology without relying on sequence similarity. The sensitivity and specificity of this method is discussed, along with a case of blind test prediction. In the appendix, we list the overall performance of this threading method in CASP5 blind test in comparison with other existing approaches.

Threading Mathematics through Symbols, Sketches, Software, Silicon, and Wood: Teachers Produce and Maintain Cohesion to Support STEM Integration

ERIC Educational Resources Information Center

Nathan, Mitchell J.; Wolfgram, Matthew; Srisurichan, Rachaya; Walkington, Candace; Alibali, Martha W.

2017-01-01

This classroom-based investigation sought to document how, in real time, STEM teachers and students attempt to locate the invariant mathematical relations that are threaded through the range of activities and representations in these classes, and how highlighting this common thread influences student participation and learning. The authors…

A mathematical model for adaptive transport network in path finding by true slime mold.

PubMed

Tero, Atsushi; Kobayashi, Ryo; Nakagaki, Toshiyuki

2007-02-21

We describe here a mathematical model of the adaptive dynamics of a transport network of the true slime mold Physarum polycephalum, an amoeboid organism that exhibits path-finding behavior in a maze. This organism possesses a network of tubular elements, by means of which nutrients and signals circulate through the plasmodium. When the organism is put in a maze, the network changes its shape to connect two exits by the shortest path. This process of path-finding is attributed to an underlying physiological mechanism: a tube thickens as the flux through it increases. The experimental evidence for this is, however, only qualitative. We constructed a mathematical model of the general form of the tube dynamics. Our model contains a key parameter corresponding to the extent of the feedback regulation between the thickness of a tube and the flux through it. We demonstrate the dependence of the behavior of the model on this parameter.

True-slime-mould-inspired hydrostatically coupled oscillator system exhibiting versatile behaviours.

PubMed

Umedachi, Takuya; Idei, Ryo; Ito, Kentaro; Ishiguro, Akio

2013-09-01

Behavioural diversity is an indispensable attribute of living systems, which makes them intrinsically adaptive and responsive to the demands of a dynamically changing environment. In contrast, conventional engineering approaches struggle to suppress behavioural diversity in artificial systems to reach optimal performance in given environments for desired tasks. The goals of this research include understanding the essential mechanism that endows living systems with behavioural diversity and implementing the mechanism in robots to exhibit adaptive behaviours. For this purpose, we have focused on an amoeba-like unicellular organism: the plasmodium of true slime mould. Despite the absence of a central nervous system, the plasmodium exhibits versatile spatiotemporal oscillatory patterns and switches spontaneously among these patterns. By exploiting this behavioural diversity, it is able to exhibit adaptive behaviour according to the situation encountered. Inspired by this organism, we built a real physical robot using hydrostatically coupled oscillators that produce versatile oscillatory patterns and spontaneous transitions among the patterns. The experimental results show that exploiting physical hydrostatic interplay—the physical dynamics of the robot—allows simple phase oscillators to promote versatile behaviours. The results can contribute to an understanding of how a living system generates versatile and adaptive behaviours with physical interplays among body parts.

Density of bunched threading dislocations in epitaxial GaN layers as determined using X-ray diffraction

NASA Astrophysics Data System (ADS)

Barchuk, M.; Holý, V.; Rafaja, D.

2018-04-01

X-ray diffraction is one of the most popular experimental methods employed for determination of dislocation densities, as it can recognize both the strain fields and the local lattice rotations produced by dislocations. The main challenge of the quantitative analysis of the dislocation density is the formulation of a suitable microstructure model, which describes the dislocation arrangement and the effect of the interactions between the strain fields from neighboring dislocations reliably in order to be able to determine the dislocation densities precisely. The aim of this study is to prove the capability of X-ray diffraction and two computational methods, which are frequently used for quantification of the threading dislocation densities from X-ray diffraction measurements, in the special case of partially bunched threading dislocations. The first method is based on the analysis of the dislocation-controlled crystal mosaicity, and the other one on the analysis of diffuse X-ray scattering from threading dislocations. The complementarity of both methods is discussed. Furthermore, it is shown how the complementarity of these methods can be used to improve the results of the quantitative analysis of bunched and thus inhomogeneously distributed threading dislocations and to get a better insight into the dislocation arrangement.

High Affinity Macrocycle Threading by a Near-Infrared Croconaine Dye with Flanking Polymer Chains

PubMed Central

Liu, Wenqi; Peck, Evan M.; Smith, Bradley D.

2016-01-01

Croconaine dyes have narrow and intense absorption bands at ~800 nm, very weak fluorescence, and high photostabilities, which combine to make them very attractive chromophores for absorption-based imaging or laser heating technologies. The physical supramolecular properties of croconaine dyes have rarely been investigated, especially in water. This study focuses on a molecular threading process that encapsulates a croconaine dye inside a tetralactam macrocycle in organic or aqueous solvent. Macrocycle association and rate constant data are reported for a series of croconaine structures with different substituents attached to the ends of the dye. The association constants were highest in water (Ka ~109 M−1), and the threading rate constants (kon) increased in the solvent order H2O > MeOH > CHCl3. Systematic variation of croconaine substituents located just outside the croconaine/macrocycle complexation interface hardly changed Ka but had a strong influence on kon. A croconaine dye with N-propyl groups at each end of the structure exhibited a desirable mixture of macrocycle threading properties; that is, there was rapid and quantitative croconaine/macrocycle complexation at relatively high concentrations in water, and no dissociation of the pre-assembled complex when it was diluted into a solution of fetal bovine serum, even after laser induced photothermal heating of the solution. The combination of favorable near-infrared absorption properties and tunable mechanical stability makes threaded croconaine/macrocycle complexes very attractive as molecular probes or as supramolecular composites for various applications in absorption-based imaging or photothermal therapy. PMID:26807599

The fall of a viscous thread onto a moving surface: a ‘fluid-mechanical sewing machine’

NASA Astrophysics Data System (ADS)

Chiu-Webster, S.; Lister, J. R.

2006-12-01

A viscous thread falling onto a steadily moving horizontal belt shows a surprisingly complex range of behaviour in experiments. Low belt speeds produce coiling, as might be expected from the behaviour of a thread falling onto a stationary surface. High belt speeds produce a steady thread, whose shape is predicted well by theory developed to describe a stretching viscous catenary with surface tension and inertia. Intermediate belt speeds show several novel modes of oscillation, which lay down a wide variety of patterns on the belt. The patterns include meanders, side kicks, slanted loops, braiding, figures-of-eight, Ws, and also period-doubled versions of figures-of-eight, meanders and coiling. The experimental boundary between steady and unsteady behaviour occurs at a slightly lower belt speed than the loss of the steady solution for a stretching catenary.

Removal of iron ore slimes from a highly turbid water by DAF.

PubMed

Faustino, L M; Braga, A S; Sacchi, G D; Whitaker, W; Reali, M A P; Leal Filho, L S; Daniel, L A

2018-05-30

This paper addresses Dissolved Air Flotation (DAF) process variables, such as the flocculation parameters and the recycle water addition, as well as the pretreatment chemical variables (coagulation conditions), to determine the optimal values for the flotation of iron ore slimes found in a highly turbid water sample from the Gualaxo do Norte River, a tributary of the Doce River Basin in Minas Gerais, Brazil. This work was conducted using a flotatest batch laboratory-scale device to evaluate the effectiveness of DAF for cleaning the water polluted by the Samarco tailings dam leakage and determine the ability of DAF to reduce the water turbidity from 358 NTU to values below 100 NTU, aiming to comply with current legislation. The results showed that the four types of tested coagulants (PAC, ferric chloride, Tanfloc SG and Tanfloc SL) provided adequate conditions for coagulation, flocculation and flotation (in the range of 90-99.6% turbidity reduction). Although the process variables were optimized and low residual turbidity vales were achieved, results revealed that a portion of the flocs settled at the bottom of the flotatest columns, which indicated that the turbidity results represented removal caused by a combination of flotation and sedimentation processes simultaneously.

Model Checking with Multi-Threaded IC3 Portfolios

DTIC Science & Technology

2015-01-15

different runs varies randomly depending on the thread interleaving. The use of a portfolio of solvers to maximize the likelihood of a quick solution is...empirically show (cf. Sec. 5.2) that the predictions based on this formula have high accuracy. Note that each solver in the portfolio potentially searches...speedup of over 300. We also show that widening the proof search of ic3 by randomizing its SAT solver is not as effective as paral- lelization

Correlation between the sub-structure parameters and the manufacturing technologies of metal threads in historical textiles using X-ray line profile analysis

NASA Astrophysics Data System (ADS)

Csiszár, Gábor; Ungár, Tamás; Járó, Márta

2013-06-01

Micro-structure can talk when documentation is missing. In ancient Roman or medieval periods, kings, queens, or just rich people decorated their clothes or even their horse covers richly with miniature jewels or metal threads. The origin or the fabrication techniques of these ancient threads is often unknown. Thirteen thread samples made of gold or gilt silver manufactured during the last sixteen hundred years are investigated for the micro-structure in terms of dislocation density, crystallite size, and planar defects. In a few cases, these features are compared with sub-structure of similar metallic threads prepared in modern, twentieth century workshops. The sub-structure is determined by X-ray line profile analysis, using high resolution diffractograms with negligible instrumental broadening. On the basis of the sub-structure parameters, we attempt to assess the metal-threads manufacturing procedures on samples stemming from the fourth century A.D. until now.

Discriminating Intercalative Effects of Threading Intercalator Nogalamycin, from Classical Intercalator Daunomycin, Using Single Molecule Atomic Force Spectroscopy.

PubMed

Banerjee, T; Banerjee, S; Sett, S; Ghosh, S; Rakshit, T; Mukhopadhyay, R

2016-01-01

DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA-the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA-the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time.

Discriminating Intercalative Effects of Threading Intercalator Nogalamycin, from Classical Intercalator Daunomycin, Using Single Molecule Atomic Force Spectroscopy

PubMed Central

Sett, S.; Ghosh, S.; Rakshit, T.; Mukhopadhyay, R.

2016-01-01

DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA—the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA—the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time. PMID:27183010

Threaded-Field-Line Model for the Transition Region and Solar Corona

NASA Astrophysics Data System (ADS)

Sokolov, I.; van der Holst, B.; Gombosi, T. I.

2014-12-01

In numerical simulations of the solar corona, both for the ambient state and especially for dynamical processes the most computational resources are spent for maintaining the numerical solution in the Low Solar Corona and in the transition region, where the temperature gradients are very sharp and the magnetic field has a complicated topology. The degraded computational efficiency is caused by the need in a highest resolution as well as the use of the fully three-dimensional implicit solver for electron heat conduction. On the other hand, the physical nature of the processes involved is rather simple (which still does not facilitate the numerical methods) as long as the heat fluxes as well as slow plasma motional velocities are aligned with the magnetic field. The Alfven wave turbulence, which is often believed to be the main driver of the solar wind and the main source of the coronal heating, is characterized by the Poynting flux of the waves, which is also aligned with the magnetic field. Therefore, the plasma state in any point of the three-dimensional grid in the Low Solar Corona can be found by solving a set of one-dimensional equations for the magnetic field line ("thread"), which passes through this point and connects it to the chromosphere and to the global Solar Corona. In the present paper we describe an innovative computational technology based upon the use of the magnetic-field-line-threads to forlmulate the boundary condition for the global solar corona model which traces the connection of each boundary point to the cromosphere along the threads.

21. View of endlift slide on pedestal and threaded shaft ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

21. View of end-lift slide on pedestal and threaded shaft with level gears. Curved deck joint at underside of roadway deck is seen, as well as submarine electrical cables resting on the masonry pier. (Nov. 30, 1988) - University Heights Bridge, Spanning Harlem River at 207th Street & West Harlem Road, New York County, NY

Structural pathway of regulated substrate transfer and threading through an Hsp100 disaggregase.

PubMed

Deville, Célia; Carroni, Marta; Franke, Kamila B; Topf, Maya; Bukau, Bernd; Mogk, Axel; Saibil, Helen R

2017-08-01

Refolding aggregated proteins is essential in combating cellular proteotoxic stress. Together with Hsp70, Hsp100 chaperones, including Escherichia coli ClpB, form a powerful disaggregation machine that threads aggregated polypeptides through the central pore of tandem adenosine triphosphatase (ATPase) rings. To visualize protein disaggregation, we determined cryo-electron microscopy structures of inactive and substrate-bound ClpB in the presence of adenosine 5'- O -(3-thiotriphosphate), revealing closed AAA+ rings with a pronounced seam. In the substrate-free state, a marked gradient of resolution, likely corresponding to mobility, spans across the AAA+ rings with a dynamic hotspot at the seam. On the seam side, the coiled-coil regulatory domains are locked in a horizontal, inactive orientation. On the opposite side, the regulatory domains are accessible for Hsp70 binding, substrate targeting, and activation. In the presence of the model substrate casein, the polypeptide threads through the entire pore channel and increased nucleotide occupancy correlates with higher ATPase activity. Substrate-induced domain displacements indicate a pathway of regulated substrate transfer from Hsp70 to the ClpB pore, inside which a spiral of loops contacts the substrate. The seam pore loops undergo marked displacements, along with ordering of the regulatory domains. These asymmetric movements suggest a mechanism for ATPase activation and substrate threading during disaggregation.

Efficient methods for implementation of multi-level nonrigid mass-preserving image registration on GPUs and multi-threaded CPUs.

PubMed

Ellingwood, Nathan D; Yin, Youbing; Smith, Matthew; Lin, Ching-Long

2016-04-01

Faster and more accurate methods for registration of images are important for research involved in conducting population-based studies that utilize medical imaging, as well as improvements for use in clinical applications. We present a novel computation- and memory-efficient multi-level method on graphics processing units (GPU) for performing registration of two computed tomography (CT) volumetric lung images. We developed a computation- and memory-efficient Diffeomorphic Multi-level B-Spline Transform Composite (DMTC) method to implement nonrigid mass-preserving registration of two CT lung images on GPU. The framework consists of a hierarchy of B-Spline control grids of increasing resolution. A similarity criterion known as the sum of squared tissue volume difference (SSTVD) was adopted to preserve lung tissue mass. The use of SSTVD consists of the calculation of the tissue volume, the Jacobian, and their derivatives, which makes its implementation on GPU challenging due to memory constraints. The use of the DMTC method enabled reduced computation and memory storage of variables with minimal communication between GPU and Central Processing Unit (CPU) due to ability to pre-compute values. The method was assessed on six healthy human subjects. Resultant GPU-generated displacement fields were compared against the previously validated CPU counterpart fields, showing good agreement with an average normalized root mean square error (nRMS) of 0.044±0.015. Runtime and performance speedup are compared between single-threaded CPU, multi-threaded CPU, and GPU algorithms. Best performance speedup occurs at the highest resolution in the GPU implementation for the SSTVD cost and cost gradient computations, with a speedup of 112 times that of the single-threaded CPU version and 11 times over the twelve-threaded version when considering average time per iteration using a Nvidia Tesla K20X GPU. The proposed GPU-based DMTC method outperforms its multi-threaded CPU version in terms

Effects of Thread Depth in the Neck Area on Peri-Implant Hard and Soft Tissues: An Animal Study.

PubMed

Sun, Shan-Pao; Lee, Dong-Won; Yun, Jeong-Ho; Park, Kwang-Ho; Park, Kwang-Bum; Moon, Ik-Sang

2016-11-01

Implants with deep thread depth have been developed for the purpose of increasing total implant surface area. However, effects of implant thread depth remain controversial. The aim of this study is to examine effects of thread depth on peri-implant tissues in terms of bone-implant contact (BIC), bone-implant volume (BIV), and hard and soft tissue dimensions using comprehensive analyses, including microcomputed tomography (micro-CT). Five beagle dogs received experimental intramandibular implants 3 months after removal of their premolars and first molars (P 2 , P 3 , P 4 , and M 1 ). Two different types of implants were installed in each animal: deep threaded (DT) and shallow threaded (ST). Resonance frequency testing was performed on the day of implantation as well as 4 and 8 weeks after implantation. Intraoral radiography, micro-CT, and histomorphometry were used to evaluate peri-implant tissues 4 and 8 weeks after implantation. There were no significant differences in resonance frequency test results between the two groups. Although radiographic analysis showed no group differences, micro-CT (P = 0.01) and histomorphometry (P = 0.003) revealed the DT group had significantly lower BIC values than the ST group at 4 weeks. However, by 8 weeks, BIC values of the two groups did not differ significantly. No significant differences in BIV or soft tissue height were observed between the two groups at either time point. DT implants showed no benefits over ST implants when inserted in dog mandibles.

Understanding Single-Thread Meandering Rivers with High Sinuosity on Mars through Chemical Precipitation Experiments

NASA Astrophysics Data System (ADS)

Lim, Y.; Kim, W.

2015-12-01

Meandering rivers are extremely ubiquitous on Earth, yet it is only recently that single-thread experimental channels with low sinuosity have been created. In these recent experiments, as well as in natural rivers, vegetation plays a crucial role in maintaining a meandering pattern by adding cohesion to the bank and inhibiting erosion. The ancient, highly sinuous channels found on Mars are enigmatic because presumably vegetation did not exist on ancient Mars. Under the hypothesis that Martian meandering rivers formed by chemical precipitation on levees and flood plain deposits, we conducted carbonate flume experiments to investigate the formation and evolution of a single-thread meander pattern without vegetation. The flow recirculating in the flume is designed to accelerate chemical reactions - dissolution of limestone using CO2 gas to produce artificial spring water and precipitation of carbonates to increase cohesion- with precise control of water discharge, sediment discharge, and temperature. Preliminary experiments successfully created a single-thread meandering pattern through chemical processes. Carbonate deposits focused along the channel sides improved the bank stability and made them resistant to erosion, which led to a stream confined in a narrow path. The experimental channels showed lateral migration of the bend through cut bank and point bar deposits; intermittent floods created overbank flow and encouraged cut bank erosion, which enhanced lateral migration of the channel, while increase in sediment supply improved lateral point bar deposition, which balanced erosion and deposition rates. This mechanism may be applied to terrestrial single-thread and/or meandering rivers with little to no vegetation or before its introduction to Earth and also provide the link between meandering river records on Mars to changes in Martian surface conditions.

INTERIOR VIEW OF JAMES HARRIS CUTTING SCREW THREADS INTO THE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

INTERIOR VIEW OF JAMES HARRIS CUTTING SCREW THREADS INTO THE INTERIOR OF FITTINGS ON ONE IN A BANK OF TAPPING MACHINES, EACH OPERATED BY THE SAME WORKER SIMULTANEOUSLY BUT TIMED TO REQUIRE WORKER ACTION AT INTERVALS THAT DO NOT INTERFERE WITH THE OTHER MACHINES. - Stockham Pipe & Fittings Company, Tapping Room, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

Deviation of the typical AAA substrate-threading pore prevents fatal protein degradation in yeast Cdc48.

PubMed

Esaki, Masatoshi; Islam, Md Tanvir; Tani, Naoki; Ogura, Teru

2017-07-14

Yeast Cdc48 is a well-conserved, essential chaperone of ATPases associated with diverse cellular activity (AAA) proteins, which recognizes substrate proteins and modulates their conformations to carry out many cellular processes. However, the fundamental mechanisms underlying the diverse pivotal roles of Cdc48 remain unknown. Almost all AAA proteins form a ring-shaped structure with a conserved aromatic amino acid residue that is essential for proper function. The threading mechanism hypothesis suggests that this residue guides the intrusion of substrate proteins into a narrow pore of the AAA ring, thereby becoming unfolded. By contrast, the aromatic residue in one of the two AAA rings of Cdc48 has been eliminated through evolution. Here, we show that artificial retrieval of this aromatic residue in Cdc48 is lethal, and essential features to support the threading mechanism are required to exhibit the lethal phenotype. In particular, genetic and biochemical analyses of the Cdc48 lethal mutant strongly suggested that when in complex with the 20S proteasome, essential proteins are abnormally forced to thread through the Cdc48 pore to become degraded, which was not detected in wild-type Cdc48. Thus, the widely applicable threading model is less effective for wild-type Cdc48; rather, Cdc48 might function predominantly through an as-yet-undetermined mechanism.

Using VoiceThread to Promote Collaborative Learning in On-Line Clinical Nurse Leader Courses.

PubMed

Fox, Ola H

The movement to advance the clinical nurse leader (CNL) as an innovative new role for meeting higher health care quality standards continues with CNL programs offered on-line at colleges and universities nationwide. Collaborative learning activities offer the opportunity for CNL students to gain experience in working together in small groups to negotiate and solve care process problems. The challenge for nurse educators is to provide collaborative learning activities in an asynchronous learning environment that can be considered isolating by default. This article reports on the experiences of 17 CNL students who used VoiceThread, a cloud-based tool that allowed them to communicate asynchronously with one another through voice comments for collaboration and sharing knowledge. Participants identified benefits and drawbacks to using VoiceThread for collaboration as compared to text-based discussion boards. Students reported that the ability to hear the voice of their peers and the instructor helped them feel like they were in a classroom communicating with "real" instructor and peers. Students indicated a preference for on-line classes that used VoiceThread discussions to on-line classes that used only text-based discussion boards. Copyright © 2016 Elsevier Inc. All rights reserved.

Metal and transuranic records in mussel shells, byssal threads and tissues

NASA Astrophysics Data System (ADS)

Koide, Minoru; Lee, Dong Soo; Goldberg, Edward D.

1982-12-01

Bivalve shells offer several advantages over tissues for the monitoring of heavy metal pollutants in the marine environment. They are easier to handle and to store. The problem of whether to depurate the animals before analyses is avoided. The shells appear to be more sensitive to environmental heavy metals levels over the long term than do the soft parts. Of the substances examined (Cd, Cu, Zn, Pb, Ag, Ni, 238Pu and 239 + 240Pu) only Pb and Pu displayed a strong covariance between soft tissue and shell concentrations. There were strong correlations between metals in the shell but not in the soft tissues in general. The byssal threads, because of their enrichment of transuranic elements and of their ease in handling, may be useful in monitoring these metals. A very weak discharge of 238Pu to marine waters adjacent to a nuclear reactor was detected in the byssal threads of mussels.

Periodic Eclipse Variations in Asynchronous Polar V1432 Aql: Evidence of a Shifting Threading Region

NASA Technical Reports Server (NTRS)

Littlefield, Colin; Mukai, Koji; Mumme, Raymond; Cain, Ryan; Magno, Katrina C.; Corpuz, Taylor; Sandefur, Davis; Boyd, David; Cook, Michael; Ulowetz, Joseph;

Structure determination and total synthesis of a novel antibacterial substance, AB0022A, produced by a cellular slime mold.

PubMed

Sawada, T; Aono, M; Asakawa, S; Ito, A; Awano, K

2000-09-01

A novel antibacterial substance, AB0022A, was isolated from the cellular slime mold Dictyostelium purpureum K1001. It inhibited the growth of Gram-positive bacteria, and its MICs ranged from 0.39 to 50 microg/ml. Because AB0022A was a highly substituted aromatic compound, we could not determine its structure based on only its physico-chemical and spectral data. We therefore used a dehalogenated derivative from AB0022A and deduced that its structure was 1,9-dihydroxy-3,7-dimethoxy-2-hexanoyl-4,6,8-trichlorodibenzofuran . To confirm this structure, we synthesized the compound having the deduced structure. The synthetic compound was identical to naturally occurring AB0022A.

The Private Voice Made Public Record: "Common Threads" and Filmic Strategy.

ERIC Educational Resources Information Center

Stoddart, Scott F.

This paper analyzes Robert Epstein's Academy Award winning documentary "Common Threads: Stories from the Quilt," which consciously employs a binary rhetoric, a "common" method, by which to read the complex narrativity of the Names Project Quilt (the quilt memorial to AIDS victims). The paper addresses the inherently rhetorical…

FODEM: A Multi-Threaded Research and Development Method for Educational Technology

ERIC Educational Resources Information Center

Suhonen, Jarkko; de Villiers, M. Ruth; Sutinen, Erkki

2012-01-01

Formative development method (FODEM) is a multithreaded design approach that was originated to support the design and development of various types of educational technology innovations, such as learning tools, and online study programmes. The threaded and agile structure of the approach provides flexibility to the design process. Intensive…

Pausing and activating thread state upon pin assertion by external logic monitoring polling loop exit time condition

DOEpatents

Chen, Dong; Giampapa, Mark; Heidelberger, Philip; Ohmacht, Martin; Satterfield, David L; Steinmacher-Burow, Burkhard; Sugavanam, Krishnan

2013-05-21

A system and method for enhancing performance of a computer which includes a computer system including a data storage device. The computer system includes a program stored in the data storage device and steps of the program are executed by a processer. The processor processes instructions from the program. A wait state in the processor waits for receiving specified data. A thread in the processor has a pause state wherein the processor waits for specified data. A pin in the processor initiates a return to an active state from the pause state for the thread. A logic circuit is external to the processor, and the logic circuit is configured to detect a specified condition. The pin initiates a return to the active state of the thread when the specified condition is detected using the logic circuit.

Automatic Thread-Level Parallelization in the Chombo AMR Library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Christen, Matthias; Keen, Noel; Ligocki, Terry

2011-05-26

The increasing on-chip parallelism has some substantial implications for HPC applications. Currently, hybrid programming models (typically MPI+OpenMP) are employed for mapping software to the hardware in order to leverage the hardware?s architectural features. In this paper, we present an approach that automatically introduces thread level parallelism into Chombo, a parallel adaptive mesh refinement framework for finite difference type PDE solvers. In Chombo, core algorithms are specified in the ChomboFortran, a macro language extension to F77 that is part of the Chombo framework. This domain-specific language forms an already used target language for an automatic migration of the large number ofmore » existing algorithms into a hybrid MPI+OpenMP implementation. It also provides access to the auto-tuning methodology that enables tuning certain aspects of an algorithm to hardware characteristics. Performance measurements are presented for a few of the most relevant kernels with respect to a specific application benchmark using this technique as well as benchmark results for the entire application. The kernel benchmarks show that, using auto-tuning, up to a factor of 11 in performance was gained with 4 threads with respect to the serial reference implementation.« less

Matrix factorization-based data fusion for gene function prediction in baker's yeast and slime mold.

PubMed

Zitnik, Marinka; Zupan, Blaž

2014-01-01

The development of effective methods for the characterization of gene functions that are able to combine diverse data sources in a sound and easily-extendible way is an important goal in computational biology. We have previously developed a general matrix factorization-based data fusion approach for gene function prediction. In this manuscript, we show that this data fusion approach can be applied to gene function prediction and that it can fuse various heterogeneous data sources, such as gene expression profiles, known protein annotations, interaction and literature data. The fusion is achieved by simultaneous matrix tri-factorization that shares matrix factors between sources. We demonstrate the effectiveness of the approach by evaluating its performance on predicting ontological annotations in slime mold D. discoideum and on recognizing proteins of baker's yeast S. cerevisiae that participate in the ribosome or are located in the cell membrane. Our approach achieves predictive performance comparable to that of the state-of-the-art kernel-based data fusion, but requires fewer data preprocessing steps.

Ocean sunfish as indicators for the 'rise of slime'.

PubMed

Grémillet, David; White, Craig R; Authier, Matthieu; Dorémus, Ghislain; Ridoux, Vincent; Pettex, Emeline

2017-12-04

Overfishing and ocean warming are drastically altering the community composition and size structure of marine ecosystems, eliminating large bodied species [1]. Against a backdrop of such environmental change, the heaviest of all bony fish, the ocean sunfish (Mola mola), seems an improbable survivor. Indeed this indolent giant is killed globally as bycatch, and is listed as 'Vulnerable'[2]. We undertook the most extensive aerial surveys of sunfish ever conducted and found surprisingly high abundances off the Atlantic and Mediterranean coasts of Western Europe. With up to 475 individuals per 100 km 2 , these figures are one order of magnitude higher than abundance estimates for other areas [3-5]. Using bioenergetic modelling, we estimate that each sunfish requires 71 kg day -1 of jellyfish, a biomass intake more than an order of magnitude greater than predicted for a similarly sized teleost. Scaled up to the population level, this equates to a remarkable 20,774 tonnes day -1 of predated jellyfish across our study area in summer. Sunfish abundance may be facilitated by overfishing and ocean warming, which together cause reduced predation of sunfish by sharks and elevated jellyfish biomass. Our combined survey and bioenergetic data provide the first-ever estimate of spatialized ocean sunfish daily food requirements, and stress the importance of this species as a global indicator for the 'rise of slime'. This hypothesis posits that, in an overfished world ocean exposed to global warming, gelatinous zooplankton should flourish, to the detriment of other mesotrophic species such as small pelagic fish, causing irreversible trophic cascades as well as a series of other environmental and economic issues. Copyright © 2017 Elsevier Ltd. All rights reserved.

Proximal half angle of the screw thread is a critical design variable affecting the pull-out strength of cancellous bone screws.

PubMed

Wang, Yingxu; Mori, Ryuji; Ozoe, Nobuaki; Nakai, Takahisa; Uchio, Yuji

2009-11-01

Screws with strong pull-out strength have been sought for the treatment of cancellous bone. We hypothesized that an obliquely angled screw thread has advantages over conventional vertical thread with a minimal proximal half angle. Metal and bone screws were made of stainless steel and porcine cortical bone. Their proximal half angle was set at 0 degrees , 30 degrees , or 60 degrees . The screws were inserted into porcine cancellous bone. At 0 degrees , the thread faced the recipient bone vertically. Pullout tests at a rate of 30 mm/min (n=40, each screw type) and microcomputed tomography (n=6) were conducted. The pull-out strength of the screws was maximal at 30 degrees ; 348.8 (SD, 44.1)N with metal and 326.6 (39.4)N with bone. It was intermediate at 0 degrees ; 301.9 (35.9)N with metal and 278.2 (30.6)N with bone. It was minimal at 60 degrees; 126.5 (39.0)N with metal and 174.8 (29.7)N with bone. Cancellous bone was damaged between the threads at 30 degrees , while intact cancellous bone was preserved between the threads at 0 degrees. A proximal half angle of around 30 degrees is appropriate because the pullout force is applied to the recipient bone evenly. Commercial cancellous screws can be improved by changing the thread shape to minimize the damage to recipient bone.

The Combined Effects of Response Time and Message Content on Growth Patterns of Discussion Threads in Computer-Supported Collaborative Argumentation

ERIC Educational Resources Information Center

Jeong, Allan

2004-01-01

This study examined the effects of response time and message content on the growth patterns of discussion threads in computer-supported collaborative argumentation. Event sequence analysis was used to measure response times between threaded messages and responses containing arguments, evidence, critiques, evaluations, and other comments from…

Conversation Thread Extraction and Topic Detection in Text-Based Chat

DTIC Science & Technology

2008-09-01

conversation extraction task. Multiple conversations in a session are interleaved. The goal in extraction is to select only those posts that belong...others. Our first-phase experiments quite clearly show the value of using time-distance as a feature in conversation thread extraction . In this set of... EXTRACTION AND TOPIC DETECTION IN TEXT-BASED CHAT by Paige Holland Adams September 2008 Thesis Advisor

Using Multi-threading for the Automatic Load Balancing of 2D Adaptive Finite Element Meshes

NASA Technical Reports Server (NTRS)

Heber, Gerd; Biswas, Rupak; Thulasiraman, Parimala; Gao, Guang R.; Saini, Subhash (Technical Monitor)

1998-01-01

In this paper, we present a multi-threaded approach for the automatic load balancing of adaptive finite element (FE) meshes The platform of our choice is the EARTH multi-threaded system which offers sufficient capabilities to tackle this problem. We implement the adaption phase of FE applications oil triangular meshes and exploit the EARTH token mechanism to automatically balance the resulting irregular and highly nonuniform workload. We discuss the results of our experiments oil EARTH-SP2, on implementation of EARTH on the IBM SP2 with different load balancing strategies that are built into the runtime system.

Practical Formal Verification of MPI and Thread Programs

NASA Astrophysics Data System (ADS)

Gopalakrishnan, Ganesh; Kirby, Robert M.

Large-scale simulation codes in science and engineering are written using the Message Passing Interface (MPI). Shared memory threads are widely used directly, or to implement higher level programming abstractions. Traditional debugging methods for MPI or thread programs are incapable of providing useful formal guarantees about coverage. They get bogged down in the sheer number of interleavings (schedules), often missing shallow bugs. In this tutorial we will introduce two practical formal verification tools: ISP (for MPI C programs) and Inspect (for Pthread C programs). Unlike other formal verification tools, ISP and Inspect run directly on user source codes (much like a debugger). They pursue only the relevant set of process interleavings, using our own customized Dynamic Partial Order Reduction algorithms. For a given test harness, DPOR allows these tools to guarantee the absence of deadlocks, instrumented MPI object leaks and communication races (using ISP), and shared memory races (using Inspect). ISP and Inspect have been used to verify large pieces of code: in excess of 10,000 lines of MPI/C for ISP in under 5 seconds, and about 5,000 lines of Pthread/C code in a few hours (and much faster with the use of a cluster or by exploiting special cases such as symmetry) for Inspect. We will also demonstrate the Microsoft Visual Studio and Eclipse Parallel Tools Platform integrations of ISP (these will be available on the LiveCD).

Threading dynamics of a polymer through parallel pores: Potential applications to DNA size separation

NASA Astrophysics Data System (ADS)

Åkerman, Björn

1997-04-01

DNA orientation measurements by linear dichroism (LD) spectroscopy and single molecule imaging by fluorescence microscopy are used to investigate the effect of DNA size (71-740 kilo base pairs) and field strength E (1-5.9 V/cm) on the conformation dynamics during the field-driven threading of DNA molecules through a set of parallel pores in agarose gels, with average pore radii between 380 Å and 1400 Å. Locally relaxed but globally oriented DNA molecules are subjected to a perpendicular field, and the observed LD time profile is compared with a recent theory for the threading [D. Long and J.-L. Viovy, Phys. Rev. E 53, 803 (1996)] which assumes the same initial state. As predicted the DNA is driven by the ends into a U-form, leading to an overshoot in the LD. The overshoot-time scales as E-(1.2-1.4) as predicted, but grows more slowly with DNA size than the predicted linear dependence. For long molecules loops form initially in the threading process but are finally consumed by the ends, and the process of transfer of DNA segments, from the loops to the arms of the U, leads to a shoulder in the LD as predicted. The critical size below which loops do not form (as indicated by the LD shoulder being absent) is between 71 and 105 kbp (0.5% agarose, 5.9 V/cm), and considerably larger than predicted because in the initial state the DNA molecules are housed in gel cavities with effective pore sizes about four times larger than the average pore size. From the data, the separation of DNA by exploiting the threading dynamics in pulsed fields [D. Long et al., CR Acad. Sci. Paris, Ser. IIb 321, 239 (1995)] is shown to be feasible in principle in an agarose-based system.

Energy-aware Thread and Data Management in Heterogeneous Multi-core, Multi-memory Systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Su, Chun-Yi

By 2004, microprocessor design focused on multicore scaling—increasing the number of cores per die in each generation—as the primary strategy for improving performance. These multicore processors typically equip multiple memory subsystems to improve data throughput. In addition, these systems employ heterogeneous processors such as GPUs and heterogeneous memories like non-volatile memory to improve performance, capacity, and energy efficiency. With the increasing volume of hardware resources and system complexity caused by heterogeneity, future systems will require intelligent ways to manage hardware resources. Early research to improve performance and energy efficiency on heterogeneous, multi-core, multi-memory systems focused on tuning a single primitivemore » or at best a few primitives in the systems. The key limitation of past efforts is their lack of a holistic approach to resource management that balances the tradeoff between performance and energy consumption. In addition, the shift from simple, homogeneous systems to these heterogeneous, multicore, multi-memory systems requires in-depth understanding of efficient resource management for scalable execution, including new models that capture the interchange between performance and energy, smarter resource management strategies, and novel low-level performance/energy tuning primitives and runtime systems. Tuning an application to control available resources efficiently has become a daunting challenge; managing resources in automation is still a dark art since the tradeoffs among programming, energy, and performance remain insufficiently understood. In this dissertation, I have developed theories, models, and resource management techniques to enable energy-efficient execution of parallel applications through thread and data management in these heterogeneous multi-core, multi-memory systems. I study the effect of dynamic concurrent throttling on the performance and energy of multi-core, non-uniform memory

Vaginal thread formation in the healthy offspring of untreated Long-Evans rats

EPA Science Inventory

Vaginal threads are characterized as cords of mesenchymal tissue that cross the vaginal opening. They are sometimes apparent in rats after weaning, and typically disappear within 1-2 days as the female reaches puberty. If persistent, they can increase uncertainty in assessing rep...

Molecular threading and tunable molecular recognition on DNA origami nanostructures.

PubMed

Wu, Na; Czajkowsky, Daniel M; Zhang, Jinjin; Qu, Jianxun; Ye, Ming; Zeng, Dongdong; Zhou, Xingfei; Hu, Jun; Shao, Zhifeng; Li, Bin; Fan, Chunhai

2013-08-21

The DNA origami technology holds great promise for the assembly of nanoscopic technological devices and studies of biochemical reactions at the single-molecule level. For these, it is essential to establish well controlled attachment of functional materials to predefined sites on the DNA origami nanostructures for reliable measurements and versatile applications. However, the two-sided nature of the origami scaffold has shown limitations in this regard. We hypothesized that holes of the commonly used two-dimensional DNA origami designs are large enough for the passage of single-stranded (ss)-DNA. Sufficiently long ssDNA initially located on one side of the origami should thus be able to "thread" to the other side through the holes in the origami sheet. By using an origami sheet attached with patterned biotinylated ssDNA spacers and monitoring streptavidin binding with atomic force microscopic (AFM) imaging, we provide unambiguous evidence that the biotin ligands positioned on one side have indeed threaded through to the other side. Our finding reveals a previously overlooked critical design feature that should provide new interpretations to previous experiments and new opportunities for the construction of origami structures with new functional capabilities.

Optical method for measuring the surface area of a threaded fastener

Treesearch

Douglas Rammer; Samuel Zelinka

2010-01-01

This article highlights major aspects of a new optical technique to determine the surface area of a threaded fastener; the theoretical framework has been reported elsewhere. Specifically, this article describes general surface area expressions used in the analysis, details of image acquisition system, and major image processing steps contained within the measurement...

Temperature mediates the effect of humidity on the viscoelasticity of glycoprotein glue within the droplets of an orb-weaving spider's prey capture threads.

PubMed

Stellwagen, Sarah D; Opell, Brent D; Short, Kelly G

2014-05-01

Sticky viscous prey capture threads retain insects that strike araneoid orb-webs. The threads' two axial fibers support a series of glue droplets, each featuring a core of adhesive viscoelastic glycoprotein covered by an aqueous solution. After sticking, the glue extends, summing the adhesion of multiple droplets, and dissipates some of the energy of a struggling prey. As a day progresses, threads experience a drop in humidity and an increase in temperature, environmental variables that have the potential to alter thread and web function. We hypothesize that thread droplets respond to these opposing environmental changes in a manner that stabilizes their performance, and test this by examining threads spun by Argiope aurantia, a species that occupies exposed, weedy habitats. We confirmed that decreased humidity increases glycoprotein viscosity and found that increased temperature had the opposite effect. To evaluate the combined effect of temperature and humidity on a droplet's ability to transfer adhesive force and dissipate energy, we extended a droplet and measured both the deflection of the axial line supporting the droplet and the duration of its tensive load. The cumulative product of these two indices, which reflects the energy required to extend a droplet, was greatest under afternoon (hot and dry) conditions, less under morning (cool and humid) conditions, and least under hot and humid afternoon conditions. Although the opposing effects of temperature and humidity tend to stabilize glycoprotein performance, A. aurantia thread droplets appear to function optimally during the afternoon, equipping this species to capture large orthopterans, which are most active at this time.

Sediment Core Extrusion Method at Millimeter Resolution Using a Calibrated, Threaded-rod

PubMed Central

Schwing, Patrick T.; Romero, Isabel C.; Larson, Rebekka A.; O'Malley, Bryan J.; Fridrik, Erika E.; Goddard, Ethan A.; Brooks, Gregg R.; Hastings, David W.; Rosenheim, Brad E.; Hollander, David J.; Grant, Guy; Mulhollan, Jim

2016-01-01

Aquatic sediment core subsampling is commonly performed at cm or half-cm resolution. Depending on the sedimentation rate and depositional environment, this resolution provides records at the annual to decadal scale, at best. An extrusion method, using a calibrated, threaded-rod is presented here, which allows for millimeter-scale subsampling of aquatic sediment cores of varying diameters. Millimeter scale subsampling allows for sub-annual to monthly analysis of the sedimentary record, an order of magnitude higher than typical sampling schemes. The extruder consists of a 2 m aluminum frame and base, two core tube clamps, a threaded-rod, and a 1 m piston. The sediment core is placed above the piston and clamped to the frame. An acrylic sampling collar is affixed to the upper 5 cm of the core tube and provides a platform from which to extract sub-samples. The piston is rotated around the threaded-rod at calibrated intervals and gently pushes the sediment out the top of the core tube. The sediment is then isolated into the sampling collar and placed into an appropriate sampling vessel (e.g., jar or bag). This method also preserves the unconsolidated samples (i.e., high pore water content) at the surface, providing a consistent sampling volume. This mm scale extrusion method was applied to cores collected in the northern Gulf of Mexico following the Deepwater Horizon submarine oil release. Evidence suggests that it is necessary to sample at the mm scale to fully characterize events that occur on the monthly time-scale for continental slope sediments. PMID:27585268

Sediment Core Extrusion Method at Millimeter Resolution Using a Calibrated, Threaded-rod.

PubMed

Schwing, Patrick T; Romero, Isabel C; Larson, Rebekka A; O'Malley, Bryan J; Fridrik, Erika E; Goddard, Ethan A; Brooks, Gregg R; Hastings, David W; Rosenheim, Brad E; Hollander, David J; Grant, Guy; Mulhollan, Jim

2016-08-17

Aquatic sediment core subsampling is commonly performed at cm or half-cm resolution. Depending on the sedimentation rate and depositional environment, this resolution provides records at the annual to decadal scale, at best. An extrusion method, using a calibrated, threaded-rod is presented here, which allows for millimeter-scale subsampling of aquatic sediment cores of varying diameters. Millimeter scale subsampling allows for sub-annual to monthly analysis of the sedimentary record, an order of magnitude higher than typical sampling schemes. The extruder consists of a 2 m aluminum frame and base, two core tube clamps, a threaded-rod, and a 1 m piston. The sediment core is placed above the piston and clamped to the frame. An acrylic sampling collar is affixed to the upper 5 cm of the core tube and provides a platform from which to extract sub-samples. The piston is rotated around the threaded-rod at calibrated intervals and gently pushes the sediment out the top of the core tube. The sediment is then isolated into the sampling collar and placed into an appropriate sampling vessel (e.g., jar or bag). This method also preserves the unconsolidated samples (i.e., high pore water content) at the surface, providing a consistent sampling volume. This mm scale extrusion method was applied to cores collected in the northern Gulf of Mexico following the Deepwater Horizon submarine oil release. Evidence suggests that it is necessary to sample at the mm scale to fully characterize events that occur on the monthly time-scale for continental slope sediments.

Theory, Self, and Rhetoric Or, What To Do With Ariadne's Thread.

ERIC Educational Resources Information Center

Marinara, Martha

Using Ariadne's thread in the narrative of the labyrinth as a metaphor for the elusiveness of language, this paper explores the concept of "self" to prepare for the discussion of autobiography as a "tool" for teaching writing, and to create a connection between a politically enabled self, a private self, and critical theory.…

Multi-threaded ATLAS simulation on Intel Knights Landing processors

NASA Astrophysics Data System (ADS)

Farrell, Steven; Calafiura, Paolo; Leggett, Charles; Tsulaia, Vakhtang; Dotti, Andrea; ATLAS Collaboration

2017-10-01

The Knights Landing (KNL) release of the Intel Many Integrated Core (MIC) Xeon Phi line of processors is a potential game changer for HEP computing. With 72 cores and deep vector registers, the KNL cards promise significant performance benefits for highly-parallel, compute-heavy applications. Cori, the newest supercomputer at the National Energy Research Scientific Computing Center (NERSC), was delivered to its users in two phases with the first phase online at the end of 2015 and the second phase now online at the end of 2016. Cori Phase 2 is based on the KNL architecture and contains over 9000 compute nodes with 96GB DDR4 memory. ATLAS simulation with the multithreaded Athena Framework (AthenaMT) is a good potential use-case for the KNL architecture and supercomputers like Cori. ATLAS simulation jobs have a high ratio of CPU computation to disk I/O and have been shown to scale well in multi-threading and across many nodes. In this paper we will give an overview of the ATLAS simulation application with details on its multi-threaded design. Then, we will present a performance analysis of the application on KNL devices and compare it to a traditional x86 platform to demonstrate the capabilities of the architecture and evaluate the benefits of utilizing KNL platforms like Cori for ATLAS production.

Design and Implementation of a Threaded Search Engine for Tour Recommendation Systems

NASA Astrophysics Data System (ADS)

Lee, Junghoon; Park, Gyung-Leen; Ko, Jin-Hee; Shin, In-Hye; Kang, Mikyung

This paper implements a threaded scan engine for the O(n!) search space and measures its performance, aiming at providing a responsive tour recommendation and scheduling service. As a preliminary step of integrating POI ontology, mobile object database, and personalization profile for the development of new vehicular telematics services, this implementation can give a useful guideline to design a challenging and computation-intensive vehicular telematics service. The implemented engine allocates the subtree to the respective threads and makes them run concurrently exploiting the primitives provided by the operating system and the underlying multiprocessor architecture. It also makes it easy to add a variety of constraints, for example, the search tree is pruned if the cost of partial allocation already exceeds the current best. The performance measurement result shows that the service can run even in the low-power telematics device when the number of destinations does not exceed 15, with an appropriate constraint processing.

A Fast and On-Machine Measuring System Using the Laser Displacement Sensor for the Contour Parameters of the Drill Pipe Thread.

PubMed

Dong, Zhixu; Sun, Xingwei; Chen, Changzheng; Sun, Mengnan

2018-04-13

The inconvenient loading and unloading of a long and heavy drill pipe gives rise to the difficulty in measuring the contour parameters of its threads at both ends. To solve this problem, in this paper we take the SCK230 drill pipe thread-repairing machine tool as a carrier to design and achieve a fast and on-machine measuring system based on a laser probe. This system drives a laser displacement sensor to acquire the contour data of a certain axial section of the thread by using the servo function of a CNC machine tool. To correct the sensor's measurement errors caused by the measuring point inclination angle, an inclination error model is built to compensate data in real time. To better suppress random error interference and ensure real contour information, a new wavelet threshold function is proposed to process data through the wavelet threshold denoising. Discrete data after denoising is segmented according to the geometrical characteristics of the drill pipe thread, and the regression model of the contour data in each section is fitted by using the method of weighted total least squares (WTLS). Then, the thread parameters are calculated in real time to judge the processing quality. Inclination error experiments show that the proposed compensation model is accurate and effective, and it can improve the data acquisition accuracy of a sensor. Simulation results indicate that the improved threshold function is of better continuity and self-adaptability, which makes sure that denoising effects are guaranteed, and, meanwhile, the complete elimination of real data distorted in random errors is avoided. Additionally, NC50 thread-testing experiments show that the proposed on-machine measuring system can complete the measurement of a 25 mm thread in 7.8 s, with a measurement accuracy of ±8 μm and repeatability limit ≤ 4 μm (high repeatability), and hence the accuracy and efficiency of measurement are both improved.

A Fast and On-Machine Measuring System Using the Laser Displacement Sensor for the Contour Parameters of the Drill Pipe Thread

PubMed Central

Sun, Xingwei; Chen, Changzheng; Sun, Mengnan

2018-01-01

The inconvenient loading and unloading of a long and heavy drill pipe gives rise to the difficulty in measuring the contour parameters of its threads at both ends. To solve this problem, in this paper we take the SCK230 drill pipe thread-repairing machine tool as a carrier to design and achieve a fast and on-machine measuring system based on a laser probe. This system drives a laser displacement sensor to acquire the contour data of a certain axial section of the thread by using the servo function of a CNC machine tool. To correct the sensor’s measurement errors caused by the measuring point inclination angle, an inclination error model is built to compensate data in real time. To better suppress random error interference and ensure real contour information, a new wavelet threshold function is proposed to process data through the wavelet threshold denoising. Discrete data after denoising is segmented according to the geometrical characteristics of the drill pipe thread, and the regression model of the contour data in each section is fitted by using the method of weighted total least squares (WTLS). Then, the thread parameters are calculated in real time to judge the processing quality. Inclination error experiments show that the proposed compensation model is accurate and effective, and it can improve the data acquisition accuracy of a sensor. Simulation results indicate that the improved threshold function is of better continuity and self-adaptability, which makes sure that denoising effects are guaranteed, and, meanwhile, the complete elimination of real data distorted in random errors is avoided. Additionally, NC50 thread-testing experiments show that the proposed on-machine measuring system can complete the measurement of a 25 mm thread in 7.8 s, with a measurement accuracy of ±8 μm and repeatability limit ≤ 4 μm (high repeatability), and hence the accuracy and efficiency of measurement are both improved. PMID:29652836

Processing communications events in parallel active messaging interface by awakening thread from wait state

DOEpatents

Archer, Charles J; Blocksome, Michael A; Ratterman, Joseph D; Smith, Brian E

2013-10-22

Processing data communications events in a parallel active messaging interface (`PAMI`) of a parallel computer that includes compute nodes that execute a parallel application, with the PAMI including data communications endpoints, and the endpoints are coupled for data communications through the PAMI and through other data communications resources, including determining by an advance function that there are no actionable data communications events pending for its context, placing by the advance function its thread of execution into a wait state, waiting for a subsequent data communications event for the context; responsive to occurrence of a subsequent data communications event for the context, awakening by the thread from the wait state; and processing by the advance function the subsequent data communications event now pending for the context.

Multi-threaded integration of HTC-Vive and MeVisLab

NASA Astrophysics Data System (ADS)

Gunacker, Simon; Gall, Markus; Schmalstieg, Dieter; Egger, Jan

2018-03-01

This work presents how Virtual Reality (VR) can easily be integrated into medical applications via a plugin for a medical image processing framework called MeVisLab. A multi-threaded plugin has been developed using OpenVR, a VR library that can be used for developing vendor and platform independent VR applications. The plugin is tested using the HTC Vive, a head-mounted display developed by HTC and Valve Corporation.

A homolog of Escherichia coli RecA in mitochondria of the cellular slime mold Dictyostelium discoideum.

PubMed

Hasegawa, Yasuna; Wakabayashi, Masayuki; Nakamura, Shogo; Kodaira, Ken-ichi; Shinohara, Hiroaki; Yasukawa, Hiro

2004-05-04

The cellular slime mold Dictyostelium discoideum expresses a gene encoding a 452-amino-acid polypeptide that is 47% identical to Escherichia coli RecA. A recA-deficient E. coli, JE6651, was transformed by pYSN1, which was designed to express the truncated form of the D. discoideum gene, and used in suppression assays. The viability of the transformant, JE6651(pYSN1), increased following UV irradiation or mitomycin C treatment. Phage lambda (red(-) gam(-)), which required RecA activity for DNA packaging, formed plaques on a lawn of JE6651(pYSN1). These results indicate that the gene product has a DNA recombination activity. Fluorescence of D. discoideum protein fused with GFP was detected in mitochondria. The gene disruption mutant was hypersensitive to UV-light (254nm), mitomycin C and H(2)O(2), indicating that D. discoideum recA is important for survival following exposure to DNA damaging agents.

Environment-dependent morphology in plasmodium of true slime mold Physarum polycephalum and a network growth model.

PubMed

Takamatsu, Atsuko; Takaba, Eri; Takizawa, Ginjiro

2009-01-07

Branching network growth patterns, depending on environmental conditions, in plasmodium of true slime mold Physarum polycephalum were investigated. Surprisingly, the patterns resemble those in bacterial colonies even though the biological mechanisms differ greatly. Bacterial colonies are collectives of microorganisms in which individual organisms have motility and interact through nutritious and chemical fields. In contrast, the plasmodium is a giant amoeba-like multinucleated unicellular organism that forms a network of tubular structures through which protoplasm streams. The cell motility of the plasmodium is generated by oscillation phenomena observed in the partial bodies, which interact through the tubular structures. First, we analyze characteristics of the morphology quantitatively, then we abstract local rules governing the growing process to construct a simple network growth model. This model is independent of specific systems, in which only two rules are applied. Finally, we discuss the mechanism of commonly observed biological pattern formations through comparison with the system of bacterial colonies.

Promoter analysis of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum.

PubMed

Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H

1999-10-28

We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.

Effect of screw threading dislocations and inverse domain boundaries in GaN on the shape of reciprocal-space maps.

PubMed

Barchuk, Mykhailo; Motylenko, Mykhaylo; Lukin, Gleb; Pätzold, Olf; Rafaja, David

2017-04-01

The microstructure of polar GaN layers, grown by upgraded high-temperature vapour phase epitaxy on [001]-oriented sapphire substrates, was studied by means of high-resolution X-ray diffraction and transmission electron microscopy. Systematic differences between reciprocal-space maps measured by X-ray diffraction and those which were simulated for different densities of threading dislocations revealed that threading dislocations are not the only microstructure defect in these GaN layers. Conventional dark-field transmission electron microscopy and convergent-beam electron diffraction detected vertical inversion domains as an additional microstructure feature. On a series of polar GaN layers with different proportions of threading dislocations and inversion domain boundaries, this contribution illustrates the capability and limitations of coplanar reciprocal-space mapping by X-ray diffraction to distinguish between these microstructure features.

Yet another cause for blocked sidestream capnogram--beware of the non-threaded cap mount in heat and moisture exchangers.

PubMed

Umesh, Goneppanavar; Jasvinder, Kaur; Shetty, Nanda

2009-08-01

Heat and moisture exchangers (HME) are commonly used during general anaesthesia and intensive care of patients on mechanical ventilators. Some of the HME manufacturers provide HMEs with a Luer lock fitting for connecting side stream CO(2) monitoring line, Luer lock cap, and a non-threaded cap mount. However, HMEs from different manufacturers and HMEs meant for use in children and for adults from the same manufacturer vary in the presence/absence of non-threaded cap mount. This can create confusion to the clinicians and can result in inadvertent connection of the CO(2) monitoring line to the non-threaded cap mount resulting in blocked CO(2) monitoring line and leak in the circuit. We caution all the anaesthesiologists and intensivists regarding this possibility while using HMEs from different manufacturers.

Developing Oral Proficiency with VoiceThread: Learners' Strategic Uses and Views

ERIC Educational Resources Information Center

Dugartsyrenova, Vera A.; Sardegna, Veronica G.

2017-01-01

This study explored Russian as a foreign language (RFL) learners' self-reported strategic uses of "VoiceThread" (VT)--a multimodal asynchronous computer-mediated communication tool--in order to gain insights into learner perceived effectiveness of VT for second language (L2) oral skills development and to determine the factors that…

Nano-enabled sensors, electronics and energy source on polymer, paper and thread substrates

NASA Astrophysics Data System (ADS)

Mostafalu, Pooria

Over the past decades, design and development of portable devices for monitoring of biomarkers especially for at risk patients is receiving considerable attention. These devices are either single use diagnostic platforms, wearable on body or on fabric, or they are implanted close to the tissue and organ that it monitors and cures. Sensors, energy sources, and data acquisition devices are the main components of a such monitoring platform. Sensors collect the information using bio-recognition tools such as enzymes and antibodies. Then, the transducers (electrodes, fluorophore, etc) convert it to the appropriate format, for instance electrical and optical signals. After that, data acquisition system amplifies and digitizes the signal and transfers the data to the recording instruments for further processing. Moreover, energy sources are necessary for powering the sensors and electronics. In wearable and implantable applications, these devices need to be flexible, light weight and biocompatible, and their performance should be similar to their rigid counterparts. In this dissertation we address these requirement for wearable and implantable devices. We showed integrated sensors, electronics, and energy sources on flexible polymers, paper, and thread. These devices provide many advantages for monitoring of the physiological condition of a patient and treatment accordingly. Real-time capability of the platform was enabled using wireless telemetry. One of the major innovations of this dissertation is the use of thread as a substrate for making medical diagnostic devices. While conventional substrates (glass, silicon, polyimide, PDMS etc) hold great promise for making wearable and implantable devices, their overall structure and form has remained essentially two dimensional, limiting their function to tissue surfaces such as skin. However, the ability to integrate functional components such as sensors, actuators, and electronics in a way that they penetrate multiple layers

50 CFR 648.11 - At-sea sea sampler/observer coverage.

Code of Federal Regulations, 2014 CFR

2014-10-01

..., catches or lands hagfish, or intends to fish for, catch, or land hagfish in or from the exclusive economic... fishing year based on the economic conditions of the scallop fishery, as determined by best available... flexibility as possible to enhance fleet viability. (2) Reduce the cost of monitoring: (i) Streamline data...

50 CFR 648.11 - At-sea sea sampler/observer coverage.

Code of Federal Regulations, 2013 CFR

2013-10-01

..., catches or lands hagfish, or intends to fish for, catch, or land hagfish in or from the exclusive economic... fishing year based on the economic conditions of the scallop fishery, as determined by best available... flexibility as possible to enhance fleet viability. (2) Reduce the cost of monitoring: (i) Streamline data...

Novel gold nanoparticle trimer reporter probe combined with dry-reagent cotton thread immunoassay device for rapid human ferritin test.

PubMed

Mao, Xun; Du, Ting-E; Meng, Lili; Song, Tingting

2015-08-19

We reported here for the first time on the use of cotton thread combined with novel gold nanoparticle trimer reporter probe for low-cost, sensitive and rapid detection of a lung cancer related biomarker, human ferritin. A model system comprising ferritin as an analyte and a pair of monoclonal antibodies was used to demonstrate the proof-of-concept on the dry-reagent natural cotton thread immunoassay device. Results indicated that the using of novel gold nanoparticle trimer reporter probe greatly improved the sensitivity comparing with traditional gold nanoparticle reporter probe on the cotton thread immunoassay device. The assay avoids multiple incubation and washing steps performed in most conventional protein analyses. Although qualitative tests are realized by observing the color change of the test zone, quantitative data are obtained by recording the optical responses of the test zone with a commercial scanner and corresponding analysis software. Under optimal conditions, the cotton thread immunoassay device was capable of measuring 10 ng/mL human ferritin under room temperature which is sensitive enough for clinical diagnosis. Moreover, the sample solution employed in the assays is just 8 μL, which is much less than traditional lateral flow strip based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

Slime moulds use heuristics based on within-patch experience to decide when to leave.

PubMed

Latty, Tanya; Beekman, Madeleine

2015-04-15

Animals foraging in patchy, non-renewing or slowly renewing environments must make decisions about how long to remain within a patch. Organisms can use heuristics ('rules of thumb') based on available information to decide when to leave the patch. Here, we investigated proximate patch-departure heuristics in two species of giant, brainless amoeba: the slime moulds Didymium bahiense and Physarum polycephalum. We explicitly tested the importance of information obtained through experience by eliminating chemosensory cues of patch quality. In P. polycephalum, patch departure was influenced by the consumption of high, and to a much lesser extent low, quality food items such that engulfing a food item increased patch-residency time. Physarum polycephalum also tended to forage for longer in darkened, 'safe' patches. In D. bahiense, engulfment of any food item increased patch residency irrespective of that food item's quality. Exposure to light had no effect on the patch-residency time of D. bahiense. Given that these organisms lack a brain, our results illustrate how the use of simple heuristics can give the impression that individuals make sophisticated foraging decisions. © 2015. Published by The Company of Biologists Ltd.

Evaluation of the increase in threading dislocation during the initial stage of physical vapor transport growth of 4H-SiC

NASA Astrophysics Data System (ADS)

Suo, Hiromasa; Tsukimoto, Susumu; Eto, Kazuma; Osawa, Hiroshi; Kato, Tomohisa; Okumura, Hajime

2018-06-01

The increase in threading dislocation during the initial stage of physical vapor transport growth of n-type 4H-SiC crystals was evaluated by cross-sectional X-ray topography. Crystals were grown under two different temperature conditions. A significant increase in threading dislocation was observed in crystals grown at a high, not low, temperature. The local strain distribution in the vicinity of the grown/seed crystal interface was evaluated using the electron backscatter diffraction technique. The local nitrogen concentration distribution was also evaluated by time-of-flight secondary ion mass spectrometry. We discuss the relationship between the increase in threading dislocation and the local strain due to thermal stress and nitrogen concentration.

Study of a Fine Grained Threaded Framework Design

NASA Astrophysics Data System (ADS)

Jones, C. D.

2012-12-01

Traditionally, HEP experiments exploit the multiple cores in a CPU by having each core process one event. However, future PC designs are expected to use CPUs which double the number of processing cores at the same rate as the cost of memory falls by a factor of two. This effectively means the amount of memory per processing core will remain constant. This is a major challenge for LHC processing frameworks since the LHC is expected to deliver more complex events (e.g. greater pileup events) in the coming years while the LHC experiment's frameworks are already memory constrained. Therefore in the not so distant future we may need to be able to efficiently use multiple cores to process one event. In this presentation we will discuss a design for an HEP processing framework which can allow very fine grained parallelization within one event as well as supporting processing multiple events simultaneously while minimizing the memory footprint of the job. The design is built around the libdispatch framework created by Apple Inc. (a port for Linux is available) whose central concept is the use of task queues. This design also accommodates the reality that not all code will be thread safe and therefore allows one to easily mark modules or sub parts of modules as being thread unsafe. In addition, the design efficiently handles the requirement that events in one run must all be processed before starting to process events from a different run. After explaining the design we will provide measurements from simulating different processing scenarios where the processing times used for the simulation are drawn from processing times measured from actual CMS event processing.

A tale of two velocities: Threading versus slicing

NASA Astrophysics Data System (ADS)

Gharechahi, Razieh; Nouri-Zonoz, Mohammad; Tavanfar, Alireza

One of the important quantities in cosmology and astrophysics is the 3-velocity of an object. Specifically, when the gravitational fields are strong, one should require the employment of general relativity both in its definition and measurement. Looking into the literature for GR-based definitions of 3-velocity, one usually finds different ad hoc definitions applied according to the case under consideration. Here, we introduce and analyze systematically the two principal definitions of 3-velocity assigned to a test particle following the timelike trajectories in stationary spacetimes. These definitions are based on the 1 + 3 (threading) and 3 + 1 (slicing) spacetime decomposition formalisms and defined relative to two different sets of observers. After showing that Synge’s definition of spatial distance and 3-velocity is equivalent to those defined in the 1 + 3 (threading) formalism, we exemplify the differences between these two definitions by calculating them for particles in circular orbits in axially symmetric stationary spacetimes. Illustrating its geometric nature, the relative linear velocity between the corresponding observers is obtained in terms of the spacetime metric components. Circular particle orbits in the Kerr spacetime, as the prototype and the most well known of stationary spacetimes, are examined with respect to these definitions to highlight their observer-dependent nature. We also examine the Kerr-NUT spacetime in which the NUT parameter, contributing to the off-diagonal terms in the metric, is mainly interpreted not as a rotation parameter but as a gravitomagnetic monopole charge. Finally, in a specific astrophysical setup which includes rotating black holes, it is shown how the local velocity of an orbiting star could be related to its spectral line shifts measured by distant observers.

Shadow-Bitcoin: Scalable Simulation via Direct Execution of Multi-Threaded Applications

DTIC Science & Technology

2015-08-10

Shadow- Bitcoin : Scalable Simulation via Direct Execution of Multi-threaded Applications Andrew Miller University of Maryland amiller@cs.umd.edu Rob...Shadow plug-in that directly executes the Bitcoin reference client software. To demonstrate the usefulness of this tool, we present novel denial-of...service attacks against the Bit- coin software that exploit low-level implementation ar- tifacts in the Bitcoin reference client; our determinis- tic

Contributions to systemic analysis for worm screw production using thread whirling devices

NASA Astrophysics Data System (ADS)

Cretu, G.

2017-08-01

The paper aims to achieve a systemic analysis of worms processing using whirling threaded devices with highlighting all the factors involved in this system. It will also carry out an analysis of these factors depending on specific conditions such machining. Are also presented the stages of experimentation program and ways of processing for data obtained.

DYNAMICS OF VERTICAL THREADS AND DESCENDING KNOTS IN A HEDGEROW PROMINENCE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chae, Jongchul

The existence and behavior of vertical fine structures of plasma-threads and knots-are a significant observational clue to understanding the magnetic structure and dynamics of quiescent prominences on the quiet Sun. Based on the equation of motion in ideal MHD, we reason that the non-hydrostatic support of plasma against gravity in general requires either the motion of plasma with a high value of downward acceleration (dynamical support) or the role of horizontal magnetic fields (magnetic support). By carefully tracking the motion of several bright threads seen in a hedgerow prominence observed by the Solar Optical Telescope aboard Hinode, we confirm thatmore » these threads are essentially static and stable, which negates the dynamic support. The application of the Kippenhahn-Schlueter solution suggests that they may be supported by sagged magnetic field lines with a sag angle of about 43{sup 0}. We also track several bright descending knots and find that their descending speeds range from 10 to 30 km s{sup -1}, with a mean value of 16 km s{sup -1}, and their vertical accelerations from -0.10 to 0.10 km s{sup -2}, with a mean of practically zero. This finding suggests that these knots are basically supported by horizontal magnetic fields against gravity even when they descend, and the complex variations of their descending speeds should be attributed to small imbalances between gravity and the force of magnetic tension. Furthermore, some knots are observed to impulsively get accelerated downward from time to time. We conjecture that these impulsive accelerations are a result of magnetic reconnection and the subsequent interchange of magnetic configuration between a knot and its surrounding structure. It is proposed that this process of reconnection and interchange not only initiates the descending motion of the knots, but also allows knots to keep falling long distance through the medium permeated by horizontal magnetic fields.« less

Comparative study on the mechanical property of silk thread from cocoons of Bombyx mori L.

PubMed

Iizuka, E; Hachimori, A; Abe, K; Sunohara, M; Hiraide, Y; Ueyama, A; Kamo, K; Fujiwara, T; Nakamura, F; Uno, T

1983-01-01

Specimens of bave (undegummed silk thread) were collected from cocoons of various origins of parent silkworm races, such as Japanese, Chinese, European, Korean and tropical origins, and from as many races as possible. An apparatus was set up to measure the dynamic elastic modulus of these specimens. In all the categories of the races tested, the elastic modulus was linearly related to the size of bave, regardless of the portion of cocoon layer from which the specimens were taken. This correlation was concluded to be universal to the silk thread of Bombyx mori L. species; however, values of the regression coefficient and of the elastic modulus were susceptible to the origin of silkworm races, depending on whether they were native or improved.

In Search of Common Threads: Linking Multicultural, Feminist, and Social Justice Counseling Paradigms

ERIC Educational Resources Information Center

Crethar, Hugh C.; Rivera, Edil Torres; Nash, Sara

2008-01-01

Multicultural, feminist, and social justice counseling theories are often viewed as disparate helping models. This article examines the complementary nature of these models and discusses the need to promote a clearer understanding of the ways in which these common threads can be used in counseling practice.

Volar fixed-angle plating of extra-articular distal radius fractures--a biomechanical analysis comparing threaded screws and smooth pegs.

PubMed

Weninger, Patrick; Dall'Ara, Enrico; Leixnering, Martin; Pezzei, Christoph; Hertz, Harald; Drobetz, Herwig; Redl, Heinz; Zysset, Philippe

2010-11-01

Distal radius fractures represent the most common fractures in adult individuals. Volar fixed-angle plating has become a popular modality for treating unstable distal radius fractures. Most of the plates allow insertion of either threaded locking screws or smooth locking pegs. To date, no biomechanical studies compare locking screws and pegs under axial and torsional loading. Ten Sawbones radii were used to simulate an AO/OTA A3 fracture. Volar fixed-angle plates (Aptus Radius 2.5, Medartis, Switzerland) with threaded locking screws (n = 5) or smooth locking pegs (n = 5) were used to fix the distal metaphyseal fragment. Each specimen was tested under axial compression and under torsional load with a servohydraulic testing machine. Qualitative parameters were recorded as well as axial and torsional stiffness, torsion strength, energy absorbed during monotonic loading and energy absorbed in one cycle. Axial stiffness was comparable between both groups (p = 0.818). If smooth pegs were used, a 17% reduction of torsional stiffness (p = 0.017) and a 12% reduction of minimum torque (p = 0.012) were recorded. A 12% reduction of energy absorbed (p = 0.013) during monotonic loading and unloading was recorded if smooth pegs were used. A 34% reduction of energy absorbed in one cycle (p < 0.007) was recorded if threaded screws were used. Sliding of the pegs out of the distal radius metaphyses of the synthetic bones was recorded at a mean torque of 3.80 Nm ± 0.19 Nm. No sliding was recorded if threaded screws were used. According to the results of this study using Sawbones, volar fixed-angle plates with threaded locking screws alone are mechanically superior to volar fixed-angle plates with smooth locking pegs alone under torsional loading.

Full covered self-expandable metal stents for the treatment of anastomotic leak using a silk thread

PubMed Central

Choi, Cheol Woong; Kang, Dae Hwan; Kim, Hyung Wook; Park, Su Bum; Kim, Su Jin; Hwang, Sun Hwi; Lee, Si Hak

2017-01-01

Abstract To evaluate the safety and effectiveness of fixation of the fully covered self-expandable metal stent (SEMS) placement using a silk thread for complete closure of an anastomotic leak. An anastomotic leak is a life-threatening complication after gastrectomy. Although the traditional treatment of choice was surgical re-intervention, an endoscopic SEMS can be used alternatively. During the study period, we retrospectively reviewed consecutive patients who received a modified covered SEMS capable of being fixed using a silk thread (Shim technique) due to an anastomotic leak after gastrectomy to prevent stent migration. Demographic data, stent placement and removal, clinical success, time to resolution, and complications were evaluated. A total of 7 patients underwent fully covered SEMS with a silk thread placement for an anastomotic leak after gastrectomy to treat gastric cancer. The patients’ mean age was 71.3 ± 8.0 years. Man sex was predominant (85.7%). All patients’ American Society of Anesthesiologists (ASA) scores were between I and III. Total gastrectomy was performed in 5 patients (71.4%) and proximal gastrectomy was performed in 2 patients (28.6%). The time between gastrectomy and stent insertion was 22.3 ± 11.1 days. The size of the leaks was 27.1 ± 11.1 mm. Technical success and complete leak closure were achieved in all patients. Stent migration was absent. All stents were removed between 4 and 6 weeks. Delayed esophageal stricture was found in 1 patient (14.2) and successfully resolved after endoscopic balloon dilation. For an anastomotic leak after gastrectomy, fully covered SEMS placement with a silk thread is an effective and safe treatment option without stent migration. The stent extraction time between 4 and 6 weeks was optimal without severe complications. PMID:28723752

Full covered self-expandable metal stents for the treatment of anastomotic leak using a silk thread.

PubMed

Choi, Cheol Woong; Kang, Dae Hwan; Kim, Hyung Wook; Park, Su Bum; Kim, Su Jin; Hwang, Sun Hwi; Lee, Si Hak

2017-07-01

To evaluate the safety and effectiveness of fixation of the fully covered self-expandable metal stent (SEMS) placement using a silk thread for complete closure of an anastomotic leak. An anastomotic leak is a life-threatening complication after gastrectomy. Although the traditional treatment of choice was surgical re-intervention, an endoscopic SEMS can be used alternatively.During the study period, we retrospectively reviewed consecutive patients who received a modified covered SEMS capable of being fixed using a silk thread (Shim technique) due to an anastomotic leak after gastrectomy to prevent stent migration. Demographic data, stent placement and removal, clinical success, time to resolution, and complications were evaluated.A total of 7 patients underwent fully covered SEMS with a silk thread placement for an anastomotic leak after gastrectomy to treat gastric cancer. The patients' mean age was 71.3 ± 8.0 years. Man sex was predominant (85.7%). All patients' American Society of Anesthesiologists (ASA) scores were between I and III. Total gastrectomy was performed in 5 patients (71.4%) and proximal gastrectomy was performed in 2 patients (28.6%). The time between gastrectomy and stent insertion was 22.3 ± 11.1 days. The size of the leaks was 27.1 ± 11.1 mm. Technical success and complete leak closure were achieved in all patients. Stent migration was absent. All stents were removed between 4 and 6 weeks. Delayed esophageal stricture was found in 1 patient (14.2) and successfully resolved after endoscopic balloon dilation.For an anastomotic leak after gastrectomy, fully covered SEMS placement with a silk thread is an effective and safe treatment option without stent migration. The stent extraction time between 4 and 6 weeks was optimal without severe complications.

Integrating soft sensor systems using conductive thread

NASA Astrophysics Data System (ADS)

Teng, Lijun; Jeronimo, Karina; Wei, Tianqi; Nemitz, Markus P.; Lyu, Geng; Stokes, Adam A.

2018-05-01

We are part of a growing community of researchers who are developing a new class of soft machines. By using mechanically soft materials (MPa modulus) we can design systems which overcome the bulk-mechanical mismatches between soft biological systems and hard engineered components. To develop fully integrated soft machines—which include power, communications, and control sub-systems—the research community requires methods for interconnecting between soft and hard electronics. Sensors based upon eutectic gallium alloys in microfluidic channels can be used to measure normal and strain forces, but integrating these sensors into systems of heterogeneous Young’s modulus is difficult due the complexity of finding a material which is electrically conductive, mechanically flexible, and stable over prolonged periods of time. Many existing gallium-based liquid alloy sensors are not mechanically or electrically robust, and have poor stability over time. We present the design and fabrication of a high-resolution pressure-sensor soft system that can transduce normal force into a digital output. In this soft system, which is built on a monolithic silicone substrate, a galinstan-based microfluidic pressure sensor is integrated with a flexible printed circuit board. We used conductive thread as the interconnect and found that this method alleviates problems arising due to the mechanical mismatch between conventional metal wires and soft or liquid materials. Conductive thread is low-cost, it is readily wetted by the liquid metal, it produces little bending moment into the microfluidic channel, and it can be connected directly onto the copper bond-pads of the flexible printed circuit board. We built a bridge-system to provide stable readings from the galinstan pressure sensor. This system gives linear measurement results between 500-3500 Pa of applied pressure. We anticipate that integrated systems of this type will find utility in soft-robotic systems as used for wearable

Cable-type supercapacitors of three-dimensional cotton thread based multi-grade nanostructures for wearable energy storage.

PubMed

Liu, Nishuang; Ma, Wenzhen; Tao, Jiayou; Zhang, Xianghui; Su, Jun; Li, Luying; Yang, Congxing; Gao, Yihua; Golberg, Dmitri; Bando, Yoshio

2013-09-20

A novel cable-type flexible supercapacitor with excellent performance is fabricated using 3D polypyrrole(PPy)-MnO2 -CNT-cotton thread multi-grade nanostructure-based electrodes. The multiple supercapacitors with a high areal capacitance 1.49 F cm(-2) at a scan rate of 1 mV s(-1) connected in series and in parallel can successfully drive a LED segment display. Such an excellent performance is attributed to the cumulative effect of conducting single-walled carbon nanotubes on cotton thread, active mesoporous flower-like MnO2 nanoplates, and PPy conductive wrapping layer improving the conductivity, and acting as pseudocapacitance material simultaneously. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

An assessment of wind tunnel test data on flexible thermal protection materials and results of new fatigue tests of threads

NASA Technical Reports Server (NTRS)

Coe, Charles F.

1985-01-01

Advanced Flexible Reusable Surface Insulation (AFRSI) was developed as a replacement for the low-temperature (white) tiles on the Space Shuttle. The first use of the AFRSI for an Orbiter flight was on the OMS POD of Orbiter (OV-099) for STS-6. Post flight examination after STS-6 showed that damage had occurred to the AFRSI during flight. The failure anomaly between previous wind-tunnel tests and STS-6 prompted a series of additional wind tunnel tests to gain an insight as to the cause of the failure. An assessment of all the past STS-6 wind tunnel tests pointed out the sensitivity of the test results to scaling of dynamic loads due to the difference of boundary layer thickness, and the material properties as a result of exposure to heating. The thread component of the AFRSI was exposed to fatigue testing using an apparatus that applied pulsating aerodynamic loads on the threads similar to the loads caused by an oscillating shock. Comparison of the mean values of the number-of-cycles to failure showed that the history of the thread was the major factor in its performance. The thread and the wind tunnel data suggests a mechanism of failure for the AFRSI.

Analysis of Modeling Parameters on Threaded Screws.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vigil, Miquela S.; Brake, Matthew Robert; Vangoethem, Douglas

2015-06-01

Assembled mechanical systems often contain a large number of bolted connections. These bolted connections (joints) are integral aspects of the load path for structural dynamics, and, consequently, are paramount for calculating a structure's stiffness and energy dissipation prop- erties. However, analysts have not found the optimal method to model appropriately these bolted joints. The complexity of the screw geometry cause issues when generating a mesh of the model. This paper will explore different approaches to model a screw-substrate connec- tion. Model parameters such as mesh continuity, node alignment, wedge angles, and thread to body element size ratios are examined. Themore » results of this study will give analysts a better understanding of the influences of these parameters and will aide in finding the optimal method to model bolted connections.« less

Peripheral Dose Heterogeneity Due to the Thread Effect in Total Marrow Irradiation With Helical Tomotherapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takahashi, Yutaka; Verneris, Michael R.; Dusenbery, Kathryn E.

Purpose: To report potential dose heterogeneity leading to underdosing at different skeletal sites in total marrow irradiation (TMI) with helical tomotherapy due to the thread effect and provide possible solutions to reduce this effect. Methods and Materials: Nine cases were divided into 2 groups based on patient size, defined as maximum left-to-right arm distance (mLRD): small mLRD (≤47 cm) and large mLRD (>47 cm). TMI treatment planning was conducted by varying the pitch and modulation factor while a jaw size (5 cm) was kept fixed. Ripple amplitude, defined as the peak-to-trough dose relative to the average dose due to themore » thread effect, and the dose–volume histogram (DVH) parameters for 9 cases with various mLRD was analyzed in different skeletal regions at off-axis (eg, bones of the arm or femur), at the central axis (eg, vertebrae), and planning target volume (PTV), defined as the entire skeleton plus 1-cm margin. Results: Average ripple amplitude for a pitch of 0.430, known as one of the magic pitches that reduce thread effect, was 9.2% at 20 cm off-axis. No significant differences in DVH parameters of PTV, vertebrae, or femur were observed between small and large mLRD groups for a pitch of ≤0.287. Conversely, in the bones of the arm, average differences in the volume receiving 95% and 107% dose (V95 and V107, respectively) between large and small mLRD groups were 4.2% (P=.016) and 16% (P=.016), respectively. Strong correlations were found between mLRD and ripple amplitude (rs=.965), mLRD and V95 (rs=−.742), and mLRD and V107 (rs=.870) of bones of the arm. Conclusions: Thread effect significantly influences DVH parameters in the bones of the arm for large mLRD patients. By implementing a favorable pitch value and adjusting arm position, peripheral dose heterogeneity could be reduced.« less

Microfluidic thread based electroanalytical system for green chromatographic separations.

PubMed

Agustini, Deonir; Fedalto, Lucas; Bergamini, Márcio F; Marcolino-Junior, Luiz Humberto

2018-02-13

The use of miniaturized chromatographic systems is an important strategy for reducing the consumption of supplies related to separations, allowing the development of more sustainable analytical methodologies. However, the high cost and complexity in the production of these systems combined with the operational difficulties and the need for the use of solvent and sample pretreatment are challenges to be overcome in order to make the chromatographic methods greener. Here, we report the construction and development of a low cost microfluidic system for green and solvent-free chromatographic separations with electrochemical detection integrated into cotton threads without the use of any mechanical pumping to transport the solutions. The manufacture of the proposed system was performed by simple assembly of the components, with the separation of the species based on an ion exchange mechanism and detection using gold electrodes manufactured directly on the cotton threads. A linear range of 0.025-5.0 mM was obtained for the effective separation of ascorbic acid (AA) and dopamine (DA) with detection limits of 2.89 μM (for AA) and 4.41 μM (for DA). Each analysis was performed at a low cost (less than 0.01 dollars), and with a small volume of waste generated (107.1 μL). So, the proposed system was successfully employed to determine the levels of AA and DA present in the tears of healthy volunteers without sample pretreatment, indicating the good analytical performance of the system and the possibility of performing greener chromatographic separations.

Distinct spinning patterns gain differentiated loading tolerance of silk thread anchorages in spiders with different ecology.

PubMed

Wolff, Jonas O; van der Meijden, Arie; Herberstein, Marie E

2017-07-26

Building behaviour in animals extends biological functions beyond bodies. Many studies have emphasized the role of behavioural programmes, physiology and extrinsic factors for the structure and function of buildings. Structure attachments associated with animal constructions offer yet unrealized research opportunities. Spiders build a variety of one- to three-dimensional structures from silk fibres. The evolution of economic web shapes as a key for ecological success in spiders has been related to the emergence of high performance silks and thread coating glues. However, the role of thread anchorages has been widely neglected in those models. Here, we show that orb-web (Araneidae) and hunting spiders (Sparassidae) use different silk application patterns that determine the structure and robustness of the joint in silk thread anchorages. Silk anchorages of orb-web spiders show a greater robustness against different loading situations, whereas the silk anchorages of hunting spiders have their highest pull-off resistance when loaded parallel to the substrate along the direction of dragline spinning. This suggests that the behavioural 'printing' of silk into attachment discs along with spinneret morphology was a prerequisite for the evolution of extended silk use in a three-dimensional space. This highlights the ecological role of attachments in the evolution of animal architectures. © 2017 The Author(s).

Meditope-Fab interaction: threading the hole.

PubMed

Bzymek, Krzysztof P; Ma, Yuelong; Avery, Kendra N; Horne, David A; Williams, John C

2017-12-01

Meditope, a cyclic 12-residue peptide, binds to a unique binding side between the light and heavy chains of the cetuximab Fab. In an effort to improve the affinity of the interaction, it was sought to extend the side chain of Arg8 in the meditope, a residue that is accessible from the other side of the meditope binding site, in order to increase the number of interactions. These modifications included an n-butyl and n-octyl extension as well as hydroxyl, amine and carboxyl substitutions. The atomic structures of the complexes and the binding kinetics for each modified meditope indicated that each extension threaded through the Fab `hole' and that the carboxyethylarginine substitution makes a favorable interaction with the Fab, increasing the half-life of the complex by threefold compared with the unmodified meditope. Taken together, these studies provide a basis for the design of additional modifications to enhance the overall affinity of this unique interaction.

MATRIX FACTORIZATION-BASED DATA FUSION FOR GENE FUNCTION PREDICTION IN BAKER’S YEAST AND SLIME MOLD

PubMed Central

ŽITNIK, MARINKA; ZUPAN, BLAŽ

2014-01-01

The development of effective methods for the characterization of gene functions that are able to combine diverse data sources in a sound and easily-extendible way is an important goal in computational biology. We have previously developed a general matrix factorization-based data fusion approach for gene function prediction. In this manuscript, we show that this data fusion approach can be applied to gene function prediction and that it can fuse various heterogeneous data sources, such as gene expression profiles, known protein annotations, interaction and literature data. The fusion is achieved by simultaneous matrix tri-factorization that shares matrix factors between sources. We demonstrate the effectiveness of the approach by evaluating its performance on predicting ontological annotations in slime mold D. discoideum and on recognizing proteins of baker’s yeast S. cerevisiae that participate in the ribosome or are located in the cell membrane. Our approach achieves predictive performance comparable to that of the state-of-the-art kernel-based data fusion, but requires fewer data preprocessing steps. PMID:24297565

Dual-thread parallel control strategy for ophthalmic adaptive optics.

PubMed

Yu, Yongxin; Zhang, Yuhua

To improve ophthalmic adaptive optics speed and compensate for ocular wavefront aberration of high temporal frequency, the adaptive optics wavefront correction has been implemented with a control scheme including 2 parallel threads; one is dedicated to wavefront detection and the other conducts wavefront reconstruction and compensation. With a custom Shack-Hartmann wavefront sensor that measures the ocular wave aberration with 193 subapertures across the pupil, adaptive optics has achieved a closed loop updating frequency up to 110 Hz, and demonstrated robust compensation for ocular wave aberration up to 50 Hz in an adaptive optics scanning laser ophthalmoscope.

Dual-thread parallel control strategy for ophthalmic adaptive optics

PubMed Central

Yu, Yongxin; Zhang, Yuhua

2015-01-01

To improve ophthalmic adaptive optics speed and compensate for ocular wavefront aberration of high temporal frequency, the adaptive optics wavefront correction has been implemented with a control scheme including 2 parallel threads; one is dedicated to wavefront detection and the other conducts wavefront reconstruction and compensation. With a custom Shack-Hartmann wavefront sensor that measures the ocular wave aberration with 193 subapertures across the pupil, adaptive optics has achieved a closed loop updating frequency up to 110 Hz, and demonstrated robust compensation for ocular wave aberration up to 50 Hz in an adaptive optics scanning laser ophthalmoscope. PMID:25866498

Extraction-spectrophotometric determination of traces of gold in copper in silver, lead, blister copper, copper concentrate and anode slime with 4,4'-bis(dimethylamino)-thiobenzophenone.

PubMed

Tsukahara, I

1977-10-01

A sensitive spectrophotometric method has been developed for the determination of gold in copper, silver, lead, blister copper, copper concentrate and anode slime. Optimal conditions have been established for the extraction and determination of gold. Gold is extracted as its bromo complex with tri-n-octylamine and determined photometrically with 4,4'-bis(dimethylamino)thiobenzophenone; the absorbance of the organic phase is measured at 540 nm and the apparent molar absorptivity is about 1.2 x 10(5) 1.mole(-1). cm(-1). As little as 0.1 or 0.2 ppm of gold in these materials can be determined.

Resolution of Infinite-Loop in Hyperincursive and Nonlocal Cellular Automata: Introduction to Slime Mold Computing

NASA Astrophysics Data System (ADS)

Aono, Masashi; Gunji, Yukio-Pegio

2004-08-01

How can non-algorithmic/non-deterministic computational syntax be computed? "The hyperincursive system" introduced by Dubois is an anticipatory system embracing the contradiction/uncertainty. Although it may provide a novel viewpoint for the understanding of complex systems, conventional digital computers cannot run faithfully as the hyperincursive computational syntax specifies, in a strict sense. Then is it an imaginary story? In this paper we try to argue that it is not. We show that a model of complex systems "Elementary Conflictable Cellular Automata (ECCA)" proposed by Aono and Gunji is embracing the hyperincursivity and the nonlocality. ECCA is based on locality-only type settings basically as well as other CA models, and/but at the same time, each cell is required to refer to globality-dominant regularity. Due to this contradictory locality-globality loop, the time evolution equation specifies that the system reaches the deadlock/infinite-loop. However, we show that there is a possibility of the resolution of these problems if the computing system has parallel and/but non-distributed property like an amoeboid organism. This paper is an introduction to "the slime mold computing" that is an attempt to cultivate an unconventional notion of computation.

Weight loss by Ppc-1, a novel small molecule mitochondrial uncoupler derived from slime mold.

PubMed

Suzuki, Toshiyuki; Kikuchi, Haruhisa; Ogura, Masato; Homma, Miwako K; Oshima, Yoshiteru; Homma, Yoshimi

2015-01-01

Mitochondria play a key role in diverse processes including ATP synthesis and apoptosis. Mitochondrial function can be studied using inhibitors of respiration, and new agents are valuable for discovering novel mechanisms involved in mitochondrial regulation. Here, we screened small molecules derived from slime molds and other microorganisms for their effects on mitochondrial oxygen consumption. We identified Ppc-1 as a novel molecule which stimulates oxygen consumption without adverse effects on ATP production. The kinetic behavior of Ppc-1 suggests its function as a mitochondrial uncoupler. Serial administration of Ppc-1 into mice suppressed weight gain with no abnormal effects on liver or kidney tissues, and no evidence of tumor formation. Serum fatty acid levels were significantly elevated in mice treated with Ppc-1, while body fat content remained low. After a single administration, Ppc-1 distributes into various tissues of individual animals at low levels. Ppc-1 stimulates adipocytes in culture to release fatty acids, which might explain the elevated serum fatty acids in Ppc-1-treated mice. The results suggest that Ppc-1 is a unique mitochondrial regulator which will be a valuable tool for mitochondrial research as well as the development of new drugs to treat obesity.

THE CHANGING PATTERN OF BIREFRINGENCE IN PLASMODIA OF THE SLIME MOLD, PHYSARUM POLYCEPHALUM

PubMed Central

Nakajima, Hiromichi; Allen, Robert D.

1965-01-01

Plasmodia of the acellular slime mold, Physarum polycephalum, reveal a complex and changing pattern of birefringence when examined with a sensitive polarizing microscope. Positively birefringent fibrils are found throughout the ectoplasmic region of the plasmodium. In the larger strands they may be oriented parallel to the strand axis, or arranged circularly or spirally along the periphery of endoplasmic channels. Some fibrils exist for only a few minutes, others for a longer period. Some, particularly the circular fibrils, undergo changes in birefringence as they undergo cyclic deformations. In the ramifying strand region and the advancing margin there is a tendency for fibrils of various sizes to become organized into mutually orthogonal arrays. In some plasmodia the channel wall material immediately adjacent to the endoplasm has been found to be birefringent. The sign of endoplasmic birefringence is negative, and its magnitude is apparently constant over the streaming cycle. The pattern of plasmodial birefringence and its changes during the shuttle streaming cycle of Physarum are considered in the light of several models designed to explain either cytoplasmic streaming alone or the entire gamut of plasmodial motions. The results of this and other recent physical studies suggest that both streaming and the various other motions of the plasmodium may very likely be explained in terms of coordinated contractions taking place in the fibrils which are rendered visible in polarized light. PMID:14287186

[A novel method based on Y-shaped cotton-polyester thread microfluidic channel].

PubMed

Wang, Lu; Shi, Yan-ru; Yan, Hong-tao

2014-08-01

A novel method based on Y-shaped microfluidic channel was firstly proposed in this study. The microfluidic channel was made of two cotton-polyester threads based on the capillary effect of cotton-polyester threads for the determination solutions. A special device was developed to fix the Y-shaped microfluidic channel by ourselves, through which the length and the tilt angle of the channel can be adjusted as requested. The spectrophotometry was compared with Scan-Adobe Photoshop software processing method. The former had a lower detection limit while the latter showed advantages in both convenience and fast operations and lower amount of samples. The proposed method was applied to the determination of nitrite. The linear ranges and detection limits are 1.0-70 micromol x L(-1), 0.66 micromol x L(-1) (spectrophotometry) and 50-450 micromol x L(-1), 45.10 micromol x L(-1) (Scan-Adobe Photoshop software processing method) respectively. This method has been successfully used to the determination of nitrite in soil samples and moat water with recoveries between 96.7% and 104%. It was proved that the proposed method was a low-cost, rapid and convenient analytical method with extensive application prospect.

End-threaded intramedullary positive profile screw ended self-tapping pin (Admit pin) - A cost-effective novel implant for fixing canine long bone fractures.

PubMed

Chanana, Mitin; Kumar, Adarsh; Tyagi, Som Prakash; Singla, Amit Kumar; Sharma, Arvind; Farooq, Uiase Bin

2018-02-01

The current study was undertaken to evaluate the clinical efficacy of end-threaded intramedullary pinning for management of various long bone fractures in canines. This study was conducted in two phases, managing 25 client-owned dogs presented with different fractures. The technique of application of end-threaded intramedullary pinning in long bone fractures was initially standardized in 6 clinical patients presented with long bone fractures. In this phase, end-threaded pins of different profiles, i.e., positive and negative, were used as the internal fixation technique. On the basis of results obtained from standardization phase, 19 client-owned dogs clinically presented with different fractures were implanted with end-threaded intramedullary positive profile screw ended self-tapping pin in the clinical application phase. The patients, allocated randomly in two groups, when evaluated postoperatively revealed slight pin migration in Group-I (negative profile), which resulted in disruption of callus site causing delayed union in one case and large callus formation in other two cases whereas no pin migration was observed in Group-II (positive profile). Other observations in Group-I was reduced muscle girth and delayed healing time as compared to Group-II. In clinical application, phase 21 st and 42 nd day post-operative radiographic follow-up revealed no pin migration in any of the cases, and there was no bone shortening or fragment collapse in end-threaded intramedullary positive profile screw ended self-tapping pin. The end-threaded intramedullary positive profile screw ended self-tapping pin used for fixation of long bone fractures in canines can resist pin migration, pin breakage, and all loads acting on the bone, i.e., compression, tension, bending, rotation, and shearing to an extent with no post-operative complications.

Too Much Control Can Hurt: A Threaded Cognition Model of the Attentional Blink

ERIC Educational Resources Information Center

Taatgen, Niels A.; Juvina, Ion; Schipper, Marc; Borst, Jelmer P.; Martens, Sander

2009-01-01

Explanations for the attentional blink (AB; a deficit in identifying the second of two targets when presented 200-500ms after the first) have recently shifted from limitations in memory consolidation to disruptions in cognitive control. With a new model based on the threaded cognition theory of multi-tasking we propose a different explanation: the…

Assessing the Effect of Dental Implants Thread Design on Distribution of Stress in Impact Loadings Using Three Dimensional Finite Element Method.

PubMed

I, Zarei; S, Khajehpour; A, Sabouri; Az, Haghnegahdar; K, Jafari

2016-06-01

Impacts and accidents are considered as the main fac- tors in losing the teeth, so the analysis and design of the implants that they can be more resistant against impacts is very important. One of the important nu- merical methods having widespread application in various fields of engineering sciences is the finite element method. Among its wide applications, the study of distribution of power in complex structures can be noted. The aim of this research was to assess the geometric effect and the type of implant thread on its performance; we also made an attempt to determine the created stress using finite element method. In this study, the three dimensional model of bone by using Cone Beam Computerized Tomography (CBCT) of the patient has been provided. The implants in this study are designed by Solid Works software. Loading is simulated in explicit dynamic, by struck of a rigid body with the speed of 1 mm/s to implant vertically and horizontally; and the maximum level of induced stress for the cortical and trabecular bone in the ANSYS Workbench software was calculated. By considering the results of this study, it was identified that, among the designed samples, the maximum imposed stress in the cortical bone layer occurred in the first group (straight threads) and the maximum stress value in the trabecular bone layer and implant occurred in the second group (tapered threads). Due to the limitations of this study, the implants with more depth thread, because of the increased contact surface of the implant with the bone, caused more stability; also, the implant with smaller thread and shorter pitch length caused more stress to the bone.

Effects of Coatings on the High-Cycle Fatigue Life of Threaded Steel Samples

NASA Astrophysics Data System (ADS)

Eder, M. A.; Haselbach, P. U.; Mishin, O. V.

2018-05-01

In this work, high-cycle fatigue is studied for threaded cylindrical high-strength steel samples coated using three different industrial processes: black oxidation, normal-temperature galvanization and high-temperature galvanization. The fatigue performance in air is compared with that of uncoated samples. Microstructural characterization revealed the abundant presence of small cracks in the zinc coating partially penetrating into the steel. This is consistent with the observation of multiple crack initiation sites along the thread in the galvanized samples, which led to crescent type fracture surfaces governed by circumferential growth. In contrast, the black oxidized and uncoated samples exhibited a semicircular segment type fracture surface governed by single-sided growth with a significantly longer fatigue life. Numerical fatigue life prediction based on an extended Paris-law formulation has been conducted on two different fracture cases: 2D axisymmetric multisided crack growth and 3D single-sided crack growth. The results of this upper-bound and lower-bound approach are in good agreement with experimental data and can potentially be used to predict the lifetime of bolted components.

RHYTHMICITY IN THE PROTOPLASMIC STREAMING OF A SLIME MOLD, PHYSARUM POLYCEPHALUM

PubMed Central

Kishimoto, Uichiro

1958-01-01

The electric potential difference (1 to 15 mv.) between two loci of the slime mold connected with a strand of protoplasm changes rhythmically with the same period (60 to 180 seconds) as that of back and forth protoplasmic streaming along the strand. When atmospheric pressure at a part of the plasmodium is increased (about 10 cm. H2O), the electric potential at this part becomes positive (0 to 20 mv.) to another part with a time constant of 2 to 15 minutes. If the atmospheric pressure at a part of the plasmodium is changed (about 10 cm. H2O) periodically, the electric potential rhythm also changes with the same period as that of the applied pressure change, and the amplitude of the former grows to a new level (i.e., forced oscillation). The electric potential rhythm, in this case, is generally delayed about 90° in phase angle from the external pressure change. The period of the electric potential rhythm which coincided with that of the pressure change is maintained for a while after stopping the application of the pressure change, if the period is not much different from the native flow rhythm. Such a pressure effect is brought about by the forced transport of protoplasm and is reversible as a rule. In the statistical analysis made by Kishimoto (1958) and in the rheological treatment made in the report, the rhythmic deformation of the contractile protein networks is supposed to be the cause of the protoplasmic flow along the strand and of the electric potential rhythm. The role of such submicroscopic networks in the protoplasm in various kinds of protoplasmic movement is emphasized. PMID:13563809

HMMerThread: detecting remote, functional conserved domains in entire genomes by combining relaxed sequence-database searches with fold recognition.

PubMed

Bradshaw, Charles Richard; Surendranath, Vineeth; Henschel, Robert; Mueller, Matthias Stefan; Habermann, Bianca Hermine

2011-03-10

Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs) are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10), a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in proteins based on weak

HMMerThread: Detecting Remote, Functional Conserved Domains in Entire Genomes by Combining Relaxed Sequence-Database Searches with Fold Recognition

PubMed Central

Bradshaw, Charles Richard; Surendranath, Vineeth; Henschel, Robert; Mueller, Matthias Stefan; Habermann, Bianca Hermine

2011-01-01

Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs) are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10), a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in proteins based on weak

Histopathologic and Ultrastructural Features of Gold Thread Implanted in the Skin for Facial Rejuvenation.

PubMed

Moulonguet, Isabelle; Arnaud, Eric; Plantier, Françoise; da Costa, Patrick; Zaleski, Stéphane

2015-10-01

The authors report the histopathologic and ultrastructural features of gold threads, which were implanted in the cheek subcutis of a 77-year-old woman 10 years ago. These particles did not give rise to any adverse reactions and were fortuitously discovered by the surgeon during a facelift. Histopathology showed a nonpolarizing exogenous material consisting of black oval structures surrounded by a capsule of fibrosis and by a discrete inflammatory reaction with a few giant cells. In some cases, only a long fibrous tract surrounded by a moderate mononucleate infiltrate was observed. The wires were characterized with scanning electron microscopy, and X-ray microanalysis revealed a specific peak at 2.2 keV representative of gold that was absent in the control skin sample. As this value is specific for gold, it confirms the presence of the metal in the patient's skin. The histopathologic appearance of gold threads is particularly distinctive and easily recognizable by dermatopathologists.

CNTs threaded (001) exposed TiO2 with high activity in photocatalytic NO oxidation.

PubMed

Xiao, Shuning; Zhu, Wei; Liu, Peijue; Liu, Fanfan; Dai, Wenrui; Zhang, Dieqing; Chen, Wei; Li, Hexing

2016-02-07

A microwave-ionothermal strategy was developed for in situ synthesis of CNTs threaded TiO2 single crystal with a tunable percentage of surface exposed (001) active facets. The CNTs were used as microwave antennas to create local "super hot" dots to induce Ti(3+) adsorption and hydrolysis, thereby leading to a good assembly of (001) facets exposed single crystalline TiO2 threaded by the CNTs in the presence of Hmim[BF4] ionic liquid. Due to the high percentage of the active (001) facets of single crystal TiO2 and the direct electron transfer property of the CNTs, the as-prepared CNTs-TiO2 composite showed a photocatalytic NO removal ratio of up to 76.8% under UV irradiation. In addition, with self-doped Ti(3+), the CNTs-TiO2 composite also exhibited an enhanced activity under irradiation with either solar lights or visible lights, showing good potential in practical applications for environmental remediation.

High Resolution Modelling of the Congo River's Multi-Threaded Main Stem Hydraulics

NASA Astrophysics Data System (ADS)

Carr, A. B.; Trigg, M.; Tshimanga, R.; Neal, J. C.; Borman, D.; Smith, M. W.; Bola, G.; Kabuya, P.; Mushie, C. A.; Tschumbu, C. L.

2017-12-01

We present the results of a summer 2017 field campaign by members of the Congo River users Hydraulics and Morphology (CRuHM) project, and a subsequent reach-scale hydraulic modelling study on the Congo's main stem. Sonar bathymetry, ADCP transects, and water surface elevation data have been collected along the Congo's heavily multi-threaded middle reach, which exhibits complex in-channel hydraulic processes that are not well understood. To model the entire basin's hydrodynamics, these in-channel hydraulic processes must be parameterised since it is not computationally feasible to represent them explicitly. Furthermore, recent research suggests that relative to other large global rivers, in-channel flows on the Congo represent a relatively large proportion of total flow through the river-floodplain system. We therefore regard sufficient representation of in-channel hydraulic processes as a Congo River hydrodynamic research priority. To enable explicit representation of in-channel hydraulics, we develop a reach-scale (70 km), high resolution hydraulic model. Simulation of flow through individual channel threads provides new information on flow depths and velocities, and will be used to inform the parameterisation of a broader basin-scale hydrodynamic model. The basin-scale model will ultimately be used to investigate floodplain fluxes, flood wave attenuation, and the impact of future hydrological change scenarios on basin hydrodynamics. This presentation will focus on the methodology we use to develop a reach-scale bathymetric DEM. The bathymetry of only a small proportion of channel threads can realistically be captured, necessitating some estimation of the bathymetry of channels not surveyed. We explore different approaches to this bathymetry estimation, and the extent to which it influences hydraulic model predictions. The CRuHM project is a consortium comprising the Universities of Kinshasa, Rhodes, Dar es Salaam, Bristol, and Leeds, and is funded by Royal

78 FR 56217 - Steel Threaded Rod from India: Postponement of Preliminary Determination of Countervailing Duty...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-09-12

... DEPARTMENT OF COMMERCE International Trade Administration [C-533-856] Steel Threaded Rod from... Administration, International Trade Administration, Department of Commerce DATES: Effective Date: September 12... Administration, International Trade Administration, U.S. Department of Commerce, 14th Street and Constitution...

Language of the People Forever: Bay Mills Spins Thread Tying Ojibwa Communities Together

ERIC Educational Resources Information Center

Austin, Brenda

2008-01-01

Why would anyone want to spend thousands of hours away from home and pay hundreds of dollars in tuition to acquire one of the world's most difficult languages? For Anishinaabe people, that is an easy question to answer. The Ojibwe language is the thread that ties communities together and unites all Anishinaabe as one people sharing a common…

Surface Analysis of the Laser Cleaned Metal Threads

NASA Astrophysics Data System (ADS)

Sokhan, M.; Hartog, F.; McPhail, D.

The laser cleaning of the tarnished silver threads was carried out using Nd:YAG laser radiation at IR (1064 nm) and visible wavelengths (532 nm). The preliminary tests were made on the piece of silk with the silver embroidery with the clean and tarnished areas. FIBS and SIMS analysis were used for analysing the condition of the surface before and after laser irradiation. It was found that irradiation below 0.4 J/cm-2 and higher than 1.0 J/cm-2 fluences aggravates the process of tarnishing and leads to the yellowing effect. The results of preliminary tests were used for finding the optimum cleaning regime for the laser cleaning of the real museum artefact: "Women Riding Jacket" dated to the beginning of 18th century.

Low cost microfluidic device based on cotton threads for electroanalytical application.

PubMed

Agustini, Deonir; Bergamini, Márcio F; Marcolino-Junior, Luiz Humberto

2016-01-21

Microfluidic devices are an interesting alternative for performing analytical assays, due to the speed of analyses, reduced sample, reagent and solvent consumption and less waste generation. However, the high manufacturing costs still prevent the massive use of these devices worldwide. Here, we present the construction of a low cost microfluidic thread-based electroanalytical device (μTED), employing extremely cheap materials and a manufacturing process free of equipment. The microfluidic channels were built with cotton threads and the estimated cost per device was only $0.39. The flow of solutions (1.12 μL s(-1)) is generated spontaneously due to the capillary forces, eliminating the use of any pumping system. To demonstrate the analytical performance of the μTED, a simultaneous determination of acetaminophen (ACT) and diclofenac (DCF) was performed by multiple pulse amperometry (MPA). A linear dynamic range (LDR) of 10 to 320 μmol L(-1) for both species, a limit of detection (LOD) and a limit of quantitation (LOQ) of 1.4 and 4.7 μmol L(-1) and 2.5 and 8.3 μmol L(-1) for ACT and DCF, respectively, as well as an analytical frequency of 45 injections per hour were reached. Thus, the proposed device has shown potential to extend the use of microfluidic analytical devices, due to its simplicity, low cost and good analytical performance.