Streamlined platform for short hairpin RNA interference and transgenesis in cultured mammalian cells.

PubMed

Khandelia, Piyush; Yap, Karen; Makeyev, Eugene V

2011-08-02

Sequence-specific gene silencing by short hairpin (sh) RNAs has recently emerged as an indispensable tool for understanding gene function and a promising avenue for drug discovery. However, a wider biomedical use of this approach is hindered by the lack of straightforward methods for achieving uniform expression of shRNAs in mammalian cell cultures. Here we report a high-efficiency and low-background (HILO) recombination-mediated cassette exchange (RMCE) technology that yields virtually homogeneous cell pools containing doxycycline-inducible shRNA elements in a matter of days and with minimal efforts. To ensure immediate utility of this approach for a wider research community, we modified 11 commonly used human (A549, HT1080, HEK293T, HeLa, HeLa-S3, and U2OS) and mouse (CAD, L929, N2a, NIH 3T3, and P19) cell lines to be compatible with the HILO-RMCE process. Because of its technical simplicity and cost efficiency, the technology will be advantageous for both low- and high-throughput shRNA experiments. We also provide evidence that HILO-RMCE will facilitate a wider range of molecular and cell biology applications by allowing one to rapidly engineer cell populations expressing essentially any transgene of interest.

Streamlined platform for short hairpin RNA interference and transgenesis in cultured mammalian cells

PubMed Central

Khandelia, Piyush; Yap, Karen; Makeyev, Eugene V.

2011-01-01

Sequence-specific gene silencing by short hairpin (sh) RNAs has recently emerged as an indispensable tool for understanding gene function and a promising avenue for drug discovery. However, a wider biomedical use of this approach is hindered by the lack of straightforward methods for achieving uniform expression of shRNAs in mammalian cell cultures. Here we report a high-efficiency and low-background (HILO) recombination-mediated cassette exchange (RMCE) technology that yields virtually homogeneous cell pools containing doxycycline-inducible shRNA elements in a matter of days and with minimal efforts. To ensure immediate utility of this approach for a wider research community, we modified 11 commonly used human (A549, HT1080, HEK293T, HeLa, HeLa-S3, and U2OS) and mouse (CAD, L929, N2a, NIH 3T3, and P19) cell lines to be compatible with the HILO-RMCE process. Because of its technical simplicity and cost efficiency, the technology will be advantageous for both low- and high-throughput shRNA experiments. We also provide evidence that HILO-RMCE will facilitate a wider range of molecular and cell biology applications by allowing one to rapidly engineer cell populations expressing essentially any transgene of interest. PMID:21768390

A hairpin within YAP mRNA 3′UTR functions in regulation at post-transcription level

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Yuen; Wang, Yuan; Feng, Jinyan

2015-04-03

The central dogma of gene expression is that DNA is transcribed into messenger RNAs, which in turn serve as the template for protein synthesis. Recently, it has been reported that mRNAs display regulatory roles that rely on their ability to compete for microRNA binding, independent of their protein-coding function. However, the regulatory mechanism of mRNAs remains poorly understood. Here, we report that a hairpin within YAP mRNA 3′untranslated region (3′UTR) functions in regulation at post-transcription level through generating endogenous siRNAs (esiRNAs). Bioinformatics analysis for secondary structure showed that YAP mRNA displayed a hairpin structure (termed standard hairpin, S-hairpin) within itsmore » 3′UTR. Surprisingly, we observed that the overexpression of S-hairpin derived from YAP 3′UTR (YAP-sh) increased the luciferase reporter activities of transcriptional factor NF-κB and AP-1 in 293T cells. Moreover, we identified that a fragment from YAP-sh, an esiRNA, was able to target mRNA 3′UTR of NF2 (a member of Hippo-signaling pathway) and YAP mRNA 3′UTR itself in hepatoma cells. Thus, we conclude that the YAP-sh within YAP mRNA 3′UTR may serve as a novel regulatory element, which functions in regulation at post-transcription level. Our finding provides new insights into the mechanism of mRNAs in regulatory function. - Highlights: • An S-hairpin within YAP mRNA 3′UTR possesses regulatory function. • YAP-sh acts as a regulatory element for YAP at post-transcription level. • YAP-sh-3p20, an esiRNA derived from YAP-sh, targets mRNAs of YAP and NF2. • YAP-sh-3p20 depresses the proliferation of HepG2 cells in vitro.« less

Analysis of hairpin RNA transgene-induced gene silencing in Fusarium oxysporum

PubMed Central

2013-01-01

Background Hairpin RNA (hpRNA) transgenes can be effective at inducing RNA silencing and have been exploited as a powerful tool for gene function analysis in many organisms. However, in fungi, expression of hairpin RNA transcripts can induce post-transcriptional gene silencing, but in some species can also lead to transcriptional gene silencing, suggesting a more complex interplay of the two pathways at least in some fungi. Because many fungal species are important pathogens, RNA silencing is a powerful technique to understand gene function, particularly when gene knockouts are difficult to obtain. We investigated whether the plant pathogenic fungus Fusarium oxysporum possesses a functional gene silencing machinery and whether hairpin RNA transcripts can be employed to effectively induce gene silencing. Results Here we show that, in the phytopathogenic fungus F. oxysporum, hpRNA transgenes targeting either a β-glucuronidase (Gus) reporter transgene (hpGus) or the endogenous gene Frp1 (hpFrp) did not induce significant silencing of the target genes. Expression analysis suggested that the hpRNA transgenes are prone to transcriptional inactivation, resulting in low levels of hpRNA and siRNA production. However, the hpGus RNA can be efficiently transcribed by promoters acquired either by recombination with a pre-existing, actively transcribed Gus transgene or by fortuitous integration near an endogenous gene promoter allowing siRNA production. These siRNAs effectively induced silencing of a target Gus transgene, which in turn appeared to also induce secondary siRNA production. Furthermore, our results suggested that hpRNA transcripts without poly(A) tails are efficiently processed into siRNAs to induce gene silencing. A convergent promoter transgene, designed to express poly(A)-minus sense and antisense Gus RNAs, without an inverted-repeat DNA structure, induced consistent Gus silencing in F. oxysporum. Conclusions These results indicate that F. oxysporum possesses

Structural features of microRNA (miRNA) precursors and their relevance to miRNA biogenesis and small interfering RNA/short hairpin RNA design.

PubMed

Krol, Jacek; Sobczak, Krzysztof; Wilczynska, Urszula; Drath, Maria; Jasinska, Anna; Kaczynska, Danuta; Krzyzosiak, Wlodzimierz J

2004-10-01

We have established the structures of 10 human microRNA (miRNA) precursors using biochemical methods. Eight of these structures turned out to be different from those that were computer-predicted. The differences localized in the terminal loop region and at the opposite side of the precursor hairpin stem. We have analyzed the features of these structures from the perspectives of miRNA biogenesis and active strand selection. We demonstrated the different thermodynamic stability profiles for pre-miRNA hairpins harboring miRNAs at their 5'- and 3'-sides and discussed their functional implications. Our results showed that miRNA prediction based on predicted precursor structures may give ambiguous results, and the success rate is significantly higher for the experimentally determined structures. On the other hand, the differences between the predicted and experimentally determined structures did not affect the stability of termini produced through "conceptual dicing." This result confirms the value of thermodynamic analysis based on mfold as a predictor of strand section by RNAi-induced silencing complex (RISC).

Novel determinants of mammalian primary microRNA processing revealed by systematic evaluation of hairpin-containing transcripts and human genetic variation

PubMed Central

Roden, Christine; Gaillard, Jonathan; Kanoria, Shaveta; Rennie, William; Barish, Syndi; Cheng, Jijun; Pan, Wen; Liu, Jun; Cotsapas, Chris; Ding, Ye; Lu, Jun

2017-01-01

Mature microRNAs (miRNAs) are processed from hairpin-containing primary miRNAs (pri-miRNAs). However, rules that distinguish pri-miRNAs from other hairpin-containing transcripts in the genome are incompletely understood. By developing a computational pipeline to systematically evaluate 30 structural and sequence features of mammalian RNA hairpins, we report several new rules that are preferentially utilized in miRNA hairpins and govern efficient pri-miRNA processing. We propose that a hairpin stem length of 36 ± 3 nt is optimal for pri-miRNA processing. We identify two bulge-depleted regions on the miRNA stem, located ∼16–21 nt and ∼28–32 nt from the base of the stem, that are less tolerant of unpaired bases. We further show that the CNNC primary sequence motif selectively enhances the processing of optimal-length hairpins. We predict that a small but significant fraction of human single-nucleotide polymorphisms (SNPs) alter pri-miRNA processing, and confirm several predictions experimentally including a disease-causing mutation. Our study enhances the rules governing mammalian pri-miRNA processing and suggests a diverse impact of human genetic variation on miRNA biogenesis. PMID:28087842

Genetically Encoded Catalytic Hairpin Assembly for Sensitive RNA Imaging in Live Cells.

PubMed

Mudiyanselage, Aruni P K K Karunanayake; Yu, Qikun; Leon-Duque, Mark A; Zhao, Bin; Wu, Rigumula; You, Mingxu

2018-06-26

DNA and RNA nanotechnology has been used for the development of dynamic molecular devices. In particular, programmable enzyme-free nucleic acid circuits, such as catalytic hairpin assembly, have been demonstrated as useful tools for bioanalysis and to scale up system complexity to an extent beyond current cellular genetic circuits. However, the intracellular functions of most synthetic nucleic acid circuits have been hindered by challenges in the biological delivery and degradation. On the other hand, genetically encoded and transcribed RNA circuits emerge as alternative powerful tools for long-term embedded cellular analysis and regulation. Herein, we reported a genetically encoded RNA-based catalytic hairpin assembly circuit for sensitive RNA imaging inside living cells. The split version of Broccoli, a fluorogenic RNA aptamer, was used as the reporter. One target RNA can catalytically trigger the fluorescence from tens-to-hundreds of Broccoli. As a result, target RNAs can be sensitively detected. We have further engineered our circuit to allow easy programming to image various target RNA sequences. This design principle opens the arena for developing a large variety of genetically encoded RNA circuits for cellular applications.

Forced-Unfolding and Force-Quench Refolding of RNA Hairpins

PubMed Central

Hyeon, Changbong; Thirumalai, D.

2006-01-01

Nanomanipulation of individual RNA molecules, using laser optical tweezers, has made it possible to infer the major features of their energy landscape. Time-dependent mechanical unfolding trajectories, measured at a constant stretching force (fS) of simple RNA structures (hairpins and three-helix junctions) sandwiched between RNA/DNA hybrid handles show that they unfold in a reversible all-or-none manner. To provide a molecular interpretation of the experiments we use a general coarse-grained off-lattice Gō-like model, in which each nucleotide is represented using three interaction sites. Using the coarse-grained model we have explored forced-unfolding of RNA hairpin as a function of fS and the loading rate (rf). The simulations and theoretical analysis have been done both with and without the handles that are explicitly modeled by semiflexible polymer chains. The mechanisms and timescales for denaturation by temperature jump and mechanical unfolding are vastly different. The directed perturbation of the native state by fS results in a sequential unfolding of the hairpin starting from their ends, whereas thermal denaturation occurs stochastically. From the dependence of the unfolding rates on rf and fS we show that the position of the unfolding transition state is not a constant but moves dramatically as either rf or fS is changed. The transition-state movements are interpreted by adopting the Hammond postulate for forced-unfolding. Forced-unfolding simulations of RNA, with handles attached to the two ends, show that the value of the unfolding force increases (especially at high pulling speeds) as the length of the handles increases. The pathways for refolding of RNA from stretched initial conformation, upon quenching fS to the quench force fQ, are highly heterogeneous. The refolding times, upon force-quench, are at least an order-of-magnitude greater than those obtained by temperature-quench. The long fQ-dependent refolding times starting from fully stretched

Design of the hairpin ribozyme for targeting specific RNA sequences.

PubMed

Hampel, A; DeYoung, M B; Galasinski, S; Siwkowski, A

1997-01-01

The following steps should be taken when designing the hairpin ribozyme to cleave a specific target sequence: 1. Select a target sequence containing BN*GUC where B is C, G, or U. 2. Select the target sequence in areas least likely to have extensive interfering structure. 3. Design the conventional hairpin ribozyme as shown in Fig. 1, such that it can form a 4 bp helix 2 and helix 1 lengths up to 10 bp. 4. Synthesize this ribozyme from single-stranded DNA templates with a double-stranded T7 promoter. 5. Prepare a series of short substrates capable of forming a range of helix 1 lengths of 5-10 bp. 6. Identify these by direct RNA sequencing. 7. Assay the extent of cleavage of each substrate to identify the optimal length of helix 1. 8. Prepare the hairpin tetraloop ribozyme to determine if catalytic efficiency can be improved.

Free-energy landscape of RNA hairpins constructed via dihedral angle principal component analysis.

PubMed

Riccardi, Laura; Nguyen, Phuong H; Stock, Gerhard

2009-12-31

To systematically construct a low-dimensional free-energy landscape of RNA systems from a classical molecular dynamics simulation, various versions of the principal component analysis (PCA) are compared: the cPCA using the Cartesian coordinates of all atoms, the dPCA using the sine/cosine-transformed six backbone dihedral angles as well as the glycosidic torsional angle chi and the pseudorotational angle P, the aPCA which ignores the circularity of the 6 + 2 dihedral angles of the RNA, and the dPCA(etatheta), which approximates the 6 backbone dihedral angles by 2 pseudotorsional angles eta and theta. As representative examples, a 10-nucleotide UUCG hairpin and the 36-nucleotide segment SL1 of the Psi site of HIV-1 are studied by classical molecular dynamics simulation, using the Amber all-atom force field and explicit solvent. It is shown that the conformational heterogeneity of the RNA hairpins can only be resolved by an angular PCA such as the dPCA but not by the cPCA using Cartesian coordinates. Apart from possible artifacts due to the coupling of overall and internal motion, this is because the details of hydrogen bonding and stacking interactions but also of global structural rearrangements of the RNA are better discriminated by dihedral angles. In line with recent experiments, it is found that the free energy landscape of RNA hairpins is quite rugged and contains various metastable conformational states which may serve as an intermediate for unfolding.

A simple and robust vector-based shRNA expression system used for RNA interference.

PubMed

Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

2013-01-01

RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

Optimization of a yeast RNA interference system for controlling gene expression and enabling rapid metabolic engineering.

PubMed

Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S

2014-05-16

Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.

Hairpin DNA probe with 5'-TCC/CCC-3' overhangs for the creation of silver nanoclusters and miRNA assay.

PubMed

Xia, Xiaodong; Hao, Yuanqiang; Hu, Shengqiang; Wang, Jianxiu

2014-01-15

A facile strategy for the assay of target miRNA using fluorescent silver nanoclusters (AgNCs) has been described. Due to the preferable interaction between cytosine residues and Ag(+), a short cytosine-rich oligonucleotide (ODN) with only six bases 5'-TCCCCC-3' served as an efficient scaffold for the creation of the AgNCs. The AgNCs displayed a bright red emission when excited at 545nm. Such ODN base-stabilized AgNCs have been exploited for miRNA sensing. Overhangs of TCC at the 5' end (5'-TCC) and CCC at the 3' end (CCC-3') (denoted as 5'-TCC/CCC-3') appended to the hairpin ODN probe which also contains recognition sequences for target miRNA were included. Interestingly, the AgNCs/hairpin ODN probe showed similar spectral properties as that templated by 5'-TCCCCC-3'. The formation of the hairpin ODN probe/miRNA duplex separated the 5'-TCC/CCC-3' overhangs, thus disturbing the optical property or structure of the AgNCs. As a result, fluorescence quenching of the AgNCs/hairpin ODN probe was obtained, which allows for facile determination of target miRNA. The proposed method is simple and cost-effective, holding great promise for clinical applications. Copyright © 2013 Elsevier B.V. All rights reserved.

RNA interference of argininosuccinate synthetase restores sensitivity to recombinant arginine deiminase (rADI) in resistant cancer cells

PubMed Central

2011-01-01

Background Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To understand the efficiency of RNA interfering of AS in sensitizing the resistant cancer cells to rADI, the down regulation of AS transiently and permanently were performed in vitro, respectively. Methods We studied the use of down-regulation of this enzyme by RNA interference in three human cancer cell lines (A375, HeLa, and MCF-7) as a way to restore sensitivity to rADI in resistant cells. The expression of AS at levels of mRNA and protein was determined to understand the effect of RNA interference. Cell viability, cell cycle, and possible mechanism of the restore sensitivity of AS RNA interference in rADI treated cancer cells were evaluated. Results AS DNA was present in all cancer cell lines studied, however, the expression of this enzyme at the mRNA and protein level was different. In two rADI-resistant cell lines, one with endogenous AS expression (MCF-7 cells) and one with induced AS expression (HeLa cells), AS small interference RNA (siRNA) inhibited 37-46% of the expression of AS in MCF-7 cells. ASsiRNA did not affect cell viability in MCF-7 which may be due to the certain amount of residual AS protein. In contrast, ASsiRNA down-regulated almost all AS expression in HeLa cells and caused cell death after rADI treatment. Permanently down-regulated AS expression by short hairpin RNA (shRNA) made MCF-7 cells become sensitive to rADI via the inhibition of 4E-BP1-regulated mTOR signaling pathway. Conclusions Our results demonstrate that rADI-resistance can be altered via AS RNA interference. Although transient enzyme down-regulation (siRNA) did not affect cell viability in MCF-7 cells, permanent down-regulation (shRNA) overcame the problem of rADI-resistance due to the more efficiency in AS silencing. PMID:21453546

Trigger loop dynamics can explain stimulation of intrinsic termination by bacterial RNA polymerase without terminator hairpin contact.

PubMed

Ray-Soni, Ananya; Mooney, Rachel A; Landick, Robert

2017-10-31

In bacteria, intrinsic termination signals cause disassembly of the highly stable elongating transcription complex (EC) over windows of two to three nucleotides after kilobases of RNA synthesis. Intrinsic termination is caused by the formation of a nascent RNA hairpin adjacent to a weak RNA-DNA hybrid within RNA polymerase (RNAP). Although the contributions of RNA and DNA sequences to termination are largely understood, the roles of conformational changes in RNAP are less well described. The polymorphous trigger loop (TL), which folds into the trigger helices to promote nucleotide addition, also is proposed to drive termination by folding into the trigger helices and contacting the terminator hairpin after invasion of the hairpin in the RNAP main cleft [Epshtein V, Cardinale CJ, Ruckenstein AE, Borukhov S, Nudler E (2007) Mol Cell 28:991-1001]. To investigate the contribution of the TL to intrinsic termination, we developed a kinetic assay that distinguishes effects of TL alterations on the rate at which ECs terminate from effects of the TL on the nucleotide addition rate that indirectly affect termination efficiency by altering the time window in which termination can occur. We confirmed that the TL stimulates termination rate, but found that stabilizing either the folded or unfolded TL conformation decreased termination rate. We propose that conformational fluctuations of the TL (TL dynamics), not TL-hairpin contact, aid termination by increasing EC conformational diversity and thus access to favorable termination pathways. We also report that the TL and the TL sequence insertion (SI3) increase overall termination efficiency by stimulating pausing, which increases the flux of ECs into the termination pathway. Published under the PNAS license.

Combined antitumor gene therapy with herpes simplex virus-thymidine kinase and short hairpin RNA specific for mammalian target of rapamycin.

PubMed

Woo, Ha-Na; Lee, Won Il; Kim, Ji Hyun; Ahn, Jeonghyun; Han, Jeong Hee; Lim, Sue Yeon; Lee, Won Woo; Lee, Heuiran

2015-12-01

A proof-of-concept study is presented using dual gene therapy that employed a small hairpin RNA (shRNA) specific for mammalian target of rapamycin (mTOR) and a herpes simplex virus-thymidine kinase (HSV-TK) gene to inhibit the growth of tumors. Recombinant adeno-associated virus (rAAV) vectors containing a mutant TK gene (sc39TK) were transduced into HeLa cells, and the prodrug ganciclovir (GCV) was administered to establish a suicide gene-therapy strategy. Additionally, rAAV vectors expressing an mTOR-targeted shRNA were employed to suppress mTOR-dependent tumor growth. GCV selectively induced death in tumor cells expressing TK, and the mTOR-targeted shRNA altered the cell cycle to impair tumor growth. Combining the TK-GCV system with mTOR inhibition suppressed tumor growth to a greater extent than that achieved with either treatment alone. Furthermore, HSV-TK expression and mTOR inhibition did not mutually interfere with each other. In conclusion, gene therapy that combines the TK-GCV system and mTOR inhibition shows promise as a novel strategy for cancer therapy.

Ethical Perspectives on RNA Interference Therapeutics

PubMed Central

Ebbesen, Mette; Jensen, Thomas G.; Andersen, Svend; Pedersen, Finn Skou

2008-01-01

RNA interference is a mechanism for controlling normal gene expression which has recently begun to be employed as a potential therapeutic agent for a wide range of disorders, including cancer, infectious diseases and metabolic disorders. Clinical trials with RNA interference have begun. However, challenges such as off-target effects, toxicity and safe delivery methods have to be overcome before RNA interference can be considered as a conventional drug. So, if RNA interference is to be used therapeutically, we should perform a risk-benefit analysis. It is ethically relevant to perform a risk-benefit analysis since ethical obligations about not inflicting harm and promoting good are generally accepted. But the ethical issues in RNA interference therapeutics not only include a risk-benefit analysis, but also considerations about respecting the autonomy of the patient and considerations about justice with regard to the inclusion criteria for participation in clinical trials and health care allocation. RNA interference is considered a new and promising therapeutic approach, but the ethical issues of this method have not been greatly discussed, so this article analyses these issues using the bioethical theory of principles of the American bioethicists, Tom L. Beauchamp and James F. Childress. PMID:18612370

Trigger loop dynamics can explain stimulation of intrinsic termination by bacterial RNA polymerase without terminator hairpin contact

PubMed Central

Ray-Soni, Ananya; Mooney, Rachel A.; Landick, Robert

2017-01-01

In bacteria, intrinsic termination signals cause disassembly of the highly stable elongating transcription complex (EC) over windows of two to three nucleotides after kilobases of RNA synthesis. Intrinsic termination is caused by the formation of a nascent RNA hairpin adjacent to a weak RNA−DNA hybrid within RNA polymerase (RNAP). Although the contributions of RNA and DNA sequences to termination are largely understood, the roles of conformational changes in RNAP are less well described. The polymorphous trigger loop (TL), which folds into the trigger helices to promote nucleotide addition, also is proposed to drive termination by folding into the trigger helices and contacting the terminator hairpin after invasion of the hairpin in the RNAP main cleft [Epshtein V, Cardinale CJ, Ruckenstein AE, Borukhov S, Nudler E (2007) Mol Cell 28:991–1001]. To investigate the contribution of the TL to intrinsic termination, we developed a kinetic assay that distinguishes effects of TL alterations on the rate at which ECs terminate from effects of the TL on the nucleotide addition rate that indirectly affect termination efficiency by altering the time window in which termination can occur. We confirmed that the TL stimulates termination rate, but found that stabilizing either the folded or unfolded TL conformation decreased termination rate. We propose that conformational fluctuations of the TL (TL dynamics), not TL-hairpin contact, aid termination by increasing EC conformational diversity and thus access to favorable termination pathways. We also report that the TL and the TL sequence insertion (SI3) increase overall termination efficiency by stimulating pausing, which increases the flux of ECs into the termination pathway. PMID:29078293

Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.

PubMed

Huang, Mei; Wu, Joseph C

2011-01-01

Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.

Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia

PubMed Central

Huang, Mei; Wu, Joseph C.

2011-01-01

Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030

Role of RNA interference in plant improvement

NASA Astrophysics Data System (ADS)

Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant

2011-06-01

Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.

Highly efficient and specific modulation of cardiac calcium homeostasis by adenovector-derived short hairpin RNA targeting phospholamban.

PubMed

Fechner, H; Suckau, L; Kurreck, J; Sipo, I; Wang, X; Pinkert, S; Loschen, S; Rekittke, J; Weger, S; Dekkers, D; Vetter, R; Erdmann, V A; Schultheiss, H-P; Paul, M; Lamers, J; Poller, W

2007-02-01

Impaired function of the phospholamban (PLB)-regulated sarcoplasmic reticulum Ca(2+) pump (SERCA2a) contributes to cardiac dysfunction in heart failure (HF). PLB downregulation may increase SERCA2a activity and improve cardiac function. Small interfering (si)RNAs mediate efficient gene silencing by RNA interference (RNAi). However, their use for in vivo gene therapy is limited by siRNA instability in plasma and tissues, and by low siRNA transfer rates into target cells. To address these problems, we developed an adenoviral vector (AdV) transcribing short hairpin (sh)RNAs against rat PLB and evaluated its potential to silence the PLB gene and to modulate SERCA2a-mediated Ca(2+) sequestration in primary neonatal rat cardiomyocytes (PNCMs). Over a period of 13 days, vector transduction resulted in stable > 99.9% ablation of PLB-mRNA at a multiplicity of infection of 100. PLB protein gradually decreased until day 7 (7+/-2% left), whereas SERCA, Na(+)/Ca(2+) exchanger (NCX1), calsequestrin and troponin I protein remained unchanged. PLB silencing was associated with a marked increase in ATP-dependent oxalate-supported Ca(2+) uptake at 0.34 microM of free Ca(2+), and rapid loss of responsiveness to protein kinase A-dependent stimulation of Ca(2+) uptake was maintained until day 7. In summary, these results indicate that AdV-derived PLB-shRNA mediates highly efficient, specific and stable PLB gene silencing and modulation of active Ca(2+) sequestration in PNCMs. The availability of the new vector now enables employment of RNAi for the treatment of HF in vivo.

Dual role for argonautes in microRNA processing and posttranscriptional regulation of microRNA expression.

PubMed

Diederichs, Sven; Haber, Daniel A

2007-12-14

MicroRNAs are small endogenous noncoding RNAs involved in posttranscriptional gene regulation. During microRNA biogenesis, Drosha and Dicer process the primary transcript (pri-miRNA) through a precursor hairpin (pre-miRNA) to the mature miRNA. The miRNA is incorporated into the RNA-Induced Silencing Complex (RISC) with Argonaute proteins, the effector molecules in RNA interference (RNAi). Here, we show that all Argonautes elevate mature miRNA expression posttranscriptionally, independent of RNase activity. Also, we identify a role for the RISC slicer Argonaute2 (Ago2) in cleaving the pre-miRNA to an additional processing intermediate, termed Ago2-cleaved precursor miRNA or ac-pre-miRNA. This endogenous, on-pathway intermediate results from cleavage of the pre-miRNA hairpin 12 nucleotides from its 3'-end. By analogy to siRNA processing, Ago2 cleavage may facilitate removal of the nicked passenger strand from RISC after maturation. The multiple roles of Argonautes in the RNAi effector phase and miRNA biogenesis and maturation suggest coordinate regulation of microRNA expression and function.

Single-Molecule Mechanical (Un)folding of RNA Hairpins: Effects of Single A-U to A∙C Pair Substitutions and Single Proton Binding and Implications for mRNA Structure-Induced -1 Ribosomal Frameshifting.

PubMed

Yang, Lixia; Zhong, Zhensheng; Tong, Cailing; Jia, Huan; Liu, Yiran; Chen, Gang

2018-06-08

A wobble A∙C pair can be protonated at near physiological pH to form a more stable wobble A+∙C pair. Here, we constructed an RNA hairpin (rHP) and three mutants with one A-U base pair substituted with an A∙C mismatch on the top (near the loop, U22C), middle (U25C) and bottom (U29C) positions of the stem, respectively. Our results on single-molecule mechanical (un)folding using optical tweezers reveal the destabilization effect of A-U to A∙C pair substitution, and protonation-dependent enhancement of mechanical stability facilitated through an increased folding rate, or decreased unfolding rate, or both. Our data show that protonation may occur rapidly upon the formation of apparent mechanical folding transition state. Furthermore, we measured the bulk -1 ribosomal frameshifting efficiencies of the hairpins by a cell-free translation assay. For the mRNA hairpins studied, -1 frameshifting efficiency correlates with mechanical unfolding force at equilibrium and folding rate at around 15 pN. U29C has a frameshifting efficiency similar to that of rHP (~2%). Accordingly, the bottom 2-4 base pairs of U29C may not form under a stretching force at pH 7.3, which is consistent with the fact that the bottom base pairs of the hairpins may be disrupted by ribosome at the slippery site. U22C and U25C have a similar frameshifting efficiency (~1%), indicating that both unfolding and folding rates of an mRNA hairpin in a crowded environment may affect frameshifting. Our data indicate that mechanical (un)folding of RNA hairpins may mimic how mRNAs unfold and fold in the presence of translating ribosomes.

Unfolding and melting of DNA (RNA) hairpins: the concept of structure-specific 2D dynamic landscapes.

PubMed

Lin, Milo M; Meinhold, Lars; Shorokhov, Dmitry; Zewail, Ahmed H

2008-08-07

A 2D free-energy landscape model is presented to describe the (un)folding transition of DNA/RNA hairpins, together with molecular dynamics simulations and experimental findings. The dependence of the (un)folding transition on the stem sequence and the loop length is shown in the enthalpic and entropic contributions to the free energy. Intermediate structures are well defined by the two coordinates of the landscape during (un)zipping. Both the free-energy landscape model and the extensive molecular dynamics simulations totaling over 10 mus predict the existence of temperature-dependent kinetic intermediate states during hairpin (un)zipping and provide the theoretical description of recent ultrafast temperature-jump studies which indicate that hairpin (un)zipping is, in general, not a two-state process. The model allows for lucid prediction of the collapsed state(s) in simple 2D space and we term it the kinetic intermediate structure (KIS) model.

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

PubMed Central

Santangeloyz, K.S.; Bertoneyz, A.L.

2011-01-01

summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

PubMed

Santangelo, K S; Bertone, A L

2011-12-01

To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted

Role of RNA interference (RNAi) in the Moss Physcomitrella patens.

PubMed

Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel

2013-01-14

RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.

Label-free technology for the amplified detection of microRNA based on the allosteric hairpin DNA switch and hybridization chain reaction.

PubMed

Cai, Sheng; Cao, Zhijuan; Lau, Choiwan; Lu, Jianzhong

2014-11-21

By using the allosteric hairpin DNA switch, a novel assay for the detection of microRNA (miRNA) let-7a via a hybridization chain reaction (HCR) was introduced. Briefly, the hairpin DNA switch probe is a single-stranded DNA consisting of a streptavidin (SA) aptamer sequence, a target binding sequence and a certain sequence that acts as a trigger of the HCR. In the presence of target let-7a, the hairpin DNA switch would open and expose the stem region sequences, where a part of this sequence acts as initiator sequence strands for the HCR and triggers a cascade of hybridization events that yields nicked double helices analogous to alternating copolymers, another part is the SA aptamer sequence which activates its binding affinity to SA on SA-coated magnetic particles. The hybridization event could be sensitively detected via an instantaneous derivatization reaction between a special chemiluminescence (CL) reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG) and the guanine nucleotides within the target, the hairpin DNA switch probe, and HCR helices to form an unstable CL intermediate for the generation of light. Our results show that the coupling of the hairpin DNA switch probe and the HCR for the amplified detection of let-7a achieves a better performance (e.g. wide linear response range: 0.1-1000 fmol, low detection limit: 0.1 fmol, and high specificity). Furthermore, this approach could be easily applied to the detection of let-7a in human lung cells, and extended to detect other types of miRNA and proteins such as PDGF based on aptamers. We believe such advancements will represent a significant step towards improved diagnostics and more personalized medical treatment.

Solution structure of a modified 2′,5′-linked RNA hairpin involved in an equilibrium with duplex

PubMed Central

Plevnik, Miha; Gdaniec, Zofia; Plavec, Janez

2005-01-01

The isomerization of phosphodiester functionality of nucleic acids from 3′,5′- to a less common 2′,5′-linkage influences the complex interplay of stereoelectronic effects that drive pseudorotational equilibrium of sugar rings and thus affect the conformational propensities for compact or more extended structures. The present study highlights the subtle balance of non-covalent forces at play in structural equilibrium of 2′,5′-linked RNA analogue, 3′-O-(2-methoxyethyl) substituted dodecamer *CG*CGAA*U*U*CG*CG, 3′-MOE-2′,5′-RNA, where all cytosines and uracils are methylated at C5. The NMR and UV spectroscopic studies have shown that 3′-MOE-2′,5′-RNA adopts both hairpin and duplex secondary structures, which are involved in a dynamic exchange that is slow on the NMR timescale and exhibits strand and salt concentration as well as pH dependence. Unusual effect of pH over a narrow physiological range is observed for imino proton resonances with exchange broadening observed at lower pH and relatively sharp lines observed at higher pH. The solution structure of 3′-MOE-2′,5′-RNA hairpin displays a unique and well-defined loop, which is stabilized by Watson–Crick A5·*U8 base pair and by n → π* stacking interactions of O4′ lone-pair electrons of A6 and *U8 with aromatic rings of A5 and *U7, respectively. In contrast, the stem region of 3′-MOE-2′,5′-RNA hairpin is more flexible. Our data highlight the important feature of backbone modifications that can have pronounced effects on interstrand association of nucleic acids. PMID:15788747

Analysis of secondary structural elements in human microRNA hairpin precursors.

PubMed

Liu, Biao; Childs-Disney, Jessica L; Znosko, Brent M; Wang, Dan; Fallahi, Mohammad; Gallo, Steven M; Disney, Matthew D

2016-03-01

MicroRNAs (miRNAs) regulate gene expression by targeting complementary mRNAs for destruction or translational repression. Aberrant expression of miRNAs has been associated with various diseases including cancer, thus making them interesting therapeutic targets. The composite of secondary structural elements that comprise miRNAs could aid the design of small molecules that modulate their function. We analyzed the secondary structural elements, or motifs, present in all human miRNA hairpin precursors and compared them to highly expressed human RNAs with known structures and other RNAs from various organisms. Amongst human miRNAs, there are 3808 are unique motifs, many residing in processing sites. Further, we identified motifs in miRNAs that are not present in other highly expressed human RNAs, desirable targets for small molecules. MiRNA motifs were incorporated into a searchable database that is freely available. We also analyzed the most frequently occurring bulges and internal loops for each RNA class and found that the smallest loops possible prevail. However, the distribution of loops and the preferred closing base pairs were unique to each class. Collectively, we have completed a broad survey of motifs found in human miRNA precursors, highly expressed human RNAs, and RNAs from other organisms. Interestingly, unique motifs were identified in human miRNA processing sites, binding to which could inhibit miRNA maturation and hence function.

A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

PubMed

Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

2018-02-12

Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

Inhibition of HIV Replication by Cyclic and Hairpin PNAs Targeting the HIV-1 TAR RNA Loop

PubMed Central

Upert, Gregory; Di Giorgio, Audrey; Upadhyay, Alok; Manvar, Dinesh; Pandey, Nootan; Pandey, Virendra N.; Patino, Nadia

2012-01-01

Human immunodeficiency virus-1 (HIV-1) replication and gene expression entails specific interaction of the viral protein Tat with its transactivation responsive element (TAR), to form a highly stable stem-bulge-loop structure. Previously, we described triphenylphosphonium (TPP) cation-based vectors that efficiently deliver nucleotide analogs (PNAs) into the cytoplasm of cells. In particular, we showed that the TPP conjugate of a linear 16-mer PNA targeting the apical stem-loop region of TAR impedes Tat-mediated transactivation of the HIV-1 LTR in vitro and also in cell culture systems. In this communication, we conjugated TPP to cyclic and hairpin PNAs targeting the loop region of HIV-1 TAR and evaluated their antiviral efficacy in a cell culture system. We found that TPP-cyclic PNAs containing only 8 residues, showed higher antiviral potency compared to hairpin PNAs of 12 or 16 residues. We further noted that the TPP-conjugates of the 8-mer cyclic PNA as well as the 16-mer linear PNA displayed similar antiviral efficacy. However, cyclic PNAs were shown to be highly specific to their target sequences. This communication emphasizes on the importance of small constrained cyclic PNAs over both linear and hairpin structures for targeting biologically relevant RNA hairpins. PMID:23029603

Thermodynamics and kinetics of RNA tertiary structure formation in the junctionless hairpin ribozyme.

PubMed

White, Neil A; Hoogstraten, Charles G

2017-09-01

The hairpin ribozyme consists of two RNA internal loops that interact to form the catalytically active structure. This docking transition is a rare example of intermolecular formation of RNA tertiary structure without coupling to helix annealing. We have used temperature-dependent surface plasmon resonance (SPR) to characterize the thermodynamics and kinetics of RNA tertiary structure formation for the junctionless form of the ribozyme, in which loops A and B reside on separate molecules. We find docking to be strongly enthalpy-driven and to be accompanied by substantial activation barriers for association and dissociation, consistent with the structural reorganization of both internal loops upon complex formation. Comparisons with the parallel analysis of a ribozyme variant carrying a 2'-O-methyl modification at the self-cleavage site and with published data in other systems reveal a surprising diversity of thermodynamic signatures, emphasizing the delicate balance of contributions to the free energy of formation of RNA tertiary structure. Copyright © 2017 Elsevier B.V. All rights reserved.

Water isotope effect on the thermostability of a polio viral RNA hairpin: A metadynamics study.

PubMed

Pathak, Arup K; Bandyopadhyay, Tusar

2017-04-28

Oral polio vaccine is considered to be the most thermolabile of all the common childhood vaccines. Despite heavy water (D 2 O) having been known for a long time to stabilise attenuated viral RNA against thermodegradation, the molecular underpinnings of its mechanism of action are still lacking. Whereas, understanding the basis of D 2 O action is an important step that might reform the way other thermolabile drugs are stored and could possibly minimize the cold chain problem. Here using a combination of parallel tempering and well-tempered metadynamics simulation in light water (H 2 O) and in D 2 O, we have fully described the free energy surface associated with the folding/unfolding of a RNA hairpin containing a non-canonical basepair motif, which is conserved within the 3'-untranslated region of poliovirus-like enteroviruses. Simulations reveal that in heavy water (D 2 O) there is a considerable increase of the stability of the folded basin as monitored through an intramolecular hydrogen bond (HB), size, shape, and flexibility of RNA structures. This translates into a higher melting temperature in D 2 O by 41 K when compared with light water (H 2 O). We have explored the hydration dynamics of the RNA, hydration shell around the RNA surface, and spatial dependence of RNA-solvent collective HB dynamics in the two water systems. Simulation in heavy water clearly showed that D 2 O strengthens the HB network in the solvent, lengthens inter-residue water-bridge lifetime, and weakens dynamical coupling of the hairpin to its solvation environment, which enhances the rigidity of solvent exposed sites of the native configurations. The results might suggest that like other added osmoprotectants, D 2 O can act as a thermostabilizer when used as a solvent.

Water isotope effect on the thermostability of a polio viral RNA hairpin: A metadynamics study

NASA Astrophysics Data System (ADS)

Pathak, Arup K.; Bandyopadhyay, Tusar

2017-04-01

Oral polio vaccine is considered to be the most thermolabile of all the common childhood vaccines. Despite heavy water (D2O) having been known for a long time to stabilise attenuated viral RNA against thermodegradation, the molecular underpinnings of its mechanism of action are still lacking. Whereas, understanding the basis of D2O action is an important step that might reform the way other thermolabile drugs are stored and could possibly minimize the cold chain problem. Here using a combination of parallel tempering and well-tempered metadynamics simulation in light water (H2O) and in D2O, we have fully described the free energy surface associated with the folding/unfolding of a RNA hairpin containing a non-canonical basepair motif, which is conserved within the 3'-untranslated region of poliovirus-like enteroviruses. Simulations reveal that in heavy water (D2O) there is a considerable increase of the stability of the folded basin as monitored through an intramolecular hydrogen bond (HB), size, shape, and flexibility of RNA structures. This translates into a higher melting temperature in D2O by 41 K when compared with light water (H2O). We have explored the hydration dynamics of the RNA, hydration shell around the RNA surface, and spatial dependence of RNA-solvent collective HB dynamics in the two water systems. Simulation in heavy water clearly showed that D2O strengthens the HB network in the solvent, lengthens inter-residue water-bridge lifetime, and weakens dynamical coupling of the hairpin to its solvation environment, which enhances the rigidity of solvent exposed sites of the native configurations. The results might suggest that like other added osmoprotectants, D2O can act as a thermostabilizer when used as a solvent.

Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

PubMed

Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

2013-02-01

To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing

PubMed Central

Butardo, Vito M.; Fitzgerald, Melissa A.; Bird, Anthony R.; Gidley, Michael J.; Flanagan, Bernadine M.; Larroque, Oscar; Resurreccion, Adoracion P.; Laidlaw, Hunter K. C.; Jobling, Stephen A.; Morell, Matthew K.; Rahman, Sadequr

2011-01-01

The inactivation of starch branching IIb (SBEIIb) in rice is traditionally associated with elevated apparent amylose content, increased peak gelatinization temperature, and a decreased proportion of short amylopectin branches. To elucidate further the structural and functional role of this enzyme, the phenotypic effects of down-regulating SBEIIb expression in rice endosperm were characterized by artificial microRNA (amiRNA) and hairpin RNA (hp-RNA) gene silencing. The results showed that RNA silencing of SBEIIb expression in rice grains did not affect the expression of other major isoforms of starch branching enzymes or starch synthases. Structural analyses of debranched starch showed that the doubling of apparent amylose content was not due to an increase in the relative proportion of amylose chains but instead was due to significantly elevated levels of long amylopectin and intermediate chains. Rices altered by the amiRNA technique produced a more extreme starch phenotype than those modified using the hp-RNA technique, with a greater increase in the proportion of long amylopectin and intermediate chains. The more pronounced starch structural modifications produced in the amiRNA lines led to more severe alterations in starch granule morphology and crystallinity as well as digestibility of freshly cooked grains. The potential role of attenuating SBEIIb expression in generating starch with elevated levels of resistant starch and lower glycaemic index is discussed. PMID:21791436

Modeling RNA interference in mammalian cells

PubMed Central

2011-01-01

Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of

Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.

PubMed

Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha

2009-08-01

Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.

Highly-sensitive microRNA detection based on bio-bar-code assay and catalytic hairpin assembly two-stage amplification.

PubMed

Tang, Songsong; Gu, Yuan; Lu, Huiting; Dong, Haifeng; Zhang, Kai; Dai, Wenhao; Meng, Xiangdan; Yang, Fan; Zhang, Xueji

2018-04-03

Herein, a highly-sensitive microRNA (miRNA) detection strategy was developed by combining bio-bar-code assay (BBA) with catalytic hairpin assembly (CHA). In the proposed system, two nanoprobes of magnetic nanoparticles functionalized with DNA probes (MNPs-DNA) and gold nanoparticles with numerous barcode DNA (AuNPs-DNA) were designed. In the presence of target miRNA, the MNP-DNA and AuNP-DNA hybridized with target miRNA to form a "sandwich" structure. After "sandwich" structures were separated from the solution by the magnetic field and dehybridized by high temperature, the barcode DNA sequences were released by dissolving AuNPs. The released barcode DNA sequences triggered the toehold strand displacement assembly of two hairpin probes, leading to recycle of barcode DNA sequences and producing numerous fluorescent CHA products for miRNA detection. Under the optimal experimental conditions, the proposed two-stage amplification system could sensitively detect target miRNA ranging from 10 pM to 10 aM with a limit of detection (LOD) down to 97.9 zM. It displayed good capability to discriminate single base and three bases mismatch due to the unique sandwich structure. Notably, it presented good feasibility for selective multiplexed detection of various combinations of synthetic miRNA sequences and miRNAs extracted from different cell lysates, which were in agreement with the traditional polymerase chain reaction analysis. The two-stage amplification strategy may be significant implication in the biological detection and clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

PubMed Central

Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

2016-01-01

Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

Ultrasensitive electrochemical sensing platform for microRNA based on tungsten oxide-graphene composites coupling with catalyzed hairpin assembly target recycling and enzyme signal amplification.

PubMed

Shuai, Hong-Lei; Huang, Ke-Jing; Xing, Ling-Li; Chen, Ying-Xu

2016-12-15

An ultrasensitive electrochemical biosensor for microRNA (miRNA) is developed based on tungsten oxide-graphene composites coupling with catalyzed hairpin assembly target recycling and enzyme signal amplification. WO3-Gr is prepared by a simple hydrothermal method and then coupled with gold nanoparticles to act as a sensing platform. The thiol-terminated capture probe H1 is immobilized on electrode through Au-S interaction. In the presence of target miRNA, H1 opens its hairpin structure by hybridization with target miRNA. This hybridization can be displaced from the structure by another stable biotinylated hairpin DNA (H2), and target miRNA is released back to the sample solution for next cycle. Thus, a large amount of H1-H2 duplex is produced after the cyclic process. At this point, a lot of signal indicators streptavidin-conjugated alkaline phosphatase (SA-ALP) are immobilized on the electrode by the specific binding of avidin-biotin. Then, thousands of ascorbic acid, which is the enzymatic product of ALP, induces the electrochemical-chemical-chemical redox cycling to produce a strongly electrochemical response in the presence of ferrocene methanol and tris (2-carboxyethyl) phosphine. Under the optimal experimental conditions, the established biosensor can detect target miRNA down to 0.05fM (S/N=3) with a linear range from 0.1fM to 100pM, and discriminate target miRNA from mismatched miRNA with a high selectivity. Copyright © 2016 Elsevier B.V. All rights reserved.

Generation of siRNA Nanosheets for Efficient RNA Interference

NASA Astrophysics Data System (ADS)

Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum

2016-04-01

After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.

Competitive folding of anti-terminator/terminator hairpins monitored by single molecule FRET.

PubMed

Clerte, Caroline; Declerck, Nathalie; Margeat, Emmanuel

2013-02-01

The control of transcription termination by RNA-binding proteins that modulate RNA-structures is an important regulatory mechanism in bacteria. LicT and SacY from Bacillus subtilis prevent the premature arrest of transcription by binding to an anti-terminator RNA hairpin that overlaps an intrinsic terminator located in the 5'-mRNA leader region of the gene to be regulated. In order to investigate the molecular determinants of this anti-termination/termination balance, we have developed a fluorescence-based nucleic acids system that mimics the competition between the LicT or SacY anti-terminator targets and the overlapping terminators. Using Förster Resonance Energy Transfer on single diffusing RNA hairpins, we could monitor directly their opening or closing state, and thus investigate the effects on this equilibrium of the binding of anti-termination proteins or terminator-mimicking oligonucleotides. We show that the anti-terminator hairpins adopt spontaneously a closed structure and that their structural dynamics is mainly governed by the length of their basal stem. The induced stability of the anti-terminator hairpins determines both the affinity and specificity of the anti-termination protein binding. Finally, we show that stabilization of the anti-terminator hairpin, by an extended basal stem or anti-termination protein binding can efficiently counteract the competing effect of the terminator-mimic.

Competitive folding of anti-terminator/terminator hairpins monitored by single molecule FRET

PubMed Central

Clerte, Caroline; Declerck, Nathalie; Margeat, Emmanuel

2013-01-01

The control of transcription termination by RNA-binding proteins that modulate RNA-structures is an important regulatory mechanism in bacteria. LicT and SacY from Bacillus subtilis prevent the premature arrest of transcription by binding to an anti-terminator RNA hairpin that overlaps an intrinsic terminator located in the 5′-mRNA leader region of the gene to be regulated. In order to investigate the molecular determinants of this anti-termination/termination balance, we have developed a fluorescence-based nucleic acids system that mimics the competition between the LicT or SacY anti-terminator targets and the overlapping terminators. Using Förster Resonance Energy Transfer on single diffusing RNA hairpins, we could monitor directly their opening or closing state, and thus investigate the effects on this equilibrium of the binding of anti-termination proteins or terminator-mimicking oligonucleotides. We show that the anti-terminator hairpins adopt spontaneously a closed structure and that their structural dynamics is mainly governed by the length of their basal stem. The induced stability of the anti-terminator hairpins determines both the affinity and specificity of the anti-termination protein binding. Finally, we show that stabilization of the anti-terminator hairpin, by an extended basal stem or anti-termination protein binding can efficiently counteract the competing effect of the terminator-mimic. PMID:23303779

Silencing GIRK4 expression in human atrial myocytes by adenovirus-delivered small hairpin RNA.

PubMed

Liu, Xiongtao; Yang, Jian; Shang, Fujun; Hong, Changming; Guo, Wangang; Wang, Bing; Zheng, Qiangsun

2009-07-01

GIRK4 has been shown to be a subunit of I(KACh), and the use of GIRK4 in human atrial myocytes to treat arrhythmia remains an important research pursuit. Adenovirus-delivered small hairpin RNA (shRNA) has been used to mediate gene knockdown in mouse cardiocytes, yet there is no information on the successful application of this technique in human cardiocytes. In the current study, we used a siRNA validation system to select the most efficient sequence for silencing GIRK4. To this end, adenovirus-delivered shRNA, which expresses this sequence, was used to silence GIRK4 expression in human atrial myocytes. Finally, the feasibility, challenges, and results of silencing GIRK4 expression were evaluated by RT-PCR, western blotting, and the voltage-clamp technique. The levels of mRNA and protein were depressed significantly in cells infected by adenovirus-delivered shRNA against GIRK4, approximately 86.3% and 51.1% lower than those cells infected by adenovirus-delivered nonsense shRNA, respectively. At the same time, I(KACh) densities were decreased 53% by adenovirus-delivered shRNA against GIRK4. In summary, adenovirus-delivered shRNA against GIRK4 mediated efficient GIRK4 knockdown in human atrial myocytes and decreased I(KACh) densities. As such, these data indicated that adenovirus-delivered shRNA against GIRK4 is a potential tool for treating arrhythmia.

RNA interference of GGTA1 physiological and immune functions in immortalized porcine aortic endothelial cells.

PubMed

Han, Wei; Zhou, Jingshi; Li, Xiao; Wang, Jianfeng; Li, Junjie; Zhang, Zhuochao; Yang, Zhaoxu; Wang, Desheng; Tao, Kaishan; Dou, Kefeng

2013-11-01

Pig organs are commonly used in xenotransplantation, and α-1,3-galactose has been shown to be the main cause of hyperacute rejection. The development of transgenic pigs that lack α-1,3-galactosyltransferase (GGTA1) has overcome this problem to a certain extent, but transgenic pigs are difficult to maintain, making their usefulness in basic research limited. For this reason, we propose to establish a cell model to study hyperacute rejection. Immortalized primary porcine aortic endothelial cells were transfected with a short hairpin RNA targeted to GGTA1. Cell proliferation, apoptosis, complement C3 activation, and the binding of human immunoglobulins and components of the complement system, including IgM, IgG, C3, and C5b-9, were examined. After RNA interference, GGTA1 was found to be reduced at both the transcript and protein level as assessed by quantitative polymerase chain reaction and flow cytometry, respectively. When cultured in the presence of human serum, the proliferation rate of the transfected cells was higher than that of untransfected cells, and the apoptosis rate was lower. Additionally, activation of C3 and the binding of human immunoglobulins IgM and IgG and complement component C3 and C5b-9 to the transfected cells were lower than in the immortalized group but higher than in untransfected cells. RNA interference of GGTA1 in cultured porcine endothelial cells reduces the reaction of immunoglobulin and complement system with the cells. Therefore, this in vitro cell model could be useful for further study of xenotransplantation. Copyright © 2013 Elsevier Inc. All rights reserved.

RNA interference targeting cytosolic NADP(+)-dependent isocitrate dehydrogenase exerts anti-obesity effect in vitro and in vivo.

PubMed

Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo

2012-08-01

A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.

Identification of an miRNA candidate reflects the possible significance of transcribed microsatellites in the hairpin precursors of black pepper.

PubMed

Joy, Nisha; Soniya, Eppurathu Vasudevan

2012-06-01

Plant miRNAs (18-24nt) are generated by the RNase III-type Dicer endonuclease from the endogenous hairpin precursors ('pre-miRNAs') with significant regulatory functions. The transcribed regions display a higher frequency of microsatellites, when compared to other regions of the genomic DNA. Simple sequence repeats (SSRs) resulting from replication slippage occurring in transcripts affect the expression of genes. The available experimental evidence for the incidence of SSRs in the miRNA precursors is limited. Considering the potential significance of SSRs in the miRNA genes, we carried out a preliminary analysis to verify the presence of SSRs in the pri-miRNAs of black pepper (Piper nigrum L.). We isolated a (CT) dinucleotide SSR bearing transcript using SMART strategy. The transcript was predicted to be a 'pri-miRNA candidate' with Dicer sites based on miRNA prediction tools and MFOLD structural predictions. The presence of this 'miRNA candidate' was confirmed by real-time TaqMan assays. The upstream sequence of the 'miRNA candidate' by genome walking when subjected to PlantCARE showed the presence of certain promoter elements, and the deduced amino acid showed significant similarity with NAP1 gene, which affects the transcription of many genes. Moreover the hairpin-like precursor overlapped the neighbouring NAP1 gene. In silico analysis revealed distinct putative functions for the 'miRNA candidate', of which majority were related to growth. Hence, we assume that this 'miRNA candidate' may get activated during transcription of NAP gene, thereby regulating the expression of many genes involved in developmental processes.

Expression of short hairpin RNAs using the compact architecture of retroviral microRNA genes.

PubMed

Burke, James M; Kincaid, Rodney P; Aloisio, Francesca; Welch, Nicole; Sullivan, Christopher S

2017-09-29

Short hairpin RNAs (shRNAs) are effective in generating stable repression of gene expression. RNA polymerase III (RNAP III) type III promoters (U6 or H1) are typically used to drive shRNA expression. While useful for some knockdown applications, the robust expression of U6/H1-driven shRNAs can induce toxicity and generate heterogeneous small RNAs with undesirable off-target effects. Additionally, typical U6/H1 promoters encompass the majority of the ∼270 base pairs (bp) of vector space required for shRNA expression. This can limit the efficacy and/or number of delivery vector options, particularly when delivery of multiple gene/shRNA combinations is required. Here, we develop a compact shRNA (cshRNA) expression system based on retroviral microRNA (miRNA) gene architecture that uses RNAP III type II promoters. We demonstrate that cshRNAs coded from as little as 100 bps of total coding space can precisely generate small interfering RNAs (siRNAs) that are active in the RNA-induced silencing complex (RISC). We provide an algorithm with a user-friendly interface to design cshRNAs for desired target genes. This cshRNA expression system reduces the coding space required for shRNA expression by >2-fold as compared to the typical U6/H1 promoters, which may facilitate therapeutic RNAi applications where delivery vector space is limiting. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Adenovirus Delivered Short Hairpin RNA Targeting a Conserved Site in the 5′ Non-Translated Region Inhibits All Four Serotypes of Dengue Viruses

PubMed Central

Korrapati, Anil Babu; Swaminathan, Gokul; Singh, Aarti; Khanna, Navin; Swaminathan, Sathyamangalam

2012-01-01

Background Dengue is a mosquito-borne viral disease caused by four closely related serotypes of Dengue viruses (DENVs). This disease whose symptoms range from mild fever to potentially fatal haemorrhagic fever and hypovolemic shock, threatens nearly half the global population. There is neither a preventive vaccine nor an effective antiviral therapy against dengue disease. The difference between severe and mild disease appears to be dependent on the viral load. Early diagnosis may enable timely therapeutic intervention to blunt disease severity by reducing the viral load. Harnessing the therapeutic potential of RNA interference (RNAi) to attenuate DENV replication may offer one approach to dengue therapy. Methodology/Principal Findings We screened the non-translated regions (NTRs) of the RNA genomes of representative members of the four DENV serotypes for putative siRNA targets mapping to known transcription/translation regulatory elements. We identified a target site in the 5′ NTR that maps to the 5′ upstream AUG region, a highly conserved cis-acting element essential for viral replication. We used a replication-defective human adenovirus type 5 (AdV5) vector to deliver a short-hairpin RNA (shRNA) targeting this site into cells. We show that this shRNA matures to the cognate siRNA and is able to inhibit effectively antigen secretion, viral RNA replication and infectious virus production by all four DENV serotypes. Conclusion/Significance The data demonstrate the feasibility of using AdV5-mediated delivery of shRNAs targeting conserved sites in the viral genome to achieve inhibition of all four DENV serotypes. This paves the way towards exploration of RNAi as a possible therapeutic strategy to curtail DENV infection. PMID:22848770

[Herpes simplex virus-mediated RNA interference targeting vesicular glutamate transporter 3 attenuates tactile allodynia in mice].

PubMed

Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang

2016-11-20

To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.

Design and cloning strategies for constructing shRNA expression vectors

PubMed Central

McIntyre, Glen J; Fanning, Gregory C

2006-01-01

Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676

A triplex ribozyme expression system based on a single hairpin ribozyme.

PubMed

Aquino-Jarquin, Guillermo; Benítez-Hess, María Luisa; DiPaolo, Joseph A; Alvarez-Salas, Luis M

2008-09-01

Triplex ribozyme (RZ) configurations allow for the individual activity of trans-acting RZs in multiple expression cassettes (multiplex), thereby increasing target cleavage relative to conventionally expressed RZs. Although hairpin RZs have been advantageously compared to hammerhead RZs, their longer size and structural features complicated triplex design. We present a triplex expression system based on a single hairpin RZ with transcleavage capability and simple engineering. The system was tested in vitro using cis- and trans-cleavage kinetic assays against a known target RNA from HPV-16 E6/E7 mRNA. Single and multiplex triplex RZ constructs were more efficient in cleaving the target than tandem-cloned hairpin RZs, suggesting that the release of individual RZs enhanced trans-cleavage kinetics. Multiplex systems constructed with two different hairpin RZs resulted in better trans-cleavage compared to standard double-RZ constructs. In addition, the triplex RZ performed cis- and trans-cleavage in cervical cancer cells. The use of triplex configurations with multiplex RZs permit differential targeting of the same or different RNA, thus improving potential use against unstable targets. This prototype will provide the basis for the development of future RZ-based therapies and technologies.

Advance of RNA interference technique in Hemipteran insects.

PubMed

Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia

2012-07-24

RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

RNA Interference in Infectious Tropical Diseases

PubMed Central

Hong, Young S.

2008-01-01

Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671

Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

PubMed

Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

2016-05-11

Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

Cas5d Protein Processes Pre-crRNA and Assembles into a Cascade-like Interference Complex in Subtype I-C/Dvulg CRISPR-Cas System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nam, Ki Hyun; Haitjema, Charles; Liu, Xueqi

Clustered regularly interspaced short palindromic repeats (CRISPRs), together with an operon of CRISPR-associated (Cas) proteins, form an RNA-based prokaryotic immune system against exogenous genetic elements. Cas5 family proteins are found in several type I CRISPR-Cas systems. Here, we report the molecular function of subtype I-C/Dvulg Cas5d from Bacillus halodurans. We show that Cas5d cleaves pre-crRNA into unit length by recognizing both the hairpin structure and the 3 single stranded sequence in the CRISPR repeat region. Cas5d structure reveals a ferredoxin domain-based architecture and a catalytic triad formed by Y46, K116, and H117 residues. We further show that after pre-crRNA processing,more » Cas5d assembles with crRNA, Csd1, and Csd2 proteins to form a multi-sub-unit interference complex similar to Escherichia coli Cascade (CRISPR-associated complex for antiviral defense) in architecture. Our results suggest that formation of a crRNA-presenting Cascade-like complex is likely a common theme among type I CRISPR subtypes.« less

RNA virus interference via CRISPR/Cas13a system in plants.

PubMed

Aman, Rashid; Ali, Zahir; Butt, Haroon; Mahas, Ahmed; Aljedaani, Fatimah; Khan, Muhammad Zuhaib; Ding, Shouwei; Mahfouz, Magdy

2018-01-04

CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.

Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

DOE PAGES

Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...

2018-03-27

Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meagher, Robert J.; Priye, Aashish; Light, Yooli K.

Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

Exploring TAR–RNA aptamer loop–loop interaction by X-ray crystallography, UV spectroscopy and surface plasmon resonance

PubMed Central

Lebars, Isabelle; Legrand, Pierre; Aimé, Ahissan; Pinaud, Noël; Fribourg, Sébastien; Di Primo, Carmelo

2008-01-01

In HIV-1, trans-activation of transcription of the viral genome is regulated by an imperfect hairpin, the trans-activating responsive (TAR) RNA element, located at the 5′ untranslated end of all viral transcripts. TAR acts as a binding site for viral and cellular proteins. In an attempt to identify RNA ligands that would interfere with the virus life-cycle by interacting with TAR, an in vitro selection was previously carried out. RNA hairpins that formed kissing-loop dimers with TAR were selected [Ducongé F. and Toulmé JJ (1999) RNA, 5:1605–1614]. We describe here the crystal structure of TAR bound to a high-affinity RNA aptamer. The two hairpins form a kissing complex and interact through six Watson–Crick base pairs. The complex adopts an overall conformation with an inter-helix angle of 28.1°, thus contrasting with previously reported solution and modelling studies. Structural analysis reveals that inter-backbone hydrogen bonds between ribose 2′ hydroxyl and phosphate oxygens at the stem-loop junctions can be formed. Thermal denaturation and surface plasmon resonance experiments with chemically modified 2′-O-methyl incorporated into both hairpins at key positions, clearly demonstrate the involvement of this intermolecular network of hydrogen bonds in complex stability. PMID:18996893

RNA Interference Therapies for an HIV-1 Functional Cure.

PubMed

Scarborough, Robert J; Gatignol, Anne

2017-12-27

HIV-1 drug therapies can prevent disease progression but cannot eliminate HIV-1 viruses from an infected individual. While there is hope that elimination of HIV-1 can be achieved, several approaches to reach a functional cure (control of HIV-1 replication in the absence of drug therapy) are also under investigation. One of these approaches is the transplant of HIV-1 resistant cells expressing anti-HIV-1 RNAs, proteins or peptides. Small RNAs that use RNA interference pathways to target HIV-1 replication have emerged as competitive candidates for cell transplant therapy and have been included in all gene combinations that have so far entered clinical trials. Here, we review RNA interference pathways in mammalian cells and the design of therapeutic small RNAs that use these pathways to target pathogenic RNA sequences. Studies that have been performed to identify anti-HIV-1 RNA interference therapeutics are also reviewed and perspectives on their use in combination gene therapy to functionally cure HIV-1 infection are provided.

RNA interference as a resistance mechanism against crop parasites in Africa: a 'Trojan horse' approach.

PubMed

Runo, Steven; Alakonya, Amos; Machuka, Jesse; Sinha, Neelima

2011-02-01

Biological crop pests cause serious economic losses. In Africa, the most prevalent parasites are insect pests, plant pathogenic root-knot nematodes, viruses and parasitic plants. African smallholder farmers struggle to overcome these parasitic constraints to agricultural production. Crop losses and the host range of these parasites have continued to increase in spite of the use of widely advocated control methods. A sustainable method to overcome biological pests in Africa would be to develop crop germplasm resistant to parasites. This is achievable using either genetic modification (GM) or a non-GM approach. However, there is a paucity of resistant genes available for introduction. Additionally, the biological processes underpinning host parasite resistance are not sufficiently well understood. The authors review a technology platform for using RNA-mediated interference (RNAi) as bioengineered resistance to important crop parasites in Africa. To achieve acquired resistance, a host crop is stably transformed with a transgene that encodes a hairpin RNA targeting essential parasitic genes. The RNAi sequence is chosen in such a way that it shares no homology with the host's genes, so it remains 'inactive' until parasitism. Upon parasitism, the RNAi sequence enters the parasite and post-transcriptional gene silencing (PTGS) mechanisms are activated, leading to the death of the parasite. Copyright © 2010 Society of Chemical Industry.

Tiny abortive initiation transcripts exert antitermination activity on an RNA hairpin-dependent intrinsic terminator.

PubMed

Lee, Sooncheol; Nguyen, Huong Minh; Kang, Changwon

2010-10-01

No biological function has been identified for tiny RNA transcripts that are abortively and repetitiously released from initiation complexes of RNA polymerase in vitro and in vivo to date. In this study, we show that abortive initiation affects termination in transcription of bacteriophage T7 gene 10. Specifically, abortive transcripts produced from promoter phi 10 exert trans-acting antitermination activity on terminator T phi both in vitro and in vivo. Following abortive initiation cycling of T7 RNA polymerase at phi 10, short G-rich and oligo(G) RNAs were produced and both specifically sequestered 5- and 6-nt C + U stretch sequences, consequently interfering with terminator hairpin formation. This antitermination activity depended on sequence-specific hybridization of abortive transcripts with the 5' but not 3' half of T phi RNA. Antitermination was abolished when T phi was mutated to lack a C + U stretch, but restored when abortive transcript sequence was additionally modified to complement the mutation in T phi, both in vitro and in vivo. Antitermination was enhanced in vivo when the abortive transcript concentration was increased via overproduction of RNA polymerase or ribonuclease deficiency. Accordingly, antitermination activity exerted on T phi by abortive transcripts should facilitate expression of T phi-downstream promoter-less genes 11 and 12 in T7 infection of Escherichia coli.

Detection of Nucleic Acids in Complex Samples via Magnetic Microbead-assisted Catalyzed Hairpin Assembly and "DD-A" FRET.

PubMed

Fang, Hongmei; Xie, Nuli; Ou, Min; Huang, Jin; Li, Wenshan; Wang, Qing; Liu, Jianbo; Yang, Xiaohai; Wang, Kemin

2018-05-21

Nucleic acids, as one kind of significant biomarkers, have attracted tremendous attention and exhibited immense value in fundamental studies and clinical applications. In this work, we developed a fluorescent assay for detecting nucleic acids in complex samples based on magnetic microbead (MMB)-assisted catalyzed hairpin assembly (CHA) and donor donor-acceptor fluorescence resonance energy transfer ("DD-A" FRET) signaling mechanism. Three types of DNA hairpin probes were employed in this system, including Capture, H1 (double FAM-labelled probe as FRET donor) and H2 (TAMRA-labelled probe as FRET acceptor). Firstly, the Captures immobilized on MMBs bound to targets in complex samples, and the sequences in Captures that could trigger catalyzed hairpin assembly (CHA) were exposed. Then, target-enriched MMBs complexes were separated and resuspended in the reaction buffer containing H1 and H2. As a result, numerous H1-H2 duplexes were formed during CHA process, inducing an obvious FRET signal. In contrast, CHA could not be trigger and the FRET signal was weak while target was absent. With the aid of magnetic separation and "DD-A" FRET, it was demonstrated to effectively eliminate errors from background interference. Importantly, this strategy realized amplified detection in buffer, with detection limits of microRNA as low as 34 pM. Furthermore, this method was successfully applied to detect microRNA-21 in serum and cell culture media. The results showed that our method has the potential for biomedical research and clinical application.

Development of a baculovirus vector carrying a small hairpin RNA for suppression of sf-caspase-1 expression and improvement of recombinant protein production.

PubMed

Zhang, Xiaoyue; Xu, Keyan; Ou, Yanmei; Xu, Xiaodong; Chen, Hongying

2018-05-02

The Baculovirus expression vector system (BEVS) is a transient expression platform for recombinant protein production in insect cells. Baculovirus infection of insect cells will shutoff host translation and induce apoptosis and lead to the termination of protein expression. Previous reports have demonstrated the enhancement of protein yield in BEVS using stable insect cell lines expressing interference RNA to suppress the expression of caspase-1. In this study, short-hairpin RNA (shRNA) expression cassettes targeting Spodoptera frugiperda caspase-1 (Sf-caspase-1) were constructed and inserted into an Autographa californica multiple nucleopolyhedrovirus (AcMNPV) vector. Using the recombinant baculovirus vectors, we detected the suppression of Sf-caspase-1 expression and cell apoptosis. Green fluorescent protein (GFP), Discosoma sp. Red (DsRed) and firefly luciferase were then expressed as reporter proteins. The results showed that suppression of apoptosis enhanced the accumulation of exogenous proteins at 2 and 3 days post infection. After 4 days post infection, the activity of the reporter proteins remained higher in BEVS using the baculovirus carrying shRNA in comparison with the control without shRNA, but the accumulated protein levels showed no obvious difference between them, suggesting that apoptosis suppression resulted in improved protein folding rather than translation efficiency at the very late stage of baculovirus infection. The baculovirus vector developed in this study would be a useful tool for the production of active proteins suitable for structural and functional studies or pharmaceutical applications in Sf9 cells, and it also has the potential to be adapted for the improvement of protein expression in different insect cell lines that can be infected by AcMNPV.

RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells

PubMed Central

Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V

2006-01-01

Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456

Nanoparticle-mediated RNA interference of angiotensinogen decreases blood pressure and improves myocardial remodeling in spontaneously hypertensive rats.

PubMed

Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin

2015-09-01

Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.

The promises and pitfalls of RNA-interference-based therapeutics

PubMed Central

Castanotto, Daniela; Rossi, John J.

2009-01-01

The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789

RNA interference can target pre-mRNA: consequences for gene expression in a Caenorhabditis elegans operon.

PubMed Central

Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M

1999-01-01

In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456

Rp-phosphorothioate modifications in RNase P RNA that interfere with tRNA binding.

PubMed Central

Hardt, W D; Warnecke, J M; Erdmann, V A; Hartmann, R K

1995-01-01

We have used Rp-phosphorothioate modifications and a binding interference assay to analyse the role of phosphate oxygens in tRNA recognition by Escherichia coli ribonuclease P (RNase P) RNA. Total (100%) Rp-phosphorothioate modification at A, C or G positions of RNase P RNA strongly impaired tRNA binding and pre-tRNA processing, while effects were less pronounced at U positions. Partially modified E. coli RNase P RNAs were separated into tRNA binding and non-binding fractions by gel retardation. Rp-phosphorothioate modifications that interfered with tRNA binding were found 5' of nucleotides A67, G68, U69, C70, C71, G72, A130, A132, A248, A249, G300, A317, A330, A352, C353 and C354. Manganese rescue at positions U69, C70, A130 and A132 identified, for the first time, sites of direct metal ion coordination in RNase P RNA. Most sites of interference are at strongly conserved nucleotides and nine reside within a long-range base-pairing interaction present in all known RNase P RNAs. In contrast to RNase P RNA, 100% Rp-phosphorothioate substitutions in tRNA showed only moderate effects on binding to RNase P RNAs from E. coli, Bacillus subtilis and Chromatium vinosum, suggesting that pro-Rp phosphate oxygens of mature tRNA contribute relatively little to the formation of the tRNA-RNase P RNA complex. Images PMID:7540978

RNA interference: from biology to drugs and therapeutics.

PubMed

Appasani, Krishnarao

2004-07-01

RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.

Effect of small hairpin RNA targeting endothelin-converting enzyme-1 in monocrotaline-induced pulmonary hypertensive rats.

PubMed

Son, Jae Sung; Kim, Kwan Chang; Kim, Bo Kyung; Cho, Min-Sun; Hong, Young Mi

2012-12-01

The purpose of this study was to investigate the therapeutic effects of small hairpin RNA (shRNA) targeting endothelin-converting enzyme (ECE)-1 in monocrotaline (MCT)-induced pulmonary hypertensive rats. Ninty-four Sprague-Dawley rats were divided into three groups: control (n = 24), MCT (n = 35) and shRNA (n = 35). Four-week survival rate in the shRNA group was significantly increased compared to that in the MCT group. The shRNA group showed a significant improvement of right ventricular (RV) pressure compared with the MCT group. The MCT and shRNA groups also showed an increase in RV/(left ventricle + septum) ratio and lung/body weight. Plasma endothelin (ET)-1 concentrations in the shRNA group were lower than those in the MCT group. Medial wall thickness of pulmonary arterioles were increased after MCT injection and was significantly decreased in the shRNA group. The number of intra-acinar muscular pulmonary arteries was decreased in the shRNA group. The mRNA expressions of ET-1 and ET receptor A (ET(A)) were significantly decreased in the shRNA group in week 4. The protein levels of ET(A) were decreased in the shRNA group in week 2. The protein levels of tumor necrosis factor-α and vascular endothelial growth factor were decreased in the shRNA group in week 4. In conclusion, the gene silencing with lentiviral vector targeting ECE-1 could be effective against hemodynamic, histopathological and gene expression changes in pulmonary hypertension.

Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells.

PubMed

Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin

2016-07-08

Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

Phosphodiesterase 5a Inhibition with Adenoviral Short Hairpin RNA Benefits Infarcted Heart Partially through Activation of Akt Signaling Pathway and Reduction of Inflammatory Cytokines.

PubMed

Li, Longhu; Zhao, Dong; Jin, Zhe; Zhang, Jian; Paul, Christian; Wang, Yigang

2015-01-01

Treatment with short hairpin RNA (shRNA) interference therapy targeting phosphodiesterase 5a after myocardial infarction (MI) has been shown to mitigate post-MI heart failure. We investigated the mechanisms that underpin the beneficial effects of PDE5a inhibition through shRNA on post-MI heart failure. An adenoviral vector with an shRNA sequence inserted was adopted for the inhibition of phosphodiesterase 5a (Ad-shPDE5a) in vivo and in vitro. Myocardial infarction (MI) was induced in male C57BL/6J mice by left coronary artery ligation, and immediately after that, the Ad-shPDE5a was injected intramyocardially around the MI region and border areas. Four weeks post-MI, the Ad-shPDE5a-treated mice showed significant mitigation of the left ventricular (LV) dilatation and dysfunction compared to control mice. Infarction size and fibrosis were also significantly reduced in Ad-shPDE5a-treated mice. Additionally, Ad-shPDE5a treatment decreased the MI-induced inflammatory cytokines interleukin (IL)-1β, IL-6, tumor necrosis factor-α, and transforming growth factor-β1, which was confirmed in vitro in Ad-shPDE5a transfected myofibroblasts cultured under oxygen glucose deprivation. Finally, Ad-shPDE5a treatment was found to activate the myocardial Akt signaling pathway in both in vivo and in vitro experiments. These findings indicate that PDE5a inhibition by Ad-shPDE5a via the Akt signal pathway could be of significant value in the design of future therapeutics for post-MI heart failure.

Novel guanidinylated bioresponsive poly(amidoamine)s designed for short hairpin RNA delivery

PubMed Central

Yu, Jiankun; Zhang, Jinmin; Xing, Haonan; Sun, Yanping; Yang, Zhen; Yang, Tianzhi; Cai, Cuifang; Zhao, Xiaoyun; Yang, Li; Ding, Pingtian

2016-01-01

Two different disulfide (SS)-containing poly(amidoamine) (PAA) polymers were constructed using guanidino (Gua)-containing monomers (ie, arginine [Arg] and agmatine [Agm]) and N,N′-cystamine bisacrylamide (CBA) by Michael-addition polymerization. In order to characterize these two Gua-SS-PAA polymers and investigate their potentials as short hairpin RNA (shRNA)-delivery carriers, pSilencer 4.1-CMV FANCF shRNA was chosen as a model plasmid DNA to form complexes with these two polymers. The Gua-SS-PAAs and plasmid DNA complexes were determined with particle sizes less than 90 nm and positive ζ-potentials under 20 mV at nucleic acid:polymer weight ratios lower than 1:24. Bioresponsive release of plasmid DNA was observed from both newly constructed complexes. Significantly lower cytotoxicity was observed for both polymer complexes compared with polyethylenimine and Lipofectamine 2000, two widely used transfection reagents as reference carriers. Arg-CBA showed higher transfection efficiency and gene-silencing efficiency in MCF7 cells than Agm-CBA and the reference carriers. In addition, the cellular uptake of Arg-CBA in MCF7 cells was found to be higher and faster than Agm-CBA and the reference carriers. Similarly, plasmid DNA transport into the nucleus mediated by Arg-CBA was more than that by Agm-CBA and the reference carriers. The study suggested that guanidine and carboxyl introduced into Gua-SS-PAAs polymers resulted in a better nuclear localization effect, which played a key role in the observed enhancement of transfection efficiency and low cytotoxicity. Overall, two newly synthesized Gua-SS-PAAs polymers demonstrated great potential to be used as shRNA carriers for gene-therapy applications. PMID:27994462

Comparative analysis of RNAi screening technologies at genome-scale reveals an inherent processing inefficiency of the plasmid-based shRNA hairpin.

PubMed

Bhinder, Bhavneet; Shum, David; Djaballah, Hakim

2014-02-01

RNAi screening in combination with the genome-sequencing projects would constitute the Holy Grail of modern genetics; enabling discovery and validation towards a better understanding of fundamental biology leading to novel targets to combat disease. Hit discordance at inter-screen level together with the lack of reproducibility is emerging as the technology's main pitfalls. To examine some of the underlining factors leading to such discrepancies, we reasoned that perhaps there is an inherent difference in knockdown efficiency of the various RNAi technologies. For this purpose, we utilized the two most popular ones, chemically synthesized siRNA duplex and plasmid-based shRNA hairpin, in order to perform a head to head comparison. Using a previously developed gain-of-function assay probing modulators of the miRNA biogenesis pathway, we first executed on a siRNA screen against the Silencer Select V4.0 library (AMB) nominating 1,273, followed by an shRNA screen against the TRC1 library (TRC1) nominating 497 gene candidates. We observed a poor overlap of only 29 hits given that there are 15,068 overlapping genes between the two libraries; with DROSHA as the only common hit out of the seven known core miRNA biogenesis genes. Distinct genes interacting with the same biogenesis regulators were observed in both screens, with a dismal cross-network overlap of only 3 genes (DROSHA, TGFBR1, and DIS3). Taken together, our study demonstrates differential knockdown activities between the two technologies, possibly due to the inefficient intracellular processing and potential cell-type specificity determinants in generating intended targeting sequences for the plasmid-based shRNA hairpins; and suggests this observed inefficiency as potential culprit in addressing the lack of reproducibility.

Characterization of a transgenic short hairpin RNA-induced murine model of Tafazzin deficiency.

PubMed

Soustek, Meghan S; Falk, Darin J; Mah, Cathryn S; Toth, Matthew J; Schlame, Michael; Lewin, Alfred S; Byrne, Barry J

2011-07-01

Barth's syndrome (BTHS) is an X-linked mitochondrial disease that is due to a mutation in the Tafazzin (TAZ) gene. Based on sequence homology, TAZ has been characterized as an acyltransferase involved in the metabolism of cardiolipin (CL), a unique phospholipid almost exclusively located in the mitochondrial inner membrane. Yeast, Drosophila, and zebrafish models have been invaluable in elucidating the role of TAZ in BTHS, but until recently a mammalian model to study the disease has been lacking. Based on in vitro evidence of RNA-mediated TAZ depletion, an inducible short hairpin RNA (shRNA)-mediated TAZ knockdown (TAZKD) mouse model has been developed (TaconicArtemis GmbH, Cologne, Germany), and herein we describe the assessment of this mouse line as a model of BTHS. Upon induction of the TAZ-specific shRNA in vivo, transgenic mouse TAZ mRNA levels were reduced by >89% in cardiac and skeletal muscle. TAZ deficiency led to the absence of tetralineoyl-CL and accumulation of monolyso-CL in cardiac muscle. Furthermore, mitochondrial morphology from cardiac and skeletal muscle was altered. Skeletal muscle mitochondria demonstrated disrupted cristae, and cardiac mitochondria were significantly enlarged and displace neighboring myofibrils. Physiological measurements demonstrated a reduction in isometric contractile strength of the soleus and a reduction in cardiac left ventricular ejection fraction of TAZKD mice compared with control animals. Therefore, the inducible TAZ-deficient model exhibits some of the molecular and clinical characteristics of BTHS patients and may ultimately help to improve our understanding of BTHS-related cardioskeletal myopathy as well as serve as an important tool in developing therapeutic strategies for BTHS.

Prokaryotic Argonautes - variations on the RNA interference theme.

PubMed

van der Oost, John; Swarts, Daan C; Jore, Matthijs M

2014-04-15

The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.

Prokaryotic Argonautes - variations on the RNA interference theme

PubMed Central

van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.

2014-01-01

The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239

Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming.

PubMed

Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

2015-07-14

The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1-3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN).

Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming

PubMed Central

Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

2015-01-01

The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1–3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN). PMID:26172504

Symbiont-mediated RNA interference in insects

PubMed Central

Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.

2016-01-01

RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963

RNA interference-mediated intrinsic antiviral immunity in invertebrates.

PubMed

Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul

2013-01-01

In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.

[Lentiviral vector-mediated short hairpin RNA targeting survivin inhibits abdominal growth of human endometrium xenograft in nude mice].

PubMed

Peng, Dongxian; He, Yuanli

2015-02-01

To investigate the inhibitory effect of lentiviral vector-mediated short hairpin RNA targeting survivin (LV-survivin shRNA) on the growth of human endometrium xenograft in the abdominal cavity of nude mice. The endometrium xenografts from 8 women with endometriosis were injected into the peritoneal cavities of 45 nude mice. The mice were then randomly assigned to receive intraperitoneal injection of LV-survivin shRNA, pGCL-NC-GFP (negative control) or PBS (blank control). Two weeks later, the number and morphometry of endometriotic lesions were quantified and the expression of survivin protein were detected by immunohistochemistry. The formation of endometriotic lesions was significantly suppressed in mice receiving LV-survivin shRNA injection as compared with those in the two control groups (P/0.001). The mice in LV-survivin-shRNA group showed significantly down-regulated expression levels of survivin protein compared with those in the negative and blank control groups, presenting also necrosis in the endometriosis-like lesions in microscopic observation. Lentiviral vector-mediated shRNA can effectively inhibit the expression of survivin in human endometrium xengrafts and suppress the formation and growth of endometriotic lesions in the abdominal cavities of nude mice.

A Graphene-enhanced imaging of microRNA with enzyme-free signal amplification of catalyzed hairpin assembly in living cells.

PubMed

Liu, Haiyun; Tian, Tian; Ji, Dandan; Ren, Na; Ge, Shenguang; Yan, Mei; Yu, Jinghua

2016-11-15

In situ imaging of miRNA in living cells could help us to monitor the miRNA expression in real time and obtain accurate information for studying miRNA related bioprocesses and disease. Given the low-level expression of miRNA, amplification strategies for intracellular miRNA are imperative. Here, we propose an amplification strategy with a non-destructive enzyme-free manner in living cells using catalyzed hairpin assembly (CHA) based on graphene oxide (GO) for cellular miRNA imaging. The enzyme-free CHA exhibits stringent recognition and excellent signal amplification of miRNA in the living cells. GO is a good candidate as a fluorescence quencher and cellular carrier. Taking the advantages of the CHA and GO, we can monitor the miRNA at low level in living cells with a simple, sensitive and real-time manner. Finally, imaging of miRNAs in the different expression cells is realized. The novel method could supply an effective tool to visualize intracellular low-level miRNAs and help us to further understand the role of miRNAs in cellular processes. Copyright © 2016 Elsevier B.V. All rights reserved.

The role of RNA structure in the interaction of U1A protein with U1 hairpin II RNA

PubMed Central

Law, Michael J.; Rice, Andrew J.; Lin, Patti; Laird-Offringa, Ite A.

2006-01-01

The N-terminal RNA Recognition Motif (RRM1) of the spliceosomal protein U1A interacting with its target U1 hairpin II (U1hpII) has been used as a paradigm for RRM-containing proteins interacting with their RNA targets. U1A binds to U1hpII via direct interactions with a 7-nucleotide (nt) consensus binding sequence at the 5′ end of a 10-nt loop, and via hydrogen bonds with the closing C–G base pair at the top of the RNA stem. Using surface plasmon resonance (Biacore), we have examined the role of structural features of U1hpII in binding to U1A RRM1. Mutational analysis of the closing base pair suggests it plays a minor role in binding and mainly prevents “breathing” of the loop. Lengthening the stem and nontarget part of the loop suggests that the increased negative charge of the RNA might slightly aid association. However, this is offset by an increase in dissociation, which may be caused by attraction of the RRM to nontarget parts of the RNA. Studies of a single stranded target and RNAs with untethered loops indicate that structure is not very relevant for association but is important for complex stability. In particular, breaking the link between the stem and the 5′ side of the loop greatly increases complex dissociation, presumably by hindering simultaneous contacts between the RRM and stem and loop nucleotides. While binding of U1A to a single stranded target is much weaker than to U1hpII, it occurs with nanomolar affinity, supporting recent evidence that binding of unstructured RNA by U1A has physiological significance. PMID:16738410

The role of RNA structure in the interaction of U1A protein with U1 hairpin II RNA.

PubMed

Law, Michael J; Rice, Andrew J; Lin, Patti; Laird-Offringa, Ite A

2006-07-01

The N-terminal RNA Recognition Motif (RRM1) of the spliceosomal protein U1A interacting with its target U1 hairpin II (U1hpII) has been used as a paradigm for RRM-containing proteins interacting with their RNA targets. U1A binds to U1hpII via direct interactions with a 7-nucleotide (nt) consensus binding sequence at the 5' end of a 10-nt loop, and via hydrogen bonds with the closing C-G base pair at the top of the RNA stem. Using surface plasmon resonance (Biacore), we have examined the role of structural features of U1hpII in binding to U1A RRM1. Mutational analysis of the closing base pair suggests it plays a minor role in binding and mainly prevents "breathing" of the loop. Lengthening the stem and nontarget part of the loop suggests that the increased negative charge of the RNA might slightly aid association. However, this is offset by an increase in dissociation, which may be caused by attraction of the RRM to nontarget parts of the RNA. Studies of a single stranded target and RNAs with untethered loops indicate that structure is not very relevant for association but is important for complex stability. In particular, breaking the link between the stem and the 5' side of the loop greatly increases complex dissociation, presumably by hindering simultaneous contacts between the RRM and stem and loop nucleotides. While binding of U1A to a single stranded target is much weaker than to U1hpII, it occurs with nanomolar affinity, supporting recent evidence that binding of unstructured RNA by U1A has physiological significance.

Combined actions of multiple hairpin loop structures and sites of rate-limiting endonucleolytic cleavage determine differential degradation rates of individual segments within polycistronic puf operon mRNA.

PubMed Central

Klug, G; Cohen, S N

1990-01-01

Differential expression of the genes within the puf operon of Rhodobacter capsulatus is accomplished in part by differences in the rate of degradation of different segments of the puf transcript. We report here that decay of puf mRNA sequences specifying the light-harvesting I (LHI) and reaction center (RC) photosynthetic membrane peptides is initiated endoribonucleolytically within a discrete 1.4-kilobase segment of the RC-coding region. Deletion of this segment increased the half-life of the RC-coding region from 8 to 20 min while not affecting decay of LHI-coding sequences upstream from an intercistronic hairpin loop structure shown previously to impede 3'-to-5' degradation. Prolongation of RC segment half-life was dependent on the presence of other hairpin structures 3' to the RC region. Inserting the endonuclease-sensitive sites into the LHI-coding segment markedly accelerated its degradation. Our results suggest that differential degradation of the RC- and LHI-coding segments of puf mRNA is accomplished at least in part by the combined actions of RC region-specific endonuclease(s), one or more exonucleases, and several strategically located exonuclease-impeding hairpins. Images PMID:2394682

Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

PubMed

Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

2015-10-01

The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

Role of the terminator hairpin in the biogenesis of functional Hfq-binding sRNAs.

PubMed

Morita, Teppei; Nishino, Ryo; Aiba, Hiroji

2017-09-01

Rho-independent transcription terminators of the genes encoding bacterial Hfq-binding sRNAs possess a set of seven or more T residues at the 3' end, as noted in previous studies. Here, we have studied the role of the terminator hairpin in the biogenesis of sRNAs focusing on SgrS and RyhB in Escherichia coli. We constructed variant sRNA genes in which the GC-rich inverted repeat sequences are extended to stabilize the terminator hairpins. We demonstrate that the extension of the hairpin stem leads to generation of heterogeneous transcripts in which the poly(U) tail is shortened. The transcripts with shortened poly(U) tails no longer bind to Hfq and lose the ability to repress the target mRNAs. The shortened transcripts are generated in an in vitro transcription system with purified RNA polymerase, indicating that the generation of shortened transcripts is caused by premature transcription termination. We conclude that the terminator structure of sRNA genes is optimized to generate functional sRNAs. Thus, the Rho-independent terminators of sRNA genes possess two common features: a long T residue stretch that is a prerequisite for generation of functional sRNAs and a moderate strength of hairpin structure that ensures the termination at the seventh or longer position within the consecutive T stretch. The modulation of the termination position at the Rho-independent terminators is critical for biosynthesis of functional sRNAs. © 2017 Morita et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Argonaute Proteins and Mechanisms of RNA Interference in Eukaryotes and Prokaryotes.

PubMed

Olina, A V; Kulbachinskiy, A V; Aravin, A A; Esyunina, D M

2018-05-01

Noncoding RNAs play essential roles in genetic regulation in all organisms. In eukaryotic cells, many small noncoding RNAs act in complex with Argonaute proteins and regulate gene expression by recognizing complementary RNA targets. The complexes of Argonaute proteins with small RNAs also play a key role in silencing of mobile genetic elements and, in some cases, viruses. These processes are collectively called RNA interference. RNA interference is a powerful tool for specific gene silencing in both basic research and therapeutic applications. Argonaute proteins are also found in prokaryotic organisms. Recent studies have shown that prokaryotic Argonautes can also cleave their target nucleic acids, in particular DNA. This activity of prokaryotic Argonautes might potentially be used to edit eukaryotic genomes. However, the molecular mechanisms of small nucleic acid biogenesis and the functions of Argonaute proteins, in particular in bacteria and archaea, remain largely unknown. Here we briefly review available data on the RNA interference processes and Argonaute proteins in eukaryotes and prokaryotes.

Comparison of specific binding sites for Escherichia coli RNA polymerase with naturally occurring hairpin regions in single-stranded DNA of coliphage M13. [Aspergillus oryzae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niyogi, S.K.; Mitra, S.

Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.

Quantitative evaluation of first, second, and third generation hairpin systems reveals the limit of mammalian vector-based RNAi

PubMed Central

Watanabe, Colin; Cuellar, Trinna L.; Haley, Benjamin

2016-01-01

ABSTRACT Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional siRNAs into shRNA/artificial miRNA backbones, or large-scale screens to identify efficacious sequences. Thus, we used quantitative cell-based assays to compare separate third generation artificial miRNA systems, miR-E (based on miR-30a) and miR-3G (based on miR-16-2 and first described in this study) to widely-adopted, first and second generation formats in both Pol-II and Pol-III expression vector contexts. Despite their unique structures and strandedness, and in contrast to first and second-generation RNAi triggers, the third generation formats operated with remarkable similarity to one another, and strong silencing was observed with a significant fraction of the evaluated target sequences within either promoter context. By pairing an established siRNA design algorithm with the third generation vectors we could readily identify targeting sequences that matched or exceeded the potency of those discovered through large-scale sensor-based assays. We find that third generation hairpin systems enable the maximal level of siRNA function, likely through enhanced processing and accumulation of precisely-defined guide RNAs. Therefore, we predict future gains in RNAi potency will come from improved hairpin expression and identification of optimal siRNA-intrinsic silencing properties rather than further modification of these scaffolds. Consequently, third generation systems should be the primary format for vector-based RNAi studies; miR-3G is advantageous due to its small expression cassette and simplified, cost-efficient cloning scheme. PMID:26786363

Role of the terminator hairpin in the biogenesis of functional Hfq-binding sRNAs

PubMed Central

Morita, Teppei; Nishino, Ryo; Aiba, Hiroji

2017-01-01

Rho-independent transcription terminators of the genes encoding bacterial Hfq-binding sRNAs possess a set of seven or more T residues at the 3′ end, as noted in previous studies. Here, we have studied the role of the terminator hairpin in the biogenesis of sRNAs focusing on SgrS and RyhB in Escherichia coli. We constructed variant sRNA genes in which the GC-rich inverted repeat sequences are extended to stabilize the terminator hairpins. We demonstrate that the extension of the hairpin stem leads to generation of heterogeneous transcripts in which the poly(U) tail is shortened. The transcripts with shortened poly(U) tails no longer bind to Hfq and lose the ability to repress the target mRNAs. The shortened transcripts are generated in an in vitro transcription system with purified RNA polymerase, indicating that the generation of shortened transcripts is caused by premature transcription termination. We conclude that the terminator structure of sRNA genes is optimized to generate functional sRNAs. Thus, the Rho-independent terminators of sRNA genes possess two common features: a long T residue stretch that is a prerequisite for generation of functional sRNAs and a moderate strength of hairpin structure that ensures the termination at the seventh or longer position within the consecutive T stretch. The modulation of the termination position at the Rho-independent terminators is critical for biosynthesis of functional sRNAs. PMID:28606943

Silence of the transcripts: RNA interference in medicine.

PubMed

Barik, Sailen

2005-10-01

Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.

Kinetics of hairpin ribozyme cleavage in yeast.

PubMed Central

Donahue, C P; Fedor, M J

1997-01-01

Hairpin ribozymes catalyze a self-cleavage reaction that provides a simple model for quantitative analyses of intracellular mechanisms of RNA catalysis. Decay rates of chimeric mRNAs containing self-cleaving ribozymes give a direct measure of intracellular cleavage kinetics in yeast. Intracellular ribozyme-mediated cleavage occurs at similar rates and shows similar inhibition by ribozyme mutations as ribozyme-mediated reactions in vitro, but only when ribozymes are located in a favorable mRNA sequence context. The impact of cleavage on mRNA abundance is shown to depend directly on intrinsic mRNA stability. Surprisingly, cleavage products are no more labile than uncleaved mRNAs despite the loss of terminal cap structures or poly (A). PMID:9292496

Photoinduced RNA interference.

PubMed

Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi

2012-07-17

Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of

Bringing RNA Interference (RNAi) into the High School Classroom

ERIC Educational Resources Information Center

Sengupta, Sibani

2013-01-01

RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…

Respiratory viral diseases: access to RNA interference therapy

PubMed Central

Bitko, Vira; Barik, Sailen

2008-01-01

This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824

Strand antagonism in RNAi: an explanation of differences in potency between intracellularly expressed siRNA and shRNA

PubMed Central

Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin

2012-01-01

Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150

Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing

PubMed Central

Salton, Maayan; Kasprzak, Wojciech K.; Voss, Ty; Shapiro, Bruce A.; Poulikakos, Poulikos I.; Misteli, Tom

2015-01-01

Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signaling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumors. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumor formation and slows growth of vemurafenib-resistant tumors. Our results identify an intronic mutation as a molecular basis for RNA splicing-mediated RAF inhibitor resistance and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma. PMID:25971842

Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing.

PubMed

Salton, Maayan; Kasprzak, Wojciech K; Voss, Ty; Shapiro, Bruce A; Poulikakos, Poulikos I; Misteli, Tom

2015-05-14

Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signalling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumours. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small-molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumour formation and slows growth of vemurafenib-resistant tumours. Our results identify an intronic mutation as the molecular basis for a RNA splicing-mediated RAF inhibitor resistance mechanism and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma.

Domain motions of Argonaute, the catalytic engine of RNA interference

PubMed Central

Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y

2007-01-01

Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference. PMID:18053142

Domain motions of Argonaute, the catalytic engine of RNA interference.

PubMed

Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y

2007-11-30

The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes - an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.

Binding of DNA hairpins to an assembler-strand as part of a primordial translation device

NASA Astrophysics Data System (ADS)

Baumann, Ulrich

1987-09-01

A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.

Montmorillonite protection of an UV-irradiated hairpin ribozyme: evolution of the RNA world in a mineral environment

PubMed Central

Biondi, Elisa; Branciamore, Sergio; Maurel, Marie-Christine; Gallori, Enzo

2007-01-01

Background The hypothesis of an RNA-based origin of life, known as the "RNA world", is strongly affected by the hostile environmental conditions probably present in the early Earth. In particular, strong UV and X-ray radiations could have been a major obstacle to the formation and evolution of the first biomolecules. In 1951, J. D. Bernal first proposed that clay minerals could have served as the sites of accumulation and protection from degradation of the first biopolymers, providing the right physical setting for the evolution of more complex systems. Numerous subsequent experimental studies have reinforced this hypothesis. Results The ability of the possibly widespread prebiotic, clay mineral montmorillonite to protect the catalytic RNA molecule ADHR1 (Adenine Dependent Hairpin Ribozyme 1) from UV-induced damages was experimentally checked. In particular, the self-cleavage reaction of the ribozyme was evaluated after UV-irradiation of the molecule in the absence or presence of clay particles. Results obtained showed a three-fold retention of the self-cleavage activity of the montmorillonite-protected molecule, with respect to the same reaction performed by the ribozyme irradiated in the absence of the clay. Conclusion These results provide a suggestion with which RNA, or RNA-like molecules, could have overcame the problem of protection from UV irradiation in the RNA world era, and suggest that a clay-rich environment could have favoured not only the formation of first genetic molecules, but also their evolution towards increasingly complex molecular organization. PMID:17767730

Short hairpin RNA suppression of thymidylate synthase produces DNA mismatches and results in excellent radiosensitization.

PubMed

Flanagan, Sheryl A; Cooper, Kristin S; Mannava, Sudha; Nikiforov, Mikhail A; Shewach, Donna S

2012-12-01

To determine the effect of short hairpin ribonucleic acid (shRNA)-mediated suppression of thymidylate synthase (TS) on cytotoxicity and radiosensitization and the mechanism by which these events occur. shRNA suppression of TS was compared with 5-fluoro-2'-deoxyuridine (FdUrd) inactivation of TS with or without ionizing radiation in HCT116 and HT29 colon cancer cells. Cytotoxicity and radiosensitization were measured by clonogenic assay. Cell cycle effects were measured by flow cytometry. The effects of FdUrd or shRNA suppression of TS on dNTP deoxynucleotide triphosphate imbalances and consequent nucleotide misincorporations into deoxyribonucleic acid (DNA) were analyzed by high-pressure liquid chromatography and as pSP189 plasmid mutations, respectively. TS shRNA produced profound (≥ 90%) and prolonged (≥ 8 days) suppression of TS in HCT116 and HT29 cells, whereas FdUrd increased TS expression. TS shRNA also produced more specific and prolonged effects on dNTPs deoxynucleotide triphosphates compared with FdUrd. TS shRNA suppression allowed accumulation of cells in S-phase, although its effects were not as long-lasting as those of FdUrd. Both treatments resulted in phosphorylation of Chk1. TS shRNA alone was less cytotoxic than FdUrd but was equally effective as FdUrd in eliciting radiosensitization (radiation enhancement ratio: TS shRNA, 1.5-1.7; FdUrd, 1.4-1.6). TS shRNA and FdUrd produced a similar increase in the number and type of pSP189 mutations. TS shRNA produced less cytotoxicity than FdUrd but was equally effective at radiosensitizing tumor cells. Thus, the inhibitory effect of FdUrd on TS alone is sufficient to elicit radiosensitization with FdUrd, but it only partially explains FdUrd-mediated cytotoxicity and cell cycle inhibition. The increase in DNA mismatches after TS shRNA or FdUrd supports a causal and sufficient role for the depletion of dTTP thymidine triphosphate and consequent DNA mismatches underlying radiosensitization. Importantly, shRNA

Caspase-3 short hairpin RNAs: a potential therapeutic agent in neurodegeneration of aluminum-exposed animal model.

PubMed

Zhang, Qinli; Li, Na; Jiao, Xia; Qin, Xiujun; Kaur, Ramanjit; Lu, Xiaoting; Song, Jing; Wang, Linping; Wang, Junming; Niu, Qiao

2014-01-01

There is abundant evidence supporting the role of caspases in the development of neurodegenerative disease, including Alzheimer's disease (AD). Therefore, regulating the activity of caspases has been considered as a therapeutic target. However, all the efforts on AD therapy using pan-caspase inhibitors have failed because of uncontrolled adverse effects. Alternatively, the specific knockdown of caspase-3 gene through RNA interference (RNAi) could serve as a future potential therapeutic strategy. The aim of the present study is to down-regulate the expression of caspase-3 gene using lentiviral vector-mediated caspase-3 short hairpin RNA (LV-Caspase-3 shRNA). The effect of LV-Caspase-3 shRNA on apoptosis induced by aluminum (Al) was investigated in primary cultured cortical neurons and validated in C57BL/6J mice. The results indicated an increase in apoptosis and caspase-3 expression in primary cultured neurons and the cortex ofmice exposed to Al, which could be down-regulated by LV-Caspase-3 shRNA. Furthermore, LV-Caspase-3 shRNA reduced neural cell death and improved learning and memory in C57BL/6J mice treated with Al. Our results suggest that LV-caspase-3 shRNA is a potential therapeutic agent to prevent neurodegeneration and cognitive dysfunction in aluminum- exposed animal models. The findings provide a rational gene therapy strategy for AD.

CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea

PubMed Central

Marraffini, Luciano A.; Sontheimer, Erik J.

2010-01-01

Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085

Cardiovascular RNA interference therapy: the broadening tool and target spectrum.

PubMed

Poller, Wolfgang; Tank, Juliane; Skurk, Carsten; Gast, Martina

2013-08-16

Understanding of the roles of noncoding RNAs (ncRNAs) within complex organisms has fundamentally changed. It is increasingly possible to use ncRNAs as diagnostic and therapeutic tools in medicine. Regarding disease pathogenesis, it has become evident that confinement to the analysis of protein-coding regions of the human genome is insufficient because ncRNA variants have been associated with important human diseases. Thus, inclusion of noncoding genomic elements in pathogenetic studies and their consideration as therapeutic targets is warranted. We consider aspects of the evolutionary and discovery history of ncRNAs, as far as they are relevant for the identification and selection of ncRNAs with likely therapeutic potential. Novel therapeutic strategies are based on ncRNAs, and we discuss here RNA interference as a highly versatile tool for gene silencing. RNA interference-mediating RNAs are small, but only parts of a far larger spectrum encompassing ncRNAs up to many kilobasepairs in size. We discuss therapeutic options in cardiovascular medicine offered by ncRNAs and key issues to be solved before clinical translation. Convergence of multiple technical advances is highlighted as a prerequisite for the translational progress achieved in recent years. Regarding safety, we review properties of RNA therapeutics, which may immunologically distinguish them from their endogenous counterparts, all of which underwent sophisticated evolutionary adaptation to specific biological contexts. Although our understanding of the noncoding human genome is only fragmentary to date, it is already feasible to develop RNA interference against a rapidly broadening spectrum of therapeutic targets and to translate this to the clinical setting under certain restrictions.

Hepatitis B virus (HBV)-specific short hairpin RNA is capable of reducing the formation of HBV covalently closed circular (CCC) DNA but has no effect on established CCC DNA in vitro.

PubMed

Starkey, Jason L; Chiari, Estelle F; Isom, Harriet C

2009-01-01

Hepatitis B virus (HBV) covalently closed circular (CCC) DNA is the source of HBV transcripts and persistence in chronically infected patients. The novel aspect of this study was to determine the effect of RNA interference (RNAi) on HBV CCC DNA when administered prior to establishment of HBV replication or during chronic HBV infection. HBV replication was initiated in HepG2 cells by transduction with HBV baculovirus. Subculture of HBV-expressing HepG2 cells at 10 days post-transduction generates a system in which HBV replication is ongoing and HBV is expressed largely from CCC DNA, thus simulating chronic HBV infection. HepG2 cells were transduced with short hairpin RNA (shRNA)-expressing baculovirus prior to initiation of HBV replication or during chronic HBV replication, and the levels of HBV RNA, HBV surface antigens (HBsAg) and replicative intermediates (RI), extracellular (EC) and CCC DNA species were measured. HBsAg, HBV RNA and DNA levels were markedly reduced until day 8 whether cells were transduced with shRNA prior to or during a chronic infection; however, the CCC DNA species were only affected when shRNA was administered prior to initiation of infection. We conclude that RNAi may have a therapeutic value for controlling HBV replication at the level of RI and EC DNA and for reducing establishment of CCC DNA during HBV infection. Our data support previous findings demonstrating the stability of HBV CCC DNA following antiviral therapy. This study also reports the development of a novel HBV baculovirus subculture system that can be used to evaluate antiviral effects on chronic HBV replication.

Single-target RNA interference for the blockade of multiple interacting proinflammatory and profibrotic pathways in cardiac fibroblasts.

PubMed

Tank, Juliane; Lindner, Diana; Wang, Xiaomin; Stroux, Andrea; Gilke, Leona; Gast, Martina; Zietsch, Christin; Skurk, Carsten; Scheibenbogen, Carmen; Klingel, Karin; Lassner, Dirk; Kühl, Uwe; Schultheiss, Heinz-Peter; Westermann, Dirk; Poller, Wolfgang

2014-01-01

Therapeutic targets of broad relevance are likely located in pathogenic pathways common to disorders of various etiologies. Screening for targets of this type revealed CCN genes to be consistently upregulated in multiple cardiomyopathies. We developed RNA interference (RNAi) to silence CCN2 and found this single-target approach to block multiple proinflammatory and profibrotic pathways in activated primary cardiac fibroblasts (PCFBs). The RNAi-strategy was developed in murine PCFBs and then investigated in "individual" human PCFBs grown from human endomyocardial biopsies (EMBs). Screening of short hairpin RNA (shRNA) sequences for high silencing efficacy and specificity yielded RNAi adenovectors silencing CCN2 in murine or human PCFBs, respectively. Comparison of RNAi with CCN2-modulating microRNA (miR) vectors expressing miR-30c or miR-133b showed higher efficacy of RNAi. In murine PCFBs, CCN2 silencing resulted in strongly reduced expression of stretch-induced chemokines (Ccl2, Ccl7, Ccl8), matrix metalloproteinases (MMP2, MMP9), extracellular matrix (Col3a1), and a cell-to-cell contact protein (Cx43), suggesting multiple signal pathways to be linked to CCN2. Immune cell chemotaxis towards CCN2-depleted PCFBs was significantly reduced. We demonstrate here that this RNAi strategy is technically applicable to "individual" human PCFBs, too, but that these display individually strikingly different responses to CCN2 depletion. Either genomically encoded factors or stable epigenetic modification may explain different responses between individual PCFBs. The new RNAi approach addresses a key regulator protein induced in cardiomyopathies. Investigation of this and other molecular therapies in individual human PCBFs may help to dissect differential pathogenic processes between otherwise similar disease entities and individuals. Copyright © 2013 Elsevier Ltd. All rights reserved.

Short Hairpin RNA Gene Silencing of Prolyl Hydroxylase-2 with a Minicircle Vector Improves Neovascularization of Hindlimb Ischemia

PubMed Central

Lijkwan, Maarten A.; Hellingman, Alwine A.; Bos, Ernst J.; van der Bogt, Koen E.A.; Huang, Mei; Kooreman, Nigel G.; de Vries, Margreet R.; Peters, Hendrika A.B.; Robbins, Robert C.; Quax, Paul H.A.

2014-01-01

Abstract In this study, we target the hypoxia inducible factor-1 alpha (HIF-1-alpha) pathway by short hairpin RNA interference therapy targeting prolyl hydroxylase-2 (shPHD2). We use the minicircle (MC) vector technology as an alternative for conventional nonviral plasmid (PL) vectors in order to improve neovascularization after unilateral hindlimb ischemia in a murine model. Gene expression and transfection efficiency of MC and PL, both in vitro and in vivo, were assessed using bioluminescence imaging (BLI) and firefly luciferase (Luc) reporter gene. C57Bl6 mice underwent unilateral electrocoagulation of the femoral artery and gastrocnemic muscle injection with MC-shPHD2, PL-shPHD2, or phosphate-buffered saline (PBS) as control. Blood flow recovery was monitored using laser Doppler perfusion imaging, and collaterals were visualized by immunohistochemistry and angiography. MC-Luc showed a 4.6-fold higher in vitro BLI signal compared with PL-Luc. BLI signals in vivo were 4.3×105±3.3×105 (MC-Luc) versus 0.4×105±0.3×105 (PL-Luc) at day 28 (p=0.016). Compared with PL-shPHD2 or PBS, MC-shPHD2 significantly improved blood flow recovery, up to 50% from day 3 until day 14 after ischemia induction. MC-shPHD2 significantly increased collateral density and capillary density, as monitored by alpha-smooth muscle actin expression and CD31+ expression, respectively. Angiography data confirmed the histological findings. Significant downregulation of PHD2 mRNA levels by MC-shPHD2 was confirmed by quantitative polymerase chain reaction. Finally, Western blot analysis confirmed significantly higher levels of HIF-1-alpha protein by MC-shPHD2, compared with PL-shPHD2 and PBS. This study provides initial evidence of a new potential therapeutic approach for peripheral artery disease. The combination of HIF-1-alpha pathway targeting by shPHD2 with the robust nonviral MC plasmid improved postischemic neovascularization, making this approach a promising potential treatment option for

Double strand RNA-mediated RNA interference through feeding in larval gypsy moth, Lymantria dispar (Lepidoptera: Erebidae)

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...

Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

PubMed

Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

2014-02-04

TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

Intratracheal administration of p38α short-hairpin RNA plasmid ameliorates lung ischemia-reperfusion injury in rats.

PubMed

Lv, Xiangqi; Tan, Jing; Liu, Dongdong; Wu, Ping; Cui, Xiaoguang

2012-06-01

Lung ischemia-reperfusion injury (LIRI) remains a significant problem after lung transplantation. A crucial signaling enzyme involved in inflammation and apoptosis during LIRI is p38 mitogen-activated protein kinase (MAPK). Gene silencing of p38α by short hairpin RNA (shRNA) can downregulate p38α expression. The lungs have an extremely large surface area, which makes the absorption of shRNA highly effective. Therefore, we evaluated the therapeutic efficacy of p38α shRNA plasmids in a rat model of lung transplantation. The delivery of p38α shRNA plasmid was performed by intratracheal administration 48 hours before transplantation into donor rats. Control animals received scrambled shRNA plasmids. Reverse-transcription polymerase chain reaction and Western blots were used to assess gene silencing efficacy. The therapeutic effects of shRNA plasmids were evaluated by lung function tests. We determined the levels of inflammatory cytokines, the level of intercellular adhesion molecule 1 (ICAM-1), c-Myc mRNA expression, and ICAM-1 protein expression, and the presence of cell apoptosis. Rats administered p38α shRNA plasmids showed a significant downregulation in lung expression of p38α transcripts and protein levels. Compared with the control group, the p38α shRNA group showed a higher pulmonary vein oxygen level, lower wet weight-to-dry weight ratio, lower lung injury score, and lower serum levels of tumor necrosis factor-α, interleukin-6, and interleukin-8. Messenger RNA levels of ICAM-1 and c-Myc in the p38α shRNA group were dramatically lower than in the control group. Levels of ICAM-1 protein expression exhibited a similar trend. Cell apoptosis decreased in the p38α shRNA group vs the control group. Intratracheal administration of p38α shRNA plasmids provided therapeutic effects in a rat model of lung transplantation. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

The catalytic mechanism of hairpin ribozyme studied by hydrostatic pressure

PubMed Central

Tobé, Sylvia; Heams, Thomas; Vergne, Jacques; Hervé, Guy; Maurel, Marie-Christine

2005-01-01

The discovery of ribozymes strengthened the RNA world hypothesis, which assumes that these precursors of modern life both stored information and acted as catalysts. For the first time among extensive studies on ribozymes, we have investigated the influence of hydrostatic pressure on the hairpin ribozyme catalytic activity. High pressures are of interest when studying life under extreme conditions and may help to understand the behavior of macromolecules at the origins of life. Kinetic studies of the hairpin ribozyme self-cleavage were performed under high hydrostatic pressure. The activation volume of the reaction (34 ± 5 ml/mol) calculated from these experiments is of the same order of magnitude as those of common protein enzymes, and reflects an important compaction of the RNA molecule during catalysis, associated to a water release. Kinetic studies were also carried out under osmotic pressure and confirmed this interpretation and the involvement of water movements (78 ± 4 water molecules per RNA molecule). Taken together, these results are consistent with structural studies indicating that loops A and B of the ribozyme come into close contact during the formation of the transition state. While validating baro-biochemistry as an efficient tool for investigating dynamics at work during RNA catalysis, these results provide a complementary view of ribozyme catalytic mechanisms. PMID:15870387

SELEX and SHAPE reveal that sequence motifs and an extended hairpin in the 5' portion of Turnip crinkle virus satellite RNA C mediate fitness in plants.

PubMed

Bayne, Charlie F; Widawski, Max E; Gao, Feng; Masab, Mohammed H; Chattopadhyay, Maitreyi; Murawski, Allison M; Sansevere, Robert M; Lerner, Bryan D; Castillo, Rinaldys J; Griesman, Trevor; Fu, Jiantao; Hibben, Jennifer K; Garcia-Perez, Alma D; Simon, Anne E; Kushner, David B

2018-07-01

Noncoding RNAs use their sequence and/or structure to mediate function(s). The 5' portion (166 nt) of the 356-nt noncoding satellite RNA C (satC) of Turnip crinkle virus (TCV) was previously modeled to contain a central region with two stem-loops (H6 and H7) and a large connecting hairpin (H2). We now report that in vivo functional selection (SELEX) experiments assessing sequence/structure requirements in H2, H6, and H7 reveal that H6 loop sequence motifs were recovered at nonrandom rates and only some residues are proposed to base-pair with accessible complementary sequences within the 5' central region. In vitro SHAPE of SELEX winners indicates that the central region is heavily base-paired, such that along with the lower stem and H2 region, one extensive hairpin exists composing the entire 5' region. As these SELEX winners are highly fit, these characteristics facilitate satRNA amplification in association with TCV in plants. Copyright © 2018 Elsevier Inc. All rights reserved.

Automated classification of RNA 3D motifs and the RNA 3D Motif Atlas

PubMed Central

Petrov, Anton I.; Zirbel, Craig L.; Leontis, Neocles B.

2013-01-01

The analysis of atomic-resolution RNA three-dimensional (3D) structures reveals that many internal and hairpin loops are modular, recurrent, and structured by conserved non-Watson–Crick base pairs. Structurally similar loops define RNA 3D motifs that are conserved in homologous RNA molecules, but can also occur at nonhomologous sites in diverse RNAs, and which often vary in sequence. To further our understanding of RNA motif structure and sequence variability and to provide a useful resource for structure modeling and prediction, we present a new method for automated classification of internal and hairpin loop RNA 3D motifs and a new online database called the RNA 3D Motif Atlas. To classify the motif instances, a representative set of internal and hairpin loops is automatically extracted from a nonredundant list of RNA-containing PDB files. Their structures are compared geometrically, all-against-all, using the FR3D program suite. The loops are clustered into motif groups, taking into account geometric similarity and structural annotations and making allowance for a variable number of bulged bases. The automated procedure that we have implemented identifies all hairpin and internal loop motifs previously described in the literature. All motif instances and motif groups are assigned unique and stable identifiers and are made available in the RNA 3D Motif Atlas (http://rna.bgsu.edu/motifs), which is automatically updated every four weeks. The RNA 3D Motif Atlas provides an interactive user interface for exploring motif diversity and tools for programmatic data access. PMID:23970545

RNA Interference: Biology, Mechanism, and Applications

PubMed Central

Agrawal, Neema; Dasaradhi, P. V. N.; Mohmmed, Asif; Malhotra, Pawan; Bhatnagar, Raj K.; Mukherjee, Sunil K.

2003-01-01

Double-stranded RNA-mediated interference (RNAi) is a simple and rapid method of silencing gene expression in a range of organisms. The silencing of a gene is a consequence of degradation of RNA into short RNAs that activate ribonucleases to target homologous mRNA. The resulting phenotypes either are identical to those of genetic null mutants or resemble an allelic series of mutants. Specific gene silencing has been shown to be related to two ancient processes, cosuppression in plants and quelling in fungi, and has also been associated with regulatory processes such as transposon silencing, antiviral defense mechanisms, gene regulation, and chromosomal modification. Extensive genetic and biochemical analysis revealed a two-step mechanism of RNAi-induced gene silencing. The first step involves degradation of dsRNA into small interfering RNAs (siRNAs), 21 to 25 nucleotides long, by an RNase III-like activity. In the second step, the siRNAs join an RNase complex, RISC (RNA-induced silencing complex), which acts on the cognate mRNA and degrades it. Several key components such as Dicer, RNA-dependent RNA polymerase, helicases, and dsRNA endonucleases have been identified in different organisms for their roles in RNAi. Some of these components also control the development of many organisms by processing many noncoding RNAs, called micro-RNAs. The biogenesis and function of micro-RNAs resemble RNAi activities to a large extent. Recent studies indicate that in the context of RNAi, the genome also undergoes alterations in the form of DNA methylation, heterochromatin formation, and programmed DNA elimination. As a result of these changes, the silencing effect of gene functions is exercised as tightly as possible. Because of its exquisite specificity and efficiency, RNAi is being considered as an important tool not only for functional genomics, but also for gene-specific therapeutic activities that target the mRNAs of disease-related genes. PMID:14665679

Asymmetric structure of five and six membered DNA hairpin loops

NASA Technical Reports Server (NTRS)

Baumann, U.; Chang, S.

1995-01-01

The tertiary structure of nucleic acid hairpins was elucidated by means of the accessibility of the single-strand-specific nuclease from mung bean. This molecular probe has proven especially useful in determining details of the structural arrangement of the nucleotides within a loop. In this study 3'-labeling is introduced to complement previously used 5'-labeling in order to assess and to exclude possible artifacts of the method. Both labeling procedures result in mutually consistent cleavage patterns. Therefore, methodological artifacts can be excluded and the potential of the nuclease as structural probe is increased. DNA hairpins with five and six membered loops reveal an asymmetric loop structure with a sharp bend of the phosphate-ribose backbone between the second and third nucleotide on the 3'-side of a loop. These hairpin structures differ from smaller loops with 3 or 4 members, which reveal this type of bend between the first and second 3' nucleotide, and resemble with respect to the asymmetry anticodon loops of tRNA.

Hairpin DNA-Templated Silver Nanoclusters as Novel Beacons in Strand Displacement Amplification for MicroRNA Detection.

PubMed

Zhang, Jingpu; Li, Chao; Zhi, Xiao; Ramón, Gabriel Alfranca; Liu, Yanlei; Zhang, Chunlei; Pan, Fei; Cui, Daxiang

2016-01-19

MicroRNA (miRNA) biomarkers display great potential for cancer diagnosis and prognosis. The development of rapid and specific methods for miRNA detection has become a hotspot. Herein, hairpin DNA-templated silver nanoclusters (AgNCs/HpDNA) were prepared and integrated into strand-displacement amplification (SDA) as a novel beacon for miRNA detection. The light-up platform was established based on guanine (G)-rich fluorescence enhancement that essentially converted the excitation/emission pair of AgNCs/HpDNAs from a shorter wavelength to a longer wavelength, and then achieved fluorescent enhancement at longer wavelength. On the basis of the validation of the method, the single and duplex detection were conducted in two plasma biomarkers (miR-16-5p and miR-19b-3p) for the diagnosis of gastric cancer. The probe (AgNCs/RED 16(7s)C) utilized for miR-16-5p detection adopted a better conformation with high specificity to recognize single-base mismatches by producing dramatically opposite signals (increase or decrease at 580 nm ex/640 nm em) while the probe (AgNCs/GRE 19b(5s)C) for miR-19b-3p generated dual signals (increase at 490 nm ex/570 nm em and decrease at 430 nm ex/530 nm em) with bright fluorescence in one reaction during the amplification, but unexpectedly was partially digested. This is for the first time to allow the generation of enhanced fluorescent AgNCs and the target recognition integrated into a single process, which offers great opportunity for specific miRNA detection in an easy and rapid way.

cis-Acting elements important for retroviral RNA packaging specificity.

PubMed

Beasley, Benjamin E; Hu, Wei-Shau

2002-05-01

Spleen necrosis virus (SNV) proteins can package RNA from distantly related murine leukemia virus (MLV), whereas MLV proteins cannot package SNV RNA efficiently. We used this nonreciprocal recognition to investigate regions of packaging signals that influence viral RNA encapsidation specificity. Although the MLV and SNV packaging signals (Psi and E, respectively) do not contain significant sequence homology, they both contain a pair of hairpins. This hairpin pair was previously proposed to be the core element in MLV Psi. In the present study, MLV-based vectors were generated to contain chimeric SNV/MLV packaging signals in which the hairpins were replaced with the heterologous counterpart. The interactions between these chimeras and MLV or SNV proteins were examined by virus replication and RNA analyses. SNV proteins recognized all of the chimeras, indicating that these chimeras were functional. We found that replacing the hairpin pair did not drastically alter the ability of MLV proteins to package these chimeras. These results indicate that, despite the important role of the hairpin pair in RNA packaging, it is not the major motif responsible for the ability of MLV proteins to discriminate between the MLV and SNV packaging signals. To determine the role of sequences flanking the hairpins in RNA packaging specificity, vectors with swapped flanking regions were generated and evaluated. SNV proteins packaged all of these chimeras efficiently. In contrast, MLV proteins strongly favored chimeras with the MLV 5'-flanking regions. These data indicated that MLV Gag recognizes multiple elements in the viral packaging signal, including the hairpin structure and flanking regions.

Chronic Cardiac-Targeted RNA Interference for the Treatment of Heart Failure Restores Cardiac Function and Reduces Pathological Hypertrophy

PubMed Central

Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.

2009-01-01

Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664

Exploring Fusarium head blight disease control by RNA interference

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi) technology provides a novel tool to study gene function and plant protection strategies. Fusarium graminearum is the causal agent of Fusarium head blight (FHB), which reduces crop yield and quality by producing trichothecene mycotoxins including 3-acetyl deoxynivalenol (3-ADO...

RNAi-dependent and -independent antiviral phenotypes of chromosomally integrated shRNA clones: role of VASP in respiratory syncytial virus growth.

PubMed

Musiyenko, Alla; Bitko, Vira; Barik, Sailen

2007-07-01

Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.

[RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer].

PubMed

Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente

2010-01-01

RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer.

Guide-substrate base-pairing requirement for box H/ACA RNA-guided RNA pseudouridylation.

PubMed

De Zoysa, Meemanage D; Wu, Guowei; Katz, Raviv; Yu, Yi-Tao

2018-06-05

Box H/ACA RNAs are a group of small RNAs found in abundance in eukaryotes (as well as in archaea). Although their sequences differ, eukaryotic box H/ACA RNAs all share the same unique hairpin-hinge-hairpin-tail structure. Almost all of them function as guides that primarily direct pseudouridylation of rRNAs and spliceosomal snRNAs at specific sites. Although box H/ACA RNA-guided pseudouridylation has been extensively studied, the detailed rules governing this reaction, especially those concerning the guide RNA-substrate RNA base-pairing interactions that determine the specificity and efficiency of pseudouridylation, are still not exactly clear. This is particularly relevant given that the lengths of the guide sequences involved in base-pairing vary from one box H/ACA RNA to another. Here, we carry out a detailed investigation into guide-substrate base-pairing interactions, and identify the minimum number of base-pairs (8), required for RNA-guided pseudouridylation. In addition, we find that the pseudouridylation pocket, present in each hairpin of box H/ACA RNA, exhibits flexibility in fitting slightly different substrate sequences. Our results are consistent across three independent pseudouridylation pockets tested, suggesting that our findings are generally applicable to box H/ACA RNA-guided RNA pseudouridylation. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells

NASA Astrophysics Data System (ADS)

Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P.; Vishwanatha, Jamboor K.

2011-11-01

Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high (~97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.

Generation of Constructs for DNA-Directed RNA Interference of Venezuelan Equine Encephalitis Virus Genes

DTIC Science & Technology

2006-12-01

Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE I I! / DEFENSE Generation of Constructs for DNA... research into specific antiviral strategies. One such strategy is RNA interference. RNA interference involves the targeted silencing of a gene using...of an effective vaccine or therapeutic for VEE, a highly infectious virus, underscores the need for research in this area. In addition, the potential

The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

PubMed

Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

1999-10-15

Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

RNA interference-based nanosystems for inflammatory bowel disease therapy

PubMed Central

Guo, Jian; Jiang, Xiaojing; Gui, Shuangying

2016-01-01

Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943

Chemical modification: the key to clinical application of RNA interference?

PubMed Central

Corey, David R.

2007-01-01

RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019

Evaluation and control of miRNA-like off-target repression for RNA interference.

PubMed

Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook

2018-03-01

RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.

RNA interference-mediated survivin gene knockdown induces growth arrest and reduced migration of vascular smooth muscle cells.

PubMed

Nabzdyk, Christoph S; Lancero, Hope; Nguyen, Khanh P; Salek, Sherveen; Conte, Michael S

2011-11-01

Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G(2)/M fraction consistent with a mitotic defect; 4',6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G(2)/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular

RNA interference-mediated survivin gene knockdown induces growth arrest and reduced migration of vascular smooth muscle cells

PubMed Central

Nabzdyk, Christoph S.; Lancero, Hope; Nguyen, Khanh P.; Salek, Sherveen

2011-01-01

Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G2/M fraction consistent with a mitotic defect; 4′,6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G2/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular injury

Toward a General Approach for RNA-Templated Hierarchical Assembly of Split-Proteins

PubMed Central

Furman, Jennifer L.; Badran, Ahmed H.; Ajulo, Oluyomi; Porter, Jason R.; Stains, Cliff I.; Segal, David J.; Ghosh, Indraneel

2010-01-01

The ability to conditionally turn on a signal or induce a function in the presence of a user-defined RNA target has potential applications in medicine and synthetic biology. Although sequence-specific pumilio repeat proteins can target a limited set of ssRNA sequences, there are no general methods for targeting ssRNA with designed proteins. As a first step toward RNA recognition, we utilized the RNA binding domain of argonaute, implicated in RNA interference, for specifically targeting generic 2-nucleotide, 3' overhangs of any dsRNA. We tested the reassembly of a split-luciferase enzyme guided by argonaute-mediated recognition of newly generated nucleotide overhangs when ssRNA is targeted by a designed complementary guide sequence. This approach was successful when argonaute was utilized in conjunction with a pumilio repeat and expanded the scope of potential ssRNA targets. However, targeting any desired ssRNA remained elusive as two argonaute domains provided minimal reassembled split-luciferase. We next designed and tested a second hierarchical assembly, wherein ssDNA guides are appended to DNA hairpins that serve as a scaffold for high affinity zinc fingers attached to split-luciferase. In the presence of a ssRNA target containing adjacent sequences complementary to the guides, the hairpins are brought into proximity, allowing for zinc finger binding and concomitant reassembly of the fragmented luciferase. The scope of this new approach was validated by specifically targeting RNA encoding VEGF, hDM2, and HER2. These approaches provide potentially general design paradigms for the conditional reassembly of fragmented proteins in the presence of any desired ssRNA target. PMID:20681585

[RNA interference library research progress and its application in cancer research].

PubMed

Zhao, Ning; Cai, Li

2013-02-01

RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.

Accumulation of dsRNA in endosomes contributes to inefficient RNA interference in the fall armyworm, Spodoptera frugiperda.

PubMed

Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy

2017-11-01

RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effects of secondary structure on pre-mRNA splicing: hairpins sequestering the 5' but not the 3' splice site inhibit intron processing in Nicotiana plumbaginifolia.

PubMed

Liu, H X; Goodall, G J; Kole, R; Filipowicz, W

1995-01-16

We have performed a systematic study of the effect of artificial hairpins on pre-mRNA splicing in protoplasts of a dicot plant, Nicotiana plumbaginifolia. Hairpins with a potential to form 18 or 24 bp stems strongly inhibit splicing when they sequester the 5' splice site or are placed in the middle of short introns. However, similar 24 bp hairpins sequestering the 3' splice site do not prevent this site from being used as an acceptor. Utilization of the stem-located 3' site requires that the base of the stem is separated from the upstream 5' splice site by a minimum of approximately 45 nucleotides and that another 'helper' 3' splice site is present downstream of the stem. The results indicate that the spliceosome or factors associated with it may have a potential to unfold secondary structure present in the downstream portion of the intron, prior to or at the step of the 3' splice site selection. The finding that the helper 3' site is required for utilization of the stem-located acceptor confirms and extends previous observations, obtained with HeLa cell in vitro splicing systems, indicating that the 3' splice site may be recognized at least twice during spliceosome assembly.

[Lentivirus-mediated RNA interference of CD133 inhibits the proliferation of CD133(+) liver cancer stem cells and increases their cisplatin chemosensitivity].

PubMed

Lan, Xi; Wang, Yong; Cao, Shu; Zou, Dongling; Li, Fang; Li, Shaolin

2012-12-01

To study the effects of CD133 suppression by lentivirus-mediated RNA interference (RNAi) on the proliferation and chemosensitivity of CD133(+) cancer stem cells (CSCs) sorted from HepG2 cell line. CD133(+) and CD133- cells were sorted from HepG2 cell line by flow cytometry, and the expression of CD133 before and after cell sorting were detected. The stem cell property of sorted CD133(+) cells were validated by sphere-forming assay in vitro and xenograft experiments in vivo. Lentivirus-mediated short hairpin RNA (shRNA) targeting CD133 were transfected into CD133(+) cells, and CD133 mRNA and protein expressions of the transfected cells were detected by RT-PCR and Western blotting, respectively. Before and after the transfection, the proliferative ability of CD133(+) cells was evaluated by colony formation assay, and the cell growth inhibition rate and apoptosis following cisplatin exposure were detected using CCK-8 assay and flow cytometry. The sorted CD133(+) cells showed a high purity of (88.74∓3.19)%, as compared with the purity of (3.36∓1.80)% before cell sorting. CD133(+) cells showed a high tumor sphere formation ability and tumorigenesis capacity compared with CD133- cells. CD133 shRNA transfection significantly inhibited CD133 mRNA and protein expressions in CD133(+) cells (P<0.01), resulting also in a significantly lowered cell proliferative ability (P<0.01) and an increased growth inhibition rate (P<0.01) and obviously increased cell apoptosis (P<0.05) after cisplatin exposure. Lentivirus-mediated RNAi for CD133 suppression inhibits the proliferation of CD133(+) liver cancer stem cells and increases their chemosensitivity to cisplatin.

Discovering ligands for a microRNA precursor with peptoid microarrays

PubMed Central

Chirayil, Sara; Chirayil, Rachel; Luebke, Kevin J.

2009-01-01

We have screened peptoid microarrays to identify specific ligands for the RNA hairpin precursor of miR-21, a microRNA involved in cancer and heart disease. Microarrays were printed by spotting a library of 7680 N-substituted oligoglycines (peptoids) onto glass slides. Two compounds on the array specifically bind RNA having the sequence and predicted secondary structure of the miR-21 precursor hairpin and have specific affinity for the target in solution. Their binding induces a conformational change around the hairpin loop, and the most specific compound recognizes the loop sequence and a bulged uridine in the proximal duplex. Functional groups contributing affinity and specificity were identified, and by varying a critical methylpyridine group, a compound with a dissociation constant of 1.9 μM for the miR-21 precursor hairpin and a 20-fold discrimination against a closely-related hairpin was created. This work describes a systematic approach to discovery of ligands for specific pre-defined novel RNA structures. It demonstrates discovery of new ligands for an RNA for which no specific lead compounds were previously known by screening a microarray of small molecules. PMID:19561197

RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.

PubMed

Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C

2017-01-01

The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila

RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems

PubMed Central

Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther

2017-01-01

ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect

Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.

PubMed

Hernández, Armando R; Peterson, Larryn W; Kool, Eric T

2012-08-17

Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.

Molecular mechanisms influencing efficiency of RNA interference in insects.

PubMed

Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan

2018-06-21

RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

RNA Interference for improving the Outcome of Islet Transplantation

PubMed Central

Li, Feng; Mahato, Ram I

2010-01-01

Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190

Differential Contribution of RNA Interference Components in Response to Distinct Fusarium graminearum Virus Infections.

PubMed

Yu, Jisuk; Lee, Kyung-Mi; Cho, Won Kyong; Park, Ju Yeon; Kim, Kook-Hyung

2018-05-01

The mechanisms of RNA interference (RNAi) as a defense response against viruses remain unclear in many plant-pathogenic fungi. In this study, we used reverse genetics and virus-derived small RNA profiling to investigate the contributions of RNAi components to the antiviral response against Fusarium graminearum viruses 1 to 3 (FgV1, -2, and -3). Real-time reverse transcription-quantitative PCR (qRT-PCR) indicated that infection of Fusarium graminearum by FgV1, -2, or -3 differentially induces the gene expression of RNAi components in F. graminearum Transcripts of the DICER-2 and AGO-1 genes of F. graminearum ( FgDICER-2 and FgAGO-1 ) accumulated at lower levels following FgV1 infection than following FgV2 or FgV3 infection. We constructed gene disruption and overexpression mutants for each of the Argonaute and dicer genes and for two RNA-dependent RNA polymerase (RdRP) genes and generated virus-infected strains of each mutant. Interestingly, mycelial growth was significantly faster for the FgV1-infected FgAGO-1 overexpression mutant than for the FgV1-infected wild type, while neither FgV2 nor FgV3 infection altered the colony morphology of the gene deletion and overexpression mutants. FgV1 RNA accumulation was significantly decreased in the FgAGO-1 overexpression mutant. Furthermore, the levels of induction of FgAGO-1 , FgDICER-2 , and some of the FgRdRP genes caused by FgV2 and FgV3 infection were similar to those caused by hairpin RNA-induced gene silencing. Using small RNA sequencing analysis, we documented different patterns of virus-derived small interfering RNA (vsiRNA) production in strains infected with FgV1, -2, and -3. Our results suggest that the Argonaute protein encoded by FgAGO-1 is required for RNAi in F. graminearum , that FgAGO-1 induction differs in response to FgV1, -2, and -3, and that FgAGO-1 might contribute to the accumulation of vsiRNAs in FgV1-infected F. graminearum IMPORTANCE To increase our understanding of how RNAi components in Fusarium

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

PubMed Central

2010-01-01

Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical

Using RNA interference to knock down the adhesion protein TES.

PubMed

Griffith, Elen

2007-01-01

RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.

The Size of the Internal Loop in DNA Hairpins Influences Their Targeting with Partially Complementary Strands

PubMed Central

2015-01-01

Targeting of noncanonical DNA structures, such as hairpin loops, may have significant diagnostic and therapeutic potential. Oligonucleotides can be used for binding to mRNA, forming a DNA/RNA hybrid duplex that inhibits translation. This kind of modulation of gene expression is called the antisense approach. In order to determine the best strategy to target a common structural motif in mRNA, we have designed a set of stem-loop DNA molecules with sequence: d(GCGCTnGTAAT5GTTACTnGCGC), where n = 1, 3, or 5, “T5” is an end loop of five thymines. We used a combination of calorimetric and spectroscopy techniques to determine the thermodynamics for the reaction of a set of hairpins containing internal loops with their respective partially complementary strands. Our aim was to determine if internal- and end-loops are promising regions for targeting with their corresponding complementary strands. Indeed, all targeting reactions were accompanied by negative changes in free energy, indicating that reactions proceed spontaneously. Further investigation showed that these negative free energy terms result from a net balance of unfavorable entropy and favorable enthalpy contributions. In particular, unfolding of hairpins and duplexes is accompanied by positive changes in heat capacity, which may be a result of exposure of hydrophobic groups to the solvent. This study provides a new method for the targeting of mRNA in order to control gene expression. PMID:25486129

Hairpin vortices in turbulent boundary layers

NASA Astrophysics Data System (ADS)

Eitel-Amor, G.; Örlü, R.; Schlatter, P.; Flores, O.

2015-02-01

The present work presents a number of parallel and spatially developing simulations of boundary layers to address the question of whether hairpin vortices are a dominant feature of near-wall turbulence, and which role they play during transition. In the first part, the parent-offspring regeneration mechanism is investigated in parallel (temporal) simulations of a single hairpin vortex introduced in a mean shear flow corresponding to either turbulent channels or boundary layers (Reτ ≲ 590). The effect of a turbulent background superimposed on the mean flow is considered by using an eddy viscosity computed from resolved simulations. Tracking the vortical structure downstream, it is found that secondary hairpins are only created shortly after initialization, with all rotational structures decaying for later times. For hairpins in a clean (laminar) environment, the decay is relatively slow, while hairpins in weak turbulent environments (10% of νt) dissipate after a couple of eddy turnover times. In the second part, the role of hairpin vortices in laminar-turbulent transition is studied using simulations of spatial boundary layers tripped by hairpin vortices. These vortices are generated by means of specific volumetric forces representing an ejection event, creating a synthetic turbulent boundary layer initially dominated by hairpin-like vortices. These hairpins are advected towards the wake region of the boundary layer, while a sinusoidal instability of the streaks near the wall results in rapid development of a turbulent boundary layer. For Reθ > 400, the boundary layer is fully developed, with no evidence of hairpin vortices reaching into the wall region. The results from both the parallel and spatial simulations strongly suggest that the regeneration process is rather short-lived and may not sustain once a turbulent background is developed. From the transitional flow simulations, it is conjectured that the forest of hairpins reported in former direct numerical

Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro

PubMed Central

Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.

2013-01-01

Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792

In Vivo RNA Interference Screening Identifies a Leukemia-Specific Dependence on Integrin Beta 3 Signaling

PubMed Central

Miller, Peter G.; Al-Shahrour, Fatima; Hartwell, Kimberly A.; Chu, Lisa P.; Järås, Marcus; Puram, Rishi V.; Puissant, Alexandre; Callahan, Kevin P.; Ashton, John; McConkey, Marie E.; Poveromo, Luke P.; Cowley, Glenn S.; Kharas, Michael G.; Labelle, Myriam; Shterental, Sebastian; Fujisaki, Joji; Silberstein, Lev; Alexe, Gabriela; Al-Hajj, Muhammad A.; Shelton, Christopher A.; Armstrong, Scott A.; Root, David E.; Scadden, David T.; Hynes, Richard O.; Mukherjee, Siddhartha; Stegmaier, Kimberly; Jordan, Craig T.; Ebert, Benjamin L.

2013-01-01

SUMMARY We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies. In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk. In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model. Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. PMID:23770013

Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

PubMed

Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

2012-01-01

Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

RNA interference against stromal interacting molecule-1 (STIM1) ameliorates ethanol-induced hepatotoxicity.

PubMed

Cui, Ruibing; Li, Rong; Guo, Xiaolan; Jia, Xiaoqing; Yan, Ming

2018-06-01

Previously we have demonstrated that stromal interacting molecule-1 (STIM1) was involved in ethanol induced liver injury. However, the exact pathogenic mechanism of STIM1 in alcoholic liver disease (ALD) is still unknown. We constructed plasmid vectors encoding short-hairpin RNA against STIM1 to investigate its role in ALD in the rat liver cell line BRL and in Sprague-Dawley rats. The results showed that STIM1 targeted sh-RNA (Sh-STIM1) significantly ameliorated ethanol-induced BRL cells injury and liver injury in rats with 20 weeks-induced alcoholic liver disease. Inhibition of STIM1 also reduced intracellular calcium ion concentration, reactive oxygen species (ROS) production, lipid peroxidation, NF-kappa B activation and TNF-α production under ethanol exposure. STIM1 may play an important role in the pathogenesis of alcoholic liver disease. Silencing STIM1 may be effective in preventing alcoholic liver disease. Copyright © 2018 Elsevier B.V. All rights reserved.

Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases

PubMed Central

Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.

2012-01-01

Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660

Ribonucleic acid interference knockdown of interleukin 6 attenuates cold-induced hypertension.

PubMed

Crosswhite, Patrick; Sun, Zhongjie

2010-06-01

The purpose of this study was to determine the role of the proinflammatory cytokine interleukin (IL) 6 in cold-induced hypertension. Four groups of male Sprague-Dawley rats were used (6 rats per group). After blood pressure was stabilized, 3 groups received intravenous delivery of adenoassociated virus carrying IL-6 small hairpin RNA (shRNA), adenoassociated virus carrying scrambled shRNA, and PBS, respectively, before exposure to a cold environment (5 degrees C). The last group received PBS and was kept at room temperature (25 degrees C, warm) as a control. Adenoassociated virus delivery of IL-6 shRNA significantly attenuated cold-induced elevation of systolic blood pressure and kept it at the control level for < or =7 weeks (length of the study). Chronic exposure to cold upregulated IL-6 expression in aorta, heart, and kidneys and increased macrophage and T-cell infiltration in kidneys, suggesting that cold exposure increases inflammation. IL-6 shRNA delivery abolished the cold-induced upregulation of IL-6, indicating effective silence of IL-6. Interestingly, RNA interference knockdown of IL-6 prevented cold-induced inflammation, as evidenced by a complete inhibition of tumor necrosis factor-alpha expression and leukocyte infiltration by IL-6 shRNA. RNA interference knockdown of IL-6 significantly decreased the cold-induced increase in vascular superoxide production. It is noted that IL-6 shRNA abolished the cold-induced increase in collagen deposition in the heart, suggesting that inflammation is involved in cold-induced cardiac remodeling. Cold exposure caused glomerular collapses, which could be prevented by knockdown of IL-6, suggesting an important role of inflammation in cold-induced renal damage. In conclusion, cold exposure increased IL-6 expression and inflammation, which play critical roles in the pathogenesis of cold-induced hypertension and cardiac and renal damage.

Establishment of Functional Genomics Pipeline in Mouse Epiblast-Like Tissue by Combining Transcriptomic Analysis and Gene Knockdown/Knockin/Knockout, Using RNA Interference and CRISPR/Cas9.

PubMed

Takata, Nozomu; Sakakura, Eriko; Kasukawa, Takeya; Sakuma, Tetsushi; Yamamoto, Takashi; Sasai, Yoshiki

2016-06-01

The epiblast (foremost embryonic ectoderm) generates all three germ layers and therefore has crucial roles in the formation of all mammalian body cells. However, regulation of epiblast gene expression is poorly understood because of the difficulty of manipulating epiblast tissues in vivo. In the present study, using the self-organizing properties of mouse embryonic stem cell (ESC), we generated and characterized epiblast-like tissue in three-dimensional culture. We identified significant genome-wide gene expression changes in this epiblast-like tissue by transcriptomic analysis. In addition, we identified the particular significance of the Erk/Mapk and integrin-linked kinase pathways, and genes related to ectoderm/epithelial formation, using the bioinformatics resources IPA and DAVID. Here, we focused on Fgf5, which ranked in the top 10 among the discovered genes. To develop a functional analysis of Fgf5, we created an efficient method combining CRISPR/Cas9-mediated genome engineering and RNA interference (RNAi). Notably, we show one-step generation of various Fgf5 reporter lines including heterozygous and homozygous knockins (the GET method). For time- and dose-dependent depletion of fgf5 over the course of development, we generated an ESC line harboring Tol2 transposon-mediated integration of an inducible short hairpin RNA interference system (pdiRNAi). Our findings raised the possibility that Fgf/Erk signaling and apicobasal epithelial integrity are important factors in epiblast development. In addition, our methods provide a framework for a broad array of applications in the areas of mammalian genetics and molecular biology to understand development and to improve future therapeutics.

Adenovirus-mediated RNA interference against foot-and-mouth disease virus infection both in vitro and in vivo.

PubMed

Chen, Weizao; Liu, Mingqiu; Jiao, Ye; Yan, Weiyao; Wei, Xuefeng; Chen, Jiulian; Fei, Liang; Liu, Yang; Zuo, Xiaoping; Yang, Fugui; Lu, Yonggan; Zheng, Zhaoxin

2006-04-01

Foot-and-mouth disease virus (FMDV) infection is responsible for the heavy economic losses in stockbreeding each year. Because of the limited effectiveness of existing vaccines and antiviral drugs, the development of new strategies is needed. RNA interference (RNAi) is an effective means of suppressing virus replication in vitro. Here we demonstrate that treatment with recombinant, replication-defective human adenovirus type 5 (Ad5) expressing short-hairpin RNAs (shRNAs) directed against either structural protein 1D (Ad5-NT21) or polymerase 3D (Ad5-POL) of FMDV totally protects swine IBRS-2 cells from homologous FMDV infection, whereas only Ad5-POL inhibits heterologous FMDV replication. Moreover, delivery of these shRNAs significantly reduces the susceptibility of guinea pigs and swine to FMDV infection. Three of five guinea pigs inoculated with 10(6) PFU of Ad5-POL and challenged 24 h later with 50 50% infectious doses (ID50) of homologous virus were protected from the major clinical manifestation of disease: the appearance of vesicles on the feet. Two of three swine inoculated with an Ad5-NT21-Ad5-POL mixture containing 2 x 10(9) PFU each and challenged 24 h later with 100 ID50 of homologous virus were protected from the major clinical disease, but treatment with a higher dose of adenovirus mixture cannot promote protection of animals. The inhibition was rapid and specific because treatment with a control adenovirus construct (Ad5-LacZ) expressing Escherichia coli galactosidase-specific shRNA showed no marked antiviral activity. Our data highlight the in vivo potential of RNAi technology in the case of FMD.

Hydrophobization and bioconjugation for enhanced siRNA delivery and targeting

PubMed Central

De Paula, Daniel; Bentley, M. Vitória L.B.; Mahato, Ram I.

2007-01-01

RNA interference (RNAi) is an evolutionarily conserved process by which double-stranded small interfering RNA (siRNA) induces sequence-specific, post-transcriptional gene silencing. Unlike other mRNA targeting strategies, RNAi takes advantage of the physiological gene silencing machinery. The potential use of siRNA as therapeutic agents has attracted great attention as a novel approach for treating severe and chronic diseases. RNAi can be achieved by either delivery of chemically synthesized siRNAs or endogenous expression of small hairpin RNA, siRNA, and microRNA (miRNA). However, the relatively high dose of siRNA required for gene silencing limits its therapeutic applications. This review discusses several strategies to improve therapeutic efficacy as well as to abrogate off-target effects and immunostimulation caused by siRNAs. There is an in-depth discussion on various issues related to the (1) mechanisms of RNAi, (2) methods of siRNA production, (3) barriers to RNAi-based therapies, (4) biodistribution, (5) design of siRNA molecules, (6) chemical modification and bioconjugation, (7) complex formation with lipids and polymers, (8) encapsulation into lipid particles, and (9) target specificity for enhanced therapeutic effectiveness. PMID:17329355

Abasic pivot substitution harnesses target specificity of RNA interference

PubMed Central

Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook

2015-01-01

Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372

Suppression of RNA Interference by Adenovirus Virus-Associated RNA†

PubMed Central

Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran

2005-01-01

We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917

RNA interference by feeding in vitro synthesized double-stranded RNA to planarians: methodology and dynamics

PubMed Central

Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.

2013-01-01

Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014

RNAimmuno: A database of the nonspecific immunological effects of RNA interference and microRNA reagents

PubMed Central

Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J.

2012-01-01

The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies. PMID:22411954

RNAimmuno: a database of the nonspecific immunological effects of RNA interference and microRNA reagents.

PubMed

Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J

2012-05-01

The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies.

¹H, ¹³C, ¹⁵N and ³¹P chemical shift assignments of a human Xist RNA A-repeat tetraloop hairpin essential for X-chromosome inactivation.

PubMed

Duszczyk, Malgorzata M; Sattler, Michael

2012-04-01

Initiation of X-chromosome inactivation in female mammals depends on the non-coding RNA Xist. We have solved the NMR structure of a 14-nucleotide hairpin with a novel AUCG tetraloop fold from a Xist A-repeat that is essential for silencing. The (1)H, (13)C, (15)N and (31)P chemical shift assignments are reported.

Gene silencing in non-model insects: Overcoming hurdles using symbiotic bacteria for trauma-free sustainable delivery of RNA interference: Sustained RNA interference in insects mediated by symbiotic bacteria: Applications as a genetic tool and as a biocide.

PubMed

Whitten, Miranda; Dyson, Paul

2017-03-01

Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.

Cardiac gene transfer of short hairpin RNA directed against phospholamban effectively knocks down gene expression but causes cellular toxicity in canines.

PubMed

Bish, Lawrence T; Sleeper, Meg M; Reynolds, Caryn; Gazzara, Jeffrey; Withnall, Elanor; Singletary, Gretchen E; Buchlis, George; Hui, Daniel; High, Katherine A; Gao, Guangping; Wilson, James M; Sweeney, H Lee

2011-08-01

Derangements in calcium cycling have been described in failing hearts, and preclinical studies have suggested that therapies aimed at correcting this defect can lead to improvements in cardiac function and survival. One strategy to improve calcium cycling would be to inhibit phospholamban (PLB), the negative regulator of SERCA2a that is upregulated in failing hearts. The goal of this study was to evaluate the safety and efficacy of using adeno-associated virus (AAV)-mediated cardiac gene transfer of short hairpin RNA (shRNA) to knock down expression of PLB. Six dogs were treated with self-complementary AAV serotype 6 (scAAV6) expressing shRNA against PLB. Three control dogs were treated with empty AAV6 capsid, and two control dogs were treated with scAAV6 expressing dominant negative PLB. Vector was delivered via a percutaneously inserted cardiac injection catheter. PLB mRNA and protein expression were analyzed in three of six shRNA dogs between days 16 and 26. The other three shRNA dogs and five control dogs were monitored long-term to assess cardiac safety. PLB mRNA was reduced 16-fold, and PLB protein was reduced 5-fold, with treatment. Serum troponin elevation and depressed cardiac function were observed in the shRNA group only at 4 weeks. An enzyme-linked immunospot assay failed to detect any T cells reactive to AAV6 capsid in peripheral blood mononuclear cells, heart, or spleen. Microarray analysis revealed alterations in cardiac expression of several microRNAs with shRNA treatment. AAV6-mediated cardiac gene transfer of shRNA effectively knocks down PLB expression but is associated with severe cardiac toxicity. Toxicity may result from dysregulation of endogenous microRNA pathways.

Cardiac Gene Transfer of Short Hairpin RNA Directed Against Phospholamban Effectively Knocks Down Gene Expression but Causes Cellular Toxicity in Canines

PubMed Central

Sleeper, Meg M.; Reynolds, Caryn; Gazzara, Jeffrey; Withnall, Elanor; Singletary, Gretchen E.; Buchlis, George; Hui, Daniel; High, Katherine A.; Gao, Guangping; Wilson, James M.; Sweeney, H. Lee

2011-01-01

Abstract Derangements in calcium cycling have been described in failing hearts, and preclinical studies have suggested that therapies aimed at correcting this defect can lead to improvements in cardiac function and survival. One strategy to improve calcium cycling would be to inhibit phospholamban (PLB), the negative regulator of SERCA2a that is upregulated in failing hearts. The goal of this study was to evaluate the safety and efficacy of using adeno-associated virus (AAV)-mediated cardiac gene transfer of short hairpin RNA (shRNA) to knock down expression of PLB. Six dogs were treated with self-complementary AAV serotype 6 (scAAV6) expressing shRNA against PLB. Three control dogs were treated with empty AAV6 capsid, and two control dogs were treated with scAAV6 expressing dominant negative PLB. Vector was delivered via a percutaneously inserted cardiac injection catheter. PLB mRNA and protein expression were analyzed in three of six shRNA dogs between days 16 and 26. The other three shRNA dogs and five control dogs were monitored long-term to assess cardiac safety. PLB mRNA was reduced 16-fold, and PLB protein was reduced 5-fold, with treatment. Serum troponin elevation and depressed cardiac function were observed in the shRNA group only at 4 weeks. An enzyme-linked immunospot assay failed to detect any T cells reactive to AAV6 capsid in peripheral blood mononuclear cells, heart, or spleen. Microarray analysis revealed alterations in cardiac expression of several microRNAs with shRNA treatment. AAV6-mediated cardiac gene transfer of shRNA effectively knocks down PLB expression but is associated with severe cardiac toxicity. Toxicity may result from dysregulation of endogenous microRNA pathways. PMID:21542669

Knockdown of Midgut Genes by dsRNA-Transgenic Plant-Mediated RNA Interference in the Hemipteran Insect Nilaparvata lugens

PubMed Central

Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun

2011-01-01

Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219

RNA interference-based functional knockdown of the voltage-gated potassium channel Kv7.2 in dorsal root ganglion neurons after in vitro and in vivo gene transfer by adeno-associated virus vectors.

PubMed

Valdor, Markus; Wagner, Anke; Röhrs, Viola; Berg, Johanna; Fechner, Henry; Schröder, Wolfgang; Tzschentke, Thomas M; Bahrenberg, Gregor; Christoph, Thomas; Kurreck, Jens

2018-01-01

Activation of the neuronal potassium channel Kv7.2 encoded by the KCNQ2 gene has recently been shown to be an attractive mechanism to inhibit nociceptive transmission. However, potent, selective, and clinically proven activators of Kv7.2/Kv7.3 currents with analgesic properties are still lacking. An important prerequisite for the development of new drugs is a model to test the selectivity of novel agonists by abrogating Kv7.2/Kv7.3 function. Since constitutive knockout mice are not viable, we developed a model based on RNA interference-mediated silencing of KCNQ2. By delivery of a KCNQ2-specific short hairpin RNA with adeno-associated virus vectors, we completely abolished the activity of the specific Kv7.2/Kv7.3-opener ICA-27243 in rat sensory neurons. Results obtained in the silencing experiments were consistent between freshly prepared and cryopreserved dorsal root ganglion neurons, as well as in dorsal root ganglion neurons dissociated and cultured after in vivo administration of the silencing vector by intrathecal injections into rats. Interestingly, the tested associated virus serotypes substantially differed with respect to their transduction capability in cultured neuronal cell lines and primary dorsal root ganglion neurons and the in vivo transfer of transgenes by intrathecal injection of associated virus vectors. However, our study provides the proof-of-concept that RNA interference-mediated silencing of KCNQ2 is a suitable approach to create an ex vivo model for testing the specificity of novel Kv7.2/Kv7.3 agonists.

Adenoviral short hairpin RNA therapy targeting phosphodiesterase 5a relieves cardiac remodeling and dysfunction following myocardial infarction.

PubMed

Li, Longhu; Haider, Husnain Kh; Wang, Linlin; Lu, Gang; Ashraf, Muhammad

2012-05-15

We previously showed that treatment with tadalafil, a long-acting phosphodiesterase-5a (PDE5a) inhibitor, effectively prevented adverse left ventricular (LV) remodeling of the infarcted heart. We hypothesized that short-hairpin RNA (shRNA) therapy targeting PDE5a would simulate the effects of pharmacological intervention for treatment of postinfarction LV remodeling and dysfunction. Experimental model of myocardial infarction was developed in female mice by permanent ligation of left coronary artery. Immediately after that, an adenoviral vector encoding for shRNA sequence targeting PDE5a (Ad-shPDE5a) was injected intramyocardially, which specifically inhibited PDE5a in the heart. Four weeks later, Ad-shPDE5a treated mice showed significant mitigation of the left ventricle (LV) dilatation and dysfunction as indicated by smaller LV cavity and more preserved ejection fraction and fractional shortening. Infarction size and fibrosis were significantly reduced in Ad-shPDE5a-treated mice. Additionally, more salvaged cardiomyocytes, significantly reduced collagen contents, and higher blood vessel density were observed in Ad-shPDE5a-treated mice. The cytoprotective effects of Ad-shPDE5a were demonstrated in vitro in Ad-shPDE5a transfected cardiomyocytes cultured under oxygen glucose deprivation. Among downstream mediators of PDE5a signaling, cyclic GMP (cGMP) and cGMP-dependent protein kinase G (PKG) were activated with concomitant reduction in caspase-3 activity. However, no significant change in PKA and cAMP activities were observed in Ad-shPDE5a-treated hearts. Inhibition with shRNA improved cardiac remodeling and dysfunction by reducing infarction size and cardiac fibrosis and increased cGMP and PKG activity. These findings suggest that PDE5 inhibition with Ad-shPDE5a is a novel approach for treatment of myocardial infarction.

Adenoviral short hairpin RNA therapy targeting phosphodiesterase 5a relieves cardiac remodeling and dysfunction following myocardial infarction

PubMed Central

Li, Longhu; Haider, Husnain Kh.; Wang, Linlin; Lu, Gang

2012-01-01

We previously showed that treatment with tadalafil, a long-acting phosphodiesterase-5a (PDE5a) inhibitor, effectively prevented adverse left ventricular (LV) remodeling of the infarcted heart. We hypothesized that short-hairpin RNA (shRNA) therapy targeting PDE5a would simulate the effects of pharmacological intervention for treatment of postinfarction LV remodeling and dysfunction. Experimental model of myocardial infarction was developed in female mice by permanent ligation of left coronary artery. Immediately after that, an adenoviral vector encoding for shRNA sequence targeting PDE5a (Ad-shPDE5a) was injected intramyocardially, which specifically inhibited PDE5a in the heart. Four weeks later, Ad-shPDE5a treated mice showed significant mitigation of the left ventricle (LV) dilatation and dysfunction as indicated by smaller LV cavity and more preserved ejection fraction and fractional shortening. Infarction size and fibrosis were significantly reduced in Ad-shPDE5a-treated mice. Additionally, more salvaged cardiomyocytes, significantly reduced collagen contents, and higher blood vessel density were observed in Ad-shPDE5a-treated mice. The cytoprotective effects of Ad-shPDE5a were demonstrated in vitro in Ad-shPDE5a transfected cardiomyocytes cultured under oxygen glucose deprivation. Among downstream mediators of PDE5a signaling, cyclic GMP (cGMP) and cGMP-dependent protein kinase G (PKG) were activated with concomitant reduction in caspase-3 activity. However, no significant change in PKA and cAMP activities were observed in Ad-shPDE5a-treated hearts. Inhibition with shRNA improved cardiac remodeling and dysfunction by reducing infarction size and cardiac fibrosis and increased cGMP and PKG activity. These findings suggest that PDE5 inhibition with Ad-shPDE5a is a novel approach for treatment of myocardial infarction. PMID:22447941

The role of positively charged amino acids and electrostatic interactions in the complex of U1A protein and U1 hairpin II RNA

PubMed Central

Law, Michael J.; Linde, Michael E.; Chambers, Eric J.; Oubridge, Chris; Katsamba, Phinikoula S.; Nilsson, Lennart; Haworth, Ian S.; Laird-Offringa, Ite A.

2006-01-01

Previous kinetic investigations of the N-terminal RNA recognition motif (RRM) domain of spliceosomal protein U1A, interacting with its RNA target U1 hairpin II, provided experimental evidence for a ‘lure and lock’ model of binding in which electrostatic interactions first guide the RNA to the protein, and close range interactions then lock the two molecules together. To further investigate the ‘lure’ step, here we examined the electrostatic roles of two sets of positively charged amino acids in U1A that do not make hydrogen bonds to the RNA: Lys20, Lys22 and Lys23 close to the RNA-binding site, and Arg7, Lys60 and Arg70, located on ‘top’ of the RRM domain, away from the RNA. Surface plasmon resonance-based kinetic studies, supplemented with salt dependence experiments and molecular dynamics simulation, indicate that Lys20 predominantly plays a role in association, while nearby residues Lys22 and Lys23 appear to be at least as important for complex stability. In contrast, kinetic analyses of residues away from the RNA indicate that they have a minimal effect on association and stability. Thus, well-positioned positively charged residues can be important for both initial complex formation and complex maintenance, illustrating the multiple roles of electrostatic interactions in protein–RNA complexes. PMID:16407334

Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

PubMed

Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

2008-08-01

The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease

PubMed Central

Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John

2012-01-01

Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703

RNA interference: ready to silence cancer?

PubMed

Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

2006-01-01

RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

Molecular requirements for RNA-induced silencing complex assembly in the Drosophila RNA interference pathway.

PubMed

Pham, John W; Sontheimer, Erik J

2005-11-25

Complexes in the Drosophila RNA-induced silencing complex (RISC) assembly pathway can be resolved using native gel electrophoresis, revealing an initiator called R1, an intermediate called R2, and an effector called R3 (now referred to as holo-RISC). Here we show that R1 forms when the Dicer-2/R2D2 heterodimer binds short interfering RNA (siRNA) duplexes. The heterodimer alone can initiate RISC assembly, indicating that other factors are dispensable for initiation. During assembly, R2 requires Argonaute 2 to convert into holo-RISC. This requirement is reminiscent of the RISC-loading complex, which also requires Argonaute 2 for assembly into RISC. We have compared R2 to the RISC-loading complex and show that the two complexes are similar in their sensitivities to ATP and to chemical modifications on siRNA duplexes, indicating that they are likely to be identical. We have examined the requirements for RISC formation and show that the siRNA 5'-termini are repeatedly monitored during RISC assembly, first by the Dcr-2/R2D2 heterodimer and again after R2 formation, before siRNA unwinding. The 2'-position of the 5'-terminal nucleotide also affects RISC assembly, because an siRNA strand bearing a 2'-deoxyribose at this position can inhibit the cognate strand from entering holo-RISC; in contrast, the 2'-deoxyribose-modified strand has enhanced activity in the RNA interference pathway.

RNA interference for functional genomics and improvement of cotton (Gossypium species)

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...

Hairpin exact coherent states in channel flow

NASA Astrophysics Data System (ADS)

Graham, Michael; Shekar, Ashwin

2017-11-01

Questions remain over the role of hairpin vortices in fully developed turbulent flows. Studies have shown that hairpins play a role in the dynamics away from the wall but the question still persists if they play any part in (near wall) fully developed turbulent dynamics. In addition, the robustness of the hairpin vortex regeneration mechanism is still under investigation. Recent studies have shown the existence of nonlinear traveling wave solutions to the Navier-Stokes equations, also known as exact coherent states (ECS), that capture many aspects of near-wall turbulent structures. Previously discovered ECS in channel flow have a quasi-streamwise vortex structure, with no indication of hairpin formation. Here we present a family of traveling wave solutions for channel flow that displays hairpin vortices. They have a streamwise vortex-streak structure near the wall with a spatially localized hairpin head near the channel centerline, attached to and sustained by the near wall structures. This family of solutions emerges through a transcritical bifurcation from a branch of traveling wave solutions with y and z reflectional symmetry. We also look into the instabilities that lead to the development of hairpins also explore its connection to turbulent dynamics.

RNA interference targets arbovirus replication in Culicoides cells.

PubMed

Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain

2013-03-01

Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.

Nano-cone optical fiber array sensors for MiRNA profiling

NASA Astrophysics Data System (ADS)

Wang, Yunshan; Senapati, Satyajyoti; Stoddart, Paul; Howard, Scott; Chang, Hsueh-Chia

2013-09-01

Up/down regulation of microRNA panels has been correlated to cardiovascular diseases and cancer. Frequent miRNA profiling at home can hence allow early cancer diagnosis and home-use chronic disease monitoring, thus reducing both mortality rate and healthcare cost. However, lifetime of miRNAs is less than 1 hour without preservation and their concentrations range from pM to mM. Despite rapid progress in the last decade, modern nucleic acid analysis methods still do not allow personalized miRNA profiling---Real-time PCR and DNA micro-array both require elaborate miRNA preservation steps and expensive equipment and nano pore sensors cannot selectively quantify a large panel with a large dynamic range. We report a novel and low-cost optical fiber sensing platform, which has the potential to profile a panel of miRNA with simple LED light sources and detectors. The individual tips of an optical imaging fiber bundle (mm in diameter with 7000 fiber cores) were etched into cones with 10 nm radius of curvature and coated with Au. FRET (Forster Resonant Energy Transfer) hairpin oligo probes, with the loop complementary to a specific miRNA that can release the hairpin, were functionalized onto the conic tips. Exciting light in the optical fiber waveguide is optimally coupled to surface plasmonics on the gold surface, which then converges to the conic tips with two orders of magnitude enhancement in intensity. Unlike nanoparticle plasmonics, tip plasmonics can be excited over a large band width and hence the plasmonic enhanced fluorescence signal of the FRET reporter is also focused towards the tip--- and is further enhanced with the periodic resonant grid of the fiber array which gives rise to pronounced standing wave interference patterns. Multiplexing is realized by functionalizing different probes onto one fiber bundle using a photoactivation process.

Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.

PubMed

Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G

2018-05-18

Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.

RNA interference targeting the ACE gene reduced blood pressure and improved myocardial remodelling in SHRs.

PubMed

He, Junhua; Bian, Yunfei; Gao, Fen; Li, Maolian; Qiu, Ling; Wu, Weidong; Zhou, Hua; Liu, Gaizhen; Xiao, Chuanshi

2009-02-01

The purpose of the present study was to investigate the effects on blood pressure and myocardial hypertrophy in SHRs (spontaneously hypertensive rats) of RNAi (RNA interference) targeting ACE (angiotensin-converting enzyme). SHRs were treated with normal saline as vehicle controls, with Ad5-EGFP as vector controls, and with recombinant adenoviral vectors Ad5-EGFP-ACE-shRNA, carrying shRNA (small hairpin RNA) for ACE as ACE-RNAi. WKY (Wistar-Kyoto) rats were used as normotensive controls treated with normal saline. The systolic blood pressure of the caudal artery was recorded. Serum levels of ACE and AngII (angiotensin II) were determined using ELISA. ACE mRNA and protein levels were determined in aorta, myocardium, kidney and lung. On day 32 of the experiment, the heart was pathologically examined. The ratios of heart weight/body weight and left ventricular weight/body weight were calculated. The serum concentration of ACE was lower in ACE-RNAi rats (16.37+/-3.90 ng/ml) compared with vehicle controls and vector controls (48.26+/-1.50 ng/ml and 46.67+/-2.82 ng/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (14.88+/-3.15 ng/ml; P>0.05). The serum concentration of AngII was also significantly lower in ACE-RNAi rats (18.24+/-3.69 pg/ml) compared with vehicle controls and vector controls (46.21+/-5.06 pg/ml and 44.93+/-4.12 pg/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (16.06+/-3.11 pg/ml; P>0.05). The expression of ACE mRNA and ACE protein were significantly reduced in the myocardium, aorta, kidney and lung in ACE-RNAi rats compared with that in vehicle controls and in vector controls (all P<0.05). ACE-RNAi treatment resulted in a reduction in systolic blood pressure by 22+/-3 mmHg and the ACE-RNAi-induced reduction lasted for more than 14 days. In contrast, blood pressure was continuously increased in the vehicle controls as well as in the vector controls. The ratios of heart weight/body weight

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

PubMed

Parrish, S; Fire, A

2001-10-01

RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.

Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

PubMed Central

Parrish, S; Fire, A

2001-01-01

RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844

Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference

PubMed Central

Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

2015-01-01

RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667

Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.

PubMed

Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

2015-03-03

RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.

Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes.

PubMed

Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P

2016-11-15

Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5'-3' exoribonuclease XRN1/Pacman on conserved RNA structures in the 3' untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo Two reproducible small-RNA hot spots within the 3' UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3' SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. Understanding the flavivirus transmission

Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes

PubMed Central

Göertz, G. P.; Fros, J. J.; Miesen, P.; Vogels, C. B. F.; van der Bent, M. L.; Geertsema, C.; Koenraadt, C. J. M.; van Oers, M. M.

2016-01-01

ABSTRACT Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5′-3′ exoribonuclease XRN1/Pacman on conserved RNA structures in the 3′ untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo. Two reproducible small-RNA hot spots within the 3′ UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3′ SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. IMPORTANCE Understanding

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences.

PubMed

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences

PubMed Central

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992

Tilting the balance between RNA interference and replication eradicates Leishmania RNA virus 1 and mitigates the inflammatory response.

PubMed

Brettmann, Erin A; Shaik, Jahangheer S; Zangger, Haroun; Lye, Lon-Fye; Kuhlmann, F Matthew; Akopyants, Natalia S; Oschwald, Dayna M; Owens, Katherine L; Hickerson, Suzanne M; Ronet, Catherine; Fasel, Nicolas; Beverley, Stephen M

2016-10-25

Many Leishmania (Viannia) parasites harbor the double-stranded RNA virus Leishmania RNA virus 1 (LRV1), which has been associated with increased disease severity in animal models and humans and with drug treatment failures in humans. Remarkably, LRV1 survives in the presence of an active RNAi pathway, which in many organisms controls RNA viruses. We found significant levels (0.4 to 2.5%) of small RNAs derived from LRV1 in both Leishmania braziliensis and Leishmania guyanensis, mapping across both strands and with properties consistent with Dicer-mediated cleavage of the dsRNA genome. LRV1 lacks cis- or trans-acting RNAi inhibitory activities, suggesting that virus retention must be maintained by a balance between RNAi activity and LRV1 replication. To tilt this balance toward elimination, we targeted LRV1 using long-hairpin/stem-loop constructs similar to those effective against chromosomal genes. LRV1 was completely eliminated, at high efficiency, accompanied by a massive overproduction of LRV1-specific siRNAs, representing as much as 87% of the total. For both L. braziliensis and L. guyanensis, RNAi-derived LRV1-negative lines were no longer able to induce a Toll-like receptor 3-dependent hyperinflammatory cytokine response in infected macrophages. We demonstrate in vitro a role for LRV1 in virulence of L. braziliensis, the Leishmania species responsible for the vast majority of mucocutaneous leishmaniasis cases. These findings establish a targeted method for elimination of LRV1, and potentially of other Leishmania viruses, which will facilitate mechanistic dissection of the role of LRV1-mediated virulence. Moreover, our data establish a third paradigm for RNAi-viral relationships in evolution: one of balance rather than elimination.

RNA Interference in Moths: Mechanisms, Applications, and Progress

PubMed Central

Xu, Jin; Wang, Xia-Fei; Chen, Peng; Liu, Fang-Tao; Zheng, Shuai-Chao; Ye, Hui; Mo, Ming-He

2016-01-01

The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA) can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi). Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses. PMID:27775569

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

PubMed Central

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

Intergenic Transcriptional Interference Is Blocked by RNA Polymerase III Transcription Factor TFIIIB in Saccharomyces cerevisiae

PubMed Central

Korde, Asawari; Rosselot, Jessica M.; Donze, David

2014-01-01

The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746

RNA interference (RNAI) as a tool to engineer high nutritional value in chicory (Chicorium intybus).

PubMed

Asad, M

2006-01-01

The major component of chicory (Chicorium intybus) root is inulin, which is a polymer of fructose. Inulin production from chicory is hampered by the enzyme fructan 1-exohydrolase (1-FEH) that degrades inulin and limits its yield. Increased FEH activity results in massive breakdown of fructan and production of Fructose and inulo-n-oses. The latter phenomena are to be avoided for industrial fructan production. RNA silencing, which is termed post-transcriptional gene silencing (PTGS) in plants, is an RNA degradation process through sequence specific nucleotide interactions induced by double-stranded RNA. For genetic improvement of crop plants, RNAi has advantages over antisense-mediated gene silencing and co-suppression, in terms of its efficiency and stability. We are generating a transgenic chicory plants with suppressed FEH (exohydrolas) genes using RNAi resulting in supressed inulin degradation. A small but important part of the construct is a sequence unique for the target gene (exons) or genes,which were cloned. The hairpin constructs were made and chicory was transformed by Agrobacterium tumifaciense, strain (C58C1). The transgenics should be select and check by means of molecular techniques.

RNA interference in the clinic: challenges and future directions

PubMed Central

Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.

2011-01-01

Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526

Binding and cleavage of nucleic acids by the "hairpin" ribozyme.

PubMed

Chowrira, B M; Burke, J M

1991-09-03

The "hairpin" ribozyme derived from the minus strand of tobacco ringspot virus satellite RNA [(-)sTRSV] efficiently catalyzes sequence-specific RNA hydrolysis in trans (Feldstein et al., 1989; Hampel & Triz, 1989; Haseloff & Gerlach, 1989). The ribozyme does not cleave DNA. An RNA substrate analogue containing a single deoxyribonucleotide residue 5' to the cleavage site (A-1) binds to the ribozyme efficiently but cannot be cleaved. A DNA substrate analogue with a ribonucleotide at A-1 is cleaved; thus A-1 provides the only 2'-OH required for cleavage. These results support cleavage via a transphosphorylation mechanism initiated by attack of the 2'-OH of A-1 on the scissile phosphodiester. The ribozyme discriminates between DNA and RNA in both binding and cleavage. Results indicate that the 2'-OH of A-1 functions in complex stabilization as well as cleavage. The ribozyme efficiently cleaves a phosphorothioate diester linkage, suggesting that the pro-Rp oxygen at the scissile phosphodiester does not coordinate Mg2+.

Vascular smooth muscle-specific knockdown of the noncardiac form of the L-type calcium channel by microRNA-based short hairpin RNA as a potential antihypertensive therapy.

PubMed

Rhee, Sung W; Stimers, Joseph R; Wang, Wenze; Pang, Li

2009-05-01

In different rodent models of hypertension, vascular voltage-gated L-type calcium channel (Ca(L)) current and vascular tone is increased because of increased expression of the noncardiac form of the Ca(L) (Ca(v)1.2). The objective of this study was to develop a small interfering RNA (siRNA) expression system against the noncardiac form of Ca(v)1.2 to reduce its expression in vascular smooth muscle cells (VSMCs). siRNAs expressing plasmids and appropriate controls were constructed and first screened in human embryonic kidney (HEK) 293 cells cotransfected with a rat Ca(v)1.2 expression vector. The most effective gene silencing was achieved with a modified mir-30a-based short hairpin RNA (shRNAmir) driven by the cytomegalovirus promoter. In A7r5 cells, a vascular smooth muscle cell line, two copies of shRNAmir driven by a chimeric VSMC-specific enhancer/promoter reduced endogenous Ca(v)1.2 expression by 61% and decreased the Ca(L) current carried by barium by 47%. Moreover, the chimeric vascular smooth muscle-specific enhancer/promoter displayed almost no activity in non-VSMCs (PC-12 and HEK 293). Because the proposed siRNA was designed to only target the noncardiac form of Ca(v)1.2, it did not affect the Ca(L) expression and function in cultured cardiomyocytes, even when driven by a stronger cytomegalovirus promoter. In conclusion, vascular Ca(v)1.2 expression and function were effectively reduced by VSMC-specific delivery of the noncardiac form of Ca(v)1.2 siRNA without similarly affecting cardiac Ca(L) expression and function. When coupled with a viral vector, this molecular intervention in vivo may provide a novel long-term vascular-specific gene therapy for hypertension.

Vascular Smooth Muscle-Specific Knockdown of the Noncardiac Form of the L-Type Calcium Channel by MicroRNA-Based Short Hairpin RNA as a Potential Antihypertensive Therapy

PubMed Central

Rhee, Sung W.; Stimers, Joseph R.; Wang, Wenze; Pang, Li

2009-01-01

In different rodent models of hypertension, vascular voltage-gated L-type calcium channel (CaL) current and vascular tone is increased because of increased expression of the noncardiac form of the CaL (Cav1.2). The objective of this study was to develop a small interfering RNA (siRNA) expression system against the noncardiac form of Cav1.2 to reduce its expression in vascular smooth muscle cells (VSMCs). siRNAs expressing plasmids and appropriate controls were constructed and first screened in human embryonic kidney (HEK) 293 cells cotransfected with a rat Cav1.2 expression vector. The most effective gene silencing was achieved with a modified mir-30a-based short hairpin RNA (shRNAmir) driven by the cytomegalovirus promoter. In A7r5 cells, a vascular smooth muscle cell line, two copies of shRNAmir driven by a chimeric VSMC-specific enhancer/promoter reduced endogenous Cav1.2 expression by 61% and decreased the CaL current carried by barium by 47%. Moreover, the chimeric vascular smooth muscle-specific enhancer/promoter displayed almost no activity in non-VSMCs (PC-12 and HEK 293). Because the proposed siRNA was designed to only target the noncardiac form of Cav1.2, it did not affect the CaL expression and function in cultured cardiomyocytes, even when driven by a stronger cytomegalovirus promoter. In conclusion, vascular Cav1.2 expression and function were effectively reduced by VSMC-specific delivery of the noncardiac form of Cav1.2 siRNA without similarly affecting cardiac CaL expression and function. When coupled with a viral vector, this molecular intervention in vivo may provide a novel long-term vascular-specific gene therapy for hypertension. PMID:19244098

Efficacy of a Novel Class of RNA Interference Therapeutic Agents

PubMed Central

Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki

2012-01-01

RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145

RNA Interference in Insect Vectors for Plant Viruses.

PubMed

Kanakala, Surapathrudu; Ghanim, Murad

2016-12-12

Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.

RNA Interference in Insect Vectors for Plant Viruses

PubMed Central

Kanakala, Surapathrudu; Ghanim, Murad

2016-01-01

Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446

A Grammatical Approach to RNA-RNA Interaction Prediction

NASA Astrophysics Data System (ADS)

Kato, Yuki; Akutsu, Tatsuya; Seki, Hiroyuki

2007-11-01

Much attention has been paid to two interacting RNA molecules involved in post-transcriptional control of gene expression. Although there have been a few studies on RNA-RNA interaction prediction based on dynamic programming algorithm, no grammar-based approach has been proposed. The purpose of this paper is to provide a new modeling for RNA-RNA interaction based on multiple context-free grammar (MCFG). We present a polynomial time parsing algorithm for finding the most likely derivation tree for the stochastic version of MCFG, which is applicable to RNA joint secondary structure prediction including kissing hairpin loops. Also, elementary tests on RNA-RNA interaction prediction have shown that the proposed method is comparable to Alkan et al.'s method.

EGFP-EGF1-Conjugated PLGA Nanoparticles for Targeted Delivery of siRNA into Injured Brain Microvascular Endothelial Cells for Efficient RNA Interference

PubMed Central

Chen, Chen; Mei, Heng; Shi, Wei; Deng, Jun; Zhang, Bo; Guo, Tao; Wang, Huafang; Hu, Yu

2013-01-01

Injured endothelium is an important target for drug and/or gene therapy because brain microvascular endothelial cells (BMECs) play critical roles in various pathophysiological conditions. RNA-mediated gene silencing presents a new therapeutic approach for treating such diseases, but major challenge is to ensure minimal toxicity and target delivery of siRNA to injured BMECs. Injured BMECs overexpress tissue factor (TF), which the fusion protein EGFP-EGF1 could be targeted to. In this study, TNF alpha (TNF-α) was chosen as a stimulus for primary BMECs to produce injured endothelium in vitro. The EGFP-EGF1-PLGA nanoparticles (ENPs) with loaded TF-siRNA were used as a new carrier for targeted delivery to the injured BMECs. The nanoparticles then produced intracellular RNA interference against TF. We compared ENP-based transfections with NP-mediated transfections, and our studies show that the ENP-based transfections result in a more efficient downregulation of TF. Our findings also show that the TF siRNA-loaded ENPs had minimal toxicity, with almost 96% of the cells viable 24 h after transfection while Lipofectamine-based transfections resulted in only 75% of the cells. Therefore, ENP-based transfection could be used for efficient siRNA transfection to injured BMECs and for efficient RNA interference (RNAi). This transfection could serve as a potential treatment for diseases, such as stroke, atherosclerosis and cancer. PMID:23593330

Evolution of hairpin vortices in a shear flow

NASA Technical Reports Server (NTRS)

Hon, T.-L.; Walker, J. D. A.

1988-01-01

Recent experimental studies suggest that the hairpin vortex plays an important (and perhaps dominant) role in the dynamics of turbulent flows near walls. In this study a numerical procedure is developed to allow the accurate computation of the trajectory of a 3-D vortex having a small core radius. For hairpin vortices which are convected in a shear flow above a wall, the calculated results show that a 2-D vortex containing a small 3-D disturbance distorts into a complex shape with subsidiary hairpin vortices forming outboard of the original hairpin vortex. As the vortex moves above the wall, it induces unsteady motion in the viscous flow near the wall: numerical solutions suggest that the boundary-layer flow near the wall will ultimately erupt in response to the motion of the hairpin vortex and in the process a secondary hairpin vortex will be created. The computer results agree with recent experimental investigations.

Therapeutic potentials of gene silencing by RNA interference: principles, challenges, and new strategies.

PubMed

Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao

2014-04-01

During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.

Induction of RNA interference in dendritic cells.

PubMed

Li, Mu; Qian, Hua; Ichim, Thomas E; Ge, Wei-Wen; Popov, Igor A; Rycerz, Katarzyna; Neu, John; White, David; Zhong, Robert; Min, Wei-Ping

2004-01-01

Dendritic cells (DC) reside at the center of the immunological universe, possessing the ability both to stimulate and inhibit various types of responses. Tolerogenic/regulatory DC with therapeutic properties can be generated through various means of manipulations in vitro and in vivo. Here we describe several attractive strategies for manipulation of DC using the novel technique of RNA interference (RNAi). Additionally, we overview some of our data regarding yet undescribed characteristics of RNAi in DC such as specific transfection strategies, persistence of gene silencing, and multi-gene silencing. The advantages of using RNAi for DC genetic manipulation gives rise to the promise of generating tailor-made DC that can be used effectively to treat a variety of immunologically mediated diseases.

Interference of hepatitis C virus RNA replication by short interfering RNAs

NASA Astrophysics Data System (ADS)

Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.

2003-02-01

Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.

shRNA target prediction informed by comprehensive enquiry (SPICE): a supporting system for high-throughput screening of shRNA library.

PubMed

Kamatuka, Kenta; Hattori, Masahiro; Sugiyama, Tomoyasu

2016-12-01

RNA interference (RNAi) screening is extensively used in the field of reverse genetics. RNAi libraries constructed using random oligonucleotides have made this technology affordable. However, the new methodology requires exploration of the RNAi target gene information after screening because the RNAi library includes non-natural sequences that are not found in genes. Here, we developed a web-based tool to support RNAi screening. The system performs short hairpin RNA (shRNA) target prediction that is informed by comprehensive enquiry (SPICE). SPICE automates several tasks that are laborious but indispensable to evaluate the shRNAs obtained by RNAi screening. SPICE has four main functions: (i) sequence identification of shRNA in the input sequence (the sequence might be obtained by sequencing clones in the RNAi library), (ii) searching the target genes in the database, (iii) demonstrating biological information obtained from the database, and (iv) preparation of search result files that can be utilized in a local personal computer (PC). Using this system, we demonstrated that genes targeted by random oligonucleotide-derived shRNAs were not different from those targeted by organism-specific shRNA. The system facilitates RNAi screening, which requires sequence analysis after screening. The SPICE web application is available at http://www.spice.sugysun.org/.

Inhibition of HBV replication in vivo using helper-dependent adenovirus vectors to deliver antiviral RNA interference expression cassettes.

PubMed

Crowther, Carol; Mowa, Mohube B; Ely, Abdullah; Arbuthnot, Patrick B

2014-01-01

HBV is hyperendemic to southern Africa and parts of Asia, but licensed antivirals have little effect on limiting life-threatening complications of the infection. Although RNA interference (RNAi)-based gene silencing has shown therapeutic potential, difficulties with delivery of anti-HBV RNAi effectors remain an obstacle to their clinical use. To address concerns about the transient nature of transgene expression and toxicity resulting from immunostimulation by recombinant adenovirus vectors (Ads), utility of RNAi-activating anti-HBV helper-dependent (HD) Ads were assessed in this study. Following intravenous administration of 5×10(9) unmodified or pegylated HD Ad infectious particles to HBV transgenic mice, HBV viral loads and serum HBV surface antigen levels were monitored for 12 weeks. Immunostimulation of HD Ads was assessed by measuring inflammatory cytokines, hepatic function and immune response to the co-delivered LacZ reporter gene. Unmodified and pegylated HD Ads transduced 80-90% of hepatocytes and expressed short hairpin RNAs (shRNAs) were processed to generate intended HBV-targeting guides. Markers of HBV replication were decreased by approximately 95% and silencing was sustained for 8 weeks. Unmodified HD Ads induced release of proinflammatory cytokines and there was evidence of an adaptive immune response to β-galactosidase. However the HD Ad-induced innate immune response was minimal in preparations that were enriched with infectious particles. HD Ads have potential utility for delivery of therapeutic HBV-silencing sequences and alterations of these vectors to attenuate their immune responses may further improve their efficacy.

Antiviral Effects of Small Interfering RNA Simultaneously Inducing RNA Interference and Type 1 Interferon in Coxsackievirus Myocarditis

PubMed Central

Ahn, Jeonghyun; Ko, Ara; Jun, Eun Jung; Won, Minah; Kim, Yoo Kyum; Ju, Eun-Seon

2012-01-01

Antiviral therapeutics are currently unavailable for treatment of coxsackievirus B3, which can cause life-threatening myocarditis. A modified small interfering RNA (siRNA) containing 5′-triphosphate, 3p-siRNA, was shown to induce RNA interference and interferon activation. We aimed to develop a potent antiviral treatment using CVB3-specific 3p-siRNA and to understand its underlying mechanisms. Virus-specific 3p-siRNA was superior to both conventional virus-specific siRNA with an empty hydroxyl group at the 5′ end (OH-siRNA) and nonspecific 3p-siRNA in decreasing viral replication and subsequent cytotoxicity. A single administration of 3p-siRNA dramatically attenuated virus-associated pathological symptoms in mice with no signs of toxicity, and their body weights eventually reached the normal range. Myocardial inflammation and fibrosis were rare, and virus production was greatly reduced. A nonspecific 3p-siRNA showed relatively less protective effect under identical conditions, and a virus-specific OH-siRNA showed no protective effects. We confirmed that virus-specific 3p-siRNA simultaneously activated target-specific gene silencing and type I interferon signaling. We provide a clear proof of concept that coxsackievirus B3-specific 3p-siRNA has 2 distinct modes of action, which significantly enhance antiviral activities with minimal organ damage. This is the first direct demonstration of improved antiviral effects with an immunostimulatory virus-specific siRNA in coxsackievirus myocarditis, and this method could be applied to many virus-related diseases. PMID:22508300

RNA interference of tubulin genes has lethal effects in Mythimna separate.

PubMed

Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

2018-05-23

RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

The molecular variability analysis of the RNA 3 of fifteen isolates of Prunus necrotic ringspot virus sheds light on the minimal requirements for the synthesis of its subgenomic RNA.

PubMed

Aparicio, Frederic; Pallás, Vicente

2002-01-01

The nucleotide sequences of the RNA 3 of fifteen isolates of Prunus necrotic ringspot virus (PNRSV) varying in the symptomatology they cause in six different Prunus spp. were determined. Analysis of the molecular variability has allowed, in addition to study the phylogenetic relationships among them, to evaluate the minimal requirements for the synthesis of the subgenomic RNA in Ilarvirus genus and their comparison to other members of the Bromoviridae family. Computer assisted comparisons led recently to Jaspars (Virus Genes 17, 233-242, 1998) to propose that a hairpin structure in viral minus strand RNA is required for subgenomic promoter activity of viruses from at least two, and possibly all five, genera in the family of Bromoviridae. For PNRSV and Apple mosaic virus two stable hairpins were proposed whereas for the rest of Ilarviruses and the other four genera of the Bromoviridae family only one stable hairpin was predicted. Comparative analysis of this region among the fifteen PNRSV isolates characterized in this study revealed that two of them showed a 12-nt deletion that led to the disappearance of the most proximal hairpin to the initiation site. Interestingly, the only hairpin found in these two isolates is very similar in primary and secondary structure to the one previously shown in Brome mosaic virus to be required for the synthesis of the subgenomic RNA. In this hairpin, the molecular diversity was concentrated mostly at the loop whereas compensatory mutations were observed at the base of the stem strongly suggesting its functional relevance. The evolutionary implications of these observations are discussed.

RNA interference for performance enhancement and detection in doping control.

PubMed

Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario

2011-10-01

RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.

Secondary RNA structure and its role in RNA interference to silence the respiratory syncytial virus fusion protein gene.

PubMed

Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R

2009-11-01

RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.

Special Issue: Gene Therapy with Emphasis on RNA Interference

PubMed Central

Lundstrom, Kenneth

2015-01-01

Gene therapy was originally thought to cover replacement of malfunctioning genes in treatment of various diseases. Today, the field has been expanded to application of viral and non-viral vectors for delivery of recombinant proteins for the compensation of missing or insufficient proteins, anti-cancer genes and proteins for destruction of tumor cells, immunostimulatory genes and proteins for stimulation of the host defense system against viral agents and tumors. Recently, the importance of RNA interference and its application in gene therapy has become an attractive alternative for drug development. PMID:26447255

Photoregulating RNA digestion using azobenzene linked dumbbell antisense oligodeoxynucleotides.

PubMed

Wu, Li; He, Yujian; Tang, Xinjing

2015-06-17

Introduction of 4,4'-bis(hydroxymethyl)-azobenzene (azo) to dumbbell hairpin oligonucleotides at the loop position was able to reversibly control the stability of the whole hairpin structure via UV or visible light irradiation. Here, we designed and synthesized a series of azobenzene linked dumbbell antisense oligodeoxynucleotides (asODNs) containing two terminal hairpins that are composed of an asODN and a short inhibitory sense strand. Thermal melting studies of these azobenzene linked dumbbell asODNs indicated that efficient trans to cis photoisomerization of azobenzene moieties induced large difference in thermal stability (ΔTm = 12.1-21.3 °C). In addition, photomodulation of their RNA binding abilities and RNA digestion by RNase H was investigated. The trans-azobenzene linked asODNs with the optimized base pairs between asODN strands and inhibitory sense strands could only bind few percentage of the target RNA, while it was able to recover their binding to the target RNA and degrade it by RNase H after light irradiation. Upon optimization, it is promising to use these azobenzene linked asODNs for reversible spatial and temporal regulation of antisense activities based on both steric binding and RNA digestion by RNase H.

Hairpin ribozyme cleavage catalyzed by aminoglycoside antibiotics and the polyamine spermine in the absence of metal ions.

PubMed Central

Earnshaw, D J; Gait, M J

1998-01-01

The hairpin ribozyme is a small catalytic RNA that achieves an active configuration by docking of its two helical domains in an antiparallel fashion. Both docking and subsequent cleavage are dependent on the presence of divalent metal ions, such as magnesium, but there is no evidence to date for direct participation of such ions in the chemical cleavage step. We show that aminoglycoside antibiotics inhibit cleavage of the hairpin ribozyme in the presence of metal ions with the most effective being 5-epi-sisomicin and neomycin B. In contrast, in the absence of metal ions, a number of aminoglycoside antibiotics at 10 mM concentration promote hairpin cleavage with rates only 13-20-fold lower than the magnesium-dependent reaction. We show that neomycin B competes with metal ions by ion replacement with the postively charged amino groups of the antibiotic. In addition, we show that the polyamine spermine at 10 mM promotes efficient hairpin cleavage with rates similar to the magnesium-dependent reaction. Low concentrations of either spermine or the shorter polyamine spermidine synergize with 5 mM magnesium ions to boost cleavage rates considerably. In contrast, at 500 microM magnesium ions, 4 mM spermine, but not spermidine, boosts the cleavage rate. The results have significance both in understanding the role of ions in hairpin ribozyme cleavage and in potential therapeutic applications in mammalian cells. PMID:9837982

Predicting RNA pseudoknot folding thermodynamics

PubMed Central

Cao, Song; Chen, Shi-Jie

2006-01-01

Based on the experimentally determined atomic coordinates for RNA helices and the self-avoiding walks of the P (phosphate) and C4 (carbon) atoms in the diamond lattice for the polynucleotide loop conformations, we derive a set of conformational entropy parameters for RNA pseudoknots. Based on the entropy parameters, we develop a folding thermodynamics model that enables us to compute the sequence-specific RNA pseudoknot folding free energy landscape and thermodynamics. The model is validated through extensive experimental tests both for the native structures and for the folding thermodynamics. The model predicts strong sequence-dependent helix-loop competitions in the pseudoknot stability and the resultant conformational switches between different hairpin and pseudoknot structures. For instance, for the pseudoknot domain of human telomerase RNA, a native-like and a misfolded hairpin intermediates are found to coexist on the (equilibrium) folding pathways, and the interplay between the stabilities of these intermediates causes the conformational switch that may underlie a human telomerase disease. PMID:16709732

On the structural features of hairpin triloops in rRNA: from nucleotide to global conformational change upon ligand binding.

PubMed

Mitrasinovic, Petar M

2006-03-01

RNA structure can be viewed as both a construct composed of various structural motifs and a flexible polymer that is substantially influenced by its environment. In this light, the present paper represents an attempt to reconcile the two standpoints. By using the 3D structures both of four (16S and 23S) portions of unbound 50S, H50S, and T30S ribosomal subunits and of 38 large ribonucleoligand complexes as the starting point, the behavior, which is induced by ligand binding, of 73 hairpin triloops with closing g-c and c-g base pairs was investigated using root-mean-square deviation (RMSD) approach and pseudotorsional (eta,theta) convention at the nucleotide-by-nucleotide level. Triloops were annotated in accordance with a recent proposal of geometric nomenclature. A simple measure for the determination of the strain of a triloop is introduced. It is believed that a possible classification of the interior triloops, based on the 2D eta-theta unique path, will aid to conceive their local behavior upon ligand binding. All rRNA residues in contact with ligands as well as regions of considerable conformational changes upon complex formation were identified. The analysis offers the answer to: how proximal to and how far from the actual ligand-binding sites the structural changes occur?

Scavenger receptor mediates systemic RNA interference in ticks.

PubMed

Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Galay, Remil Linggatong; Tanaka, Tetsuya; Fujisaki, Kozo

2011-01-01

RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks.

Scavenger Receptor Mediates Systemic RNA Interference in Ticks

PubMed Central

Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Linggatong Galay, Remil; Tanaka, Tetsuya; Fujisaki, Kozo

2011-01-01

RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks. PMID:22145043

How hairpin vortices emerge from exact invariant solutions

NASA Astrophysics Data System (ADS)

Schneider, Tobias M.; Farano, Mirko; de Palma, Pietro; Robinet, Jean-Christoph; Cherubini, Stefania

2017-11-01

Hairpin vortices are among the most commonly observed flow structures in wall-bounded shear flows. However, within the dynamical system approach to turbulence, those structures have not yet been described. They are not captured by known exact invariant solutions of the Navier-Stokes equations nor have other state-space structures supporting hairpins been identified. We show that hairpin structures are observed along an optimally growing trajectory leaving a well known exact traveling wave solution of plane Poiseuille flow. The perturbation triggering hairpins does not correspond to an unstable mode of the exact traveling wave but lies in the stable manifold where non-normality causes strong transient amplification.

Ebolavirus proteins suppress the effects of small interfering RNA by direct interaction with the mammalian RNA interference pathway.

PubMed

Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J

2011-03-01

Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.

Ultrafast Unzipping of a Beta-Hairpin Peptide

NASA Astrophysics Data System (ADS)

Zinth, W.; Schrader, T. E.; Schreier, W. J.; Koller, F. O.; Cordes, T.; Babitzki, G.; Denschlag, R.; Tavan, P.; Löweneck, M.; Dong, Shou-Liang; Moroder, L.; Renner, C.

Light induced switching of a beta-hairpin structure is investigated by femtosecond IR spectroscopy. While the unzipping process comprises ultrafast kinetics and is finished within 1 ns, the folding into the hairpin structure is a much slower process.

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

PubMed Central

Tomoyasu, Yoshinori

2014-01-01

The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485

Direct Spectroscopic Study of Reconstituted Transcription Complexes Reveals That Intrinsic Termination Is Driven Primarily by Thermodynamic Destabilization of the Nucleic Acid Framework*S

PubMed Central

Datta, Kausiki; von Hippel, Peter H.

2008-01-01

Changes in near UV circular dichroism (CD) and fluorescence spectra of site-specifically placed pairs of 2-aminopurine residues have been used to probe the roles of the RNA hairpin and the RNA-DNA hybrid in controlling intrinsic termination of transcription. Functional transcription complexes were assembled directly by mixing preformed nucleic acid scaffolds of defined sequence with T7 RNA polymerase (RNAP). Scaffolds containing RNA hairpins immediately upstream of a GC-rich hybrid formed complexes of reduced stability, whereas the same hairpins adjacent to a hybrid of rU-dA base pairs triggered complex dissociation and transcript release. 2-Aminopurine probes at the upstream ends of the hairpin stems show that the hairpins open on RNAP binding and that stem re-formation begins after one or two RNA bases on the downstream side of the stem have emerged from the RNAP exit tunnel. Hairpins directly adjacent to the RNA-DNA hybrid weaken RNAP binding, decrease elongation efficiency, and disrupt the upstream end of the hybrid as well as interfere with the movement of the template base at the RNAP active site. Probing the edges of the DNA transcription bubble demonstrates that termination hairpins prevent translocation of the RNAP, suggesting that they transiently “lock” the polymerase to the nucleic acid scaffold and, thus, hold the RNA-DNA hybrid “in frame.” At intrinsic terminators the weak rU-dA hybrid and the adjacent termination hairpin combine to destabilize the elongation complex sufficiently to permit significant transcript release, whereas hairpin-dependent pausing provides time for the process to go to completion. PMID:18070878

Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

PubMed

Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

2015-01-01

In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior

Altered stoichiometry Escherichia coli Cascade complexes with shortened CRISPR RNA spacers are capable of interference and primed adaptation

DOE PAGES

Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...

2016-10-13

The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less

Altered stoichiometry Escherichia coli Cascade complexes with shortened CRISPR RNA spacers are capable of interference and primed adaptation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia

The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less

Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells

DTIC Science & Technology

2005-07-01

pl of RNase/DNase free water and performed PCR amplification in 50pl reaction volumes using Invitrogen’s Platinum® Pfx DNA Polymerase . To obtain a...destroyed1’ 2. This pathway, known as RNA interference (RNAi), has been exploited in organisms ranging from plants to fungi to animals for...experimentally alter its targeting capability. Indeed such strategies have previously succeeded in both plants and animals23󈧜. My initial studies

How short RNAs impact the human ribonuclease Dicer activity: putative regulatory feedback-loops and other RNA-mediated mechanisms controlling microRNA processing.

PubMed

Koralewska, Natalia; Hoffmann, Weronika; Pokornowska, Maria; Milewski, Marek; Lipinska, Andrea; Bienkowska-Szewczyk, Krystyna; Figlerowicz, Marek; Kurzynska-Kokorniak, Anna

2016-01-01

Ribonuclease Dicer plays a pivotal role in RNA interference pathways by processing long double-stranded RNAs and single-stranded hairpin RNA precursors into small interfering RNAs (siRNAs) and microRNAs (miRNAs), respectively. While details of Dicer regulation by a variety of proteins are being elucidated, less is known about non-protein factors, e.g. RNA molecules, that may influence this enzyme's activity. Therefore, we decided to investigate the question of whether the RNA molecules can function not only as Dicer substrates but also as its regulators. Our previous in vitro studies indicated that the activity of human Dicer can be influenced by short RNA molecules that either bind to Dicer or interact with its substrates, or both. Those studies were carried out with commercial Dicer preparations. Nevertheless, such preparations are usually not homogeneous enough to carry out more detailed RNA-binding studies. Therefore, we have established our own system for the production of human Dicer in insect cells. In this manuscript, we characterize the RNA-binding and RNA-cleavage properties of the obtained preparation. We demonstrate that Dicer can efficiently bind single-stranded RNAs that are longer than ~20-nucleotides. Consequently, we revisit possible scenarios of Dicer regulation by single-stranded RNA species ranging from ~10- to ~60-nucleotides, in the context of their binding to this enzyme. Finally, we show that siRNA/miRNA-sized RNAs may affect miRNA production either by binding to Dicer or by participating in regulatory feedback-loops. Altogether, our studies suggest a broad regulatory role of short RNAs in Dicer functioning.

Single molecule RNA folding studied with optical trapping

NASA Astrophysics Data System (ADS)

Vieregg, Jeffrey Robert

The RNA folding problem (predicting the equilibrium structure and folding pathway of an RNA molecule from its sequence) is one of the classic problems of biophysics. Recent discoveries of many new functions for RNA have increased its importance, and new instrumental techniques have provided new ways to characterize molecular behavior. In particular, optical trapping (optical tweezers) allows controlled mechanical force to be applied to single RNA molecules while their end-to-end extension is monitored in real time. This enables characterization of RNA folding dynamics at a level unreachable by traditional bulk methods. Furthermore, recent advances in statistical mechanics make it possible to recover equilibrium quantities such as free energy from reactions which occur away from equilibrium. This dissertation describes the application of optical trapping and non-equilibrium statistical mechanics to quantitatively characterize folding of RNA secondary structures. By measuring the folding free energy of several specially designed hairpins in solutions containing various amounts of sodium and potassium, we were able to determine that RNA secondary structure thermodynamics depends not only on monovalent cation concentration but also surprisingly, on species. We also investigated the temperature dependence of hairpin folding thermodynamics and kinetics, which provided a direct measurement of enthalpy and entropy for RNA folding at physiological temperatures. We found that the folding pathway was quite sensitive to both salt and temperature, as measured by the folding success rate of a biologically important hairpin from the HIV-1 viral genome. Finally, I discuss modeling of force-induced RNA folding and unfolding, as well as a series of efforts which have dramatically improved the performance of our optical trapping instrument.

How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference

ERIC Educational Resources Information Center

Kuldell, Natalie H.

2006-01-01

It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…

Bleomycin Can Cleave an Oncogenic Noncoding RNA.

PubMed

Angelbello, Alicia J; Disney, Matthew D

2018-01-04

Noncoding RNAs are pervasive in cells and contribute to diseases such as cancer. A question in biomedical research is whether noncoding RNAs are targets of medicines. Bleomycin is a natural product that cleaves DNA; however, it is known to cleave RNA in vitro. Herein, an in-depth analysis of the RNA cleavage preferences of bleomycin A5 is presented. Bleomycin A5 prefers to cleave RNAs with stretches of AU base pairs. Based on these preferences and bioinformatic analysis, the microRNA-10b hairpin precursor was identified as a potential substrate for bleomycin A5. Both in vitro and cellular experiments demonstrated cleavage. Importantly, chemical cleavage by bleomycin A5 in the microRNA-10b hairpin precursors occurred near the Drosha and Dicer enzymatic processing sites and led to destruction of the microRNA. Evidently, oncogenic noncoding RNAs can be considered targets of cancer medicines and might elicit their pharmacological effects by targeting noncoding RNA. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

On hairpin vortices as model of wall turbulence structure

NASA Technical Reports Server (NTRS)

Liu, N.-S.; Shamroth, S. J.; Mcdonald, H.

1985-01-01

A model of the hairpin vortex has been constructed and used in two distinct but related approaches. The first approach is kinematic in nature in which a synthesis procedure using hairpin vortices to provide a quantitative link between mean flow quantities and the statistical quantities of near wall turbulence has become developed. The second approach is dynamic in nature, and the evolution of an incipient 'representative' hairpin vortex as well as the distortion of a background laminar boundary layer flow, in which the hairpin vortex is immersed, has been simulated by numerical solution of the unsteady, three-dimensional Navier-Stokes equations.

RNA interference: learning gene knock-down from cell physiology

PubMed Central

Mocellin, Simone; Provenzano, Maurizio

2004-01-01

Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

Design and application of cotranscriptional non-enzymatic RNA circuits and signal transducers

PubMed Central

Bhadra, Sanchita; Ellington, Andrew D.

2014-01-01

Nucleic acid circuits are finding increasing real-life applications in diagnostics and synthetic biology. Although DNA has been the main operator in most nucleic acid circuits, transcriptionally produced RNA circuits could provide powerful alternatives for reagent production and their use in cells. Towards these goals, we have implemented a particular nucleic acid circuit, catalytic hairpin assembly, using RNA for both information storage and processing. Our results demonstrated that the design principles developed for DNA circuits could be readily translated to engineering RNA circuits that operated with similar kinetics and sensitivities of detection. Not only could purified RNA hairpins perform amplification reactions but RNA hairpins transcribed in vitro also mediated amplification, even without purification. Moreover, we could read the results of the non-enzymatic amplification reactions using a fluorescent RNA aptamer ‘Spinach’ that was engineered to undergo sequence-specific conformational changes. These advances were applied to the end-point and real-time detection of the isothermal strand displacement amplification reaction that produces single-stranded DNAs as part of its amplification cycle. We were also able to readily engineer gate structures with RNA similar to those that have previously formed the basis of DNA circuit computations. Taken together, these results validate an entirely new chemistry for the implementation of nucleic acid circuits. PMID:24493736

The hairpin resonator: A plasma density measuring technique revisited

NASA Astrophysics Data System (ADS)

Piejak, R. B.; Godyak, V. A.; Garner, R.; Alexandrovich, B. M.; Sternberg, N.

2004-04-01

A microwave resonator probe is a resonant structure from which the relative permittivity of the surrounding medium can be determined. Two types of microwave resonator probes (referred to here as hairpin probes) have been designed and built to determine the electron density in a low-pressure gas discharge. One type, a transmission probe, is a functional equivalent of the original microwave resonator probe introduced by R. L. Stenzel [Rev. Sci. Instrum. 47, 603 (1976)], modified to increase coupling to the hairpin structure and to minimize plasma perturbation. The second type, a reflection probe, differs from the transmission probe in that it requires only one coaxial feeder cable. A sheath correction, based on the fluid equations for collisionless ions in a cylindrical electron-free sheath, is presented here to account for the sheath that naturally forms about the hairpin structure immersed in plasma. The sheath correction extends the range of electron density that can be accurately measured with a particular wire separation of the hairpin structure. Experimental measurements using the hairpin probe appear to be highly reproducible. Comparisons with Langmuir probes show that the Langmuir probe determines an electron density that is 20-30% lower than the hairpin. Further comparisons, with both an interferometer and a Langmuir probe, show hairpin measurements to be in good agreement with the interferometer while Langmuir probe measurements again result in a lower electron density.

RNA interference-based resistance in transgenic tomato plants against Tomato yellow leaf curl virus-Oman (TYLCV-OM) and its associated betasatellite.

PubMed

Ammara, Um e; Mansoor, Shahid; Saeed, Muhammad; Amin, Imran; Briddon, Rob W; Al-Sadi, Abdullah Mohammed

2015-03-04

Tomato yellow leaf curl virus (TYLCV), a monopartite begomovirus (family Geminiviridae) is responsible for heavy yield losses for tomato production around the globe. In Oman at least five distinct begomoviruses cause disease in tomato, including TYLCV. Unusually, TYLCV infections in Oman are sometimes associated with a betasatellite (Tomato leaf curl betasatellite [ToLCB]; a symptom modulating satellite). RNA interference (RNAi) can be used to develop resistance against begomoviruses at either the transcriptional or post-transcriptional levels. A hairpin RNAi (hpRNAi) construct to express double-stranded RNA homologous to sequences of the intergenic region, coat protein gene, V2 gene and replication-associated gene of Tomato yellow leaf curl virus-Oman (TYLCV-OM) was produced. Initially, transient expression of the hpRNAi construct at the site of virus inoculation was shown to reduce the number of plants developing symptoms when inoculated with either TYLCV-OM or TYLCV-OM with ToLCB-OM to Nicotiana benthamiana or tomato. Solanum lycopersicum L. cv. Pusa Ruby was transformed with the hpRNAi construct and nine confirmed transgenic lines were obtained and challenged with TYLCV-OM and ToLCB-OM by Agrobacterium-mediated inoculation. For all but one line, for which all plants remained symptomless, inoculation with TYLCV-OM led to a proportion (≤25%) of tomato plants developing symptoms of infection. For inoculation with TYLCV-OM and ToLCB-OM all lines showed a proportion of plants (≤45%) symptomatic. However, for all infected transgenic plants the symptoms were milder and virus titre in plants was lower than in infected non-transgenic tomato plants. These results show that RNAi can be used to develop resistance against geminiviruses in tomato. The resistance in this case is not immunity but does reduce the severity of infections and virus titer. Also, the betasatellite may compromise resistance, increasing the proportion of plants which ultimately show symptoms.

Equilibrium denaturation and preferential interactions of an RNA tetraloop with urea

DOE PAGES

Miner, Jacob Carlson; García, Angel Enrique

2017-02-09

Urea is an important organic cosolute with implications in maintaining osmotic stress in cells and differentially stabilizing ensembles of folded biomolecules. We report an equilibrium study of urea-induced denaturation of a hyperstable RNA tetraloop through unbiased replica exchange molecular dynamics. We find that, in addition to destabilizing the folded state, urea smooths the RNA free energy landscape by destabilizing specific configurations, and forming favorable interactions with RNA nucleobases. A linear concentration-dependence of the free energy (m-value) is observed, in agreement with the results of other RNA hairpins and proteins. Additionally, analysis of the hydrogen-bonding and stacking interactions within RNA primarilymore » show temperature-dependence, while interactions between RNA and urea primarily show concentration-dependence. Lastly, our findings provide valuable insight into the effects of urea on RNA folding and describe the thermodynamics of a basic RNA hairpin as a function of solution chemistry.« less

Equilibrium denaturation and preferential interactions of an RNA tetraloop with urea

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miner, Jacob Carlson; García, Angel Enrique

Urea is an important organic cosolute with implications in maintaining osmotic stress in cells and differentially stabilizing ensembles of folded biomolecules. We report an equilibrium study of urea-induced denaturation of a hyperstable RNA tetraloop through unbiased replica exchange molecular dynamics. We find that, in addition to destabilizing the folded state, urea smooths the RNA free energy landscape by destabilizing specific configurations, and forming favorable interactions with RNA nucleobases. A linear concentration-dependence of the free energy (m-value) is observed, in agreement with the results of other RNA hairpins and proteins. Additionally, analysis of the hydrogen-bonding and stacking interactions within RNA primarilymore » show temperature-dependence, while interactions between RNA and urea primarily show concentration-dependence. Lastly, our findings provide valuable insight into the effects of urea on RNA folding and describe the thermodynamics of a basic RNA hairpin as a function of solution chemistry.« less

Equilibrium Denaturation and Preferential Interactions of an RNA Tetraloop with Urea.

PubMed

Miner, Jacob C; García, Angel E

2017-04-20

Urea is an important organic cosolute with implications in maintaining osmotic stress in cells and differentially stabilizing ensembles of folded biomolecules. We report an equilibrium study of urea-induced denaturation of a hyperstable RNA tetraloop through unbiased replica exchange molecular dynamics. We find that, in addition to destabilizing the folded state, urea smooths the RNA free energy landscape by destabilizing specific configurations, and forming favorable interactions with RNA nucleobases. A linear concentration-dependence of the free energy (m-value) is observed, in agreement with the results of other RNA hairpins and proteins. Additionally, analysis of the hydrogen-bonding and stacking interactions within RNA primarily show temperature-dependence, while interactions between RNA and urea primarily show concentration-dependence. Our findings provide valuable insight into the effects of urea on RNA folding and describe the thermodynamics of a basic RNA hairpin as a function of solution chemistry.

Microprocessor activity controls differential miRNA biogenesis In Vivo.

PubMed

Conrad, Thomas; Marsico, Annalisa; Gehre, Maja; Orom, Ulf Andersson

2014-10-23

In miRNA biogenesis, pri-miRNA transcripts are converted into pre-miRNA hairpins. The in vivo properties of this process remain enigmatic. Here, we determine in vivo transcriptome-wide pri-miRNA processing using next-generation sequencing of chromatin-associated pri-miRNAs. We identify a distinctive Microprocessor signature in the transcriptome profile from which efficiency of the endogenous processing event can be accurately quantified. This analysis reveals differential susceptibility to Microprocessor cleavage as a key regulatory step in miRNA biogenesis. Processing is highly variable among pri-miRNAs and a better predictor of miRNA abundance than primary transcription itself. Processing is also largely stable across three cell lines, suggesting a major contribution of sequence determinants. On the basis of differential processing efficiencies, we define functionality for short sequence features adjacent to the pre-miRNA hairpin. In conclusion, we identify Microprocessor as the main hub for diversified miRNA output and suggest a role for uncoupling miRNA biogenesis from host gene expression. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

On future's doorstep: RNA interference and the pharmacopeia of tomorrow.

PubMed

Gewirtz, Alan M

2007-12-01

Small molecules and antibodies have revolutionized the treatment of malignant diseases and appear promising for the treatment of many others. Nonetheless, there are many candidate therapeutic targets that are not amenable to attack by the current generation of targeted therapies, and in a small but growing number of patients, resistance to initially successful treatments evolves. This Review Series on the medicinal promise of posttranscriptional gene silencing with small interfering RNA and other molecules capable of inducing RNA interference (RNAi) is motivated by the hypothesis that effectors of RNAi can be developed into effective drugs for treating malignancies as well as many other types of disease. As this Review Series points out, there is still much to do, but many in the field now hope that the time has finally arrived when "antisense" therapies will finally come of age and fulfill their promise as the magic bullets of the 21st century.

A multisite gateway-based toolkit for targeted gene expression and hairpin RNA silencing in tomato fruits.

PubMed

Estornell, Leandro Hueso; Orzáez, Diego; López-Peña, Lucas; Pineda, Benito; Antón, María Teresa; Moreno, Vicente; Granell, Antonio

2009-04-01

A collection of fruit promoters, reporter genes and protein tags has been constructed in a triple-gateway format, a recombination-based cloning system that facilitates the tandem assembly of three DNA fragments into plant expression vectors. The new pENFRUIT collection includes, among others, the classical tomato-ripening promoters E8 and 2A11 and a set of six new tomato promoters. The new promoter activities were characterized in both transient assays and stable transgenic plants. The range of expression of the new promoters comprises strong (PNH, PLI), medium (PLE, PFF, PHD) and weak (PSN) promoters driving gene expression preferentially in the fruit, and covering a wide range of tissues and developmental stages. Together, a total of 78 possible combinations for the expression of a gene of interest in the fruit, plus a set of five reporters for new promoter analysis, was made available in the current collection. Moreover, the pENFRUIT promoter collection is adaptable to hairpin RNA strategies aimed at tissue/organ-specific gene silencing with only an additional cloning step. The pENFRUIT toolkit broadens the spectrum of promoter activities available for fruit biotechnology and fundamental research, and bypasses technical difficulties of current ligase-dependent cloning techniques in the construction of fruit expression cassettes. The pENFRUIT vector collection is available for the research community in a plasmid repository, facilitating its accessibility.

Characterization of Bleomycin-Mediated Cleavage of a Hairpin DNA Library

PubMed Central

Segerman, Zachary J.; Roy, Basab; Hecht, Sidney M.

2013-01-01

A study of BLM A5 was conducted using a previously isolated library of hairpin DNAs found to bind strongly to metal free BLM. The ability of Fe(II)•BLM to effect cleavage on both the 3' and 5'-arms of the hairpin DNAs was characterized. The strongly bound DNAs were found to be efficient substrates for Fe•BLM A5-mediated hairpin DNA cleavage. Surprisingly, the most prevalent site of BLM-mediated cleavage was found to be the 5′-AT-3′ dinucleotide sequence. This dinucleotide sequence, and other sequences generally not cleaved well by BLM when examined using arbitrarily chosen DNA substrates, were apparent when examining the library of ten hairpin DNAs. In total, 132 sites of DNA cleavage were produced by exposure of the hairpin DNA library to Fe•BLM A5. The existence of multiple sites of cleavage on both the 3′- and 5′-arms of the hairpin DNAs suggested that some of these might be double-strand cleavage events. Accordingly, an assay was developed with which to test the propensity of the hairpin DNAs to undergo double-strand DNA damage. One hairpin DNA was characterized using this method, and gave results consistent with earlier reports of double-strand DNA cleavage, but with a sequence selectivity different from those reported previously. PMID:23834496

Non-target Effects of Green Fluorescent Protein (GFP)-derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays

PubMed Central

Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.

2013-01-01

RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797

Non-Target Effects of Green Fluorescent Protein (GFP)-Derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays.

PubMed

Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P

2013-01-04

RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.

RNA Interference of the Muscle Actin Gene in Bed Bugs: Exploring Injection Versus Topical Application for dsRNA Delivery.

PubMed

Basnet, Sanjay; Kamble, Shripat T

2018-05-01

Bed bugs are one the most troublesome household pests that feed primarily on human blood. RNA interference (RNAi) is currently being pursued as a potential tool for insect population management and has shown efficacy against some phytophagous insects. We evaluated the different techniques to deliver dsRNA specific to bed bug muscle actin (dsactin) into bed bugs. Initially, stability of dsRNA in human blood was studied to evaluate the feasibility of feeding method. Adult bed bugs were injected with dsRNA between last thoracic segment and first abdominal segment on the ventral side, with a dose of 0.2 µg dsactin per insect. In addition to injection, dsactin was mixed in acetone and treated topically in the abdomens of fifth stage nymphs. We found the quick degradation of dsRNA in blood. Injection of dsactin caused significant depletion of actin transcripts and substantial reduction in oviposition and lethality in female adults. Topically treated dsRNA in fifth stage nymphs had no effect on actin mRNA expression and survival. Our results demonstrated that injection is a reliable method of dsRNA delivery into bed bugs while topical treatment was not successful. This research provides an understanding on effective delivery methods of dsRNA into bed bugs for functional genomics research and feasibility of the RNAi based molecules for pest management purposes.

Tomographic PIV Study of Hairpin Vortices

NASA Astrophysics Data System (ADS)

Sabatino, Daniel; Rossmann, Tobias

2014-11-01

Tomographic PIV is used in a free surface water channel to quantify the flow behavior of hairpin vortices that are artificially generated in a laminar boundary layer. Direct injection from a 32:1 aspect ratio slot at low blowing ratios (0 . 1 < BR < 0 . 2) is used to generate an isolated hairpin vortex in a thick laminar boundary layer (485 < Reδ* < 600). Due to the large dynamic range of length and velocity scales (the resulting vortices have advection velocities 5X greater than their tangential velocities), a tailored optical arrangement and specialized post processing techniques are required to fully capture the small-scale behavior and long-time development of the flow field. Hairpin generation and evolution are presented using the λ2 criterion derived from the instantaneous, three-dimensional velocity field. The insight provided by the tomographic data is also compared to the conclusions drawn from 2D PIV and passive scalar visualizations. Finally, the three-dimensional behavior of the measured velocity field is correlated with that of a simultaneously imaged, passive scalar dye that marks the boundary of the injected fluid, allowing the examination of the entrainment behavior of the hairpin. Supported by the National Science Foundation under Grant CBET-1040236.

Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.

PubMed

Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla

2014-04-01

Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.

Carbon nanotube enhanced label-free detection of microRNAs based on hairpin probe triggered solid-phase rolling-circle amplification

NASA Astrophysics Data System (ADS)

Tian, Qianqian; Wang, Ying; Deng, Ruijie; Lin, Lei; Liu, Yang; Li, Jinghong

2014-12-01

The detection of microRNAs (miRNAs) is imperative for gaining a better understanding of the functions of these biomarkers and has great potential for the early diagnosis of human disease. High sensitivity and selectivity for miRNA detection brings new challenges. Herein, an ultrasensitive protocol for electrochemical detection of miRNA is designed through carbon nanotube (CNT) enhanced label-free detection based on hairpin probe triggered solid-phase rolling-circle amplification (RCA). Traditionally, RCA, widely applied for signal enhancement in the construction of a variety of biosensors, has an intrinsic limitation of ultrasensitive detection, as it is difficult to separate the enzymes, templates, and padlock DNAs from the RCA products in the homogeneous solution. We purposely designed a solid-phase RCA strategy, using CNTs as the solid substrate, integrated with a hairpin structured probe to recognize target miRNA. In the presence of miRNA the stem-loop structure will be unfolded, triggering the CNT based RCA process. Due to the efficient blocking effect originating from the polymeric RCA products, the label-free assay of miRNA exhibits an ultrasensitive detection limit of 1.2 fM. Furthermore, the protocol possesses excellent specificity for resolving lung cancer-related let-7 family members which have only one-nucleotide variations. The high sensitivity and selectivity give the method great potential for applications in online diagnostics and in situ detection in long-term development.The detection of microRNAs (miRNAs) is imperative for gaining a better understanding of the functions of these biomarkers and has great potential for the early diagnosis of human disease. High sensitivity and selectivity for miRNA detection brings new challenges. Herein, an ultrasensitive protocol for electrochemical detection of miRNA is designed through carbon nanotube (CNT) enhanced label-free detection based on hairpin probe triggered solid-phase rolling-circle amplification

Virus-Derived Gene Expression and RNA Interference Vector for Grapevine

PubMed Central

Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.

2012-01-01

The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553

RNA-Catalyzed RNA Ligation on an External RNA Template

NASA Technical Reports Server (NTRS)

McGinness, Kathleen E.; Joyce, Gerald F.

2002-01-01

Variants of the hc ligase ribozyme, which catalyzes ligation of the 3' end of an RNA substrate to the 5' end of the ribozyme, were utilized to evolve a ribozyme that catalyzes ligation reactions on an external RNA template. The evolved ribozyme catalyzes the joining of an oligonucleotide 3'-hydroxyl to the 5'-triphosphate of an RNA hairpin molecule. The ribozyme can also utilize various substrate sequences, demonstrating a largely sequence-independent mechanism for substrate recognition. The ribozyme also carries out the ligation of two oligonucleotides that are bound at adjacent positions on a complementary template. Finally, it catalyzes addition of mononucleoside '5-triphosphates onto the '3 end of an oligonucleotide primer in a template-dependent manner. The development of ribozymes that catalyze polymerase-type reactions contributes to the notion that an RNA world could have existed during the early history of life on Earth.

Homo sapiens Systemic RNA Interference-defective-1 Transmembrane Family Member 1 (SIDT1) Protein Mediates Contact-dependent Small RNA Transfer and MicroRNA-21-driven Chemoresistance*

PubMed Central

Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.

2012-01-01

Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421

Stem-Loop RNA Hairpins in Giant Viruses: Invading rRNA-Like Repeats and a Template Free RNA

PubMed Central

Seligmann, Hervé; Raoult, Didier

2018-01-01

We examine the hypothesis that de novo template-free RNAs still form spontaneously, as they did at the origins of life, invade modern genomes, contribute new genetic material. Previously, analyses of RNA secondary structures suggested that some RNAs resembling ancestral (t)RNAs formed recently de novo, other parasitic sequences cluster with rRNAs. Here positive control analyses of additional RNA secondary structures confirm ancestral and de novo statuses of RNA grouped according to secondary structure. Viroids with branched stems resemble de novo RNAs, rod-shaped viroids resemble rRNA secondary structures, independently of GC contents. 5′ UTR leading regions of West Nile and Dengue flavivirid viruses resemble de novo and rRNA structures, respectively. An RNA homologous with Megavirus, Dengue and West Nile genomes, copperhead snake microsatellites and levant cotton repeats, not templated by Mimivirus' genome, persists throughout Mimivirus' infection. Its secondary structure clusters with candidate de novo RNAs. The saltatory phyletic distribution and secondary structure of Mimivirus' peculiar RNA suggest occasional template-free polymerization of this sequence, rather than noncanonical transcriptions (swinger polymerization, posttranscriptional editing). PMID:29449833

Proflavine sensitivity of RNA processing in isolated nuclei.

PubMed Central

Yannarell, A; Niemann, M; Schumm, D E; Webb, T E

1977-01-01

The intercalating agent proflavine inhibits the processing and subsequent release of preformed messenger RNA and ribosomal RNA from isolated liver nuclei to surrogate cytoplasm. The direct effect of proflavine on these processes, as monitored in a reconstituted cell-free system, supports the theory that base-paired segments (i.e. hairpin loops) in the precursor RNA's are involved as recognition sites in nuclear RNA processing. PMID:866181

A Simple Laboratory Practical to Illustrate RNA Mediated Gene Interference Using Drosophila Cell Culture

ERIC Educational Resources Information Center

Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak

2010-01-01

RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…

RNA interference inhibits yellow fever virus replication in vitro and in vivo.

PubMed

Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L

2009-04-01

RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.

The core microprocessor component DiGeorge syndrome critical region 8 (DGCR8) is a nonspecific RNA-binding protein.

PubMed

Roth, Braden M; Ishimaru, Daniella; Hennig, Mirko

2013-09-13

MicroRNA (miRNA) biogenesis follows a conserved succession of processing steps, beginning with the recognition and liberation of an miRNA-containing precursor miRNA hairpin from a large primary miRNA transcript (pri-miRNA) by the Microprocessor, which consists of the nuclear RNase III Drosha and the double-stranded RNA-binding domain protein DGCR8 (DiGeorge syndrome critical region protein 8). Current models suggest that specific recognition is driven by DGCR8 detection of single-stranded elements of the pri-miRNA stem-loop followed by Drosha recruitment and pri-miRNA cleavage. Because countless RNA transcripts feature single-stranded-dsRNA junctions and DGCR8 can bind hundreds of mRNAs, we explored correlations between RNA binding properties of DGCR8 and specific pri-miRNA substrate processing. We found that DGCR8 bound single-stranded, double-stranded, and random hairpin transcripts with similar affinity. Further investigation of DGCR8/pri-mir-16 interactions by NMR detected intermediate exchange regimes over a wide range of stoichiometric ratios. Diffusion analysis of DGCR8/pri-mir-16 interactions by pulsed field gradient NMR lent further support to dynamic complex formation involving free components in exchange with complexes of varying stoichiometry, although in vitro processing assays showed exclusive cleavage of pri-mir-16 variants bearing single-stranded flanking regions. Our results indicate that DGCR8 binds RNA nonspecifically. Therefore, a sequential model of DGCR8 recognition followed by Drosha recruitment is unlikely. Known RNA substrate requirements are broad and include 70-nucleotide hairpins with unpaired flanking regions. Thus, specific RNA processing is likely facilitated by preformed DGCR8-Drosha heterodimers that can discriminate between authentic substrates and other hairpins.

The Core Microprocessor Component DiGeorge Syndrome Critical Region 8 (DGCR8) Is a Nonspecific RNA-binding Protein*

PubMed Central

Roth, Braden M.; Ishimaru, Daniella; Hennig, Mirko

2013-01-01

MicroRNA (miRNA) biogenesis follows a conserved succession of processing steps, beginning with the recognition and liberation of an miRNA-containing precursor miRNA hairpin from a large primary miRNA transcript (pri-miRNA) by the Microprocessor, which consists of the nuclear RNase III Drosha and the double-stranded RNA-binding domain protein DGCR8 (DiGeorge syndrome critical region protein 8). Current models suggest that specific recognition is driven by DGCR8 detection of single-stranded elements of the pri-miRNA stem-loop followed by Drosha recruitment and pri-miRNA cleavage. Because countless RNA transcripts feature single-stranded-dsRNA junctions and DGCR8 can bind hundreds of mRNAs, we explored correlations between RNA binding properties of DGCR8 and specific pri-miRNA substrate processing. We found that DGCR8 bound single-stranded, double-stranded, and random hairpin transcripts with similar affinity. Further investigation of DGCR8/pri-mir-16 interactions by NMR detected intermediate exchange regimes over a wide range of stoichiometric ratios. Diffusion analysis of DGCR8/pri-mir-16 interactions by pulsed field gradient NMR lent further support to dynamic complex formation involving free components in exchange with complexes of varying stoichiometry, although in vitro processing assays showed exclusive cleavage of pri-mir-16 variants bearing single-stranded flanking regions. Our results indicate that DGCR8 binds RNA nonspecifically. Therefore, a sequential model of DGCR8 recognition followed by Drosha recruitment is unlikely. Known RNA substrate requirements are broad and include 70-nucleotide hairpins with unpaired flanking regions. Thus, specific RNA processing is likely facilitated by preformed DGCR8-Drosha heterodimers that can discriminate between authentic substrates and other hairpins. PMID:23893406

On hairpin vortex generation from near-wall streamwise vortices

NASA Astrophysics Data System (ADS)

Wang, Yinshan; Huang, Weixi; Xu, Chunxiao

2015-04-01

The generation of a hairpin vortex from near-wall streamwise vortices is studied via the direct numerical simulation (DNS) of the streak transient growth in the minimal channel flow at . The streak profile is obtained by conditionally averaging the DNS data of the fully developed turbulent channel flow at the same Reynolds number. The near-wall streamwise vortices are produced by the transient growth of the streak which is initially subjected to the sinuous perturbation of the spanwise velocity. It is shown that the arch head of the hairpin vortex first grows from the downstream end of the stronger streamwise vortex and then connects with the weaker, opposite-signed streamwise vortex in their overlap region, forming a complete individual hairpin structure. The vorticity transport along the vortex lines indicates that the strength increase and the spatial expansion of the arch head are due to the stretching and the turning of the vorticity vector, respectively. The hairpin packets could be further produced from the generated individual hairpin vortex following the parent-offspring process.

Potential applications of RNA interference-based therapeutics in the treatment of cardiovascular disease.

PubMed

Hassan, Ali

2006-06-01

RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.

Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.

PubMed

Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad

2009-01-01

RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.

Novel AgoshRNA molecules for silencing of the CCR5 co-receptor for HIV-1 infection

PubMed Central

Herrera-Carrillo, Elena

2017-01-01

Allogeneic transplantation of blood stem cells from a CCR5-Δ32 homozygous donor to an HIV-infected individual, the “Berlin patient”, led to a cure. Since then there has been a search for approaches that mimic this intervention in a gene therapy setting. RNA interference (RNAi) has evolved as a powerful tool to regulate gene expression in a sequence-specific manner and can be used to inactivate the CCR5 mRNA. Short hairpin RNA (shRNA) molecules can impair CCR5 expression, but these molecules may cause unintended side effects and they will not be processed in cells that lack Dicer, such as monocytes. Dicer-independent RNAi pathways have opened opportunities for new AgoshRNA designs that rely exclusively on Ago2 for maturation. Furthermore, AgoshRNA processing yields a single active guide RNA, thus reducing off-target effects. In this study, we tested different AgoshRNA designs against CCR5. We selected AgoshRNAs that potently downregulated CCR5 expression on human T cells and peripheral blood mononuclear cells (PBMC) and that had no apparent adverse effect on T cell development as assessed in a competitive cell growth assay. CCR5 knockdown significantly protected T cells from CCR5 tropic HIV-1 infection. PMID:28542329

Combination of RNA interference and virus receptor trap exerts additive antiviral activity in coxsackievirus B3-induced myocarditis in mice.

PubMed

Stein, Elisabeth A; Pinkert, Sandra; Becher, Peter Moritz; Geisler, Anja; Zeichhardt, Heinz; Klopfleisch, Robert; Poller, Wolfgang; Tschöpe, Carsten; Lassner, Dirk; Fechner, Henry; Kurreck, Jens

2015-02-15

Coxsackievirus B3 (CVB3) is a major heart pathogen against which no therapy exists to date. The potential of a combination treatment consisting of a proteinaceous virus receptor trap and an RNA interference-based component to prevent CVB3-induced myocarditis was investigated. A soluble variant of the extracellular domain of the coxsackievirus-adenovirus receptor (sCAR-Fc) was expressed from an adenoviral vector and 2 short hairpin RNAs (shRdRp2.4) directed against CVB3 were delivered by an adeno-associated virus (AAV) vector. Cell culture experiments revealed additive antiviral activity of the combined application. In a CVB3-induced mouse myocarditis model, both components applied individually significantly reduced inflammation and viral load in the heart. The combination exerted an additive antiviral effect and reduced heart pathology. Hemodynamic measurement revealed that infection with CVB3 resulted in impaired heart function, as illustrated by a drastically reduced cardiac output and impaired contractility and relaxation. Treatment with either sCAR-Fc or shRdRp2.4 significantly improved these parameters. Importantly, the combination of both components led to a further significant improvement of heart function. Combination of sCAR-Fc and shRdRp2.4 exerted additive effects and was significantly more effective than either of the single treatments in inhibiting CVB3-induced myocarditis and preventing cardiac dysfunction. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.

PubMed

Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

2014-01-01

RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.

RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding

PubMed Central

Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

2014-01-01

RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689

RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.

PubMed

Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F

2005-01-01

In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.

RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans

PubMed Central

Tops, Bastiaan B. J.; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C.; Plasterk, Ronald H. A.; Ketting, René F.

2005-01-01

In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of ∼250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step. PMID:15653635

Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects.

PubMed

Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E

2018-05-04

Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for

Bridging from Replication to Translation with a Thermal, Autonomous Replicator Made from Transfer RNA

NASA Astrophysics Data System (ADS)

Braun, Dieter; Möller, Friederike M.; Krammer, Hubert

2013-03-01

Central to the understanding of living systems is the interplay between DNA/RNA and proteins. Known as Eigen paradox, proteins require genetic information while proteins are needed for the replication of genes. RNA world scenarios focus on a base by base replication disconnected from translation. Here we used strategies from DNA machines to demonstrate a tight connection between a basic replication mechanism and translation. A pool of hairpin molecules replicate a two-letter code. The replication is thermally driven: the energy and negative entropy to drive replication is initially stored in metastable hairpins by kinetic cooling. Both are released by a highly specific and exponential replication reaction that is solely implemented by base hybridization. The duplication time is 30s. The reaction is monitored by fluorescence and described by a detailed kinetic model. The RNA hairpins usetransfer RNA sequences and the replication is driven by the simple disequilibrium setting of a thermal gradient The experiments propose a physical rather than a chemical scenario for the autonomous replication of protein encoding information. Supported by the NanoSystems Initiative Munich and ERC.

Prediction of effective RNA interference targets and pathway-related genes in lepidopteran insects by RNA sequencing analysis.

PubMed

Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia

2018-06-01

When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.

Effect of North Bicyclo[3.1.0]hexane 2'-Deoxypseudosugars on RNA Interference: A Novel Class of siRNA Modification | Center for Cancer Research

Cancer.gov

The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.

Crystal structure of RlmAI: Implications for understanding the 23S rRNA G745/G748-methylation at the macrolide antibiotic-binding site

PubMed Central

Das, Kalyan; Acton, Thomas; Chiang, Yiwen; Shih, Lydia; Arnold, Eddy; Montelione, Gaetano T.

2004-01-01

The RlmA class of enzymes (RlmAI and RlmAII) catalyzes N1-methylation of a guanine base (G745 in Gram-negative and G748 in Gram-positive bacteria) of hairpin 35 of 23S rRNA. We have determined the crystal structure of Escherichia coli RlmAI at 2.8-Å resolution, providing 3D structure information for the RlmA class of RNA methyltransferases. The dimeric protein structure exhibits features that provide new insights into its molecular function. Each RlmAI molecule has a Zn-binding domain, responsible for specific recognition and binding of its rRNA substrate, and a methyltransferase domain. The asymmetric RlmAI dimer observed in the crystal structure has a well defined W-shaped RNA-binding cleft. Two S-adenosyl-l-methionine substrate molecules are located at the two valleys of the W-shaped RNA-binding cleft. The unique shape of the RNA-binding cleft, different from that of known RNA-binding proteins, is highly specific and structurally complements the 3D structure of hairpin 35 of bacterial 23S rRNA. Apart from the hairpin 35, parts of hairpins 33 and 34 also interact with the RlmAI dimer. PMID:14999102

Incorporation of a cationic aminopropyl chain in DNA hairpins: thermodynamics and hydration

PubMed Central

Soto, Ana Maria; Kankia, Besik I.; Dande, Prasad; Gold, Barry; Marky, Luis A.

2001-01-01

We report on the physicochemical effects resulting from incorporating a 5-(3-aminopropyl) side chain onto a 2′-deoxyuridine (dU) residue in a short DNA hairpin. A combination of spectroscopy, calorimetry, density and ultrasound techniques were used to investigate both the helix–coil transition of a set of  hairpins with the following sequence: d(GCGACTTTTTGNCGC) [N = dU, deoxythymidine (dT) or 5-(3-aminopropyl)-2′-deoxyuridine (dU*)], and the interaction of each hairpin with Mg2+. All three molecules undergo two-state transitions with melting temperatures (TM) independent of strand concentration that indicates their intramolecular hairpin formation. The unfolding of each hairpin takes place with similar TM values of 64–66°C and similar thermodynamic profiles. The unfavorable unfolding free energies of 6.4–6.9 kcal/mol result from the typical compensation of unfavorable enthalpies, 36–39 kcal/mol, and favorable entropies of ∼110 cal/mol. Furthermore, the stability of each hairpin increases as the salt concentration increases, the TM-dependence on salt yielded slopes of 2.3–2.9°C, which correspond to counterion releases of 0.53 (dU and dT) and 0.44 (dU*) moles of Na+ per mole of hairpin. Absolute volumetric and compressibility measurements reveal that all three hairpins have similar hydration levels. The electrostatic interaction of Mg2+ with each hairpin yielded binding affinities in the order: dU > dT > dU*, and a similar release of 2–4 electrostricted water molecules. The main result is that the incorporation of the cationic 3-aminopropyl side chain in the major groove of the hairpin stem neutralizes some local negative charges yielding a hairpin molecule with lower charge density. PMID:11522834

Polyamidoamine Dendrimer Conjugates with Cyclodextrins as Novel Carriers for DNA, shRNA and siRNA

PubMed Central

Arima, Hidetoshi; Motoyama, Keiichi; Higashi, Taishi

2012-01-01

Gene, short hairpin RNA (shRNA) and small interfering RNA (siRNA) delivery can be particularly used for the treatment of diseases by the entry of genetic materials mammalian cells either to express new proteins or to suppress the expression of proteins, respectively. Polyamidoamine (PAMAM) StarburstTM dendrimers are used as non-viral vectors (carriers) for gene, shRNA and siRNA delivery. Recently, multifunctional PAMAM dendrimers can be used for the wide range of biomedical applications including intracellular delivery of genes and nucleic acid drugs. In this context, this review paper provides the recent findings on PAMAM dendrimer conjugates with cyclodextrins (CyDs) for gene, shRNA and siRNA delivery. PMID:24300184

A potential role for RNA interference in controlling the activity of the human LINE-1 retrotransposon.

PubMed

Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J

2005-01-01

Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

RNA interference can be used to disrupt gene function in tardigrades.

PubMed

Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob

2013-05-01

How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.

Vector-based RNA interference against vascular endothelial growth factor-A significantly limits vascularization and growth of prostate cancer in vivo.

PubMed

Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia

2005-12-01

RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.

Defective RNA particles derived from Tomato black ring virus genome interfere with the replication of parental virus.

PubMed

Hasiów-Jaroszewska, Beata; Minicka, Julia; Zarzyńska-Nowak, Aleksandra; Budzyńska, Daria; Elena, Santiago F

2018-05-02

Tomato black ring virus (TBRV) is the only member of the Nepovirus genus that is known to form defective RNA particles (D RNAs) during replication. Here, de novo generation of D RNAs was observed during prolonged passages of TBRV isolates originated from Solanum lycopersicum and Lactuca sativa in Chenopodium quinoa plants. D RNAs of about 500 nt derived by a single deletion in the RNA1 molecule and contained a portion of the 5' untranslated region and viral replicase, and almost the entire 3' non-coding region. Short regions of sequence complementarity were found at the 5' and 3' junction borders, which can facilitate formation of the D RNAs. Moreover, in this study we analyzed the effects of D RNAs on TBRV replication and symptoms development of infected plants. C. quinoa, S. lycopersicum, Nicotiana tabacum, and L. sativa were infected with the original TBRV isolates (TBRV-D RNA) and those containing additional D RNA particles (TBRV + D RNA). The viral accumulation in particular hosts was measured up to 28 days post inoculation by RT-qPCR. Statistical analyses revealed that D RNAs interfere with TBRV replication and thus should be referred to as defective interfering particles. The magnitude of the interference effect depends on the interplay between TBRV isolate and host species. Copyright © 2018 Elsevier B.V. All rights reserved.

Development of Hairpin Vortices in Turbulent Spots and End-Wall Transition

NASA Technical Reports Server (NTRS)

Smith, Charles R.

2007-01-01

The end-stage phase of boundary layer transition is characterized by the development of hairpin-like vortices which evolve rapidly into patches of turbulent behavior. In general, the characteristics of the evolution form this hairpin stage to the turbulent stage is poorly understood, which has prompted the present experimental examination of hairpin vortex development and growth processes. Two topics of particular relevance to the workshop focus will be covered: 1) the growth of turbulent spots through the generatio and amalgamation of hairpin-like vortices, and 2) the development of hairpin vortices during transition in an end-wall junction flow. Brief summaries of these studies are described below. Using controlled generation of hairpin vortices by surface injection in a critical laminar boundary layer, detailed flow visualization studies have been done of the phases of growth of single hairpin vortices, from the initial hairgin generation, through the systematic generation of secondary hairpin-like flow structures, culminating in the evolution to a turbulent spot. The key to the growth process is strong vortex-surface interactions, which give rise to strong eruptive events adjacent to the surface, which results in the generation of subsequent hairpin vortex structures due to inviscid-viscuous interactions between the eruptive events and the free steam fluid. The general process of vortex-surface fluid interaction, coupled with subsequent interactions and amalgamation of the generated multiple hairpin-type vortices, is demonstrated as a physical mechanism for the growth and development of turbulent spots. When a boundary layer flow along a surface encounters a bluff body obstruction extending from the surface (such as cylinder or wing), the strong adverse pressure gradients generated by these types of flows result in the concentration of the impinging vorticity into a system of discrete vortices near the end-wall juncture of the obstruction, with the extensions

Adenovirus-mediated interference of FABP4 regulates mRNA expression of ADIPOQ, LEP and LEPR in bovine adipocytes.

PubMed

Wei, S; Zan, L S; Wang, H B; Cheng, G; Du, M; Jiang, Z; Hausman, G J; McFarland, D C; Dodson, M V

2013-02-27

Fatty acid binding protein 4 (FABP4) is an important adipocyte gene, with roles in fatty acid transport and fat deposition in animals as well as human metabolic syndrome. However, little is known about the functional regulation of FABP4 at the cellular level in bovine. We designed and selected an effective shRNA (small hairpin RNA) against bovine FABP4, constructed a corresponding adenovirus (AD-FABP4), and then detected its influence on mRNA expression of four differentiation-related genes (PPAR(y), CEBPA, CEBPB, and SREBF1) and three lipid metabolism-related genes (ADIPOQ, LEP and LEPR) of adipocytes. The FABP4 mRNA content, derived from bovine adipocytes, decreased by 41% (P < 0.01) after 24 h and 66% (P < 0.01) after 72 h of AD-FABP4 infection. However, lower mRNA content of FABP4 did not significantly alter levels of differentiation-related gene expression at 24 h following AD-FABP4 treatment of bovine-derived preadipocytes (P = 0.54, 0.78, 0.89, and 0.94, respectively). Meanwhile, knocking down (partially silencing) FABP4 significantly decreased ADIPOQ (P < 0.05) and LEP (P < 0.01) gene expression after 24 h of AD-FABP4 treatment, decreased ADIPOQ (P < 0.01) and LEP (P < 0.01) gene expression, but increased LEPR mRNA expression (P < 0.01) after a 72-h treatment of bovine preadipocytes. We conclude that FABP4 plays a role in fat deposition and metabolic syndrome by regulating lipid metabolism-related genes (such as ADIPOQ, LEP and LEPR), without affecting the ability of preadipocytes to differentiate into adipocytes.

Lentivirus-mediated shRNA interference of ghrelin receptor blocks proliferation in the colorectal cancer cells.

PubMed

Liu, An; Huang, Chenggang; Xu, Jia; Cai, Xuehong

2016-09-01

Ghrelin, an orexigenic peptide, acts via the growth hormone secretagogue receptor (GHSR) to stimulate the release of growth hormone. Moreover, it has a range of biological actions, including the stimulation of food intake, modulation of insulin signaling and cardiovascular effects. Recently, it has been demonstrated that ghrelin has a proliferative and antiapoptotic effects in cancers, suggesting a potential role in promoting tumor growth. However, it remains unknown whether GHSR contributes to colorectal cancer proliferation. In this study, the therapeutic effect of lentivirus-mediated short hairpin RNA (shRNA) targeting ghrelin receptor 1a (GHSR1a) was analyzed in colorectal cancer cell line SW480 both in vitro and in vivo. Our study demonstrated that ghrelin and GHSR1a are significantly upregulated in cancerous colorectal tissue samples and cell lines. In vitro, human colorectal cancer cell line SW480 with downregulation of GHSR1a by shRNA showed significant inhibition of cell viability compared with blank control (BC) or scrambled control (SC) regardless of the application of exogenous ghrelin. Furthermore, GHSR1a silencing by target specific shRNA was shown capable of increasing PTEN, inhibiting AKT phosphorylation and promoting the release of p53 in SW480 cells. In addition, the effects of GHSR1a knockdown were further explored in vivo using colorectal tumor xenograft mouse model. The tumor weights were decreased markedly in GHSR1α knockdown SW480 mouse xenograft tumors compared with blank control or negative control tumors. Our results suggested that the expression of GHSR1a is significantly correlated with the growth of colorectal cancer cells, and the GHSR1a knockdown approach may be a potential therapy for the treatment of colorectal cancer. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Identification of Short Hairpin RNA Targeting Foot-And-Mouth Disease Virus with Transgenic Bovine Fetal Epithelium Cells

PubMed Central

He, Hongbin; Ding, Fangrong; Yang, Hongjun; Cheng, Lei; Liu, Wenhao; Zhong, Jifeng; Dai, Yunping; Li, Guangpeng; He, Chengqiang; Yu, Li; Li, Jianbin

2012-01-01

Background Although it is known that RNA interference (RNAi) targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV), it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. Principal Finding Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2), VP3 (RNAi-VP3), or VP4 (RNAi-VP4) of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. Conclusion RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV. PMID:22905125

Harnessing RNA interference to develop neonatal therapies: from Nobel Prize winning discovery to proof of concept clinical trials.

PubMed

DeVincenzo, John P

2009-10-01

A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral

Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

PubMed

Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

2017-02-01

RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

The protective effect of Hif3a RNA interference and HIF-prolyl hydroxylase inhibition on cardiomyocytes under anoxia-reoxygenation.

PubMed

Drevytska, T; Gonchar, E; Okhai, I; Lynnyk, O; Mankovska, I; Klionsky, D; Dosenko, V

2018-06-01

The aim of this study was to investigate the molecular mechanisms underlying the protective effects of hypoxia-inducible factor (HIF) signaling pathway activation in cardiomyocytes under anoxia-reoxygenation (A/R) injury. In this study, rat neonatal cardiomyocytes were pretreated with anti-Hif3A/Hif-3α siRNA or HIF-prolyl hydroxylase inhibitor prior to A/R injury. Our results showed that both HIF3A silencing and HIF-prolyl hydroxylase inhibition effectively increased the cell viability during A/R, led to changes in mRNA expression of HIF1-target genes, and reduced the loss of mitochondrial membrane potential (Δψ m ). Furthermore, application of anti-Hif3a siRNA led to an increase in mRNA expression of Epo, Igf1, Slc2a1/Glut-1, and Slc2a4/Glut-4. Similar results were observed with HIF-prolyl hydroxylase inhibition, which additionally upregulated the mRNA expression of Epor, Tert, and Pdk1. Hif3a RNA-interference and application of HIF-prolyl hydroxylase inhibitor during A/R modelling led to an increase of Δψ m on 11.5 and 11.9 mV respectively, compared to the control groups. Thus, Hif3a RNA interference and HIF-prolyl hydroxylase inhibition protect cardiomyocytes against A/R injury via the HIF signaling pathway. Copyright © 2018 Elsevier Inc. All rights reserved.

Non-specific binding of Na+ and Mg2+ to RNA determined by force spectroscopy methods

PubMed Central

Bizarro, C. V.; Alemany, A.; Ritort, F.

2012-01-01

RNA duplex stability depends strongly on ionic conditions, and inside cells RNAs are exposed to both monovalent and multivalent ions. Despite recent advances, we do not have general methods to quantitatively account for the effects of monovalent and multivalent ions on RNA stability, and the thermodynamic parameters for secondary structure prediction have only been derived at 1M [Na+]. Here, by mechanically unfolding and folding a 20 bp RNA hairpin using optical tweezers, we study the RNA thermodynamics and kinetics at different monovalent and mixed monovalent/Mg2+ salt conditions. We measure the unfolding and folding rupture forces and apply Kramers theory to extract accurate information about the hairpin free energy landscape under tension at a wide range of ionic conditions. We obtain non-specific corrections for the free energy of formation of the RNA hairpin and measure how the distance of the transition state to the folded state changes with force and ionic strength. We experimentally validate the Tightly Bound Ion model and obtain values for the persistence length of ssRNA. Finally, we test the approximate rule by which the non-specific binding affinity of divalent cations at a given concentration is equivalent to that of monovalent cations taken at 100-fold concentration for small molecular constructs. PMID:22492710

Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

PubMed

Lee, Sooncheol; Kang, Changwon

2011-05-06

The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

Ingestion of genetically modified yeast symbiont reduces fitness of an insect pest via RNA interference

PubMed Central

Murphy, Katherine A.; Tabuloc, Christine A.; Cervantes, Kevin R.; Chiu, Joanna C.

2016-01-01

RNA interference has had major advances as a developing tool for pest management. In laboratory experiments, double-stranded RNA (dsRNA) is often administered to the insect by genetic modification of the crop, or synthesized in vitro and topically applied to the crop. Here, we engineered genetically modified yeast that express dsRNA targeting y-Tubulin in Drosophila suzukii. Our design takes advantage of the symbiotic interactions between Drosophila, yeast, and fruit crops. Yeast is naturally found growing on the surface of fruit crops, constitutes a major component of the Drosophila microbiome, and is highly attractive to Drosophila. Thus, this naturally attractive yeast biopesticide can deliver dsRNA to an insect pest without the need for genetic crop modification. We demonstrate that this biopesticide decreases larval survivorship, and reduces locomotor activity and reproductive fitness in adults, which are indicative of general health decline. To our knowledge, this is the first study to show that yeast can be used to deliver dsRNA to an insect pest. PMID:26931800

Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

PubMed Central

Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.

2012-01-01

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory β-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory β-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus. PMID:22496223

RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental design

USDA-ARS?s Scientific Manuscript database

Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive ex...

RNA interference: new mechanistic and biochemical insights with application in oral cancer therapy.

PubMed

Buduru, Smaranda; Zimta, Alina-Andreea; Ciocan, Cristina; Braicu, Cornelia; Dudea, Diana; Irimie, Alexandra Iulia; Berindan-Neagoe, Ioana

2018-01-01

Over the last few decades, the incidence of oral cancer has gradually increased, due to the negative influence of environmental factors and also abnormalities within the genome. The main issues in oral cancer treatment consist in surpassing resistance and recurrence. However, continuous discovery of altered signaling pathways in these tumors provides valuable information for the identification of novel gene candidates targeted in personalized therapy. RNA interference (RNAi) is a natural mechanism that involves small interfering RNA (siRNA); this can be exploited in biomedical research by using natural or synthetic constructs for activation of the mechanism. Synthetic siRNA transcripts were developed as a versatile class of molecular tools that have a diverse range of programmable roles, being involved in the regulation of several biological processes, thereby providing the perspective of an alternative option to classical treatment. In this review, we summarize the latest information related to the application of siRNA in oral malignancy together with molecular aspects of the technology and also the perspective upon the delivery system. Also, the emergence of newer technologies such as clustered regularly interspaced short palindromic repeats/Cas9 or transcription activator-like effector nucleases in comparison with the RNAi approach is discussed in this paper.

RNA interference technology in crop protection against arthropod pests, pathogens and nematodes.

PubMed

Zotti, Moises; Dos Santos, Ericmar Avila; Cagliari, Deise; Christiaens, Olivier; Taning, Clauvis Nji Tizi; Smagghe, Guy

2018-06-01

Scientists have made significant progress in understanding and unraveling several aspects of double-stranded RNA (dsRNA)-mediated gene silencing during the last two decades. Now that the RNA interference (RNAi) mechanism is well understood, it is time to consider how to apply the acquired knowledge to agriculture and crop protection. Some RNAi-based products are already available for farmers and more are expected to reach the market soon. Tailor-made dsRNA as an active ingredient for biopesticide formulations is considered a raw material that can be used for diverse purposes, from pest control and bee protection against viruses to pesticide resistance management. The RNAi mechanism works at the messenger RNA (mRNA) level, exploiting a sequence-dependent mode of action, which makes it unique in potency and selectivity compared with conventional agrochemicals. Furthermore, the use of RNAi in crop protection can be achieved by employing plant-incorporated protectants through plant transformation, but also by non-transformative strategies such as the use of formulations of sprayable RNAs as direct control agents, resistance factor repressors or developmental disruptors. In this review, RNAi is presented in an agricultural context (discussing products that have been launched on the market or will soon be available), and we go beyond the classical presentation of successful examples of RNAi in pest-insect control and comprehensively explore its potential for the control of plant pathogens, nematodes and mites, and to fight against diseases and parasites in beneficial insects. Moreover, we also discuss its use as a repressor for the management of pesticide-resistant weeds and insects. Finally, this review reports on the advances in non-transformative dsRNA delivery and the production costs of dsRNA, and discusses environmental considerations. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Identification and tracking of hairpin vortex auto-generation in turbulent wall-bounded flow

NASA Astrophysics Data System (ADS)

Huang, Yangzi; Green, Melissa

2016-11-01

Hairpin vortices have been widely accepted as component structures of turbulent boundary layers. Their properties (size, vorticity, energy) and dynamic phenomena (origin, growth, breakdown) have been shown to correlate to the complex, multi-scaled turbulent motions observed in both experiments and simulations. As established in the literature, the passage of a hairpin vortex creates a wall-normal ejection of fluid, which encounters the high-speed freestream resulting in near-wall shear and increased drag. A previously generated simulation of an isolated hairpin vortex is used to study the auto-generation of a secondary vortex structure. Eulerian methods such as the Q criterion and Γ2 function, as well as Lagrangian methods are used to visualize the three-dimensional hairpin vortices and the auto-generation process. The circulation development and wall-normal location of both primary and secondary hairpin heads are studied to determine if there is a correlation between the strength and height of the primary hairpin vortex with the secondary hairpin vortex auto-generation.

RNA interference can be used to disrupt gene function in tardigrades

PubMed Central

Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob

2012-01-01

How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800

β-hairpin-mediated nucleation of polyglutamine amyloid formation

PubMed Central

Kar, Karunakar; Hoop, Cody L.; Drombosky, Kenneth W.; Baker, Matthew A.; Kodali, Ravindra; Arduini, Irene; van der Wel, Patrick C. A.; Horne, W. Seth; Wetzel, Ronald

2013-01-01

The conformational preferences of polyglutamine (polyQ) sequences are of major interest because of their central importance in the expanded CAG repeat diseases that include Huntington’s disease (HD). Here we explore the response of various biophysical parameters to the introduction of β-hairpin motifs within polyQ sequences. These motifs (trpzip, disulfide, D-Pro-Gly, Coulombic attraction, L-Pro-Gly) enhance formation rates and stabilities of amyloid fibrils with degrees of effectiveness well-correlated with their known abilities to enhance β-hairpin formation in other peptides. These changes led to decreases in the critical nucleus for amyloid formation from a value of n* = 4 for a simple, unbroken Q23 sequence to approximate unitary n* values for similar length polyQs containing β-hairpin motifs. At the same time, the morphologies, secondary structures, and bioactivities of the resulting fibrils were essentially unchanged from simple polyQ aggregates. In particular, the signature pattern of SSNMR 13C Gln resonances that appears to be unique to polyQ amyloid is replicated exactly in fibrils from a β-hairpin polyQ. Importantly, while β-hairpin motifs do produce enhancements in the equilibrium constant for nucleation in aggregation reactions, these Kn* values remain quite low (~ 10−10) and there is no evidence for significant embellishment of β-structure within the monomer ensemble. The results indicate an important role for β-turns in the nucleation mechanism and structure of polyQ amyloid and have implications for the nature of the toxic species in expanded CAG repeat diseases. PMID:23353826

A hot-spot-active magnetic graphene oxide substrate for microRNA detection based on cascaded chemiluminescence resonance energy transfer

NASA Astrophysics Data System (ADS)

Bi, Sai; Chen, Min; Jia, Xiaoqiang; Dong, Ying

2015-02-01

Herein, a cascaded chemiluminescence resonance energy transfer (C-CRET) process was demonstrated from horseradish peroxidase (HRP)-mimicking DNAzyme-catalyzed luminol-H2O2 to fluorescein and further to graphene oxide (GO) when HRP-mimicking DNAzyme/fluorescein was in close proximity to the GO surface. The proposed C-CRET system was successfully implemented to construct three modes of C-CRET hot-spot-active substrates (modes I, II and III) by covalently immobilizing HRP-mimicking DNAzyme/fluorescein-labeled hairpin DNAs (hot-spot-generation probes) on magnetic GO (MGO), resulting in a signal ``off'' state due to the quenching of the luminol/H2O2/HRP-mimicking DNAzyme/fluorescein CRET system by GO. Upon the introduction of microRNA-122 (miRNA-122), the targets (mode I) or the new triggers that were generated through a strand displacement reaction (SDR) initiated by miRNA-122 (modes II and III) hybridized with the loop domains of hairpin probes on MGO to form double-stranded (modes I and II) or triplex-stem structures (mode III), causing an ``open'' configuration of the hairpin probe and a CRET signal ``on'' state, thus achieving sensitive and selective detection of miRNA-122. More importantly, the substrate exhibited excellent controllability, reversibility and reproducibility through SDR and magnetic separation (modes II and III), especially sequence-independence for hairpin probes in mode III, holding great potential for the development of a versatile platform for optical biosensing.Herein, a cascaded chemiluminescence resonance energy transfer (C-CRET) process was demonstrated from horseradish peroxidase (HRP)-mimicking DNAzyme-catalyzed luminol-H2O2 to fluorescein and further to graphene oxide (GO) when HRP-mimicking DNAzyme/fluorescein was in close proximity to the GO surface. The proposed C-CRET system was successfully implemented to construct three modes of C-CRET hot-spot-active substrates (modes I, II and III) by covalently immobilizing HRP-mimicking DNAzyme

Delivery of dsRNA through topical feeding for RNA interference in the citrus sap piercing-sucking hemipteran, Diaphorina citri.

PubMed

Killiny, Nabil; Kishk, Abdelaziz

2017-06-01

RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.

RNA interference tools for the western flower thrips, Frankliniella occidentalis.

PubMed

Badillo-Vargas, Ismael E; Rotenberg, Dorith; Schneweis, Brandi A; Whitfield, Anna E

2015-05-01

The insect order Thysanoptera is exclusively comprised of small insects commonly known as thrips. The western flower thrips, Frankliniella occidentalis, is an economically important pest amongst thysanopterans due to extensive feeding damage and tospovirus transmission to hundreds of plant species worldwide. Geographically-distinct populations of F. occidentalis have developed resistance against many types of traditional chemical insecticides, and as such, management of thrips and tospoviruses are a persistent challenge in agriculture. Molecular methods for defining the role(s) of specific genes in thrips-tospovirus interactions and for assessing their potential as gene targets in thrips management strategies is currently lacking. The goal of this work was to develop an RNA interference (RNAi) tool that enables functional genomic assays and to evaluate RNAi for its potential as a biologically-based approach for controlling F. occidentalis. Using a microinjection system, we delivered double-stranded RNA (dsRNA) directly to the hemocoel of female thrips to target the vacuolar ATP synthase subunit B (V-ATPase-B) gene of F. occidentalis. Gene expression analysis using real-time quantitative reverse transcriptase-PCR (qRT-PCR) revealed significant reductions of V-ATPase-B transcripts at 2 and 3 days post-injection (dpi) with dsRNA of V-ATPase-B compared to injection with dsRNA of GFP. Furthermore, the effect of knockdown of the V-ATPase-B gene in females at these two time points was mirrored by the decreased abundance of V-ATPase-B protein as determined by quantitative analysis of Western blots. Reduction in V-ATPase-B expression in thrips resulted in increased female mortality and reduced fertility, i.e., number of viable offspring produced. Survivorship decreased significantly by six dpi compared to the dsRNA-GFP control group, which continued decreasing significantly until the end of the bioassay. Surviving female thrips injected with dsRNA-V-ATPase-B produced

Effective inhibition of HIV-1 production by short hairpin RNAs and small interfering RNAs targeting a highly conserved site in HIV-1 Gag RNA is optimized by evaluating alternative length formats.

PubMed

Scarborough, Robert J; Adams, Kelsey L; Daher, Aïcha; Gatignol, Anne

2015-09-01

We have previously identified a target site in HIV-1 RNA that was particularly accessible to a ribozyme and a short hairpin RNA (shRNA). To design small interfering RNAs (siRNAs) targeting this site, we evaluated the effects of siRNAs with different lengths on HIV-1 production. The potency and efficacy of these siRNAs were dependent on the length of their intended sense strand with trends for symmetrical and asymmetrical formats that were similar. Although a typical canonical format with a 21-nucleotide (nt) sense strand was effective at inhibiting HIV-1 production, Dicer substrate siRNAs (dsiRNAs) with the longest lengths (27 to 29 nucleotides) were the most effective. Induction of double-stranded RNA immune responses and effects on cell viability were not detected in cells transfected with different siRNAs, suggesting that the differences observed were not related to indirect effects on HIV-1 production. For the corresponding shRNA designs, a different trend in potency and efficacy against HIV-1 production was observed, with the most effective shRNAs having stem lengths from 20 to 27 bp. Our results highlight the importance of evaluating different designs to identify the best siRNA and shRNA formats for any particular target site and provide a set of highly effective molecules for further development as drug and gene therapies for HIV-1 infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

An Enzyme-Catalyzed Multistep DNA Refolding Mechanism in Hairpin Telomere Formation

PubMed Central

Shi, Ke; Huang, Wai Mun; Aihara, Hideki

2013-01-01

Hairpin telomeres of bacterial linear chromosomes are generated by a DNA cutting–rejoining enzyme protelomerase. Protelomerase resolves a concatenated dimer of chromosomes as the last step of chromosome replication, converting a palindromic DNA sequence at the junctions between chromosomes into covalently closed hairpins. The mechanism by which protelomerase transforms a duplex DNA substrate into the hairpin telomeres remains largely unknown. We report here a series of crystal structures of the protelomerase TelA bound to DNA that represent distinct stages along the reaction pathway. The structures suggest that TelA converts a linear duplex substrate into hairpin turns via a transient strand-refolding intermediate that involves DNA-base flipping and wobble base-pairs. The extremely compact di-nucleotide hairpin structure of the product is fully stabilized by TelA prior to strand ligation, which drives the reaction to completion. The enzyme-catalyzed, multistep strand refolding is a novel mechanism in DNA rearrangement reactions. PMID:23382649

Cardiospecific CD36 suppression by lentivirus-mediated RNA interference prevents cardiac hypertrophy and systolic dysfunction in high-fat-diet induced obese mice.

PubMed

Zhang, Yijie; Bao, Mingwei; Dai, Mingyan; Wang, Xin; He, Wenbo; Tan, Tuantuan; Lin, Dandan; Wang, Wei; Wen, Ying; Zhang, Rui

2015-06-03

Fatty acid (FA) catabolism abnormality has been proved to play an important role in obesity-related cardiomyopathy. We hypothesized that cardiospecific suppression of CD36, the predominant membrane FA transporter, would protect against obesity-related cardiomyopathy. Four-wk-old male C57BL/6 J mice were fed with either high-fat-diet (HFD) or control-normal-diet for 2 wk. Then they were subjected to intramyocardial injection with recombinant lentiviral vectors containing short hairpin RNAs to selectively downregulate the expression of either cardiac CD36 or irrelevant gene by RNA interference. After a 10-wk continuation of the diet, biochemical, functional, morphological, histological, metabolic and molecular profiles were assessed. HFD administration elicited obesity, cardiac hypertrophy and systolic dysfunction accompanied with elevated serum levels of blood urea nitrogen (BUN), creatinine, fasting serum glucose (FSG), total cholesterol (TC) and triglyceride. Additionally, HFD consumption promoted lipid accumulation and reactive oxygen species (ROS) generation in the cardiomyocytes. Cardiospecific CD36 inhibition protected against HFD induced cardiac remodeling by decreasing heart/body weight ratio, increasing left ventricular (LV) ejection fraction and fractional shortening as well as normalizing LV diameter, without influencing body weight gain. Inhibition of cardiac CD36 also mitigated obesity induced alteration in BUN, creatinine and triglyceride, but had no effect on FSG or TC. Moreover, cardiospecific CD36 deficiency corrected myocardial lipid overaccumulation and intracellular ROS overproduction that were induced by HFD feeding. Cardiospecific CD36 inhibition protects against the aggravation of cardiac functional and morphological changes associated with HFD induced obesity. CD36 represents a potential therapeutic target for obesity cardiomyopathy.

RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.

PubMed

Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil

2017-01-01

Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.

Modeling the mechanism of CLN025 beta-hairpin formation

NASA Astrophysics Data System (ADS)

McKiernan, Keri A.; Husic, Brooke E.; Pande, Vijay S.

2017-09-01

Beta-hairpins are substructures found in proteins that can lend insight into more complex systems. Furthermore, the folding of beta-hairpins is a valuable test case for benchmarking experimental and theoretical methods. Here, we simulate the folding of CLN025, a miniprotein with a beta-hairpin structure, at its experimental melting temperature using a range of state-of-the-art protein force fields. We construct Markov state models in order to examine the thermodynamics, kinetics, mechanism, and rate-determining step of folding. Mechanistically, we find the folding process is rate-limited by the formation of the turn region hydrogen bonds, which occurs following the downhill hydrophobic collapse of the extended denatured protein. These results are presented in the context of established and contradictory theories of the beta-hairpin folding process. Furthermore, our analysis suggests that the AMBER-FB15 force field, at this temperature, best describes the characteristics of the full experimental CLN025 conformational ensemble, while the AMBER ff99SB-ILDN and CHARMM22* force fields display a tendency to overstabilize the native state.

Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies.

PubMed

Wang, Leo L; Burdick, Jason A

2017-01-01

It has been nearly two decades since RNA-interference (RNAi) was first reported. While there are no approved clinical uses, several phase II and III clinical trials suggest the great promise of RNAi therapeutics. One challenge for RNAi therapies is the controlled localization and sustained presentation to target tissues, to both overcome systemic toxicity concerns and to enhance in vivo efficacy. One approach that is emerging to address these limitations is the entrapment of RNAi molecules within hydrogels for local and sustained release. In these systems, nucleic acids are either delivered as siRNA conjugates or within nanoparticles. A plethora of hydrogels has been implemented using these approaches, including both traditional hydrogels that have already been developed for other applications and new hydrogels developed specifically for RNAi delivery. These hydrogels have been applied to various applications in vivo, including cancer, bone regeneration, inflammation and cardiac repair. This review will examine the design and implementation of such hydrogel RNAi systems and will cover the most recent applications of these systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Internal vs Fishhook Hairpin DNA: Unzipping Locations and Mechanisms in the α-Hemolysin Nanopore

PubMed Central

2015-01-01

Studies on the interaction of hairpin DNA with the α-hemolysin (α-HL) nanopore have determined hairpin unzipping kinetics, thermodynamics, and sequence-dependent DNA/protein interactions. Missing from these results is a systematic study comparing the unzipping process for fishhook (one-tail) vs internal (two-tail) hairpins when they are electrophoretically driven from the cis to the trans side of α-HL via a 30-mer single-stranded tail. In the current studies, fishhook hairpins showed long unzipping times with one deep blockage current level. In contrast, the internal hairpins demonstrated relatively fast unzipping and a characteristic pulse-like current pattern. These differences were further explored with respect to stem length and sequence context. Further, a series of internal hairpins with asymmetric tails were studied, for which it was determined that a second tail longer than 12 nucleotides results in internal hairpin unzipping behavior, while tail lengths of 6 nucleotides behaved like fishhook hairpins. Interestingly, these studies were able to resolve a current difference of ∼6% between hairpin DNA immobilized in the nanopore waiting to unzip vs the translocating unzipped DNA, with the latter showing a deeper current blockage level. This demonstration of different currents for immobilized and translocating DNA has not been described previously. These results were interpreted as fishhook hairpins unzipping inside the vestibule, while the internal hairpins unzip outside the vestibule of α-HL. Lastly, we used this knowledge to study the unzipping of a long double-stranded DNA (>50 base pairs) outside the vestibule of α-HL. The conclusions drawn from these studies are anticipated to be beneficial in future application of nanopore analysis of nucleic acids. PMID:25333648

Double-stranded RNA interferes in a sequence-specific manner with the infection of representative members of the two viroid families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo

2008-02-05

Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one ofmore » the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.« less

Peptide Inhibitors of the Amyloidogenesis of IAPP: Verification of the Hairpin Binding Geometry Hypothesis

PubMed Central

Sivanesam, Kalkena; Shu, Irene; Huggins, Kelly N. L.; Tatarek-Nossol, Marianna; Kapurniotu, Aphrodite; Andersen, Niels H.

2016-01-01

Versions of a previously discovered β-hairpin peptide inhibitor of IAPP aggregation that are stabilized in that conformation, or even forced to remain in the hairpin conformation by a backbone cyclization constraint, display superior activity as inhibitors. The cyclized hairpin, cyclo-WW2, displays inhibitory activity at sub-stoichiometric concentrations relative to this amyloidogenic peptide. The hairpin binding hypothesis stands confirmed. PMID:27317951

Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

PubMed Central

Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

2014-01-01

RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

RNA interference technology to control pest sea lampreys--a proof-of-concept.

PubMed

Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven

2014-01-01

The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.

RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept

PubMed Central

Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven

2014-01-01

The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485

Structural and sequence features of two residue turns in beta-hairpins.

PubMed

Madan, Bharat; Seo, Sung Yong; Lee, Sun-Gu

2014-09-01

Beta-turns in beta-hairpins have been implicated as important sites in protein folding. In particular, two residue β-turns, the most abundant connecting elements in beta-hairpins, have been a major target for engineering protein stability and folding. In this study, we attempted to investigate and update the structural and sequence properties of two residue turns in beta-hairpins with a large data set. For this, 3977 beta-turns were extracted from 2394 nonhomologous protein chains and analyzed. First, the distribution, dihedral angles and twists of two residue turn types were determined, and compared with previous data. The trend of turn type occurrence and most structural features of the turn types were similar to previous results, but for the first time Type II turns in beta-hairpins were identified. Second, sequence motifs for the turn types were devised based on amino acid positional potentials of two-residue turns, and their distributions were examined. From this study, we could identify code-like sequence motifs for the two residue beta-turn types. Finally, structural and sequence properties of beta-strands in the beta-hairpins were analyzed, which revealed that the beta-strands showed no specific sequence and structural patterns for turn types. The analytical results in this study are expected to be a reference in the engineering or design of beta-hairpin turn structures and sequences. © 2014 Wiley Periodicals, Inc.

Peptide Inhibitors of the amyloidogenesis of IAPP: verification of the hairpin-binding geometry hypothesis.

PubMed

Sivanesam, Kalkena; Shu, Irene; Huggins, Kelly N L; Tatarek-Nossol, Marianna; Kapurniotu, Aphrodite; Andersen, Niels H

2016-08-01

Versions of a previously discovered β-hairpin peptide inhibitor of IAPP aggregation that are stabilized in that conformation, or even forced to remain in the hairpin conformation by a backbone cyclization constraint, display superior activity as inhibitors. The cyclized hairpin, cyclo-WW2, displays inhibitory activity at substoichiometric concentrations relative to this amyloidogenic peptide. The hairpin-binding hypothesis stands confirmed. © 2016 Federation of European Biochemical Societies.

Correlation of RNA secondary structure statistics with thermodynamic stability and applications to folding.

PubMed

Wu, Johnny C; Gardner, David P; Ozer, Stuart; Gutell, Robin R; Ren, Pengyu

2009-08-28

The accurate prediction of the secondary and tertiary structure of an RNA with different folding algorithms is dependent on several factors, including the energy functions. However, an RNA higher-order structure cannot be predicted accurately from its sequence based on a limited set of energy parameters. The inter- and intramolecular forces between this RNA and other small molecules and macromolecules, in addition to other factors in the cell such as pH, ionic strength, and temperature, influence the complex dynamics associated with transition of a single stranded RNA to its secondary and tertiary structure. Since all of the factors that affect the formation of an RNAs 3D structure cannot be determined experimentally, statistically derived potential energy has been used in the prediction of protein structure. In the current work, we evaluate the statistical free energy of various secondary structure motifs, including base-pair stacks, hairpin loops, and internal loops, using their statistical frequency obtained from the comparative analysis of more than 50,000 RNA sequences stored in the RNA Comparative Analysis Database (rCAD) at the Comparative RNA Web (CRW) Site. Statistical energy was computed from the structural statistics for several datasets. While the statistical energy for a base-pair stack correlates with experimentally derived free energy values, suggesting a Boltzmann-like distribution, variation is observed between different molecules and their location on the phylogenetic tree of life. Our statistical energy values calculated for several structural elements were utilized in the Mfold RNA-folding algorithm. The combined statistical energy values for base-pair stacks, hairpins and internal loop flanks result in a significant improvement in the accuracy of secondary structure prediction; the hairpin flanks contribute the most.

[Expression of Jagged1 mRNA in human epithelial ovarian carcinoma tissues and effect of RNA interference of Jagged1 on growth of xenograft in nude mice].

PubMed

Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G

2016-06-25

To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (P<0.01). (2) The tumor volume was (491± 68) mm(3) and tumor mass was (2.6±0.4) g in Jagged1 interference group, which were significantly lower than that in the blank plasmid group [(842±88) mm(3) and (4.4±0.8) g, respectively] and that in the control group [(851±90) mm(3) and (4.5±0.9) g, respectively; P<0.05], the tumor inhibition rate was 42.2% in Jagged1 interference group, which was significantly higher than that in the blank plasmid group and that in the control group (2.2% and 0, respectively), the differences were

RNA interference as a method for target-site screening in the Western Corn Rootworm, Diabrotica virgifera virgifera

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most

Metamorphosis of a Hairpin Vortex into a Young Turbulent Spot

NASA Technical Reports Server (NTRS)

Singer, Bart A.; Joslin, Ronald D.

1995-01-01

Direct numerical simulation was used to study the formation and growth of a hairpin vortex in a flat-plate boundary layer and its later development into a young turbulent spot. Fluid injection through a slit in the wall triggered the initial vortex. The legs of the vortex were stretched into a hairpin shape as it traveled downstream. Multiple hairpin vortex heads developed between the stretched legs. New vortices formed beneath the streamwise-elongated vortex legs. The continued development of additional vortices resulted in the formation of a traveling region of highly disturbed ow with an arrowhead shape similar to that of a turbulent spot.

Emerging strategies for RNA interference (RNAi) applications in insects.

PubMed

Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W

2015-01-01

RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.

Modulating RNA Alignment Using Directional Dynamic Kinks: Application in Determining an Atomic-Resolution Ensemble for a Hairpin using NMR Residual Dipolar Couplings.

PubMed

Salmon, Loïc; Giambaşu, George M; Nikolova, Evgenia N; Petzold, Katja; Bhattacharya, Akash; Case, David A; Al-Hashimi, Hashim M

2015-10-14

Approaches that combine experimental data and computational molecular dynamics (MD) to determine atomic resolution ensembles of biomolecules require the measurement of abundant experimental data. NMR residual dipolar couplings (RDCs) carry rich dynamics information, however, difficulties in modulating overall alignment of nucleic acids have limited the ability to fully extract this information. We present a strategy for modulating RNA alignment that is based on introducing variable dynamic kinks in terminal helices. With this strategy, we measured seven sets of RDCs in a cUUCGg apical loop and used this rich data set to test the accuracy of an 0.8 μs MD simulation computed using the Amber ff10 force field as well as to determine an atomic resolution ensemble. The MD-generated ensemble quantitatively reproduces the measured RDCs, but selection of a sub-ensemble was required to satisfy the RDCs within error. The largest discrepancies between the RDC-selected and MD-generated ensembles are observed for the most flexible loop residues and backbone angles connecting the loop to the helix, with the RDC-selected ensemble resulting in more uniform dynamics. Comparison of the RDC-selected ensemble with NMR spin relaxation data suggests that the dynamics occurs on the ps-ns time scales as verified by measurements of R(1ρ) relaxation-dispersion data. The RDC-satisfying ensemble samples many conformations adopted by the hairpin in crystal structures indicating that intrinsic plasticity may play important roles in conformational adaptation. The approach presented here can be applied to test nucleic acid force fields and to characterize dynamics in diverse RNA motifs at atomic resolution.

Aedes aegypti uses RNA interference in defense against Sindbis virus infection.

PubMed

Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D

2008-03-17

RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.

RNA Interference of Gonadotropin-Inhibitory Hormone Gene Induces Arousal in Songbirds

PubMed Central

Ubuka, Takayoshi; Mukai, Motoko; Wolfe, Jordan; Beverly, Ryan; Clegg, Sarah; Wang, Ariel; Hsia, Serena; Li, Molly; Krause, Jesse S.; Mizuno, Takanobu; Fukuda, Yujiro; Tsutsui, Kazuyoshi; Bentley, George E.; Wingfield, John C.

2012-01-01

Gonadotropin-inhibitory hormone (GnIH) was originally identified in quail as a hypothalamic neuropeptide inhibitor of pituitary gonadotropin synthesis and release. However, GnIH neuronal fibers do not only terminate in the median eminence to control anterior pituitary function but also extend widely in the brain, suggesting it has multiple roles in the regulation of behavior. To identify the role of GnIH neurons in the regulation of behavior, we investigated the effect of RNA interference (RNAi) of the GnIH gene on the behavior of white-crowned sparrows, a highly social songbird species. Administration of small interfering RNA against GnIH precursor mRNA into the third ventricle of male and female birds reduced resting time, spontaneous production of complex vocalizations, and stimulated brief agonistic vocalizations. GnIH RNAi further enhanced song production of short duration in male birds when they were challenged by playbacks of novel male songs. These behaviors resembled those of breeding birds during territorial defense. The overall results suggest that GnIH gene silencing induces arousal. In addition, the activities of male and female birds were negatively correlated with GnIH mRNA expression in the paraventricular nucleus. Density of GnIH neuronal fibers in the ventral tegmental area was decreased by GnIH RNAi treatment in female birds, and the number of gonadotropin-releasing hormone neurons that received close appositions of GnIH neuronal fiber terminals was negatively correlated with the activity of male birds. In summary, GnIH may decrease arousal level resulting in the inhibition of specific motivated behavior such as in reproductive contexts. PMID:22279571

Hybridization-based biosensor containing hairpin probes and use thereof

DOEpatents

Miller, Benjamin L.; Strohsahl, Christopher M.

2010-10-12

A sensor chip that includes: a fluorescence quenching surface; a nucleic acid probe that contains first and second ends with the first end bound to the fluorescence quenching surface, and is characterized by being able to self-anneal into a hairpin conformation; and a first fluorophore bound to the second end of the first nucleic acid molecule. When the first nucleic acid molecule is in the hairpin conformation, the fluorescence quenching surface substantially quenches fluorescent emissions by the first fluorophore; and when the first nucleic acid molecule is in a non-hairpin conformation, fluorescent emissions by the fluorophore are substantially free of quenching by the fluorescence quenching surface. Various nucleic acid probes, methods of making the sensor chip, biological sensor devices that contain the sensor chip, and their methods of use are also disclosed.

The dawn of the RNA World: Toward functional complexity through ligation of random RNA oligomers

PubMed Central

Briones, Carlos; Stich, Michael; Manrubia, Susanna C.

2009-01-01

A main unsolved problem in the RNA World scenario for the origin of life is how a template-dependent RNA polymerase ribozyme emerged from short RNA oligomers obtained by random polymerization on mineral surfaces. A number of computational studies have shown that the structural repertoire yielded by that process is dominated by topologically simple structures, notably hairpin-like ones. A fraction of these could display RNA ligase activity and catalyze the assembly of larger, eventually functional RNA molecules retaining their previous modular structure: molecular complexity increases but template replication is absent. This allows us to build up a stepwise model of ligation-based, modular evolution that could pave the way to the emergence of a ribozyme with RNA replicase activity, step at which information-driven Darwinian evolution would be triggered. PMID:19318464

Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens

PubMed Central

Meliopoulos, Victoria A.; Andersen, Lauren E.; Birrer, Katherine F.; Simpson, Kaylene J.; Lowenthal, John W.; Bean, Andrew G. D.; Stambas, John; Stewart, Cameron R.; Tompkins, S. Mark; van Beusechem, Victor W.; Fraser, Iain; Mhlanga, Musa; Barichievy, Samantha; Smith, Queta; Leake, Devin; Karpilow, Jon; Buck, Amy; Jona, Ghil; Tripp, Ralph A.

2012-01-01

Influenza virus encodes only 11 viral proteins but replicates in a broad range of avian and mammalian species by exploiting host cell functions. Genome-wide RNA interference (RNAi) has proven to be a powerful tool for identifying the host molecules that participate in each step of virus replication. Meta-analysis of findings from genome-wide RNAi screens has shown influenza virus to be dependent on functional nodes in host cell pathways, requiring a wide variety of molecules and cellular proteins for replication. Because rapid evolution of the influenza A viruses persistently complicates the effectiveness of vaccines and therapeutics, a further understanding of the complex host cell pathways coopted by influenza virus for replication may provide new targets and strategies for antiviral therapy. RNAi genome screening technologies together with bioinformatics can provide the ability to rapidly identify specific host factors involved in resistance and susceptibility to influenza virus, allowing for novel disease intervention strategies.—Meliopoulos, V. A., Andersen, L. E., Birrer, K. F., Simpson, K. J., Lowenthal, J. W., Bean, A. G. D., Stambas, J., Stewart, C. R., Tompkins, S. M., van Beusechem, V. W., Fraser, I., Mhlanga, M., Barichievy, S., Smith, Q., Leake, D., Karpilow, J., Buck, A., Jona, G., Tripp, R. A. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens. PMID:22247330

Functional analysis of two polygalacturonase genes in Apolygus lucorum associated with eliciting plant injury using RNA interference.

PubMed

Zhang, Wanna; Liu, Bing; Lu, Yanhui; Liang, Gemei

2017-04-01

Salivary enzymes of many piercing-sucking insects lead to host plant injury. The salivary enzymes, polygalacturonase (PGs), act in insect feeding. PG family genes have been cloned from the mirid bug Apolygus lucorum, a pest of cotton and other host crops in China. We investigated the function of two PG genes that are highly expressed in A. lucorum nymphs (PG3-4) and adults (PG3-5), using siRNA injection-based RNA interference (RNAi). Accumulation of mRNA encoding both genes and their cognate proteins was significantly reduced (>60%) in experimental compared control green fluorescent protein (GFP) siRNA-treated mirids at 48 h post injection. Injury levels of cotton buds were also significantly reduced after injecting saliva isolated from PG3-4 and PG3-5 siRNA-treated A. lucorum. These results demonstrate that these two PG act in A. lucorum elicitation of plant injury. © 2017 Wiley Periodicals, Inc.

A member of the polymerase beta nucleotidyltransferase superfamily is required for RNA interference in C. elegans.

PubMed

Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C

2005-02-22

RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

PubMed Central

Schnare, M N; Gray, M W

1982-01-01

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

Visual detection of STAT5B gene expression in living cell using the hairpin DNA modified gold nanoparticle beacon.

PubMed

Xue, Jianpeng; Shan, Lingling; Chen, Haiyan; Li, Yang; Zhu, Hongyan; Deng, Dawei; Qian, Zhiyu; Achilefu, Samuel; Gu, Yueqing

2013-03-15

Signal transducer and activator of transcription 5B (STAT5B) is an important protein in JAK-STAT signaling pathway that is responsible for the metastasis and proliferation of tumor cells. Determination of the STAT5B messenger Ribonucleic Acid (mRNA) relating to the STAT5B expression provides insight into the mechanism of tumor progression. In this study, we designed and used a special hairpin deoxyribonucleic acid (DNA) for human STAT5B mRNA to functionalize gold nanoparticles, which served as a beacon for detecting human STAT5B expression. Up to 90% quenching efficiency was achieved. Upon hybridizing with the target mRNA, the hairpin DNA modified gold nanoparticle beacons (hDAuNP beacons) release the fluorophores attached at 5' end of the oligonucleotide sequence. The fluorescence properties of the beacon before and after the hybridization with the complementary DNA were confirmed in vitro. The stability of hDAuNP beacons against degradation by DNase I and GSH indicated that the prepared beacon is stable inside cells. The detected fluorescence in MCF-7 cancer cells correlates with the specific STAT5B mRNA expression, which is consistent with the result from PCR measurement. Fluorescence microscopy showed that the hDAuNP beacons internalized in cells without using transfection agents, with intracellular distribution in the cytoplasm rather than the nucleus. The results demonstrated that this beacon could directly provide quantitative measurement of the intracellular STAT5B mRNA in living cells. Compared to the previous approaches, this beacon has advantages of higher target to background ratio of detection and an increased resistance to nuclease degradation. The strategy reported in this study is a promising approach for the intracellular measurement of RNA or protein expression in living cells, and has great potential in the study of drug screening and discovery. Copyright © 2012 Elsevier B.V. All rights reserved.

General acid-base catalysis mediated by nucleobases in the hairpin ribozyme

PubMed Central

Kath-Schorr, Stephanie; Wilson, Timothy J.; Li, Nan-Sheng; Lu, Jun; Piccirilli, Joseph A.; Lilley, David M. J.

2012-01-01

The catalytic mechanism by which the hairpin ribozyme accelerates cleavage or ligation of the phosphodiester backbone of RNA has been incompletely understood. There is experimental evidence for an important role for an adenine (A38) and a guanine (G8), and it has been proposed that these act in general acid-base catalysis. In this work we show that a large reduction in cleavage rate on substitution of A38 by purine (A38P) can be reversed by replacement of the 5′-oxygen atom at the scissile phosphate by sulfur (5′-PS), which is a much better leaving group. This is consistent with A38 acting as the general acid in the unmodified ribozyme. The rate of cleavage of the 5′-PS substrate by the A38P ribozyme increases with pH log-linearly, indicative of a requirement for a deprotonated base with a relatively high pKa. On substitution of G8 by diaminopurine, the 5′-PS substrate cleavage rate at first increases with pH and then remains at a plateau, exhibiting an apparent pKa consistent with this nucleotide acting in general base catalysis. Alternative explanations for the pH dependence of hairpin ribozyme reactivity are discussed, from which we conclude that general acid-base catalysis by A38 and G8 is the simplest and most probable explanation consistent with all the experimental data. PMID:22958171

miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction

PubMed Central

Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A

2015-01-01

RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908

A hot-spot-active magnetic graphene oxide substrate for microRNA detection based on cascaded chemiluminescence resonance energy transfer.

PubMed

Bi, Sai; Chen, Min; Jia, Xiaoqiang; Dong, Ying

2015-02-28

Herein, a cascaded chemiluminescence resonance energy transfer (C-CRET) process was demonstrated from horseradish peroxidase (HRP)-mimicking DNAzyme-catalyzed luminol-H2O2 to fluorescein and further to graphene oxide (GO) when HRP-mimicking DNAzyme/fluorescein was in close proximity to the GO surface. The proposed C-CRET system was successfully implemented to construct three modes of C-CRET hot-spot-active substrates (modes I, II and III) by covalently immobilizing HRP-mimicking DNAzyme/fluorescein-labeled hairpin DNAs (hot-spot-generation probes) on magnetic GO (MGO), resulting in a signal "off" state due to the quenching of the luminol/H2O2/HRP-mimicking DNAzyme/fluorescein CRET system by GO. Upon the introduction of microRNA-122 (miRNA-122), the targets (mode I) or the new triggers that were generated through a strand displacement reaction (SDR) initiated by miRNA-122 (modes II and III) hybridized with the loop domains of hairpin probes on MGO to form double-stranded (modes I and II) or triplex-stem structures (mode III), causing an "open" configuration of the hairpin probe and a CRET signal "on" state, thus achieving sensitive and selective detection of miRNA-122. More importantly, the substrate exhibited excellent controllability, reversibility and reproducibility through SDR and magnetic separation (modes II and III), especially sequence-independence for hairpin probes in mode III, holding great potential for the development of a versatile platform for optical biosensing.

Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference

PubMed Central

Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara

2011-01-01

RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198

DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells

PubMed Central

Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan

2008-01-01

P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720

DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.

PubMed

Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan

2008-03-01

P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).

Drosha Promotes Splicing of a Pre-microRNA-like Alternative Exon

PubMed Central

Havens, Mallory A.; Reich, Ashley A.; Hastings, Michelle L.

2014-01-01

The ribonuclease III enzyme Drosha has a central role in the biogenesis of microRNA (miRNA) by binding and cleaving hairpin structures in primary RNA transcripts into precursor miRNAs (pre-miRNAs). Many miRNA genes are located within protein-coding host genes and cleaved by Drosha in a manner that is coincident with splicing of introns by the spliceosome. The close proximity of splicing and pre-miRNA biogenesis suggests a potential for co-regulation of miRNA and host gene expression, though this relationship is not completely understood. Here, we describe a cleavage-independent role for Drosha in the splicing of an exon that has a predicted hairpin structure resembling a Drosha substrate. We find that Drosha can cleave the alternatively spliced exon 5 of the eIF4H gene into a pre-miRNA both in vitro and in cells. However, the primary role of Drosha in eIF4H gene expression is to promote the splicing of exon 5. Drosha binds to the exon and enhances splicing in a manner that depends on RNA structure but not on cleavage by Drosha. We conclude that Drosha can function like a splicing enhancer and promote exon inclusion. Our results reveal a new mechanism of alternative splicing regulation involving a cleavage-independent role for Drosha in splicing. PMID:24786770

Miniature short hairpin RNA screens to characterize antiproliferative drugs.

PubMed

Kittanakom, Saranya; Arnoldo, Anthony; Brown, Kevin R; Wallace, Iain; Kunavisarut, Tada; Torti, Dax; Heisler, Lawrence E; Surendra, Anuradha; Moffat, Jason; Giaever, Guri; Nislow, Corey

2013-08-07

The application of new proteomics and genomics technologies support a view in which few drugs act solely by inhibiting a single cellular target. Indeed, drug activity is modulated by complex, often incompletely understood cellular mechanisms. Therefore, efforts to decipher mode of action through genetic perturbation such as RNAi typically yields "hits" that fall into several categories. Of particular interest to the present study, we aimed to characterize secondary activities of drugs on cells. Inhibiting a known target can result in clinically relevant synthetic phenotypes. In one scenario, drug perturbation could, for example, improperly activate a protein that normally inhibits a particular kinase. In other cases, additional, lower affinity targets can be inhibited as in the example of inhibition of c-Kit observed in Bcr-Abl-positive cells treated with Gleevec. Drug transport and metabolism also play an important role in the way any chemicals act within the cells. Finally, RNAi per se can also affect cell fitness by more general off-target effects, e.g., via the modulation of apoptosis or DNA damage repair. Regardless of the root cause of these unwanted effects, understanding the scope of a drug's activity and polypharmacology is essential for better understanding its mechanism(s) of action, and such information can guide development of improved therapies. We describe a rapid, cost-effective approach to characterize primary and secondary effects of small-molecules by using small-scale libraries of virally integrated short hairpin RNAs. We demonstrate this principle using a "minipool" composed of shRNAs that target the genes encoding the reported protein targets of approved drugs. Among the 28 known reported drug-target pairs, we successfully identify 40% of the targets described in the literature and uncover several unanticipated drug-target interactions based on drug-induced synthetic lethality. We provide a detailed protocol for performing such screens and for

Miniature Short Hairpin RNA Screens to Characterize Antiproliferative Drugs

PubMed Central

Kittanakom, Saranya; Arnoldo, Anthony; Brown, Kevin R.; Wallace, Iain; Kunavisarut, Tada; Torti, Dax; Heisler, Lawrence E.; Surendra, Anuradha; Moffat, Jason; Giaever, Guri; Nislow, Corey

2013-01-01

The application of new proteomics and genomics technologies support a view in which few drugs act solely by inhibiting a single cellular target. Indeed, drug activity is modulated by complex, often incompletely understood cellular mechanisms. Therefore, efforts to decipher mode of action through genetic perturbation such as RNAi typically yields “hits” that fall into several categories. Of particular interest to the present study, we aimed to characterize secondary activities of drugs on cells. Inhibiting a known target can result in clinically relevant synthetic phenotypes. In one scenario, drug perturbation could, for example, improperly activate a protein that normally inhibits a particular kinase. In other cases, additional, lower affinity targets can be inhibited as in the example of inhibition of c-Kit observed in Bcr-Abl−positive cells treated with Gleevec. Drug transport and metabolism also play an important role in the way any chemicals act within the cells. Finally, RNAi per se can also affect cell fitness by more general off-target effects, e.g., via the modulation of apoptosis or DNA damage repair. Regardless of the root cause of these unwanted effects, understanding the scope of a drug’s activity and polypharmacology is essential for better understanding its mechanism(s) of action, and such information can guide development of improved therapies. We describe a rapid, cost-effective approach to characterize primary and secondary effects of small-molecules by using small-scale libraries of virally integrated short hairpin RNAs. We demonstrate this principle using a “minipool” composed of shRNAs that target the genes encoding the reported protein targets of approved drugs. Among the 28 known reported drug−target pairs, we successfully identify 40% of the targets described in the literature and uncover several unanticipated drug−target interactions based on drug-induced synthetic lethality. We provide a detailed protocol for performing such

Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo.

PubMed

Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui

2013-12-01

We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.

PubMed

Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L

2016-12-05

Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.

Coupling an EML4-ALK centric interactome with RNA interference identifies sensitizers to ALK inhibitors

PubMed Central

Zhang, Guolin; Scarborough, Hannah; Kim, Jihye; Rozhok, Andrii I.; Chen, Y. Ann; Zhang, Xiaohui; Song, Lanxi; Bai, Yun; Fang, Bin; Liu, Richard Z.; Koomen, John; Tan, Aik Choon; Degregori, James; Haura, Eric B.

2017-01-01

Patients with lung cancers harboring anaplastic lymphoma kinase (ALK) gene fusions benefit from treatment with ALK kinase inhibitors but acquired resistance inevitably arises. A better understanding of proximal ALK signaling mechanisms may identify sensitizers to ALK inhibitors that disrupt the balance between pro-survival and pro-apoptotic effector signals. Using affinity purification coupled with mass spectrometry in an ALK fusion lung cancer cell line (H3122), we generated an ALK signaling network and investigated signaling activity using tyrosine phosphoproteomics. We identified a network of 464 proteins composed of subnetworks with differential response to ALK inhibitors. A small hairpin RNA screen targeting 407 proteins in this network revealed 64 and 9 proteins whose loss sensitized cells to crizotinib and alectinib, respectively. Among these, knocking down fibroblast growth factor receptor substrate 2 (FRS2) or coiled-coil and C2 domain-containing protein 1A (CC2D1A, both scaffolding proteins, sensitized multiple ALK fusion cell lines to the ALK inhibitors crizotinib and alectinib. Collectively, our data provides a resource that enhances our understanding of signaling and drug resistance networks consequent to ALK fusions, and identifies potential targets to improve the efficacy of ALK inhibitors in patients. PMID:27811184

RNA interference in the Asian Longhorned Beetle:Identification of Key RNAi Genes and Reference Genes for RT-qPCR

USDA-ARS?s Scientific Manuscript database

Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...

RNA interference-based therapeutics for inherited long QT syndrome.

PubMed

Li, Guoliang; Ma, Shuting; Sun, Chaofeng

2015-08-01

Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved.

RNA interference-based therapeutics for inherited long QT syndrome

PubMed Central

LI, GUOLIANG; MA, SHUTING; SUN, CHAOFENG

2015-01-01

Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved. PMID:26622327

Synthetic, structural mimetics of the β-hairpin flap of HIV-1 protease inhibit enzyme function.

PubMed

Chauhan, Jay; Chen, Shen-En; Fenstermacher, Katherine J; Naser-Tavakolian, Aurash; Reingewertz, Tali; Salmo, Rosene; Lee, Christian; Williams, Emori; Raje, Mithun; Sundberg, Eric; DeStefano, Jeffrey J; Freire, Ernesto; Fletcher, Steven

2015-11-01

Small-molecule mimetics of the β-hairpin flap of HIV-1 protease (HIV-1 PR) were designed based on a 1,4-benzodiazepine scaffold as a strategy to interfere with the flap-flap protein-protein interaction, which functions as a gated mechanism to control access to the active site. Michaelis-Menten kinetics suggested our small-molecules are competitive inhibitors, which indicates the mode of inhibition is through binding the active site or sterically blocking access to the active site and preventing flap closure, as designed. More generally, a new bioactive scaffold for HIV-1PR inhibition has been discovered, with the most potent compound inhibiting the protease with a modest K(i) of 11 μM. Copyright © 2015 Elsevier Ltd. All rights reserved.

16D10 siRNAs inhibit root-knot nematode infection in transgenic grape hairy roots

USDA-ARS?s Scientific Manuscript database

To develop a biotech-based solution for controlling Root-knot nematodes (RKNs) in grapes, we evaluated the efficacy of plant-derived RNA interference (RNAi) silencing of a conserved RKN effector gene, 16D10, for nematode resistance in transgenic grape hairy roots. Two hairpin-based silencing constru...

In silico molecular docking analysis of the human Argonaute 2 PAZ domain reveals insights into RNA interference.

PubMed

Kandeel, Mahmoud; Kitade, Yukio

2013-07-01

RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.

RNA interference-mediated NOTCH3 knockdown induces phenotype switching of vascular smooth muscle cells in vitro

PubMed Central

Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming

2015-01-01

Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway. PMID:26550181

RNA interference-mediated NOTCH3 knockdown induces phenotype switching of vascular smooth muscle cells in vitro.

PubMed

Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming

2015-01-01

Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway.

A label-free DNA hairpin biosensor for colorimetric detection of target with suitable functional DNA partners.

PubMed

Nie, Ji; Zhang, De-Wen; Tie, Cai; Zhou, Ying-Lin; Zhang, Xin-Xiang

2013-11-15

The combination of aptamer and peroxidase-mimicking DNAzyme within a hairpin structure can form a functional DNA probe. The activities of both aptamer (as biorecognition element) and DNAzyme (as signal amplification element) are blocked via base pairing in the hairpin structure. The presence of target triggers the opening of the hairpin to form target/aptamer complex and releases G-quadruplex sequence which can generate amplified colorimetric signals. In this work, we elaborated a universal and simple procedure to design an efficient and sensitive hairpin probe with suitable functional DNA partners. A fill-in-the-blank process was developed for sequence design, and two key points including the pretreatment of the hairpin probe and the selection of suitable signal transducer sequence were proved to enhance the detection sensitivity. Cocaine was chosen as a model target for a proof of concept. A series of hairpins with different numbers of base pairs in the stem region were prepared. Hairpin-C10 with ten base pairs was screened out and a lowest detectable cocaine concentration of 5 μM by colorimetry was obtained. The proposed functional DNA hairpin showed good selectivity and satisfactory analysis in spiked biologic fluid. The whole "mix-and-measure" detection based on DNA hairpin without the need of immobilization and labeling was indicated to be time and labor saving. The strategy has potential to be transplanted into more smart hairpins toward other targets for general application in bioanalytical chemistry. Copyright © 2013 Elsevier B.V. All rights reserved.

RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?

PubMed Central

Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N.

2016-01-01

The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term. PMID:26927085

RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?

PubMed

Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N

2016-02-26

The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term.

Thermodynamic stability of RNA structures formed by CNG trinucleotide repeats. Implication for prediction of RNA structure.

PubMed

Broda, Magdalena; Kierzek, Elzbieta; Gdaniec, Zofia; Kulinski, Tadeusz; Kierzek, Ryszard

2005-08-16

Trinucleotide repeat expansion diseases (TREDs) are correlated with elongation of CNG DNA and RNA repeats to pathological level. This paper shows, for the first time, complete data concerning thermodynamic stabilities of RNA with CNG trinucleotide repeats. Our studies include the stability of oligoribonucleotides composed of two to seven of CAG, CCG, CGG, and CUG repeats. The thermodynamic parameters of helix propagation correlated with the presence of multiple N-N mismatches within CNG RNA duplexes were also determined. Moreover, the total stability of CNG RNA hairpins, as well as the contribution of trinucleotide repeats placed only in the stem or loop regions, was evaluated. The improved thermodynamic parameters allow to predict much more accurately the thermodynamic stabilities and structures of CNG RNAs.

Expression and RNA interference of salivary polygalacturonase genes in the tarnished plant bug, Lygus lineolaris.

PubMed

Walker, William B; Allen, Margaret L

2010-01-01

Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris.

Expression and RNA Interference of Salivary Polygalacturonase Genes in the Tarnished Plant Bug, Lygus lineolaris

PubMed Central

Walker, William B.; Allen, Margaret L.

2010-01-01

Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris. PMID:21062205

RNA Interference Based Approach to Down Regulate Osmoregulators of Whitefly (Bemisia tabaci): Potential Technology for the Control of Whitefly

USDA-ARS?s Scientific Manuscript database

Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...

CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

PubMed

Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

2014-05-06

In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

RNA interference of carboxyesterases causes nymph mortality in the Asian citrus psyllid, Diaphorina citri.

PubMed

Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil

2017-03-01

Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.

The Impact of Small RNA Interference Against Homer1 on Rats with Type 2 Diabetes and ERK Phosphorylation.

PubMed

Lu, Jun; Gan, Jihong; Fu, Guoqiang; Ding, Lu; Zheng, Qiangsun

2015-12-01

The objective of the study is to evaluate Homer1 expression in rats with Type 2 diabetes mellitus (T2DM) and investigate the mechanism by which Homer1 influences the pathogenesis of diabetes through study on rat model with decreased Homer1 expression. Rat model of T2DM was constructed and blood insulin concentration was measured. Homer1 mRNA and protein expressions in rat pancreatic tissue were determined using RT-PCR as well as Western blotting. Homer1 expression in human monocytic THP-1 cells was interfered using short hairpin RNA, and its effect on phosphorylation of extracellular signal-regulated kinase (ERK) was assessed. Fasting glucose concentration in rat model of T2DM was significantly higher than that of normal rats (13.1 ± 2.4 vs 5.1 ± 1.1 mmol/L), and fasting blood insulin concentration of diabetic group was significantly lower than that of normal group (13.6 ± 1.9 18.3 ± 2.2 mIU/L) (P < 0.05). Homer1 mRNA and protein expressions in pancreatic tissue of rats with T2DM were significantly higher than those of normal rats (P < 0.05). Level of ERK phosphorylation in pancreatic tissue of rats with T2DM was significantly higher than that of normal rats. Homer1 mRNA level in rat pancreatic tissue of T2DM was positively correlated with the area of pancreatic islets (r = 0.526, P = 0.014). Homer1 mRNA level was significantly inhibited in high-glucose and high-fat stimulated human monotypic THP-1 cells with interfered Homer1. Compared with controls, P-ERK phosphorylation was significantly decreased in THP-1 cells with interfered Homer1 (P < 0.05). Homer1 can promote the progression of T2DM, which may be achieved through affecting ERK phosphorylation.

Competitive folding of RNA structures at a termination–antitermination site

PubMed Central