Establishment of conditional vectors for hairpin siRNA knockdowns
Matsukura, Shiro; Jones, Peter A.; Takai, Daiya
2003-01-01
Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529
Rode, Ambadas B; Endoh, Tamaki; Sugimoto, Naoki
2016-11-07
Non-coding RNAs play important roles in cellular homeostasis and are involved in many human diseases including cancer. Intermolecular RNA-RNA interactions are the basis for the diverse functions of many non-coding RNAs. Herein, we show how the presence of tRNA influences the equilibrium between hairpin and G-quadruplex conformations in the 5' untranslated regions of oncogenes and model sequences. Kinetic and equilibrium analyses of the hairpin to G-quadruplex conformational transition of purified RNA as well as during co-transcriptional folding indicate that tRNA significantly shifts the equilibrium toward the hairpin conformer. The enhancement of relative translation efficiency in a reporter gene assay is shown to be due to the tRNA-mediated shift in hairpin-G-quadruplex equilibrium of oncogenic mRNAs. Our findings suggest that tRNA is a possible therapeutic target in diseases in which RNA conformational equilibria is dysregulated. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ou-Yang, Fangqian; Luo, Qing-Jun; Zhang, Yue; Richardson, Casey R.; Jiang, Yingwen; Rock, Christopher D.
2013-01-01
microRNAs (miRNAs) are a class of small RNAs (sRNAs) of ~21 nucleotides (nt) in length processed from foldback hairpins by DICER-LIKE1 (DCL1) or DCL4. They regulate the expression of target mRNAs by base pairing through RNA-Induced Silencing Complex (RISC). In the RISC, ARGONAUTE1 (AGO1) is the key protein that cleaves miRNA targets at position ten of a miRNA:target duplex. The authenticity of many annotated rice miRNA hairpins is under debate because of their homology to repeat sequences. Some of them, like miR1884b, have been removed from the current release of miRBase based on incomplete information. In this study, we investigated the association of transposable element (TE)-derived miRNAs with typical miRNA pathways (DCL1/4- and AGO1-dependent) using publicly available deep sequencing datasets. Seven miRNA hairpins with 13 unique sRNAs were specifically enriched in AGO1 immunoprecipitation samples and relatively reduced in DCL1/4 knockdown genotypes. Interestingly, these species are ~21-nt long, instead of 24-nt as annotated in miRBase and the literature. Their expression profiles meet current criteria for functional annotation of miRNAs. In addition, diagnostic cleavage tags were found in degradome datasets for predicted target mRNAs. Most of these miRNA hairpins share significant homology with miniature inverted-repeat transposable elements (MITEs), one type of abundant DNA transposons in rice. Finally, the root-specific production of a 24 nt miRNA-like sRNA was confirmed by RNA blot for a novel EST that maps to the 3'-UTR of a candidate pseudogene showing extensive sequence homology to miR1884b hairpin. Our data are consistent with the hypothesis that TEs can serve as a driving force for the evolution of some MIRNAs, where co-opting of DICER-LIKE1/4 processing and integration into AGO1 could exapt transcribed TE-associated hairpins into typical miRNA pathways. PMID:23420033
Bhinder, Bhavneet; Antczak, Christophe; Ramirez, Christina N.; Shum, David; Liu-Sullivan, Nancy; Radu, Constantin; Frattini, Mark G.
2013-01-01
Abstract RNA interference technology is becoming an integral tool for target discovery and validation.; With perhaps the exception of only few studies published using arrayed short hairpin RNA (shRNA) libraries, most of the reports have been either against pooled siRNA or shRNA, or arrayed siRNA libraries. For this purpose, we have developed a workflow and performed an arrayed genome-scale shRNA lethality screen against the TRC1 library in HeLa cells. The resulting targets would be a valuable resource of candidates toward a better understanding of cellular homeostasis. Using a high-stringency hit nomination method encompassing criteria of at least three active hairpins per gene and filtered for potential off-target effects (OTEs), referred to as the Bhinder–Djaballah analysis method, we identified 1,252 lethal and 6 rescuer gene candidates, knockdown of which resulted in severe cell death or enhanced growth, respectively. Cross referencing individual hairpins with the TRC1 validated clone database, 239 of the 1,252 candidates were deemed independently validated with at least three validated clones. Through our systematic OTE analysis, we have identified 31 microRNAs (miRNAs) in lethal and 2 in rescuer genes; all having a seed heptamer mimic in the corresponding shRNA hairpins and likely cause of the OTE observed in our screen, perhaps unraveling a previously unknown plausible essentiality of these miRNAs in cellular viability. Taken together, we report on a methodology for performing large-scale arrayed shRNA screens, a comprehensive analysis method to nominate high-confidence hits, and a performance assessment of the TRC1 library highlighting the intracellular inefficiencies of shRNA processing in general. PMID:23198867
Stabilization of RNA hairpins using non-nucleotide linkers and circularization.
Kiliszek, Agnieszka; Blaszczyk, Leszek; Kierzek, Ryszard; Rypniewski, Wojciech
2017-06-02
An RNA hairpin is an essential structural element of RNA. Hairpins play crucial roles in gene expression and intermolecular recognition but are also involved in the pathogenesis of some congenital diseases. Structural studies of the hairpin motifs are impeded by their thermodynamic instability, as they tend to unfold to form duplexes, especially at high concentrations required for crystallography or nuclear magnetic resonance spectroscopy. We have elaborated techniques to stabilize the RNA hairpins by linking the free ends of the RNA strand at the base of the hairpin stem. One method involves stilbene diether or hexaethylene glycol linkers and circularization by T4 RNA ligase. Another method uses click chemistry to stitch the RNA ends with a triazole linker. Both techniques are efficient and easy to perform. They should be useful in making stable, biologically relevant RNA constructs for structural studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Constitutive Expression of Short Hairpin RNA in Vivo Triggers Buildup of Mature Hairpin Molecules
Ahn, M.; Witting, S.R.; Ruiz, R.; Saxena, R.
2011-01-01
Abstract RNA interference (RNAi) has become the cornerstone technology for studying gene function in mammalian cells. In addition, it is a promising therapeutic treatment for multiple human diseases. Virus-mediated constitutive expression of short hairpin RNA (shRNA) has the potential to provide a permanent source of silencing molecules to tissues, and it is being devised as a strategy for the treatment of liver conditions such as hepatitis B and hepatitis C virus infection. Unintended interaction between silencing molecules and cellular components, leading to toxic effects, has been described in vitro. Despite the enormous interest in using the RNAi technology for in vivo applications, little is known about the safety of constitutively expressing shRNA for multiple weeks. Here we report the effects of in vivo shRNA expression, using helper-dependent adenoviral vectors. We show that gene-specific knockdown is maintained for at least 6 weeks after injection of 1 × 1011 viral particles. Nonetheless, accumulation of mature shRNA molecules was observed up to weeks 3 and 4, and then declined gradually, suggesting the buildup of mature shRNA molecules induced cell death with concomitant loss of viral DNA and shRNA expression. No evidence of well-characterized innate immunity activation (such as interferon production) or saturation of the exportin-5 pathway was observed. Overall, our data suggest constitutive expression of shRNA results in accumulation of mature shRNA molecules, inducing cellular toxicity at late time points, despite the presence of gene silencing. PMID:21780944
Replacement of RNA hairpins by in vitro selected tetranucleotides.
Dichtl, B; Pan, T; DiRenzo, A B; Uhlenbeck, O C
1993-01-01
An in vitro selection method based on the autolytic cleavage of yeast tRNA(Phe) by Pb2+ was applied to obtain tRNA derivatives with the anticodon hairpin replaced by four single-stranded nucleotides. Based on the rates of the site-specific cleavage by Pb2+ and the presence of a specific UV-induced crosslink, certain tetranucleotide sequences allow proper folding of the rest of the tRNA molecule, whereas others do not. One such successful tetramer sequence was also used to replace the acceptor stem of yeast tRNA(Phe) and the anticodon hairpin of E.coli tRNA(Phe) without disrupting folding. These experiments suggest that certain tetramers may be able to replace structurally nonessential hairpins in any RNA. Images PMID:7680121
Free energy profile of RNA hairpins: a molecular dynamics simulation study.
Deng, Nan-Jie; Cieplak, Piotr
2010-02-17
RNA hairpin loops are one of the most abundant secondary structure elements and participate in RNA folding and protein-RNA recognition. To characterize the free energy surface of RNA hairpin folding at an atomic level, we calculated the potential of mean force (PMF) as a function of the end-to-end distance, by using umbrella sampling simulations in explicit solvent. Two RNA hairpins containing tetraloop cUUCGg and cUUUUg are studied with AMBER ff99 and CHARMM27 force fields. Experimentally, the UUCG hairpin is known to be significantly more stable than UUUU. In this study, the calculations using AMBER force field give a qualitatively correct description for the folding of two RNA hairpins, as the calculated PMF confirms the global stability of the folded structures and the resulting relative folding free energy is in quantitative agreement with the experimental result. The hairpin stabilities are also correctly differentiated by the more rapid molecular mechanics-Poisson Boltzmann-surface area approach, but the relative free energy estimated from this method is overestimated. The free energy profile shows that the native state basin and the unfolded state plateau are separated by a wide shoulder region, which samples a variety of native-like structures with frayed terminal basepair. The calculated PMF lacks major barriers that are expected near the transition regions, and this is attributed to the limitation of the 1-D reaction coordinate. The PMF results are compared with other studies of small RNA hairpins using kinetics method and coarse grained models. The two RNA hairpins described by CHARMM27 are significantly more deformable than those represented by AMBER. Compared with the AMBER results, the CHARMM27 calculated DeltaG(fold) for the UUUU tetraloop is in better agreement with the experimental results. However, the CHARMM27 calculation does not confirm the global stability of the experimental UUCG structure; instead, the extended conformations are predicted
Silencing GIRK4 expression in human atrial myocytes by adenovirus-delivered small hairpin RNA.
Liu, Xiongtao; Yang, Jian; Shang, Fujun; Hong, Changming; Guo, Wangang; Wang, Bing; Zheng, Qiangsun
2009-07-01
GIRK4 has been shown to be a subunit of I(KACh), and the use of GIRK4 in human atrial myocytes to treat arrhythmia remains an important research pursuit. Adenovirus-delivered small hairpin RNA (shRNA) has been used to mediate gene knockdown in mouse cardiocytes, yet there is no information on the successful application of this technique in human cardiocytes. In the current study, we used a siRNA validation system to select the most efficient sequence for silencing GIRK4. To this end, adenovirus-delivered shRNA, which expresses this sequence, was used to silence GIRK4 expression in human atrial myocytes. Finally, the feasibility, challenges, and results of silencing GIRK4 expression were evaluated by RT-PCR, western blotting, and the voltage-clamp technique. The levels of mRNA and protein were depressed significantly in cells infected by adenovirus-delivered shRNA against GIRK4, approximately 86.3% and 51.1% lower than those cells infected by adenovirus-delivered nonsense shRNA, respectively. At the same time, I(KACh) densities were decreased 53% by adenovirus-delivered shRNA against GIRK4. In summary, adenovirus-delivered shRNA against GIRK4 mediated efficient GIRK4 knockdown in human atrial myocytes and decreased I(KACh) densities. As such, these data indicated that adenovirus-delivered shRNA against GIRK4 is a potential tool for treating arrhythmia.
miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction
Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A
2015-01-01
RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908
A 2',2'-disulfide-bridged dinucleotide conformationally locks RNA hairpins.
Gauthier, Florian; Beltran, Frédéric; Biscans, Annabelle; Debart, Françoise; Dupouy, Christelle; Vasseur, Jean-Jacques
2018-05-02
The synthesis and the impact of a disulfide bridge between 2'-O-positions of two adjacent nucleotides in an RNA duplex and in the loop of RNA hairpins are reported. The incorporation of this 2',2'-disulfide (S-S) bridge enabled thermal and enzymatic stabilization of the hairpin depending on its position in the loop. The influence of the disulfide bridge on RNA folding was studied at the HIV Dimerization Initiation Site (DIS) as an RNA sequence model. We have shown that this S-S bridge locked the hairpin form, whereas the extended duplex form was generated after the reduction of the disulfide bond in the presence of tris(2-carboxyethyl)phosphine or glutathione. Thus, the S-S bridge can be useful for understanding RNA folding; an RNA molecular beacon locked by an S-S bridge was also investigated as a sensor for the detection of glutathione.
Ratajczak, Katarzyna; Krazinski, Bartlomiej E; Kowalczyk, Anna E; Dworakowska, Beata; Jakiela, Slawomir; Stobiecka, Magdalena
2018-05-07
Cancer biomarkers offer unique prospects for the development of cancer diagnostics and therapy. One of such biomarkers, protein survivin (Sur), exhibits strong antiapoptotic and proliferation-enhancing properties and is heavily expressed in multiple cancers. Thus, it can be utilized to provide new modalities for modulating the cell-growth rate, essential for effective cancer treatment. Herein, we have focused on the development of a new survivin-based cancer detection platform for colorectal cancer cells SW480 using a turn-on fluorescence oligonucleotide molecular beacon (MB) probe, encoded to recognize Sur messenger RNA (mRNA). Contrary to the expectations, we have found that both the complementary target oligonucleotide strands as well as the single- and double-mismatch targets, instead of exhibiting the anticipated simple random conformations, preferentially formed secondary structure motifs by folding into small-loop hairpin structures. Such a conformation may interfere with, or even undermine, the biorecognition process. To gain better understanding of the interactions involved, we have replaced the classical Tyagi-Kramer model of interactions between a straight target oligonucleotide strand and a hairpin MB with a new model to account for the hairpin-hairpin interactions as the biorecognition principle. A detailed mechanism of these interactions has been proposed. Furthermore, in experimental work, we have demonstrated an efficient transfection of malignant SW480 cells with SurMB probes containing a fluorophore Joe (SurMB-Joe) using liposomal nanocarriers. The green emission from SurMB-Joe in transfected cancer cells, due to the hybridization of the SurMB-Joe loop with Sur mRNA hairpin target, corroborates Sur overexpression. On the other hand, healthy human-colon epithelial cells CCD 841 CoN show only negligible expression of survivin mRNA. These experiments provide the proof-of-concept for distinguishing between the cancer and normal cells by the proposed
Energy landscapes, folding mechanisms, and kinetics of RNA tetraloop hairpins.
Chakraborty, Debayan; Collepardo-Guevara, Rosana; Wales, David J
2014-12-31
RNA hairpins play a pivotal role in a diverse range of cellular functions, and are integral components of ribozymes, mRNA, and riboswitches. However, the mechanistic and kinetic details of RNA hairpin folding, which are key determinants of most of its biological functions, are poorly understood. In this work, we use the discrete path sampling (DPS) approach to explore the energy landscapes of two RNA tetraloop hairpins, and provide insights into their folding mechanisms and kinetics in atomistic detail. Our results show that the potential energy landscapes have a distinct funnel-like bias toward the folded hairpin state, consistent with efficient structure-seeking properties. Mechanistic and kinetic information is analyzed in terms of kinetic transition networks. We find microsecond folding times, consistent with temperature jump experiments, for hairpin folding initiated from relatively compact unfolded states. This process is essentially driven by an initial collapse, followed by rapid zippering of the helix stem in the final phase. Much lower folding rates are predicted when the folding is initiated from extended chains, which undergo longer excursions on the energy landscape before nucleation events can occur. Our work therefore explains recent experiments and coarse-grained simulations, where the folding kinetics exhibit precisely this dependency on the initial conditions.
Bhinder, Bhavneet; Shum, David; Djaballah, Hakim
2014-02-01
RNAi screening in combination with the genome-sequencing projects would constitute the Holy Grail of modern genetics; enabling discovery and validation towards a better understanding of fundamental biology leading to novel targets to combat disease. Hit discordance at inter-screen level together with the lack of reproducibility is emerging as the technology's main pitfalls. To examine some of the underlining factors leading to such discrepancies, we reasoned that perhaps there is an inherent difference in knockdown efficiency of the various RNAi technologies. For this purpose, we utilized the two most popular ones, chemically synthesized siRNA duplex and plasmid-based shRNA hairpin, in order to perform a head to head comparison. Using a previously developed gain-of-function assay probing modulators of the miRNA biogenesis pathway, we first executed on a siRNA screen against the Silencer Select V4.0 library (AMB) nominating 1,273, followed by an shRNA screen against the TRC1 library (TRC1) nominating 497 gene candidates. We observed a poor overlap of only 29 hits given that there are 15,068 overlapping genes between the two libraries; with DROSHA as the only common hit out of the seven known core miRNA biogenesis genes. Distinct genes interacting with the same biogenesis regulators were observed in both screens, with a dismal cross-network overlap of only 3 genes (DROSHA, TGFBR1, and DIS3). Taken together, our study demonstrates differential knockdown activities between the two technologies, possibly due to the inefficient intracellular processing and potential cell-type specificity determinants in generating intended targeting sequences for the plasmid-based shRNA hairpins; and suggests this observed inefficiency as potential culprit in addressing the lack of reproducibility.
Nabzdyk, Christoph S; Lancero, Hope; Nguyen, Khanh P; Salek, Sherveen; Conte, Michael S
2011-11-01
Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G(2)/M fraction consistent with a mitotic defect; 4',6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G(2)/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular
Nabzdyk, Christoph S.; Lancero, Hope; Nguyen, Khanh P.; Salek, Sherveen
2011-01-01
Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G2/M fraction consistent with a mitotic defect; 4′,6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G2/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular injury
Expression of short hairpin RNAs using the compact architecture of retroviral microRNA genes.
Burke, James M; Kincaid, Rodney P; Aloisio, Francesca; Welch, Nicole; Sullivan, Christopher S
2017-09-29
Short hairpin RNAs (shRNAs) are effective in generating stable repression of gene expression. RNA polymerase III (RNAP III) type III promoters (U6 or H1) are typically used to drive shRNA expression. While useful for some knockdown applications, the robust expression of U6/H1-driven shRNAs can induce toxicity and generate heterogeneous small RNAs with undesirable off-target effects. Additionally, typical U6/H1 promoters encompass the majority of the ∼270 base pairs (bp) of vector space required for shRNA expression. This can limit the efficacy and/or number of delivery vector options, particularly when delivery of multiple gene/shRNA combinations is required. Here, we develop a compact shRNA (cshRNA) expression system based on retroviral microRNA (miRNA) gene architecture that uses RNAP III type II promoters. We demonstrate that cshRNAs coded from as little as 100 bps of total coding space can precisely generate small interfering RNAs (siRNAs) that are active in the RNA-induced silencing complex (RISC). We provide an algorithm with a user-friendly interface to design cshRNAs for desired target genes. This cshRNA expression system reduces the coding space required for shRNA expression by >2-fold as compared to the typical U6/H1 promoters, which may facilitate therapeutic RNAi applications where delivery vector space is limiting. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Investigation of RNA Hairpin Loop Folding with Time-Resolved Infrared Spectroscopy
NASA Astrophysics Data System (ADS)
Stancik, Aaron Lee
Ribonucleic acids (RNAs) are a group of functional biopolymers central to the molecular underpinnings of life. To complete the many processes they mediate, RNAs must fold into precise three-dimensional structures. Hairpin loops are the most ubiquitous and basic structural elements present in all folded RNAs, and are the foundation upon which all complex tertiary structures are built. A hairpin loop forms when a single stranded RNA molecule folds back on itself creating a helical stem of paired bases capped by a loop. This work investigates the formation of UNCG hairpin loops with the sequence 5'-GC(UNCG)GC-3' (N = A, U, G, or C) using both equilibrium infrared (IR) and time-resolved IR spectroscopy. Equilibrium IR melting data were used to determine thermodynamic parameters. Melting temperatures ranged from 50 to 60°C, and enthalpies of unfolding were on the order of 100 kJ/mol. In the time-resolved work, temperature jumps of up to 20°C at 2.5°C increments were obtained with transient relaxation kinetics spanning nanoseconds to hundreds of microseconds. The relaxation kinetics for all of the oligomers studied were fit to first or second order exponentials. Multiple vibrational transitions were probed on each oligomer for fully folded and partially denatured structures. In the time-resolved limit, in contrast to equilibrium melting, RNA does not fold according to two-state behavior. These results are some of the first to show that RNA hairpins fold according to a rugged energy landscape, which contradicts their relatively simple nature. In addition, this work has proven that time-resolved IR spectroscopy is a powerful and novel tool for investigating the earliest events of RNA folding, the formation of the hairpin loop.
A hairpin within YAP mRNA 3′UTR functions in regulation at post-transcription level
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, Yuen; Wang, Yuan; Feng, Jinyan
2015-04-03
The central dogma of gene expression is that DNA is transcribed into messenger RNAs, which in turn serve as the template for protein synthesis. Recently, it has been reported that mRNAs display regulatory roles that rely on their ability to compete for microRNA binding, independent of their protein-coding function. However, the regulatory mechanism of mRNAs remains poorly understood. Here, we report that a hairpin within YAP mRNA 3′untranslated region (3′UTR) functions in regulation at post-transcription level through generating endogenous siRNAs (esiRNAs). Bioinformatics analysis for secondary structure showed that YAP mRNA displayed a hairpin structure (termed standard hairpin, S-hairpin) within itsmore » 3′UTR. Surprisingly, we observed that the overexpression of S-hairpin derived from YAP 3′UTR (YAP-sh) increased the luciferase reporter activities of transcriptional factor NF-κB and AP-1 in 293T cells. Moreover, we identified that a fragment from YAP-sh, an esiRNA, was able to target mRNA 3′UTR of NF2 (a member of Hippo-signaling pathway) and YAP mRNA 3′UTR itself in hepatoma cells. Thus, we conclude that the YAP-sh within YAP mRNA 3′UTR may serve as a novel regulatory element, which functions in regulation at post-transcription level. Our finding provides new insights into the mechanism of mRNAs in regulatory function. - Highlights: • An S-hairpin within YAP mRNA 3′UTR possesses regulatory function. • YAP-sh acts as a regulatory element for YAP at post-transcription level. • YAP-sh-3p20, an esiRNA derived from YAP-sh, targets mRNAs of YAP and NF2. • YAP-sh-3p20 depresses the proliferation of HepG2 cells in vitro.« less
Analysis of hairpin RNA transgene-induced gene silencing in Fusarium oxysporum
2013-01-01
Background Hairpin RNA (hpRNA) transgenes can be effective at inducing RNA silencing and have been exploited as a powerful tool for gene function analysis in many organisms. However, in fungi, expression of hairpin RNA transcripts can induce post-transcriptional gene silencing, but in some species can also lead to transcriptional gene silencing, suggesting a more complex interplay of the two pathways at least in some fungi. Because many fungal species are important pathogens, RNA silencing is a powerful technique to understand gene function, particularly when gene knockouts are difficult to obtain. We investigated whether the plant pathogenic fungus Fusarium oxysporum possesses a functional gene silencing machinery and whether hairpin RNA transcripts can be employed to effectively induce gene silencing. Results Here we show that, in the phytopathogenic fungus F. oxysporum, hpRNA transgenes targeting either a β-glucuronidase (Gus) reporter transgene (hpGus) or the endogenous gene Frp1 (hpFrp) did not induce significant silencing of the target genes. Expression analysis suggested that the hpRNA transgenes are prone to transcriptional inactivation, resulting in low levels of hpRNA and siRNA production. However, the hpGus RNA can be efficiently transcribed by promoters acquired either by recombination with a pre-existing, actively transcribed Gus transgene or by fortuitous integration near an endogenous gene promoter allowing siRNA production. These siRNAs effectively induced silencing of a target Gus transgene, which in turn appeared to also induce secondary siRNA production. Furthermore, our results suggested that hpRNA transcripts without poly(A) tails are efficiently processed into siRNAs to induce gene silencing. A convergent promoter transgene, designed to express poly(A)-minus sense and antisense Gus RNAs, without an inverted-repeat DNA structure, induced consistent Gus silencing in F. oxysporum. Conclusions These results indicate that F. oxysporum possesses
Krol, Jacek; Sobczak, Krzysztof; Wilczynska, Urszula; Drath, Maria; Jasinska, Anna; Kaczynska, Danuta; Krzyzosiak, Wlodzimierz J
2004-10-01
We have established the structures of 10 human microRNA (miRNA) precursors using biochemical methods. Eight of these structures turned out to be different from those that were computer-predicted. The differences localized in the terminal loop region and at the opposite side of the precursor hairpin stem. We have analyzed the features of these structures from the perspectives of miRNA biogenesis and active strand selection. We demonstrated the different thermodynamic stability profiles for pre-miRNA hairpins harboring miRNAs at their 5'- and 3'-sides and discussed their functional implications. Our results showed that miRNA prediction based on predicted precursor structures may give ambiguous results, and the success rate is significantly higher for the experimentally determined structures. On the other hand, the differences between the predicted and experimentally determined structures did not affect the stability of termini produced through "conceptual dicing." This result confirms the value of thermodynamic analysis based on mfold as a predictor of strand section by RNAi-induced silencing complex (RISC).
Roden, Christine; Gaillard, Jonathan; Kanoria, Shaveta; Rennie, William; Barish, Syndi; Cheng, Jijun; Pan, Wen; Liu, Jun; Cotsapas, Chris; Ding, Ye; Lu, Jun
2017-01-01
Mature microRNAs (miRNAs) are processed from hairpin-containing primary miRNAs (pri-miRNAs). However, rules that distinguish pri-miRNAs from other hairpin-containing transcripts in the genome are incompletely understood. By developing a computational pipeline to systematically evaluate 30 structural and sequence features of mammalian RNA hairpins, we report several new rules that are preferentially utilized in miRNA hairpins and govern efficient pri-miRNA processing. We propose that a hairpin stem length of 36 ± 3 nt is optimal for pri-miRNA processing. We identify two bulge-depleted regions on the miRNA stem, located ∼16–21 nt and ∼28–32 nt from the base of the stem, that are less tolerant of unpaired bases. We further show that the CNNC primary sequence motif selectively enhances the processing of optimal-length hairpins. We predict that a small but significant fraction of human single-nucleotide polymorphisms (SNPs) alter pri-miRNA processing, and confirm several predictions experimentally including a disease-causing mutation. Our study enhances the rules governing mammalian pri-miRNA processing and suggests a diverse impact of human genetic variation on miRNA biogenesis. PMID:28087842
Piras, Bryan A; O'Connor, Daniel M; French, Brent A
2013-01-01
AAV9 is a powerful gene delivery vehicle capable of providing long-term gene expression in a variety of cell types, particularly cardiomyocytes. The use of AAV-delivery for RNA interference is an intense area of research, but a comprehensive analysis of knockdown in cardiac and liver tissues after systemic delivery of AAV9 has yet to be reported. We sought to address this question by using AAV9 to deliver a short-hairpin RNA targeting the enhanced green fluorescent protein (GFP) in transgenic mice that constitutively overexpress GFP in all tissues. The expression cassette was initially tested in vitro and we demonstrated a 61% reduction in mRNA and a 90% reduction in GFP protein in dual-transfected 293 cells. Next, the expression cassette was packaged as single-stranded genomes in AAV9 capsids to test cardiac GFP knockdown with several doses ranging from 1.8×10(10) to 1.8×10(11) viral genomes per mouse and a dose-dependent response was obtained. We then analyzed GFP expression in both heart and liver after delivery of 4.4×10(11) viral genomes per mouse. We found that while cardiac knockdown was highly efficient, with a 77% reduction in GFP mRNA and a 71% reduction in protein versus control-treated mice, there was no change in liver expression. This was despite a 4.5-fold greater number of viral genomes in the liver than in the heart. This study demonstrates that single-stranded AAV9 vectors expressing shRNA can be used to achieve highly efficient cardiac-selective knockdown of GFP expression that is sustained for at least 7 weeks after the systemic injection of 8 day old mice, with no change in liver expression and no evidence of liver damage despite high viral genome presence in the liver.
Genetically Encoded Catalytic Hairpin Assembly for Sensitive RNA Imaging in Live Cells.
Mudiyanselage, Aruni P K K Karunanayake; Yu, Qikun; Leon-Duque, Mark A; Zhao, Bin; Wu, Rigumula; You, Mingxu
2018-06-26
DNA and RNA nanotechnology has been used for the development of dynamic molecular devices. In particular, programmable enzyme-free nucleic acid circuits, such as catalytic hairpin assembly, have been demonstrated as useful tools for bioanalysis and to scale up system complexity to an extent beyond current cellular genetic circuits. However, the intracellular functions of most synthetic nucleic acid circuits have been hindered by challenges in the biological delivery and degradation. On the other hand, genetically encoded and transcribed RNA circuits emerge as alternative powerful tools for long-term embedded cellular analysis and regulation. Herein, we reported a genetically encoded RNA-based catalytic hairpin assembly circuit for sensitive RNA imaging inside living cells. The split version of Broccoli, a fluorogenic RNA aptamer, was used as the reporter. One target RNA can catalytically trigger the fluorescence from tens-to-hundreds of Broccoli. As a result, target RNAs can be sensitively detected. We have further engineered our circuit to allow easy programming to image various target RNA sequences. This design principle opens the arena for developing a large variety of genetically encoded RNA circuits for cellular applications.
Forced-Unfolding and Force-Quench Refolding of RNA Hairpins
Hyeon, Changbong; Thirumalai, D.
2006-01-01
Nanomanipulation of individual RNA molecules, using laser optical tweezers, has made it possible to infer the major features of their energy landscape. Time-dependent mechanical unfolding trajectories, measured at a constant stretching force (fS) of simple RNA structures (hairpins and three-helix junctions) sandwiched between RNA/DNA hybrid handles show that they unfold in a reversible all-or-none manner. To provide a molecular interpretation of the experiments we use a general coarse-grained off-lattice Gō-like model, in which each nucleotide is represented using three interaction sites. Using the coarse-grained model we have explored forced-unfolding of RNA hairpin as a function of fS and the loading rate (rf). The simulations and theoretical analysis have been done both with and without the handles that are explicitly modeled by semiflexible polymer chains. The mechanisms and timescales for denaturation by temperature jump and mechanical unfolding are vastly different. The directed perturbation of the native state by fS results in a sequential unfolding of the hairpin starting from their ends, whereas thermal denaturation occurs stochastically. From the dependence of the unfolding rates on rf and fS we show that the position of the unfolding transition state is not a constant but moves dramatically as either rf or fS is changed. The transition-state movements are interpreted by adopting the Hammond postulate for forced-unfolding. Forced-unfolding simulations of RNA, with handles attached to the two ends, show that the value of the unfolding force increases (especially at high pulling speeds) as the length of the handles increases. The pathways for refolding of RNA from stretched initial conformation, upon quenching fS to the quench force fQ, are highly heterogeneous. The refolding times, upon force-quench, are at least an order-of-magnitude greater than those obtained by temperature-quench. The long fQ-dependent refolding times starting from fully stretched
Merentie, Mari; Rissanen, Riina; Lottonen-Raikaslehto, Line; Huusko, Jenni; Gurzeler, Erika; Turunen, Mikko P; Holappa, Lari; Mäkinen, Petri; Ylä-Herttuala, Seppo
2018-01-01
Vascular endothelial growth factor-A (VEGF-A) is the master regulator of angiogenesis, vascular permeability and growth. However, its role in mature blood vessels is still not well understood. To better understand the role of VEGF-A in the adult vasculature, we generated a VEGF-A knockdown mouse model carrying a doxycycline (dox)-regulatable short hairpin RNA (shRNA) transgene, which silences VEGF-A. The aim was to find the critical level of VEGF-A reduction for vascular well-being in vivo. In vitro, the dox-inducible lentiviral shRNA vector decreased VEGF-A expression efficiently and dose-dependently in mouse endothelial cells and cardiomyocytes. In the generated transgenic mice plasma VEGF-A levels decreased shortly after the dox treatment but returned back to normal after two weeks. VEGF-A expression decreased shortly after the dox treatment only in some tissues. Surprisingly, increasing the dox exposure time and dose led to elevated VEGF-A expression in some tissues of both wildtype and knockdown mice, suggesting that dox itself has an effect on VEGF-A expression. When the effect of dox on VEGF-A levels was further tested in naïve/non-transduced cells, the dox administration led to a decreased VEGF-A expression in endothelial cells but to an increased expression in cardiomyocytes. In conclusion, the VEGF-A knockdown was achieved in a dox-regulatable fashion with a VEGF-A shRNA vector in vitro, but not in the knockdown mouse model in vivo. Dox itself was found to regulate VEGF-A expression explaining the unexpected results in mice. The effect of dox on VEGF-A levels might at least partly explain its previously reported beneficial effects on myocardial and brain ischemia. Also, this effect on VEGF-A should be taken into account in all studies using dox-regulated vectors.
Design of the hairpin ribozyme for targeting specific RNA sequences.
Hampel, A; DeYoung, M B; Galasinski, S; Siwkowski, A
1997-01-01
The following steps should be taken when designing the hairpin ribozyme to cleave a specific target sequence: 1. Select a target sequence containing BN*GUC where B is C, G, or U. 2. Select the target sequence in areas least likely to have extensive interfering structure. 3. Design the conventional hairpin ribozyme as shown in Fig. 1, such that it can form a 4 bp helix 2 and helix 1 lengths up to 10 bp. 4. Synthesize this ribozyme from single-stranded DNA templates with a double-stranded T7 promoter. 5. Prepare a series of short substrates capable of forming a range of helix 1 lengths of 5-10 bp. 6. Identify these by direct RNA sequencing. 7. Assay the extent of cleavage of each substrate to identify the optimal length of helix 1. 8. Prepare the hairpin tetraloop ribozyme to determine if catalytic efficiency can be improved.
Characterization of a transgenic short hairpin RNA-induced murine model of Tafazzin deficiency.
Soustek, Meghan S; Falk, Darin J; Mah, Cathryn S; Toth, Matthew J; Schlame, Michael; Lewin, Alfred S; Byrne, Barry J
2011-07-01
Barth's syndrome (BTHS) is an X-linked mitochondrial disease that is due to a mutation in the Tafazzin (TAZ) gene. Based on sequence homology, TAZ has been characterized as an acyltransferase involved in the metabolism of cardiolipin (CL), a unique phospholipid almost exclusively located in the mitochondrial inner membrane. Yeast, Drosophila, and zebrafish models have been invaluable in elucidating the role of TAZ in BTHS, but until recently a mammalian model to study the disease has been lacking. Based on in vitro evidence of RNA-mediated TAZ depletion, an inducible short hairpin RNA (shRNA)-mediated TAZ knockdown (TAZKD) mouse model has been developed (TaconicArtemis GmbH, Cologne, Germany), and herein we describe the assessment of this mouse line as a model of BTHS. Upon induction of the TAZ-specific shRNA in vivo, transgenic mouse TAZ mRNA levels were reduced by >89% in cardiac and skeletal muscle. TAZ deficiency led to the absence of tetralineoyl-CL and accumulation of monolyso-CL in cardiac muscle. Furthermore, mitochondrial morphology from cardiac and skeletal muscle was altered. Skeletal muscle mitochondria demonstrated disrupted cristae, and cardiac mitochondria were significantly enlarged and displace neighboring myofibrils. Physiological measurements demonstrated a reduction in isometric contractile strength of the soleus and a reduction in cardiac left ventricular ejection fraction of TAZKD mice compared with control animals. Therefore, the inducible TAZ-deficient model exhibits some of the molecular and clinical characteristics of BTHS patients and may ultimately help to improve our understanding of BTHS-related cardioskeletal myopathy as well as serve as an important tool in developing therapeutic strategies for BTHS.
Free-energy landscape of RNA hairpins constructed via dihedral angle principal component analysis.
Riccardi, Laura; Nguyen, Phuong H; Stock, Gerhard
2009-12-31
To systematically construct a low-dimensional free-energy landscape of RNA systems from a classical molecular dynamics simulation, various versions of the principal component analysis (PCA) are compared: the cPCA using the Cartesian coordinates of all atoms, the dPCA using the sine/cosine-transformed six backbone dihedral angles as well as the glycosidic torsional angle chi and the pseudorotational angle P, the aPCA which ignores the circularity of the 6 + 2 dihedral angles of the RNA, and the dPCA(etatheta), which approximates the 6 backbone dihedral angles by 2 pseudotorsional angles eta and theta. As representative examples, a 10-nucleotide UUCG hairpin and the 36-nucleotide segment SL1 of the Psi site of HIV-1 are studied by classical molecular dynamics simulation, using the Amber all-atom force field and explicit solvent. It is shown that the conformational heterogeneity of the RNA hairpins can only be resolved by an angular PCA such as the dPCA but not by the cPCA using Cartesian coordinates. Apart from possible artifacts due to the coupling of overall and internal motion, this is because the details of hydrogen bonding and stacking interactions but also of global structural rearrangements of the RNA are better discriminated by dihedral angles. In line with recent experiments, it is found that the free energy landscape of RNA hairpins is quite rugged and contains various metastable conformational states which may serve as an intermediate for unfolding.
Santangeloyz, K.S.; Bertoneyz, A.L.
2011-01-01
summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this
Santangelo, K S; Bertone, A L
2011-12-01
To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted
Short hairpin RNA interference therapy for ischemic heart disease.
Huang, Mei; Chan, Denise A; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C; Chen, Xiaoyuan; Giaccia, Amato J; Wu, Joseph C
2008-09-30
During hypoxia, upregulation of hypoxia inducible factor-1 alpha transcriptional factor can activate several downstream angiogenic genes. However, hypoxia inducible factor-1 alpha is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. PHD2 was cloned from mouse embryonic stem cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter followed by a separate hypoxia response element-incorporated promoter driving a firefly luciferase reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared with the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of hypoxia inducible factor-1 alpha protein and several downstream angiogenic genes by >30% (P<0.01). Afterward, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending artery in mice. Animals were randomized into shPHD2 experimental group (n=25) versus shScramble control group (n=20). Bioluminescence imaging detected plasmid-mediated transgene expression for 4 to 5 weeks. Echocardiography showed the shPHD2 group had improved fractional shortening compared with the shScramble group at Week 4 (33.7%+/-1.9% versus 28.4%+/-2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot analysis of explanted hearts also confirmed that animals treated with shPHD2 had significantly higher levels of hypoxia inducible factor-1 alpha protein. This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by
Xia, Xiaodong; Hao, Yuanqiang; Hu, Shengqiang; Wang, Jianxiu
2014-01-15
A facile strategy for the assay of target miRNA using fluorescent silver nanoclusters (AgNCs) has been described. Due to the preferable interaction between cytosine residues and Ag(+), a short cytosine-rich oligonucleotide (ODN) with only six bases 5'-TCCCCC-3' served as an efficient scaffold for the creation of the AgNCs. The AgNCs displayed a bright red emission when excited at 545nm. Such ODN base-stabilized AgNCs have been exploited for miRNA sensing. Overhangs of TCC at the 5' end (5'-TCC) and CCC at the 3' end (CCC-3') (denoted as 5'-TCC/CCC-3') appended to the hairpin ODN probe which also contains recognition sequences for target miRNA were included. Interestingly, the AgNCs/hairpin ODN probe showed similar spectral properties as that templated by 5'-TCCCCC-3'. The formation of the hairpin ODN probe/miRNA duplex separated the 5'-TCC/CCC-3' overhangs, thus disturbing the optical property or structure of the AgNCs. As a result, fluorescence quenching of the AgNCs/hairpin ODN probe was obtained, which allows for facile determination of target miRNA. The proposed method is simple and cost-effective, holding great promise for clinical applications. Copyright © 2013 Elsevier B.V. All rights reserved.
Transcriptional and phenotypic comparisons of Ppara knockout and siRNA knockdown mice
De Souza, Angus T.; Dai, Xudong; Spencer, Andrew G.; Reppen, Tom; Menzie, Ann; Roesch, Paula L.; He, Yudong; Caguyong, Michelle J.; Bloomer, Sherri; Herweijer, Hans; Wolff, Jon A.; Hagstrom, James E.; Lewis, David L.; Linsley, Peter S.; Ulrich, Roger G.
2006-01-01
RNA interference (RNAi) has great potential as a tool for studying gene function in mammals. However, the specificity and magnitude of the in vivo response to RNAi remains to be fully characterized. A molecular and phenotypic comparison of a genetic knockout mouse and the corresponding knockdown version would help clarify the utility of the RNAi approach. Here, we used hydrodynamic delivery of small interfering RNA (siRNA) to knockdown peroxisome proliferator activated receptor alpha (Ppara), a gene that is central to the regulation of fatty acid metabolism. We found that Ppara knockdown in the liver results in a transcript profile and metabolic phenotype that is comparable to those of Ppara−/− mice. Combining the profiles from mice treated with the PPARα agonist fenofibrate, we confirmed the specificity of the RNAi response and identified candidate genes proximal to PPARα regulation. Ppara knockdown animals developed hypoglycemia and hypertriglyceridemia, phenotypes observed in Ppara−/− mice. In contrast to Ppara−/− mice, fasting was not required to uncover these phenotypes. Together, these data validate the utility of the RNAi approach and suggest that siRNA can be used as a complement to classical knockout technology in gene function studies. PMID:16945951
Ray-Soni, Ananya; Mooney, Rachel A; Landick, Robert
2017-10-31
In bacteria, intrinsic termination signals cause disassembly of the highly stable elongating transcription complex (EC) over windows of two to three nucleotides after kilobases of RNA synthesis. Intrinsic termination is caused by the formation of a nascent RNA hairpin adjacent to a weak RNA-DNA hybrid within RNA polymerase (RNAP). Although the contributions of RNA and DNA sequences to termination are largely understood, the roles of conformational changes in RNAP are less well described. The polymorphous trigger loop (TL), which folds into the trigger helices to promote nucleotide addition, also is proposed to drive termination by folding into the trigger helices and contacting the terminator hairpin after invasion of the hairpin in the RNAP main cleft [Epshtein V, Cardinale CJ, Ruckenstein AE, Borukhov S, Nudler E (2007) Mol Cell 28:991-1001]. To investigate the contribution of the TL to intrinsic termination, we developed a kinetic assay that distinguishes effects of TL alterations on the rate at which ECs terminate from effects of the TL on the nucleotide addition rate that indirectly affect termination efficiency by altering the time window in which termination can occur. We confirmed that the TL stimulates termination rate, but found that stabilizing either the folded or unfolded TL conformation decreased termination rate. We propose that conformational fluctuations of the TL (TL dynamics), not TL-hairpin contact, aid termination by increasing EC conformational diversity and thus access to favorable termination pathways. We also report that the TL and the TL sequence insertion (SI3) increase overall termination efficiency by stimulating pausing, which increases the flux of ECs into the termination pathway. Published under the PNAS license.
Short hairpin RNA interference therapy for ischemic heart disease
Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.
2013-01-01
Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to
Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.
2013-01-01
Malignant neuroblastomas mostly occur in children and are frequently associated with N-Myc amplification. Oncogene amplification, which is selective increase in copy number of the oncogene, provides survival advantages in solid tumors including malignant neuroblastoma. We have decreased expression of N-Myc oncogene using short hairpin RNA (shRNA) plasmid to increase anti-tumor efficacy of the isoflavonoid apigenin (APG) in human malignant neuroblastoma SK-N-DZ and SK-N-BE2 cell lines that harbor N-Myc amplification. N-Myc knockdown induced morphological and biochemical features of neuronal differentiation. Combination of N-Myc knockdown and APG most effectively induced morphological and biochemical features of apoptotic death. This combination therapy also prevented cell migration and decreased N-Myc driven survival, angiogenic, and invasive factors. Collectively, N-Myc knockdown and APG treatment is a promising strategy for controlling the growth of human malignant neuroblastoma cell lines that harbor N-Myc amplification. PMID:23941992
Hossain, Md Motarab; Banik, Naren L; Ray, Swapan K
2013-10-15
Malignant neuroblastomas mostly occur in children and are frequently associated with N-Myc amplification. Oncogene amplification, which is selective increase in copy number of the oncogene, provides survival advantages in solid tumors including malignant neuroblastoma. We have decreased expression of N-Myc oncogene using short hairpin RNA (shRNA) plasmid to increase anti-tumor efficacy of the isoflavonoid apigenin (APG) in human malignant neuroblastoma SK-N-DZ and SK-N-BE2 cell lines that harbor N-Myc amplification. N-Myc knockdown induced morphological and biochemical features of neuronal differentiation. Combination of N-Myc knockdown and APG most effectively induced morphological and biochemical features of apoptotic death. This combination therapy also prevented cell migration and decreased N-Myc driven survival, angiogenic, and invasive factors. Collectively, N-Myc knockdown and APG treatment is a promising strategy for controlling the growth of human malignant neuroblastoma cell lines that harbor N-Myc amplification. © 2013 Elsevier B.V. All rights reserved.
Rhee, Sung W; Stimers, Joseph R; Wang, Wenze; Pang, Li
2009-05-01
In different rodent models of hypertension, vascular voltage-gated L-type calcium channel (Ca(L)) current and vascular tone is increased because of increased expression of the noncardiac form of the Ca(L) (Ca(v)1.2). The objective of this study was to develop a small interfering RNA (siRNA) expression system against the noncardiac form of Ca(v)1.2 to reduce its expression in vascular smooth muscle cells (VSMCs). siRNAs expressing plasmids and appropriate controls were constructed and first screened in human embryonic kidney (HEK) 293 cells cotransfected with a rat Ca(v)1.2 expression vector. The most effective gene silencing was achieved with a modified mir-30a-based short hairpin RNA (shRNAmir) driven by the cytomegalovirus promoter. In A7r5 cells, a vascular smooth muscle cell line, two copies of shRNAmir driven by a chimeric VSMC-specific enhancer/promoter reduced endogenous Ca(v)1.2 expression by 61% and decreased the Ca(L) current carried by barium by 47%. Moreover, the chimeric vascular smooth muscle-specific enhancer/promoter displayed almost no activity in non-VSMCs (PC-12 and HEK 293). Because the proposed siRNA was designed to only target the noncardiac form of Ca(v)1.2, it did not affect the Ca(L) expression and function in cultured cardiomyocytes, even when driven by a stronger cytomegalovirus promoter. In conclusion, vascular Ca(v)1.2 expression and function were effectively reduced by VSMC-specific delivery of the noncardiac form of Ca(v)1.2 siRNA without similarly affecting cardiac Ca(L) expression and function. When coupled with a viral vector, this molecular intervention in vivo may provide a novel long-term vascular-specific gene therapy for hypertension.
Rhee, Sung W.; Stimers, Joseph R.; Wang, Wenze; Pang, Li
2009-01-01
In different rodent models of hypertension, vascular voltage-gated L-type calcium channel (CaL) current and vascular tone is increased because of increased expression of the noncardiac form of the CaL (Cav1.2). The objective of this study was to develop a small interfering RNA (siRNA) expression system against the noncardiac form of Cav1.2 to reduce its expression in vascular smooth muscle cells (VSMCs). siRNAs expressing plasmids and appropriate controls were constructed and first screened in human embryonic kidney (HEK) 293 cells cotransfected with a rat Cav1.2 expression vector. The most effective gene silencing was achieved with a modified mir-30a-based short hairpin RNA (shRNAmir) driven by the cytomegalovirus promoter. In A7r5 cells, a vascular smooth muscle cell line, two copies of shRNAmir driven by a chimeric VSMC-specific enhancer/promoter reduced endogenous Cav1.2 expression by 61% and decreased the CaL current carried by barium by 47%. Moreover, the chimeric vascular smooth muscle-specific enhancer/promoter displayed almost no activity in non-VSMCs (PC-12 and HEK 293). Because the proposed siRNA was designed to only target the noncardiac form of Cav1.2, it did not affect the CaL expression and function in cultured cardiomyocytes, even when driven by a stronger cytomegalovirus promoter. In conclusion, vascular Cav1.2 expression and function were effectively reduced by VSMC-specific delivery of the noncardiac form of Cav1.2 siRNA without similarly affecting cardiac CaL expression and function. When coupled with a viral vector, this molecular intervention in vivo may provide a novel long-term vascular-specific gene therapy for hypertension. PMID:19244098
RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells
Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V
2006-01-01
Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456
Ray-Soni, Ananya; Mooney, Rachel A.; Landick, Robert
2017-01-01
In bacteria, intrinsic termination signals cause disassembly of the highly stable elongating transcription complex (EC) over windows of two to three nucleotides after kilobases of RNA synthesis. Intrinsic termination is caused by the formation of a nascent RNA hairpin adjacent to a weak RNA−DNA hybrid within RNA polymerase (RNAP). Although the contributions of RNA and DNA sequences to termination are largely understood, the roles of conformational changes in RNAP are less well described. The polymorphous trigger loop (TL), which folds into the trigger helices to promote nucleotide addition, also is proposed to drive termination by folding into the trigger helices and contacting the terminator hairpin after invasion of the hairpin in the RNAP main cleft [Epshtein V, Cardinale CJ, Ruckenstein AE, Borukhov S, Nudler E (2007) Mol Cell 28:991–1001]. To investigate the contribution of the TL to intrinsic termination, we developed a kinetic assay that distinguishes effects of TL alterations on the rate at which ECs terminate from effects of the TL on the nucleotide addition rate that indirectly affect termination efficiency by altering the time window in which termination can occur. We confirmed that the TL stimulates termination rate, but found that stabilizing either the folded or unfolded TL conformation decreased termination rate. We propose that conformational fluctuations of the TL (TL dynamics), not TL-hairpin contact, aid termination by increasing EC conformational diversity and thus access to favorable termination pathways. We also report that the TL and the TL sequence insertion (SI3) increase overall termination efficiency by stimulating pausing, which increases the flux of ECs into the termination pathway. PMID:29078293
Ribonucleic acid interference knockdown of interleukin 6 attenuates cold-induced hypertension.
Crosswhite, Patrick; Sun, Zhongjie
2010-06-01
The purpose of this study was to determine the role of the proinflammatory cytokine interleukin (IL) 6 in cold-induced hypertension. Four groups of male Sprague-Dawley rats were used (6 rats per group). After blood pressure was stabilized, 3 groups received intravenous delivery of adenoassociated virus carrying IL-6 small hairpin RNA (shRNA), adenoassociated virus carrying scrambled shRNA, and PBS, respectively, before exposure to a cold environment (5 degrees C). The last group received PBS and was kept at room temperature (25 degrees C, warm) as a control. Adenoassociated virus delivery of IL-6 shRNA significantly attenuated cold-induced elevation of systolic blood pressure and kept it at the control level for < or =7 weeks (length of the study). Chronic exposure to cold upregulated IL-6 expression in aorta, heart, and kidneys and increased macrophage and T-cell infiltration in kidneys, suggesting that cold exposure increases inflammation. IL-6 shRNA delivery abolished the cold-induced upregulation of IL-6, indicating effective silence of IL-6. Interestingly, RNA interference knockdown of IL-6 prevented cold-induced inflammation, as evidenced by a complete inhibition of tumor necrosis factor-alpha expression and leukocyte infiltration by IL-6 shRNA. RNA interference knockdown of IL-6 significantly decreased the cold-induced increase in vascular superoxide production. It is noted that IL-6 shRNA abolished the cold-induced increase in collagen deposition in the heart, suggesting that inflammation is involved in cold-induced cardiac remodeling. Cold exposure caused glomerular collapses, which could be prevented by knockdown of IL-6, suggesting an important role of inflammation in cold-induced renal damage. In conclusion, cold exposure increased IL-6 expression and inflammation, which play critical roles in the pathogenesis of cold-induced hypertension and cardiac and renal damage.
Cohen, Ami; Whitfield, Timothy W; Kreifeldt, Max; Koebel, Pascale; Kieffer, Brigitte L; Contet, Candice; George, Olivier; Koob, George F
2014-01-01
Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn), are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc) mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV) vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn) or a scrambled shRNA (AAV-shScr) as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST). Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p.), followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.
Selective gene silencing by viral delivery of short hairpin RNA
2010-01-01
RNA interference (RNAi) technology has not only become a powerful tool for functional genomics, but also allows rapid drug target discovery and in vitro validation of these targets in cell culture. Furthermore, RNAi represents a promising novel therapeutic option for treating human diseases, in particular cancer. Selective gene silencing by RNAi can be achieved essentially by two nucleic acid based methods: i) cytoplasmic delivery of short double-stranded (ds) interfering RNA oligonucleotides (siRNA), where the gene silencing effect is only transient in nature, and possibly not suitable for all applications; or ii) nuclear delivery of gene expression cassettes that express short hairpin RNA (shRNA), which are processed like endogenous interfering RNA and lead to stable gene down-regulation. Both processes involve the use of nucleic acid based drugs, which are highly charged and do not cross cell membranes by free diffusion. Therefore, in vivo delivery of RNAi therapeutics must use technology that enables the RNAi therapeutic to traverse biological membrane barriers in vivo. Viruses and the vectors derived from them carry out precisely this task and have become a major delivery system for shRNA. Here, we summarize and compare different currently used viral delivery systems, give examples of in vivo applications, and indicate trends for new developments, such as replicating viruses for shRNA delivery to cancer cells. PMID:20858246
Crosswhite, Patrick; Chen, Kai; Sun, Zhongjie
2014-11-01
Cold temperatures are associated with increased mortality and morbidity of cardiovascular and pulmonary disease. Cold exposure causes lung inflammation, pulmonary hypertension (PH), and right ventricle hypertrophy, but there is no effective therapy because of unknown mechanism. Here, we investigated whether RNA interference silencing of tumor necrosis factor (TNF)-α decreases cold-induced macrophage infiltration, PH, and pulmonary arterial (PA) remodeling. We found for the first time that continuous cold exposure (5.0°C) increased TNF-α expression and macrophage infiltration in the lungs and PAs right before elevation of right ventricle systolic pressure. The in vivo RNA interference silencing of TNF-α was achieved by intravenous delivery of recombinant AAV-2 carrying TNF-α short hairpin small-interfering RNA 24 hours before cold exposure. Cold exposure for 8 weeks significantly increased right ventricle pressure compared with the warm controls (40.19±4.9 versus 22.9±1.1 mm Hg), indicating that cold exposure caused PH. Cold exposure increased TNF-α, interleukin-6, and phosphodiesterase-1C protein expression in the lungs and PAs and increased lung macrophage infiltration. Notably, TNF-α short hairpin small-interfering RNA prevented the cold-induced increases in TNF-α, interleukin-6, and phosphodiesterase-1C protein expression, abolished lung macrophage infiltration, and attenuated PH (26.28±1.6 mm Hg), PA remodeling, and right ventricle hypertrophy. PA smooth muscle cells isolated from cold-exposed animals showed increased intracellular superoxide levels and cell proliferation along with decreased intracellular cGMP. These cold-induced changes were prevented by TNF-α short hairpin small-interfering RNA. In conclusions, upregulation of TNF-α played a critical role in the pathogenesis of cold-induced PH by promoting pulmonary macrophage infiltration and inflammation. AAV delivery of TNF-α short hairpin small-interfering RNA may be an effective
AKI after Conditional and Kidney-Specific Knockdown of Stanniocalcin-1
Huang, Luping; Belousova, Tatiana; Pan, Jenny Szu-Chin; Du, Jie; Ju, Huiming; Lu, Lianghao; Zhang, Pumin; Truong, Luan D.; Nuotio-Antar, Alli
2014-01-01
Stanniocalcin-1 is an intracrine protein; it binds to the cell surface, is internalized to the mitochondria, and diminishes superoxide generation through induction of uncoupling proteins. In vitro, stanniocalcin-1 inhibits macrophages and preserves endothelial barrier function, and transgenic overexpression of stanniocalcin-1 in mice protects against ischemia-reperfusion kidney injury. We sought to determine the kidney phenotype after kidney endothelium-specific expression of stanniocalcin-1 small hairpin RNA (shRNA). We generated transgenic mice that express stanniocalcin-1 shRNA or scrambled shRNA upon removal of a floxed reporter (phosphoglycerate kinase-driven enhanced green fluorescent protein) and used ultrasound microbubbles to deliver tyrosine kinase receptor-2 promoter-driven Cre to the kidney to permit kidney endothelium-specific shRNA expression. Stanniocalcin-1 mRNA and protein were expressed throughout the kidney in wild-type mice. Delivery of tyrosine kinase receptor-2 promoter-driven Cre to stanniocalcin-1 shRNA transgenic kidneys diminished the expression of stanniocalcin-1 mRNA and protein throughout the kidneys. Stanniocalcin-1 mRNA and protein expression did not change in similarly treated scrambled shRNA transgenic kidneys, and we observed no Cre protein expression in cultured and tyrosine kinase receptor-2 promoter-driven Cre–transfected proximal tubule cells, suggesting that knockdown of stanniocalcin-1 in epithelial cells in vivo may result from stanniocalcin-1 shRNA transfer from endothelial cells to epithelial cells. Kidney-specific knockdown of stanniocalcin-1 led to severe proximal tubule injury characterized by vacuolization, decreased uncoupling of protein-2 expression, greater generation of superoxide, activation of the unfolded protein response, initiation of autophagy, cell apoptosis, and kidney failure. Our observations suggest that stanniocalcin-1 is critical for tubular epithelial survival under physiologic conditions. PMID
Yang, Lixia; Zhong, Zhensheng; Tong, Cailing; Jia, Huan; Liu, Yiran; Chen, Gang
2018-06-08
A wobble A∙C pair can be protonated at near physiological pH to form a more stable wobble A+∙C pair. Here, we constructed an RNA hairpin (rHP) and three mutants with one A-U base pair substituted with an A∙C mismatch on the top (near the loop, U22C), middle (U25C) and bottom (U29C) positions of the stem, respectively. Our results on single-molecule mechanical (un)folding using optical tweezers reveal the destabilization effect of A-U to A∙C pair substitution, and protonation-dependent enhancement of mechanical stability facilitated through an increased folding rate, or decreased unfolding rate, or both. Our data show that protonation may occur rapidly upon the formation of apparent mechanical folding transition state. Furthermore, we measured the bulk -1 ribosomal frameshifting efficiencies of the hairpins by a cell-free translation assay. For the mRNA hairpins studied, -1 frameshifting efficiency correlates with mechanical unfolding force at equilibrium and folding rate at around 15 pN. U29C has a frameshifting efficiency similar to that of rHP (~2%). Accordingly, the bottom 2-4 base pairs of U29C may not form under a stretching force at pH 7.3, which is consistent with the fact that the bottom base pairs of the hairpins may be disrupted by ribosome at the slippery site. U22C and U25C have a similar frameshifting efficiency (~1%), indicating that both unfolding and folding rates of an mRNA hairpin in a crowded environment may affect frameshifting. Our data indicate that mechanical (un)folding of RNA hairpins may mimic how mRNAs unfold and fold in the presence of translating ribosomes.
Lin, Milo M; Meinhold, Lars; Shorokhov, Dmitry; Zewail, Ahmed H
2008-08-07
A 2D free-energy landscape model is presented to describe the (un)folding transition of DNA/RNA hairpins, together with molecular dynamics simulations and experimental findings. The dependence of the (un)folding transition on the stem sequence and the loop length is shown in the enthalpic and entropic contributions to the free energy. Intermediate structures are well defined by the two coordinates of the landscape during (un)zipping. Both the free-energy landscape model and the extensive molecular dynamics simulations totaling over 10 mus predict the existence of temperature-dependent kinetic intermediate states during hairpin (un)zipping and provide the theoretical description of recent ultrafast temperature-jump studies which indicate that hairpin (un)zipping is, in general, not a two-state process. The model allows for lucid prediction of the collapsed state(s) in simple 2D space and we term it the kinetic intermediate structure (KIS) model.
Cai, Sheng; Cao, Zhijuan; Lau, Choiwan; Lu, Jianzhong
2014-11-21
By using the allosteric hairpin DNA switch, a novel assay for the detection of microRNA (miRNA) let-7a via a hybridization chain reaction (HCR) was introduced. Briefly, the hairpin DNA switch probe is a single-stranded DNA consisting of a streptavidin (SA) aptamer sequence, a target binding sequence and a certain sequence that acts as a trigger of the HCR. In the presence of target let-7a, the hairpin DNA switch would open and expose the stem region sequences, where a part of this sequence acts as initiator sequence strands for the HCR and triggers a cascade of hybridization events that yields nicked double helices analogous to alternating copolymers, another part is the SA aptamer sequence which activates its binding affinity to SA on SA-coated magnetic particles. The hybridization event could be sensitively detected via an instantaneous derivatization reaction between a special chemiluminescence (CL) reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG) and the guanine nucleotides within the target, the hairpin DNA switch probe, and HCR helices to form an unstable CL intermediate for the generation of light. Our results show that the coupling of the hairpin DNA switch probe and the HCR for the amplified detection of let-7a achieves a better performance (e.g. wide linear response range: 0.1-1000 fmol, low detection limit: 0.1 fmol, and high specificity). Furthermore, this approach could be easily applied to the detection of let-7a in human lung cells, and extended to detect other types of miRNA and proteins such as PDGF based on aptamers. We believe such advancements will represent a significant step towards improved diagnostics and more personalized medical treatment.
Solution structure of a modified 2′,5′-linked RNA hairpin involved in an equilibrium with duplex
Plevnik, Miha; Gdaniec, Zofia; Plavec, Janez
2005-01-01
The isomerization of phosphodiester functionality of nucleic acids from 3′,5′- to a less common 2′,5′-linkage influences the complex interplay of stereoelectronic effects that drive pseudorotational equilibrium of sugar rings and thus affect the conformational propensities for compact or more extended structures. The present study highlights the subtle balance of non-covalent forces at play in structural equilibrium of 2′,5′-linked RNA analogue, 3′-O-(2-methoxyethyl) substituted dodecamer *CG*CGAA*U*U*CG*CG, 3′-MOE-2′,5′-RNA, where all cytosines and uracils are methylated at C5. The NMR and UV spectroscopic studies have shown that 3′-MOE-2′,5′-RNA adopts both hairpin and duplex secondary structures, which are involved in a dynamic exchange that is slow on the NMR timescale and exhibits strand and salt concentration as well as pH dependence. Unusual effect of pH over a narrow physiological range is observed for imino proton resonances with exchange broadening observed at lower pH and relatively sharp lines observed at higher pH. The solution structure of 3′-MOE-2′,5′-RNA hairpin displays a unique and well-defined loop, which is stabilized by Watson–Crick A5·*U8 base pair and by n → π* stacking interactions of O4′ lone-pair electrons of A6 and *U8 with aromatic rings of A5 and *U7, respectively. In contrast, the stem region of 3′-MOE-2′,5′-RNA hairpin is more flexible. Our data highlight the important feature of backbone modifications that can have pronounced effects on interstrand association of nucleic acids. PMID:15788747
Analysis of secondary structural elements in human microRNA hairpin precursors.
Liu, Biao; Childs-Disney, Jessica L; Znosko, Brent M; Wang, Dan; Fallahi, Mohammad; Gallo, Steven M; Disney, Matthew D
2016-03-01
MicroRNAs (miRNAs) regulate gene expression by targeting complementary mRNAs for destruction or translational repression. Aberrant expression of miRNAs has been associated with various diseases including cancer, thus making them interesting therapeutic targets. The composite of secondary structural elements that comprise miRNAs could aid the design of small molecules that modulate their function. We analyzed the secondary structural elements, or motifs, present in all human miRNA hairpin precursors and compared them to highly expressed human RNAs with known structures and other RNAs from various organisms. Amongst human miRNAs, there are 3808 are unique motifs, many residing in processing sites. Further, we identified motifs in miRNAs that are not present in other highly expressed human RNAs, desirable targets for small molecules. MiRNA motifs were incorporated into a searchable database that is freely available. We also analyzed the most frequently occurring bulges and internal loops for each RNA class and found that the smallest loops possible prevail. However, the distribution of loops and the preferred closing base pairs were unique to each class. Collectively, we have completed a broad survey of motifs found in human miRNA precursors, highly expressed human RNAs, and RNAs from other organisms. Interestingly, unique motifs were identified in human miRNA processing sites, binding to which could inhibit miRNA maturation and hence function.
Inhibition of HIV Replication by Cyclic and Hairpin PNAs Targeting the HIV-1 TAR RNA Loop
Upert, Gregory; Di Giorgio, Audrey; Upadhyay, Alok; Manvar, Dinesh; Pandey, Nootan; Pandey, Virendra N.; Patino, Nadia
2012-01-01
Human immunodeficiency virus-1 (HIV-1) replication and gene expression entails specific interaction of the viral protein Tat with its transactivation responsive element (TAR), to form a highly stable stem-bulge-loop structure. Previously, we described triphenylphosphonium (TPP) cation-based vectors that efficiently deliver nucleotide analogs (PNAs) into the cytoplasm of cells. In particular, we showed that the TPP conjugate of a linear 16-mer PNA targeting the apical stem-loop region of TAR impedes Tat-mediated transactivation of the HIV-1 LTR in vitro and also in cell culture systems. In this communication, we conjugated TPP to cyclic and hairpin PNAs targeting the loop region of HIV-1 TAR and evaluated their antiviral efficacy in a cell culture system. We found that TPP-cyclic PNAs containing only 8 residues, showed higher antiviral potency compared to hairpin PNAs of 12 or 16 residues. We further noted that the TPP-conjugates of the 8-mer cyclic PNA as well as the 16-mer linear PNA displayed similar antiviral efficacy. However, cyclic PNAs were shown to be highly specific to their target sequences. This communication emphasizes on the importance of small constrained cyclic PNAs over both linear and hairpin structures for targeting biologically relevant RNA hairpins. PMID:23029603
Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S
2014-05-16
Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.
White, Neil A; Hoogstraten, Charles G
2017-09-01
The hairpin ribozyme consists of two RNA internal loops that interact to form the catalytically active structure. This docking transition is a rare example of intermolecular formation of RNA tertiary structure without coupling to helix annealing. We have used temperature-dependent surface plasmon resonance (SPR) to characterize the thermodynamics and kinetics of RNA tertiary structure formation for the junctionless form of the ribozyme, in which loops A and B reside on separate molecules. We find docking to be strongly enthalpy-driven and to be accompanied by substantial activation barriers for association and dissociation, consistent with the structural reorganization of both internal loops upon complex formation. Comparisons with the parallel analysis of a ribozyme variant carrying a 2'-O-methyl modification at the self-cleavage site and with published data in other systems reveal a surprising diversity of thermodynamic signatures, emphasizing the delicate balance of contributions to the free energy of formation of RNA tertiary structure. Copyright © 2017 Elsevier B.V. All rights reserved.
Water isotope effect on the thermostability of a polio viral RNA hairpin: A metadynamics study.
Pathak, Arup K; Bandyopadhyay, Tusar
2017-04-28
Oral polio vaccine is considered to be the most thermolabile of all the common childhood vaccines. Despite heavy water (D 2 O) having been known for a long time to stabilise attenuated viral RNA against thermodegradation, the molecular underpinnings of its mechanism of action are still lacking. Whereas, understanding the basis of D 2 O action is an important step that might reform the way other thermolabile drugs are stored and could possibly minimize the cold chain problem. Here using a combination of parallel tempering and well-tempered metadynamics simulation in light water (H 2 O) and in D 2 O, we have fully described the free energy surface associated with the folding/unfolding of a RNA hairpin containing a non-canonical basepair motif, which is conserved within the 3'-untranslated region of poliovirus-like enteroviruses. Simulations reveal that in heavy water (D 2 O) there is a considerable increase of the stability of the folded basin as monitored through an intramolecular hydrogen bond (HB), size, shape, and flexibility of RNA structures. This translates into a higher melting temperature in D 2 O by 41 K when compared with light water (H 2 O). We have explored the hydration dynamics of the RNA, hydration shell around the RNA surface, and spatial dependence of RNA-solvent collective HB dynamics in the two water systems. Simulation in heavy water clearly showed that D 2 O strengthens the HB network in the solvent, lengthens inter-residue water-bridge lifetime, and weakens dynamical coupling of the hairpin to its solvation environment, which enhances the rigidity of solvent exposed sites of the native configurations. The results might suggest that like other added osmoprotectants, D 2 O can act as a thermostabilizer when used as a solvent.
Water isotope effect on the thermostability of a polio viral RNA hairpin: A metadynamics study
NASA Astrophysics Data System (ADS)
Pathak, Arup K.; Bandyopadhyay, Tusar
2017-04-01
Oral polio vaccine is considered to be the most thermolabile of all the common childhood vaccines. Despite heavy water (D2O) having been known for a long time to stabilise attenuated viral RNA against thermodegradation, the molecular underpinnings of its mechanism of action are still lacking. Whereas, understanding the basis of D2O action is an important step that might reform the way other thermolabile drugs are stored and could possibly minimize the cold chain problem. Here using a combination of parallel tempering and well-tempered metadynamics simulation in light water (H2O) and in D2O, we have fully described the free energy surface associated with the folding/unfolding of a RNA hairpin containing a non-canonical basepair motif, which is conserved within the 3'-untranslated region of poliovirus-like enteroviruses. Simulations reveal that in heavy water (D2O) there is a considerable increase of the stability of the folded basin as monitored through an intramolecular hydrogen bond (HB), size, shape, and flexibility of RNA structures. This translates into a higher melting temperature in D2O by 41 K when compared with light water (H2O). We have explored the hydration dynamics of the RNA, hydration shell around the RNA surface, and spatial dependence of RNA-solvent collective HB dynamics in the two water systems. Simulation in heavy water clearly showed that D2O strengthens the HB network in the solvent, lengthens inter-residue water-bridge lifetime, and weakens dynamical coupling of the hairpin to its solvation environment, which enhances the rigidity of solvent exposed sites of the native configurations. The results might suggest that like other added osmoprotectants, D2O can act as a thermostabilizer when used as a solvent.
Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun
2008-01-01
The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.
Butardo, Vito M.; Fitzgerald, Melissa A.; Bird, Anthony R.; Gidley, Michael J.; Flanagan, Bernadine M.; Larroque, Oscar; Resurreccion, Adoracion P.; Laidlaw, Hunter K. C.; Jobling, Stephen A.; Morell, Matthew K.; Rahman, Sadequr
2011-01-01
The inactivation of starch branching IIb (SBEIIb) in rice is traditionally associated with elevated apparent amylose content, increased peak gelatinization temperature, and a decreased proportion of short amylopectin branches. To elucidate further the structural and functional role of this enzyme, the phenotypic effects of down-regulating SBEIIb expression in rice endosperm were characterized by artificial microRNA (amiRNA) and hairpin RNA (hp-RNA) gene silencing. The results showed that RNA silencing of SBEIIb expression in rice grains did not affect the expression of other major isoforms of starch branching enzymes or starch synthases. Structural analyses of debranched starch showed that the doubling of apparent amylose content was not due to an increase in the relative proportion of amylose chains but instead was due to significantly elevated levels of long amylopectin and intermediate chains. Rices altered by the amiRNA technique produced a more extreme starch phenotype than those modified using the hp-RNA technique, with a greater increase in the proportion of long amylopectin and intermediate chains. The more pronounced starch structural modifications produced in the amiRNA lines led to more severe alterations in starch granule morphology and crystallinity as well as digestibility of freshly cooked grains. The potential role of attenuating SBEIIb expression in generating starch with elevated levels of resistant starch and lower glycaemic index is discussed. PMID:21791436
Tang, Songsong; Gu, Yuan; Lu, Huiting; Dong, Haifeng; Zhang, Kai; Dai, Wenhao; Meng, Xiangdan; Yang, Fan; Zhang, Xueji
2018-04-03
Herein, a highly-sensitive microRNA (miRNA) detection strategy was developed by combining bio-bar-code assay (BBA) with catalytic hairpin assembly (CHA). In the proposed system, two nanoprobes of magnetic nanoparticles functionalized with DNA probes (MNPs-DNA) and gold nanoparticles with numerous barcode DNA (AuNPs-DNA) were designed. In the presence of target miRNA, the MNP-DNA and AuNP-DNA hybridized with target miRNA to form a "sandwich" structure. After "sandwich" structures were separated from the solution by the magnetic field and dehybridized by high temperature, the barcode DNA sequences were released by dissolving AuNPs. The released barcode DNA sequences triggered the toehold strand displacement assembly of two hairpin probes, leading to recycle of barcode DNA sequences and producing numerous fluorescent CHA products for miRNA detection. Under the optimal experimental conditions, the proposed two-stage amplification system could sensitively detect target miRNA ranging from 10 pM to 10 aM with a limit of detection (LOD) down to 97.9 zM. It displayed good capability to discriminate single base and three bases mismatch due to the unique sandwich structure. Notably, it presented good feasibility for selective multiplexed detection of various combinations of synthetic miRNA sequences and miRNAs extracted from different cell lysates, which were in agreement with the traditional polymerase chain reaction analysis. The two-stage amplification strategy may be significant implication in the biological detection and clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.
Shuai, Hong-Lei; Huang, Ke-Jing; Xing, Ling-Li; Chen, Ying-Xu
2016-12-15
An ultrasensitive electrochemical biosensor for microRNA (miRNA) is developed based on tungsten oxide-graphene composites coupling with catalyzed hairpin assembly target recycling and enzyme signal amplification. WO3-Gr is prepared by a simple hydrothermal method and then coupled with gold nanoparticles to act as a sensing platform. The thiol-terminated capture probe H1 is immobilized on electrode through Au-S interaction. In the presence of target miRNA, H1 opens its hairpin structure by hybridization with target miRNA. This hybridization can be displaced from the structure by another stable biotinylated hairpin DNA (H2), and target miRNA is released back to the sample solution for next cycle. Thus, a large amount of H1-H2 duplex is produced after the cyclic process. At this point, a lot of signal indicators streptavidin-conjugated alkaline phosphatase (SA-ALP) are immobilized on the electrode by the specific binding of avidin-biotin. Then, thousands of ascorbic acid, which is the enzymatic product of ALP, induces the electrochemical-chemical-chemical redox cycling to produce a strongly electrochemical response in the presence of ferrocene methanol and tris (2-carboxyethyl) phosphine. Under the optimal experimental conditions, the established biosensor can detect target miRNA down to 0.05fM (S/N=3) with a linear range from 0.1fM to 100pM, and discriminate target miRNA from mismatched miRNA with a high selectivity. Copyright © 2016 Elsevier B.V. All rights reserved.
Kumar, Rohit; Singh, Satyendra Pal; Mitra, Abhijit
2018-01-02
Myostatin (MSTN) is a well-known negative regulator of skeletal muscle development. Reduced expression due to natural mutations in the coding region and knockout as well as knockdown of MSTN results in an increase in the muscle mass. In the present study, we demonstrated as high as 60 and 52% downregulation (p < 0.01) of MSTN mRNA and protein in the primary fetal myoblast cells of goats using synthetic shRNAs (n = 3), without any interferon response. We, for the first time, evaluated the effect of MSTN knockdown on the expression of MRFs (namely, MyoD, Myf5), follistatin (FST), and IGFs (IGF-1 & IGF-2) in goat myoblast cells. MSTN knockdown caused an upregulation (p < 0.05) of MyoD and downregulation (p < 0.01) of MYf5 and FST expression. Moreover, we report up to ∼four fold (p < 0.001) enhanced proliferation in myoblasts after four days of culture. The anti-MSTN shRNA demonstrated in the present study could be used for the production of transgenic goats to increase the muscle mass.
Competitive folding of anti-terminator/terminator hairpins monitored by single molecule FRET.
Clerte, Caroline; Declerck, Nathalie; Margeat, Emmanuel
2013-02-01
The control of transcription termination by RNA-binding proteins that modulate RNA-structures is an important regulatory mechanism in bacteria. LicT and SacY from Bacillus subtilis prevent the premature arrest of transcription by binding to an anti-terminator RNA hairpin that overlaps an intrinsic terminator located in the 5'-mRNA leader region of the gene to be regulated. In order to investigate the molecular determinants of this anti-termination/termination balance, we have developed a fluorescence-based nucleic acids system that mimics the competition between the LicT or SacY anti-terminator targets and the overlapping terminators. Using Förster Resonance Energy Transfer on single diffusing RNA hairpins, we could monitor directly their opening or closing state, and thus investigate the effects on this equilibrium of the binding of anti-termination proteins or terminator-mimicking oligonucleotides. We show that the anti-terminator hairpins adopt spontaneously a closed structure and that their structural dynamics is mainly governed by the length of their basal stem. The induced stability of the anti-terminator hairpins determines both the affinity and specificity of the anti-termination protein binding. Finally, we show that stabilization of the anti-terminator hairpin, by an extended basal stem or anti-termination protein binding can efficiently counteract the competing effect of the terminator-mimic.
Competitive folding of anti-terminator/terminator hairpins monitored by single molecule FRET
Clerte, Caroline; Declerck, Nathalie; Margeat, Emmanuel
2013-01-01
The control of transcription termination by RNA-binding proteins that modulate RNA-structures is an important regulatory mechanism in bacteria. LicT and SacY from Bacillus subtilis prevent the premature arrest of transcription by binding to an anti-terminator RNA hairpin that overlaps an intrinsic terminator located in the 5′-mRNA leader region of the gene to be regulated. In order to investigate the molecular determinants of this anti-termination/termination balance, we have developed a fluorescence-based nucleic acids system that mimics the competition between the LicT or SacY anti-terminator targets and the overlapping terminators. Using Förster Resonance Energy Transfer on single diffusing RNA hairpins, we could monitor directly their opening or closing state, and thus investigate the effects on this equilibrium of the binding of anti-termination proteins or terminator-mimicking oligonucleotides. We show that the anti-terminator hairpins adopt spontaneously a closed structure and that their structural dynamics is mainly governed by the length of their basal stem. The induced stability of the anti-terminator hairpins determines both the affinity and specificity of the anti-termination protein binding. Finally, we show that stabilization of the anti-terminator hairpin, by an extended basal stem or anti-termination protein binding can efficiently counteract the competing effect of the terminator-mimic. PMID:23303779
Zhang, Zhi-Sheng; Yang, Dong-Yan; Fu, Yan-Bo; Zhang, Lei; Zhao, Qian-Ping; Li, Gang
2015-03-01
Integrin β1 subunit and its downstream molecule integrin-linked kinase and focal adhesion kinase have been confirmed to be essential to cell survival and inhibition of apoptosis and hypoxia/reoxygenation (H/R)-induced injuries in cardiomyocytes. However, it is still unclear whether CrkL [v-crk avian sarcoma virus CT-10 oncogene homolog (Crk)-like], which acts also as a component of the integrin pathway, could also affect H/R-induced injuries in the cardiomyocytes. The rat-derived H9C2 cardiomyocytes were infected with a CrkL small hairpin RNA interference recombinant lentivirus, which knockdowns the endogenous CrkL expression in the cardiomyocytes. Apoptosis, cell proliferation and survival were examined in the H9C2 cardiomyocytes treated with either H/R or not. Results showed that knockdown of CrkL could significantly increase apoptosis and inhibition of the cell proliferation and survival and deteriorate the previously mentioned injuries induced by H/R. In contrast, overexpression of human CrkL could relieve the exacerbation of the previously mentioned injuries induced by CrkL knockdown in the H9C2 cardiomyocytes via regulation of Bax and extracellular signal-regulated kinase1/2 (p-ERK1/2). In conclusion, these results confirmed that knockdown of CrkL could deteriorate H/R-induced apoptosis and cell survival inhibition in rat-derived H9C2 cardiomyocytes via Bax and downregulation of p-ERK1/2. It implies that CrkL could mitigate H/R-induced injuries in the cardiomyocytes. Copyright © 2015 John Wiley & Sons, Ltd.
shRNA-Induced Gene Knockdown In Vivo to Investigate Neutrophil Function.
Basit, Abdul; Tang, Wenwen; Wu, Dianqing
2016-01-01
To silence genes in neutrophils efficiently, we exploited the RNA interference and developed an shRNA-based gene knockdown technique. This method involves transfection of mouse bone marrow-derived hematopoietic stem cells with retroviral vector carrying shRNA directed at a specific gene. Transfected stem cells are then transplanted into irradiated wild-type mice. After engraftment of stem cells, the transplanted mice have two sets of circulating neutrophils. One set has a gene of interest knocked down while the other set has full complement of expressed genes. This efficient technique provides a unique way to directly compare the response of neutrophils with a knocked-down gene to that of neutrophils with the full complement of expressed genes in the same environment.
Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.
Kundu, Anup K; Iyer, Swathi V; Chandra, Sruti; Adhikari, Amit S; Iwakuma, Tomoo; Mandal, Tarun K
2017-01-01
The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line. The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP) and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency. Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent. This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.
Hossain, Mohammad Motarab; Ray, Swapan Kumar
2014-10-01
Ewing's sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing's sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing's sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing's sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing's sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing's sarcoma in cell culture and animal models.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Czarnecki, Olaf; Bryan, Anthony C.; Jawdy, Sara S.
Genetic engineering of plants that results in successful establishment of new biochemical or regulatory pathways requires stable introduction of one or more genes into the plant genome. It might also be necessary to down-regulate or turn off expression of endogenous genes in order to reduce activity of competing pathways. An established way to knockdown gene expression in plants is expressing a hairpin-RNAi construct, eventually leading to degradation of a specifically targeted mRNA. Knockdown of multiple genes that do not share homologous sequences is still challenging and involves either sophisticated cloning strategies to create vectors with different serial expression constructs ormore » multiple transformation events that is often restricted by a lack of available transformation markers. Synthetic RNAi fragments were assembled in yeast carrying homologous sequences to six or seven non-family genes and introduced into pAGRIKOLA. Transformation of Arabidopsis thaliana and subsequent expression analysis of targeted genes proved efficient knockdown of all target genes. In conclusion, we present a simple and cost-effective method to create constructs to simultaneously knockdown multiple non-family genes or genes that do not share sequence homology. The presented method can be applied in plant and animal synthetic biology as well as traditional plant and animal genetic engineering.« less
Czarnecki, Olaf; Bryan, Anthony C.; Jawdy, Sara S.; ...
2016-02-17
Genetic engineering of plants that results in successful establishment of new biochemical or regulatory pathways requires stable introduction of one or more genes into the plant genome. It might also be necessary to down-regulate or turn off expression of endogenous genes in order to reduce activity of competing pathways. An established way to knockdown gene expression in plants is expressing a hairpin-RNAi construct, eventually leading to degradation of a specifically targeted mRNA. Knockdown of multiple genes that do not share homologous sequences is still challenging and involves either sophisticated cloning strategies to create vectors with different serial expression constructs ormore » multiple transformation events that is often restricted by a lack of available transformation markers. Synthetic RNAi fragments were assembled in yeast carrying homologous sequences to six or seven non-family genes and introduced into pAGRIKOLA. Transformation of Arabidopsis thaliana and subsequent expression analysis of targeted genes proved efficient knockdown of all target genes. In conclusion, we present a simple and cost-effective method to create constructs to simultaneously knockdown multiple non-family genes or genes that do not share sequence homology. The presented method can be applied in plant and animal synthetic biology as well as traditional plant and animal genetic engineering.« less
Cai, Huawei; Wu, Jiu-sheng; Muzik, Otto; Hsieh, Jer-Tsong; Lee, Robert J; Peng, Fangyu
2014-04-01
Copper is an element required for cell proliferation and angiogenesis. Human prostate cancer xenografts with increased (64)Cu radioactivity were visualized previously by PET using (64)CuCl2 as a radiotracer ((64)CuCl2 PET). This study aimed to determine whether the increased tumor (64)Cu radioactivity was due to increased cellular uptake of (64)Cu mediated by human copper transporter 1 (hCtr1) or simply due to nonspecific binding of ionic (64)CuCl2 to tumor tissue. In addition, the functional role of hCtr1 in proliferation of prostate cancer cells and tumor growth was also assessed. A lentiviral vector encoding short-hairpin RNA specific for hCtr1 (Lenti-hCtr1-shRNA) was constructed for RNA interference-mediated knockdown of hCtr1 expression in prostate cancer cells. The degree of hCtr1 knockdown was determined by Western blot, and the effect of hCtr1 knockdown on copper uptake and proliferation were examined in vitro by cellular (64)Cu uptake and cell proliferation assays. The effects of hCtr1 knockdown on tumor uptake of (64)Cu were determined by PET quantification and tissue radioactivity assay. The effects of hCtr1 knockdown on tumor growth were assessed by PET/CT and tumor size measurement with a caliper. RNA interference-mediated knockdown of hCtr1 was associated with the reduced cellular uptake of (64)Cu and the suppression of prostate cancer cell proliferation in vitro. At 24 h after intravenous injection of the tracer (64)CuCl2, the (64)Cu uptake by the tumors with knockdown of hCtr1 (4.02 ± 0.31 percentage injected dose per gram [%ID/g] in Lenti-hCtr1-shRNA-PC-3 and 2.30 ± 0.59 %ID/g in Lenti-hCtr1-shRNA-DU-145) was significantly lower than the (64)Cu uptake by the control tumors without knockdown of hCtr1 (7.21 ± 1.48 %ID/g in Lenti-SCR-shRNA-PC-3 and 5.57 ± 1.20 %ID/g in Lenti-SCR-shRNA-DU-145, P < 0.001) by PET quantification. Moreover, the volumes of prostate cancer xenograft tumors with knockdown of hCtr1 (179 ± 111 mm(3) for Lenti-hCtr1-shRNA
Hossain, Mohammad Motarab; Ray, Swapan Kumar
2016-01-01
Ewing’s sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing’s sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing’s sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing’s sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing’s sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing’s sarcoma in cell culture and animal models. PMID:27547487
Joy, Nisha; Soniya, Eppurathu Vasudevan
2012-06-01
Plant miRNAs (18-24nt) are generated by the RNase III-type Dicer endonuclease from the endogenous hairpin precursors ('pre-miRNAs') with significant regulatory functions. The transcribed regions display a higher frequency of microsatellites, when compared to other regions of the genomic DNA. Simple sequence repeats (SSRs) resulting from replication slippage occurring in transcripts affect the expression of genes. The available experimental evidence for the incidence of SSRs in the miRNA precursors is limited. Considering the potential significance of SSRs in the miRNA genes, we carried out a preliminary analysis to verify the presence of SSRs in the pri-miRNAs of black pepper (Piper nigrum L.). We isolated a (CT) dinucleotide SSR bearing transcript using SMART strategy. The transcript was predicted to be a 'pri-miRNA candidate' with Dicer sites based on miRNA prediction tools and MFOLD structural predictions. The presence of this 'miRNA candidate' was confirmed by real-time TaqMan assays. The upstream sequence of the 'miRNA candidate' by genome walking when subjected to PlantCARE showed the presence of certain promoter elements, and the deduced amino acid showed significant similarity with NAP1 gene, which affects the transcription of many genes. Moreover the hairpin-like precursor overlapped the neighbouring NAP1 gene. In silico analysis revealed distinct putative functions for the 'miRNA candidate', of which majority were related to growth. Hence, we assume that this 'miRNA candidate' may get activated during transcription of NAP gene, thereby regulating the expression of many genes involved in developmental processes.
Sundarrajan, Lakshminarasimhan; Unniappan, Suraj
2017-10-01
Irisin is a myokine encoded in fibronectin type III domain containing 5 (FNDC5). FNDC5 forms an integral part of the muscle post-exercise, and causes an increase in energy expenditure in mammals. Irisin is abundantly expressed in cardiac and skeletal muscles and is secreted upon activation of peroxisome proliferator-activated receptor gamma coactivator-1 (PGC-1 alpha). Irisin regulates feeding behaviour and cardiovascular function in mammals. More recently, irisin has gained importance as a potential biomarker for myocardial infarction due to its abundance in cardiac muscle. The goal of this research was to determine whether irisin influences feeding, and regulates appetite regulatory peptides in zebrafish. Intraperitoneal injection of irisin [0.1, 1, 10 and 100ng/g body weight (BW)] did not affect feeding, but its knockdown using siRNA (10ng/g BW) caused a significant reduction in food intake. Knockdown of irisin reduced ghrelin and orexin-A mRNA expression, and increased cocaine and amphetamine regulated transcript mRNA expression in zebrafish brain and gut. siRNA mediated knockdown of irisin also downregulated brain derived neurotrophic factor mRNA in zebrafish. The role of endogenous irisin on food intake is likely mediated by its actions on other metabolic peptides. Collectively, these results indicate that unaltered endogenous irisin is required to maintain food intake in zebrafish. Copyright © 2017 Elsevier Inc. All rights reserved.
Li, Jinzheng; Gong, Junhua; Li, Peizhi; Li, Min; Liu, Yiming; Liang, Shaoyong; Gong, Jianping
2014-03-27
Our previous studies have shown that Kupffer cells (KCs) play a crucial role in postoperative pathologic changes. Recent reports have demonstrated that microRNA-155 (miR-155) is associated with inflammation and upregulation of proinflammatory mediators in the peripheral blood and allografts of transplant patients. However, the precise mechanism for this remains unknown. KCs isolated from BALB/c mice were transfected with miR-155 mimic or inhibitor. Levels of suppressor of cytokine signaling 1/Janus kinase/signal transducer and activator of transcription (SOCS1/JAK/STAT) proteins and surface molecules (MHC-II, CD40, and CD86) were then measured. T-cell proliferation and apoptosis were evaluated in mixed lymphocyte reactions. Orthotopic liver transplantation was performed in mice after miR-155 short hairpin RNA lentivirus treatment, and postoperative survival, liver function and histology, and mRNA and protein expression were analyzed. miR-155 knockdown in KCs decreased MHC-II, CD40, and CD86 expression, suppressed antigen-presenting function, and affected SOCS1/JAK/STAT inflammatory pathways. In addition, KCs transfected with miR-155 inhibitor and cocultured with T lymphocytes showed reduced T-cell responses but a greater number of apoptotic T cells. Finally, miR-155 suppression in graft liver prolonged liver allograft survival and improved liver function. The changes were closely associated with the levels of T helper 1 and 2 (Th1/Th2) cytokines and T-cell apoptosis, but a direct mechanistic link in vivo was not established. These data suggest miR-155 regulates the balance of Th1/Th2 cytokines and the maturation and function of KCs in mice. miR-155 repression in KCs positively regulates KC function toward immunosuppression and prolongs liver allograft survival.
A triplex ribozyme expression system based on a single hairpin ribozyme.
Aquino-Jarquin, Guillermo; Benítez-Hess, María Luisa; DiPaolo, Joseph A; Alvarez-Salas, Luis M
2008-09-01
Triplex ribozyme (RZ) configurations allow for the individual activity of trans-acting RZs in multiple expression cassettes (multiplex), thereby increasing target cleavage relative to conventionally expressed RZs. Although hairpin RZs have been advantageously compared to hammerhead RZs, their longer size and structural features complicated triplex design. We present a triplex expression system based on a single hairpin RZ with transcleavage capability and simple engineering. The system was tested in vitro using cis- and trans-cleavage kinetic assays against a known target RNA from HPV-16 E6/E7 mRNA. Single and multiplex triplex RZ constructs were more efficient in cleaving the target than tandem-cloned hairpin RZs, suggesting that the release of individual RZs enhanced trans-cleavage kinetics. Multiplex systems constructed with two different hairpin RZs resulted in better trans-cleavage compared to standard double-RZ constructs. In addition, the triplex RZ performed cis- and trans-cleavage in cervical cancer cells. The use of triplex configurations with multiplex RZs permit differential targeting of the same or different RNA, thus improving potential use against unstable targets. This prototype will provide the basis for the development of future RZ-based therapies and technologies.
Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie
2016-05-11
Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.
Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...
2018-03-27
Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meagher, Robert J.; Priye, Aashish; Light, Yooli K.
Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less
Kowalczewski, Christine J; Saul, Justin M
2015-10-01
Antagonists and inhibitory molecules responsible for maintaining tissue homeostasis can present a significant barrier to healing when tissue engineering/regenerative medicine strategies are employed. One example of this situation is the up-regulation of antagonists such as noggin in response to increasing concentrations of bone morphogenetic protein-2 (BMP-2) present from endogenous bone repair processes or delivered exogenously from biomaterials (synthetic bone grafts). While recombinant human (rh)BMP-2 delivered from synthetic bone grafts has been shown to be an effective alternative to autografts and allografts, the supraphysiological doses of rhBMP-2 have led to clinically-adverse side effects. The high rhBMP-2 dosage may be required, in part, to overcome the presence of antagonists such as noggin. Small interfering RNA (siRNA) is an appealing approach to overcome this problem because it can knock-down antagonists or inhibitory molecules in a temporary manner. Here, we conducted fundamental studies on the delivery of siRNA from material surfaces as a means to knock-down antagonists like noggin. Non-viral cationic lipid (Lipofectamine)-siRNA complexes were delivered from a fibrin hydrogel surface to MC3T3-E1 preosteoblasts that were treated with a supraphysiological dose of rhBMP-2 to achieve noggin mRNA expression levels higher than cells naïve to rhBMP-2. Confocal microscopy and flow cytometry showed intracellular uptake of siRNA in over 98% of MC3T3-E1 cells after 48 h. Doses of 0.5 and 1 μg noggin siRNA were able to significantly reduce noggin mRNA to levels equivalent to those in MC3T3-E1 cells not exposed to rhBMP-2 with no effects on cell viability. Small interfering RNA (siRNA) has been considered for treatment of diseases ranging from Alzheimer's to cancer. However, the ability to use siRNA in conjunction with biomaterials to direct tissue regeneration processes has received relatively little attention. Using the bone morphogenetic protein 2
Lee, Sooncheol; Nguyen, Huong Minh; Kang, Changwon
2010-10-01
No biological function has been identified for tiny RNA transcripts that are abortively and repetitiously released from initiation complexes of RNA polymerase in vitro and in vivo to date. In this study, we show that abortive initiation affects termination in transcription of bacteriophage T7 gene 10. Specifically, abortive transcripts produced from promoter phi 10 exert trans-acting antitermination activity on terminator T phi both in vitro and in vivo. Following abortive initiation cycling of T7 RNA polymerase at phi 10, short G-rich and oligo(G) RNAs were produced and both specifically sequestered 5- and 6-nt C + U stretch sequences, consequently interfering with terminator hairpin formation. This antitermination activity depended on sequence-specific hybridization of abortive transcripts with the 5' but not 3' half of T phi RNA. Antitermination was abolished when T phi was mutated to lack a C + U stretch, but restored when abortive transcript sequence was additionally modified to complement the mutation in T phi, both in vitro and in vivo. Antitermination was enhanced in vivo when the abortive transcript concentration was increased via overproduction of RNA polymerase or ribonuclease deficiency. Accordingly, antitermination activity exerted on T phi by abortive transcripts should facilitate expression of T phi-downstream promoter-less genes 11 and 12 in T7 infection of Escherichia coli.
Zhang, Qinli; Li, Na; Jiao, Xia; Qin, Xiujun; Kaur, Ramanjit; Lu, Xiaoting; Song, Jing; Wang, Linping; Wang, Junming; Niu, Qiao
2014-01-01
There is abundant evidence supporting the role of caspases in the development of neurodegenerative disease, including Alzheimer's disease (AD). Therefore, regulating the activity of caspases has been considered as a therapeutic target. However, all the efforts on AD therapy using pan-caspase inhibitors have failed because of uncontrolled adverse effects. Alternatively, the specific knockdown of caspase-3 gene through RNA interference (RNAi) could serve as a future potential therapeutic strategy. The aim of the present study is to down-regulate the expression of caspase-3 gene using lentiviral vector-mediated caspase-3 short hairpin RNA (LV-Caspase-3 shRNA). The effect of LV-Caspase-3 shRNA on apoptosis induced by aluminum (Al) was investigated in primary cultured cortical neurons and validated in C57BL/6J mice. The results indicated an increase in apoptosis and caspase-3 expression in primary cultured neurons and the cortex ofmice exposed to Al, which could be down-regulated by LV-Caspase-3 shRNA. Furthermore, LV-Caspase-3 shRNA reduced neural cell death and improved learning and memory in C57BL/6J mice treated with Al. Our results suggest that LV-caspase-3 shRNA is a potential therapeutic agent to prevent neurodegeneration and cognitive dysfunction in aluminum- exposed animal models. The findings provide a rational gene therapy strategy for AD.
Knockdown of RhoA expression alters ovarian cancer biological behavior in vitro and in nude mice.
Wang, Xiaoxia; Jiang, Wenyan; Kang, Jiali; Liu, Qicai; Nie, Miaoling
2015-08-01
RhoA regulates cell proliferation, migration, angiogenesis and gene expression. Altered RhoA activity contributes to cancer progression. The present study investigated the effects of RhoA knockdown on the regulation of ovarian cancer biological behavior in vitro and in nude mice. The expression of RhoA was knocked down using a lentivirus carrying RhoA short hairpin RNA (shRNA) in ovarian cancer cells and was confirmed by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. The altered ovarian cancer biological behaviors were assayed by cell viability, terminal deoxynucleotidyltransferase-mediated dUTP nick end-labeling (TUNEL), migration, invasion, and nude mice tumorigenicity assays, while the altered gene expression was detected by RT-qPCR and western blot analysis. The results showed that lentivirus-carrying RhoA shRNA significantly suppressed RhoA expression in ovarian cancer cells, which suppressed tumor cell viability, migration, invasion and adhesion in vitro. RhoA silencing also inhibited the tumorigenicity of ovarian cancer cells in nude mice, which was characterized by the suppression of tumor xenograft formation and growth and induction of tumor cell apoptosis. The results of the present study demonstrated that knockdown of RhoA expression had a significant antitumor effect on ovarian cancer cells in vitro and in nude mice, suggesting that RhoA may be a target for the development of a novel therapeutic strategy in the control of ovarian cancer.
Le, Hai Van; Kim, Jae Young
2016-06-01
Toll-like receptor 10 (TLR10) is the only orphan receptor whose natural ligand and function are unknown among the 10 human TLRs. In this study, to test whether TLR10 recognizes some known TLR ligands, we established a stable TLR10 knockdown human monocytic cell line THP-1 using TLR10 short hairpin RNA lentiviral particle and puromycin selection. Among 60 TLR10 knockdown clones that were derived from each single transduced cell, six clones were randomly selected, and then one of those clones, named E7, was chosen for the functional study. E7 exhibited approximately 50% inhibition of TLR10 mRNA and protein expression. Of all the TLRs, only the expression of TLR10 changed significantly in this cell line. Additionally, phorbol 12-myristate 13-acetate-induced macrophage differentiation of TLR10 knockdown cells was not affected in the knockdown cells. When exposed to TLR ligands, such as synthetic diacylated lipoprotein (FSL-1), lipopolysaccharide (LPS), and flagellin, significant induction of proinflammatory cytokine gene expression including Interleukin-8 (IL-8), Interleukin-1 beta (IL-1β), Tumor necrosis factor-alpha (TNF-α) and Chemokine (C-C Motif) Ligand 20 (CCL20) expression, was found in the control THP-1 cells, whereas the TLR10 knockdown cells exhibited a significant reduction in the expression of IL-8, IL-1β, and CCL20. TNF-α was the only cytokine for which the expression did not decrease in the TLR10 knockdown cells from that measured in the control cells. Analysis of putative binding sites for transcription factors using a binding-site-prediction program revealed that the TNF-α promoter does not have putative binding sites for AP-1 or c-Jun, comprising a major transcription factor along with NF-κB for TLR signaling. Our results suggest that TLR10 is involved in the recognition of FSL-1, LPS, and flagellin and TLR-ligand-induced expression of TNF-α does not depend on TLR10.
Gene expression analysis upon lncRNA DDSR1 knockdown in human fibroblasts
Jia, Li; Sun, Zhonghe; Wu, Xiaolin; Misteli, Tom; Sharma, Vivek
2015-01-01
Long non-coding RNAs (lncRNAs) play important roles in regulating diverse biological processes including DNA damage and repair. We have recently reported that the DNA damage inducible lncRNA DNA damage-sensitive RNA1 (DDSR1) regulates DNA repair by homologous recombination (HR). Since lncRNAs also modulate gene expression, we identified gene expression changes upon DDSR1 knockdown in human fibroblast cells. Gene expression analysis after RNAi treatment targeted against DDSR1 revealed 119 genes that show differential expression. Here we provide a detailed description of the microarray data (NCBI GEO accession number GSE67048) and the data analysis procedure associated with the publication by Sharma et al., 2015 in EMBO Reports [1]. PMID:26697398
Knockdown of Pentraxin 3 suppresses tumorigenicity and metastasis of human cervical cancer cells.
Ying, Tsung-Ho; Lee, Chien-Hsing; Chiou, Hui-Ling; Yang, Shun-Fa; Lin, Chu-Liang; Hung, Chia-Hung; Tsai, Jen-Pi; Hsieh, Yi-Hsien
2016-07-05
Pentraxin 3 (PTX3) as an inflammatory molecule has been shown to be involved in immune response, inflammation, and cancer. However, the effects of PTX3 on the biological features of cervical cancer cells in vitro and in vivo have not been delineated. Immunohistochemical staining showed that increased PTX3 expression was significantly associated with tumor grade (P < 0.011) and differentiation (P < 0.019). Knocking down PTX3 with lentivirus-mediated small hairpin RNA (shRNA) in cervical cancer cell lines resulted in inhibited cell viability, diminished colony-forming ability, and induced cell cycle arrest at the G2/M phase of the cell cycle, along with downregulated expression of cyclin B1, cdc2, and cdc25c, and upregulated expression of p-cdc2, p-cdc25c, p21, and p27. Furthermore, knockdown of PTX3 significantly decreased the potential of migration and invasion of cervical cancer cells by inhibiting matrix metalloproteidase-2 (MMP-2), MMP-9, and urokinase plasminogen activator (uPA). Moreover, in vivo functional studies showed PTX3-knockdown in mice suppressed tumorigenicity and lung metastatic potential. Conversely, overexpression of PTX3 enhanced proliferation and invasion both in vitro and in vivo. Our results demonstrated that PTX3 contributes to tumorigenesis and metastasis of human cervical cancer cells. Further studies are warranted to demonstrate PTX3 as a novel therapeutic biomarker for human cervical cancer.
Bathina, Chandra Sekhar; Rajulapati, Anuradha; Franzke, Michelle; Yamamoto, Kenta; Cunningham, J Thomas; Mifflin, Steve
2013-11-01
Noradrenergic A2 neurons in nucleus tractus solitarius (NTS) respond to stressors such as hypoxia. We hypothesize that tyrosine hydroxylase (TH) knockdown in NTS reduces cardiovascular responses to chronic intermittent hypoxia (CIH), a model of the arterial hypoxemia observed during sleep apnea in humans. Adult male Sprague-Dawley rats were implanted with radiotelemetry transmitters and adeno-associated viral constructs with green fluorescent protein (GFP) reporter having either short hairpin RNA (shRNA) for TH or scrambled virus (scRNA) were injected into caudal NTS. Virus-injected rats were exposed to 7 days of CIH (alternating periods of 10% O2 and of 21% O2 from 8 AM to 4 PM; from 4 PM to 8 AM rats were exposed to 21% O2). CIH increased mean arterial pressure (MAP) and heart rate (HR) during the day in both the scRNA (n = 14, P < 0.001 MAP and HR) and shRNA (n = 13, P < 0.001 MAP and HR) groups. During the night, MAP and HR remained elevated in the scRNA rats (P < 0.001 MAP and HR) but not in the shRNA group. TH immunoreactivity and protein were reduced in the shRNA group. FosB/ΔFosB immunoreactivity was decreased in paraventricular nucleus (PVN) of shRNA group (P < 0.001). However, the shRNA group did not show any change in the FosB/ΔFosB immunoreactivity in the rostral ventrolateral medulla. Exposure to CIH increased MAP which persisted beyond the period of exposure to CIH. Knockdown of TH in the NTS reduced this CIH-induced persistent increase in MAP and reduced the transcriptional activation of PVN. This indicates that NTS A2 neurons play a role in the cardiovascular responses to CIH.
Hong, Seong-Ho; Chang, Seung-Hee; Cho, Kyung-Cho; Kim, Sanghwa; Park, Sungjin; Lee, Ah Young; Jiang, Hu-Lin; Kim, Hyeon-Jeong; Lee, Somin; Yu, Kyeong-Nam; Seo, Hwi Won; Chae, Chanhee; Kim, Kwang Pyo; Park, Jongsun; Cho, Myung-Haing
2016-10-04
Trafficking from the endoplasmic reticulum (ER) to the Golgi apparatus is elevated in cancer cells. Therefore, proteins of the ER-Golgi intermediate compartment (ERGIC) attract significant attention as targets for cancer treatment. Enhanced cancer cell growth and epithelial-mesenchymal transition by ERGICs correlates with poor-prognosis of lung cancer. This prompted us to assess whether knockdown of ERGIC3 may decrease lung cancer growth. To test the hypothesis, the effects of ERGIC3 short hairpin RNA (shERGIC3) on ER stress-induced cell death and lung tumorigenesis were investigated both in vitro and in vivo. Knockdown of ERGIC3 led to ER stress-induced autophagic cell death and suppression of proliferation in the A549 human lung cancer cell-line. Moreover, non-invasive aerosol-delivery of shERGIC3 using the biocompatible carrier glycerol propoxylate triacrylate and spermine (GPT-SPE) inhibited lung tumorigenesis in the K-rasLA1 murine model of lung cancer. Our data suggest that suppression of ERGIC3 could provide a framework for the development of effective lung cancer therapies.
Son, Jae Sung; Kim, Kwan Chang; Kim, Bo Kyung; Cho, Min-Sun; Hong, Young Mi
2012-12-01
The purpose of this study was to investigate the therapeutic effects of small hairpin RNA (shRNA) targeting endothelin-converting enzyme (ECE)-1 in monocrotaline (MCT)-induced pulmonary hypertensive rats. Ninty-four Sprague-Dawley rats were divided into three groups: control (n = 24), MCT (n = 35) and shRNA (n = 35). Four-week survival rate in the shRNA group was significantly increased compared to that in the MCT group. The shRNA group showed a significant improvement of right ventricular (RV) pressure compared with the MCT group. The MCT and shRNA groups also showed an increase in RV/(left ventricle + septum) ratio and lung/body weight. Plasma endothelin (ET)-1 concentrations in the shRNA group were lower than those in the MCT group. Medial wall thickness of pulmonary arterioles were increased after MCT injection and was significantly decreased in the shRNA group. The number of intra-acinar muscular pulmonary arteries was decreased in the shRNA group. The mRNA expressions of ET-1 and ET receptor A (ET(A)) were significantly decreased in the shRNA group in week 4. The protein levels of ET(A) were decreased in the shRNA group in week 2. The protein levels of tumor necrosis factor-α and vascular endothelial growth factor were decreased in the shRNA group in week 4. In conclusion, the gene silencing with lentiviral vector targeting ECE-1 could be effective against hemodynamic, histopathological and gene expression changes in pulmonary hypertension.
Novel guanidinylated bioresponsive poly(amidoamine)s designed for short hairpin RNA delivery
Yu, Jiankun; Zhang, Jinmin; Xing, Haonan; Sun, Yanping; Yang, Zhen; Yang, Tianzhi; Cai, Cuifang; Zhao, Xiaoyun; Yang, Li; Ding, Pingtian
2016-01-01
Two different disulfide (SS)-containing poly(amidoamine) (PAA) polymers were constructed using guanidino (Gua)-containing monomers (ie, arginine [Arg] and agmatine [Agm]) and N,N′-cystamine bisacrylamide (CBA) by Michael-addition polymerization. In order to characterize these two Gua-SS-PAA polymers and investigate their potentials as short hairpin RNA (shRNA)-delivery carriers, pSilencer 4.1-CMV FANCF shRNA was chosen as a model plasmid DNA to form complexes with these two polymers. The Gua-SS-PAAs and plasmid DNA complexes were determined with particle sizes less than 90 nm and positive ζ-potentials under 20 mV at nucleic acid:polymer weight ratios lower than 1:24. Bioresponsive release of plasmid DNA was observed from both newly constructed complexes. Significantly lower cytotoxicity was observed for both polymer complexes compared with polyethylenimine and Lipofectamine 2000, two widely used transfection reagents as reference carriers. Arg-CBA showed higher transfection efficiency and gene-silencing efficiency in MCF7 cells than Agm-CBA and the reference carriers. In addition, the cellular uptake of Arg-CBA in MCF7 cells was found to be higher and faster than Agm-CBA and the reference carriers. Similarly, plasmid DNA transport into the nucleus mediated by Arg-CBA was more than that by Agm-CBA and the reference carriers. The study suggested that guanidine and carboxyl introduced into Gua-SS-PAAs polymers resulted in a better nuclear localization effect, which played a key role in the observed enhancement of transfection efficiency and low cytotoxicity. Overall, two newly synthesized Gua-SS-PAAs polymers demonstrated great potential to be used as shRNA carriers for gene-therapy applications. PMID:27994462
[siRNA-mediated tissue factor knockdown in porcine neonatal islet cell clusters in vitro].
Ji, Ming; Yi, Shounan; Yu, Deling; Wang, Wei
2011-12-01
To determine the genetic modification on neonatal porcine islet cell clusters (NICC) by small interfering RNA (siRNA)-mediated tissue factor (TF) knockdown in vitro. Porcine NICC were transfected with 5 pairs of designed siRNA respectively or in different combinations with lipofectamine 2000. Transfected NICC were analyzed for TF gene by real-time PCR to select the siRNA which worked best. Meanwhile, the viability of NICC after the TF siRNA transfection was examined by FACS. The efficiency of TF gene and protein suppression was measured by real-time PCR and and FACS respectively. Real-time PCR and FACS showed that a 60% reduction in the TF gene expression and a 50% reduction in the protien level of TF on NICC were achieved by transfecting 3 pairs of selected siRNA. The siRNA transfection had no significant effect on the viability of NICC which was analyzed by FACS. The expression of TF on porcine NICC is efficiently suppressed by 3 pairs of designed siRNA in vitro.
Antisense Oligonucleotide-Mediated Transcript Knockdown in Zebrafish.
Pauli, Andrea; Montague, Tessa G; Lennox, Kim A; Behlke, Mark A; Schier, Alexander F
2015-01-01
Antisense oligonucleotides (ASOs) are synthetic, single-strand RNA-DNA hybrids that induce catalytic degradation of complementary cellular RNAs via RNase H. ASOs are widely used as gene knockdown reagents in tissue culture and in Xenopus and mouse model systems. To test their effectiveness in zebrafish, we targeted 20 developmental genes and compared the morphological changes with mutant and morpholino (MO)-induced phenotypes. ASO-mediated transcript knockdown reproduced the published loss-of-function phenotypes for oep, chordin, dnd, ctnnb2, bmp7a, alk8, smad2 and smad5 in a dosage-sensitive manner. ASOs knocked down both maternal and zygotic transcripts, as well as the long noncoding RNA (lncRNA) MALAT1. ASOs were only effective within a narrow concentration range and were toxic at higher concentrations. Despite this drawback, quantitation of knockdown efficiency and the ability to degrade lncRNAs make ASOs a useful knockdown reagent in zebrafish.
Shang, Q-Y; Wu, C-S; Gao, H-R
2017-09-01
The present study explored the effect that deoxycytidine kinase (DCK) knockdown had on proliferation, apoptosis and tumorigenicity in vivo of cervical cancer HeLa cells. Human cervical cancer HeLa cells that had received no prior treatment were selected from the HeLa group. The HeLa-negative control (NC) group consisted of cells that had undergone an empty vector treatment, and finally the HeLa-short hairpin RNA (shRNA) group included cells that were treated by means of shRNA-DCK expression. DCK expressions were evaluated by quantitative real-time polymerase chain reaction in addition to western blotting assays. Cell proliferation was estimated using the Cell Counting Kit-8 (CCK-8) assay and cell cycle progression. Cell apoptosis was determined by flow cytometry. BALB/c nude mice (n=24) were selected to establish transplanted tumor models, with gross tumor volume measured every 3 days. The results in vitro were as follows: compared with the HeLa group, the HeLa-shRNA group exhibited downregulation of DCK expression and inhibition of cell proliferation at 48, 72 and 96 h. Additionally, more cells in the HeLa-shRNA group were arrested in G0/G1 stage and less in S and G2/M stages, as well as in promotion of cell apoptosis. In vivo results are as follows: when comparing the HeLa and HeLa-NC groups, the gross tumor volume of the transplanted tumor in nude mice in the HeLa-shRNA group was found to have decreased in 13, 16, 19 and 22 days. Based on these findings, our study suggests that DCK knockdown facilitates apoptosis while inhibiting proliferation and tumorigenicity in vivo of cervical cancer HeLa cells.
Quan, Yongsheng; Zhang, Yan; Lin, Wei; Shen, Zhaohua; Wu, Shuai; Zhu, Changxin; Wang, Xiaoyan
2018-03-04
Emerging evidence has demonstrated that long noncoding RNAs (lncRNAs) play a critical role in tumorigenesis of gastric cancer. LncRNA MAP3K20 antisense RNA 1 (MLK7-AS1) has been identified as one of gastric cancer-specific lncRNAs. However, its precise role in gastric cancer remains unknown. In this study, we found that lncRNA MLK7-AS1 was significantly increased in gastric cancer tissues compared with in adjacent tissues. Gastric cancer patients with high MLK7-AS1 expression had a shorter survival and poorer prognosis. By loss-function assay, we demonstrated that knockdown of MLK7-AS1 inhibited cell proliferation and induced apoptosis in HGC27and MKN-45 cells. Furthermore, we identified miR-375 as a target of MLK7-AS1. MLK7-AS1 interacted with Dnmt1 and recruited it to miR-375 promotor, hyper-methylating miR-375 promotor and repressing miR-375 expression. Taken together, our findings demonstrate that knockdown of MLK7-AS1 by siRNA inhibits gastric cancer growth by epigenetically regulating miR-375. Thus, MLK7-AS1 may be a useful prognostic marker and therapeutic target for gastric cancer patients. Copyright © 2018 Elsevier Inc. All rights reserved.
Peng, Dongxian; He, Yuanli
2015-02-01
To investigate the inhibitory effect of lentiviral vector-mediated short hairpin RNA targeting survivin (LV-survivin shRNA) on the growth of human endometrium xenograft in the abdominal cavity of nude mice. The endometrium xenografts from 8 women with endometriosis were injected into the peritoneal cavities of 45 nude mice. The mice were then randomly assigned to receive intraperitoneal injection of LV-survivin shRNA, pGCL-NC-GFP (negative control) or PBS (blank control). Two weeks later, the number and morphometry of endometriotic lesions were quantified and the expression of survivin protein were detected by immunohistochemistry. The formation of endometriotic lesions was significantly suppressed in mice receiving LV-survivin shRNA injection as compared with those in the two control groups (P/0.001). The mice in LV-survivin-shRNA group showed significantly down-regulated expression levels of survivin protein compared with those in the negative and blank control groups, presenting also necrosis in the endometriosis-like lesions in microscopic observation. Lentiviral vector-mediated shRNA can effectively inhibit the expression of survivin in human endometrium xengrafts and suppress the formation and growth of endometriotic lesions in the abdominal cavities of nude mice.
Liu, Haiyun; Tian, Tian; Ji, Dandan; Ren, Na; Ge, Shenguang; Yan, Mei; Yu, Jinghua
2016-11-15
In situ imaging of miRNA in living cells could help us to monitor the miRNA expression in real time and obtain accurate information for studying miRNA related bioprocesses and disease. Given the low-level expression of miRNA, amplification strategies for intracellular miRNA are imperative. Here, we propose an amplification strategy with a non-destructive enzyme-free manner in living cells using catalyzed hairpin assembly (CHA) based on graphene oxide (GO) for cellular miRNA imaging. The enzyme-free CHA exhibits stringent recognition and excellent signal amplification of miRNA in the living cells. GO is a good candidate as a fluorescence quencher and cellular carrier. Taking the advantages of the CHA and GO, we can monitor the miRNA at low level in living cells with a simple, sensitive and real-time manner. Finally, imaging of miRNAs in the different expression cells is realized. The novel method could supply an effective tool to visualize intracellular low-level miRNAs and help us to further understand the role of miRNAs in cellular processes. Copyright © 2016 Elsevier B.V. All rights reserved.
The role of RNA structure in the interaction of U1A protein with U1 hairpin II RNA
Law, Michael J.; Rice, Andrew J.; Lin, Patti; Laird-Offringa, Ite A.
2006-01-01
The N-terminal RNA Recognition Motif (RRM1) of the spliceosomal protein U1A interacting with its target U1 hairpin II (U1hpII) has been used as a paradigm for RRM-containing proteins interacting with their RNA targets. U1A binds to U1hpII via direct interactions with a 7-nucleotide (nt) consensus binding sequence at the 5′ end of a 10-nt loop, and via hydrogen bonds with the closing C–G base pair at the top of the RNA stem. Using surface plasmon resonance (Biacore), we have examined the role of structural features of U1hpII in binding to U1A RRM1. Mutational analysis of the closing base pair suggests it plays a minor role in binding and mainly prevents “breathing” of the loop. Lengthening the stem and nontarget part of the loop suggests that the increased negative charge of the RNA might slightly aid association. However, this is offset by an increase in dissociation, which may be caused by attraction of the RRM to nontarget parts of the RNA. Studies of a single stranded target and RNAs with untethered loops indicate that structure is not very relevant for association but is important for complex stability. In particular, breaking the link between the stem and the 5′ side of the loop greatly increases complex dissociation, presumably by hindering simultaneous contacts between the RRM and stem and loop nucleotides. While binding of U1A to a single stranded target is much weaker than to U1hpII, it occurs with nanomolar affinity, supporting recent evidence that binding of unstructured RNA by U1A has physiological significance. PMID:16738410
The role of RNA structure in the interaction of U1A protein with U1 hairpin II RNA.
Law, Michael J; Rice, Andrew J; Lin, Patti; Laird-Offringa, Ite A
2006-07-01
The N-terminal RNA Recognition Motif (RRM1) of the spliceosomal protein U1A interacting with its target U1 hairpin II (U1hpII) has been used as a paradigm for RRM-containing proteins interacting with their RNA targets. U1A binds to U1hpII via direct interactions with a 7-nucleotide (nt) consensus binding sequence at the 5' end of a 10-nt loop, and via hydrogen bonds with the closing C-G base pair at the top of the RNA stem. Using surface plasmon resonance (Biacore), we have examined the role of structural features of U1hpII in binding to U1A RRM1. Mutational analysis of the closing base pair suggests it plays a minor role in binding and mainly prevents "breathing" of the loop. Lengthening the stem and nontarget part of the loop suggests that the increased negative charge of the RNA might slightly aid association. However, this is offset by an increase in dissociation, which may be caused by attraction of the RRM to nontarget parts of the RNA. Studies of a single stranded target and RNAs with untethered loops indicate that structure is not very relevant for association but is important for complex stability. In particular, breaking the link between the stem and the 5' side of the loop greatly increases complex dissociation, presumably by hindering simultaneous contacts between the RRM and stem and loop nucleotides. While binding of U1A to a single stranded target is much weaker than to U1hpII, it occurs with nanomolar affinity, supporting recent evidence that binding of unstructured RNA by U1A has physiological significance.
Long non-coding RNA expression profile in Cdk5-knockdown mouse skin.
Ji, Kaiyuan; Fan, Ruiwen; Zhang, Junzhen; Yang, Shanshan; Dong, Changsheng
2018-06-08
To elucidate the Cdk5 regulatory molecular mechanism in skin, we generated Cdk5-knockdown mice and subjected their skins to lncRNA sequencing. The results showed that there were 4533 novel lncRNAs from 142 lncRNA families. In total, 693 lncRNAs were significantly differentially expressed. Alignment analysis of the lncRNAs in miRBase identified 45 pre-mRNAs. By KEGG PATHWAY Database analysis, we found that lncRNAs (lnc-NONMMUT064276.2, lnc-NONMMUT075728.1, and lnc-NONMMUT039653.2) may regulate pigmentation by regulating target genes. To reveal potential antisense lncRNA-mRNA interactions, we searched all lncRNA-mRNA duplexes using RNAplex, and found 97 lncRNAs interacted with mRNAs. The luciferase assay confirmed that TCONS_00049140 binded to Krt80 by the co-transfection of pVAX1-TCONS_00049140 and pGL0-Krt80 expression plasmids in 293T cell, based on the bioinformatics analysis. Overexpression of TCONS_00049140 in mouse melanocytes down-regulated Krt80 and resulted in the phenotype of increased cell proliferation and increased melanin production. The results suggested that TCONS_00049140 contributed to skin thickening through Krt80. Our findings provide a direction for research of the molecular mechanism of Cdk5 function. Copyright © 2017. Published by Elsevier B.V.
Klug, G; Cohen, S N
1990-01-01
Differential expression of the genes within the puf operon of Rhodobacter capsulatus is accomplished in part by differences in the rate of degradation of different segments of the puf transcript. We report here that decay of puf mRNA sequences specifying the light-harvesting I (LHI) and reaction center (RC) photosynthetic membrane peptides is initiated endoribonucleolytically within a discrete 1.4-kilobase segment of the RC-coding region. Deletion of this segment increased the half-life of the RC-coding region from 8 to 20 min while not affecting decay of LHI-coding sequences upstream from an intercistronic hairpin loop structure shown previously to impede 3'-to-5' degradation. Prolongation of RC segment half-life was dependent on the presence of other hairpin structures 3' to the RC region. Inserting the endonuclease-sensitive sites into the LHI-coding segment markedly accelerated its degradation. Our results suggest that differential degradation of the RC- and LHI-coding segments of puf mRNA is accomplished at least in part by the combined actions of RC region-specific endonuclease(s), one or more exonucleases, and several strategically located exonuclease-impeding hairpins. Images PMID:2394682
Role of the terminator hairpin in the biogenesis of functional Hfq-binding sRNAs.
Morita, Teppei; Nishino, Ryo; Aiba, Hiroji
2017-09-01
Rho-independent transcription terminators of the genes encoding bacterial Hfq-binding sRNAs possess a set of seven or more T residues at the 3' end, as noted in previous studies. Here, we have studied the role of the terminator hairpin in the biogenesis of sRNAs focusing on SgrS and RyhB in Escherichia coli. We constructed variant sRNA genes in which the GC-rich inverted repeat sequences are extended to stabilize the terminator hairpins. We demonstrate that the extension of the hairpin stem leads to generation of heterogeneous transcripts in which the poly(U) tail is shortened. The transcripts with shortened poly(U) tails no longer bind to Hfq and lose the ability to repress the target mRNAs. The shortened transcripts are generated in an in vitro transcription system with purified RNA polymerase, indicating that the generation of shortened transcripts is caused by premature transcription termination. We conclude that the terminator structure of sRNA genes is optimized to generate functional sRNAs. Thus, the Rho-independent terminators of sRNA genes possess two common features: a long T residue stretch that is a prerequisite for generation of functional sRNAs and a moderate strength of hairpin structure that ensures the termination at the seventh or longer position within the consecutive T stretch. The modulation of the termination position at the Rho-independent terminators is critical for biosynthesis of functional sRNAs. © 2017 Morita et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Miniature short hairpin RNA screens to characterize antiproliferative drugs.
Kittanakom, Saranya; Arnoldo, Anthony; Brown, Kevin R; Wallace, Iain; Kunavisarut, Tada; Torti, Dax; Heisler, Lawrence E; Surendra, Anuradha; Moffat, Jason; Giaever, Guri; Nislow, Corey
2013-08-07
The application of new proteomics and genomics technologies support a view in which few drugs act solely by inhibiting a single cellular target. Indeed, drug activity is modulated by complex, often incompletely understood cellular mechanisms. Therefore, efforts to decipher mode of action through genetic perturbation such as RNAi typically yields "hits" that fall into several categories. Of particular interest to the present study, we aimed to characterize secondary activities of drugs on cells. Inhibiting a known target can result in clinically relevant synthetic phenotypes. In one scenario, drug perturbation could, for example, improperly activate a protein that normally inhibits a particular kinase. In other cases, additional, lower affinity targets can be inhibited as in the example of inhibition of c-Kit observed in Bcr-Abl-positive cells treated with Gleevec. Drug transport and metabolism also play an important role in the way any chemicals act within the cells. Finally, RNAi per se can also affect cell fitness by more general off-target effects, e.g., via the modulation of apoptosis or DNA damage repair. Regardless of the root cause of these unwanted effects, understanding the scope of a drug's activity and polypharmacology is essential for better understanding its mechanism(s) of action, and such information can guide development of improved therapies. We describe a rapid, cost-effective approach to characterize primary and secondary effects of small-molecules by using small-scale libraries of virally integrated short hairpin RNAs. We demonstrate this principle using a "minipool" composed of shRNAs that target the genes encoding the reported protein targets of approved drugs. Among the 28 known reported drug-target pairs, we successfully identify 40% of the targets described in the literature and uncover several unanticipated drug-target interactions based on drug-induced synthetic lethality. We provide a detailed protocol for performing such screens and for
Miniature Short Hairpin RNA Screens to Characterize Antiproliferative Drugs
Kittanakom, Saranya; Arnoldo, Anthony; Brown, Kevin R.; Wallace, Iain; Kunavisarut, Tada; Torti, Dax; Heisler, Lawrence E.; Surendra, Anuradha; Moffat, Jason; Giaever, Guri; Nislow, Corey
2013-01-01
The application of new proteomics and genomics technologies support a view in which few drugs act solely by inhibiting a single cellular target. Indeed, drug activity is modulated by complex, often incompletely understood cellular mechanisms. Therefore, efforts to decipher mode of action through genetic perturbation such as RNAi typically yields “hits” that fall into several categories. Of particular interest to the present study, we aimed to characterize secondary activities of drugs on cells. Inhibiting a known target can result in clinically relevant synthetic phenotypes. In one scenario, drug perturbation could, for example, improperly activate a protein that normally inhibits a particular kinase. In other cases, additional, lower affinity targets can be inhibited as in the example of inhibition of c-Kit observed in Bcr-Abl−positive cells treated with Gleevec. Drug transport and metabolism also play an important role in the way any chemicals act within the cells. Finally, RNAi per se can also affect cell fitness by more general off-target effects, e.g., via the modulation of apoptosis or DNA damage repair. Regardless of the root cause of these unwanted effects, understanding the scope of a drug’s activity and polypharmacology is essential for better understanding its mechanism(s) of action, and such information can guide development of improved therapies. We describe a rapid, cost-effective approach to characterize primary and secondary effects of small-molecules by using small-scale libraries of virally integrated short hairpin RNAs. We demonstrate this principle using a “minipool” composed of shRNAs that target the genes encoding the reported protein targets of approved drugs. Among the 28 known reported drug−target pairs, we successfully identify 40% of the targets described in the literature and uncover several unanticipated drug−target interactions based on drug-induced synthetic lethality. We provide a detailed protocol for performing such
DOE Office of Scientific and Technical Information (OSTI.GOV)
Niyogi, S.K.; Mitra, S.
Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.
Watanabe, Colin; Cuellar, Trinna L.; Haley, Benjamin
2016-01-01
ABSTRACT Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional siRNAs into shRNA/artificial miRNA backbones, or large-scale screens to identify efficacious sequences. Thus, we used quantitative cell-based assays to compare separate third generation artificial miRNA systems, miR-E (based on miR-30a) and miR-3G (based on miR-16-2 and first described in this study) to widely-adopted, first and second generation formats in both Pol-II and Pol-III expression vector contexts. Despite their unique structures and strandedness, and in contrast to first and second-generation RNAi triggers, the third generation formats operated with remarkable similarity to one another, and strong silencing was observed with a significant fraction of the evaluated target sequences within either promoter context. By pairing an established siRNA design algorithm with the third generation vectors we could readily identify targeting sequences that matched or exceeded the potency of those discovered through large-scale sensor-based assays. We find that third generation hairpin systems enable the maximal level of siRNA function, likely through enhanced processing and accumulation of precisely-defined guide RNAs. Therefore, we predict future gains in RNAi potency will come from improved hairpin expression and identification of optimal siRNA-intrinsic silencing properties rather than further modification of these scaffolds. Consequently, third generation systems should be the primary format for vector-based RNAi studies; miR-3G is advantageous due to its small expression cassette and simplified, cost-efficient cloning scheme. PMID:26786363
Yao, Juan; Zhang, Zhang; Deng, Zhenghua; Wang, Youqiang; Guo, Yongcan
2017-10-23
An isothermal, enzyme free, ultra-specific and ultra-sensitive protocol for electrochemical detection of miRNAs is proposed based on the toehold-mediated strand displacement reaction (SDR) and non-enzymatic catalytic hairpin reaction (CHA) recycling. The SDR was first triggered only in the presence of target miRNA and this process also affects other miRNA interferences having similar target sequences, thus guaranteeing a high discrimination factor and could be used in rare content miRNA detection with various amounts of interferences having similar target sequences. The output protector strand then triggered enzyme free CHA amplification and generates plenty of hairpin self-assembly products. This process in turn influences SDR equilibrium to move to the right and generates large amounts of protector output to ensure analysis sensitivity. Compared with traditional CHA, our proposed method greatly improved the signal to noise ratio and shows excellent performance in rare miRNA detection with miRNA analogue interference. Under the optimal experimental conditions and using square wave voltammetry, the established biosensor could detect target miRNA-21 down to 30 fM (S/N = 3) with a dynamic range from 100 fM to 2 nM, and discriminate rare target miRNA-21 from mismatched miRNA with high selectivity. This method holds great promise in miRNA detection from human cancer cell lines and would be a versatile and powerful tool for clinical molecular diagnostics.
Role of the terminator hairpin in the biogenesis of functional Hfq-binding sRNAs
Morita, Teppei; Nishino, Ryo; Aiba, Hiroji
2017-01-01
Rho-independent transcription terminators of the genes encoding bacterial Hfq-binding sRNAs possess a set of seven or more T residues at the 3′ end, as noted in previous studies. Here, we have studied the role of the terminator hairpin in the biogenesis of sRNAs focusing on SgrS and RyhB in Escherichia coli. We constructed variant sRNA genes in which the GC-rich inverted repeat sequences are extended to stabilize the terminator hairpins. We demonstrate that the extension of the hairpin stem leads to generation of heterogeneous transcripts in which the poly(U) tail is shortened. The transcripts with shortened poly(U) tails no longer bind to Hfq and lose the ability to repress the target mRNAs. The shortened transcripts are generated in an in vitro transcription system with purified RNA polymerase, indicating that the generation of shortened transcripts is caused by premature transcription termination. We conclude that the terminator structure of sRNA genes is optimized to generate functional sRNAs. Thus, the Rho-independent terminators of sRNA genes possess two common features: a long T residue stretch that is a prerequisite for generation of functional sRNAs and a moderate strength of hairpin structure that ensures the termination at the seventh or longer position within the consecutive T stretch. The modulation of the termination position at the Rho-independent terminators is critical for biosynthesis of functional sRNAs. PMID:28606943
Khandelia, Piyush; Yap, Karen; Makeyev, Eugene V
2011-08-02
Sequence-specific gene silencing by short hairpin (sh) RNAs has recently emerged as an indispensable tool for understanding gene function and a promising avenue for drug discovery. However, a wider biomedical use of this approach is hindered by the lack of straightforward methods for achieving uniform expression of shRNAs in mammalian cell cultures. Here we report a high-efficiency and low-background (HILO) recombination-mediated cassette exchange (RMCE) technology that yields virtually homogeneous cell pools containing doxycycline-inducible shRNA elements in a matter of days and with minimal efforts. To ensure immediate utility of this approach for a wider research community, we modified 11 commonly used human (A549, HT1080, HEK293T, HeLa, HeLa-S3, and U2OS) and mouse (CAD, L929, N2a, NIH 3T3, and P19) cell lines to be compatible with the HILO-RMCE process. Because of its technical simplicity and cost efficiency, the technology will be advantageous for both low- and high-throughput shRNA experiments. We also provide evidence that HILO-RMCE will facilitate a wider range of molecular and cell biology applications by allowing one to rapidly engineer cell populations expressing essentially any transgene of interest.
Streamlined platform for short hairpin RNA interference and transgenesis in cultured mammalian cells
Khandelia, Piyush; Yap, Karen; Makeyev, Eugene V.
2011-01-01
Sequence-specific gene silencing by short hairpin (sh) RNAs has recently emerged as an indispensable tool for understanding gene function and a promising avenue for drug discovery. However, a wider biomedical use of this approach is hindered by the lack of straightforward methods for achieving uniform expression of shRNAs in mammalian cell cultures. Here we report a high-efficiency and low-background (HILO) recombination-mediated cassette exchange (RMCE) technology that yields virtually homogeneous cell pools containing doxycycline-inducible shRNA elements in a matter of days and with minimal efforts. To ensure immediate utility of this approach for a wider research community, we modified 11 commonly used human (A549, HT1080, HEK293T, HeLa, HeLa-S3, and U2OS) and mouse (CAD, L929, N2a, NIH 3T3, and P19) cell lines to be compatible with the HILO-RMCE process. Because of its technical simplicity and cost efficiency, the technology will be advantageous for both low- and high-throughput shRNA experiments. We also provide evidence that HILO-RMCE will facilitate a wider range of molecular and cell biology applications by allowing one to rapidly engineer cell populations expressing essentially any transgene of interest. PMID:21768390
Kinetics of hairpin ribozyme cleavage in yeast.
Donahue, C P; Fedor, M J
1997-01-01
Hairpin ribozymes catalyze a self-cleavage reaction that provides a simple model for quantitative analyses of intracellular mechanisms of RNA catalysis. Decay rates of chimeric mRNAs containing self-cleaving ribozymes give a direct measure of intracellular cleavage kinetics in yeast. Intracellular ribozyme-mediated cleavage occurs at similar rates and shows similar inhibition by ribozyme mutations as ribozyme-mediated reactions in vitro, but only when ribozymes are located in a favorable mRNA sequence context. The impact of cleavage on mRNA abundance is shown to depend directly on intrinsic mRNA stability. Surprisingly, cleavage products are no more labile than uncleaved mRNAs despite the loss of terminal cap structures or poly (A). PMID:9292496
A simple and robust vector-based shRNA expression system used for RNA interference.
Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi
2013-01-01
RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.
Zhou, Xiao-Na; Li, Guang-Ming; Xu, Ying-Chen; Zhao, Tuan-Jie; Wu, Ji-Xiang
2016-11-05
Decoy receptor 3 (DcR3) binds to Fas ligand (FasL) and inhibits FasL-induced apoptosis. The receptor is overexpressed in hepatocellular carcinoma (HCC), and it is associated with the growth and metastatic spread of tumors. DcR3 holds promises as a new target for the treatment of HCC, but little is known regarding the molecular mechanisms underlying the oncogenic properties of DcR3. The present work, therefore, examined the role of DcR3 in regulating the growth and invasive property of liver cancer cell HepG2. HepG2 cells were stably transfected with lentivirus-based short hairpin RNA vector targeting DcR3. After the knockdown of DcR3 was confirmed, cell proliferation, clone formation, ability of migrating across transwell membrane, and wound healing were assessed in vitro. Matrix metalloproteinase-9 (MMP 9) and vascular epithelial growth factor (VEGF)-C and D expressions of the DcR3 knockdown were also studied. Comparisons between multiple groups were done using one-way analysis of variance (ANOVA), while pairwise comparisons were performed using Student's t test. P< 0.05 was regarded statistically significant. DcR3 was overexpressed in HepG2 compared to other HCC cell lines and normal hepatocyte Lo-2. Stable knockdown of DcR3 slowed down the growth of HepG2 (P < 0.05) and reduced the number of clones formed by 50% compared to those without DcR3 knockdown (P < 0.05). The knockdown also reduced the migration of HepG2 across transwell matrix membrane by five folds compared to the control (P < 0.05) and suppressed the closure of scratch wound (P < 0.05). In addition, the messenger RNA levels of MMP 9, VEGF-C, and VEGF-D were significantly suppressed by DcR3 knockdown by 90% when compared with the mock control (P < 0.05). Loss of DcR3 impaired the growth and invasive property of HCC cell line of HepG2. Targeting DcR3 may be a potential therapeutic approach for the treatment of HCC.
Zhou, Xiao-Na; Li, Guang-Ming; Xu, Ying-Chen; Zhao, Tuan-Jie; Wu, Ji-Xiang
2016-01-01
Background: Decoy receptor 3 (DcR3) binds to Fas ligand (FasL) and inhibits FasL-induced apoptosis. The receptor is overexpressed in hepatocellular carcinoma (HCC), and it is associated with the growth and metastatic spread of tumors. DcR3 holds promises as a new target for the treatment of HCC, but little is known regarding the molecular mechanisms underlying the oncogenic properties of DcR3. The present work, therefore, examined the role of DcR3 in regulating the growth and invasive property of liver cancer cell HepG2. Methods: HepG2 cells were stably transfected with lentivirus-based short hairpin RNA vector targeting DcR3. After the knockdown of DcR3 was confirmed, cell proliferation, clone formation, ability of migrating across transwell membrane, and wound healing were assessed in vitro. Matrix metalloproteinase-9 (MMP 9) and vascular epithelial growth factor (VEGF)-C and D expressions of the DcR3 knockdown were also studied. Comparisons between multiple groups were done using one-way analysis of variance (ANOVA), while pairwise comparisons were performed using Student's t test. P < 0.05 was regarded statistically significant. Results: DcR3 was overexpressed in HepG2 compared to other HCC cell lines and normal hepatocyte Lo-2. Stable knockdown of DcR3 slowed down the growth of HepG2 (P < 0.05) and reduced the number of clones formed by 50% compared to those without DcR3 knockdown (P < 0.05). The knockdown also reduced the migration of HepG2 across transwell matrix membrane by five folds compared to the control (P < 0.05) and suppressed the closure of scratch wound (P < 0.05). In addition, the messenger RNA levels of MMP 9, VEGF-C, and VEGF-D were significantly suppressed by DcR3 knockdown by 90% when compared with the mock control (P < 0.05). Conclusions: Loss of DcR3 impaired the growth and invasive property of HCC cell line of HepG2. Targeting DcR3 may be a potential therapeutic approach for the treatment of HCC. PMID:27779171
Yao, Yilong; Ma, Jun; Xue, Yixue; Wang, Ping; Li, Zhen; Liu, Jing; Chen, Liangyu; Xi, Zhuo; Teng, Hao; Wang, Zhenhua; Li, Zhiqing; Liu, Yunhui
2015-04-01
Glioblastoma (GBM) is the most common and aggressive primary brain tumor. Great interest persists in useful therapeutic targets in GBM. Aberrant expression of long non-coding RNAs (lncRNAs) has been functionally associated with many cancers. Here, we elucidated the function and the possible molecular mechanisms of lncRNA XIST in human glioblastoma stem cells (GSCs). Our results proved that XIST expression was up-regulated in glioma tissues and GSCs. Functionally, knockdown of XIST exerted tumor-suppressive functions by reducing cell proliferation, migration and invasion as well as inducing apoptosis. The in vivo studies also showed that knockdown of XIST suppressed tumor growth and produced high survival in nude mice. Further, there was reciprocal repression between XIST and miR-152. Mechanistic investigations defined the direct binding ability of the predicted miR-152 binding site on the XIST. In addition, XIST and miR-152 are probably in the same RNA induced silencing complex (RISC). Finally, miR-152 mediated the tumor-suppressive effects that knockdown of XIST exerted. Taken together, these results provided a comprehensive analysis of XIST in GSCs and important clues for understanding the key roles of lncRNA-miRNA functional network in human glioma. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.
Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G
2018-05-18
Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.
Yang, Dong; Dai, Xiaoyu; Li, Keqiang; Xie, Yangyang; Zhao, Jianpei; Dong, Mingjun; Yu, Hua; Kong, Zhenfang
2018-06-01
Stromal interaction molecule 1 (STIM1) is an endoplasmic reticulum Ca 2+ sensor which has been reported to be overexpressed in numerous types of cancer, and is involved in the cell proliferation, invasion, migration and metastasis frequently observed in cancer. However, the role of STIM1 in colorectal cancer (CRC) remains unknown. The purpose of the present study was to investigate the effect of STIM1 in human CRC. The expression of STIM1 was specifically knocked down using lentivirus-mediated small hairpin RNA (shRNA) interference techniques in the CRC cell lines HCT116 and SW1116. Subsequently, the efficiency of infection was confirmed using green fluorescent protein (GFP)-positive signals. The knockdown efficiency was further determined using the reverse transcription-quantitative polymerase chain reaction and western blotting analysis. As a result, CRC cell lines with STIM1 silenced were successfully constructed and subsequently employed in a series of cell function assays. Knockdown of STIM1 significantly suppressed cell proliferation and colony formation, as revealed by an MTT and colony formation assay. Furthermore, it was identified that STIM1 silencing may promote cell apoptosis through the induction of mitochondria-associated apoptosis, as was identified by increased expression levels of B-cell lymphoma 2 (Bcl-2)-associated death promoter, Bcl-2-associated X protein and poly(ADP-ribose) polymerase cleavage. Therefore, STIM1 may serve a critical role in the progression of CRC by regulating cell proliferation and apoptosis, which may provide a potential therapeutic target for the treatment of CRC.
Binding of DNA hairpins to an assembler-strand as part of a primordial translation device
NASA Astrophysics Data System (ADS)
Baumann, Ulrich
1987-09-01
A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.
si-RNA-mediated knockdown of PDLIM5 suppresses gastric cancer cell proliferation in vitro.
Li, Yanliang; Gao, Yongsheng; Xu, Yue; Sun, Xianjun; Song, Xilin; Ma, Heng; Yang, Mingshan
2015-04-01
Gastric cancer is the second most prominent cause of cancer mortality in the world. This study was designed to identify the possible use of si-RNA-mediated PDLIM5 gene silencing as a therapeutic tool for gastric cancer. Expression levels of PDLIM5 were detected in several gastric cancer cell lines using Western blot and qRT-PCR. We found PDLIM5 is highly expressed in all cultured gastric cancer cell lines. Small interfering RNA (si-RNA) was then employed to knock down PDLIM5 expression in MGC80-3 gastric cancer cells. Knockdown of PDLIM5 significantly inhibited cell proliferation and colony formation. Moreover, the absence of PDLIM5 in MGC80-3 cells led to S phase cell cycle arrest and apoptosis. This study highlights the critical role of PDLIM5 in gastric cancer cell growth and suggests that si-RNA-mediated silencing of PDLIM5 might serve as a potential therapeutic approach for the treatment of gastric cancer. © 2014 John Wiley & Sons A/S.
Biondi, Elisa; Branciamore, Sergio; Maurel, Marie-Christine; Gallori, Enzo
2007-01-01
Background The hypothesis of an RNA-based origin of life, known as the "RNA world", is strongly affected by the hostile environmental conditions probably present in the early Earth. In particular, strong UV and X-ray radiations could have been a major obstacle to the formation and evolution of the first biomolecules. In 1951, J. D. Bernal first proposed that clay minerals could have served as the sites of accumulation and protection from degradation of the first biopolymers, providing the right physical setting for the evolution of more complex systems. Numerous subsequent experimental studies have reinforced this hypothesis. Results The ability of the possibly widespread prebiotic, clay mineral montmorillonite to protect the catalytic RNA molecule ADHR1 (Adenine Dependent Hairpin Ribozyme 1) from UV-induced damages was experimentally checked. In particular, the self-cleavage reaction of the ribozyme was evaluated after UV-irradiation of the molecule in the absence or presence of clay particles. Results obtained showed a three-fold retention of the self-cleavage activity of the montmorillonite-protected molecule, with respect to the same reaction performed by the ribozyme irradiated in the absence of the clay. Conclusion These results provide a suggestion with which RNA, or RNA-like molecules, could have overcame the problem of protection from UV irradiation in the RNA world era, and suggest that a clay-rich environment could have favoured not only the formation of first genetic molecules, but also their evolution towards increasingly complex molecular organization. PMID:17767730
Flanagan, Sheryl A; Cooper, Kristin S; Mannava, Sudha; Nikiforov, Mikhail A; Shewach, Donna S
2012-12-01
To determine the effect of short hairpin ribonucleic acid (shRNA)-mediated suppression of thymidylate synthase (TS) on cytotoxicity and radiosensitization and the mechanism by which these events occur. shRNA suppression of TS was compared with 5-fluoro-2'-deoxyuridine (FdUrd) inactivation of TS with or without ionizing radiation in HCT116 and HT29 colon cancer cells. Cytotoxicity and radiosensitization were measured by clonogenic assay. Cell cycle effects were measured by flow cytometry. The effects of FdUrd or shRNA suppression of TS on dNTP deoxynucleotide triphosphate imbalances and consequent nucleotide misincorporations into deoxyribonucleic acid (DNA) were analyzed by high-pressure liquid chromatography and as pSP189 plasmid mutations, respectively. TS shRNA produced profound (≥ 90%) and prolonged (≥ 8 days) suppression of TS in HCT116 and HT29 cells, whereas FdUrd increased TS expression. TS shRNA also produced more specific and prolonged effects on dNTPs deoxynucleotide triphosphates compared with FdUrd. TS shRNA suppression allowed accumulation of cells in S-phase, although its effects were not as long-lasting as those of FdUrd. Both treatments resulted in phosphorylation of Chk1. TS shRNA alone was less cytotoxic than FdUrd but was equally effective as FdUrd in eliciting radiosensitization (radiation enhancement ratio: TS shRNA, 1.5-1.7; FdUrd, 1.4-1.6). TS shRNA and FdUrd produced a similar increase in the number and type of pSP189 mutations. TS shRNA produced less cytotoxicity than FdUrd but was equally effective at radiosensitizing tumor cells. Thus, the inhibitory effect of FdUrd on TS alone is sufficient to elicit radiosensitization with FdUrd, but it only partially explains FdUrd-mediated cytotoxicity and cell cycle inhibition. The increase in DNA mismatches after TS shRNA or FdUrd supports a causal and sufficient role for the depletion of dTTP thymidine triphosphate and consequent DNA mismatches underlying radiosensitization. Importantly, shRNA
Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun
2011-01-01
Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219
Keebaugh, Alaine C.; Barrett, Catherine E.; LaPrairie, Jamie L.; Jenkins, Jasmine J.; Young, Larry J.
2015-01-01
Oxytocin modulates many aspects of social cognition and behaviors, including maternal nurturing, social recognition and bonding. Natural variation in oxytocin receptor (OXTR) density in the nucleus accumbens (NAcc) is associated with variation in alloparental behavior, and artificially enhancing OXTR expression in the NAcc enhances alloparental behavior and pair bonding in socially monogamous prairie voles. Furthermore, infusion of an OXTR antagonist into the nucleus accumbens (NAcc) inhibits alloparental behavior and partner preference formation. However, antagonists can promiscuously interact with other neuropeptide receptors. To directly examine the role of OXTR signaling in social bonding, we used RNA interference to selectively knockdown, but not eliminate, OXTR in the NAcc of female prairie voles and examined the impact on social behaviors. Using an adeno-associated viral vector expressing a short hairpin RNA (shRNA) targeting Oxtr mRNA, we reduced accumbal OXTR density in female prairie voles from juvenile age through adulthood. Females receiving the shRNA vector displayed a significant reduction in alloparental behavior and disrupted partner preference formation. These are the first direct demonstrations that OXTR plays a critical role in alloparental behavior and adult social attachment, and suggest that natural variation in OXTR expression in this region alone can create variation in social behavior. PMID:25874849
Fan, Tingting; Zhang, Changsong; Zong, Ming; Fan, Lieying
2018-01-01
Impaired apoptosis of rheumatoid arthritis (RA)-fibroblast-like synoviocytes (FLS) is pivotal in the process of RA. Peptidyl arginine deiminase type IV (PADI4) is associated with autoantibody regulation via histone citrullination in RA. The present study aimed to investigate the role of PADI4 in the apoptosis of RA-FLS. FLS were isolated from patients with RA and a rat model. The effects of PADI4 on RA-FLS were investigated in vitro and in vivo. Hypoxia-induced autophagy was induced by 1% O2 and was detected by immunohistochemical and immunofluorescence analysis; in addition, apoptosis was detected by flow cytometry. RA-FLS obtained from RA rat model exhibited significant proliferation under severe hypoxia conditions. Hypoxia also significantly induced autophagy and elevated the expression of PADI4. Subsequently, short hairpin RNA-mediated PADI4 knockdown was demonstrated to significantly inhibit hypoxia-induced autophagy and promote apoptosis in RA-FLS. The results of these in vitro and in vivo studies suggested that PADI4 may be closely associated with hypoxia-induced autophagy, and the inhibition of hypoxia-induced autophagy by PADI4 knockdown may contribute to an increase in the apoptosis of RA-FLS. PMID:29393388
Woo, Ha-Na; Lee, Won Il; Kim, Ji Hyun; Ahn, Jeonghyun; Han, Jeong Hee; Lim, Sue Yeon; Lee, Won Woo; Lee, Heuiran
2015-12-01
A proof-of-concept study is presented using dual gene therapy that employed a small hairpin RNA (shRNA) specific for mammalian target of rapamycin (mTOR) and a herpes simplex virus-thymidine kinase (HSV-TK) gene to inhibit the growth of tumors. Recombinant adeno-associated virus (rAAV) vectors containing a mutant TK gene (sc39TK) were transduced into HeLa cells, and the prodrug ganciclovir (GCV) was administered to establish a suicide gene-therapy strategy. Additionally, rAAV vectors expressing an mTOR-targeted shRNA were employed to suppress mTOR-dependent tumor growth. GCV selectively induced death in tumor cells expressing TK, and the mTOR-targeted shRNA altered the cell cycle to impair tumor growth. Combining the TK-GCV system with mTOR inhibition suppressed tumor growth to a greater extent than that achieved with either treatment alone. Furthermore, HSV-TK expression and mTOR inhibition did not mutually interfere with each other. In conclusion, gene therapy that combines the TK-GCV system and mTOR inhibition shows promise as a novel strategy for cancer therapy.
Lv, Xiangqi; Tan, Jing; Liu, Dongdong; Wu, Ping; Cui, Xiaoguang
2012-06-01
Lung ischemia-reperfusion injury (LIRI) remains a significant problem after lung transplantation. A crucial signaling enzyme involved in inflammation and apoptosis during LIRI is p38 mitogen-activated protein kinase (MAPK). Gene silencing of p38α by short hairpin RNA (shRNA) can downregulate p38α expression. The lungs have an extremely large surface area, which makes the absorption of shRNA highly effective. Therefore, we evaluated the therapeutic efficacy of p38α shRNA plasmids in a rat model of lung transplantation. The delivery of p38α shRNA plasmid was performed by intratracheal administration 48 hours before transplantation into donor rats. Control animals received scrambled shRNA plasmids. Reverse-transcription polymerase chain reaction and Western blots were used to assess gene silencing efficacy. The therapeutic effects of shRNA plasmids were evaluated by lung function tests. We determined the levels of inflammatory cytokines, the level of intercellular adhesion molecule 1 (ICAM-1), c-Myc mRNA expression, and ICAM-1 protein expression, and the presence of cell apoptosis. Rats administered p38α shRNA plasmids showed a significant downregulation in lung expression of p38α transcripts and protein levels. Compared with the control group, the p38α shRNA group showed a higher pulmonary vein oxygen level, lower wet weight-to-dry weight ratio, lower lung injury score, and lower serum levels of tumor necrosis factor-α, interleukin-6, and interleukin-8. Messenger RNA levels of ICAM-1 and c-Myc in the p38α shRNA group were dramatically lower than in the control group. Levels of ICAM-1 protein expression exhibited a similar trend. Cell apoptosis decreased in the p38α shRNA group vs the control group. Intratracheal administration of p38α shRNA plasmids provided therapeutic effects in a rat model of lung transplantation. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.
Yu, Han; Pan, Houwen Matthew; Evalin, Fnu; Trau, Dieter Wilhelm; Patzel, Volker
2018-06-05
The breakthrough of genetic therapy is set back by the lack of suitable genetic vector systems. We present the development of permeability-tunable, capsule-like, polymeric, micron-sized, core-shell particles for delivery of recombinant nucleic acids into target cells. These particles were demonstrated to effectively release rod-shaped small hairpin RNA and to selectively retain the RNA-encoding DNA template which was designed to form a bulky tripartite structure. Thus, they can serve as delivery vectors preloaded with cargo RNA or alternatively as RNA producing micro-bioreactors. The internalization of particles by human tissue culture cells inversely correlated with particle size and with the cell to particle ratio, though at a higher than stoichiometric excess of particles over cells, cell viability was impaired. Among primary human peripheral blood mononuclear cells, up to 50% of the monocytes displayed positive uptake of particles. Finally, these particles efficiently delivered siRNA into HEK293T cells triggering functional knockdown of the target gene lamin A/C. Particle-mediated knockdown was superior to that observed after conventional siRNA delivery via lipofection. Core-shell particles protect encapsulated nucleic acids from degradation and target cell genomes from direct contact with recombinant DNA, thus representing a promising delivery vector system that can be explored for genetic therapy and vaccination.
Li, N; Jiang, K; Fang, L P; Yao, L L; Yu, Z
2018-06-26
Long noncoding RNA colon cancer-associated transcript 1 (lncRNA CCAT1) is highly expressed in gastric cancer (GC) tissues compared with normal counterparts and CCAT1 upregulation can promote proliferation and migration of GC cells in vitro. B-cell specific moloney leukemia virus insertion site 1 (Bmi-1) expression is positively correlated with tumor progression. The present study aimed to investigate the biological functions of CCAT1 and the relationships between CCAT1 and Bmi-1 in GC progression. In the present study, CCAT1 was knocked down by specific shRNA transfection in two human GC cell lines (MGC-803 and SGC-7901). The effects of CCAT1 knockdown on GC cell proliferation, cell cycle, migration and invasion were investigated in vitro. The effect of CCAT1 knockdown on peritoneal metastasis was assessed in nude mice. Bmi-1 expression levels were examined both in vitro and in vivo. The results showed that CCAT1 knockdown markedly inhibited cell proliferation, migration and invasion, arrested the cell cycle at G0/G1 phase in vitro, and inhibited peritoneal metastasis in nude mice, along with the downregulation of Bmi-1. Taken together, CCAT1 is functionally involved in growth and metastasis of GC cells and it may be a potential target for GC therapy.
The catalytic mechanism of hairpin ribozyme studied by hydrostatic pressure
Tobé, Sylvia; Heams, Thomas; Vergne, Jacques; Hervé, Guy; Maurel, Marie-Christine
2005-01-01
The discovery of ribozymes strengthened the RNA world hypothesis, which assumes that these precursors of modern life both stored information and acted as catalysts. For the first time among extensive studies on ribozymes, we have investigated the influence of hydrostatic pressure on the hairpin ribozyme catalytic activity. High pressures are of interest when studying life under extreme conditions and may help to understand the behavior of macromolecules at the origins of life. Kinetic studies of the hairpin ribozyme self-cleavage were performed under high hydrostatic pressure. The activation volume of the reaction (34 ± 5 ml/mol) calculated from these experiments is of the same order of magnitude as those of common protein enzymes, and reflects an important compaction of the RNA molecule during catalysis, associated to a water release. Kinetic studies were also carried out under osmotic pressure and confirmed this interpretation and the involvement of water movements (78 ± 4 water molecules per RNA molecule). Taken together, these results are consistent with structural studies indicating that loops A and B of the ribozyme come into close contact during the formation of the transition state. While validating baro-biochemistry as an efficient tool for investigating dynamics at work during RNA catalysis, these results provide a complementary view of ribozyme catalytic mechanisms. PMID:15870387
Bayne, Charlie F; Widawski, Max E; Gao, Feng; Masab, Mohammed H; Chattopadhyay, Maitreyi; Murawski, Allison M; Sansevere, Robert M; Lerner, Bryan D; Castillo, Rinaldys J; Griesman, Trevor; Fu, Jiantao; Hibben, Jennifer K; Garcia-Perez, Alma D; Simon, Anne E; Kushner, David B
2018-07-01
Noncoding RNAs use their sequence and/or structure to mediate function(s). The 5' portion (166 nt) of the 356-nt noncoding satellite RNA C (satC) of Turnip crinkle virus (TCV) was previously modeled to contain a central region with two stem-loops (H6 and H7) and a large connecting hairpin (H2). We now report that in vivo functional selection (SELEX) experiments assessing sequence/structure requirements in H2, H6, and H7 reveal that H6 loop sequence motifs were recovered at nonrandom rates and only some residues are proposed to base-pair with accessible complementary sequences within the 5' central region. In vitro SHAPE of SELEX winners indicates that the central region is heavily base-paired, such that along with the lower stem and H2 region, one extensive hairpin exists composing the entire 5' region. As these SELEX winners are highly fit, these characteristics facilitate satRNA amplification in association with TCV in plants. Copyright © 2018 Elsevier Inc. All rights reserved.
Automated classification of RNA 3D motifs and the RNA 3D Motif Atlas
Petrov, Anton I.; Zirbel, Craig L.; Leontis, Neocles B.
2013-01-01
The analysis of atomic-resolution RNA three-dimensional (3D) structures reveals that many internal and hairpin loops are modular, recurrent, and structured by conserved non-Watson–Crick base pairs. Structurally similar loops define RNA 3D motifs that are conserved in homologous RNA molecules, but can also occur at nonhomologous sites in diverse RNAs, and which often vary in sequence. To further our understanding of RNA motif structure and sequence variability and to provide a useful resource for structure modeling and prediction, we present a new method for automated classification of internal and hairpin loop RNA 3D motifs and a new online database called the RNA 3D Motif Atlas. To classify the motif instances, a representative set of internal and hairpin loops is automatically extracted from a nonredundant list of RNA-containing PDB files. Their structures are compared geometrically, all-against-all, using the FR3D program suite. The loops are clustered into motif groups, taking into account geometric similarity and structural annotations and making allowance for a variable number of bulged bases. The automated procedure that we have implemented identifies all hairpin and internal loop motifs previously described in the literature. All motif instances and motif groups are assigned unique and stable identifiers and are made available in the RNA 3D Motif Atlas (http://rna.bgsu.edu/motifs), which is automatically updated every four weeks. The RNA 3D Motif Atlas provides an interactive user interface for exploring motif diversity and tools for programmatic data access. PMID:23970545
Asymmetric structure of five and six membered DNA hairpin loops
NASA Technical Reports Server (NTRS)
Baumann, U.; Chang, S.
1995-01-01
The tertiary structure of nucleic acid hairpins was elucidated by means of the accessibility of the single-strand-specific nuclease from mung bean. This molecular probe has proven especially useful in determining details of the structural arrangement of the nucleotides within a loop. In this study 3'-labeling is introduced to complement previously used 5'-labeling in order to assess and to exclude possible artifacts of the method. Both labeling procedures result in mutually consistent cleavage patterns. Therefore, methodological artifacts can be excluded and the potential of the nuclease as structural probe is increased. DNA hairpins with five and six membered loops reveal an asymmetric loop structure with a sharp bend of the phosphate-ribose backbone between the second and third nucleotide on the 3'-side of a loop. These hairpin structures differ from smaller loops with 3 or 4 members, which reveal this type of bend between the first and second 3' nucleotide, and resemble with respect to the asymmetry anticodon loops of tRNA.
Zhang, Jingpu; Li, Chao; Zhi, Xiao; Ramón, Gabriel Alfranca; Liu, Yanlei; Zhang, Chunlei; Pan, Fei; Cui, Daxiang
2016-01-19
MicroRNA (miRNA) biomarkers display great potential for cancer diagnosis and prognosis. The development of rapid and specific methods for miRNA detection has become a hotspot. Herein, hairpin DNA-templated silver nanoclusters (AgNCs/HpDNA) were prepared and integrated into strand-displacement amplification (SDA) as a novel beacon for miRNA detection. The light-up platform was established based on guanine (G)-rich fluorescence enhancement that essentially converted the excitation/emission pair of AgNCs/HpDNAs from a shorter wavelength to a longer wavelength, and then achieved fluorescent enhancement at longer wavelength. On the basis of the validation of the method, the single and duplex detection were conducted in two plasma biomarkers (miR-16-5p and miR-19b-3p) for the diagnosis of gastric cancer. The probe (AgNCs/RED 16(7s)C) utilized for miR-16-5p detection adopted a better conformation with high specificity to recognize single-base mismatches by producing dramatically opposite signals (increase or decrease at 580 nm ex/640 nm em) while the probe (AgNCs/GRE 19b(5s)C) for miR-19b-3p generated dual signals (increase at 490 nm ex/570 nm em and decrease at 430 nm ex/530 nm em) with bright fluorescence in one reaction during the amplification, but unexpectedly was partially digested. This is for the first time to allow the generation of enhanced fluorescent AgNCs and the target recognition integrated into a single process, which offers great opportunity for specific miRNA detection in an easy and rapid way.
Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo
2012-08-01
A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.
cis-Acting elements important for retroviral RNA packaging specificity.
Beasley, Benjamin E; Hu, Wei-Shau
2002-05-01
Spleen necrosis virus (SNV) proteins can package RNA from distantly related murine leukemia virus (MLV), whereas MLV proteins cannot package SNV RNA efficiently. We used this nonreciprocal recognition to investigate regions of packaging signals that influence viral RNA encapsidation specificity. Although the MLV and SNV packaging signals (Psi and E, respectively) do not contain significant sequence homology, they both contain a pair of hairpins. This hairpin pair was previously proposed to be the core element in MLV Psi. In the present study, MLV-based vectors were generated to contain chimeric SNV/MLV packaging signals in which the hairpins were replaced with the heterologous counterpart. The interactions between these chimeras and MLV or SNV proteins were examined by virus replication and RNA analyses. SNV proteins recognized all of the chimeras, indicating that these chimeras were functional. We found that replacing the hairpin pair did not drastically alter the ability of MLV proteins to package these chimeras. These results indicate that, despite the important role of the hairpin pair in RNA packaging, it is not the major motif responsible for the ability of MLV proteins to discriminate between the MLV and SNV packaging signals. To determine the role of sequences flanking the hairpins in RNA packaging specificity, vectors with swapped flanking regions were generated and evaluated. SNV proteins packaged all of these chimeras efficiently. In contrast, MLV proteins strongly favored chimeras with the MLV 5'-flanking regions. These data indicated that MLV Gag recognizes multiple elements in the viral packaging signal, including the hairpin structure and flanking regions.
Guide-substrate base-pairing requirement for box H/ACA RNA-guided RNA pseudouridylation.
De Zoysa, Meemanage D; Wu, Guowei; Katz, Raviv; Yu, Yi-Tao
2018-06-05
Box H/ACA RNAs are a group of small RNAs found in abundance in eukaryotes (as well as in archaea). Although their sequences differ, eukaryotic box H/ACA RNAs all share the same unique hairpin-hinge-hairpin-tail structure. Almost all of them function as guides that primarily direct pseudouridylation of rRNAs and spliceosomal snRNAs at specific sites. Although box H/ACA RNA-guided pseudouridylation has been extensively studied, the detailed rules governing this reaction, especially those concerning the guide RNA-substrate RNA base-pairing interactions that determine the specificity and efficiency of pseudouridylation, are still not exactly clear. This is particularly relevant given that the lengths of the guide sequences involved in base-pairing vary from one box H/ACA RNA to another. Here, we carry out a detailed investigation into guide-substrate base-pairing interactions, and identify the minimum number of base-pairs (8), required for RNA-guided pseudouridylation. In addition, we find that the pseudouridylation pocket, present in each hairpin of box H/ACA RNA, exhibits flexibility in fitting slightly different substrate sequences. Our results are consistent across three independent pseudouridylation pockets tested, suggesting that our findings are generally applicable to box H/ACA RNA-guided RNA pseudouridylation. Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Fechner, H; Suckau, L; Kurreck, J; Sipo, I; Wang, X; Pinkert, S; Loschen, S; Rekittke, J; Weger, S; Dekkers, D; Vetter, R; Erdmann, V A; Schultheiss, H-P; Paul, M; Lamers, J; Poller, W
2007-02-01
Impaired function of the phospholamban (PLB)-regulated sarcoplasmic reticulum Ca(2+) pump (SERCA2a) contributes to cardiac dysfunction in heart failure (HF). PLB downregulation may increase SERCA2a activity and improve cardiac function. Small interfering (si)RNAs mediate efficient gene silencing by RNA interference (RNAi). However, their use for in vivo gene therapy is limited by siRNA instability in plasma and tissues, and by low siRNA transfer rates into target cells. To address these problems, we developed an adenoviral vector (AdV) transcribing short hairpin (sh)RNAs against rat PLB and evaluated its potential to silence the PLB gene and to modulate SERCA2a-mediated Ca(2+) sequestration in primary neonatal rat cardiomyocytes (PNCMs). Over a period of 13 days, vector transduction resulted in stable > 99.9% ablation of PLB-mRNA at a multiplicity of infection of 100. PLB protein gradually decreased until day 7 (7+/-2% left), whereas SERCA, Na(+)/Ca(2+) exchanger (NCX1), calsequestrin and troponin I protein remained unchanged. PLB silencing was associated with a marked increase in ATP-dependent oxalate-supported Ca(2+) uptake at 0.34 microM of free Ca(2+), and rapid loss of responsiveness to protein kinase A-dependent stimulation of Ca(2+) uptake was maintained until day 7. In summary, these results indicate that AdV-derived PLB-shRNA mediates highly efficient, specific and stable PLB gene silencing and modulation of active Ca(2+) sequestration in PNCMs. The availability of the new vector now enables employment of RNAi for the treatment of HF in vivo.
ABCC6 knockdown in HepG2 cells induces a senescent-like cell phenotype.
Miglionico, Rocchina; Ostuni, Angela; Armentano, Maria Francesca; Milella, Luigi; Crescenzi, Elvira; Carmosino, Monica; Bisaccia, Faustino
2017-01-01
Pseudoxanthoma elasticum (PXE) is characterized by progressive ectopic mineralization of elastic fibers in dermal, ocular and vascular tissues. No effective treatment exists. It is caused by inactivating mutations in the gene encoding for the ATP-binding cassette, sub-family C member 6 transporter (ABCC6), which is mainly expressed in the liver. The ABCC6 substrate (s) and the PXE pathomechanism remain unknown. Recent studies have shown that overexpression of ABCC6 in HEK293 cells results in efflux of ATP, which is rapidly converted into nucleoside monophosphates and pyrophosphate (PPi). Since the latter inhibits mineralization, it was proposed that the absence of circulating PPi in PXE patients results in the characteristic ectopic mineralization. These studies also demonstrated that the presence of ABCC6 modifies cell secretory activity and suggested that ABCC6 can change the cell phenotype. Stable ABCC6 knockdown HepG2 clones were generated using small hairpin RNA (shRNA) technology. The intracellular glutathione and ROS levels were determined. Experiments using cell cycle analysis, real-time PCR and western blot were performed on genes involved in the senescence phenotype. To shed light on the physiological role of ABCC6, we focused on the phenotype of HepG2 cells that lack ABCC6 activity. Interestingly, we found that ABCC6 knockdown HepG2 cells show: 1) intracellular reductive stress; 2) cell cycle arrest in G1 phase; 3) upregulation of p21 Cip p53 independent; and 4) downregulation of lamin A/C. These findings show that the absence of ABCC6 profoundly changes the HepG2 phenotype, suggesting that the PXE syndrome is a complex metabolic disease that is not exclusively related to the absence of pyrophosphate in the bloodstream.
Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng
2017-10-01
RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.
2007-03-01
RTb motif mutants hTERT Senescence Apoptosis Long lag period [20,25] Ribozymes Hairpin hTR, hTERT Apoptosis Incomplete knockdown of target [26...O-(2-Methoxyethyl) oligomers. b Reverse transcriptase motif.the growth and viability of cancer cells (Table 1). Ribozymes and short-interfering RNA...recent studies indicate that complete knockdown is not essential for efficient and rapid apoptosis in reference to siRNA against hTR and ribozymes
Knockdown of long noncoding RNA 00152 (LINC00152) inhibits human retinoblastoma progression.
Li, Songhe; Wen, Dacheng; Che, Songtian; Cui, Zhihua; Sun, Yabin; Ren, Hua; Hao, Jilong
2018-01-01
A growing body of evidence supports the involvement of long noncoding RNA 00152 (LINC00152) in the progression and metastasis of multiple cancers. However, the exact roles of LINC00152 in the progression of human retinoblastoma (RB) remain unknown. We explored the expression and biological function of human RB. The expression level of LINC00152 in RB tissues and cells was analyzed using quantitative real-time PCR. The function of LINC00152 was determined using a series of in vitro assays. In vivo, a nude mouse model was established to analyze the function of LINC00152. Gene and protein expressions were detected using quantitative real-time PCR and Western blot assays, respectively. The expression of LINC00152 mRNA was upregulated in RB tissues and cell lines. Knockdown of LINC00152 significantly inhibited cell proliferation, colony formation, migration, and invasion and promoted cell apoptosis and caspase-3 and caspase-8 activities in vitro, as well as suppressing tumorigenesis in vivo. We identified several genes related to proliferation, apoptosis, and invasion including Ki-67, Bcl-2, and MMP-9 that were transcriptionally inactivated by LINC00152. Taken together, these data implicate LINC00152 as a therapeutic target in RB.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K., E-mail: swapan.ray@uscmed.sc.edu
Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly inmore » SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-{kappa}B), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in
Miller, Peter G.; Al-Shahrour, Fatima; Hartwell, Kimberly A.; Chu, Lisa P.; Järås, Marcus; Puram, Rishi V.; Puissant, Alexandre; Callahan, Kevin P.; Ashton, John; McConkey, Marie E.; Poveromo, Luke P.; Cowley, Glenn S.; Kharas, Michael G.; Labelle, Myriam; Shterental, Sebastian; Fujisaki, Joji; Silberstein, Lev; Alexe, Gabriela; Al-Hajj, Muhammad A.; Shelton, Christopher A.; Armstrong, Scott A.; Root, David E.; Scadden, David T.; Hynes, Richard O.; Mukherjee, Siddhartha; Stegmaier, Kimberly; Jordan, Craig T.; Ebert, Benjamin L.
2013-01-01
SUMMARY We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies. In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk. In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model. Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. PMID:23770013
Parallel shRNA and CRISPR-Cas9 screens enable antiviral drug target identification.
Deans, Richard M; Morgens, David W; Ökesli, Ayşe; Pillay, Sirika; Horlbeck, Max A; Kampmann, Martin; Gilbert, Luke A; Li, Amy; Mateo, Roberto; Smith, Mark; Glenn, Jeffrey S; Carette, Jan E; Khosla, Chaitan; Bassik, Michael C
2016-05-01
Broad-spectrum antiviral drugs targeting host processes could potentially treat a wide range of viruses while reducing the likelihood of emergent resistance. Despite great promise as therapeutics, such drugs remain largely elusive. Here we used parallel genome-wide high-coverage short hairpin RNA (shRNA) and clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 screens to identify the cellular target and mechanism of action of GSK983, a potent broad-spectrum antiviral with unexplained cytotoxicity. We found that GSK983 blocked cell proliferation and dengue virus replication by inhibiting the pyrimidine biosynthesis enzyme dihydroorotate dehydrogenase (DHODH). Guided by mechanistic insights from both genomic screens, we found that exogenous deoxycytidine markedly reduced GSK983 cytotoxicity but not antiviral activity, providing an attractive new approach to improve the therapeutic window of DHODH inhibitors against RNA viruses. Our results highlight the distinct advantages and limitations of each screening method for identifying drug targets, and demonstrate the utility of parallel knockdown and knockout screens for comprehensive probing of drug activity.
Li, Chengwen; Xiao, Pingjie; Gray, Steven James; Weinberg, Marc Scott; Samulski, R Jude
2011-08-23
Molecular knockdown of disease proteins and restoration of wild-type activity represent a promising but challenging strategy for the treatment of diseases that result from the accumulation of misfolded proteins (i.e., Huntington disease, amyotrophic lateral sclerosis, and α-1 antitrypsin deficiency). In this study we used alpha-1 antitrypsin (AAT) deficiency with the piZZ mutant phenotype as a model system to evaluate the efficiency of gene-delivery approaches that both silence the piZZ transcript (e.g., shRNA) and restore circulating wild-type AAT expression from resistant codon-optimized AAT (AAT-opt) transgene cassette using adeno-associated virus (AAV) vector delivery. After systemic injection of a self-complimentary AAV serotype 8 (scAAV8) vector encoding shRNA in piZZ transgenic mice, both mutant AAT mRNA in the liver and defected serum protein level were inhibited by 95%, whereas liver pathology, as monitored by dPAS and fibrosis staining, reversed. To restore blood AAT levels in AAV8/shRNA-treated mice, several strategies to restore functional AAT levels were tested, including using AAV AAT-opt transgene cassettes targeted to muscle and liver, or combination vectors carrying piZZ shRNA and AAT-opt transgenes separately, or a single bicistronic AAV vector. With these molecular approaches, we observed over 90% knockdown of mutant AAT with a 13- to 30-fold increase of circulating wild-type AAT protein from the shRNA-resistant AAT-opt cassette. The molecular approaches applied in this study can simultaneously prevent liver pathology and restore blood AAT concentration in AAT deficiencies. Based on these observations, similar gene-therapy strategies could be considered for any diseases caused by accumulation of misfolded proteins.
Morecroft, Ian; White, Katie; Caruso, Paola; Nilsen, Margaret; Loughlin, Lynn; Alba, Raul; Reynolds, Paul N; Danilov, Sergei M; Baker, Andrew H; MacLean, Margaret R
2012-01-01
Serotonin is produced by pulmonary arterial endothelial cells (PAEC) via tryptophan hydroxylase-1 (Tph1). Pathologically, serotonin acts on underlying pulmonary arterial cells, contributing to vascular remodeling associated with pulmonary arterial hypertension (PAH). The effects of hypoxia on PAEC-Tph1 activity are unknown. We investigated the potential of a gene therapy approach to PAH using selective inhibition of PAEC-Tph1 in vivo in a hypoxic model of PAH. We exposed cultured bovine pulmonary arterial smooth muscle cells (bPASMCs) to conditioned media from human PAECs (hPAECs) before and after hypoxic exposure. Serotonin levels were increased in hypoxic PAEC media. Conditioned media evoked bPASMC proliferation, which was greater with hypoxic PAEC media, via a serotonin-dependent mechanism. In vivo, adenoviral vectors targeted to PAECs (utilizing bispecific antibody to angiotensin-converting enzyme (ACE) as the selective targeting system) were used to deliver small hairpin Tph1 RNA sequences in rats. Hypoxic rats developed PAH and increased lung Tph1. PAEC-Tph1 expression and development of PAH were attenuated by our PAEC-Tph1 gene knockdown strategy. These results demonstrate that hypoxia induces Tph1 activity and selective knockdown of PAEC-Tph1 attenuates hypoxia-induced PAH in rats. Further investigation of pulmonary endothelial-specific Tph1 inhibition via gene interventions is warranted. PMID:22525513
Liu, H X; Goodall, G J; Kole, R; Filipowicz, W
1995-01-16
We have performed a systematic study of the effect of artificial hairpins on pre-mRNA splicing in protoplasts of a dicot plant, Nicotiana plumbaginifolia. Hairpins with a potential to form 18 or 24 bp stems strongly inhibit splicing when they sequester the 5' splice site or are placed in the middle of short introns. However, similar 24 bp hairpins sequestering the 3' splice site do not prevent this site from being used as an acceptor. Utilization of the stem-located 3' site requires that the base of the stem is separated from the upstream 5' splice site by a minimum of approximately 45 nucleotides and that another 'helper' 3' splice site is present downstream of the stem. The results indicate that the spliceosome or factors associated with it may have a potential to unfold secondary structure present in the downstream portion of the intron, prior to or at the step of the 3' splice site selection. The finding that the helper 3' site is required for utilization of the stem-located acceptor confirms and extends previous observations, obtained with HeLa cell in vitro splicing systems, indicating that the 3' splice site may be recognized at least twice during spliceosome assembly.
Friedrich, Michael; Meier, Doreen; Schuster, Isabelle; Nellen, Wolfgang
2015-01-01
We have previously shown that the most abundant Dictyostelium discoideum retroelement DIRS-1 is suppressed by RNAi mechanisms. Here we provide evidence that both inverted terminal repeats have strong promoter activity and that bidirectional expression apparently generates a substrate for Dicer. A cassette containing the inverted terminal repeats and a fragment of a gene of interest was sufficient to activate the RNAi response, resulting in the generation of ~21 nt siRNAs, a reduction of mRNA and protein expression of the respective endogene. Surprisingly, no transitivity was observed on the endogene. This was in contrast to previous observations, where endogenous siRNAs caused spreading on an artificial transgene. Knock-down was successful on seven target genes that we examined. In three cases a phenotypic analysis proved the efficiency of the approach. One of the target genes was apparently essential because no knock-out could be obtained; the RNAi mediated knock-down, however, resulted in a very slow growing culture indicating a still viable reduction of gene expression. ADVANTAGES OF THE DIRS-1–RNAI SYSTEM: The knock-down system required a short DNA fragment (~400 bp) of the target gene as an initial trigger. Further siRNAs were generated by RdRPs since we have shown some siRNAs with a 5'-triphosphate group. Extrachromosomal vectors facilitate the procedure and allowed for molecular and phenotypic analysis within one week. The system provides an efficient and rapid method to reduce protein levels including those of essential genes.
Discovering ligands for a microRNA precursor with peptoid microarrays
Chirayil, Sara; Chirayil, Rachel; Luebke, Kevin J.
2009-01-01
We have screened peptoid microarrays to identify specific ligands for the RNA hairpin precursor of miR-21, a microRNA involved in cancer and heart disease. Microarrays were printed by spotting a library of 7680 N-substituted oligoglycines (peptoids) onto glass slides. Two compounds on the array specifically bind RNA having the sequence and predicted secondary structure of the miR-21 precursor hairpin and have specific affinity for the target in solution. Their binding induces a conformational change around the hairpin loop, and the most specific compound recognizes the loop sequence and a bulged uridine in the proximal duplex. Functional groups contributing affinity and specificity were identified, and by varying a critical methylpyridine group, a compound with a dissociation constant of 1.9 μM for the miR-21 precursor hairpin and a 20-fold discrimination against a closely-related hairpin was created. This work describes a systematic approach to discovery of ligands for specific pre-defined novel RNA structures. It demonstrates discovery of new ligands for an RNA for which no specific lead compounds were previously known by screening a microarray of small molecules. PMID:19561197
Hossain, Md Motarab; Banik, Naren L; Ray, Swapan K
2012-08-01
Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro
Suzuki, Masataka G.; Ito, Haruka; Aoki, Fugaku
2014-01-01
Sexual differentiation in Bombyx mori is controlled by sex-specific splicing of Bmdsx, which results in the omission of exons 3 and 4 in a male-specific manner. In B. mori, insulin-like growth factor II mRNA-binding protein (Imp) is a male-specific factor involved in male-specific splicing of Bmdsx. Male-specific Imp mRNA results from the male-specific inclusion of exon 8. To verify the link between histone methylation and alternative RNA processing in Imp, we examined the effects of RNAi-mediated knockdown of several histone methyltransferases on the sex-specific mRNA expression of Imp. As a result, male-specific expression of Imp mRNA was completely abolished when expression of the H3K79 methyltransferase DOT1L was repressed to <10% of that in control males. Chromatin immunoprecipitation-quantitative PCR analysis revealed a higher distribution of H3K79me2 in normal males than in normal females across Imp. RNA polymerase II (RNAP II) processivity assays indicated that RNAi knockdown of DOT1L in males caused a twofold decrease in RNAP II processivity compared to that in control males, with almost equivalent levels to those observed in normal females. Inhibition of RNAP II-mediated elongation in male cells repressed the male-specific splicing of Imp. Our data suggest the possibility that H3K79me2 accumulation along Imp is associated with the male-specific alternative processing of Imp mRNA that results from increased RNAP II processivity. PMID:24758924
EphA2 knockdown attenuates atherosclerotic lesion development in ApoE(-/-) mice.
Jiang, Hong; Li, Xinyun; Zhang, Xiaoli; Liu, Yan; Huang, Shanying; Wang, Xiaowei
2014-01-01
The inflammatory response of vascular endothelial cells plays important roles in the initiation and progression of atherosclerotic lesions. EphA2 receptor activation promotes the endothelial cell inflammatory response, and its expression is increased in the endothelial cell layer of atherosclerotic plaques. However, the association between EphA2 and atherosclerosis has not been determined. Eight-week-old male ApoE(-/-) mice were systemically infected with adenoassociated virus serotype 9 carrying a small hairpin RNA specifically targeting the EphA2 gene to knock down EphA2 expression in aortic endothelial cells. These mice were then fed a high-cholesterol diet for 12 weeks. Blood was collected for the measurement of plasma lipids. The aortas were harvested to evaluate the atherosclerotic lesion size, macrophage components, and expression of proinflammatory genes using Oil Red O staining, immunofluorescence staining, and molecular biology analysis. The lesions formed in the entire aorta and aortic sinus of the ApoE(-/-) mice with EphA2 knockdown were significantly smaller than those in the control mice (10.7%±3.1% versus 25.1%±4.2%; 0.51±0.02mm(2) versus 0.85±0.03mm(2); n=10; P<.05). Furthermore, the lesions in the ApoE(-/-) mice with EphA2 knockdown displayed reduced inflammation compared with the control mice, as reflected by the decreased macrophage infiltration (8.2%±2.9% versus 22.7%±4%; n=10; P<.05); decreased nuclear factor-κβ activation; and diminished expression of vascular cell adhesion molecule-1, E-selectin, and monocyte chemotactic protein-1 (all P<.05). Our data demonstrate that the EphA2 receptor silencing attenuates the extent and inflammation of atherosclerotic lesions in ApoE(-/-) mice. Thus, EphA2 knockdown in endothelial cells represents a novel therapeutic strategy for patients with atherosclerosis. Copyright © 2014 Elsevier Inc. All rights reserved.
Yang, Guangling; Song, Ruipeng; Wang, Limin; Wu, Xuejian
2018-07-01
Long non-coding RNA P73 antisense RNA 1 T (lncRNA TP73-AS1) has been shown to involve in the progression of numerous tumors. Nevertheless, the expression as well as the functional mechanisms of TP73-AS1 in osteosarcoma (OS) are still largely unknown. This study aimed to explore the roles and underlying mechanism of TP73-AS1 in OS progression. In thye present study, TP73-AS1 expression was significantly increased in OS tissues and cell lines. High TP73-AS1 expression was associated with poor overall survival of OS patients. TP73-AS1 knockdown suppressed OS cells proliferation and invasion in vitro as well as tumor growth in vivo. Furthermore, we identified that miR-142 could act as a direct target for TP73-AS1 and miR-142 inhibition reversed the suppression of OS cells proliferation and invasion induced by TP73-AS1 knockdown. In addition, we showed that TP73-AS1 could function as a sponge of miR-142 to positively regulate Rac1 in OS cells. Thus, our data suggested that TP73-AS1 served as an oncogenic lncRNA in OS progression, and could be regarded as an efficient therapeutic target in the treatment of OS. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.
2012-01-01
Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (−)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in expression of NFP, NSE, and e-cadherin and also decreases in expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro network
2015-01-01
Targeting of noncanonical DNA structures, such as hairpin loops, may have significant diagnostic and therapeutic potential. Oligonucleotides can be used for binding to mRNA, forming a DNA/RNA hybrid duplex that inhibits translation. This kind of modulation of gene expression is called the antisense approach. In order to determine the best strategy to target a common structural motif in mRNA, we have designed a set of stem-loop DNA molecules with sequence: d(GCGCTnGTAAT5GTTACTnGCGC), where n = 1, 3, or 5, “T5” is an end loop of five thymines. We used a combination of calorimetric and spectroscopy techniques to determine the thermodynamics for the reaction of a set of hairpins containing internal loops with their respective partially complementary strands. Our aim was to determine if internal- and end-loops are promising regions for targeting with their corresponding complementary strands. Indeed, all targeting reactions were accompanied by negative changes in free energy, indicating that reactions proceed spontaneously. Further investigation showed that these negative free energy terms result from a net balance of unfavorable entropy and favorable enthalpy contributions. In particular, unfolding of hairpins and duplexes is accompanied by positive changes in heat capacity, which may be a result of exposure of hydrophobic groups to the solvent. This study provides a new method for the targeting of mRNA in order to control gene expression. PMID:25486129
Hairpin vortices in turbulent boundary layers
NASA Astrophysics Data System (ADS)
Eitel-Amor, G.; Örlü, R.; Schlatter, P.; Flores, O.
2015-02-01
The present work presents a number of parallel and spatially developing simulations of boundary layers to address the question of whether hairpin vortices are a dominant feature of near-wall turbulence, and which role they play during transition. In the first part, the parent-offspring regeneration mechanism is investigated in parallel (temporal) simulations of a single hairpin vortex introduced in a mean shear flow corresponding to either turbulent channels or boundary layers (Reτ ≲ 590). The effect of a turbulent background superimposed on the mean flow is considered by using an eddy viscosity computed from resolved simulations. Tracking the vortical structure downstream, it is found that secondary hairpins are only created shortly after initialization, with all rotational structures decaying for later times. For hairpins in a clean (laminar) environment, the decay is relatively slow, while hairpins in weak turbulent environments (10% of νt) dissipate after a couple of eddy turnover times. In the second part, the role of hairpin vortices in laminar-turbulent transition is studied using simulations of spatial boundary layers tripped by hairpin vortices. These vortices are generated by means of specific volumetric forces representing an ejection event, creating a synthetic turbulent boundary layer initially dominated by hairpin-like vortices. These hairpins are advected towards the wake region of the boundary layer, while a sinusoidal instability of the streaks near the wall results in rapid development of a turbulent boundary layer. For Reθ > 400, the boundary layer is fully developed, with no evidence of hairpin vortices reaching into the wall region. The results from both the parallel and spatial simulations strongly suggest that the regeneration process is rather short-lived and may not sustain once a turbulent background is developed. From the transitional flow simulations, it is conjectured that the forest of hairpins reported in former direct numerical
Cartault, François; Munier, Patrick; Benko, Edgar; Desguerre, Isabelle; Hanein, Sylvain; Boddaert, Nathalie; Bandiera, Simonetta; Vellayoudom, Jeanine; Krejbich-Trotot, Pascale; Bintner, Marc; Hoarau, Jean-Jacques; Girard, Muriel; Génin, Emmanuelle; de Lonlay, Pascale; Fourmaintraux, Alain; Naville, Magali; Rodriguez, Diana; Feingold, Josué; Renouil, Michel; Munnich, Arnold; Westhof, Eric; Fähling, Michael; Lyonnet, Stanislas; Henrion-Caude, Alexandra
2012-01-01
The human genome is densely populated with transposons and transposon-like repetitive elements. Although the impact of these transposons and elements on human genome evolution is recognized, the significance of subtle variations in their sequence remains mostly unexplored. Here we report homozygosity mapping of an infantile neurodegenerative disease locus in a genetic isolate. Complete DNA sequencing of the 400-kb linkage locus revealed a point mutation in a primate-specific retrotransposon that was transcribed as part of a unique noncoding RNA, which was expressed in the brain. In vitro knockdown of this RNA increased neuronal apoptosis, consistent with the inappropriate dosage of this RNA in vivo and with the phenotype. Moreover, structural analysis of the sequence revealed a small RNA-like hairpin that was consistent with the putative gain of a functional site when mutated. We show here that a mutation in a unique transposable element-containing RNA is associated with lethal encephalopathy, and we suggest that RNAs that harbor evolutionarily recent repetitive elements may play important roles in human brain development. PMID:22411793
Knockdown of p53 suppresses Nanog expression in embryonic stem cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia
2014-01-10
Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less
Huang, Mei; Nguyen, Patricia; Jia, Fangjun; Hu, Shijun; Gong, Yongquan; de Almeida, Patricia E.; Wang, Li; Nag, Divya; Kay, Mark A.; Giaccia, Amato J; Robbins, Robert C.; Wu, Joseph C.
2011-01-01
Background Under normoxic conditions, hypoxia inducible factor-1 alpha (HIF-1α) is rapidly degraded by two hydroxylases, prolyl hydroxylase (PHD) and factor inhibiting HIF-1 (FIH). Because HIF-1α mediates the cardioprotective response to ischemic injury, its up-regulation may be an effective therapeutic option for ischemic heart failure. Methods and Results PHD and FIH were cloned from mouse embryonic stem cells. The best candidate short hairpin sequences for inhibiting PHD isoenzyme 2 (shPHD2) and FIH (shFIH) were inserted into novel non-viral minicircle vectors. In vitro studies after cell transfection of mouse C2C12 myoblasts, HL-1 atrial myocytes, and c-kit+ cardiac progenitor cells (CPCs) demonstrated higher expression of angiogenesis factors in the double knockdown group compared to the single knockdown and shScramble control groups. To confirm in vitro data, shRNA minicircle vectors were injected intramyocardially following LAD ligation in adult FVB mice (n=60). Functional studies using magnetic resonance imaging (MRI), echocardiography, and pressure-volume (PV) loops showed greater improvement in cardiac function in the double knockdown group. To assess mechanism(s) of this functional recovery, we performed a cell trafficking experiment, which demonstrated significantly greater recruitment of bone marrow cells to the ischemic myocardium in the double knockdown group. Fluorescence activated cell sorting (FACS) showed significantly higher activation of endogenous c-kit+ cardiac progenitor cells. Immunostaining showed increased neovascularization and decreased apoptosis in areas of injured myocardium. Finally, western blots and laser capture microdissection (LCM) analysis confirmed up-regulation of HIF-1α protein and angiogenesis genes, respectively. Conclusions We demonstrated that HIF-1α up-regulation by double knockdown of PHD and FIH synergistically increases stem cell mobilization and myocardial angiogenesis, leading to improved cardiac function. PMID
Liu, An; Huang, Chenggang; Xu, Jia; Cai, Xuehong
2016-09-01
Ghrelin, an orexigenic peptide, acts via the growth hormone secretagogue receptor (GHSR) to stimulate the release of growth hormone. Moreover, it has a range of biological actions, including the stimulation of food intake, modulation of insulin signaling and cardiovascular effects. Recently, it has been demonstrated that ghrelin has a proliferative and antiapoptotic effects in cancers, suggesting a potential role in promoting tumor growth. However, it remains unknown whether GHSR contributes to colorectal cancer proliferation. In this study, the therapeutic effect of lentivirus-mediated short hairpin RNA (shRNA) targeting ghrelin receptor 1a (GHSR1a) was analyzed in colorectal cancer cell line SW480 both in vitro and in vivo. Our study demonstrated that ghrelin and GHSR1a are significantly upregulated in cancerous colorectal tissue samples and cell lines. In vitro, human colorectal cancer cell line SW480 with downregulation of GHSR1a by shRNA showed significant inhibition of cell viability compared with blank control (BC) or scrambled control (SC) regardless of the application of exogenous ghrelin. Furthermore, GHSR1a silencing by target specific shRNA was shown capable of increasing PTEN, inhibiting AKT phosphorylation and promoting the release of p53 in SW480 cells. In addition, the effects of GHSR1a knockdown were further explored in vivo using colorectal tumor xenograft mouse model. The tumor weights were decreased markedly in GHSR1α knockdown SW480 mouse xenograft tumors compared with blank control or negative control tumors. Our results suggested that the expression of GHSR1a is significantly correlated with the growth of colorectal cancer cells, and the GHSR1a knockdown approach may be a potential therapy for the treatment of colorectal cancer. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Duszczyk, Malgorzata M; Sattler, Michael
2012-04-01
Initiation of X-chromosome inactivation in female mammals depends on the non-coding RNA Xist. We have solved the NMR structure of a 14-nucleotide hairpin with a novel AUCG tetraloop fold from a Xist A-repeat that is essential for silencing. The (1)H, (13)C, (15)N and (31)P chemical shift assignments are reported.
Intraperitoneal AAV9-shRNA inhibits target expression in neonatal skeletal and cardiac muscles.
Mayra, Azat; Tomimitsu, Hiroyuki; Kubodera, Takayuki; Kobayashi, Masaki; Piao, Wenying; Sunaga, Fumiko; Hirai, Yukihiko; Shimada, Takashi; Mizusawa, Hidehiro; Yokota, Takanori
2011-02-11
Systemic injections of AAV vectors generally transduce to the liver more effectively than to cardiac and skeletal muscles. The short hairpin RNA (shRNA)-expressing AAV9 (shRNA-AAV9) can also reduce target gene expression in the liver, but not enough in cardiac or skeletal muscles. Higher doses of shRNA-AAV9 required for inhibiting target genes in cardiac and skeletal muscles often results in shRNA-related toxicity including microRNA oversaturation that can induce fetal liver failure. In this study, we injected high-dose shRNA-AAV9 to neonates and efficiently silenced genes in cardiac and skeletal muscles without inducing liver toxicity. This is because AAV is most likely diluted or degraded in the liver than in cardiac or skeletal muscle during cell division after birth. We report that this systemically injected shRNA-AAV method does not induce any major side effects, such as liver dysfunction, and the dose of shRNA-AAV is sufficient for gene silencing in skeletal and cardiac muscle tissues. This novel method may be useful for generating gene knockdown in skeletal and cardiac mouse tissues, thus providing mouse models useful for analyzing diseases caused by loss-of-function of target genes. Copyright © 2011 Elsevier Inc. All rights reserved.
Knockdown and replacement therapy mediated by artificial mirtrons in spinocerebellar ataxia 7
Curtis, Helen J.; Wood, Matthew J.A.
2017-01-01
Abstract We evaluate a knockdown-replacement strategy mediated by mirtrons as an alternative to allele-specific silencing using spinocerebellar ataxia 7 (SCA7) as a model. Mirtrons are introns that form pre-microRNA hairpins after splicing, producing RNAi effectors not processed by Drosha. Mirtron mimics may therefore avoid saturation of the canonical processing pathway. This method combines gene silencing mediated by an artificial mirtron with delivery of a functional copy of the gene such that both elements of the therapy are always expressed concurrently, minimizing the potential for undesirable effects and preserving wild-type function. This mutation- and single nucleotide polymorphism-independent method could be crucial in dominant diseases that feature both gain- and loss-of-function pathologies or have a heterogeneous genetic background. Here we develop mirtrons against ataxin 7 with silencing efficacy comparable to shRNAs, and introduce silent mutations into an ataxin 7 transgene such that it is resistant to their effect. We successfully express the transgene and one mirtron together from a single construct. Hence, we show that this method can be used to silence the endogenous allele of ataxin 7 and replace it with an exogenous copy of the gene, highlighting the efficacy and transferability across patient genotypes of this approach. PMID:28575281
Diederichs, Sven; Haber, Daniel A
2007-12-14
MicroRNAs are small endogenous noncoding RNAs involved in posttranscriptional gene regulation. During microRNA biogenesis, Drosha and Dicer process the primary transcript (pri-miRNA) through a precursor hairpin (pre-miRNA) to the mature miRNA. The miRNA is incorporated into the RNA-Induced Silencing Complex (RISC) with Argonaute proteins, the effector molecules in RNA interference (RNAi). Here, we show that all Argonautes elevate mature miRNA expression posttranscriptionally, independent of RNase activity. Also, we identify a role for the RISC slicer Argonaute2 (Ago2) in cleaving the pre-miRNA to an additional processing intermediate, termed Ago2-cleaved precursor miRNA or ac-pre-miRNA. This endogenous, on-pathway intermediate results from cleavage of the pre-miRNA hairpin 12 nucleotides from its 3'-end. By analogy to siRNA processing, Ago2 cleavage may facilitate removal of the nicked passenger strand from RISC after maturation. The multiple roles of Argonautes in the RNAi effector phase and miRNA biogenesis and maturation suggest coordinate regulation of microRNA expression and function.
Bish, Lawrence T; Sleeper, Meg M; Reynolds, Caryn; Gazzara, Jeffrey; Withnall, Elanor; Singletary, Gretchen E; Buchlis, George; Hui, Daniel; High, Katherine A; Gao, Guangping; Wilson, James M; Sweeney, H Lee
2011-08-01
Derangements in calcium cycling have been described in failing hearts, and preclinical studies have suggested that therapies aimed at correcting this defect can lead to improvements in cardiac function and survival. One strategy to improve calcium cycling would be to inhibit phospholamban (PLB), the negative regulator of SERCA2a that is upregulated in failing hearts. The goal of this study was to evaluate the safety and efficacy of using adeno-associated virus (AAV)-mediated cardiac gene transfer of short hairpin RNA (shRNA) to knock down expression of PLB. Six dogs were treated with self-complementary AAV serotype 6 (scAAV6) expressing shRNA against PLB. Three control dogs were treated with empty AAV6 capsid, and two control dogs were treated with scAAV6 expressing dominant negative PLB. Vector was delivered via a percutaneously inserted cardiac injection catheter. PLB mRNA and protein expression were analyzed in three of six shRNA dogs between days 16 and 26. The other three shRNA dogs and five control dogs were monitored long-term to assess cardiac safety. PLB mRNA was reduced 16-fold, and PLB protein was reduced 5-fold, with treatment. Serum troponin elevation and depressed cardiac function were observed in the shRNA group only at 4 weeks. An enzyme-linked immunospot assay failed to detect any T cells reactive to AAV6 capsid in peripheral blood mononuclear cells, heart, or spleen. Microarray analysis revealed alterations in cardiac expression of several microRNAs with shRNA treatment. AAV6-mediated cardiac gene transfer of shRNA effectively knocks down PLB expression but is associated with severe cardiac toxicity. Toxicity may result from dysregulation of endogenous microRNA pathways.
Sleeper, Meg M.; Reynolds, Caryn; Gazzara, Jeffrey; Withnall, Elanor; Singletary, Gretchen E.; Buchlis, George; Hui, Daniel; High, Katherine A.; Gao, Guangping; Wilson, James M.; Sweeney, H. Lee
2011-01-01
Abstract Derangements in calcium cycling have been described in failing hearts, and preclinical studies have suggested that therapies aimed at correcting this defect can lead to improvements in cardiac function and survival. One strategy to improve calcium cycling would be to inhibit phospholamban (PLB), the negative regulator of SERCA2a that is upregulated in failing hearts. The goal of this study was to evaluate the safety and efficacy of using adeno-associated virus (AAV)-mediated cardiac gene transfer of short hairpin RNA (shRNA) to knock down expression of PLB. Six dogs were treated with self-complementary AAV serotype 6 (scAAV6) expressing shRNA against PLB. Three control dogs were treated with empty AAV6 capsid, and two control dogs were treated with scAAV6 expressing dominant negative PLB. Vector was delivered via a percutaneously inserted cardiac injection catheter. PLB mRNA and protein expression were analyzed in three of six shRNA dogs between days 16 and 26. The other three shRNA dogs and five control dogs were monitored long-term to assess cardiac safety. PLB mRNA was reduced 16-fold, and PLB protein was reduced 5-fold, with treatment. Serum troponin elevation and depressed cardiac function were observed in the shRNA group only at 4 weeks. An enzyme-linked immunospot assay failed to detect any T cells reactive to AAV6 capsid in peripheral blood mononuclear cells, heart, or spleen. Microarray analysis revealed alterations in cardiac expression of several microRNAs with shRNA treatment. AAV6-mediated cardiac gene transfer of shRNA effectively knocks down PLB expression but is associated with severe cardiac toxicity. Toxicity may result from dysregulation of endogenous microRNA pathways. PMID:21542669
RNCR3 knockdown inhibits diabetes mellitus-induced retinal reactive gliosis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Chang; Shanghai Key Laboratory of Visual Impairment and Restoration, Shanghai; The Fourth School of Clinical Medicine, Nanjing Medical University, Nanjing
Retinal reactive gliosis is an important pathological feature of diabetic retinopathy. Identifying the underlying mechanisms causing reactive gliosis will be important for developing new therapeutic strategies for treating diabetic retinopathy. Herein, we show that long noncoding RNA-RNCR3 knockdown significantly inhibits retinal reactive gliosis. RNCR3 knockdown leads to a marked reduction in the release of several cytokines. RNCR3 knockdown alleviates diabetes mellitus-induced retinal neurodegeneration, as shown by less apoptotic retinal cells and ameliorative visual function. RNCR3 knockdown could also decrease Müller glial cell viability and proliferation, and reduce the expression of glial reactivity-related genes including GFAP and vimentin in vitro. Collectively, thismore » study shows that RNCR3 knockdown may be a promising strategy for the prevention of diabetes mellitus-induced retinal neurodegeneration. - Highlights: • RNCR3 knockdown inhibits retinal reactive gliosis. • RNCR3 knockdown causes a significant change in cytokine profile. • RNCR3 knockdown alleviates diabetes mellitus-induced retinal neurodegeneration. • RNCR3 knockdown affects Müller glial cell function in vitro.« less
Wang, Qingying; Wei, Yingze; Zhang, Jiawen
2017-05-01
D-dopachrome tautomerase (D-DT) is a homologue of macrophage migration inhibitory factor (MIF) with similar functions. However, the possible biological roles of D-DT in cervical cancer remain unknown so far. D-dopachrome tautomerase was assessed by immunohistochemistry in 83 cervical cancer and 31 normal cervix tissues. The stable knockdown of D-DT and MIF by lentivirus-delivered short hairpin RNA was established, and tumor growth was examined in vitro and in vivo. The effects of D-DT and MIF on the migration and invasion were further detected by wound healing assay and transwell assay. Western blot was used to explore the mechanism of D-DT and MIF in cervical cancer pathogenesis. We found that D-DT was significantly high in cervical cancer, which correlated with lymph node metastasis. The knockdown of D-DT and MIF, individually and additively, inhibited the proliferation, migration, and invasion in HeLa and SiHa cells and restrained the growth of xenograft tumor. The ablation of D-DT and MIF rescued the expression of E-cadherin and inhibited the expression of PCNA, cyclin D1, gankyrin, Sam68, and vimentin, as well as phospho-Akt and phospho-glycogen synthase kinase 3-β. The inhibition of D-DT and MIF in combination may represent a potential therapeutic strategy for cervical cancer.
Bishop, Cecily V; Hennebold, Jon D; Kahl, Christoph A; Stouffer, Richard L
2016-05-01
Adenoviral vectors (vectors) expressing short-hairpin RNAs complementary to macaque nuclear progesterone (P) receptor PGR mRNA (shPGR) or a nontargeting scrambled control (shScram) were used to determine the role PGR plays in ovulation/luteinization in rhesus monkeys. Nonluteinized granulosa cells collected from monkeys (n = 4) undergoing controlled ovarian stimulation protocols were exposed to either shPGR, shScram, or no virus for 24 h; human chorionic gonadotropin (hCG) was then added to half of the wells to induce luteinization (luteinized granulosa cells [LGCs]; n = 4-6 wells/treatment/monkey). Cells/media were collected 48, 72, and 120 h postvector for evaluation of PGR mRNA and P levels. Addition of hCG increased (P < 0.05) PGR mRNA and medium P levels in controls. However, a time-dependent decline (P < 0.05) in PGR mRNA and P occurred in shPGR vector groups. Injection of shPGR, but not shScram, vector into the preovulatory follicle 20 h before hCG administration during controlled ovulation protocols prevented follicle rupture in five of six monkeys as determined by laparoscopic evaluation, with a trapped oocyte confirmed in three of four follicles of excised ovaries. Injection of shPGR also prevented the rise in serum P levels following the hCG bolus compared to shScram (P < 0.05). Nuclear PGR immunostaining was undetectable in granulosa cells from shPGR-injected follicles, compared to intense staining in shScram controls. Thus, the nuclear PGR appears to mediate P action in the dominant follicle promoting ovulation in primates. In vitro and in vivo effects of PGR knockdown in LGCs also support the hypothesis that P enhances its own synthesis in the primate corpus luteum by promoting luteinization. © 2016 by the Society for the Study of Reproduction, Inc.
Li, Longhu; Haider, Husnain Kh; Wang, Linlin; Lu, Gang; Ashraf, Muhammad
2012-05-15
We previously showed that treatment with tadalafil, a long-acting phosphodiesterase-5a (PDE5a) inhibitor, effectively prevented adverse left ventricular (LV) remodeling of the infarcted heart. We hypothesized that short-hairpin RNA (shRNA) therapy targeting PDE5a would simulate the effects of pharmacological intervention for treatment of postinfarction LV remodeling and dysfunction. Experimental model of myocardial infarction was developed in female mice by permanent ligation of left coronary artery. Immediately after that, an adenoviral vector encoding for shRNA sequence targeting PDE5a (Ad-shPDE5a) was injected intramyocardially, which specifically inhibited PDE5a in the heart. Four weeks later, Ad-shPDE5a treated mice showed significant mitigation of the left ventricle (LV) dilatation and dysfunction as indicated by smaller LV cavity and more preserved ejection fraction and fractional shortening. Infarction size and fibrosis were significantly reduced in Ad-shPDE5a-treated mice. Additionally, more salvaged cardiomyocytes, significantly reduced collagen contents, and higher blood vessel density were observed in Ad-shPDE5a-treated mice. The cytoprotective effects of Ad-shPDE5a were demonstrated in vitro in Ad-shPDE5a transfected cardiomyocytes cultured under oxygen glucose deprivation. Among downstream mediators of PDE5a signaling, cyclic GMP (cGMP) and cGMP-dependent protein kinase G (PKG) were activated with concomitant reduction in caspase-3 activity. However, no significant change in PKA and cAMP activities were observed in Ad-shPDE5a-treated hearts. Inhibition with shRNA improved cardiac remodeling and dysfunction by reducing infarction size and cardiac fibrosis and increased cGMP and PKG activity. These findings suggest that PDE5 inhibition with Ad-shPDE5a is a novel approach for treatment of myocardial infarction.
Li, Longhu; Haider, Husnain Kh.; Wang, Linlin; Lu, Gang
2012-01-01
We previously showed that treatment with tadalafil, a long-acting phosphodiesterase-5a (PDE5a) inhibitor, effectively prevented adverse left ventricular (LV) remodeling of the infarcted heart. We hypothesized that short-hairpin RNA (shRNA) therapy targeting PDE5a would simulate the effects of pharmacological intervention for treatment of postinfarction LV remodeling and dysfunction. Experimental model of myocardial infarction was developed in female mice by permanent ligation of left coronary artery. Immediately after that, an adenoviral vector encoding for shRNA sequence targeting PDE5a (Ad-shPDE5a) was injected intramyocardially, which specifically inhibited PDE5a in the heart. Four weeks later, Ad-shPDE5a treated mice showed significant mitigation of the left ventricle (LV) dilatation and dysfunction as indicated by smaller LV cavity and more preserved ejection fraction and fractional shortening. Infarction size and fibrosis were significantly reduced in Ad-shPDE5a-treated mice. Additionally, more salvaged cardiomyocytes, significantly reduced collagen contents, and higher blood vessel density were observed in Ad-shPDE5a-treated mice. The cytoprotective effects of Ad-shPDE5a were demonstrated in vitro in Ad-shPDE5a transfected cardiomyocytes cultured under oxygen glucose deprivation. Among downstream mediators of PDE5a signaling, cyclic GMP (cGMP) and cGMP-dependent protein kinase G (PKG) were activated with concomitant reduction in caspase-3 activity. However, no significant change in PKA and cAMP activities were observed in Ad-shPDE5a-treated hearts. Inhibition with shRNA improved cardiac remodeling and dysfunction by reducing infarction size and cardiac fibrosis and increased cGMP and PKG activity. These findings suggest that PDE5 inhibition with Ad-shPDE5a is a novel approach for treatment of myocardial infarction. PMID:22447941
Law, Michael J.; Linde, Michael E.; Chambers, Eric J.; Oubridge, Chris; Katsamba, Phinikoula S.; Nilsson, Lennart; Haworth, Ian S.; Laird-Offringa, Ite A.
2006-01-01
Previous kinetic investigations of the N-terminal RNA recognition motif (RRM) domain of spliceosomal protein U1A, interacting with its RNA target U1 hairpin II, provided experimental evidence for a ‘lure and lock’ model of binding in which electrostatic interactions first guide the RNA to the protein, and close range interactions then lock the two molecules together. To further investigate the ‘lure’ step, here we examined the electrostatic roles of two sets of positively charged amino acids in U1A that do not make hydrogen bonds to the RNA: Lys20, Lys22 and Lys23 close to the RNA-binding site, and Arg7, Lys60 and Arg70, located on ‘top’ of the RRM domain, away from the RNA. Surface plasmon resonance-based kinetic studies, supplemented with salt dependence experiments and molecular dynamics simulation, indicate that Lys20 predominantly plays a role in association, while nearby residues Lys22 and Lys23 appear to be at least as important for complex stability. In contrast, kinetic analyses of residues away from the RNA indicate that they have a minimal effect on association and stability. Thus, well-positioned positively charged residues can be important for both initial complex formation and complex maintenance, illustrating the multiple roles of electrostatic interactions in protein–RNA complexes. PMID:16407334
Luo, Jian; Chen, Yongjun; Li, Qiang; Wang, Bing; Zhou, Yanqiong; Lan, Hongzhen
2016-01-01
Cholangiocarcinoma is a deadly disease which responds poorly to surgery and conventional chemotherapy or radiotherapy. Early diagnosis is difficult due to the anatomical and biological characteristics of cholangiocarcinoma. Cyclin-dependent kinase inhibitor 1B (p27Kip1) is a cyclin-dependent kinase inhibitor and in the present study, we found that p27Kip1 expression was suppressed in the nucleus and increased in the cytoplasm in 53 samples of cholangiocarcinoma from patients with highly malignant tumors (poorly-differentiated and tumor-node-metastsis (TNM) stage III–IV) compared with that in samples from 10 patients with chronic cholangitis. The expression of phosphorylated (p-)p27Kip1 (Ser10), one of the phosphorylated forms of p27Kip1, was increased in the patient samples with increasing malignancy and clinical stage. Coincidentally, chromosome region maintenance 1 (CRM-1; also referred to as exportin 1 or Xpo1), a critical protein responsible for protein translocation from the nucleus to the cytoplasm, was also overexpressed in the tumor samples which were poorly differentiated and of a higher clinical stage. Through specific short hairpin RNA (shRNA)-mediated knockdown of CRM-1 in the cholangiocarcinoma cell line QBC939, we identified an elevation of cytoplasmic p27Kip1 and a decrease of nuclear p27Kip1. Furthermore, the viability and colony formation ability of QBC939 cells was largely reduced with G1 arrest. Consistent with the findings of the in vitro experiments, in a xenograft mouse model, the tumors formed in the CRM-1 knockdown group were markedly smaller and weighed less than those in the control group in vivo. Taken together, these findings demonstrated that the interplay between CRM-1 and p27Kip1 may provide potentially potent biomarkers and functional targets for the development of future cholangiocarcinoma treatments. PMID:27279267
Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin
2015-09-01
Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.
Tai, Kuo-Feng; Wang, Chien-Hsing
2013-12-01
The transforming growth factor β (TGF-β) is the key molecule implicated in impaired immune function in human patients with malignant melanoma. TGF-β can promote tumor growth, invasion, and metastasis in advanced stages of melanoma. Blocking these tumor-promoting effects of TGF-β provides a potentially important therapeutic strategy for the treatment of melanoma. In this study, we used an adenovirus-based shRNA expression system and successfully constructed Ad/TGF-β1-RNA interference (RNAi) which mediated the RNAi for TGF-β1 gene silencing. We examined the effects of TGF-β1 protein knockdown by RNAi on the growth and metastasis of melanoma in C57BL/6 mice induced by the B16F0 cell line. The TGF-β1 hairpin oligonucleotide was cloned into adenoviral vector. The resulting recombinant adenoviruses infected murine melanoma cell line, B16F0, and designated as B16F0/TGF-β1-RNAi cells. The blank adenoviral vector also infected B16F0 cells and designed as B16F0/vector-control cells served as a control. TGF-β1 expression was reduced in B16F0/TGF-β1-RNAi cells compared with B16F0 cells and B16F0/vector-control cells. Three million wild-type B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells were injected subcutaneously into the right flanks of adult female syngeneic mice C57BL/6. The tumor sizes were 756.09 (65.35), 798.48 (78.77), and 203.55 (24.56) mm at the 14th day in the mice receiving B16F0 cells, B16F0/vector-control cells, and B16F0/TGFβ1-RNAi cells, respectively. The P value was less than 0.01 by 1-way analysis of variance. TGF-β1 knockdown in B16F0 cells enhanced the infiltration of CD4 and CD8 T cells in the tumor regions. C57BL/6 mice were evaluated for pulmonary metastasis after tail vein injection of 2 million B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells. The pulmonary metastasis also reduced significantly on days 14 day and 21 in mice injected with B16F0/TGF-β1-RNAi tumors. The blood vessel density of the
Rebelo, Thalia M; Vania, Leila; Ferreira, Eloise; Weiss, Stefan F T
2018-07-01
The 37 kDa/67 kDa laminin receptor (LRP/LR) is over-expressed in tumor cells and has been implicated in several tumourigenic processes such as metastasis and telomerase activation, however, more importantly the focus of the present study is on the maintenance of cellular viability and the evasion of apoptosis. The aim of the study was to investigate the role of LRP/LR on the cellular viability of early (A375) and late stage (A375SM) malignant melanoma cells. Flow cytometry and western blot analysis revealed that A375SM cells contain more cell-surface and total LRP/LR levels in comparison to the A375 cells, respectively. In order to determine the effect of LRP/LR on cell viability and apoptosis, LRP was down-regulated via siRNA technology. MTT assays revealed that LRP knock-down led to significant reductions in the viability of A375 and A375SM cells. Confocal microscopy indicated nuclear morphological changes suggestive of apoptotic induction in both cell lines and Annexin-V FITC/PI assays confirmed this observation. Additionally, caspase-3 activity assays revealed that apoptosis was induced in both cell lines after siRNA-mediated down-regulation of LRP. Caspase-8 and -9 activity assays suggested that post LRP knock-down; A375 cells undergo apoptosis solely via the extrinsic pathway, while A375SM cells undergo apoptosis via the intrinsic pathway. siRNAs mediated LRP knock-down might represent a powerful alternative therapeutic strategy for the treatment of malignant melanoma through the induction of apoptosis. Copyright © 2018. Published by Elsevier Inc.
Hairpin exact coherent states in channel flow
NASA Astrophysics Data System (ADS)
Graham, Michael; Shekar, Ashwin
2017-11-01
Questions remain over the role of hairpin vortices in fully developed turbulent flows. Studies have shown that hairpins play a role in the dynamics away from the wall but the question still persists if they play any part in (near wall) fully developed turbulent dynamics. In addition, the robustness of the hairpin vortex regeneration mechanism is still under investigation. Recent studies have shown the existence of nonlinear traveling wave solutions to the Navier-Stokes equations, also known as exact coherent states (ECS), that capture many aspects of near-wall turbulent structures. Previously discovered ECS in channel flow have a quasi-streamwise vortex structure, with no indication of hairpin formation. Here we present a family of traveling wave solutions for channel flow that displays hairpin vortices. They have a streamwise vortex-streak structure near the wall with a spatially localized hairpin head near the channel centerline, attached to and sustained by the near wall structures. This family of solutions emerges through a transcritical bifurcation from a branch of traveling wave solutions with y and z reflectional symmetry. We also look into the instabilities that lead to the development of hairpins also explore its connection to turbulent dynamics.
Novel AgoshRNA molecules for silencing of the CCR5 co-receptor for HIV-1 infection
Herrera-Carrillo, Elena
2017-01-01
Allogeneic transplantation of blood stem cells from a CCR5-Δ32 homozygous donor to an HIV-infected individual, the “Berlin patient”, led to a cure. Since then there has been a search for approaches that mimic this intervention in a gene therapy setting. RNA interference (RNAi) has evolved as a powerful tool to regulate gene expression in a sequence-specific manner and can be used to inactivate the CCR5 mRNA. Short hairpin RNA (shRNA) molecules can impair CCR5 expression, but these molecules may cause unintended side effects and they will not be processed in cells that lack Dicer, such as monocytes. Dicer-independent RNAi pathways have opened opportunities for new AgoshRNA designs that rely exclusively on Ago2 for maturation. Furthermore, AgoshRNA processing yields a single active guide RNA, thus reducing off-target effects. In this study, we tested different AgoshRNA designs against CCR5. We selected AgoshRNAs that potently downregulated CCR5 expression on human T cells and peripheral blood mononuclear cells (PBMC) and that had no apparent adverse effect on T cell development as assessed in a competitive cell growth assay. CCR5 knockdown significantly protected T cells from CCR5 tropic HIV-1 infection. PMID:28542329
MISSION LentiPlex pooled shRNA library screening in mammalian cells.
Coussens, Matthew J; Corman, Courtney; Fischer, Ashley L; Sago, Jack; Swarthout, John
2011-12-21
RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to knockdown gene expression levels in loss of gene function studies. There are two main methods for performing RNAi. The first is the use of small interfering RNAs (siRNAs) that are chemically synthesized, and the second utilizes short-hairpin RNAs (shRNAs) encoded within plasmids. The latter can be transfected into cells directly or packaged into replication incompetent lentiviral particles. The main advantages of using lentiviral shRNAs is the ease of introduction into a wide variety of cell types, their ability to stably integrate into the genome for long term gene knockdown and selection, and their efficacy in conducting high-throughput loss of function screens. To facilitate this we have created the LentiPlex pooled shRNA library. The MISSION LentiPlex Human shRNA Pooled Library is a genome-wide lentiviral pool produced using a proprietary process. The library consists of over 75,000 shRNA constructs from the TRC collection targeting 15,000+ human genes. Each library is tested for shRNA representation before product release to ensure robust library coverage. The library is provided in a ready-to-use lentiviral format at titers of at least 5 x 10(8) TU/ml via p24 assay and is pre-divided into ten subpools of approximately 8,000 shRNA constructs each. Amplification and sequencing primers are also provided for downstream target identification. Previous studies established a synergistic antitumor activity of TRAIL when combined with Paclitaxel in A549 cells, a human lung carcinoma cell line. In this study we demonstrate the application of a pooled LentiPlex shRNA library to rapidly conduct a positive selection screen for genes involved in the cytotoxicity of A549 cells when exposed to TRAIL and Paclitaxel. One barrier often encountered with high-throughput screens is the cost and difficulty in deconvolution; we
Zhang, Ying-Hui; Wang, Juan-Juan; Li, Min; Zheng, Han-Xi; Xu, Lan; Chen, You-Guo
2016-03-01
The objectives of this study were to investigate the functional effect of matrix metallopeptidase 14 (MMP14) on cell invasion in cervical cancer cells (HeLa line) and to study the underlying molecular mechanisms. Expression vector of short hairpin RNA targeting MMP14 was treated in HeLa cells, and then, transfection efficiency was verified by a florescence microscope. Transwell assay was used to investigate cell invasion ability in HeLa cells. Quantitative polymerase chain reaction and Western blotting analysis were used to detect the expression of MMP14 and relative factors in messenger RNA and protein levels, respectively. Matrix metallopeptidase 14 short hairpin RNA expression vector transfection obviously decreased MMP14 expression in messenger RNA and protein levels. Down-regulation of MMP14 suppressed invasion ability of HeLa cells and reduced transforming growth factor β1 and vascular endothelial growth factor B expressions. Furthermore, MMP14 knockdown decreased bone sialoprotein and enhanced forkhead box protein L2 expression in both RNA and protein levels. Matrix metallopeptidase 14 plays an important role in regulating invasion of HeLa cells. Matrix metallopeptidase 14 knockdown contributes to attenuating the malignant phenotype of cervical cancer cell.
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
Binding and cleavage of nucleic acids by the "hairpin" ribozyme.
Chowrira, B M; Burke, J M
1991-09-03
The "hairpin" ribozyme derived from the minus strand of tobacco ringspot virus satellite RNA [(-)sTRSV] efficiently catalyzes sequence-specific RNA hydrolysis in trans (Feldstein et al., 1989; Hampel & Triz, 1989; Haseloff & Gerlach, 1989). The ribozyme does not cleave DNA. An RNA substrate analogue containing a single deoxyribonucleotide residue 5' to the cleavage site (A-1) binds to the ribozyme efficiently but cannot be cleaved. A DNA substrate analogue with a ribonucleotide at A-1 is cleaved; thus A-1 provides the only 2'-OH required for cleavage. These results support cleavage via a transphosphorylation mechanism initiated by attack of the 2'-OH of A-1 on the scissile phosphodiester. The ribozyme discriminates between DNA and RNA in both binding and cleavage. Results indicate that the 2'-OH of A-1 functions in complex stabilization as well as cleavage. The ribozyme efficiently cleaves a phosphorothioate diester linkage, suggesting that the pro-Rp oxygen at the scissile phosphodiester does not coordinate Mg2+.
Koutsogiannouli, Evangelia A.; Hader, Christiane; Pinkerneil, Maria; Hoffmann, Michèle J.; Schulz, Wolfgang A.
2017-01-01
Disturbances in histone acetyltransferases (HATs) are common in cancers. In urothelial carcinoma (UC), p300 and CBP are often mutated, whereas the GNAT family HATs GCN5 and PCAF (General Control Nonderepressible 5, p300/CBP-Associated Factor) are often upregulated. Here, we explored the effects of specific siRNA-mediated knockdown of GCN5, PCAF or both in four UC cell lines (UCCs). Expression of various HATs and marker proteins was measured by qRT-PCR and western blot. Cellular effects of knockdowns were analyzed by flow cytometry and ATP-, caspase-, and colony forming-assays. GCN5 was regularly upregulated in UCCs, whereas PCAF was variable. Knockdown of GCN5 or both GNATs, but not of PCAF alone, diminished viability and inhibited clonogenic growth in 2/4 UCCs, inducing cell cycle changes and caspase-3/7 activity. PCAF knockdown elicited GCN5 mRNA upregulation. Double knockdown increased c-MYC and MDM2 (Mouse Double Minute 2) in most cell lines. In conclusion, GCN5 upregulation is especially common in UCCs. GCN5 knockdown impeded growth of specific UCCs, whereas PCAF knockdown elicited minor effects. The limited sensitivity towards GNAT knockdown and its variation between the cell lines might be due to compensatory effects including HAT, c-MYC and MDM2 upregulation. Our results predict that developing drugs targeting individual HATs for UC treatment may be challenging. PMID:28678170
Knockdown of Lmo7 inhibits chick myogenesis.
Possidonio, Ana C B; Soares, Carolina P; Fontenele, Marcio; Morris, Eduardo R; Mouly, Vincent; Costa, Manoel L; Mermelstein, Claudia
2016-02-01
The multifunctional protein Lmo7 has been implicated in some aspects of myogenesis in mammals. Here we studied the distribution and expression of Lmo7 and the effects of Lmo7 knockdown in primary cultures of chick skeletal muscle cells. Lmo7 was localized within the nuclei of myoblasts and at the perinuclear region of myotubes. Knockdown of Lmo7 using siRNA specific to chick reduces the number and width of myotubes and the number of MyoD positive-myoblasts. Both Wnt3a enriched medium and Bio, activators of the Wnt/beta-catenin pathway, could rescue the effects of the Lmo7 knockdown suggesting a crosstalk between the Wnt/beta-catenin and Lmo7-mediated signaling pathways. Our data shows a role of Lmo7 during the initial events of chick skeletal myogenesis, particularly in myoblast survival. © 2016 Federation of European Biochemical Societies.
A Grammatical Approach to RNA-RNA Interaction Prediction
NASA Astrophysics Data System (ADS)
Kato, Yuki; Akutsu, Tatsuya; Seki, Hiroyuki
2007-11-01
Much attention has been paid to two interacting RNA molecules involved in post-transcriptional control of gene expression. Although there have been a few studies on RNA-RNA interaction prediction based on dynamic programming algorithm, no grammar-based approach has been proposed. The purpose of this paper is to provide a new modeling for RNA-RNA interaction based on multiple context-free grammar (MCFG). We present a polynomial time parsing algorithm for finding the most likely derivation tree for the stochastic version of MCFG, which is applicable to RNA joint secondary structure prediction including kissing hairpin loops. Also, elementary tests on RNA-RNA interaction prediction have shown that the proposed method is comparable to Alkan et al.'s method.
Brain-Targeted (Pro)Renin Receptor Knockdown attenuates Angiotensin II-Dependent Hypertension
Li, Wencheng; Peng, Hua; Cao, Theresa; Sato, Ryosuke; McDaniels, Sarah. J.; Kobori, Hiroyuki; Navar, L. Gabriel; Feng, Yumei
2012-01-01
The (pro)renin receptor is a newly discovered member of the brain renin-angiotensin system. To investigate the role of brain (pro)renin receptor in hypertension, adeno-associated virus-mediated (pro)renin receptor shRNA was used to knockdown (pro)renin receptor expression in the brain of non-transgenic normotensive and human renin-angiotensinogen double transgenic hypertensive mice. Blood pressure was monitored using implanted telemetric probes in conscious animals. Real-time PCR and immunostaining were performed to determine (pro)renin receptor, angiotensin II type 1 receptor and vasopressin mRNA levels. Plasma vasopressin levels were determined by Enzyme-Linked Immuno Sorbent Assay. Double transgenic mice exhibited higher blood pressure, elevated cardiac and vascular sympathetic tone, and impaired spontaneous baroreflex sensitivity. Intracerebroventricular delivery of (pro)renin receptor shRNA significantly reduced blood pressure, cardiac and vasomotor sympathetic tone, and improved baroreflex sensitivity compared to the control virus treatment in double transgenic mice. (Pro)renin receptor knockdown significantly reduced angiotensin II type 1 receptor and vasopressin levels in double transgenic mice. These data indicate that (pro)renin receptor knockdown in the brain attenuates angiotensin II-dependent hypertension and is associated with a decrease insympathetic tone and an improvement of the baroreflex sensitivity. In addition, brain-targeted (pro)renin receptor knockdown is associated with down-regulation of angiotensin II type 1 receptor and vasopressin levels. We conclude that central (pro)renin receptor contributes to the pathogenesis of hypertension in human renin-angiotensinogen transgenic mice. PMID:22526255
Korrapati, Anil Babu; Swaminathan, Gokul; Singh, Aarti; Khanna, Navin; Swaminathan, Sathyamangalam
2012-01-01
Background Dengue is a mosquito-borne viral disease caused by four closely related serotypes of Dengue viruses (DENVs). This disease whose symptoms range from mild fever to potentially fatal haemorrhagic fever and hypovolemic shock, threatens nearly half the global population. There is neither a preventive vaccine nor an effective antiviral therapy against dengue disease. The difference between severe and mild disease appears to be dependent on the viral load. Early diagnosis may enable timely therapeutic intervention to blunt disease severity by reducing the viral load. Harnessing the therapeutic potential of RNA interference (RNAi) to attenuate DENV replication may offer one approach to dengue therapy. Methodology/Principal Findings We screened the non-translated regions (NTRs) of the RNA genomes of representative members of the four DENV serotypes for putative siRNA targets mapping to known transcription/translation regulatory elements. We identified a target site in the 5′ NTR that maps to the 5′ upstream AUG region, a highly conserved cis-acting element essential for viral replication. We used a replication-defective human adenovirus type 5 (AdV5) vector to deliver a short-hairpin RNA (shRNA) targeting this site into cells. We show that this shRNA matures to the cognate siRNA and is able to inhibit effectively antigen secretion, viral RNA replication and infectious virus production by all four DENV serotypes. Conclusion/Significance The data demonstrate the feasibility of using AdV5-mediated delivery of shRNAs targeting conserved sites in the viral genome to achieve inhibition of all four DENV serotypes. This paves the way towards exploration of RNAi as a possible therapeutic strategy to curtail DENV infection. PMID:22848770
Evolution of hairpin vortices in a shear flow
NASA Technical Reports Server (NTRS)
Hon, T.-L.; Walker, J. D. A.
1988-01-01
Recent experimental studies suggest that the hairpin vortex plays an important (and perhaps dominant) role in the dynamics of turbulent flows near walls. In this study a numerical procedure is developed to allow the accurate computation of the trajectory of a 3-D vortex having a small core radius. For hairpin vortices which are convected in a shear flow above a wall, the calculated results show that a 2-D vortex containing a small 3-D disturbance distorts into a complex shape with subsidiary hairpin vortices forming outboard of the original hairpin vortex. As the vortex moves above the wall, it induces unsteady motion in the viscous flow near the wall: numerical solutions suggest that the boundary-layer flow near the wall will ultimately erupt in response to the motion of the hairpin vortex and in the process a secondary hairpin vortex will be created. The computer results agree with recent experimental investigations.
Yi, Ying-Jie; Jia, Xiu-Hong; Wang, Jian-Yong; Li, You-Jie; Wang, Hong; Xie, Shu-Yang
2016-05-01
Multidrug resistance (MDR) of leukemia cells is a major obstacle in chemotherapeutic treatment. The high expression and constitutive activation of P-glycoprotein (P-gp) and multidrug resistance protein-1 (MRP-1) have been reported to play a vital role in enhancing cell resistance to anticancer drugs in many tumors. The present study aimed to investigate the reversal of MDR by silencing homeobox A10 (HOXA10) in adriamycin (ADR)-resistant human chronic myelogenous leukemia (CML) K562/ADM cells by modulating the expression of P-gp and MRP-1. K562/ADM cells were stably transfected with HOXA10-targeted short hairpin RNA (shRNA). The results of reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis showed that the mRNA and protein expression of HOXA10 was markedly suppressed following transfection with a shRNA-containing vector. The sensitivity of the K562/ADM cells to ADR was enhanced by the silencing of HOXA10, due to the increased intracellular accumulation of ADR. The accumulation of ADR induced by the silencing of HOXA10 may be due to the downregulation of P-gp and MRP-1. Western blot analysis revealed that downregulating HOXA10 inhibited the protein expression of P-gp and MRP-1. Taken together, these results suggest that knockdown of HOXA10 combats resistance and that HOXA10 is a potential target for resistant human CML.
Stable SET knockdown in breast cell carcinoma inhibits cell migration and invasion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jie; Key Laboratory of Modern Toxicology of Shenzhen, Shenzhen Center for Disease Control and Prevention, Shenzhen; Yang, Xi-fei
2014-10-10
Highlights: • We employed RNA interference to knockdown SET expression in breast cancer cells. • Knockdown of SET expression inhibits cell proliferation, migration and invasion. • Knockdown of SET expression increases the activity and expression of PP2A. • Knockdown of SET expression decreases the expression of MMP-9. - Abstract: Breast cancer is the most malignant tumor for women, however, the mechanisms underlying this devastating disease remain unclear. SET is an endogenous inhibitor of protein phosphatase 2A (PP2A) and involved in many physiological and pathological processes. SET could promote the occurrence of tumor through inhibiting PP2A. In this study, we exploremore » the role of SET in the migration and invasion of breast cancer cells MDA-MB-231 and ZR-75-30. The stable suppression of SET expression through lentivirus-mediated RNA interference (RNAi) was shown to inhibit the growth, migration and invasion of breast cancer cells. Knockdown of SET increases the activity and expression of PP2Ac and decrease the expression of matrix metalloproteinase 9 (MMP-9). These data demonstrate that SET may be involved in the pathogenic processes of breast cancer, indicating that SET can serve as a potential therapeutic target for the treatment of breast cancer.« less
Aparicio, Frederic; Pallás, Vicente
2002-01-01
The nucleotide sequences of the RNA 3 of fifteen isolates of Prunus necrotic ringspot virus (PNRSV) varying in the symptomatology they cause in six different Prunus spp. were determined. Analysis of the molecular variability has allowed, in addition to study the phylogenetic relationships among them, to evaluate the minimal requirements for the synthesis of the subgenomic RNA in Ilarvirus genus and their comparison to other members of the Bromoviridae family. Computer assisted comparisons led recently to Jaspars (Virus Genes 17, 233-242, 1998) to propose that a hairpin structure in viral minus strand RNA is required for subgenomic promoter activity of viruses from at least two, and possibly all five, genera in the family of Bromoviridae. For PNRSV and Apple mosaic virus two stable hairpins were proposed whereas for the rest of Ilarviruses and the other four genera of the Bromoviridae family only one stable hairpin was predicted. Comparative analysis of this region among the fifteen PNRSV isolates characterized in this study revealed that two of them showed a 12-nt deletion that led to the disappearance of the most proximal hairpin to the initiation site. Interestingly, the only hairpin found in these two isolates is very similar in primary and secondary structure to the one previously shown in Brome mosaic virus to be required for the synthesis of the subgenomic RNA. In this hairpin, the molecular diversity was concentrated mostly at the loop whereas compensatory mutations were observed at the base of the stem strongly suggesting its functional relevance. The evolutionary implications of these observations are discussed.
Li, Na; Yan, Yunhuan; Zhang, Angke; Gao, Jiming; Zhang, Chong; Wang, Xue; Hou, Gaopeng; Zhang, Gaiping; Jia, Jinbu; Zhou, En-Min; Xiao, Shuqi
2016-12-13
Many viruses encode microRNAs (miRNAs) that are small non-coding single-stranded RNAs which play critical roles in virus-host interactions. Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most economically impactful viruses in the swine industry. The present study sought to determine whether PRRSV encodes miRNAs that could regulate PRRSV replication. Four viral small RNAs (vsRNAs) were mapped to the stem-loop structures in the ORF1a, ORF1b and GP2a regions of the PRRSV genome by bioinformatics prediction and experimental verification. Of these, the structures with the lowest minimum free energy (MFE) values predicted for PRRSV-vsRNA1 corresponded to typical stem-loop, hairpin structures. Inhibition of PRRSV-vsRNA1 function led to significant increases in viral replication. Transfection with PRRSV-vsRNA1 mimics significantly inhibited PRRSV replication in primary porcine alveolar macrophages (PAMs). The time-dependent increase in the abundance of PRRSV-vsRNA1 mirrored the gradual upregulation of PRRSV RNA expression. Knockdown of proteins associated with cellular miRNA biogenesis demonstrated that Drosha and Argonaute (Ago2) are involved in PRRSV-vsRNA1 biogenesis. Moreover, PRRSV-vsRNA1 bound specifically to the nonstructural protein 2 (NSP2)-coding sequence of PRRSV genome RNA. Collectively, the results reveal that PRRSV encodes a functional PRRSV-vsRNA1 which auto-regulates PRRSV replication by directly targeting and suppressing viral NSP2 gene expression. These findings not only provide new insights into the mechanism of the pathogenesis of PRRSV, but also explore a potential avenue for controlling PRRSV infection using viral small RNAs.
Photoregulating RNA digestion using azobenzene linked dumbbell antisense oligodeoxynucleotides.
Wu, Li; He, Yujian; Tang, Xinjing
2015-06-17
Introduction of 4,4'-bis(hydroxymethyl)-azobenzene (azo) to dumbbell hairpin oligonucleotides at the loop position was able to reversibly control the stability of the whole hairpin structure via UV or visible light irradiation. Here, we designed and synthesized a series of azobenzene linked dumbbell antisense oligodeoxynucleotides (asODNs) containing two terminal hairpins that are composed of an asODN and a short inhibitory sense strand. Thermal melting studies of these azobenzene linked dumbbell asODNs indicated that efficient trans to cis photoisomerization of azobenzene moieties induced large difference in thermal stability (ΔTm = 12.1-21.3 °C). In addition, photomodulation of their RNA binding abilities and RNA digestion by RNase H was investigated. The trans-azobenzene linked asODNs with the optimized base pairs between asODN strands and inhibitory sense strands could only bind few percentage of the target RNA, while it was able to recover their binding to the target RNA and degrade it by RNase H after light irradiation. Upon optimization, it is promising to use these azobenzene linked asODNs for reversible spatial and temporal regulation of antisense activities based on both steric binding and RNA digestion by RNase H.
Earnshaw, D J; Gait, M J
1998-01-01
The hairpin ribozyme is a small catalytic RNA that achieves an active configuration by docking of its two helical domains in an antiparallel fashion. Both docking and subsequent cleavage are dependent on the presence of divalent metal ions, such as magnesium, but there is no evidence to date for direct participation of such ions in the chemical cleavage step. We show that aminoglycoside antibiotics inhibit cleavage of the hairpin ribozyme in the presence of metal ions with the most effective being 5-epi-sisomicin and neomycin B. In contrast, in the absence of metal ions, a number of aminoglycoside antibiotics at 10 mM concentration promote hairpin cleavage with rates only 13-20-fold lower than the magnesium-dependent reaction. We show that neomycin B competes with metal ions by ion replacement with the postively charged amino groups of the antibiotic. In addition, we show that the polyamine spermine at 10 mM promotes efficient hairpin cleavage with rates similar to the magnesium-dependent reaction. Low concentrations of either spermine or the shorter polyamine spermidine synergize with 5 mM magnesium ions to boost cleavage rates considerably. In contrast, at 500 microM magnesium ions, 4 mM spermine, but not spermidine, boosts the cleavage rate. The results have significance both in understanding the role of ions in hairpin ribozyme cleavage and in potential therapeutic applications in mammalian cells. PMID:9837982
Predicting RNA pseudoknot folding thermodynamics
Cao, Song; Chen, Shi-Jie
2006-01-01
Based on the experimentally determined atomic coordinates for RNA helices and the self-avoiding walks of the P (phosphate) and C4 (carbon) atoms in the diamond lattice for the polynucleotide loop conformations, we derive a set of conformational entropy parameters for RNA pseudoknots. Based on the entropy parameters, we develop a folding thermodynamics model that enables us to compute the sequence-specific RNA pseudoknot folding free energy landscape and thermodynamics. The model is validated through extensive experimental tests both for the native structures and for the folding thermodynamics. The model predicts strong sequence-dependent helix-loop competitions in the pseudoknot stability and the resultant conformational switches between different hairpin and pseudoknot structures. For instance, for the pseudoknot domain of human telomerase RNA, a native-like and a misfolded hairpin intermediates are found to coexist on the (equilibrium) folding pathways, and the interplay between the stabilities of these intermediates causes the conformational switch that may underlie a human telomerase disease. PMID:16709732
Gao, Yuan; Xiao, Fei; Wang, Chenglong; Wang, Chuandong; Cui, Penglei; Zhang, Xiaoling; Chen, Xiaodong
2018-05-09
Osteogenic differentiation of human bone marrow-derived mesenchymal stem cells (hBMSCs) is essential for the human bone formation, and emerging evidence shows that long non-coding RNAs (lncRNAs) play important roles in hBMSC osteogenic differentiation. MALAT1 is often regarded as a tumor-related lncRNA, but its function in mesenchymal stem cell differentiation remains to be defined. In this study, we aimed to investigate whether MALAT1 regulates Osterix (Osx) expression by sponging miR-143 to promote hBMSC osteogenic differentiation. Firstly, we found that the expression of MALAT1 was much lower in hBMSCs from osteoporosis patients and miR-143 was contrarily higher. In addition, MALAT1 expression increased, and miR-143 decreased when hBMSCs were treated with osteogenic induction. Then, we used short hairpin RNAs to knockdown MALAT1, and the results showed that hBMSC osteogenic differentiation decreased significantly, indicating that MALAT1 is a positive regulator of osteogenic differentiation in hBMSCs. Furthermore, by luciferase assays, we found that MALAT1 could directly bind to miR-143 and negatively regulate its expression. Similarly, miR-143 could directly bind to the target site on the Osx 3'-UTR and then inhibit Osx expression. Knockdown of MALAT1 decreased Osx expression, and co-transfection of miR-143 inhibitor could rescue Osx mRNA expression. While Osx expression was increased in MALAT1-overexpressing hBMSCs, it was reversed by the miR-143 mimics. Moreover, Osx silencing decreased ALP, OCN, and OPN mRNA expression induced by the miR-143 inhibitor. Altogether, our findings suggest that MALAT1 acts to regulate Osx expression through targeting miR-143; thus, it is considered as a positive regulator in hBMSC osteogenic differentiation. © 2018 Wiley Periodicals, Inc.
RNA targeting with CRISPR-Cas13.
Abudayyeh, Omar O; Gootenberg, Jonathan S; Essletzbichler, Patrick; Han, Shuo; Joung, Julia; Belanto, Joseph J; Verdine, Vanessa; Cox, David B T; Kellner, Max J; Regev, Aviv; Lander, Eric S; Voytas, Daniel F; Ting, Alice Y; Zhang, Feng
2017-10-12
RNA has important and diverse roles in biology, but molecular tools to manipulate and measure it are limited. For example, RNA interference can efficiently knockdown RNAs, but it is prone to off-target effects, and visualizing RNAs typically relies on the introduction of exogenous tags. Here we demonstrate that the class 2 type VI RNA-guided RNA-targeting CRISPR-Cas effector Cas13a (previously known as C2c2) can be engineered for mammalian cell RNA knockdown and binding. After initial screening of 15 orthologues, we identified Cas13a from Leptotrichia wadei (LwaCas13a) as the most effective in an interference assay in Escherichia coli. LwaCas13a can be heterologously expressed in mammalian and plant cells for targeted knockdown of either reporter or endogenous transcripts with comparable levels of knockdown as RNA interference and improved specificity. Catalytically inactive LwaCas13a maintains targeted RNA binding activity, which we leveraged for programmable tracking of transcripts in live cells. Our results establish CRISPR-Cas13a as a flexible platform for studying RNA in mammalian cells and therapeutic development.
Mitrasinovic, Petar M
2006-03-01
RNA structure can be viewed as both a construct composed of various structural motifs and a flexible polymer that is substantially influenced by its environment. In this light, the present paper represents an attempt to reconcile the two standpoints. By using the 3D structures both of four (16S and 23S) portions of unbound 50S, H50S, and T30S ribosomal subunits and of 38 large ribonucleoligand complexes as the starting point, the behavior, which is induced by ligand binding, of 73 hairpin triloops with closing g-c and c-g base pairs was investigated using root-mean-square deviation (RMSD) approach and pseudotorsional (eta,theta) convention at the nucleotide-by-nucleotide level. Triloops were annotated in accordance with a recent proposal of geometric nomenclature. A simple measure for the determination of the strain of a triloop is introduced. It is believed that a possible classification of the interior triloops, based on the 2D eta-theta unique path, will aid to conceive their local behavior upon ligand binding. All rRNA residues in contact with ligands as well as regions of considerable conformational changes upon complex formation were identified. The analysis offers the answer to: how proximal to and how far from the actual ligand-binding sites the structural changes occur?
Åsman, Anna K M; Vetukuri, Ramesh R; Jahan, Sultana N; Fogelqvist, Johan; Corcoran, Pádraic; Avrova, Anna O; Whisson, Stephen C; Dixelius, Christina
2014-12-10
The oomycete Phytophthora infestans possesses active RNA silencing pathways, which presumably enable this plant pathogen to control the large numbers of transposable elements present in its 240 Mb genome. Small RNAs (sRNAs), central molecules in RNA silencing, are known to also play key roles in this organism, notably in regulation of critical effector genes needed for infection of its potato host. To identify additional classes of sRNAs in oomycetes, we mapped deep sequencing reads to transfer RNAs (tRNAs) thereby revealing the presence of 19-40 nt tRNA-derived RNA fragments (tRFs). Northern blot analysis identified abundant tRFs corresponding to half tRNA molecules. Some tRFs accumulated differentially during infection, as seen by examining sRNAs sequenced from P. infestans-potato interaction libraries. The putative connection between tRF biogenesis and the canonical RNA silencing pathways was investigated by employing hairpin RNA-mediated RNAi to silence the genes encoding P. infestans Argonaute (PiAgo) and Dicer (PiDcl) endoribonucleases. By sRNA sequencing we show that tRF accumulation is PiDcl1-independent, while Northern hybridizations detected reduced levels of specific tRNA-derived species in the PiAgo1 knockdown line. Our findings extend the sRNA diversity in oomycetes to include fragments derived from non-protein-coding RNA transcripts and identify tRFs with elevated levels during infection of potato by P. infestans.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, Hongxue; Department of Urology, Hospital of Xinjiang Production and Construction Corps, Urumqi 830002; Li, Xuechao
Antisense non-coding RNA in the INK4 locus (ANRIL) is a member of long non-coding RNAs and has been reported to be dysregulated in several human cancers. However, the role of ANRIL in bladder cancer remains unclear. This present study aimed to investigate whether and how ANRIL involved in bladder cancer. Our results showed up-regulation of ANRIL in bladder cancer tissues versus the corresponding adjacent non-tumor tissues. To explore the specific mechanisms, ANRIL was silenced by small interfering RNA or short hairpin RNA transfection in human bladder cancer T24 and EJ cells. Knockdown of ANRIL repressed cell proliferation and increased cellmore » apoptosis, along with decreased expression of Bcl-2 and increased expressions of Bax, cytoplasmic cytochrome c and Smac and cleaved caspase-9, caspase-3 and PARP. However, no change of cleaved caspase-8 level was observed. Furthermore, in vivo experiment confirmed that knockdown of ANRIL inhibited tumorigenic ability of EJ cells in nude mice. Meanwhile, in accordance with in vitro study, knockdown of ANRIL inhibited expression of Bcl-2 and up-regulated expressions of Bax and cleaved caspase-9, but did not affect cleaved caspase-8 level. In conclusion, we first report that ANRIL possibly serves as an oncogene in bladder cancer and regulates bladder cancer cell proliferation and apoptosis through the intrinsic apoptosis pathway. - Highlights: • We first report the role of ANRIL in bladder cancer. • ANRIL is obviously up-regulated in bladder cancer tissues. • ANRIL regulates bladder cancer cell proliferation and cell apoptosis through the intrinsic pathway.« less
How hairpin vortices emerge from exact invariant solutions
NASA Astrophysics Data System (ADS)
Schneider, Tobias M.; Farano, Mirko; de Palma, Pietro; Robinet, Jean-Christoph; Cherubini, Stefania
2017-11-01
Hairpin vortices are among the most commonly observed flow structures in wall-bounded shear flows. However, within the dynamical system approach to turbulence, those structures have not yet been described. They are not captured by known exact invariant solutions of the Navier-Stokes equations nor have other state-space structures supporting hairpins been identified. We show that hairpin structures are observed along an optimally growing trajectory leaving a well known exact traveling wave solution of plane Poiseuille flow. The perturbation triggering hairpins does not correspond to an unstable mode of the exact traveling wave but lies in the stable manifold where non-normality causes strong transient amplification.
Ultrafast Unzipping of a Beta-Hairpin Peptide
NASA Astrophysics Data System (ADS)
Zinth, W.; Schrader, T. E.; Schreier, W. J.; Koller, F. O.; Cordes, T.; Babitzki, G.; Denschlag, R.; Tavan, P.; Löweneck, M.; Dong, Shou-Liang; Moroder, L.; Renner, C.
Light induced switching of a beta-hairpin structure is investigated by femtosecond IR spectroscopy. While the unzipping process comprises ultrafast kinetics and is finished within 1 ns, the folding into the hairpin structure is a much slower process.
Yang, Xin; Xie, Wen; Li, Ru-mei; Zhou, Xiao-mao; Wang, Shao-li; Wu, Qing-jun; Yang, Ni-na; Xia, Ji-xing; Yang, Ze-zong; Guo, Li-tao; Liu, Ya-ting; Zhang, You-jun
2017-01-01
Bemisia tabaci has developed a high level of resistance to thiamethoxam, a second generation neonicotinoid insecticide that has been widely used to control this pest. In this study, we investigated whether hydroxyacid-oxoacid transhydrogenase (HOT) is involved in resistance to the neonicotinoid insecticide thiamethoxam in the whitefly. We cloned the full-length gene that encodes HOT in B. tabaci. Its cDNA contains a 1428-bp open reading frame encoding 475 amino acid residues. Then we evaluated the mRNA expression level of HOT in different developmental stages, and found HOT expression was significantly greater in thiamethoxam resistance adults than in thiamethoxam susceptible adults. Subsequently, seven field populations of B. tabaci adults were sampled, the expression of mRNA level of HOT significant positive correlated with thiamethoxam resistance level. At last, we used a modified gene silencing system to knock-down HOT expression in B. tabaci adults. The results showed that the HOT mRNA levels decreased by 57% and thiamethoxam resistance decreased significantly after 2 days of feeding on a diet containing HOT dsRNA. The results indicated that down-regulation of HOT expression decreases thiamethoxam resistance in B. tabaci adults. PMID:28117358
Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange
Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.
2014-01-01
RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198
Deng, Ang; Zhang, Hongqi; Hu, Minyu; Liu, Shaohua; Gao, Qile; Wang, Yuxiang; Guo, Chaofeng
2017-12-01
Indian hedgehog protein (Ihh) is evolutionarily conserved and serves important roles in controlling the differentiation of progenitor cells into osteoblasts. Ihh null mutant mice exhibit a failure of osteoblast development in endochondral bone. Although studies have demonstrated that Ihh signaling is a potent local factor that regulates osteoblast differentiation, the specific transcription factors that determine osteoblast differentiation remain unclear. Further studies are required to determine the precise mechanism through which Ihh regulates osteoblast differentiation. In the present study, Ihh was knocked down in osteoblast MC3T3‑E1 cells using short hairpin RNA, to investigate the function of Ihh in osteoblast proliferation and differentiation and to examine the potential mechanism through which Ihh induces osteoblast apoptosis and cell cycle arrest. It was observed that the knockdown of Ihh induced a marked inhibition of cell growth and increased the apoptosis rate compared with the negative control osteoblasts. Downregulation of Ihh resulted in a cell cycle arrest at the G1 to S phase boundary in osteoblasts. In addition, the knockdown of Ihh decreased the alkaline phosphatase activity and mineral deposition of osteoblasts. The inhibitory roles of Ihh downregulation in osteoblast growth and differentiation may be associated with the transforming growth factor‑β/mothers against decapentaplegic homolog and tumor necrosis factor receptor superfamily member 11B/tumor necrosis factor ligand superfamily member 11 signaling pathways. Manipulating either Ihh expression or its signaling components may be of benefit for the treatment of skeletal diseases.
Nourinia, Ramin; Soheili, Zahra-Soheila; Ahmadieh, Hamid; Akrami, Hassan; Rezaei Kanavi, Mozhgan; Samiei, Shahram
2013-01-01
To evaluate the effect of placental growth factor (PlGF) gene knockdown in a murine model of laser-induced choroidal neovascularization. Choroidal neovascularization was induced in the left eyes of 11 mice by infrared laser. Small interfering RNA (siRNA, 20 picomoles/10 μl) corresponding to PlGF mRNA was administered intravitreally by Hamilton syringe in all subjects. One month later, fluorescein angiography and histolologic examination were performed. No leakage was apparent in the 11 eyes treated with siRNA cognate to PlGF. The results of histological evaluation were consistent with angiographic findings showing absence of choroidal neovascularization. Knockdown of the PlGF gene can inhibit the growth of laser-induced choroidal neovascularization in mice.
Al-Ayedh, Hassan; Rizwan-Ul-Haq, Muhammad; Hussain, Abid; Aljabr, Ahmed M
2016-11-01
Palm trees around the world are prone to notorious Rhynchophorus ferrugineus, which causes heavy losses of palm plantations. In Middle Eastern countries, this pest is a major threat to date palm orchards. Conventional pest control measures with the major share of synthetic insecticides have resulted in insect resistance and environmental issues. Therefore, in order to explore better alternatives, the RNAi approach was employed to knock down the catalase gene in fifth and tenth larval instars with different dsRNA application methods, and their insecticidal potency was studied. dsRNA of 444 bp was prepared to knock down catalase in R. ferrugineus. Out of the three dsRNA application methods, dsRNA injection into larvae was the most effective, followed by dsRNA application by artificial feeding. Both methods resulted in significant catalase knockdown in various tissues, especially the midgut. As a result, the highest growth inhibition of 123.49 and 103.47% and larval mortality of 80 and 40% were observed in fifth-instar larvae, whereas larval growth inhibition remained at 86.83 and 69.08% with larval mortality at 30 and 10% in tenth-instar larvae after dsRNA injection and artificial diet treatment. The topical application method was the least efficient, with the lowest larval growth inhibition of 57.23 and 45.61% and 0% mortality in fifth- and tenth-instar larvae. Generally, better results were noted at the high dsRNA dose of 5 µL. Catalase enzyme is found in most insect body tissues, and thus its dsRNA can cause broad-scale gene knockdown within the insect body, depending upon the application method. Significant larval mortality and growth inhibition after catalase knockdown in R. ferrugineus confirms its insecticidal potency and suggests a bright future for RNAi-based bioinsecticides in pest control. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Reichhart, Nadine; Crespo-Garcia, Sergio; Haase, Nadine; Golic, Michaela; Skosyrski, Sergej; Rübsam, Anne; Herrspiegel, Christina; Kociok, Norbert; Alenina, Natalia; Bader, Michael; Dechend, Ralf; Strauss, Olaf; Joussen, Antonia M
2017-01-01
Although the renin-angiotensin system plays an important role in the progression of diabetic retinopathy, its influence therein has not been systematically evaluated. Here we test the suitability of a new translational model of diabetic retinopathy, the TetO rat, for addressing the role of angiotensin-II receptor 1 (AT1) blockade in experimental diabetic retinopathy. Diabetes was induced by tetracycline-inducible small hairpin RNA (shRNA) knockdown of the insulin receptor in rats, generating TetO rats. Systemic treatment consisted of an AT1 blocker (ARB) at the onset of diabetes, following which, 4-5 weeks later the retina was analysed in vivo and ex vivo. Retinal function was assessed by Ganzfeld electroretinography (ERG). Retinal vessels in TetO rats showed differences in vessel calibre, together with gliosis. The total number and the proportion of activated mononuclear phagocytes was increased. TetO rats presented with loss of retinal ganglion cells (RGC) and ERG indicated photoreceptor malfunction. Both the inner and outer blood-retina barriers were affected. The ARB treated group showed reduced gliosis and an overall amelioration of retinal function, alongside RGC recovery, whilst no statistically significant differences in vascular and inflammatory features were detected. The TetO rat represents a promising translational model for the early neurovascular changes associated with type 2 diabetic retinopathy. ARB treatment had an effect on the neuronal component of the retina but not on the vasculature.
Design and cloning strategies for constructing shRNA expression vectors
McIntyre, Glen J; Fanning, Gregory C
2006-01-01
Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676
Single molecule RNA folding studied with optical trapping
NASA Astrophysics Data System (ADS)
Vieregg, Jeffrey Robert
The RNA folding problem (predicting the equilibrium structure and folding pathway of an RNA molecule from its sequence) is one of the classic problems of biophysics. Recent discoveries of many new functions for RNA have increased its importance, and new instrumental techniques have provided new ways to characterize molecular behavior. In particular, optical trapping (optical tweezers) allows controlled mechanical force to be applied to single RNA molecules while their end-to-end extension is monitored in real time. This enables characterization of RNA folding dynamics at a level unreachable by traditional bulk methods. Furthermore, recent advances in statistical mechanics make it possible to recover equilibrium quantities such as free energy from reactions which occur away from equilibrium. This dissertation describes the application of optical trapping and non-equilibrium statistical mechanics to quantitatively characterize folding of RNA secondary structures. By measuring the folding free energy of several specially designed hairpins in solutions containing various amounts of sodium and potassium, we were able to determine that RNA secondary structure thermodynamics depends not only on monovalent cation concentration but also surprisingly, on species. We also investigated the temperature dependence of hairpin folding thermodynamics and kinetics, which provided a direct measurement of enthalpy and entropy for RNA folding at physiological temperatures. We found that the folding pathway was quite sensitive to both salt and temperature, as measured by the folding success rate of a biologically important hairpin from the HIV-1 viral genome. Finally, I discuss modeling of force-induced RNA folding and unfolding, as well as a series of efforts which have dramatically improved the performance of our optical trapping instrument.
Kim, Seong-Wook; Seo, Misun; Kim, Duk-Soo; Kang, Moonkyung; Kim, Yeon-Soo; Koh, Hae-Young; Shin, Hee-Sup
2015-01-01
Background Decreased expression of phospholipase C-β1 (PLC-β1) has been observed in the brains of patients with schizophrenia, but, to our knowledge, no studies have shown a possible association between this altered PLC-β1 expression and the pathogenesis of schizophrenia. Although PLC-β1-null (PLC-β1−/−) mice exhibit multiple endophenotypes of schizophrenia, it remains unclear how regional decreases in PLC-β1 expression in the brain contribute to specific behavioural defects. Methods We selectively knocked down PLC-β1 in the medial prefrontal cortex (mPFC) using a small hairpin RNA strategy in mice. Results Silencing PLC-β1 in the mPFC resulted in working memory deficits, as assayed using the delayed non-match-to-sample T-maze task. Notably, however, other schizophrenia- related behaviours observed in PLC-β1−/− mice, including phenotypes related to locomotor activity, sociability and sensorimotor gating, were normal in PLC-β1 knockdown mice. Limitations Phenotypes of PLC-β1 knockdown mice, such as locomotion, anxiety and sensorimotor gating, have already been published in our previous studies. Further, the neural mechanisms underlying the working memory deficit in mice may be different from those in human schizophrenia. Conclusion These results indicate that PLC-β1 signalling in the mPFC is required for working memory. Importantly, these results support the notion that the decrease in PLC-β1 expression in the brains of patients with schizophrenia is a pathogenically relevant molecular marker of the disorder. PMID:25268789
Bleomycin Can Cleave an Oncogenic Noncoding RNA.
Angelbello, Alicia J; Disney, Matthew D
2018-01-04
Noncoding RNAs are pervasive in cells and contribute to diseases such as cancer. A question in biomedical research is whether noncoding RNAs are targets of medicines. Bleomycin is a natural product that cleaves DNA; however, it is known to cleave RNA in vitro. Herein, an in-depth analysis of the RNA cleavage preferences of bleomycin A5 is presented. Bleomycin A5 prefers to cleave RNAs with stretches of AU base pairs. Based on these preferences and bioinformatic analysis, the microRNA-10b hairpin precursor was identified as a potential substrate for bleomycin A5. Both in vitro and cellular experiments demonstrated cleavage. Importantly, chemical cleavage by bleomycin A5 in the microRNA-10b hairpin precursors occurred near the Drosha and Dicer enzymatic processing sites and led to destruction of the microRNA. Evidently, oncogenic noncoding RNAs can be considered targets of cancer medicines and might elicit their pharmacological effects by targeting noncoding RNA. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
On hairpin vortices as model of wall turbulence structure
NASA Technical Reports Server (NTRS)
Liu, N.-S.; Shamroth, S. J.; Mcdonald, H.
1985-01-01
A model of the hairpin vortex has been constructed and used in two distinct but related approaches. The first approach is kinematic in nature in which a synthesis procedure using hairpin vortices to provide a quantitative link between mean flow quantities and the statistical quantities of near wall turbulence has become developed. The second approach is dynamic in nature, and the evolution of an incipient 'representative' hairpin vortex as well as the distortion of a background laminar boundary layer flow, in which the hairpin vortex is immersed, has been simulated by numerical solution of the unsteady, three-dimensional Navier-Stokes equations.
Zhu, Xiaosan; Dai, Yichen; Chen, Zhangxin; Xie, Junpei; Zeng, Wei; Lin, Yuanyuan
2013-01-01
Overexpression of Pokemon, which is an erythroid myeloid ontogenic factor protein, occurs in different cancers, including hepatocellular carcinoma (HCC). Pokemon is also reported to have an oncogenic activity in various human cancers. This study investigated the effect of Pokemon knockdown on the regulation of HCC growth. POK shRNA suppressed the expression of Pokemon protein in HepG2 cells compared to the negative control vector-transfected HCC cells. Pokemon knockdown also reduced HCC cell viability and enhanced cisplatin-induced apoptosis in HCC cells. AKT activation and the expression of various cell cycle-related genes were inhibited following Pokemon knockdown. These data demonstrate that Pokemon may play a role in HCC progression, suggesting that inhibition of Pokemon expression using Pokemon shRNA should be further evaluated as a novel target for the control of HCC.
Nourinia, Ramin; Soheili, Zahra-Soheila; Ahmadieh, Hamid; Akrami, Hassan; Rezaei Kanavi, Mozhgan; Samiei, Shahram
2013-01-01
Purpose To evaluate the effect of placental growth factor (PlGF) gene knockdown in a murine model of laser-induced choroidal neovascularization. Methods Choroidal neovascularization was induced in the left eyes of 11 mice by infrared laser. Small interfering RNA (siRNA, 20 picomoles/10 μl) corresponding to PlGF mRNA was administered intravitreally by Hamilton syringe in all subjects. One month later, fluorescein angiography and histolologic examination were performed. Results No leakage was apparent in the 11 eyes treated with siRNA cognate to PlGF. The results of histological evaluation were consistent with angiographic findings showing absence of choroidal neovascularization. Conclusion Knockdown of the PlGF gene can inhibit the growth of laser-induced choroidal neovascularization in mice. PMID:23825706
Design and application of cotranscriptional non-enzymatic RNA circuits and signal transducers
Bhadra, Sanchita; Ellington, Andrew D.
2014-01-01
Nucleic acid circuits are finding increasing real-life applications in diagnostics and synthetic biology. Although DNA has been the main operator in most nucleic acid circuits, transcriptionally produced RNA circuits could provide powerful alternatives for reagent production and their use in cells. Towards these goals, we have implemented a particular nucleic acid circuit, catalytic hairpin assembly, using RNA for both information storage and processing. Our results demonstrated that the design principles developed for DNA circuits could be readily translated to engineering RNA circuits that operated with similar kinetics and sensitivities of detection. Not only could purified RNA hairpins perform amplification reactions but RNA hairpins transcribed in vitro also mediated amplification, even without purification. Moreover, we could read the results of the non-enzymatic amplification reactions using a fluorescent RNA aptamer ‘Spinach’ that was engineered to undergo sequence-specific conformational changes. These advances were applied to the end-point and real-time detection of the isothermal strand displacement amplification reaction that produces single-stranded DNAs as part of its amplification cycle. We were also able to readily engineer gate structures with RNA similar to those that have previously formed the basis of DNA circuit computations. Taken together, these results validate an entirely new chemistry for the implementation of nucleic acid circuits. PMID:24493736
The hairpin resonator: A plasma density measuring technique revisited
NASA Astrophysics Data System (ADS)
Piejak, R. B.; Godyak, V. A.; Garner, R.; Alexandrovich, B. M.; Sternberg, N.
2004-04-01
A microwave resonator probe is a resonant structure from which the relative permittivity of the surrounding medium can be determined. Two types of microwave resonator probes (referred to here as hairpin probes) have been designed and built to determine the electron density in a low-pressure gas discharge. One type, a transmission probe, is a functional equivalent of the original microwave resonator probe introduced by R. L. Stenzel [Rev. Sci. Instrum. 47, 603 (1976)], modified to increase coupling to the hairpin structure and to minimize plasma perturbation. The second type, a reflection probe, differs from the transmission probe in that it requires only one coaxial feeder cable. A sheath correction, based on the fluid equations for collisionless ions in a cylindrical electron-free sheath, is presented here to account for the sheath that naturally forms about the hairpin structure immersed in plasma. The sheath correction extends the range of electron density that can be accurately measured with a particular wire separation of the hairpin structure. Experimental measurements using the hairpin probe appear to be highly reproducible. Comparisons with Langmuir probes show that the Langmuir probe determines an electron density that is 20-30% lower than the hairpin. Further comparisons, with both an interferometer and a Langmuir probe, show hairpin measurements to be in good agreement with the interferometer while Langmuir probe measurements again result in a lower electron density.
Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I
2015-01-01
We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.
Tjondrokoesoemo, Andoria; Park, Ki Ho; Ferrante, Christopher; Komazaki, Shinji; Lesniak, Sebastian; Brotto, Marco; Ko, Jae-Kyun; Zhou, Jingsong; Weisleder, Noah; Ma, Jianjie
2011-01-01
Efficient intracellular Ca2+ ([Ca2+]i) homeostasis in skeletal muscle requires intact triad junctional complexes comprised of t-tubule invaginations of plasma membrane and terminal cisternae of sarcoplasmic reticulum. Bin1 consists of a specialized BAR domain that is associated with t-tubule development in skeletal muscle and involved in tethering the dihydropyridine receptors (DHPR) to the t-tubule. Here, we show that Bin1 is important for Ca2+ homeostasis in adult skeletal muscle. Since systemic ablation of Bin1 in mice results in postnatal lethality, in vivo electroporation mediated transfection method was used to deliver RFP-tagged plasmid that produced short –hairpin (sh)RNA targeting Bin1 (shRNA-Bin1) to study the effect of Bin1 knockdown in adult mouse FDB skeletal muscle. Upon confirming the reduction of endogenous Bin1 expression, we showed that shRNA-Bin1 muscle displayed swollen t-tubule structures, indicating that Bin1 is required for the maintenance of intact membrane structure in adult skeletal muscle. Reduced Bin1 expression led to disruption of t-tubule structure that was linked with alterations to intracellular Ca2+ release. Voltage-induced Ca2+ released in isolated single muscle fibers of shRNA-Bin1 showed that both the mean amplitude of Ca2+ current and SR Ca2+ transient were reduced when compared to the shRNA-control, indicating compromised coupling between DHPR and ryanodine receptor 1. The mean frequency of osmotic stress induced Ca2+ sparks was reduced in shRNA-Bin1, indicating compromised DHPR activation. ShRNA-Bin1 fibers also displayed reduced Ca2+ sparks' amplitude that was attributed to decreased total Ca2+ stores in the shRNA-Bin1 fibers. Human mutation of Bin1 is associated with centronuclear myopathy and SH3 domain of Bin1 is important for sarcomeric protein organization in skeletal muscle. Our study showing the importance of Bin1 in the maintenance of intact t-tubule structure and ([Ca2+]i) homeostasis in adult skeletal muscle
Equilibrium denaturation and preferential interactions of an RNA tetraloop with urea
Miner, Jacob Carlson; García, Angel Enrique
2017-02-09
Urea is an important organic cosolute with implications in maintaining osmotic stress in cells and differentially stabilizing ensembles of folded biomolecules. We report an equilibrium study of urea-induced denaturation of a hyperstable RNA tetraloop through unbiased replica exchange molecular dynamics. We find that, in addition to destabilizing the folded state, urea smooths the RNA free energy landscape by destabilizing specific configurations, and forming favorable interactions with RNA nucleobases. A linear concentration-dependence of the free energy (m-value) is observed, in agreement with the results of other RNA hairpins and proteins. Additionally, analysis of the hydrogen-bonding and stacking interactions within RNA primarilymore » show temperature-dependence, while interactions between RNA and urea primarily show concentration-dependence. Lastly, our findings provide valuable insight into the effects of urea on RNA folding and describe the thermodynamics of a basic RNA hairpin as a function of solution chemistry.« less
Equilibrium denaturation and preferential interactions of an RNA tetraloop with urea
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miner, Jacob Carlson; García, Angel Enrique
Urea is an important organic cosolute with implications in maintaining osmotic stress in cells and differentially stabilizing ensembles of folded biomolecules. We report an equilibrium study of urea-induced denaturation of a hyperstable RNA tetraloop through unbiased replica exchange molecular dynamics. We find that, in addition to destabilizing the folded state, urea smooths the RNA free energy landscape by destabilizing specific configurations, and forming favorable interactions with RNA nucleobases. A linear concentration-dependence of the free energy (m-value) is observed, in agreement with the results of other RNA hairpins and proteins. Additionally, analysis of the hydrogen-bonding and stacking interactions within RNA primarilymore » show temperature-dependence, while interactions between RNA and urea primarily show concentration-dependence. Lastly, our findings provide valuable insight into the effects of urea on RNA folding and describe the thermodynamics of a basic RNA hairpin as a function of solution chemistry.« less
Equilibrium Denaturation and Preferential Interactions of an RNA Tetraloop with Urea.
Miner, Jacob C; García, Angel E
2017-04-20
Urea is an important organic cosolute with implications in maintaining osmotic stress in cells and differentially stabilizing ensembles of folded biomolecules. We report an equilibrium study of urea-induced denaturation of a hyperstable RNA tetraloop through unbiased replica exchange molecular dynamics. We find that, in addition to destabilizing the folded state, urea smooths the RNA free energy landscape by destabilizing specific configurations, and forming favorable interactions with RNA nucleobases. A linear concentration-dependence of the free energy (m-value) is observed, in agreement with the results of other RNA hairpins and proteins. Additionally, analysis of the hydrogen-bonding and stacking interactions within RNA primarily show temperature-dependence, while interactions between RNA and urea primarily show concentration-dependence. Our findings provide valuable insight into the effects of urea on RNA folding and describe the thermodynamics of a basic RNA hairpin as a function of solution chemistry.
Microprocessor activity controls differential miRNA biogenesis In Vivo.
Conrad, Thomas; Marsico, Annalisa; Gehre, Maja; Orom, Ulf Andersson
2014-10-23
In miRNA biogenesis, pri-miRNA transcripts are converted into pre-miRNA hairpins. The in vivo properties of this process remain enigmatic. Here, we determine in vivo transcriptome-wide pri-miRNA processing using next-generation sequencing of chromatin-associated pri-miRNAs. We identify a distinctive Microprocessor signature in the transcriptome profile from which efficiency of the endogenous processing event can be accurately quantified. This analysis reveals differential susceptibility to Microprocessor cleavage as a key regulatory step in miRNA biogenesis. Processing is highly variable among pri-miRNAs and a better predictor of miRNA abundance than primary transcription itself. Processing is also largely stable across three cell lines, suggesting a major contribution of sequence determinants. On the basis of differential processing efficiencies, we define functionality for short sequence features adjacent to the pre-miRNA hairpin. In conclusion, we identify Microprocessor as the main hub for diversified miRNA output and suggest a role for uncoupling miRNA biogenesis from host gene expression. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Zhang, Xiaoyue; Xu, Keyan; Ou, Yanmei; Xu, Xiaodong; Chen, Hongying
2018-05-02
The Baculovirus expression vector system (BEVS) is a transient expression platform for recombinant protein production in insect cells. Baculovirus infection of insect cells will shutoff host translation and induce apoptosis and lead to the termination of protein expression. Previous reports have demonstrated the enhancement of protein yield in BEVS using stable insect cell lines expressing interference RNA to suppress the expression of caspase-1. In this study, short-hairpin RNA (shRNA) expression cassettes targeting Spodoptera frugiperda caspase-1 (Sf-caspase-1) were constructed and inserted into an Autographa californica multiple nucleopolyhedrovirus (AcMNPV) vector. Using the recombinant baculovirus vectors, we detected the suppression of Sf-caspase-1 expression and cell apoptosis. Green fluorescent protein (GFP), Discosoma sp. Red (DsRed) and firefly luciferase were then expressed as reporter proteins. The results showed that suppression of apoptosis enhanced the accumulation of exogenous proteins at 2 and 3 days post infection. After 4 days post infection, the activity of the reporter proteins remained higher in BEVS using the baculovirus carrying shRNA in comparison with the control without shRNA, but the accumulated protein levels showed no obvious difference between them, suggesting that apoptosis suppression resulted in improved protein folding rather than translation efficiency at the very late stage of baculovirus infection. The baculovirus vector developed in this study would be a useful tool for the production of active proteins suitable for structural and functional studies or pharmaceutical applications in Sf9 cells, and it also has the potential to be adapted for the improvement of protein expression in different insect cell lines that can be infected by AcMNPV.
Estornell, Leandro Hueso; Orzáez, Diego; López-Peña, Lucas; Pineda, Benito; Antón, María Teresa; Moreno, Vicente; Granell, Antonio
2009-04-01
A collection of fruit promoters, reporter genes and protein tags has been constructed in a triple-gateway format, a recombination-based cloning system that facilitates the tandem assembly of three DNA fragments into plant expression vectors. The new pENFRUIT collection includes, among others, the classical tomato-ripening promoters E8 and 2A11 and a set of six new tomato promoters. The new promoter activities were characterized in both transient assays and stable transgenic plants. The range of expression of the new promoters comprises strong (PNH, PLI), medium (PLE, PFF, PHD) and weak (PSN) promoters driving gene expression preferentially in the fruit, and covering a wide range of tissues and developmental stages. Together, a total of 78 possible combinations for the expression of a gene of interest in the fruit, plus a set of five reporters for new promoter analysis, was made available in the current collection. Moreover, the pENFRUIT promoter collection is adaptable to hairpin RNA strategies aimed at tissue/organ-specific gene silencing with only an additional cloning step. The pENFRUIT toolkit broadens the spectrum of promoter activities available for fruit biotechnology and fundamental research, and bypasses technical difficulties of current ligase-dependent cloning techniques in the construction of fruit expression cassettes. The pENFRUIT vector collection is available for the research community in a plasmid repository, facilitating its accessibility.
2010-01-01
Background The parasitic mite Varroa destructor is considered the major pest of the European honey bee (Apis mellifera) and responsible for declines in honey bee populations worldwide. Exploiting the full potential of gene sequences becoming available for V. destructor requires adaptation of modern molecular biology approaches to this non-model organism. Using a mu-class glutathione S-transferase (VdGST-mu1) as a candidate gene we investigated the feasibility of gene knockdown in V. destructor by double-stranded RNA-interference (dsRNAi). Results Intra-haemocoelic injection of dsRNA-VdGST-mu1 resulted in 97% reduction in VdGST-mu1 transcript levels 48 h post-injection compared to mites injected with a bolus of irrelevant dsRNA (LacZ). This gene suppression was maintained to, at least, 72 h. Total GST catalytic activity was reduced by 54% in VdGST-mu1 gene knockdown mites demonstrating the knockdown was effective at the translation step as well as the transcription steps. Although near total gene knockdown was achieved by intra-haemocoelic injection, only half of such treated mites survived this traumatic method of dsRNA administration and less invasive methods were assessed. V. destructor immersed overnight in 0.9% NaCl solution containing dsRNA exhibited excellent reduction in VdGST-mu1 transcript levels (87% compared to mites immersed in dsRNA-LacZ). Importantly, mites undergoing the immersion approach had greatly improved survival (75-80%) over 72 h, approaching that of mites not undergoing any treatment. Conclusions Our findings on V. destructor are the first report of gene knockdown in any mite species and demonstrate that the small size of such organisms is not a major impediment to applying gene knockdown approaches to the study of such parasitic pests. The immersion in dsRNA solution method provides an easy, inexpensive, relatively high throughput method of gene silencing suitable for studies in V. destructor, other small mites and immature stages of ticks
Hua, Ping; Liu, Li-Bao; Liu, Jia-Liang; Wang, Meng; Jiang, Hui-Qi; Zeng, Kuan; Yang, Yan-Qi; Yang, Song-Ran
2013-09-01
Transplantation of bone marrow mesenchymal stem cells is a promising new strategy for the repair of infarcted cardiac tissue. However, the majority of transplanted bone marrow mesenchymal stem cells (BMSCs) die soon after transplantation, due in part to oxidative stress in the ischemic region. Oxidative stress is known to induce apoptosis through the activation of caspase-3. The aim of this study is to determine whether small interfering RNA targeting caspase-3 can inhibit the apoptosis of rat BMSCs in vitro. Caspase-3 siRNA expression vectors were prepared and transfected into rat BMSCs in the presence of liposomes. Western blot assay and real-time polymerase chain reaction (RT-PCR) were performed to detect caspase-3 expression. A retrovirus packaging system was employed to package 293FT cells producing caspase-3 siRNA virus, which were transfected into rat BMSCs. Those stably expressing caspase-3 siRNA were screened by Western blot assay and RT-PCR to determine caspase-3 expression levels. Stable transfection of caspase-3 siRNA significantly decreased caspase-3 protein (0.26 ± 0.001 vs. 0.42 ± 0.004, P < 0.05) and mRNA expression (0.19 ± 0.002 vs. 1, P < 0.05) in BMSCs compared to non-transfected BMSCs. Cells were incubated in H2O2 to induce apoptosis, which was detected by TUNEL staining, and BMSC morphology was not altered by either transient or stable transfection of caspase-3 siRNA. H2O2-induced apoptosis of BMSCs stably transfected with caspase-3 siRNA was dramatically reduced compared to that of normal BMSCs (11.0 ± 3.2 vs. 25.8 ± 4.2, P < 0.05). Caspase-3 knockdown BMSCs are thus more resistant to apoptosis than normal BMSCs, potentially increasing their survival rates under conditions that cause oxidative stress.
Characterization of Bleomycin-Mediated Cleavage of a Hairpin DNA Library
Segerman, Zachary J.; Roy, Basab; Hecht, Sidney M.
2013-01-01
A study of BLM A5 was conducted using a previously isolated library of hairpin DNAs found to bind strongly to metal free BLM. The ability of Fe(II)•BLM to effect cleavage on both the 3' and 5'-arms of the hairpin DNAs was characterized. The strongly bound DNAs were found to be efficient substrates for Fe•BLM A5-mediated hairpin DNA cleavage. Surprisingly, the most prevalent site of BLM-mediated cleavage was found to be the 5′-AT-3′ dinucleotide sequence. This dinucleotide sequence, and other sequences generally not cleaved well by BLM when examined using arbitrarily chosen DNA substrates, were apparent when examining the library of ten hairpin DNAs. In total, 132 sites of DNA cleavage were produced by exposure of the hairpin DNA library to Fe•BLM A5. The existence of multiple sites of cleavage on both the 3′- and 5′-arms of the hairpin DNAs suggested that some of these might be double-strand cleavage events. Accordingly, an assay was developed with which to test the propensity of the hairpin DNAs to undergo double-strand DNA damage. One hairpin DNA was characterized using this method, and gave results consistent with earlier reports of double-strand DNA cleavage, but with a sequence selectivity different from those reported previously. PMID:23834496
Tomographic PIV Study of Hairpin Vortices
NASA Astrophysics Data System (ADS)
Sabatino, Daniel; Rossmann, Tobias
2014-11-01
Tomographic PIV is used in a free surface water channel to quantify the flow behavior of hairpin vortices that are artificially generated in a laminar boundary layer. Direct injection from a 32:1 aspect ratio slot at low blowing ratios (0 . 1 < BR < 0 . 2) is used to generate an isolated hairpin vortex in a thick laminar boundary layer (485 < Reδ* < 600). Due to the large dynamic range of length and velocity scales (the resulting vortices have advection velocities 5X greater than their tangential velocities), a tailored optical arrangement and specialized post processing techniques are required to fully capture the small-scale behavior and long-time development of the flow field. Hairpin generation and evolution are presented using the λ2 criterion derived from the instantaneous, three-dimensional velocity field. The insight provided by the tomographic data is also compared to the conclusions drawn from 2D PIV and passive scalar visualizations. Finally, the three-dimensional behavior of the measured velocity field is correlated with that of a simultaneously imaged, passive scalar dye that marks the boundary of the injected fluid, allowing the examination of the entrainment behavior of the hairpin. Supported by the National Science Foundation under Grant CBET-1040236.
NASA Astrophysics Data System (ADS)
Tian, Qianqian; Wang, Ying; Deng, Ruijie; Lin, Lei; Liu, Yang; Li, Jinghong
2014-12-01
The detection of microRNAs (miRNAs) is imperative for gaining a better understanding of the functions of these biomarkers and has great potential for the early diagnosis of human disease. High sensitivity and selectivity for miRNA detection brings new challenges. Herein, an ultrasensitive protocol for electrochemical detection of miRNA is designed through carbon nanotube (CNT) enhanced label-free detection based on hairpin probe triggered solid-phase rolling-circle amplification (RCA). Traditionally, RCA, widely applied for signal enhancement in the construction of a variety of biosensors, has an intrinsic limitation of ultrasensitive detection, as it is difficult to separate the enzymes, templates, and padlock DNAs from the RCA products in the homogeneous solution. We purposely designed a solid-phase RCA strategy, using CNTs as the solid substrate, integrated with a hairpin structured probe to recognize target miRNA. In the presence of miRNA the stem-loop structure will be unfolded, triggering the CNT based RCA process. Due to the efficient blocking effect originating from the polymeric RCA products, the label-free assay of miRNA exhibits an ultrasensitive detection limit of 1.2 fM. Furthermore, the protocol possesses excellent specificity for resolving lung cancer-related let-7 family members which have only one-nucleotide variations. The high sensitivity and selectivity give the method great potential for applications in online diagnostics and in situ detection in long-term development.The detection of microRNAs (miRNAs) is imperative for gaining a better understanding of the functions of these biomarkers and has great potential for the early diagnosis of human disease. High sensitivity and selectivity for miRNA detection brings new challenges. Herein, an ultrasensitive protocol for electrochemical detection of miRNA is designed through carbon nanotube (CNT) enhanced label-free detection based on hairpin probe triggered solid-phase rolling-circle amplification
Gros-Louis, Francois; Kriz, Jasna; Kabashi, Edor; McDearmid, Jonathan; Millecamps, Stéphanie; Urushitani, Makoto; Lin, Li; Dion, Patrick; Zhu, Qinzhang; Drapeau, Pierre; Julien, Jean-Pierre; Rouleau, Guy A
2008-09-01
Recessive ALS2 mutations are linked to three related but slightly different neurodegenerative disorders: amyotrophic lateral sclerosis, hereditary spastic paraplegia and primary lateral sclerosis. To investigate the function of the ALS2 encoded protein, we generated Als2 knock-out (KO) mice and zAls2 knock-down zebrafish. The Als2(-/-) mice lacking exon 2 and part of exon 3 developed mild signs of neurodegeneration compatible with axonal transport deficiency. In contrast, zAls2 knock-down zebrafish had severe developmental abnormalities, swimming deficits and motor neuron perturbation. We identified, by RT-PCR, northern and western blotting novel Als2 transcripts in mouse central nervous system. These Als2 transcripts were present in Als2 null mice as well as in wild-type littermates and some rescued the zebrafish phenotype. Thus, we speculate that the newly identified Als2 mRNA species prevent the Als2 KO mice from developing severe neurodegenerative disease and might also regulate the severity of the motor neurons phenotype observed in ALS2 patients.
Yamazaki, Tomomi; Shiraishi, Sayaka; Kishimoto, Kyoko; Miura, Shinji; Ezaki, Osamu
2011-06-01
The effects of a diet rich in saturated fat on fatty liver formation and the related mechanisms that induce fatty liver were examined. C57BL/6J mice were fed butter or safflower oil as a high-fat (HF) diet (40% fat calories) for 2, 4, 10, or 17 weeks. Although both HF diets induced similar levels of obesity, HF butter-fed mice showed a two to threefold increase in liver triacylglycerol (TG) concentration compared to HF safflower oil-fed mice at 4 or 10 weeks without hyperinsulinemia. At 4 weeks, increases in peroxisome proliferator-activated receptor γ2 (PPARγ2), CD36, and adipose differentiation-related protein (ADRP) mRNAs were observed in HF butter-fed mice; at 10 weeks, an increase in sterol regulatory element-binding protein-1c (SREBP-1c) was observed; at 17 weeks, these increases were attenuated. At 4 weeks, a single injection of adenoviral vector-based short hairpin interfering RNA against PPARγ2 in HF butter-fed mice reduced PPARγ protein and mRNA of its target genes (CD36 and ADRP) by 43%, 43%, and 39%, respectively, with a reduction in liver TG concentration by 38% in 5 days. PPARγ2 knockdown also reduced mRNAs in lipogenic genes (fatty-acid-synthase, stearoyl-CoA desaturase 1, acetyl-CoA carboxylase 1) without alteration of SREBP-1c mRNA. PPARγ2 knockdown reduced mRNAs in genes related to inflammation (CD68, interleukin-1β, tumor necrosis factor-α, and monocyte chemoattractant protein-1). In conclusion, saturated fatty acid-rich oil induced fatty liver in mice, and this was triggered initially by an increase in PPARγ2 protein in the liver, which led to increased expression of lipogenic genes. Inactivation of PPARγ2 may improve fatty liver induced by HF saturated fat. Copyright © 2011 Elsevier Inc. All rights reserved.
Post-transcriptional control of DGCR8 expression by the Microprocessor.
Triboulet, Robinson; Chang, Hao-Ming; Lapierre, Robert J; Gregory, Richard I
2009-06-01
The Microprocessor, comprising the RNase III Drosha and the double-stranded RNA binding protein DGCR8, is essential for microRNA (miRNA) biogenesis. In the miRNA processing pathway certain hairpin structures within primary miRNA (pri-miRNA) transcripts are specifically cleaved by the Microprocessor to release approximately 60-70-nucleotide precursor miRNA (pre-miRNA) intermediates. Although both Drosha and DGCR8 are required for Microprocessor activity, the mechanisms regulating the expression of these proteins are unknown. Here we report that the Microprocessor negatively regulates DGCR8 expression. Using in vitro reconstitution and in vivo studies, we demonstrate that a hairpin, localized in the 5' untranslated region (5'UTR) of DGCR8 mRNA, is cleaved by the Microprocessor. Accordingly, knockdown of Drosha leads to an increase in DGCR8 mRNA and protein levels in cells. Furthermore, we found that the DGCR8 5'UTR confers Microprocessor-dependent repression of a luciferase reporter gene in vivo. Our results uncover a novel feedback loop that regulates DGCR8 levels.
Nazem, Shima; Rabiee, Farzaneh; Ghaedi, Kamran; Babashah, Sadegh; Sadeghizadeh, Majid; Nasr-Esfahani, Mohammad Hossein
2018-06-01
Fibronectin type III domain-containing 5 protein (Fndc5) is a glycosylated protein with elevated expression in high energy demanded tissues as heart, brain, and muscle. It has been shown that upregulation of Fndc5 is regulated by peroxisome proliferator-activated receptor-γ coactivator-1 alpha (PGC-1α), which is known as a master regulator of mitochondrial function and biogenesis. Also, our group indicated that Fndc5 expression increases gradually during cardiac differentiation of mouse embryonic stem cells (mESCs). In this paper, to clarify the importance of Fndc5 in cardiac differentiation, we south to knock down Fndc5 expression by generation a stably transduced mESC line that derives the expression of a short hairpin RNA (shRNA) against Fndc5 gene following doxycycline (Dox) induction. Knock-down of Fndc5 demonstrated a considerable decrease in expression of cardiac progenitor and cardiomyocyte markers. Considering the fact that mitochondria play a crucial role in cardiac differentiation of ESCs, we investigated the role of Fndc5, as a downstream target of PGC1-α, on mitochondrial indices. Results showed that expression of nuclear encoded mitochondrial genes including PGC1-α, Atp5b, Ndufb5, and SOD2 significantly decreased. Moreover, mitochondrial membrane potential (ΔΨm) and relative ATP content of cardiomyocytes decreased markedly with relative ROS level increase. Together, our results suggest that Fndc5 attenuates process of cardiac differentiation of mESCs which is associated with modulation of mitochondrial function and gene expression. © 2017 Wiley Periodicals, Inc.
Liu, Zuqiang; Falo, Louis D; You, Zhaoyang
2011-07-01
Although high mobility group box 1 (HMGB1) in tumor cells is involved in many aspects of tumor progression, its role in tumor immune suppression remains elusive. Host cell-derived IL-10 suppressed a naturally acquired CD8 T cell-dependent antitumor response. The suppressive activity of tumor-associated Foxp3(+)CD4(+)CD25(+) regulatory T cells (Treg) was IL-10 dependent. Neutralizing HMGB1 impaired tumor cell-promoted IL-10 production by Treg. Short hairpin RNA-mediated knockdown of HMGB1 (HMGB1 KD) in tumor cells did not affect tumor cell growth but uncovered naturally acquired long-lasting tumor-specific IFN-γ- or TNF-α-producing CD8 T cell responses and attenuated their ability to induce Treg, leading to naturally acquired CD8 T cell- or IFN-γ-dependent tumor rejection. The data suggest that tumor cell-derived HMGB1 may suppress naturally acquired CD8 T cell-dependent antitumor immunity via enhancing Treg to produce IL-10, which is necessary for Treg-mediated immune suppression.
RNA-Catalyzed RNA Ligation on an External RNA Template
NASA Technical Reports Server (NTRS)
McGinness, Kathleen E.; Joyce, Gerald F.
2002-01-01
Variants of the hc ligase ribozyme, which catalyzes ligation of the 3' end of an RNA substrate to the 5' end of the ribozyme, were utilized to evolve a ribozyme that catalyzes ligation reactions on an external RNA template. The evolved ribozyme catalyzes the joining of an oligonucleotide 3'-hydroxyl to the 5'-triphosphate of an RNA hairpin molecule. The ribozyme can also utilize various substrate sequences, demonstrating a largely sequence-independent mechanism for substrate recognition. The ribozyme also carries out the ligation of two oligonucleotides that are bound at adjacent positions on a complementary template. Finally, it catalyzes addition of mononucleoside '5-triphosphates onto the '3 end of an oligonucleotide primer in a template-dependent manner. The development of ribozymes that catalyze polymerase-type reactions contributes to the notion that an RNA world could have existed during the early history of life on Earth.
Stem-Loop RNA Hairpins in Giant Viruses: Invading rRNA-Like Repeats and a Template Free RNA
Seligmann, Hervé; Raoult, Didier
2018-01-01
We examine the hypothesis that de novo template-free RNAs still form spontaneously, as they did at the origins of life, invade modern genomes, contribute new genetic material. Previously, analyses of RNA secondary structures suggested that some RNAs resembling ancestral (t)RNAs formed recently de novo, other parasitic sequences cluster with rRNAs. Here positive control analyses of additional RNA secondary structures confirm ancestral and de novo statuses of RNA grouped according to secondary structure. Viroids with branched stems resemble de novo RNAs, rod-shaped viroids resemble rRNA secondary structures, independently of GC contents. 5′ UTR leading regions of West Nile and Dengue flavivirid viruses resemble de novo and rRNA structures, respectively. An RNA homologous with Megavirus, Dengue and West Nile genomes, copperhead snake microsatellites and levant cotton repeats, not templated by Mimivirus' genome, persists throughout Mimivirus' infection. Its secondary structure clusters with candidate de novo RNAs. The saltatory phyletic distribution and secondary structure of Mimivirus' peculiar RNA suggest occasional template-free polymerization of this sequence, rather than noncanonical transcriptions (swinger polymerization, posttranscriptional editing). PMID:29449833
Fang, Hongmei; Xie, Nuli; Ou, Min; Huang, Jin; Li, Wenshan; Wang, Qing; Liu, Jianbo; Yang, Xiaohai; Wang, Kemin
2018-05-21
Nucleic acids, as one kind of significant biomarkers, have attracted tremendous attention and exhibited immense value in fundamental studies and clinical applications. In this work, we developed a fluorescent assay for detecting nucleic acids in complex samples based on magnetic microbead (MMB)-assisted catalyzed hairpin assembly (CHA) and donor donor-acceptor fluorescence resonance energy transfer ("DD-A" FRET) signaling mechanism. Three types of DNA hairpin probes were employed in this system, including Capture, H1 (double FAM-labelled probe as FRET donor) and H2 (TAMRA-labelled probe as FRET acceptor). Firstly, the Captures immobilized on MMBs bound to targets in complex samples, and the sequences in Captures that could trigger catalyzed hairpin assembly (CHA) were exposed. Then, target-enriched MMBs complexes were separated and resuspended in the reaction buffer containing H1 and H2. As a result, numerous H1-H2 duplexes were formed during CHA process, inducing an obvious FRET signal. In contrast, CHA could not be trigger and the FRET signal was weak while target was absent. With the aid of magnetic separation and "DD-A" FRET, it was demonstrated to effectively eliminate errors from background interference. Importantly, this strategy realized amplified detection in buffer, with detection limits of microRNA as low as 34 pM. Furthermore, this method was successfully applied to detect microRNA-21 in serum and cell culture media. The results showed that our method has the potential for biomedical research and clinical application.
Lebars, Isabelle; Legrand, Pierre; Aimé, Ahissan; Pinaud, Noël; Fribourg, Sébastien; Di Primo, Carmelo
2008-01-01
In HIV-1, trans-activation of transcription of the viral genome is regulated by an imperfect hairpin, the trans-activating responsive (TAR) RNA element, located at the 5′ untranslated end of all viral transcripts. TAR acts as a binding site for viral and cellular proteins. In an attempt to identify RNA ligands that would interfere with the virus life-cycle by interacting with TAR, an in vitro selection was previously carried out. RNA hairpins that formed kissing-loop dimers with TAR were selected [Ducongé F. and Toulmé JJ (1999) RNA, 5:1605–1614]. We describe here the crystal structure of TAR bound to a high-affinity RNA aptamer. The two hairpins form a kissing complex and interact through six Watson–Crick base pairs. The complex adopts an overall conformation with an inter-helix angle of 28.1°, thus contrasting with previously reported solution and modelling studies. Structural analysis reveals that inter-backbone hydrogen bonds between ribose 2′ hydroxyl and phosphate oxygens at the stem-loop junctions can be formed. Thermal denaturation and surface plasmon resonance experiments with chemically modified 2′-O-methyl incorporated into both hairpins at key positions, clearly demonstrate the involvement of this intermolecular network of hydrogen bonds in complex stability. PMID:18996893
Proflavine sensitivity of RNA processing in isolated nuclei.
Yannarell, A; Niemann, M; Schumm, D E; Webb, T E
1977-01-01
The intercalating agent proflavine inhibits the processing and subsequent release of preformed messenger RNA and ribosomal RNA from isolated liver nuclei to surrogate cytoplasm. The direct effect of proflavine on these processes, as monitored in a reconstituted cell-free system, supports the theory that base-paired segments (i.e. hairpin loops) in the precursor RNA's are involved as recognition sites in nuclear RNA processing. PMID:866181
Long noncoding AFAP1-antisense RNA 1 is upregulated and promotes tumorigenesis in gastric cancer.
Ye, Fei; Gong, Yi; Chen, Xiangheng; Yu, Meiying; Zuo, Zhongkun; Pei, Dongni; Liu, Wei; Wang, Qunwei; Zhou, Jun; Duan, Lunxi; Zhang, Leiyi; Li, Xiaojing; Tang, Tenglong; Huang, Jiangsheng
2018-05-01
Long noncoding RNA serves important roles in gastric cancer (GC). However, the prognostic significance and tumorigenesis effect of AFAP1-antisense RNA 1 (AS1) in GC remain to be clarified. The present study was conducted in order to determine the expression level of AFAP1-AS1 by reverse transcription-quantitative polymerase chain reaction. It was demonstrated that AFAP1-AS1 expression level was higher in GC tissues in comparison with adjacent tissues. By analyzing 66 GC tissue specimens, AFAP1-AS1 expression level was found to be markedly associated with tumor size, clinical stage and differentiation. By performing multivariate Cox regression test, AFAP1-AS1 expression level was confirmed to be an independent factor for poor prognosis in patients with GC. Furthermore, SGC-7901 and BGC-823 cells were used for further investigation following transfection of an AFAP1-AS1 short hairpin RNA lentiviral vector. Knockdown of AFAP1-AS1 significantly inhibited GC cell proliferation, migration and invasion abilities in vitro . Finally, nude mice experiments confirmed that downregulation of AFAP1-AS1 in GC cells suppressed tumor growth in vivo . In conclusion, the results of the present study suggested that AFAP1-AS1 may serve as a valuable prognostic indicator and therapeutic target for GC.
Abd El Halim, Hesham M; Alshukri, Baida M H; Ahmad, Munawar S; Nakasu, Erich Y T; Awwad, Mohammed H; Salama, Elham M; Gatehouse, Angharad M R; Edwards, Martin G
2016-07-14
The voltage-gated sodium ion channel (VGSC) belongs to the largest superfamily of ion channels. Since VGSCs play key roles in physiological processes they are major targets for effective insecticides. RNA interference (RNAi) is widely used to analyse gene function, but recently, it has shown potential to contribute to novel strategies for selectively controlling agricultural insect pests. The current study evaluates the delivery of dsRNA targeted to the sodium ion channel paralytic A (TcNav) gene in Tribolium castaneum as a viable means of controlling this insect pest. Delivery of TcNav dsRNA caused severe developmental arrest with larval mortalities up to 73% post injection of dsRNA. Injected larvae showed significant (p < 0.05) knockdown in gene expression between 30-60%. Expression was also significantly (p < 0.05) reduced in pupae following injection causing 30% and 42% knockdown for early and late pupal stages, respectively. Oral delivery of dsRNA caused dose-dependant mortalities of between 19 and 51.34%; this was accompanied by significant (p < 0.05) knockdown in gene expression following 3 days of continuous feeding. The majority of larvae injected with, or fed, dsRNA died during the final larval stage prior to pupation. This work provides evidence of a viable RNAi-based strategy for insect control.
Roth, Braden M; Ishimaru, Daniella; Hennig, Mirko
2013-09-13
MicroRNA (miRNA) biogenesis follows a conserved succession of processing steps, beginning with the recognition and liberation of an miRNA-containing precursor miRNA hairpin from a large primary miRNA transcript (pri-miRNA) by the Microprocessor, which consists of the nuclear RNase III Drosha and the double-stranded RNA-binding domain protein DGCR8 (DiGeorge syndrome critical region protein 8). Current models suggest that specific recognition is driven by DGCR8 detection of single-stranded elements of the pri-miRNA stem-loop followed by Drosha recruitment and pri-miRNA cleavage. Because countless RNA transcripts feature single-stranded-dsRNA junctions and DGCR8 can bind hundreds of mRNAs, we explored correlations between RNA binding properties of DGCR8 and specific pri-miRNA substrate processing. We found that DGCR8 bound single-stranded, double-stranded, and random hairpin transcripts with similar affinity. Further investigation of DGCR8/pri-mir-16 interactions by NMR detected intermediate exchange regimes over a wide range of stoichiometric ratios. Diffusion analysis of DGCR8/pri-mir-16 interactions by pulsed field gradient NMR lent further support to dynamic complex formation involving free components in exchange with complexes of varying stoichiometry, although in vitro processing assays showed exclusive cleavage of pri-mir-16 variants bearing single-stranded flanking regions. Our results indicate that DGCR8 binds RNA nonspecifically. Therefore, a sequential model of DGCR8 recognition followed by Drosha recruitment is unlikely. Known RNA substrate requirements are broad and include 70-nucleotide hairpins with unpaired flanking regions. Thus, specific RNA processing is likely facilitated by preformed DGCR8-Drosha heterodimers that can discriminate between authentic substrates and other hairpins.
Roth, Braden M.; Ishimaru, Daniella; Hennig, Mirko
2013-01-01
MicroRNA (miRNA) biogenesis follows a conserved succession of processing steps, beginning with the recognition and liberation of an miRNA-containing precursor miRNA hairpin from a large primary miRNA transcript (pri-miRNA) by the Microprocessor, which consists of the nuclear RNase III Drosha and the double-stranded RNA-binding domain protein DGCR8 (DiGeorge syndrome critical region protein 8). Current models suggest that specific recognition is driven by DGCR8 detection of single-stranded elements of the pri-miRNA stem-loop followed by Drosha recruitment and pri-miRNA cleavage. Because countless RNA transcripts feature single-stranded-dsRNA junctions and DGCR8 can bind hundreds of mRNAs, we explored correlations between RNA binding properties of DGCR8 and specific pri-miRNA substrate processing. We found that DGCR8 bound single-stranded, double-stranded, and random hairpin transcripts with similar affinity. Further investigation of DGCR8/pri-mir-16 interactions by NMR detected intermediate exchange regimes over a wide range of stoichiometric ratios. Diffusion analysis of DGCR8/pri-mir-16 interactions by pulsed field gradient NMR lent further support to dynamic complex formation involving free components in exchange with complexes of varying stoichiometry, although in vitro processing assays showed exclusive cleavage of pri-mir-16 variants bearing single-stranded flanking regions. Our results indicate that DGCR8 binds RNA nonspecifically. Therefore, a sequential model of DGCR8 recognition followed by Drosha recruitment is unlikely. Known RNA substrate requirements are broad and include 70-nucleotide hairpins with unpaired flanking regions. Thus, specific RNA processing is likely facilitated by preformed DGCR8-Drosha heterodimers that can discriminate between authentic substrates and other hairpins. PMID:23893406
On hairpin vortex generation from near-wall streamwise vortices
NASA Astrophysics Data System (ADS)
Wang, Yinshan; Huang, Weixi; Xu, Chunxiao
2015-04-01
The generation of a hairpin vortex from near-wall streamwise vortices is studied via the direct numerical simulation (DNS) of the streak transient growth in the minimal channel flow at . The streak profile is obtained by conditionally averaging the DNS data of the fully developed turbulent channel flow at the same Reynolds number. The near-wall streamwise vortices are produced by the transient growth of the streak which is initially subjected to the sinuous perturbation of the spanwise velocity. It is shown that the arch head of the hairpin vortex first grows from the downstream end of the stronger streamwise vortex and then connects with the weaker, opposite-signed streamwise vortex in their overlap region, forming a complete individual hairpin structure. The vorticity transport along the vortex lines indicates that the strength increase and the spatial expansion of the arch head are due to the stretching and the turning of the vorticity vector, respectively. The hairpin packets could be further produced from the generated individual hairpin vortex following the parent-offspring process.
Bingsohn, L; Knorr, E; Billion, A; Narva, K E; Vilcinskas, A
2017-02-01
RNA interference (RNAi) is a promising alternative strategy for ecologically friendly pest management. However, the identification of RNAi candidate genes is challenging owing to the absence of laboratory strains and the seasonality of most pest species. Tribolium castaneum is a well-established model, with a strong and robust RNAi response, which can be used as a high-throughput screening platform to identify potential RNAi target genes. Recently, the cactus gene was identified as a sensitive RNAi target for pest control. To explore whether the spectrum of promising RNAi targets can be expanded beyond those found by random large-scale screening, to encompass others identified using targeted knowledge-based approaches, we constructed a Cactus interaction network. We tested nine genes in this network and found that the delivery of double-stranded RNA corresponding to fusilli and cactin showed lethal effects. The silencing of cactin resulted in 100% lethality at every developmental stage from the larva to the adult. The knockdown of pelle, Dorsal-related immunity factor and short gastrulation reduced or even prevented egg hatching in the next generation. The combination of such targets with lethal and parental RNAi effects can now be tested against different pest species in field studies. © 2016 The Royal Entomological Society.
Arzt, Lisa; Halbwedl, Iris; Gogg-Kamerer, Margit; Popper, Helmut H
2017-07-01
Malignant pleural mesothelioma (MPM) is the most common primary tumor of the pleura. Its incidence is still increasing in Europe and the prognosis remains poor. We investigated the oncogenic function of signal transducer and activator of transcription 1 (STAT1) in MPM in more detail. A miRNA profiling was performed on 52 MPM tissue samples. Upregulated miRNAs (targeting SOCS1/3) were knocked-down using miRNA inhibitors. mRNA expression levels of STAT1/3, SOCS1/3 were detected in MPM cell lines. STAT1 has been knocked-down using siRNA and qPCR was used to detect mRNA expression levels of all JAK/STAT family members and genes that regulate them. An immunohistochemical staining was performed to detect the expression of caspases. STAT1 was upregulated and STAT3 was downregulated, SOCS1/3 protein was not detected but it was possible to detect SOCS1/3 mRNA in MPM cell lines. The upregulated miRNAs were successfully knocked-down, however the expected effect on SOCS1 expression was not detected. STAT1 knock-down had different effects on STAT3/5 expression. Caspase 3a and 8 expression was found to be increased after STAT1 knock-down. The physiologic regulation of STAT1 via SOCS1 is completely lost in MPM and it does not seem that the miRNAs identified by now, do inhibit the expression of SOCS1. MPM cell lines compensate STAT1 knock-down by increasing the expression of STAT3 or STAT5a, two genes which are generally considered to be oncogenes. And much more important, STAT1 knock-down induces apoptosis in MPM cell lines and STAT1 might therefore be a target for therapeutic intervention.
Li, Longhu; Zhao, Dong; Jin, Zhe; Zhang, Jian; Paul, Christian; Wang, Yigang
2015-01-01
Treatment with short hairpin RNA (shRNA) interference therapy targeting phosphodiesterase 5a after myocardial infarction (MI) has been shown to mitigate post-MI heart failure. We investigated the mechanisms that underpin the beneficial effects of PDE5a inhibition through shRNA on post-MI heart failure. An adenoviral vector with an shRNA sequence inserted was adopted for the inhibition of phosphodiesterase 5a (Ad-shPDE5a) in vivo and in vitro. Myocardial infarction (MI) was induced in male C57BL/6J mice by left coronary artery ligation, and immediately after that, the Ad-shPDE5a was injected intramyocardially around the MI region and border areas. Four weeks post-MI, the Ad-shPDE5a-treated mice showed significant mitigation of the left ventricular (LV) dilatation and dysfunction compared to control mice. Infarction size and fibrosis were also significantly reduced in Ad-shPDE5a-treated mice. Additionally, Ad-shPDE5a treatment decreased the MI-induced inflammatory cytokines interleukin (IL)-1β, IL-6, tumor necrosis factor-α, and transforming growth factor-β1, which was confirmed in vitro in Ad-shPDE5a transfected myofibroblasts cultured under oxygen glucose deprivation. Finally, Ad-shPDE5a treatment was found to activate the myocardial Akt signaling pathway in both in vivo and in vitro experiments. These findings indicate that PDE5a inhibition by Ad-shPDE5a via the Akt signal pathway could be of significant value in the design of future therapeutics for post-MI heart failure.
Matin, Maryam M; Walsh, James R; Gokhale, Paul J; Draper, Jonathan S; Bahrami, Ahmad R; Morton, Ian; Moore, Harry D; Andrews, Peter W
2004-01-01
We have used RNA interference (RNAi) to downregulate beta2-microglobulin and Oct4 in human embryonal carcinoma (hEC) cells and embryonic stem (hES) cells, demonstrating that RNAi is an effective tool for regulating specific gene activity in these human stem cells. The knockdown of Oct4 but not beta2-microglobulin expression in both EC and ES cells resulted in their differentiation, as indicated by a marked change in morphology, growth rate, and surface antigen phenotype, with respect to SSEA1, SSEA3, and TRA-1-60 expression. Expression of hCG and Gcm1 was also induced following knockdown of Oct4 expression, in both 2102Ep hEC cells and in H7 and H14 hES cells, consistent with the conclusion that, as in the mouse, Oct4 is required to maintain the undifferentiated stem cell state, and that differentiation to trophectoderm occurs in its absence. NTERA2 hEC cells also differentiated, but not to trophectoderm, suggesting their equivalence to a later stage of embryogenesis than other hEC and hES cells.
NASA Astrophysics Data System (ADS)
Braun, Dieter; Möller, Friederike M.; Krammer, Hubert
2013-03-01
Central to the understanding of living systems is the interplay between DNA/RNA and proteins. Known as Eigen paradox, proteins require genetic information while proteins are needed for the replication of genes. RNA world scenarios focus on a base by base replication disconnected from translation. Here we used strategies from DNA machines to demonstrate a tight connection between a basic replication mechanism and translation. A pool of hairpin molecules replicate a two-letter code. The replication is thermally driven: the energy and negative entropy to drive replication is initially stored in metastable hairpins by kinetic cooling. Both are released by a highly specific and exponential replication reaction that is solely implemented by base hybridization. The duplication time is 30s. The reaction is monitored by fluorescence and described by a detailed kinetic model. The RNA hairpins usetransfer RNA sequences and the replication is driven by the simple disequilibrium setting of a thermal gradient The experiments propose a physical rather than a chemical scenario for the autonomous replication of protein encoding information. Supported by the NanoSystems Initiative Munich and ERC.
Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin
2016-07-08
Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.
Das, Kalyan; Acton, Thomas; Chiang, Yiwen; Shih, Lydia; Arnold, Eddy; Montelione, Gaetano T.
2004-01-01
The RlmA class of enzymes (RlmAI and RlmAII) catalyzes N1-methylation of a guanine base (G745 in Gram-negative and G748 in Gram-positive bacteria) of hairpin 35 of 23S rRNA. We have determined the crystal structure of Escherichia coli RlmAI at 2.8-Å resolution, providing 3D structure information for the RlmA class of RNA methyltransferases. The dimeric protein structure exhibits features that provide new insights into its molecular function. Each RlmAI molecule has a Zn-binding domain, responsible for specific recognition and binding of its rRNA substrate, and a methyltransferase domain. The asymmetric RlmAI dimer observed in the crystal structure has a well defined W-shaped RNA-binding cleft. Two S-adenosyl-l-methionine substrate molecules are located at the two valleys of the W-shaped RNA-binding cleft. The unique shape of the RNA-binding cleft, different from that of known RNA-binding proteins, is highly specific and structurally complements the 3D structure of hairpin 35 of bacterial 23S rRNA. Apart from the hairpin 35, parts of hairpins 33 and 34 also interact with the RlmAI dimer. PMID:14999102
Incorporation of a cationic aminopropyl chain in DNA hairpins: thermodynamics and hydration
Soto, Ana Maria; Kankia, Besik I.; Dande, Prasad; Gold, Barry; Marky, Luis A.
2001-01-01
We report on the physicochemical effects resulting from incorporating a 5-(3-aminopropyl) side chain onto a 2′-deoxyuridine (dU) residue in a short DNA hairpin. A combination of spectroscopy, calorimetry, density and ultrasound techniques were used to investigate both the helix–coil transition of a set of hairpins with the following sequence: d(GCGACTTTTTGNCGC) [N = dU, deoxythymidine (dT) or 5-(3-aminopropyl)-2′-deoxyuridine (dU*)], and the interaction of each hairpin with Mg2+. All three molecules undergo two-state transitions with melting temperatures (TM) independent of strand concentration that indicates their intramolecular hairpin formation. The unfolding of each hairpin takes place with similar TM values of 64–66°C and similar thermodynamic profiles. The unfavorable unfolding free energies of 6.4–6.9 kcal/mol result from the typical compensation of unfavorable enthalpies, 36–39 kcal/mol, and favorable entropies of ∼110 cal/mol. Furthermore, the stability of each hairpin increases as the salt concentration increases, the TM-dependence on salt yielded slopes of 2.3–2.9°C, which correspond to counterion releases of 0.53 (dU and dT) and 0.44 (dU*) moles of Na+ per mole of hairpin. Absolute volumetric and compressibility measurements reveal that all three hairpins have similar hydration levels. The electrostatic interaction of Mg2+ with each hairpin yielded binding affinities in the order: dU > dT > dU*, and a similar release of 2–4 electrostricted water molecules. The main result is that the incorporation of the cationic 3-aminopropyl side chain in the major groove of the hairpin stem neutralizes some local negative charges yielding a hairpin molecule with lower charge density. PMID:11522834
Polyamidoamine Dendrimer Conjugates with Cyclodextrins as Novel Carriers for DNA, shRNA and siRNA
Arima, Hidetoshi; Motoyama, Keiichi; Higashi, Taishi
2012-01-01
Gene, short hairpin RNA (shRNA) and small interfering RNA (siRNA) delivery can be particularly used for the treatment of diseases by the entry of genetic materials mammalian cells either to express new proteins or to suppress the expression of proteins, respectively. Polyamidoamine (PAMAM) StarburstTM dendrimers are used as non-viral vectors (carriers) for gene, shRNA and siRNA delivery. Recently, multifunctional PAMAM dendrimers can be used for the wide range of biomedical applications including intracellular delivery of genes and nucleic acid drugs. In this context, this review paper provides the recent findings on PAMAM dendrimer conjugates with cyclodextrins (CyDs) for gene, shRNA and siRNA delivery. PMID:24300184
Zhong, Di; Zhao, Siren; He, Guangxu; Li, Jinku; Lang, Yanbin; Ye, Wei; Li, Yongli; Jiang, Chuanlu; Li, Xianfeng
2015-06-01
Leucine-rich α2 glycoprotein 1 (LRG1) has been shown to be aberrantly expressed in multiple human malignancies. However, the biological functions of LRG1 in human glioblastoma remain unknown. Here, we report for the first time the role of LRG1 in glioblastoma development based on the preliminary in vitro and in vivo data. We first confirmed the expression of LRG1 in human glioblastoma cell lines. Next, to investigate the role of LRG1 in the tumorigenesis and development of glioblastoma, a short hairpin RNA (shRNA) construct targeting LRG1 mRNA was transfected into U251 glioblastoma cells to generate a cell line with stably silenced LRG1 expression. The results showed that silencing of LRG1 significantly inhibited cell proliferation, induced cell cycle arrest at G0/G1 phase, and enhanced apoptosis in U251 cells in vitro. Consistently, LRG1 silencing resulted in the downregulation of key cell cycle factors including cyclin D1, B, and E and apoptotic gene Bcl-2 while elevated the levels of pro-apoptotic Bax and cleaved caspase-3, as determined by Western blot analysis. We further demonstrate that the silencing of LRG1 expression effectively reduced the tumorigenicity of U251 cells, delayed tumor formation, and promoted apoptosis in a xenograft tumor model in vivo. In conclusion, silencing the expression of LRG1 suppresses the growth of glioblastoma U251 cells in vitro and in vivo, suggesting that LRG1 may play a critical role in glioblastoma development, and it may have potential clinical implications in glioblastoma therapy.
Yang, R; Castriota, G; Chen, Y; Cleary, M A; Ellsworth, K; Shin, M K; Tran, J-Lv; Vogt, T F; Wu, M; Xu, S; Yang, X; Zhang, B B; Berger, J P; Qureshi, S A
2011-02-01
To investigate the impact of reduced adipocyte fatty acid-binding protein 4 (FABP4) in control of body weight, glucose and lipid homeostasis in diet-induced obese (DIO) mice. We applied RNA interference (RNAi) technology to generate FABP4 germline knockdown mice to investigate their metabolic phenotype. RNAi-mediated knockdown reduced FABP4 mRNA expression and protein levels by almost 90% in adipocytes of standard chow-fed mice. In adipocytes of DIO mice, RNAi reduced FABP4 expression and protein levels by 70 and 80%, respectively. There was no increase in adipocyte FABP5 expression in FABP4 knockdown mice. The knockdown of FABP4 significantly increased body weight and fat mass in DIO mice. However, FABP4 knockdown did not affect plasma glucose and lipid homeostasis in DIO mice; nor did it improve their insulin sensitivity. Our data indicate that robust knockdown of FABP4 increases body weight and fat mass without improving glucose and lipid homeostasis in DIO mice.
Ye, Xueting; Xie, Jing; Huang, Hang; Deng, Zhexian
2018-01-01
Melanoma antigen A6 (MAGEA6) is a cancer-specific ubiquitin ligase of AMP-activated protein kinase (AMPK). The current study tested MAGEA6 expression and potential function in renal cell carcinoma (RCC). MAGEA6 and AMPK expression in human RCC tissues and RCC cells were tested by Western blotting assay and qRT-PCR assay. shRNA method was applied to knockdown MAGEA6 in human RCC cells. Cell survival and proliferation were tested by MTT assay and BrdU ELISA assay, respectively. Cell apoptosis was tested by the TUNEL assay and single strand DNA ELISA assay. The 786-O xenograft in nude mouse model was established to test RCC cell growth in vivo. MAGEA6 is specifically expressed in RCC tissues as well as in the established (786-O and A498) and primary human RCC cells. MAGEA6 expression is correlated with AMPKα1 downregulation in RCC tissues and cells. It is not detected in normal renal tissues nor in the HK-2 renal epithelial cells. MAGEA6 knockdown by targeted-shRNA induced AMPK stabilization and activation, which led to mTOR complex 1 (mTORC1) in-activation and RCC cell death/apoptosis. AMPK inhibition, by AMPKα1 shRNA or the dominant negative AMPKα1 (T172A), almost reversed MAGEA6 knockdown-induced RCC cell apoptosis. Conversely, expression of the constitutive-active AMPKα1 (T172D) mimicked the actions by MAGEA6 shRNA. In vivo, MAGEA6 shRNA-bearing 786-O tumors grew significantly slower in nude mice than the control tumors. AMPKα1 stabilization and activation as well as mTORC1 in-activation were detected in MAGEA6 shRNA tumor tissues. MAGEA6 knockdown inhibits human RCC cells via activating AMPK signaling. © 2018 The Author(s). Published by S. Karger AG, Basel.
Development of Hairpin Vortices in Turbulent Spots and End-Wall Transition
NASA Technical Reports Server (NTRS)
Smith, Charles R.
2007-01-01
The end-stage phase of boundary layer transition is characterized by the development of hairpin-like vortices which evolve rapidly into patches of turbulent behavior. In general, the characteristics of the evolution form this hairpin stage to the turbulent stage is poorly understood, which has prompted the present experimental examination of hairpin vortex development and growth processes. Two topics of particular relevance to the workshop focus will be covered: 1) the growth of turbulent spots through the generatio and amalgamation of hairpin-like vortices, and 2) the development of hairpin vortices during transition in an end-wall junction flow. Brief summaries of these studies are described below. Using controlled generation of hairpin vortices by surface injection in a critical laminar boundary layer, detailed flow visualization studies have been done of the phases of growth of single hairpin vortices, from the initial hairgin generation, through the systematic generation of secondary hairpin-like flow structures, culminating in the evolution to a turbulent spot. The key to the growth process is strong vortex-surface interactions, which give rise to strong eruptive events adjacent to the surface, which results in the generation of subsequent hairpin vortex structures due to inviscid-viscuous interactions between the eruptive events and the free steam fluid. The general process of vortex-surface fluid interaction, coupled with subsequent interactions and amalgamation of the generated multiple hairpin-type vortices, is demonstrated as a physical mechanism for the growth and development of turbulent spots. When a boundary layer flow along a surface encounters a bluff body obstruction extending from the surface (such as cylinder or wing), the strong adverse pressure gradients generated by these types of flows result in the concentration of the impinging vorticity into a system of discrete vortices near the end-wall juncture of the obstruction, with the extensions
Role of Prefrontal Cortex Glucocorticoid Receptors in Stress and Emotion
McKlveen, Jessica M.; Myers, Brent; Flak, Jonathan N.; Bundzikova, Jana; Solomon, Matia B.; Seroogy, Kim B.; Herman, James P.
2013-01-01
Background Stress-related disorders (e.g., depression) are associated with hypothalamic-pituitary-adrenocortical axis dysregulation and prefrontal cortex (PFC) dysfunction, suggesting a functional link between aberrant prefrontal corticosteroid signaling and mood regulation. Methods We used a virally mediated knockdown strategy (short hairpin RNA targeting the glucocorticoid receptor [GR]) to attenuate PFC GR signaling in the rat PFC. Adult male rats received bilateral microinjections of vector control or short hairpin RNA targeting the GR into the prelimbic (n = 44) or infralimbic (n = 52) cortices. Half of the animals from each injection group underwent chronic variable stress, and all were subjected to novel restraint. The first 2 days of chronic variable stress were used to assess depression- and anxiety-like behavior in the forced swim test and open field. Results The GR knockdown confined to the infralimbic PFC caused acute stress hyper-responsiveness, sensitization of stress responses after chronic variable stress, and induced depression-like behavior (increased immobility in the forced swim test). Knockdown of GR in the neighboring prelimbic PFC increased hypothalamic-pituitary-adrenocortical axis responses to acute stress and caused hyper-locomotion in the open field, but did not affect stress sensitization or helplessness behavior. Conclusions The data indicate a marked functional heterogeneity of glucocorticoid action in the PFC and highlight a prominent role for the infralimbic GR in appropriate stress adaptation, emotional control, and mood regulation. PMID:23683655
Lifespan and reproduction in brain-specific miR-29-knockdown mouse.
Takeda, Toru; Tanabe, Hiroyuki
2016-03-18
The microRNA miR-29 is widely distributed and highly expressed in adult mouse brain during the mouse's lifetime. We recently created conditional mutant mice whose miR-29 was brain-specifically knocked down through overexpression of an antisense RNA transgene against miR-29. To explore a role for brain miR-29 in maximizing organismal fitness, we assessed somatic growth, reproduction, and lifespan in the miR-29-knockdown (KD) mice and their wild-type (WT) littermates. The KD mice were developmentally indistinguishable from WT mice with respect to gross morphology and physical activity. Fertility testing revealed that KD males were subfertile, whereas KD females were hyperfertile, only in terms of reproductive success, when compared to their gender-matched WT correspondents. Another phenotypic difference between KD and WT animals appeared in their lifespan data; KD males displayed an overall increasing tendency in post-reproductive survival relative to WT males. In contrast, KD females were prone to shorter lifespans than WT females. These results clarify that brain-targeted miR-29 knockdown affects both lifespan and reproduction in a gender-dependent manner, and moreover that the reciprocal responsiveness to the miR-29 knockdown between these two phenotypes in both genders closely follow life-course models based on the classical trade-off prediction wherein elaborate early-life energetic investment in reproduction entails accelerated late-life declines in survival, and vice versa. Thus, this study identified miR-29 as the first mammalian miRNA that is directly implicated in the lifetime trade-off between the two major fitness components, lifespan and reproduction. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Non-specific binding of Na+ and Mg2+ to RNA determined by force spectroscopy methods
Bizarro, C. V.; Alemany, A.; Ritort, F.
2012-01-01
RNA duplex stability depends strongly on ionic conditions, and inside cells RNAs are exposed to both monovalent and multivalent ions. Despite recent advances, we do not have general methods to quantitatively account for the effects of monovalent and multivalent ions on RNA stability, and the thermodynamic parameters for secondary structure prediction have only been derived at 1M [Na+]. Here, by mechanically unfolding and folding a 20 bp RNA hairpin using optical tweezers, we study the RNA thermodynamics and kinetics at different monovalent and mixed monovalent/Mg2+ salt conditions. We measure the unfolding and folding rupture forces and apply Kramers theory to extract accurate information about the hairpin free energy landscape under tension at a wide range of ionic conditions. We obtain non-specific corrections for the free energy of formation of the RNA hairpin and measure how the distance of the transition state to the folded state changes with force and ionic strength. We experimentally validate the Tightly Bound Ion model and obtain values for the persistence length of ssRNA. Finally, we test the approximate rule by which the non-specific binding affinity of divalent cations at a given concentration is equivalent to that of monovalent cations taken at 100-fold concentration for small molecular constructs. PMID:22492710
PTEN knockdown alters dendritic spine/protrusion morphology, not density
Haws, Michael E.; Jaramillo, Thomas C.; Espinosa-Becerra, Felipe; Widman, Allie; Stuber, Garret D.; Sparta, Dennis R.; Tye, Kay M.; Russo, Scott J.; Parada, Luis F.; Kaplitt, Michael; Bonci, Antonello; Powell, Craig M.
2014-01-01
Mutations in phosphatase and tensin homolog deleted on chromosome ten (PTEN) are implicated in neuropsychiatric disorders including autism. Previous studies report that PTEN knockdown in neurons in vivo leads to increased spine density and synaptic activity. To better characterize synaptic changes in neurons lacking PTEN, we examined the effects of shRNA knockdown of PTEN in basolateral amygdala neurons on synaptic spine density and morphology using fluorescent dye confocal imaging. Contrary to previous studies in dentate gyrus, we find that knockdown of PTEN in basolateral amygdala leads to a significant decrease in total spine density in distal dendrites. Curiously, this decreased spine density is associated with increased miniature excitatory post-synaptic current frequency and amplitude, suggesting an increase in number and function of mature spines. These seemingly contradictory findings were reconciled by spine morphology analysis demonstrating increased mushroom spine density and size with correspondingly decreased thin protrusion density at more distal segments. The same analysis of PTEN conditional deletion in dentate gyrus demonstrated that loss of PTEN does not significantly alter total density of dendritic protrusions in the dentate gyrus, but does decrease thin protrusion density and increases density of more mature mushroom spines. These findings suggest that, contrary to previous reports, PTEN knockdown may not induce de novo spinogenesis, but instead may increase synaptic activity by inducing morphological and functional maturation of spines. Furthermore, behavioral analysis of basolateral amygdala PTEN knockdown suggests that these changes limited only to the basolateral amygdala complex may not be sufficient to induce increased anxiety-related behaviors. PMID:24264880
Zou, Man; Li, Yanhui; Xia, Shu; Chu, Qian; Xiao, Xiaoguang; Qiu, Hong; Chen, Yu; Zheng, Zu'an; Liu, Fei; Zhuang, Liang; Yu, Shiying
2017-01-01
Triple-negative breast cancer (TNBC) is a high-risk breast cancer phenotype without specific targeted therapy options and is significantly associated with increased local recurrence in patients treated with radiotherapy. CAVEOLIN-1 (CAV-1)-mediated epidermal growth factor receptor (EGFR) nuclear translocation following irradiation promotes DNA repair and thus induces radiation resistance. In this study, we aimed to determine whether knockdown of CAV-1 enhances the radiosensitivity of basal-like TNBC cell lines and to explore the possible mechanisms. Western blotting was used to compare protein expression in a panel of breast cancer cell lines. Nuclear accumulation of EGFR as well as DNA repair and damage at multiple time points following irradiation with or without CAV-1 siRNA pretreatment were investigated using western blotting and confocal microscopy. The radiosensitizing effect of CAV-1 siRNA was evaluated using a clonogenic assay. Flowcytometry was performed to analyse cell apoptosis and cell cycle alteration. We found that CAV-1 is over-expressed in basal-like TNBC cell lines and barely expressed in HER-2-positive cells; additionally, we observed that HER-2-positive cell lines are more sensitive to irradiation than basal-like TNBC cells. Our findings revealed that radiation-induced EGFR nuclear translocation was impaired by knockdown of CAV-1. In parallel, radiation-induced elevation of DNA repair proteins was also hampered by pretreatment with CAV-1 siRNA before irradiation. Silencing of CAV-1 also promoted DNA damage 24 h after irradiation. Colony formation assays verified that cells could be radiosensitized after knockdown of CAV-1. Furthermore, G2/M cell cycle arrest and apoptosis enhancement may also contribute to the radiosensitizing effect of CAV-1 siRNA. Our results support the hypothesis that CAV-1 knockdown by siRNA causes increased radiosensitivity in basal-like TNBC cells. The mechanisms associated with this effect are reduced DNA repair through
Lee, Sooncheol; Kang, Changwon
2011-05-06
The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.
p62/SQSTM1 enhances breast cancer stem-like properties by stabilizing MYC mRNA
Xu, L-Z; Li, S-S; Zhou, W; Kang, Z-J; Zhang, Q-X; Kamran, M; Xu, J; Liang, D-P; Wang, C-L; Hou, Z-J; Wan, X-B; Wang, H-J; Lam, E W-F; Zhao, Z-W; Liu, Q
2017-01-01
Aberrant p62 overexpression has been implicated in breast cancer development. Here, we found that p62 expression was elevated in breast cancer stem cells (BCSCs), including CD44+CD24− fractions, mammospheres, ALDH1+ populations and side population cells. Indeed, short-hairpin RNA (shRNA)-mediated knockdown of p62 impaired breast cancer cells from self-renewing under anchorage-independent conditions, whereas ectopic overexpression of p62 enhanced the self-renewal ability of breast cancer cells in vitro. Genetic depletion of p62 robustly inhibited tumor-initiating frequencies, as well as growth rates of BCSC-derived tumor xenografts in immunodeficient mice. Consistently, immunohistochemical analysis of clinical breast tumor tissues showed that high p62 expression levels were linked to poorer clinical outcome. Further gene expression profiling analysis revealed that p62 was positively correlated with MYC expression level, which mediated the function of p62 in promoting breast cancer stem-like properties. MYC mRNA level was reduced upon p62 deletion by siRNA and increased with p62 overexpression in breast cancer cells, suggesting that p62 positively regulated MYC mRNA. Interestingly, p62 did not transactivate MYC promoter. Instead, p62 delayed the degradation of MYC mRNA by repressing the expression of let-7a and let-7b, thus promoting MYC mRNA stabilization at the post-transcriptional level. Consistently, let-7a and let-7b mimics attenuated p62-mediated MYC mRNA stabilization. Together, these findings unveiled a previously unappreciated role of p62 in the regulation of BCSCs, assigning p62 as a promising therapeutic target for breast cancer treatments. PMID:27345399
Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA
Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.
2012-01-01
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory β-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory β-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus. PMID:22496223
Scavenger receptor mediates systemic RNA interference in ticks.
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Galay, Remil Linggatong; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks.
Scavenger Receptor Mediates Systemic RNA Interference in Ticks
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Linggatong Galay, Remil; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks. PMID:22145043
Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming.
Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben
2015-07-14
The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1-3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN).
Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming
Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben
2015-01-01
The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1–3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN). PMID:26172504
[Knockdown of PRDX6 in microglia reduces neuron viability after OGD/R injury].
Tan, Li; Zhao, Yong; Jiang, Beibei; Yang, Bo; Zhang, Hui
2016-08-01
Objective To observe the effects of peroxiredoxin 6 (PRDX6) knockdown in the microglia on neuron viability after oxygen-glucose deprivation and reoxygenation (OGD/R). Methods Microglia was treated with lentivirus PRDX6-siRNA and Ca(2+)-independent phospholipase A2 (iPLA2) inhibitor, 1-hexadecyl-3-(trifluoroethgl)-sn-glycerol-2 phosphomethanol (MJ33). Twenty-four hours later, it was co-cultured with primary neuron to establish the microglia-neuron co-culture OGD/R model. According to the different treatment of microglia, the cells were divided into normal group, OGD/R group, negative control-siRNA treated OGD/R group, PRDX6-siRNA treated OGD/R group and PRDX6-siRNA combined with MJ33 treated OGD/R group. Western blot analysis and real-time quantitative PCR were respectively performed to detect PRDX6 protein and mRNA levels after knockdown of PRDX6 in microglia. The iPLA2 activity was measured by ELISA. MTS and lactate dehydrogenase (LDH) assay were used to measure neuron viability and cell damage. The oxidative stress level of neuron was determined by measuring superoxide dismutase (SOD) and malonaldehyde (MDA) content. Results In PRDX6-siRNA group, neuron viability was inhibited and oxidative stress damage was aggravated compared with OGD/R group. In PRDX6-siRNA combined with MJ33 group, cell viability was promoted and oxidative stress damage was alleviated compared with PRDX6-siRNA group. Conclusion PRDX6 in microglia protects neuron against OGD/R-induced injury, and iPLA2 activity has an effect on PRDX6.
Zhang, Rui; Xu, Jian; Zhao, Jian; Bai, Jinghui
2017-07-11
MicroRNAs have been proved to participate in multiple biological processes in cancers. For developing resistance to cytotoxic drug, cancer cells, especially the cancer stem cells, usually change their microRNA expression profile to survive in hostile environments. In the present study, we found that expression of microRNA-27a was increased in colorectal cancer stem cells. High level of microRNA-27a was indicated to induce the resistance to TNF-related apoptosis-inducing ligand (TRAIL). Knockdown of microRNA-27a resensitized colorectal cancer stem cells to TRAIL-induced cell death. Mechanically, the gene of Apaf-1, which is associated with the mitochondrial apoptosis, was demonstrated to be the target of microRNA-27a in colorectal cancer stem cells. Knockdown of microRNA-27a increased the expression level of Apaf-1, thus enhancing the formation of Apaf-1-caspase-9 complex and subsequently promoting the TRAIL-induced apoptosis in colorectal cancer stem cells. These findings suggested that knockdown of microRNA-27a in colorectal cancer stem cells by the specific antioligonucleotides was potential to reverse the chemoresistance to TRAIL. It may represent a novel therapeutic strategy for treating the colorectal cancer more effectively.
Kovacheva, Marineta; Zepp, Michael; Berger, Stefan M; Berger, Martin R
2014-07-30
Increased bone sialoprotein (BSP) serum levels are related to breast cancer skeletal metastasis, but their relevance is unknown. We elucidated novel intracellular BSP functions by a conditional knockdown of BSP. Conditional MDA-MB-231 subclones were equipped with a novel gene expression cassette containing a tet-reg-ulated miRNA providing knockdown of BSP production. These clones were used to assess the effect of BSP on morphology, proliferation, migration, colony formation and gene expression in vitro, and on soft tissue and osteolytic le-sions in a xenograft model by three imaging methods. BSP knockdown caused significant anti-proliferative, anti-migratory and anti-clonogenic effects in vitro (p<0.001). In vivo, significant de-creases of soft tissue and osteolytic lesions (p<0.03) were recorded after 3 weeks of miRNA treatment, leading to complete remission within 6 weeks. Microarray data revealed that 0.3% of genes were modulated in response to BSP knockdown. Upregulated genes included the endoplasmic reticulum stress genes ATF3 and DDIT3, the tumor suppressor gene EGR1, ID2 (related to breast epithelial differentiation), c-FOS and SERPINB2, whereas the metastasis associated genes CD44 and IL11 were downregulated. Also, activation of apoptotic pathways was demonstrated. These results implicate that intracellular BSP is essential for breast cancer skeletal metastasis and a target for treating these lesions.
Kovacheva, Marineta; Zepp, Michael; Berger, Stefan M.; Berger, Martin R.
2014-01-01
Increased bone sialoprotein (BSP) serum levels are related to breast cancer skeletal metastasis, but their relevance is unknown. We elucidated novel intracellular BSP functions by a conditional knockdown of BSP. Conditional MDA-MB-231 subclones were equipped with a novel gene expression cassette containing a tet-regulated miRNA providing knockdown of BSP production. These clones were used to assess the effect of BSP on morphology, proliferation, migration, colony formation and gene expression in vitro, and on soft tissue and osteolytic lesions in a xenograft model by three imaging methods. BSP knockdown caused significant anti-proliferative, anti-migratory and anti-clonogenic effects in vitro (p<0.001). In vivo, significant decreases of soft tissue and osteolytic lesions (p<0.03) were recorded after 3 weeks of miRNA treatment, leading to complete remission within 6 weeks. Microarray data revealed that 0.3% of genes were modulated in response to BSP knockdown. Upregulated genes included the endoplasmic reticulum stress genes ATF3 and DDIT3, the tumor suppressor gene EGR1, ID2 (related to breast epithelial differentiation), c-FOS and SERPINB2, whereas the metastasis associated genes CD44 and IL11 were downregulated. Also, activation of apoptotic pathways was demonstrated. These results implicate that intracellular BSP is essential for breast cancer skeletal metastasis and a target for treating these lesions. PMID:24980816
Identification and tracking of hairpin vortex auto-generation in turbulent wall-bounded flow
NASA Astrophysics Data System (ADS)
Huang, Yangzi; Green, Melissa
2016-11-01
Hairpin vortices have been widely accepted as component structures of turbulent boundary layers. Their properties (size, vorticity, energy) and dynamic phenomena (origin, growth, breakdown) have been shown to correlate to the complex, multi-scaled turbulent motions observed in both experiments and simulations. As established in the literature, the passage of a hairpin vortex creates a wall-normal ejection of fluid, which encounters the high-speed freestream resulting in near-wall shear and increased drag. A previously generated simulation of an isolated hairpin vortex is used to study the auto-generation of a secondary vortex structure. Eulerian methods such as the Q criterion and Γ2 function, as well as Lagrangian methods are used to visualize the three-dimensional hairpin vortices and the auto-generation process. The circulation development and wall-normal location of both primary and secondary hairpin heads are studied to determine if there is a correlation between the strength and height of the primary hairpin vortex with the secondary hairpin vortex auto-generation.
Chu, Yu-De; Chen, Hsin-Kai; Huang, Tao; Chan, Shih-Peng
2016-01-15
Primary microRNAs (pri-miRNAs) are cleaved by the nuclear RNase III Drosha to produce hairpin-shaped precursor miRNAs (pre-miRNAs). In humans, this process is known to be facilitated by the DEAD-box helicases p68 (DDX5) and p72 (DDX17). In this study, we performed a candidate-based RNAi screen in C. elegans to identify DEAD/H-box proteins involved in miRNA biogenesis. In a let-7(mg279) sensitized genetic background, knockdown of a homolog of yeast splicing factor Prp28p, DDX-23, or a homolog of human helicases p68 and p72, DDX-17, enhanced let-7 loss-of-function phenotypes, suggesting that these helicases play a role in let-7 processing and/or function. In both ddx-23(RNAi) and ddx-17(RNAi), levels of mature let-7 were decreased while pri-let-7 was found to accumulate, indicating that the helicases likely act at the level of pri-let-7 processing. DDX-23 and DDX-17 were also required for the biogenesis of other known heterochronic miRNAs, including lin-4 and the let-7 family members miR-48, miR-84 and miR-241. Their function was not confined to the heterochronic pathway, however, since they were both necessary for down-regulation of cog-1 by the spatial patterning miRNA, lsy-6. Here, we present a novel function for C. elegans DDX-23 in pri-miRNA processing, and also suggest a conserved role for DDX-17 in this process. Copyright © 2015 Elsevier Inc. All rights reserved.
β-hairpin-mediated nucleation of polyglutamine amyloid formation
Kar, Karunakar; Hoop, Cody L.; Drombosky, Kenneth W.; Baker, Matthew A.; Kodali, Ravindra; Arduini, Irene; van der Wel, Patrick C. A.; Horne, W. Seth; Wetzel, Ronald
2013-01-01
The conformational preferences of polyglutamine (polyQ) sequences are of major interest because of their central importance in the expanded CAG repeat diseases that include Huntington’s disease (HD). Here we explore the response of various biophysical parameters to the introduction of β-hairpin motifs within polyQ sequences. These motifs (trpzip, disulfide, D-Pro-Gly, Coulombic attraction, L-Pro-Gly) enhance formation rates and stabilities of amyloid fibrils with degrees of effectiveness well-correlated with their known abilities to enhance β-hairpin formation in other peptides. These changes led to decreases in the critical nucleus for amyloid formation from a value of n* = 4 for a simple, unbroken Q23 sequence to approximate unitary n* values for similar length polyQs containing β-hairpin motifs. At the same time, the morphologies, secondary structures, and bioactivities of the resulting fibrils were essentially unchanged from simple polyQ aggregates. In particular, the signature pattern of SSNMR 13C Gln resonances that appears to be unique to polyQ amyloid is replicated exactly in fibrils from a β-hairpin polyQ. Importantly, while β-hairpin motifs do produce enhancements in the equilibrium constant for nucleation in aggregation reactions, these Kn* values remain quite low (~ 10−10) and there is no evidence for significant embellishment of β-structure within the monomer ensemble. The results indicate an important role for β-turns in the nucleation mechanism and structure of polyQ amyloid and have implications for the nature of the toxic species in expanded CAG repeat diseases. PMID:23353826
NASA Astrophysics Data System (ADS)
Bi, Sai; Chen, Min; Jia, Xiaoqiang; Dong, Ying
2015-02-01
Herein, a cascaded chemiluminescence resonance energy transfer (C-CRET) process was demonstrated from horseradish peroxidase (HRP)-mimicking DNAzyme-catalyzed luminol-H2O2 to fluorescein and further to graphene oxide (GO) when HRP-mimicking DNAzyme/fluorescein was in close proximity to the GO surface. The proposed C-CRET system was successfully implemented to construct three modes of C-CRET hot-spot-active substrates (modes I, II and III) by covalently immobilizing HRP-mimicking DNAzyme/fluorescein-labeled hairpin DNAs (hot-spot-generation probes) on magnetic GO (MGO), resulting in a signal ``off'' state due to the quenching of the luminol/H2O2/HRP-mimicking DNAzyme/fluorescein CRET system by GO. Upon the introduction of microRNA-122 (miRNA-122), the targets (mode I) or the new triggers that were generated through a strand displacement reaction (SDR) initiated by miRNA-122 (modes II and III) hybridized with the loop domains of hairpin probes on MGO to form double-stranded (modes I and II) or triplex-stem structures (mode III), causing an ``open'' configuration of the hairpin probe and a CRET signal ``on'' state, thus achieving sensitive and selective detection of miRNA-122. More importantly, the substrate exhibited excellent controllability, reversibility and reproducibility through SDR and magnetic separation (modes II and III), especially sequence-independence for hairpin probes in mode III, holding great potential for the development of a versatile platform for optical biosensing.Herein, a cascaded chemiluminescence resonance energy transfer (C-CRET) process was demonstrated from horseradish peroxidase (HRP)-mimicking DNAzyme-catalyzed luminol-H2O2 to fluorescein and further to graphene oxide (GO) when HRP-mimicking DNAzyme/fluorescein was in close proximity to the GO surface. The proposed C-CRET system was successfully implemented to construct three modes of C-CRET hot-spot-active substrates (modes I, II and III) by covalently immobilizing HRP-mimicking DNAzyme
Scarborough, Robert J; Adams, Kelsey L; Daher, Aïcha; Gatignol, Anne
2015-09-01
We have previously identified a target site in HIV-1 RNA that was particularly accessible to a ribozyme and a short hairpin RNA (shRNA). To design small interfering RNAs (siRNAs) targeting this site, we evaluated the effects of siRNAs with different lengths on HIV-1 production. The potency and efficacy of these siRNAs were dependent on the length of their intended sense strand with trends for symmetrical and asymmetrical formats that were similar. Although a typical canonical format with a 21-nucleotide (nt) sense strand was effective at inhibiting HIV-1 production, Dicer substrate siRNAs (dsiRNAs) with the longest lengths (27 to 29 nucleotides) were the most effective. Induction of double-stranded RNA immune responses and effects on cell viability were not detected in cells transfected with different siRNAs, suggesting that the differences observed were not related to indirect effects on HIV-1 production. For the corresponding shRNA designs, a different trend in potency and efficacy against HIV-1 production was observed, with the most effective shRNAs having stem lengths from 20 to 27 bp. Our results highlight the importance of evaluating different designs to identify the best siRNA and shRNA formats for any particular target site and provide a set of highly effective molecules for further development as drug and gene therapies for HIV-1 infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Camargo, Carolina; Wu, Ke; Fishilevich, Elane; Narva, Kenneth E; Siegfried, Blair D
2018-06-01
The use of transgenic crops that induce silencing of essential genes using double-stranded RNA (dsRNA) through RNA interference (RNAi) in western corn rootworm, Diabrotica virgifera virgifera, is likely to be an important component of new technologies for the control of this important corn pest. Previous studies have demonstrated that the dsRNA response in D. v. virgifera depends on the presence of RNAi pathway genes including Dicer-2 and Argonaute 2, and that downregulation of these genes limits the lethality of environmental dsRNA. A potential resistance mechanism to lethal dsRNA may involve loss of function of RNAi pathway genes. Howver, the potential for resistance to evolve may depend on whether these pathway genes have essential functions such that the loss of function of core proteins in the RNAi pathway will have fitness costs in D. v. virgifera. Fitness costs associated with potential resistance mechanisms have a central role in determining how resistance can evolve to RNAi technologies in western corn rootworm. We evaluated the effect of dsRNA and microRNA pathway gene knockdown on the development of D. v. virgifera larvae through short-term and long-term exposures to dsRNA for Dicer and Argonaute genes. Downregulation of Argonaute 2, Dicer-2, Dicer-1 did not significantly affect larval survivorship or development through short and long-term exposure to dsRNA. However, downregulation of Argonaute 1 reduced larval survivorship and delayed development. The implications of these results as they relate to D. v. virgifera resistance to lethal dsRNA are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seo, Sung-Keum; Kim, Jae-Hee; Choi, Ha-Na
Highlights: • Knockdown of TWIST1 enhanced ATO- and IR-induced cell death in NSCLCs. • Intracellular ROS levels were increased in cells treated with TWIST1 siRNA. • TWIST1 siRNA induced MMP loss and mitochondrial fragmentation. • TWIST1 siRNA upregulated the fission-related proteins FIS1 and DRP1. - Abstract: TWIST1 is implicated in the process of epithelial mesenchymal transition, metastasis, stemness, and drug resistance in cancer cells, and therefore is a potential target for cancer therapy. In the present study, we found that knockdown of TWIST1 by small interfering RNA (siRNA) enhanced arsenic trioxide (ATO)- and ionizing radiation (IR)-induced cell death in non-small-cellmore » lung cancer cells. Interestingly, intracellular reactive oxygen species levels were increased in cells treated with TWIST1 siRNA and further increased by co-treatment with ATO or IR. Pretreatment of lung cancer cells with the antioxidant N-acetyl-cysteine markedly suppressed the cell death induced by combined treatment with TWIST1 siRNA and ATO or IR. Moreover, treatment of cells with TWIST1 siRNA induced mitochondrial membrane depolarization and significantly increased mitochondrial fragmentation (fission) and upregulated the fission-related proteins FIS1 and DRP1. Collectively, our results demonstrate that siRNA-mediated TWIST1 knockdown induces mitochondrial dysfunction and enhances IR- and ATO-induced cell death in lung cancer cells.« less
Chen, Weiqin; Yechoor, Vijay K; Chang, Benny Hung-Junn; Li, Ming V; March, Keith L; Chan, Lawrence
2009-10-01
Mutations in the Berardinelli-Seip congenital lipodystrophy 2 gene (BSCL2) are the underlying defect in patients with congenital generalized lipodystrophy type 2. BSCL2 encodes a protein called seipin, whose function is largely unknown. In this study, we investigated the role of Bscl2 in the regulation of adipocyte differentiation. Bscl2 mRNA is highly up-regulated during standard hormone-induced adipogenesis in 3T3-L1 cells in vitro. However, this up-regulation does not occur during mesenchymal stem cell (C3H10T1/2 cells) commitment to the preadipocyte lineage. Knockdown of Bscl2 by short hairpin RNA in C3H10T1/2 cells has no effect on bone morphogenetic protein-4-induced preadipocyte commitment. However, knockdown in 3T3-L1 cells prevents adipogenesis induced by a standard hormone cocktail, but adipogenesis can be rescued by the addition of peroxisome proliferator-activated receptor-gamma agonist pioglitazone at an early stage of differentiation. Interestingly, pioglitazone-induced differentiation in the absence of standard hormone is not associated with up-regulated Bscl2 expression. On the other hand, short hairpin RNA-knockdown of Bscl2 largely blocks pioglitazone-induced adipose differentiation. These experiments suggest that Bscl2 may be essential for normal adipogenesis; it works upstream or at the level of peroxisome proliferator-activated receptor-gamma, enabling the latter to exert its full activity during adipogenesis. Loss of Bscl2 function thus interferes with the normal transcriptional cascade of adipogenesis during fat cell differentiation, resulting in near total loss of fat or lipodystrophy.
Yi, Hong; Peng, Rui; Zhang, Lu-Yu; Sun, Yan; Peng, Hui-Min; Liu, Han-Deng; Yu, Li-Juan; Li, Ai-Ling; Zhang, Ya-Juan; Jiang, Wen-Hao; Zhang, Zheng
2017-02-02
Diabetic nephropathy (DN) as the primary cause of end-stage kidney disease is a common complication of diabetes. Recent researches have shown the activation of nuclear factor kappa light-chain enhancer of activated B cells (NF-κB) and NACHT, LRR and PYD domain-containing protein 3 (NLRP3) inflammasome are associated with inflammation in the progression of DN, but the exact mechanism is unclear. Long noncoding RNAs (lncRNAs) have roles in the development of many diseases including DN. However, the relationship between lncRNAs and inflammation in DN remains largely unknown. Our previous study has revealed that 14 lncRNAs are abnormally expressed in DN by RNA sequencing and real-time quantitative PCR (qRT-PCR) in the renal tissues of db/db DN mice. In this study, these lncRNAs were verified their expressions by qRT-PCR in mesangial cells (MCs) cultured under high- and low-glucose conditions. Twelve lncRNAs displayed the same expressional tendencies in both renal tissues and MCs. In particular, long intergenic noncoding RNA (lincRNA)-Gm4419 was the only one associating with NF-κB among these 12 lncRNAs by bioinformatics methods. Moreover, Gm4419 knockdown could obviously inhibit the expressions of pro-inflammatory cytokines and renal fibrosis biomarkers, and reduce cell proliferation in MCs under high-glucose condition, whereas overexpression of Gm4419 could increase the inflammation, fibrosis and cell proliferation in MCs under low-glucose condition. Interestingly, our results showed that Gm4419 could activate the NF-κB pathway by directly interacting with p50, the subunit of NF-κB. In addition, we found that p50 could interact with NLRP3 inflammasome in MCs. In conclusion, our findings suggest lincRNA-Gm4419 may participate in the inflammation, fibrosis and proliferation in MCs under high-glucose condition through NF-κB/NLRP3 inflammasome signaling pathway, and may provide new insights into the regulation of Gm4419 during the progression of DN.
An Enzyme-Catalyzed Multistep DNA Refolding Mechanism in Hairpin Telomere Formation
Shi, Ke; Huang, Wai Mun; Aihara, Hideki
2013-01-01
Hairpin telomeres of bacterial linear chromosomes are generated by a DNA cutting–rejoining enzyme protelomerase. Protelomerase resolves a concatenated dimer of chromosomes as the last step of chromosome replication, converting a palindromic DNA sequence at the junctions between chromosomes into covalently closed hairpins. The mechanism by which protelomerase transforms a duplex DNA substrate into the hairpin telomeres remains largely unknown. We report here a series of crystal structures of the protelomerase TelA bound to DNA that represent distinct stages along the reaction pathway. The structures suggest that TelA converts a linear duplex substrate into hairpin turns via a transient strand-refolding intermediate that involves DNA-base flipping and wobble base-pairs. The extremely compact di-nucleotide hairpin structure of the product is fully stabilized by TelA prior to strand ligation, which drives the reaction to completion. The enzyme-catalyzed, multistep strand refolding is a novel mechanism in DNA rearrangement reactions. PMID:23382649
Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui
2015-10-01
The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.
Li, Ningjing; Nattie, Eugene; Li, Aihua
2014-01-01
Melanin concentrating hormone (MCH), a neuropeptide produced mainly in neurons localized to the lateral hypothalamic area (LHA), has been implicated in the regulation of food intake, energy balance, sleep state, and the cardiovascular system. Hypothalamic MCH neurons also have multisynaptic connections with diaphragmatic motoneurons and project to many central chemoreceptor sites. However, there are few studies of MCH involvement in central respiratory control. To test the hypothesis that MCH plays a role in the central chemoreflex, we induced a down regulation of MCH in the central nervous system by knocking down the MCH precursor (pMCH) mRNA in the LHA using a pool of small interfering RNA (siRNA), and measured the resultant changes in breathing, metabolic rate, body weight, and blood glucose levels in conscious rats. The injections of pMCH-siRNA into the LHA successfully produced a ∼ 62% reduction of pMCH mRNA expression in the LHA and a ∼ 43% decrease of MCH levels in the cerebrospinal fluid relative to scrambled-siRNA treatment (P = 0.006 and P = 0.02 respectively). Compared to the pretreatment baseline and the scrambled-siRNA treated control rats, knockdown of MCH resulted in: 1) an enhanced hypercapnic chemoreflex (∼ 42 & 47% respectively; P < 0.05) only in wakefulness; 2) a decrease in body weight and basal glucose levels; and 3) an unchanged metabolic rate. Our results indicate that MCH participates not only in the regulation of glucose and sleep-wake homeostasis but also the vigilance-state dependent regulation of the central hypercapnic chemoreflex and respiratory control.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Chunmao; Ding, Chao; Kong, Minjian
2011-07-08
Highlights: {yields} We compared lipofection with magnetofection about difference of transfection efficiency on delivery a therapeutic gene in vitro and in vivo. {yields} We investigated the difference of shRNA induced by magnetofection and lipofection into A549 cell and subcutaneous tumor to knockdown IGF-1R overexpressed in A549 cell and A549 tumor. {yields} We investigated in vivo shRNA silenced IGF-1R overexpression 24, 48, and 72 h after shRNA intravenous injection into tumor-bearing mice by way of magnetofection and lipofection. {yields} Our results showed that magnetofection could achieve therapeutic gene targeted delivery into special site, which contributed to targeted gene therapy of lungmore » cancers. -- Abstract: Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1 {+-} 6% and by liposomal magnetofection by 85.1 {+-} 3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the
Srikar, R.; Suresh, Dhananjay; Zambre, Ajit; Taylor, Kristen; Chapman, Sarah; Leevy, Matthew; Upendran, Anandhi; Kannan, Raghuraman
2016-01-01
A tri-block nanoparticle (TBN) comprising of an enzymatically cleavable porous gelatin nanocore encapsulated with gefitinib (tyrosine kinase inhibitor (TKI)) and surface functionalized with cetuximab-siRNA conjugate has been synthesized. Targeted delivery of siRNA to undruggable KRAS mutated non-small cell lung cancer cells would sensitize the cells to TKI drugs and offers an efficient therapy for treating cancer; however, efficient delivery of siRNA and releasing it in cytoplasm remains a major challenge. We have shown TBN can efficiently deliver siRNA to cytoplasm of KRAS mutant H23 Non-Small Cell Lung Cancer (NSCLC) cells for oncogene knockdown; subsequently, sensitizing it to TKI. In the absence of TKI, the nanoparticle showed minimal toxicity suggesting that the cells adapt a parallel GAB1 mediated survival pathway. In H23 cells, activated ERK results in phosphorylation of GAB1 on serine and threonine residues to form GAB1-p85 PI3K complex. In the absence of TKI, knocking down the oncogene dephosphorylated ERK, and negated the complex formation. This event led to tyrosine phosphorylation at Tyr627 domain of GAB1 that regulated EGFR signaling by recruiting SHP2. In the presence of TKI, GAB1-SHP2 dissociation occurs, leading to cell death. The outcome of this study provides a promising platform for treating NSCLC patients harboring KRAS mutation. PMID:27530552
Srikar, R; Suresh, Dhananjay; Zambre, Ajit; Taylor, Kristen; Chapman, Sarah; Leevy, Matthew; Upendran, Anandhi; Kannan, Raghuraman
2016-08-17
A tri-block nanoparticle (TBN) comprising of an enzymatically cleavable porous gelatin nanocore encapsulated with gefitinib (tyrosine kinase inhibitor (TKI)) and surface functionalized with cetuximab-siRNA conjugate has been synthesized. Targeted delivery of siRNA to undruggable KRAS mutated non-small cell lung cancer cells would sensitize the cells to TKI drugs and offers an efficient therapy for treating cancer; however, efficient delivery of siRNA and releasing it in cytoplasm remains a major challenge. We have shown TBN can efficiently deliver siRNA to cytoplasm of KRAS mutant H23 Non-Small Cell Lung Cancer (NSCLC) cells for oncogene knockdown; subsequently, sensitizing it to TKI. In the absence of TKI, the nanoparticle showed minimal toxicity suggesting that the cells adapt a parallel GAB1 mediated survival pathway. In H23 cells, activated ERK results in phosphorylation of GAB1 on serine and threonine residues to form GAB1-p85 PI3K complex. In the absence of TKI, knocking down the oncogene dephosphorylated ERK, and negated the complex formation. This event led to tyrosine phosphorylation at Tyr627 domain of GAB1 that regulated EGFR signaling by recruiting SHP2. In the presence of TKI, GAB1-SHP2 dissociation occurs, leading to cell death. The outcome of this study provides a promising platform for treating NSCLC patients harboring KRAS mutation.
NASA Astrophysics Data System (ADS)
Srikar, R.; Suresh, Dhananjay; Zambre, Ajit; Taylor, Kristen; Chapman, Sarah; Leevy, Matthew; Upendran, Anandhi; Kannan, Raghuraman
2016-08-01
A tri-block nanoparticle (TBN) comprising of an enzymatically cleavable porous gelatin nanocore encapsulated with gefitinib (tyrosine kinase inhibitor (TKI)) and surface functionalized with cetuximab-siRNA conjugate has been synthesized. Targeted delivery of siRNA to undruggable KRAS mutated non-small cell lung cancer cells would sensitize the cells to TKI drugs and offers an efficient therapy for treating cancer; however, efficient delivery of siRNA and releasing it in cytoplasm remains a major challenge. We have shown TBN can efficiently deliver siRNA to cytoplasm of KRAS mutant H23 Non-Small Cell Lung Cancer (NSCLC) cells for oncogene knockdown; subsequently, sensitizing it to TKI. In the absence of TKI, the nanoparticle showed minimal toxicity suggesting that the cells adapt a parallel GAB1 mediated survival pathway. In H23 cells, activated ERK results in phosphorylation of GAB1 on serine and threonine residues to form GAB1-p85 PI3K complex. In the absence of TKI, knocking down the oncogene dephosphorylated ERK, and negated the complex formation. This event led to tyrosine phosphorylation at Tyr627 domain of GAB1 that regulated EGFR signaling by recruiting SHP2. In the presence of TKI, GAB1-SHP2 dissociation occurs, leading to cell death. The outcome of this study provides a promising platform for treating NSCLC patients harboring KRAS mutation.
Jiwaji, Meesbah; Sandison, Mairi E.; Reboud, Julien; Stevenson, Ross; Daly, Rónán; Barkess, Gráinne; Faulds, Karen; Kolch, Walter; Graham, Duncan; Girolami, Mark A.; Cooper, Jonathan M.; Pitt, Andrew R.
2014-01-01
Introduction Gene therapy continues to grow as an important area of research, primarily because of its potential in the treatment of disease. One significant area where there is a need for better understanding is in improving the efficiency of oligonucleotide delivery to the cell and indeed, following delivery, the characterization of the effects on the cell. Methods In this report, we compare different transfection reagents as delivery vehicles for gold nanoparticles functionalized with DNA oligonucleotides, and quantify their relative transfection efficiencies. The inhibitory properties of small interfering RNA (siRNA), single-stranded RNA (ssRNA) and single-stranded DNA (ssDNA) sequences targeted to human metallothionein hMT-IIa are also quantified in HeLa cells. Techniques used in this study include fluorescence and confocal microscopy, qPCR and Western analysis. Findings We show that the use of transfection reagents does significantly increase nanoparticle transfection efficiencies. Furthermore, siRNA, ssRNA and ssDNA sequences all have comparable inhibitory properties to ssDNA sequences immobilized onto gold nanoparticles. We also show that functionalized gold nanoparticles can co-localize with autophagosomes and illustrate other factors that can affect data collection and interpretation when performing studies with functionalized nanoparticles. Conclusions The desired outcome for biological knockdown studies is the efficient reduction of a specific target; which we demonstrate by using ssDNA inhibitory sequences targeted to human metallothionein IIa gene transcripts that result in the knockdown of both the mRNA transcript and the target protein. PMID:24926959
MacDonald, Michael J.; Brown, Laura J.; Longacre, Melissa J.; Stoker, Scott W.; Kendrick, Mindy A.; Hasan, Noaman M.
2013-01-01
Background There are three isocitrate dehydrogenases (IDHs) in the pancreatic insulin cell; IDH1 (cytosolic) and IDH2 (mitochondrial) use NADP(H). IDH3 is mitochondrial, uses NAD(H) and was believed to be the IDH that supports the citric acid cycle. Methods With shRNAs targeting mRNAs for these enzymes we generated cell lines from INS-1 832/13 cells with severe (80%–90%) knockdown of the mitochondrial IDHs separately and together in the same cell line. Results With knockdown of both mitochondrial IDH’s mRNA, enzyme activity and protein level, but not with knockdown of one mitochondrial IDH, glucose- and BCH (an allosteric activator of glutamate dehydrogenase)-plus-glutamine-stimulated insulin release were inhibited. Cellular levels of citrate, α-ketoglutarate, malate and ATP were altered in patterns consistent with blockage at the mitochondrial IDH reactions. We were able to generate only 50% knockdown of Idh1 mRNA in multiple cell lines (without inhibition of insulin release) possibly because greater knockdown of IDH1 was not compatible with cell line survival. Conclusions The mitochondrial IDHs are redundant for insulin secretion. When both enzymes are severely knocked down, their low activities (possibly assisted by transport of IDH products and other metabolic intermediates from the cytosol into mitochondria) are sufficient for cell growth, but inadequate for insulin secretion when the requirement for intermediates is certainly more rapid. The results also indicate that IDH2 can support the citric acid cycle. General Significance As almost all mammalian cells possess substantial amounts of all three IDH enzymes, the biological principles suggested by these results are probably extrapolatable to many tissues. PMID:23876293
Modeling the mechanism of CLN025 beta-hairpin formation
NASA Astrophysics Data System (ADS)
McKiernan, Keri A.; Husic, Brooke E.; Pande, Vijay S.
2017-09-01
Beta-hairpins are substructures found in proteins that can lend insight into more complex systems. Furthermore, the folding of beta-hairpins is a valuable test case for benchmarking experimental and theoretical methods. Here, we simulate the folding of CLN025, a miniprotein with a beta-hairpin structure, at its experimental melting temperature using a range of state-of-the-art protein force fields. We construct Markov state models in order to examine the thermodynamics, kinetics, mechanism, and rate-determining step of folding. Mechanistically, we find the folding process is rate-limited by the formation of the turn region hydrogen bonds, which occurs following the downhill hydrophobic collapse of the extended denatured protein. These results are presented in the context of established and contradictory theories of the beta-hairpin folding process. Furthermore, our analysis suggests that the AMBER-FB15 force field, at this temperature, best describes the characteristics of the full experimental CLN025 conformational ensemble, while the AMBER ff99SB-ILDN and CHARMM22* force fields display a tendency to overstabilize the native state.
Internal vs Fishhook Hairpin DNA: Unzipping Locations and Mechanisms in the α-Hemolysin Nanopore
2015-01-01
Studies on the interaction of hairpin DNA with the α-hemolysin (α-HL) nanopore have determined hairpin unzipping kinetics, thermodynamics, and sequence-dependent DNA/protein interactions. Missing from these results is a systematic study comparing the unzipping process for fishhook (one-tail) vs internal (two-tail) hairpins when they are electrophoretically driven from the cis to the trans side of α-HL via a 30-mer single-stranded tail. In the current studies, fishhook hairpins showed long unzipping times with one deep blockage current level. In contrast, the internal hairpins demonstrated relatively fast unzipping and a characteristic pulse-like current pattern. These differences were further explored with respect to stem length and sequence context. Further, a series of internal hairpins with asymmetric tails were studied, for which it was determined that a second tail longer than 12 nucleotides results in internal hairpin unzipping behavior, while tail lengths of 6 nucleotides behaved like fishhook hairpins. Interestingly, these studies were able to resolve a current difference of ∼6% between hairpin DNA immobilized in the nanopore waiting to unzip vs the translocating unzipped DNA, with the latter showing a deeper current blockage level. This demonstration of different currents for immobilized and translocating DNA has not been described previously. These results were interpreted as fishhook hairpins unzipping inside the vestibule, while the internal hairpins unzip outside the vestibule of α-HL. Lastly, we used this knowledge to study the unzipping of a long double-stranded DNA (>50 base pairs) outside the vestibule of α-HL. The conclusions drawn from these studies are anticipated to be beneficial in future application of nanopore analysis of nucleic acids. PMID:25333648
Shum, David; Bhinder, Bhavneet; Djaballah, Hakim
2013-01-01
MicroRNAs (miRNAs) are small endogenous and conserved non-coding RNA molecules that regulate gene expression. Although the first miRNA was discovered well over sixteen years ago, little is known about their biogenesis and it is only recently that we have begun to understand their scope and diversity. For this purpose, we performed an RNAi screen aimed at identifying genes involved in their biogenesis pathway with a potential use as biomarkers. Using a previously developed miRNA 21 (miR-21) EGFP-based biosensor cell based assay monitoring green fluorescence enhancements, we performed an arrayed short hairpin RNA (shRNA) screen against a lentiviral particle ready TRC1 library covering 16,039 genes in 384-well plate format, and interrogating the genome one gene at a time building a panoramic view of endogenous miRNA activity. Using the BDA method for RNAi data analysis, we nominate 497 gene candidates the knockdown of which increased the EGFP fluorescence and yielding an initial hit rate of 3.09%; of which only 22, with reported validated clones, are deemed high-confidence gene candidates. An unexpected and surprising result was that only DROSHA was identified as a hit out of the seven core essential miRNA biogenesis genes; suggesting that perhaps intracellular shRNA processing into the correct duplex may be cell dependent and with differential outcome. Biological classification revealed several major control junctions among them genes involved in transport and vesicular trafficking. In summary, we report on 22 high confidence gene candidate regulators of miRNA biogenesis with potential use in drug and biomarker discovery. PMID:23977983
Zhang, Rui; Xu, Jian; Zhao, Jian; Bai, Jinghui
2017-01-01
MicroRNAs have been proved to participate in multiple biological processes in cancers. For developing resistance to cytotoxic drug, cancer cells, especially the cancer stem cells, usually change their microRNA expression profile to survive in hostile environments. In the present study, we found that expression of microRNA-27a was increased in colorectal cancer stem cells. High level of microRNA-27a was indicated to induce the resistance to TNF-related apoptosis-inducing ligand (TRAIL). Knockdown of microRNA-27a resensitized colorectal cancer stem cells to TRAIL-induced cell death. Mechanically, the gene of Apaf-1, which is associated with the mitochondrial apoptosis, was demonstrated to be the target of microRNA-27a in colorectal cancer stem cells. Knockdown of microRNA-27a increased the expression level of Apaf-1, thus enhancing the formation of Apaf-1-caspase-9 complex and subsequently promoting the TRAIL-induced apoptosis in colorectal cancer stem cells. These findings suggested that knockdown of microRNA-27a in colorectal cancer stem cells by the specific antioligonucleotides was potential to reverse the chemoresistance to TRAIL. It may represent a novel therapeutic strategy for treating the colorectal cancer more effectively. PMID:28423356
Dual knockdown of N-ras and epiregulin synergistically suppressed the growth of human hepatoma cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Meng; He, Hong-wei; Sun, Huan-xing
2009-09-18
Hepatocellular carcinoma (HCC) is a major challenge because of its resistance to conventional cytotoxic chemotherapy and radiotherapy. Multi-targeted therapy might be a new option for HCC treatment. Our previous study showed that N-ras gene was activated in HCC and was inhibited by RNA interference. In the present study, we investigated the alternation of gene expression by microarray in N-Ras-siRNA-treated HepG2 cells. The results revealed that the EREG gene, encoding epiregulin, was dramatically up-regulated in response to silence of N-ras. We speculated that the up-regulation of epiregulin was involved in the compensatory mechanism of N-ras knockdown for cell growth. Therefore, wemore » evaluated whether dual silence of N-ras and epiregulin display a greater suppression of cell growth. The results confirmed that dual knockdown of N-ras and epiregulin synergistically inhibited cell growth. Our results also showed that dual knockdown of N-ras and epiregulin significantly induced cell arrest at G0/G1 phase. Furthermore, Western blot assay showed that dual knockdown of N-ras and epiregulin markedly reduced the phosphorylations of ERK1/2, Akt and Rb, and inhibited the expression of cyclin D1. Our findings imply that multi-targeted silence of oncogenes might be an effective treatment for HCC.« less
Sivanesam, Kalkena; Shu, Irene; Huggins, Kelly N. L.; Tatarek-Nossol, Marianna; Kapurniotu, Aphrodite; Andersen, Niels H.
2016-01-01
Versions of a previously discovered β-hairpin peptide inhibitor of IAPP aggregation that are stabilized in that conformation, or even forced to remain in the hairpin conformation by a backbone cyclization constraint, display superior activity as inhibitors. The cyclized hairpin, cyclo-WW2, displays inhibitory activity at sub-stoichiometric concentrations relative to this amyloidogenic peptide. The hairpin binding hypothesis stands confirmed. PMID:27317951
Yang, Jun; Yang, Yu; Chen, Jian-Min; Wang, Gen; Xu, Hong-Tao; Liu, Wen-Yan; Lin, Bao-Cheng
2007-01-01
Our pervious study has proved that arginine vasopressin (AVP) in periaqueductal gray (PAG) plays a role in antinociception. After establishing a model of local special gene knockdown, the nociceptive effect of vasopressin receptor subunit in PAG was investigated in the rat. Microinjection of short-interfering RNA (siRNA) into PAG, which targeted vasopressin receptor subtypes (V(1a), V(1b) and V(2)), locally weakened the associated mRNA expression and depressed the related receptor synthesis in a dose-dependent manner, in which the significant inhibitive effect occurred on from 7th day to 14th day following 1microg or 2microg siRNA administration. PAG knockdown of V(2) receptor gene markedly decreased pain threshold in from 6th day to 13th day after siRNA administration, whereas local knockdown of either V(1a) or V(1b) receptor gene could not influence pain threshold. The data suggest that V(2) rather than V(1a) and V(1b) receptor in PAG involves in nociception.
[Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].
Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan
2018-02-01
Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.
Structural and sequence features of two residue turns in beta-hairpins.
Madan, Bharat; Seo, Sung Yong; Lee, Sun-Gu
2014-09-01
Beta-turns in beta-hairpins have been implicated as important sites in protein folding. In particular, two residue β-turns, the most abundant connecting elements in beta-hairpins, have been a major target for engineering protein stability and folding. In this study, we attempted to investigate and update the structural and sequence properties of two residue turns in beta-hairpins with a large data set. For this, 3977 beta-turns were extracted from 2394 nonhomologous protein chains and analyzed. First, the distribution, dihedral angles and twists of two residue turn types were determined, and compared with previous data. The trend of turn type occurrence and most structural features of the turn types were similar to previous results, but for the first time Type II turns in beta-hairpins were identified. Second, sequence motifs for the turn types were devised based on amino acid positional potentials of two-residue turns, and their distributions were examined. From this study, we could identify code-like sequence motifs for the two residue beta-turn types. Finally, structural and sequence properties of beta-strands in the beta-hairpins were analyzed, which revealed that the beta-strands showed no specific sequence and structural patterns for turn types. The analytical results in this study are expected to be a reference in the engineering or design of beta-hairpin turn structures and sequences. © 2014 Wiley Periodicals, Inc.
Sivanesam, Kalkena; Shu, Irene; Huggins, Kelly N L; Tatarek-Nossol, Marianna; Kapurniotu, Aphrodite; Andersen, Niels H
2016-08-01
Versions of a previously discovered β-hairpin peptide inhibitor of IAPP aggregation that are stabilized in that conformation, or even forced to remain in the hairpin conformation by a backbone cyclization constraint, display superior activity as inhibitors. The cyclized hairpin, cyclo-WW2, displays inhibitory activity at substoichiometric concentrations relative to this amyloidogenic peptide. The hairpin-binding hypothesis stands confirmed. © 2016 Federation of European Biochemical Societies.
Wu, Johnny C; Gardner, David P; Ozer, Stuart; Gutell, Robin R; Ren, Pengyu
2009-08-28
The accurate prediction of the secondary and tertiary structure of an RNA with different folding algorithms is dependent on several factors, including the energy functions. However, an RNA higher-order structure cannot be predicted accurately from its sequence based on a limited set of energy parameters. The inter- and intramolecular forces between this RNA and other small molecules and macromolecules, in addition to other factors in the cell such as pH, ionic strength, and temperature, influence the complex dynamics associated with transition of a single stranded RNA to its secondary and tertiary structure. Since all of the factors that affect the formation of an RNAs 3D structure cannot be determined experimentally, statistically derived potential energy has been used in the prediction of protein structure. In the current work, we evaluate the statistical free energy of various secondary structure motifs, including base-pair stacks, hairpin loops, and internal loops, using their statistical frequency obtained from the comparative analysis of more than 50,000 RNA sequences stored in the RNA Comparative Analysis Database (rCAD) at the Comparative RNA Web (CRW) Site. Statistical energy was computed from the structural statistics for several datasets. While the statistical energy for a base-pair stack correlates with experimentally derived free energy values, suggesting a Boltzmann-like distribution, variation is observed between different molecules and their location on the phylogenetic tree of life. Our statistical energy values calculated for several structural elements were utilized in the Mfold RNA-folding algorithm. The combined statistical energy values for base-pair stacks, hairpins and internal loop flanks result in a significant improvement in the accuracy of secondary structure prediction; the hairpin flanks contribute the most.
Lijkwan, Maarten A.; Hellingman, Alwine A.; Bos, Ernst J.; van der Bogt, Koen E.A.; Huang, Mei; Kooreman, Nigel G.; de Vries, Margreet R.; Peters, Hendrika A.B.; Robbins, Robert C.; Quax, Paul H.A.
2014-01-01
Abstract In this study, we target the hypoxia inducible factor-1 alpha (HIF-1-alpha) pathway by short hairpin RNA interference therapy targeting prolyl hydroxylase-2 (shPHD2). We use the minicircle (MC) vector technology as an alternative for conventional nonviral plasmid (PL) vectors in order to improve neovascularization after unilateral hindlimb ischemia in a murine model. Gene expression and transfection efficiency of MC and PL, both in vitro and in vivo, were assessed using bioluminescence imaging (BLI) and firefly luciferase (Luc) reporter gene. C57Bl6 mice underwent unilateral electrocoagulation of the femoral artery and gastrocnemic muscle injection with MC-shPHD2, PL-shPHD2, or phosphate-buffered saline (PBS) as control. Blood flow recovery was monitored using laser Doppler perfusion imaging, and collaterals were visualized by immunohistochemistry and angiography. MC-Luc showed a 4.6-fold higher in vitro BLI signal compared with PL-Luc. BLI signals in vivo were 4.3×105±3.3×105 (MC-Luc) versus 0.4×105±0.3×105 (PL-Luc) at day 28 (p=0.016). Compared with PL-shPHD2 or PBS, MC-shPHD2 significantly improved blood flow recovery, up to 50% from day 3 until day 14 after ischemia induction. MC-shPHD2 significantly increased collateral density and capillary density, as monitored by alpha-smooth muscle actin expression and CD31+ expression, respectively. Angiography data confirmed the histological findings. Significant downregulation of PHD2 mRNA levels by MC-shPHD2 was confirmed by quantitative polymerase chain reaction. Finally, Western blot analysis confirmed significantly higher levels of HIF-1-alpha protein by MC-shPHD2, compared with PL-shPHD2 and PBS. This study provides initial evidence of a new potential therapeutic approach for peripheral artery disease. The combination of HIF-1-alpha pathway targeting by shPHD2 with the robust nonviral MC plasmid improved postischemic neovascularization, making this approach a promising potential treatment option for
Anti-tumor effect of estrogen-related receptor alpha knockdown on uterine endometrial cancer
Matsushima, Hiroshi; Mori, Taisuke; Ito, Fumitake; Yamamoto, Takuro; Akiyama, Makoto; Kokabu, Tetsuya; Yoriki, Kaori; Umemura, Shiori; Akashi, Kyoko; Kitawaki, Jo
2016-01-01
Estrogen-related receptor (ERR)α presents structural similarities with estrogen receptor (ER)α. However, it is an orphan receptor not binding to naturally occurring estrogens. This study was designed to investigate the role of ERRα in endometrial cancer progression. Immunohistochemistry analysis on 50 specimens from patients with endometrial cancer showed that ERRα was expressed in all examined tissues and the elevated expression levels of ERRα were associated with advanced clinical stages and serous histological type (p < 0.01 for each). ERRα knockdown with siRNA suppressed angiogenesis via VEGF and cell proliferation in vitro (p < 0.01). Cell cycle and apoptosis assays using flow cytometry and western blot revealed that ERRα knockdown induced cell cycle arrest during the mitotic phase followed by apoptosis initiated by caspase-3. Additionally, ERRα knockdown sensitized cells to paclitaxel. A significant reduction of tumor growth and angiogenesis was also observed in ERRα knockdown xenografts (p < 0.01). These findings indicate that ERRα may serve as a novel molecular target for the treatment of endometrial cancer. PMID:27153547
Knockdown of SLC39A7 inhibits cell growth and induces apoptosis in human colorectal cancer cells.
Sheng, Nengquan; Yan, Li; You, Weiqiang; Tan, Gewen; Gong, Jianfeng; Chen, Hongqi; Yang, Yi; Hu, Landian; Wang, Zhigang
2017-10-01
SLC39A7 (zip7) is a zinc transporter that plays a key role in intestinal epithelial self-renewal. However, little is known about SLC39A7 in colorectal cancer. To assess the biological function of SLC39A7 in colorectal cancer, the expression of SLC39A7 in human colorectal tumors and five colorectal cancer cell lines were evaluated by Oncomine Cancer Microarray Database and western blot analysis. In addition, short hairpin RNAs specifically targeting SLC39A7 were transfected into HCT116 and SW1116 cells to knockdown SLC39A7 expression. Then, the effects of SLC39A7 knockdown on colorectal cancer cells were detected by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyl-tetrazolium bromide, colony-forming assay and flow cytometry. Our results showed that colorectal tumors have higher expression levels of SLC39A7 than normal colon tissues. Knockdown of SLC39A7 exhibited a significant decrease in cell viability and proliferation of colorectal cancer cells. It was also shown that knockdown of SLC39A7 interfered with cell cycle progression and induced G2/M cell cycle arrest, as well as boosted early and late apoptosis in colorectal cancer cells. Furthermore, downregulation of SLC39A7 promoted the cleavage of PARP and enhanced the expression of Bad, Caspase-9, and cleaved-Caspase-3, as well as suppressed Bcl-2 expression. In conclusion, our results suggest that SLC39A7 plays a crucial role in the proliferation and survival of colorectal cancer cells, which associates with colorectal tumorigenesis. © The Author 2017. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Luo, Jian; Chen, Yongjun; Li, Qiang; Wang, Bing; Zhou, Yanqiong; Lan, Hongzhen
2016-08-01
Cholangiocarcinoma is a deadly disease which responds poorly to surgery and conventional chemotherapy or radiotherapy. Early diagnosis is difficult due to the anatomical and biological characteristics of cholangiocarcinoma. Cyclin-dependent kinase inhibitor 1B (p27Kip1) is a cyclin‑dependent kinase inhibitor and in the present study, we found that p27Kip1 expression was suppressed in the nucleus and increased in the cytoplasm in 53 samples of cholangiocarcinoma from patients with highly malignant tumors (poorly-differentiated and tumor-node-metastsis (TNM) stage III-IV) compared with that in samples from 10 patients with chronic cholangitis. The expression of phosphorylated (p-)p27Kip1 (Ser10), one of the phosphorylated forms of p27Kip1, was increased in the patient samples with increasing malignancy and clinical stage. Coincidentally, chromosome region maintenance 1 (CRM-1; also referred to as exportin 1 or Xpo1), a critical protein responsible for protein translocation from the nucleus to the cytoplasm, was also overexpressed in the tumor samples which were poorly differentiated and of a higher clinical stage. Through specific short hairpin RNA (shRNA)-mediated knockdown of CRM-1 in the cholangiocarcinoma cell line QBC939, we identified an elevation of cytoplasmic p27Kip1 and a decrease of nuclear p27Kip1. Furthermore, the viability and colony formation ability of QBC939 cells was largely reduced with G1 arrest. Consistent with the findings of the in vitro experiments, in a xenograft mouse model, the tumors formed in the CRM-1 knockdown group were markedly smaller and weighed less than those in the control group in vivo. Taken together, these findings demonstrated that the interplay between CRM-1 and p27Kip1 may provide potentially potent biomarkers and functional targets for the development of future cholangiocarcinoma treatments.
He, Xiangfei; Sun, Fuguang; Guo, Fengfu; Wang, Kai; Gao, Yisheng; Feng, Yanfei; Song, Bin; Li, Wenzhi; Li, Yang
2017-01-26
Renal cell carcinoma (RCC) is one of the most common kidney cancers worldwide. Although great progressions have been made in the past decades, its morbidity and lethality remain increasing. Long noncoding RNAs (lncRNAs) are demonstrated to play significant roles in the tumorigenesis. This study aimed to investigate the detailed roles of lncRNA FTX in RCC cell proliferation and metastasis. Our results showed that the transcript levels of FTX in both clinical RCC tissues and the cultured RCC cells were significantly upregulated and associated with multiple clinical parameters of RCC patients, including familial status, tumor sizes, lymphatic metastasis, and TNM stages. With cell proliferation assays, colony formation assays, and cell cycle assays, we testified that knockdown of FTX in A498 and ACHIN cells with specific shRNAs inhibited cell proliferation rate, colony formation ability, and arrested cell cycle in the G0/G1 phase. FTX depletion also suppressed cell migration and invasion with Transwell assays and wound-healing assays. These data indicated the pro-oncogenic potential of FTX in RCC, which makes it a latent therapeutic target of RCC diagnosis and treatment in the clinic.
Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Alsaqufi, Ahmed; Perera, Dayan A; Shang, Mei; Odin, Ramjie; Vo, Khoi; Drescher, David; Robinson, Dalton; Zhang, Dan; Abass, Nermeen; Dunham, Rex A
2017-05-31
Repressible knockdown approaches were investigated for transgenic sterilization in channel catfish, Ictalurus punctatus . Two primordial germ cell (PGC) marker genes, nanos and dead end , were targeted for knockdown, and an off-target gene, vasa , was monitored. Two potentially salt sensitive repressible promoters, zebrafish adenylosuccinate synthase 2 (ADSS) and zebrafish racemase (Rm), were each coupled with four knockdown strategies: ds-sh RNA targeting the 5' end (N1) or 3' end (N2) of channel catfish nanos , full-length cDNA sequence of channel catfish nanos for overexpression (cDNA) and ds-sh RNA targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with sodium chloride as the repressor compound. Spawning rates of full-sibling P₁ fish exposed or not exposed to the constructs as treated and untreated embryos were 93% and 59%, respectively, indicating potential sterilization of fish and repression of the constructs. Although the mRNA expression data of PGC marker genes were inconsistent in P₁ fish, most F₁ individuals were able to downregulate the target genes in untreated groups and repress the knockdown process in treated groups. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but more data from F₂ or F₃ are needed for evaluation.
He, Quan; Harris, Nicole; Ren, Jun; Han, Xianlin
2014-01-01
Tafazzin, a mitochondrial acyltransferase, plays an important role in cardiolipin side chain remodeling. Previous studies have shown that dysfunction of tafazzin reduces cardiolipin content, impairs mitochondrial function, and causes dilated cardiomyopathy in Barth syndrome. Reactive oxygen species (ROS) have been implicated in the development of cardiomyopathy and are also the obligated byproducts of mitochondria. We hypothesized that tafazzin knockdown increases ROS production from mitochondria, and a mitochondria-targeted antioxidant prevents tafazzin knockdown induced mitochondrial and cardiac dysfunction. We employed cardiac myocytes transduced with an adenovirus containing tafazzin shRNA as a model to investigate the effects of the mitochondrial antioxidant, mito-Tempo. Knocking down tafazzin decreased steady state levels of cardiolipin and increased mitochondrial ROS. Treatment of cardiac myocytes with mito-Tempo normalized tafazzin knockdown enhanced mitochondrial ROS production and cellular ATP decline. Mito-Tempo also significantly abrogated tafazzin knockdown induced cardiac hypertrophy, contractile dysfunction, and cell death. We conclude that mitochondria-targeted antioxidant prevents cardiac dysfunction induced by tafazzin gene knockdown in cardiac myocytes and suggest mito-Tempo as a potential therapeutic for Barth syndrome and other dilated cardiomyopathies resulting from mitochondrial oxidative stress. PMID:25247053
Boone, Deborah R; Leek, Jeanna M; Falduto, Michael T; Torres, Karen E O; Sell, Stacy L; Parsley, Margaret A; Cowart, Jeremy C; Uchida, Tatsuo; Micci, Maria-Adelaide; DeWitt, Douglas S; Prough, Donald S; Hellmich, Helen L
2017-01-01
Virally mediated RNA interference (RNAi) to knock down injury-induced genes could improve functional outcome after traumatic brain injury (TBI); however, little is known about the consequences of gene knockdown on downstream cell signaling pathways and how RNAi influences neurodegeneration and behavior. Here, we assessed the effects of adeno-associated virus (AAV) siRNA vectors that target two genes with opposing roles in TBI pathogenesis: the allegedly detrimental neuronal nitric oxide synthase (nNOS) and the potentially protective glutathione peroxidase 1 (GPx-1). In rat hippocampal progenitor cells, three siRNAs that target different regions of each gene (nNOS, GPx-1) effectively knocked down gene expression. However, in vivo, in our rat model of fluid percussion brain injury, the consequences of AAV-siRNA were variable. One nNOS siRNA vector significantly reduced the number of degenerating hippocampal neurons and showed a tendency to improve working memory. GPx-1 siRNA treatment did not alter TBI-induced neurodegeneration or working memory deficits. Nevertheless, microarray analysis of laser captured, virus-infected neurons showed that knockdown of nNOS or GPx-1 was specific and had broad effects on downstream genes. Since nNOS knockdown only modestly ameliorated TBI-induced working memory deficits, despite widespread genomic changes, manipulating expression levels of single genes may not be sufficient to alter functional outcome after TBI.
Metamorphosis of a Hairpin Vortex into a Young Turbulent Spot
NASA Technical Reports Server (NTRS)
Singer, Bart A.; Joslin, Ronald D.
1995-01-01
Direct numerical simulation was used to study the formation and growth of a hairpin vortex in a flat-plate boundary layer and its later development into a young turbulent spot. Fluid injection through a slit in the wall triggered the initial vortex. The legs of the vortex were stretched into a hairpin shape as it traveled downstream. Multiple hairpin vortex heads developed between the stretched legs. New vortices formed beneath the streamwise-elongated vortex legs. The continued development of additional vortices resulted in the formation of a traveling region of highly disturbed ow with an arrowhead shape similar to that of a turbulent spot.
Salmon, Loïc; Giambaşu, George M; Nikolova, Evgenia N; Petzold, Katja; Bhattacharya, Akash; Case, David A; Al-Hashimi, Hashim M
2015-10-14
Approaches that combine experimental data and computational molecular dynamics (MD) to determine atomic resolution ensembles of biomolecules require the measurement of abundant experimental data. NMR residual dipolar couplings (RDCs) carry rich dynamics information, however, difficulties in modulating overall alignment of nucleic acids have limited the ability to fully extract this information. We present a strategy for modulating RNA alignment that is based on introducing variable dynamic kinks in terminal helices. With this strategy, we measured seven sets of RDCs in a cUUCGg apical loop and used this rich data set to test the accuracy of an 0.8 μs MD simulation computed using the Amber ff10 force field as well as to determine an atomic resolution ensemble. The MD-generated ensemble quantitatively reproduces the measured RDCs, but selection of a sub-ensemble was required to satisfy the RDCs within error. The largest discrepancies between the RDC-selected and MD-generated ensembles are observed for the most flexible loop residues and backbone angles connecting the loop to the helix, with the RDC-selected ensemble resulting in more uniform dynamics. Comparison of the RDC-selected ensemble with NMR spin relaxation data suggests that the dynamics occurs on the ps-ns time scales as verified by measurements of R(1ρ) relaxation-dispersion data. The RDC-satisfying ensemble samples many conformations adopted by the hairpin in crystal structures indicating that intrinsic plasticity may play important roles in conformational adaptation. The approach presented here can be applied to test nucleic acid force fields and to characterize dynamics in diverse RNA motifs at atomic resolution.
Hybridization-based biosensor containing hairpin probes and use thereof
Miller, Benjamin L.; Strohsahl, Christopher M.
2010-10-12
A sensor chip that includes: a fluorescence quenching surface; a nucleic acid probe that contains first and second ends with the first end bound to the fluorescence quenching surface, and is characterized by being able to self-anneal into a hairpin conformation; and a first fluorophore bound to the second end of the first nucleic acid molecule. When the first nucleic acid molecule is in the hairpin conformation, the fluorescence quenching surface substantially quenches fluorescent emissions by the first fluorophore; and when the first nucleic acid molecule is in a non-hairpin conformation, fluorescent emissions by the fluorophore are substantially free of quenching by the fluorescence quenching surface. Various nucleic acid probes, methods of making the sensor chip, biological sensor devices that contain the sensor chip, and their methods of use are also disclosed.
The dawn of the RNA World: Toward functional complexity through ligation of random RNA oligomers
Briones, Carlos; Stich, Michael; Manrubia, Susanna C.
2009-01-01
A main unsolved problem in the RNA World scenario for the origin of life is how a template-dependent RNA polymerase ribozyme emerged from short RNA oligomers obtained by random polymerization on mineral surfaces. A number of computational studies have shown that the structural repertoire yielded by that process is dominated by topologically simple structures, notably hairpin-like ones. A fraction of these could display RNA ligase activity and catalyze the assembly of larger, eventually functional RNA molecules retaining their previous modular structure: molecular complexity increases but template replication is absent. This allows us to build up a stepwise model of ligation-based, modular evolution that could pave the way to the emergence of a ribozyme with RNA replicase activity, step at which information-driven Darwinian evolution would be triggered. PMID:19318464
Neutral Polymeric Micelles for RNA Delivery
Lundy, Brittany B.; Convertine, Anthony; Miteva, Martina; Stayton, Patrick S.
2013-01-01
RNA interference (RNAi) drugs have significant therapeutic potential but delivery systems with appropriate efficacy and toxicity profiles are still needed. Here, we describe a neutral, ampholytic polymeric delivery system based on conjugatable diblock polymer micelles. The diblock copolymer contains a hydrophilic poly[N-(2-hydroxypropyl) methacrylamide-co-N-(2-(pyridin-2- yldisulfanyl)ethyl)methacrylamide) (poly[HPMA-co-PDSMA]) segment to promote aqueous stability and facilitate thiol-disulfide exchange reactions, and a second ampholytic block composed of propyl acrylic acid (PAA), dimethylaminoethyl methacrylate (DMAEMA), and butyl methacrylate (BMA). The poly[(HPMA-co-PDSMA)-b-(PAA-co-DMAEMA-co-BMA)] was synthesized using Reversible Addition-Fragmentation chain Transfer (RAFT) polymerization with an overall molecular weight of 22,000 g/mol and a PDI of 1.88. Dynamic light scattering and fluorescence measurements indicated that the diblock copolymers self-assemble under aqueous conditions to form polymeric micelles with a hydrodynamic radius and critical micelle concentration of 25 nm and 25 μg/mL respectively. Red blood cell hemolysis experiments show that the neutral hydrophilic micelles have potent membrane destabilizing activity at endosomal pH values. Thiolated siRNA targeting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was directly conjugated to the polymeric micelles via thiol exchange reactions with the pyridal disulfide groups present in the micelle corona. Maximum silencing activity in HeLa cells was observed at a 1:10 molar ratio of siRNA to polymer following a 48 h incubation period. Under these conditions 90 % mRNA knockdown and 65 % and protein knockdown of at 48 h was achieved with negligible toxicity. In contrast the polymeric micelles lacking a pH-responsive endosomalytic segment demonstrated negligible mRNA and protein knockdown under these conditions. The potent mRNA knockdown and excellent biocompatibility of the neutral siRNA conjugates
Fan, Tingting; Zhang, Changsong; Zong, Ming; Fan, Lieying
2018-04-01
Impaired apoptosis of rheumatoid arthritis (RA)‑fibroblast‑like synoviocytes (FLS) is pivotal in the process of RA. Peptidyl arginine deiminase type IV (PADI4) is associated with autoantibody regulation via histone citrullination in RA. The present study aimed to investigate the role of PADI4 in the apoptosis of RA‑FLS. FLS were isolated from patients with RA and a rat model. The effects of PADI4 on RA‑FLS were investigated in vitro and in vivo. Hypoxia‑induced autophagy was induced by 1% O2 and was detected by immunohistochemical and immunofluorescence analysis; in addition, apoptosis was detected by flow cytometry. RA‑FLS obtained from RA rat model exhibited significant proliferation under severe hypoxia conditions. Hypoxia also significantly induced autophagy and elevated the expression of PADI4. Subsequently, short hairpin RNA‑mediated PADI4 knockdown was demonstrated to significantly inhibit hypoxia‑induced autophagy and promote apoptosis in RA‑FLS. The results of these in vitro and in vivo studies suggested that PADI4 may be closely associated with hypoxia‑induced autophagy, and the inhibition of hypoxia‑induced autophagy by PADI4 knockdown may contribute to an increase in the apoptosis of RA‑FLS.
ENHANCING ADULT NERVE REGENERATION THROUGH THE KNOCKDOWN OF RETINOBLASTOMA PROTEIN
Christie, Kimberly J.; Krishnan, Anand; Martinez, Jose A.; Purdy, Kaylynn; Singh, Bhagat; Eaton, Shane; Zochodne, Douglas
2016-01-01
Tumour suppressor pathways may offer novel targets capable of altering the plasticity of post-mitotic adult neurons. Here we describe a role for retinoblastoma (Rb) protein, widely expressed in adult sensory neurons and their axons, during regeneration. In adult sensory neurons, Rb siRNA knockdown or Rb1 deletion in vitro enhances neurite outgrowth and branching. Plasticity is achieved in part through upregulation of neuronal PPARγ; its antagonism inhibits Rb siRNA plasticity whereas a PPARγ agonist increases growth. In an in vivo regenerative paradigm following complete peripheral nerve trunk transection, direct delivery of Rb siRNA prompts increased outgrowth of axons from proximal stumps and entrains Schwann cells to accompany them for greater distances. Similarly Rb siRNA delivery following a nerve crush improves behavioural indices of motor and sensory recovery in mice. The overall findings indicate that inhibition of tumour suppressor molecules has a role to play in promoting adult neuron regeneration. PMID:24752312
Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.
Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C
2017-09-11
To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.
Wang, Xiaoyu; Zhang, Yiting; Lin, Haiyingjie; Liu, Yan; Tan, Yi; Lin, Jie; Gao, Fenze; Lin, Shaoqiang
2017-01-22
Emerging evidence indicates that β-galactoside-α2,3-sialyltransferase III (ST3Gal3) involves in development, inflammation, neoplastic transformation, and metastasis. However, the role of ST3Gal3 in regulating cancer chemoresistance remains elusive. Herein, we investigated the functional effects of ST3Gal3 in cisplatin-resistant ovarian cancer cells. We found that the levels of ST3Gal3 mRNA differed significantly among ovarian cancer cell lines. HO8910PM cells that have high invasive and metastatic capacity express elevated ST3Gal3 mRNA and are resistant to cisplatin, comparing to SKOV3 cells that have a lower level of ST3Gal3 expression and are more chemosensitive to cisplatin. We found that the expression of ST3Gal3 has reverse correlation with the dosage of cisplatin used in both SKOV3 and HO8910PM cells, and high dose of cisplatin could down-regulate ST3Gal3 expression. We then examined the functional effects of ST3Gal3 knockdown in cancer cell lines using FACS analysis. The number of apoptotic cells was much higher in cells if ST3Gal3 expression was knocked down by siRNA and/or by treating cells with higher dosage of cisplatin in comparison to control cells. Interestingly, in HO8910PM cells with ST3Gal3 knockdown, the levels of caspase 8 and caspase 3 proteins increased, which was more obvious in cells treated with both ST3Gal3 knockdown and cisplatin, suggesting that ST3Gal3 knockdown synergistically enhanced cisplatin-induced apoptosis in ovarian cancer cells. Taken together, these results uncover an alternative mechanism of cisplatin-resistance through ST3Gal3 and open a window for effective prevention of chemoresistance and relapse of ovarian cancer by targeting ST3Gal3. Copyright © 2016 Elsevier Inc. All rights reserved.
Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.
Schnare, M N; Gray, M W
1982-01-01
In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176
Starkey, Jason L; Chiari, Estelle F; Isom, Harriet C
2009-01-01
Hepatitis B virus (HBV) covalently closed circular (CCC) DNA is the source of HBV transcripts and persistence in chronically infected patients. The novel aspect of this study was to determine the effect of RNA interference (RNAi) on HBV CCC DNA when administered prior to establishment of HBV replication or during chronic HBV infection. HBV replication was initiated in HepG2 cells by transduction with HBV baculovirus. Subculture of HBV-expressing HepG2 cells at 10 days post-transduction generates a system in which HBV replication is ongoing and HBV is expressed largely from CCC DNA, thus simulating chronic HBV infection. HepG2 cells were transduced with short hairpin RNA (shRNA)-expressing baculovirus prior to initiation of HBV replication or during chronic HBV replication, and the levels of HBV RNA, HBV surface antigens (HBsAg) and replicative intermediates (RI), extracellular (EC) and CCC DNA species were measured. HBsAg, HBV RNA and DNA levels were markedly reduced until day 8 whether cells were transduced with shRNA prior to or during a chronic infection; however, the CCC DNA species were only affected when shRNA was administered prior to initiation of infection. We conclude that RNAi may have a therapeutic value for controlling HBV replication at the level of RI and EC DNA and for reducing establishment of CCC DNA during HBV infection. Our data support previous findings demonstrating the stability of HBV CCC DNA following antiviral therapy. This study also reports the development of a novel HBV baculovirus subculture system that can be used to evaluate antiviral effects on chronic HBV replication.
Xue, Jianpeng; Shan, Lingling; Chen, Haiyan; Li, Yang; Zhu, Hongyan; Deng, Dawei; Qian, Zhiyu; Achilefu, Samuel; Gu, Yueqing
2013-03-15
Signal transducer and activator of transcription 5B (STAT5B) is an important protein in JAK-STAT signaling pathway that is responsible for the metastasis and proliferation of tumor cells. Determination of the STAT5B messenger Ribonucleic Acid (mRNA) relating to the STAT5B expression provides insight into the mechanism of tumor progression. In this study, we designed and used a special hairpin deoxyribonucleic acid (DNA) for human STAT5B mRNA to functionalize gold nanoparticles, which served as a beacon for detecting human STAT5B expression. Up to 90% quenching efficiency was achieved. Upon hybridizing with the target mRNA, the hairpin DNA modified gold nanoparticle beacons (hDAuNP beacons) release the fluorophores attached at 5' end of the oligonucleotide sequence. The fluorescence properties of the beacon before and after the hybridization with the complementary DNA were confirmed in vitro. The stability of hDAuNP beacons against degradation by DNase I and GSH indicated that the prepared beacon is stable inside cells. The detected fluorescence in MCF-7 cancer cells correlates with the specific STAT5B mRNA expression, which is consistent with the result from PCR measurement. Fluorescence microscopy showed that the hDAuNP beacons internalized in cells without using transfection agents, with intracellular distribution in the cytoplasm rather than the nucleus. The results demonstrated that this beacon could directly provide quantitative measurement of the intracellular STAT5B mRNA in living cells. Compared to the previous approaches, this beacon has advantages of higher target to background ratio of detection and an increased resistance to nuclease degradation. The strategy reported in this study is a promising approach for the intracellular measurement of RNA or protein expression in living cells, and has great potential in the study of drug screening and discovery. Copyright © 2012 Elsevier B.V. All rights reserved.
Nemunaitis, John; Barve, Minal; Orr, Douglas; Kuhn, Joseph; Magee, Mitchell; Lamont, Jeffrey; Bedell, Cynthia; Wallraven, Gladice; Pappen, Beena O; Roth, Alyssa; Horvath, Staci; Nemunaitis, Derek; Kumar, Padmasini; Maples, Phillip B; Senzer, Neil
2014-01-01
Therapies for advanced hepatocellular carcinoma (HCC) are limited. We carried out a phase I trial of a novel autologous whole-cell tumor cell immunotherapy (FANG™), which incorporates a dual granulocyte macrophage colony-stimulating factor (GM-CSF) expressive/bifunctional small hairpin RNA interference (bi-shRNAi) vector. The bi-shRNAi DNA targets furin, which is a proconvertase of transforming growth factors beta (TGFβ) 1 and 2. Safety, mechanism, immunoeffectiveness, and suggested benefit were previously shown [Senzer et al.: Mol Ther 2012;20:679-689; Senzer et al.: J Vaccines Vaccin 2013;4:209]. We now provide further follow-up of a subset of 8 HCC patients. FANG manufacturing was successful in 7 of 8 attempts (one failure due to insufficient cell yield). Median GM-CSF expression was 144 pg/10(6) cells, TGFβ1 knockdown was 100%, and TGFβ2 knockdown was 93% of the vector-transported cells. Five patients were vaccinated (1 or 2.5×10(7) cells/intradermal injection, 6-11 vaccinations). No FANG toxicity was observed. Three of these patients demonstrated evidence of an immune response to the autologous tumor cell sample. Long-term follow-up demonstrated survival of 319, 729, 784, 931+, and 1,043+ days of the FANG-treated patients. In conclusion, evidence supports further assessment of the FANG immunotherapy in HCC. © 2014 S. Karger AG, Basel.
Knockdown of IL-8 Provoked Premature Senescence of Placenta-Derived Mesenchymal Stem Cells.
Li, Juan-Juan; Ma, Feng-Xia; Wang, You-Wei; Chen, Fang; Lu, Shi-Hong; Chi, Ying; Du, Wen-Jing; Song, Bao-Quan; Hu, Liang-Ding; Chen, Hu; Han, Zhong-Chao
2017-06-15
Mesenchymal stem cells (MSCs) have shown promise for use in cell therapy, and due to their tumor tropism can serve as vehicles for delivering therapeutic agents to tumor sites. Because interleukin-8 (IL-8) is known to mediate the protumor effect of MSCs, elimination of IL-8 secretion by MSCs may enhance their safety for use in cancer gene therapy. However, little is known concerning the effect of endogenously secreted IL-8 on MSCs. We performed studies using placenta-derived MSCs (PMSCs) to determine whether knockdown of IL-8 would influence their biological activity. We first verified that IL-8 and its membrane receptor CXCR2, but not CXCR1, were highly expressed in PMSCs. We then employed lentivirus-mediated small hairpin RNA interference to generate stable IL-8-silenced PMSCs, which displayed a variety of characteristic senescent phenotypes. We observed that at day 9 post-transfection, IL-8-silenced PMSCs had become larger and displayed a more flattened appearance when compared with their controls. Moreover, their proliferation, colony forming unit-fibroblast formation, adipogenic and osteogenic differentiation, and immunosuppressive potentials were significantly impaired. Enhanced senescence-associated β-galactosidase (SA-β-gal) activity and specific global gene expression profiles confirmed that IL-8 silencing evoked the senescence process in PMSCs. Increased levels of p-Akt and decreased levels of FOXO3a protein expression suggested that reactive oxygen species played a role in the initiation and maintenance of senescence in IL-8-silenced PMSCs. Notably, the majority of CXCR2 ligands were downregulated in presenescent IL-8-silenced PMSCs but upregulated in senescent cells, indicating an antagonistic pleiotropy of the IL-8/CXCR2 signaling pathway in PMSCs. This effect may promote the proliferation of young cells and accelerate senescence of old cells.
Bahi, Amine
2013-10-01
Whether metabotropic glutamate 7 (mGluR7) -activation enhances or diminishes the reinforcing properties of psychostimulants remains unclear. We have previously shown that systemic mGluR7 activation reduced alcohol consumption and preference as well as locomotor-stimulating and rewarding properties of ethanol. In this study, we further examined the contribution of mGluR7 on the effect of ethanol within the nucleus accumbens (NAcc), a neural target for many drugs of abuse. Using short hairpin RNA (shRNA)-expressing lentiviral vectors (LV) to alter locally the activity of mGluR7 in male rats, we have shown that blocking mGluR7 expression increased ethanol consumption and preference in a two-bottle choice drinking paradigm with no effect either on saccharin or on quinine used for taste discrimination. In addition, mGluR7 knockdown increases preference for environments previously paired with low doses of ethanol in the conditioned place preference (CPP) test, as it shifted the dose-response curve for ethanol CPP to the left, indicating alterations in the rewarding effects of alcohol. More importantly, mGluR7 blockade in the dorsal striatum (DS) neither affected ethanol consumption nor ethanol-elicited CPP. These results show that levels of mGluR7 in the NAcc regulate responsiveness to alcohol. Taken together, these findings clearly demonstrate that mGluR7 signaling within the NAcc is a key modulator of functional responses to ethanol and offer an important target for regulating the addictive effects of alcohol.
Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Alsaqufi, Ahmed; Perera, Dayan A.; Shang, Mei; Odin, Ramjie; Vo, Khoi; Drescher, David; Robinson, Dalton; Zhang, Dan; Abass, Nermeen; Dunham, Rex A.
2017-01-01
Repressible knockdown approaches were investigated for transgenic sterilization in channel catfish, Ictalurus punctatus. Two primordial germ cell (PGC) marker genes, nanos and dead end, were targeted for knockdown, and an off-target gene, vasa, was monitored. Two potentially salt sensitive repressible promoters, zebrafish adenylosuccinate synthase 2 (ADSS) and zebrafish racemase (Rm), were each coupled with four knockdown strategies: ds-sh RNA targeting the 5′ end (N1) or 3′ end (N2) of channel catfish nanos, full-length cDNA sequence of channel catfish nanos for overexpression (cDNA) and ds-sh RNA targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with sodium chloride as the repressor compound. Spawning rates of full-sibling P1 fish exposed or not exposed to the constructs as treated and untreated embryos were 93% and 59%, respectively, indicating potential sterilization of fish and repression of the constructs. Although the mRNA expression data of PGC marker genes were inconsistent in P1 fish, most F1 individuals were able to downregulate the target genes in untreated groups and repress the knockdown process in treated groups. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but more data from F2 or F3 are needed for evaluation. PMID:28561774
General acid-base catalysis mediated by nucleobases in the hairpin ribozyme
Kath-Schorr, Stephanie; Wilson, Timothy J.; Li, Nan-Sheng; Lu, Jun; Piccirilli, Joseph A.; Lilley, David M. J.
2012-01-01
The catalytic mechanism by which the hairpin ribozyme accelerates cleavage or ligation of the phosphodiester backbone of RNA has been incompletely understood. There is experimental evidence for an important role for an adenine (A38) and a guanine (G8), and it has been proposed that these act in general acid-base catalysis. In this work we show that a large reduction in cleavage rate on substitution of A38 by purine (A38P) can be reversed by replacement of the 5′-oxygen atom at the scissile phosphate by sulfur (5′-PS), which is a much better leaving group. This is consistent with A38 acting as the general acid in the unmodified ribozyme. The rate of cleavage of the 5′-PS substrate by the A38P ribozyme increases with pH log-linearly, indicative of a requirement for a deprotonated base with a relatively high pKa. On substitution of G8 by diaminopurine, the 5′-PS substrate cleavage rate at first increases with pH and then remains at a plateau, exhibiting an apparent pKa consistent with this nucleotide acting in general base catalysis. Alternative explanations for the pH dependence of hairpin ribozyme reactivity are discussed, from which we conclude that general acid-base catalysis by A38 and G8 is the simplest and most probable explanation consistent with all the experimental data. PMID:22958171
Bi, Sai; Chen, Min; Jia, Xiaoqiang; Dong, Ying
2015-02-28
Herein, a cascaded chemiluminescence resonance energy transfer (C-CRET) process was demonstrated from horseradish peroxidase (HRP)-mimicking DNAzyme-catalyzed luminol-H2O2 to fluorescein and further to graphene oxide (GO) when HRP-mimicking DNAzyme/fluorescein was in close proximity to the GO surface. The proposed C-CRET system was successfully implemented to construct three modes of C-CRET hot-spot-active substrates (modes I, II and III) by covalently immobilizing HRP-mimicking DNAzyme/fluorescein-labeled hairpin DNAs (hot-spot-generation probes) on magnetic GO (MGO), resulting in a signal "off" state due to the quenching of the luminol/H2O2/HRP-mimicking DNAzyme/fluorescein CRET system by GO. Upon the introduction of microRNA-122 (miRNA-122), the targets (mode I) or the new triggers that were generated through a strand displacement reaction (SDR) initiated by miRNA-122 (modes II and III) hybridized with the loop domains of hairpin probes on MGO to form double-stranded (modes I and II) or triplex-stem structures (mode III), causing an "open" configuration of the hairpin probe and a CRET signal "on" state, thus achieving sensitive and selective detection of miRNA-122. More importantly, the substrate exhibited excellent controllability, reversibility and reproducibility through SDR and magnetic separation (modes II and III), especially sequence-independence for hairpin probes in mode III, holding great potential for the development of a versatile platform for optical biosensing.
Knockdown of NF-κB1 by shRNA Inhibits the Growth of Renal Cell Carcinoma In Vitro and In Vivo.
Ikegami, Amanda; Teixeira, Luiz Felipe S; Braga, Marina S; Dias, Matheus Henrique Dos S; Lopes, Eduardo C; Bellini, Maria Helena
2018-06-11
Renal cell carcinoma (RCC) accounts for approximately 2%-3% of human malignancies and is the most aggressive among urologic tumors. Biological heterogeneity, drug resistance, and chemotherapy side effects are the biggest obstacles to the effective treatment of RCC. The NF-κB transcription factor is one of several molecules identified to be responsible for the aggressive phenotype of this tumor. In the past decade, several studies have demonstrated the activation of NF-κB in RCC, and many have implicated NF-κB1 (p50) as an important molecule in tumor progression and metastasis. In the present study, a lentivirus was used to deliver shRNA targeting NF-κB1 into mouse RCC (Renca) cells. It was determined that the knockdown of the NF-κB1 gene led to a reduction in cell proliferation and late apoptosis/necrosis in vitro. Flow cytometry analysis demonstrated G2/M arrest in the cells. In addition, immunoblotting analysis revealed a significant increase in cyclin B1 and Bax. In vivo experiments showed that Renca-shRNA-NF-κB1 cells have significantly diminished tumorigenicity. Moreover, immunohistochemical analysis revealed an increase in necrotic areas of Renca-shRNA-NF-κB1 tumors. Thus, this study indicates that downregulation of NF-κB1 can suppress RCC tumorigenesis by inducing late apoptosis/necrosis. Therefore, NF-κB1 may be a potential therapeutic target for RCC.
Knockdown of ferroportin accelerates erastin-induced ferroptosis in neuroblastoma cells.
Geng, N; Shi, B-J; Li, S-L; Zhong, Z-Y; Li, Y-C; Xua, W-L; Zhou, H; Cai, J-H
2018-06-01
Ferroptosis is a new-found iron-dependent form of non-apoptotic regulated cell death (RCD), which is activated on therapy with several antitumor agents, but the potential mechanism remains unclear. Erastin, exhibiting selectivity for RAS-mutated cancer cells, induces ferroptosis by increasing iron and lipid reactive oxygen species (ROS) levels in cell. Ferroportin (Fpn), the sole iron export protein, participates in the regulation of intracellular iron concentration. In this study, we investigated the role of Fpn on ferroptosis induced by erastin in SH-SY5Y cells. The cell viability was determined by CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay kit. The activity of caspase-3 was measured by ELISA kit. qRT-PCR was performed to examine the mRNA expression of Fpn. Western blot assay was conducted to examine the expression level of marker proteins. Specific commercial kits were used to examine the levels of MDA, ROS and iron in cells, respectively. Ferroptosis was evaluated by intracellular lipid ROS level and iron concentration. Hepcidin could prevent erastin-induced ferroptosis by degrading Fpn. Erastin (5 μg/mL) was observed to induce ferroptosis in neuroblastoma cells at 6 hours, which was promoted by knockdown of Fpn. The expression of Fpn gene and protein was decreased in SH-SY5Y cells treated with erastin. After treatment with erastin, Fpn siRNA transfection in SH-SY5Y cells was able to accelerate ferroptosis-associated phenotypic changes. Fpn acted as a negative regulator of ferroptosis by reducing intracellular iron concentration. Knockdown of Fpn enhanced anticancer activity of erastin. These results suggested that knockdown of Fpn accelerated erastin-induced ferroptosis by increasing iron-dependent lipid ROS accumulation, highlighting Fpn as a potential therapeutic target site for neuroblastoma. Thus, Fpn inhibitors may provide new access for chemosensitization of neuroblastoma.
Drosha Promotes Splicing of a Pre-microRNA-like Alternative Exon
Havens, Mallory A.; Reich, Ashley A.; Hastings, Michelle L.
2014-01-01
The ribonuclease III enzyme Drosha has a central role in the biogenesis of microRNA (miRNA) by binding and cleaving hairpin structures in primary RNA transcripts into precursor miRNAs (pre-miRNAs). Many miRNA genes are located within protein-coding host genes and cleaved by Drosha in a manner that is coincident with splicing of introns by the spliceosome. The close proximity of splicing and pre-miRNA biogenesis suggests a potential for co-regulation of miRNA and host gene expression, though this relationship is not completely understood. Here, we describe a cleavage-independent role for Drosha in the splicing of an exon that has a predicted hairpin structure resembling a Drosha substrate. We find that Drosha can cleave the alternatively spliced exon 5 of the eIF4H gene into a pre-miRNA both in vitro and in cells. However, the primary role of Drosha in eIF4H gene expression is to promote the splicing of exon 5. Drosha binds to the exon and enhances splicing in a manner that depends on RNA structure but not on cleavage by Drosha. We conclude that Drosha can function like a splicing enhancer and promote exon inclusion. Our results reveal a new mechanism of alternative splicing regulation involving a cleavage-independent role for Drosha in splicing. PMID:24786770
RNA "traffic lights": an analytical tool to monitor siRNA integrity.
Holzhauser, Carolin; Liebl, Renate; Goepferich, Achim; Wagenknecht, Hans-Achim; Breunig, Miriam
2013-05-17
The combination of thiazole orange and thiazole red as an internal energy transfer-based fluorophore pair in oligonucleotides provides an outstanding analytical tool to follow DNA/RNA hybridization through a distinct fluorescence color change from red to green. Herein, we demonstrate that this concept can be applied to small interfering RNA (siRNA) to monitor RNA integrity in living cells in real time with a remarkable dynamic range and excellent contrast ratios in cellular media. Furthermore, we show that our siRNA-sensors still possess their gene silencing function toward the knockdown of enhanced green fluorescent protein in CHO-K1 cells.
PHD3-mediated prolyl hydroxylation of nonmuscle actin impairs polymerization and cell motility
Luo, Weibo; Lin, Benjamin; Wang, Yingfei; Zhong, Jun; O'Meally, Robert; Cole, Robert N.; Pandey, Akhilesh; Levchenko, Andre; Semenza, Gregg L.
2014-01-01
Actin filaments play an essential role in cell movement, and many posttranslational modifications regulate actin filament assembly. Here we report that prolyl hydroxylase 3 (PHD3) interacts with nonmuscle actin in human cells and catalyzes hydroxylation of actin at proline residues 307 and 322. Blocking PHD3 expression or catalytic activity by short hairpin RNA knockdown or pharmacological inhibition, respectively, decreased actin prolyl hydroxylation. PHD3 knockdown increased filamentous F-actin assembly, which was reversed by PHD3 overexpression. PHD3 knockdown increased cell velocity and migration distance. Inhibition of PHD3 prolyl hydroxylase activity by dimethyloxalylglycine also increased actin polymerization and cell migration. These data reveal a novel role for PHD3 as a negative regulator of cell motility through posttranslational modification of nonmuscle actins. PMID:25079693
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zheng, Rong; Department of Radiation Oncology, Fujian Medical University Union Hospital, Fuzhou, Fujian; Yao, Qiwei
Purpose: Although increasing evidence has shown that long noncoding RNAs play an important regulatory role in carcinogenesis and tumor progression, little is known about the role of small nucleolar RNA host gene 18 (SNHG18) in cancer. The goal of this study was to investigate the expression of SNHG18 and its clinical significance in glioma. Methods and Materials: Differences in the lncRNA expression profile between M059K and M059J cells were assessed by lncRNA expression microarray analysis. The expression and localization of SNHG18 in glioma cells or tissues was evaluated by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and in situ hybridization (ISH),more » respectively. the clinical associations of SNHG18 in glioma was evaluated by qRT-PCR, ISH and immunohistochemistry. The role of SNHG18 in glioma radiosensitivity was evaluated by colony formation assays, immunofluorescence, Western blot and tumor growth inhibition study. Results: The present study investigated the clinical associations of SNHG18 and its role in glioma. Our results showed that the expression of SNHG18 was remarkably upregulated in clinical glioma tissues compared with normal brain tissues. SNHG18 expression was associated with the clinical tumor grade and correlated negatively with isocitrate dehydrogenase 1 mutation. In addition, knockdown of SNHG18 with short hairpin RNA suppressed the radioresistance of glioma cells, and transgenic expression of SNHG18 had the opposite effect. Furthermore, xenograft tumors grown from cells with SNHG18 deletion were more radiosensitive than tumors grown from control cells. Further studies revealed that SNHG18 promotes radioresistance by inhibiting semaphorin 5A and that inhibition of semaphorin 5A expression abrogated the radiosensitizing effect caused by SNHG18 deletion. Conclusions: Our findings provide new insights into the role of SNHG18 in glioma and suggest its potential as a target for glioma therapy.« less
Yang, Zhongmeng; Tang, Yuxing; Lu, Huading; Shi, Bo; Ye, Yongheng; Xu, Guoyong; Zhao, Qing
2018-06-12
Long Non-Coding RNA Reprogramming (lncRNA-ROR) plays an important role in regulating various biologic processes, whereas the effect of lncRNA-ROR in osteoarthritis (OA) is little studied. This study aimed to explore lncRNA-ROR expression in articular cartilage and identify the functional mechanism of lncRNA-ROR in OA. OA cartilage tissues were obtained from 15 OA patients, and 6 normal cartilage tissues were set as controls. Chondrocytes were isolated from the collected cartilage tissues. lncRNA-ROR was knockdown in normal cells and overexpressed in OA cells. Cell viability was determined with Cell Counting Kit-8 assay, and apoptosis was measured using flow cytometric analysis. Moreover, proteins and mRNAs involved in this study were also measured using Western blotting and quantitative real-time PCR (qPCR). Level of lncRNA-ROR was decreased in OA compared with normal chondrocytes, and overexpression of lncRNA-ROR dramatically promoted cell viability of OA chondrocytes. In addition, knockdown lncRNA-ROR inhibited apoptosis and promoted autophagy of normal chondrocytes. Moreover, lncRNA-ROR inhibited the expression of p53 in both mRNA and protein levels. Furthermore, we revealed that lncRNA-ROR regulated apoptosis and autophagy of chondrocytes via HIF1α and p53. The results indicated that lncRNA-ROR played a critical role in the pathogenesis of OA, suggesting that lncRNA-ROR could serve as a new potential therapeutic target for OA. © 2018 Wiley Periodicals, Inc.
Nie, Ji; Zhang, De-Wen; Tie, Cai; Zhou, Ying-Lin; Zhang, Xin-Xiang
2013-11-15
The combination of aptamer and peroxidase-mimicking DNAzyme within a hairpin structure can form a functional DNA probe. The activities of both aptamer (as biorecognition element) and DNAzyme (as signal amplification element) are blocked via base pairing in the hairpin structure. The presence of target triggers the opening of the hairpin to form target/aptamer complex and releases G-quadruplex sequence which can generate amplified colorimetric signals. In this work, we elaborated a universal and simple procedure to design an efficient and sensitive hairpin probe with suitable functional DNA partners. A fill-in-the-blank process was developed for sequence design, and two key points including the pretreatment of the hairpin probe and the selection of suitable signal transducer sequence were proved to enhance the detection sensitivity. Cocaine was chosen as a model target for a proof of concept. A series of hairpins with different numbers of base pairs in the stem region were prepared. Hairpin-C10 with ten base pairs was screened out and a lowest detectable cocaine concentration of 5 μM by colorimetry was obtained. The proposed functional DNA hairpin showed good selectivity and satisfactory analysis in spiked biologic fluid. The whole "mix-and-measure" detection based on DNA hairpin without the need of immobilization and labeling was indicated to be time and labor saving. The strategy has potential to be transplanted into more smart hairpins toward other targets for general application in bioanalytical chemistry. Copyright © 2013 Elsevier B.V. All rights reserved.
Moreno-Maldonado, Rodolfo; Murillas, Rodolfo; Page, Angustias; Suarez-Cabrera, Cristian; Alameda, Josefa P.; Bravo, Ana; Casanova, M. Llanos
2014-01-01
Inhibition of gene expression through siRNAs is a tool increasingly used for the study of gene function in model systems, including transgenic mice. To achieve perdurable effects, the stable expression of siRNAs by an integrated transgenic construct is necessary. For transgenic siRNA expression, promoters transcribed by either RNApol II or III (such as U6 or H1 promoters) can be used. Relatively large amounts of small RNAs synthesis are achieved when using RNApol III promoters, which can be advantageous in knockdown experiments. To study the feasibility of H1 promoter-driven RNAi-expressing constructs for protein knockdown in transgenic mice, we chose IKK1 as the target gene. Our results indicate that constructs containing the H1 promoter are sensitive to the presence of prokaryotic sequences and to transgene position effects, similar to RNApol II promoters-driven constructs. We observed variable expression levels of transgenic siRNA among different tissues and animals and a reduction of up to 80% in IKK1 expression. Furthermore, IKK1 knockdown led to hair follicle alterations. In summary, we show that constructs directed by the H1 promoter can be used for knockdown of genes of interest in different organs and for the generation of animal models complementary to knockout and overexpression models. PMID:24523631
Nakano, Masataka; Fukami, Tatsuki; Gotoh, Saki; Takamiya, Masataka; Aoki, Yasuhiro; Nakajima, Miki
2016-01-08
Adenosine to inosine (A-to-I) RNA editing is the most frequent type of post-transcriptional nucleotide conversion in humans, and it is catalyzed by adenosine deaminase acting on RNA (ADAR) enzymes. In this study we investigated the effect of RNA editing on human aryl hydrocarbon receptor (AhR) expression because the AhR transcript potentially forms double-stranded structures, which are targets of ADAR enzymes. In human hepatocellular carcinoma-derived Huh-7 cells, the ADAR1 knockdown reduced the RNA editing levels in the 3'-untranslated region (3'-UTR) of the AhR transcript and increased the AhR protein levels. The ADAR1 knockdown enhanced the ligand-mediated induction of CYP1A1, a gene downstream of AhR. We investigated the possibility that A-to-I RNA editing creates miRNA targeting sites in the AhR mRNA and found that the miR-378-dependent down-regulation of AhR was abolished by ADAR1 knockdown. These results indicated that the ADAR1-mediated down-regulation of AhR could be attributed to the creation of a miR-378 recognition site in the AhR 3'-UTR. The interindividual differences in the RNA editing levels within the AhR 3'-UTR in a panel of 32 human liver samples were relatively small, whereas the differences in ADAR1 expression were large (220-fold). In the human liver samples a significant inverse association was observed between the miR-378 and AhR protein levels, suggesting that the RNA-editing-dependent down-regulation of AhR by miR-378 contributes to the variability in the constitutive hepatic expression of AhR. In conclusion, this study uncovered for the first time that A-to-I RNA editing modulates the potency of xenobiotic metabolism in the human liver. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Ke, Rui; Liu, Lu; Zhu, Yanting; Li, Shaojun; Xie, Xinming; Li, Fangwei; Song, Yang; Yang, Lan; Gao, Li; Li, Manxiang
2016-01-01
It has been shown that activation of adenosine monophosphate-activated protein kinase (AMPK) suppresses proliferation of a variety of tumor cells as well as nonmalignant cells. In this study, we used post-transcriptional gene silencing with small interfering RNA (siRNA) to specifically examine the effect of AMPK on pulmonary arterial smooth muscle cells (PASMCs) proliferation and to further elucidate its underlying molecular mechanisms. Our results showed that knockdown of AMPKα2 promoted primary cultured PASMCs proliferation; this was accompanied with the elevation of phosphorylation of mammalian target of rapamycin (mTOR) and S-phase kinase-associated protein 2 (Skp2) protein level and reduction of p27Kip1. Importantly, prior silencing of mTOR with siRNA abolished AMPKα2 knockdown-induced Skp2 upregulation, p27Kip1 reduction as well as PASMCs proliferation. Furthermore, pre-depletion of Skp2 by siRNA also eliminated p27Kip1 downregulation and PASMCs proliferation caused by AMPKα2 knockdown. Taken together, our study indicates that AMPKα2 isoform plays an important role in regulation of PASMCs proliferation by modulating mTOR/Skp2/p27Kip1 axis, and suggests that activation of AMPKα2 might have potential value in the prevention and treatment of pulmonary arterial hypertension. PMID:27258250
Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound
McTiernan, Charles F.; Chen, Xucai; Klein, Edwin C.; Villanueva, Flordeliza S.
2016-01-01
RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848
Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.
Kopechek, Jonathan A; Carson, Andrew R; McTiernan, Charles F; Chen, Xucai; Klein, Edwin C; Villanueva, Flordeliza S
2016-01-01
RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.
Broda, Magdalena; Kierzek, Elzbieta; Gdaniec, Zofia; Kulinski, Tadeusz; Kierzek, Ryszard
2005-08-16
Trinucleotide repeat expansion diseases (TREDs) are correlated with elongation of CNG DNA and RNA repeats to pathological level. This paper shows, for the first time, complete data concerning thermodynamic stabilities of RNA with CNG trinucleotide repeats. Our studies include the stability of oligoribonucleotides composed of two to seven of CAG, CCG, CGG, and CUG repeats. The thermodynamic parameters of helix propagation correlated with the presence of multiple N-N mismatches within CNG RNA duplexes were also determined. Moreover, the total stability of CNG RNA hairpins, as well as the contribution of trinucleotide repeats placed only in the stem or loop regions, was evaluated. The improved thermodynamic parameters allow to predict much more accurately the thermodynamic stabilities and structures of CNG RNAs.
Li, Qing; Karim, Ahmad F.; Ding, Xuedong; Das, Biswajit; Dobrowolski, Curtis; Gibson, Richard M.; Quiñones-Mateu, Miguel E.; Karn, Jonathan; Rojas, Roxana E.
2016-01-01
Chemical regulation of macrophage function is one key strategy for developing host-directed adjuvant therapies for tuberculosis (TB). A critical step to develop these therapies is the identification and characterization of specific macrophage molecules and pathways with a high potential to serve as drug targets. Using a barcoded lentivirus-based pooled short-hairpin RNA (shRNA) library combined with next generation sequencing, we identified 205 silenced host genes highly enriched in mycobacteria-resistant macrophages. Twenty-one of these “hits” belonged to the oxidoreductase functional category. NAD(P)H:quinone oxidoreductase 1 (NQO1) was the top oxidoreductase “hit”. NQO1 expression was increased after mycobacterial infection, and NQO1 knockdown increased macrophage differentiation, NF-κB activation, and the secretion of pro-inflammatory cytokines TNF-α and IL-1β in response to infection. This suggests that mycobacteria hijacks NQO1 to down-regulate pro-inflammatory and anti-bacterial functions. The competitive inhibitor of NQO1 dicoumarol synergized with rifampin to promote intracellular killing of mycobacteria. Thus, NQO1 is a new host target in mycobacterial infection that could potentially be exploited to increase antibiotic efficacy in vivo. Our findings also suggest that pooled shRNA libraries could be valuable tools for genome-wide screening in the search for novel druggable host targets for adjunctive TB therapies. PMID:27297123
Acute tau knockdown in the hippocampus of adult mice causes learning and memory deficits.
Velazquez, Ramon; Ferreira, Eric; Tran, An; Turner, Emily C; Belfiore, Ramona; Branca, Caterina; Oddo, Salvatore
2018-05-10
Misfolded and hyperphosphorylated tau accumulates in several neurodegenerative disorders including Alzheimer's disease, frontotemporal dementia with Parkinsonism, corticobasal degeneration, progressive supranuclear palsy, Down syndrome, and Pick's disease. Tau is a microtubule-binding protein, and its role in microtubule stabilization is well defined. In contrast, while growing evidence suggests that tau is also involved in synaptic physiology, a complete assessment of tau function in the adult brain has been hampered by robust developmental compensation of other microtubule-binding proteins in tau knockout mice. To circumvent these developmental compensations and assess the role of tau in the adult brain, we generated an adeno-associated virus (AAV) expressing a doxycycline-inducible short-hairpin (Sh) RNA targeted to tau, herein referred to as AAV-ShRNATau. We performed bilateral stereotaxic injections in 7-month-old C57Bl6/SJL wild-type mice with either the AAV-ShRNATau or a control AAV. We found that acute knockdown of tau in the adult hippocampus significantly impaired motor coordination and spatial memory. Blocking the expression of the AAV-ShRNATau, thereby allowing tau levels to return to control levels, restored motor coordination and spatial memory. Mechanistically, the reduced tau levels were associated with lower BDNF levels, reduced levels of synaptic proteins associated with learning, and decreased spine density. We provide compelling evidence that tau is necessary for motor and cognitive function in the adult brain, thereby firmly supporting that tau loss-of-function may contribute to the clinical manifestations of many tauopathies. These findings have profound clinical implications given that anti-tau therapies are in clinical trials for Alzheimer's disease. © 2018 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
Zinc finger protein 598 inhibits cell survival by promoting UV-induced apoptosis.
Yang, Qiaohong; Gupta, Romi
2018-01-19
UV is one of the major causes of DNA damage induced apoptosis. However, cancer cells adopt alternative mechanisms to evade UV-induced apoptosis. To identify factors that protect cancer cells from UV-induced apoptosis, we performed a genome wide short-hairpin RNA (shRNA) screen, which identified Zinc finger protein 598 (ZNF598) as a key regulator of UV-induced apoptosis. Here, we show that UV irradiation transcriptionally upregulates ZNF598 expression. Additionally, ZNF598 knockdown in cancer cells inhibited UV-induced apoptosis. In our study, we observe that ELK1 mRNA level as well as phosphorylated ELK1 levels was up regulated upon UV irradiation, which was necessary for UV irradiation induced upregulation of ZNF598. Cells expressing ELK1 shRNA were also resistant to UV-induced apoptosis, and phenocopy ZNF598 knockdown. Upon further investigation, we found that ZNF598 knockdown inhibits UV-induced apoptotic gene expression, which matches with decrease in percentage of annexin V positive cell. Similarly, ectopic expression of ZNF598 promoted apoptotic gene expression and also increased annexin V positive cells. Collectively, these results demonstrate that ZNF598 is a UV irradiation regulated gene and its loss results in resistance to UV-induced apoptosis.
Competitive folding of RNA structures at a termination–antitermination site
Ait-Bara, Soraya; Clerté, Caroline; Declerck, Nathalie; Margeat, Emmanuel
2017-01-01
Antitermination is a regulatory process based on the competitive folding of terminator–antiterminator structures that can form in the leader region of nascent transcripts. In the case of the Bacillus subtilis licS gene involved in β-glucosides utilization, the binding of the antitermination protein LicT to a short RNA hairpin (RAT) prevents the formation of an overlapping terminator and thereby allows transcription to proceed. Here, we monitored in vitro the competition between termination and antitermination by combining bulk and single-molecule fluorescence-based assays using labeled RNA oligonucleotide constructs of increasing length that mimic the progressive transcription of the terminator invading the antiterminator hairpin. Although high affinity binding is abolished as soon as the antiterminator basal stem is disrupted by the invading terminator, LicT can still bind and promote closing of the partially unfolded RAT hairpin. However, binding no longer occurs once the antiterminator structure has been disrupted by the full-length terminator. Based on these findings, we propose a kinetic competition model for the sequential events taking place at the termination–antitermination site, where LicT needs to capture its RAT target before completion of the terminator to remain tightly bound during RNAP pausing, before finally dissociating irreversibly from the elongated licS transcript. PMID:28235843
Knockdown of cullin 4A inhibits growth and increases chemosensitivity in lung cancer cells.
Hung, Ming-Szu; Chen, I-Chuan; You, Liang; Jablons, David M; Li, Ya-Chin; Mao, Jian-Hua; Xu, Zhidong; Lung, Jr-Hau; Yang, Cheng-Ta; Liu, Shih-Tung
2016-07-01
Cullin 4A (Cul4A) has been observed to be overexpressed in various cancers. In this study, the role of Cul4A in the growth and chemosensitivity in lung cancer cells were studied. We showed that Cul4A is overexpressed in lung cancer cells and tissues. Knockdown of the Cul4A expression by shRNA in lung cancer cells resulted in decreased cellular proliferation and growth in lung cancer cells. Increased sensitivity to gemcitabine, a chemotherapy drug, was also noted in those Cul4A knockdown lung cancer cells. Moreover, increased expression of p21, transforming growth factor (TGF)-β inducible early gene-1 (TIEG1) and TGF beta-induced (TGFBI) was observed in lung cancer cells after Cul4A knockdown, which may be partially related to increased chemosensitivity to gemcitabine. G0/G1 cell cycle arrest was also noted after Cul4A knockdown. Notably, decreased tumour growth and increased chemosensitivity to gemcitabine were also noted after Cul4A knockdown in lung cancer xenograft nude mice models. In summary, our study showed that targeting Cul4A with RNAi or other techniques may provide a possible insight to the development of lung cancer therapy in the future. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Brain gene expression changes elicited by peripheral vitellogenin knockdown in the honey bee.
Wheeler, M M; Ament, S A; Rodriguez-Zas, S L; Robinson, G E
2013-10-01
Vitellogenin (Vg) is best known as a yolk protein precursor. Vg also functions to regulate behavioural maturation in adult honey bee workers, but the underlying molecular mechanisms by which it exerts this novel effect are largely unknown. We used abdominal vitellogenin (vg) knockdown with RNA interference (RNAi) and brain transcriptomic profiling to gain insights into how Vg influences honey bee behavioural maturation. We found that vg knockdown caused extensive gene expression changes in the bee brain, with much of this transcriptional response involving changes in central biological functions such as energy metabolism. vg knockdown targeted many of the same genes that show natural, maturation-related differences, but the direction of change for the genes in these two contrasts was not correlated. By contrast, vg knockdown targeted many of the same genes that are regulated by juvenile hormone (JH) and there was a significant correlation for the direction of change for the genes in these two contrasts. These results indicate that the tight coregulatory relationship that exists between JH and Vg in the regulation of honey bee behavioural maturation is manifest at the genomic level and suggest that these two physiological factors act through common pathways to regulate brain gene expression and behaviour. © 2013 Royal Entomological Society.
Zeng, Bo; Zeng, Zhen; Liu, Chang; Yang, Yaying
2017-06-01
Objective To investigate the effect of Golgi α-mannosidase II (GM2) gene knockdown on adhesion abilities of BGC-823 human gastric carcinoma cells. Methods Three plasmid vectors expressing GM2 shRNAs and a negative control plasmid vector were designed, constructed and then transfected into BGC-823 cells by Lipofectamine TM 2000. After transfection, the mRNA and protein levels of GM2 in BGC-823 cells were detected by real-time quantitative PCR (qRT-PCR) and Western blotting to evaluate the transfection efficacy. The best plasmid for GM2 gene knockdown was selected and stably transfected into BGC-823 cells. Adhesion abilities of BGC-823 cells after GM2 gene silencing were observed by cell-cell, cell-matrix and cell-endothelial cell adhesion assays. At the same time, the expressions of E-cadherin, P-selectin, CD44v6 and intercellular adhesion molecule-1 (ICAM-1) proteins were detected by Western blotting after GM2 gene knockdown. Results The expression of GM2 was effectively knockdown in GM2-shRNA-2-transfected BGC-823 cells. Compared with the blank control group and the negative control group, the intercellular adhesion ability of the GM2-shRNA-2-transfected cells increased significantly, while their cell-matrix and cell-endothelium adhesion abilities markedly decreased. In GM2-shRNA-2 transfection group, E-cadherin expression was significantly elevated and the P-selectin expression was significantly reduced, while the expression levels of CD44v6 and ICAM-1 were not obviously changed. Conclusion After GM2 gene knockdown, the intercellular adhesion ability of gastric carcinoma BGC-823 cells is enhanced, while the adhesion abilities with the extracellular matrix and endothelial cells are weakened. The changes might be related to the up-regulated expression of E-cadherin and the down-regulation of P-selectin.
Xu, Xiaohui; Ma, Congmin; Liu, Chao; Duan, Zhihui; Zhang, Li
2018-06-14
Atherosclerosis remains to be one of the most common vascular disorders resulting in morbidity and mortality in the world. Recent studies suggested that endothelial cells (ECs) injury caused by oxidative low-density lipoprotein (ox-LDL) is an early marker for atherosclerosis. Nevertheless, the mechanisms of ox-LDL-induced ECs injury are complicated and largely unknown. Here, we found lncRNA XIST (X-inactive specific transcript) was upregulated in human umbilical vein endothelial cells (HUVECs) stimulated by ox-LDL. Knockdown of XIST boosted the cell viability and suppressed cell apoptosis under ox-LDL stimuli. Further experiments identified XIST regulated the expression of Nucleotide-Binding Oligomerization Domain 2 (NOD2) by sponging miR-320. XIST silencing exerted a protective effect on ox-LDL-induced HUVECs injury via miR-320/NOD2 regulatory network. Our data provide insight into the role of the lncRNA XIST in ox-LDL mediated ECs injury, which can aid in developing new therapeutic strategies for the treatment of atherosclerosis. Copyright © 2018 Elsevier Inc. All rights reserved.
MiRduplexSVM: A High-Performing MiRNA-Duplex Prediction and Evaluation Methodology
Karathanasis, Nestoras; Tsamardinos, Ioannis; Poirazi, Panayiota
2015-01-01
We address the problem of predicting the position of a miRNA duplex on a microRNA hairpin via the development and application of a novel SVM-based methodology. Our method combines a unique problem representation and an unbiased optimization protocol to learn from mirBase19.0 an accurate predictive model, termed MiRduplexSVM. This is the first model that provides precise information about all four ends of the miRNA duplex. We show that (a) our method outperforms four state-of-the-art tools, namely MaturePred, MiRPara, MatureBayes, MiRdup as well as a Simple Geometric Locator when applied on the same training datasets employed for each tool and evaluated on a common blind test set. (b) In all comparisons, MiRduplexSVM shows superior performance, achieving up to a 60% increase in prediction accuracy for mammalian hairpins and can generalize very well on plant hairpins, without any special optimization. (c) The tool has a number of important applications such as the ability to accurately predict the miRNA or the miRNA*, given the opposite strand of a duplex. Its performance on this task is superior to the 2nts overhang rule commonly used in computational studies and similar to that of a comparative genomic approach, without the need for prior knowledge or the complexity of performing multiple alignments. Finally, it is able to evaluate novel, potential miRNAs found either computationally or experimentally. In relation with recent confidence evaluation methods used in miRBase, MiRduplexSVM was successful in identifying high confidence potential miRNAs. PMID:25961860
Quan, J; Zhou, L; Qu, J
2015-03-09
Products of the Pim (the proviral integration site for the Moloney murine leukemia virus) family of proto—oncogenes possess serine/threonine kinase activity and belong to the Ca2+/calmodulin—dependent protein kinase group. Pim—3, a member of the Pim family is closely linked to the development of a variety of tumors. However, the role of Pim—3 in human glioblastoma remains unknown. In this study, we elucidated the role of Pim—3 in the growth and apoptosis of glioblastoma cells. Western blotting was used for determination of protein levels, and shRNA was used for Pim—3 knockdown. The MTT assay was used to evaluate cell proliferation and flow cytometry was used to determine cell cycle status and the number of apoptotic cells. A mouse xenograft model was established by injecting nude mice with Pim—3—depleted glioblastoma cells in order to determine tumor growth in vivo. We demonstrated that Pim—3 was highly expressed in human glioblastoma cell lines. We also found that knockdown of Pim—3 by specific shRNA slowed decreased proliferation, induced cell cycle arrest in the G0/G1 phase, and increased apoptosis in glioblastoma cells. Pim—3 knockdown potently inhibited the growth of subcutaneously implanted glioblastoma cells in vivo. We further revealed that Pim—3 knockdown induced growth inhibition by reducing the levels of the anti—apoptotic protein Bcl—xl and cell cycle regulatory proteins, including cyclin D1 and Cdc25C, and increasing the levels of the pro—apoptotic protein Bax.
Structure-Function Model for Kissing Loop Interactions That Initiate Dimerization of Ty1 RNA
Gamache, Eric R.; Doh, Jung H.; Ritz, Justin; Laederach, Alain; Bellaousov, Stanislav; Mathews, David H.; Curcio, M. Joan
2017-01-01
The genomic RNA of the retrotransposon Ty1 is packaged as a dimer into virus-like particles. The 5′ terminus of Ty1 RNA harbors cis-acting sequences required for translation initiation, packaging and initiation of reverse transcription (TIPIRT). To identify RNA motifs involved in dimerization and packaging, a structural model of the TIPIRT domain in vitro was developed from single-nucleotide resolution RNA structural data. In general agreement with previous models, the first 326 nucleotides of Ty1 RNA form a pseudoknot with a 7-bp stem (S1), a 1-nucleotide interhelical loop and an 8-bp stem (S2) that delineate two long, structured loops. Nucleotide substitutions that disrupt either pseudoknot stem greatly reduced helper-Ty1-mediated retrotransposition of a mini-Ty1, but only mutations in S2 destabilized mini-Ty1 RNA in cis and helper-Ty1 RNA in trans. Nested in different loops of the pseudoknot are two hairpins with complementary 7-nucleotide motifs at their apices. Nucleotide substitutions in either motif also reduced retrotransposition and destabilized mini- and helper-Ty1 RNA. Compensatory mutations that restore base-pairing in the S2 stem or between the hairpins rescued retrotransposition and RNA stability in cis and trans. These data inform a model whereby a Ty1 RNA kissing complex with two intermolecular kissing-loop interactions initiates dimerization and packaging. PMID:28445416
Macromolecular crowding impacts on the diffusion and conformation of DNA hairpins
NASA Astrophysics Data System (ADS)
Stiehl, Olivia; Weidner-Hertrampf, Kathrin; Weiss, Matthias
2015-01-01
Biochemical reactions in crowded fluids differ significantly from those in dilute solutions. Both, excluded-volume interactions with surrounding macromolecules ("crowders") and an enhanced rebinding of reaction partners due to crowding-induced viscoelasticity and subdiffusion have been hypothesized to shift chemical equilibria towards the associated state. We have explored the impact of both cues in an experimentally tunable system by monitoring the steady-state fraction of open DNA hairpins in crowded fluids with varying viscoelastic characteristics but similar occupied volume fractions. As a result, we observed an increased fraction of closed DNA hairpins in viscoelastic crowded fluids. Our observations compare favorably to a simple statistical model that considers both facets of crowding, while preferential interactions between crowders and DNA hairpins appear to have little influence.
Propensities of peptides containing the Asn-Gly segment to form β-turn and β-hairpin structures.
Kang, Young Kee; Yoo, In Kee
2016-09-01
The propensities of peptides that contain the Asn-Gly segment to form β-turn and β-hairpin structures were explored using the density functional methods and the implicit solvation model in CH2 Cl2 and water. The populations of preferred β-turn structures varied depending on the sequence and solvent polarity. In solution, β-hairpin structures with βI' turn motifs were most preferred for the heptapeptides containing the Asn-Gly segment regardless of the sequence of the strands. These preferences in solution are consistent with the corresponding X-ray structures. The sequence, H-bond strengths, solvent polarity, and conformational flexibility appeared to interact to determine the preferred β-hairpin structure of each heptapeptide, although the β-turn segments played a role in promoting the formation of β-hairpin structures and the β-hairpin propensity varied. In the heptapeptides containing the Asn-Gly segment, the β-hairpin formation was enthalpically favored and entropically disfavored at 25°C in water. The calculated results for β-turns and β-hairpins containing the Asn-Gly segment imply that these structural preferences may be useful for the design of bioactive macrocyclic peptides containing β-hairpin mimics and the design of binding epitopes for protein-protein and protein-nucleic acid recognitions. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 653-664, 2016. © 2016 Wiley Periodicals, Inc.
Hoa, Neil T; Ge, Lisheng; Erickson, Kate L; Kruse, Carol A; Cornforth, Andrew N; Kuznetsov, Yurii; McPherson, Alex; Martini, Filippo; Jadus, Martin R
2015-01-01
Cancer cells derived from Glioblastoma multiforme possess membranous protrusions allowing these cells to infiltrate surrounding tissue, while resisting lymphocyte cytotoxicity. Microvilli and filopodia are supported by actin filaments cross-linked by fascin. Fascin-1 was genetically silenced within human U251 glioma cells; these knock-down glioma cells lost their microvilli/filopodia. The doubling time of these fascin-1 knock-down cells was doubled that of shRNA control U251 cells. Fascin-1 knock-down cells lost their transmigratory ability responding to interleukin-6 or insulin-like growth factor-1. Fascin-1 silenced U251 cells were more easily killed by cytolytic lymphocytes. Fascin-1 knock-down provides unique opportunities to augment glioma immunotherapy by simultaneously targeting several key glioma functions: like cell transmigration, cell division and resisting immune responses. PMID:25901196
LI, BEI-XU; LUO, CHENG-LIANG; LI, HUI; YANG, PENG; ZHANG, MING-CHANG; XU, HONG-MEI; XU, HONG-FEI; SHEN, YI-WEN; XUE, AI-MIN; ZHAO, ZI-QIN
2012-01-01
Jumonji domain containing 2A (JMJD2A) is a potential cancer-associated gene that may be involved in human breast cancer. The present study aimed to investigate suppressive effects on the MCF-7 human breast cancer cell line by transfection with JMJD2A-specific siRNA. Quantitative real-time PCR and western blot analysis were used to detect the expression levels of JMJD2A. Flow cytometric (FCM) analysis and WST-8 assay were used to evaluate cell proliferation. Boyden chambers were used in cell migration and invasion assays to evaluate the cell exercise capacity. Expression levels of JMJD2A mRNA and protein in the siRNA group were both downregulated successfully by transfection. FCM results showed that the percentage of cells in the G0/G1 phase in the siRNA group was significantly greater than that in the blank (P<0.05) and negative control groups (P<0.05). Additionally, the mean absorbance in the siRNA group was significantly lower (P<0.05), as observed by WST-8 assay. Moreover, a decreased number of migrated cells in the siRNA group was observed (P<0.05) using a cell migration and invasion assay. These data indicated that knockdown of JMJD2A may cause inhibition of proliferation, migration and invasion of MCF-7 cells. This study provides a new perspective in understanding the molecular mechanisms underlying the progression of breast cancer and offers a potential therapeutic target for breast cancer. PMID:23170139
Wen, Guangming; Dong, Wenxia; Liu, Bin; Li, Zhongping; Fan, Lifang
2018-05-29
A novel cascade photoelectrochemical (PEC) signal amplification biosensing tactics was developed for DNA detection based on a target-driven DNA association to induce cyclic hairpin assembly. In the circulatory system there are two ssDNA (A and B) and two hairpins (C and D). The hybridization of these ssDNA led to the formation of an A-target-B structure. The close proximity of their toehold and branch-migration regions was able to induce the cyclic hairpin assembly. Afterwards, the assembly result further causes the separation of a double-stranded probe DNA (Q:F) to switch the PEC signal via toehold-mediated strand replacement. As such, the signal stranded DNA-CdS QDs (F) as the signal tag was released in the presence of the target DNA. The signal DNA-CdS QDs was then coated to F-doped tin oxide (FTO) electrode leading to the "signal-on" PEC signal. The designed biosensing strategy showed a low detection limit of 21.3 pM for target DNA and a broad linear range from 50 pM to 100 nM. This signal amplification PEC sensing method exhibited a potential application to detect protein molecules, RNA or metal ions via changing the sequence of A and B recognition. Copyright © 2018 Elsevier B.V. All rights reserved.
Effects of a mutation on the folding mechanism of a beta-hairpin.
Juraszek, Jarek; Bolhuis, Peter G
2009-12-17
The folding mechanism of a protein is determined by its primary sequence. Yet, how the mechanism is changed by a mutation is still poorly understood, even for basic secondary structures such as beta-hairpins. We perform an extensive simulation study of the effects of mutating the GB1 beta-hairpin into Trpzip4 (Y5W, F12W, V14W) on the folding mechanism. While Trpzip4 has a much more stable native state due to very strong hydrophobic interactions of the side chains, its folding rate does not differ significantly from the wild type beta-hairpin. We sample the free-energy landscapes of both hairpins with Replica Exchange Molecular Dynamics (REMD) and identify the four (meta)stable states (U, H, F, and N). Using Transition Path Sampling (TPS), we then harvest ensembles of unbiased pathways between the H and F states and between the F and N states to investigate the unbiased folding mechanisms. In both hairpins, the hydrophobic collapse (U-H) is followed by the middle hydrogen bond formation (H-F), and finally a closing of the strands in a zipper-like fashion (F-N). For the Trpzip4, the path ensembles indicate that the final F-N step is much more difficult than for GB1 and involves partial unfolding, rezipping of hydrogen bonds, and rearrangement of the Trp-14 side chain. For the rate-limiting (H-F) step, the path ensembles show that in GB1 desolvation and strand closure go hand in hand, while in Trpzip4 desolvation is decoupled from strand closure. Nevertheless, likelihood maximization shows that the reaction coordinate for both hairpins remains the interstrand distance. We conclude that the folding mechanism of both hairpins is a combination of hydrophobic collapse and zipping of hydrogen bonds but that the zipper mechanism is more visible in Trpzip4. A major difference between the two hairpins is that in the transition state of the rate-limiting step for Trpzip4 one tryptophan is exposed to the solvent due to steric hindrance, making the folding mechanism more complex
Electronic Interactions of Michler's Ketone with DNA Bases in Synthetic Hairpins.
Jalilov, Almaz S; Young, Ryan M; Eaton, Samuel W; Wasielewski, Michael R; Lewis, Frederick D
2015-01-01
The mechanism and dynamics of photoinduced electron transfer in two families of DNA hairpins possessing Michler's ketone linkers have been investigated by means of steady state and time-resolved transient absorption and emission spectroscopies. The excited state behavior of the diol linker employed in hairpin synthesis is similar to that of Michler's ketone in methanol solution. Hairpins possessing only a Michler's ketone linker undergo fast singlet state charge separation and charge recombination with an adjacent purine base, attributed to well-stacked ground state conformations, and intersystem crossing to the triplet state, attributed to poorly stacked ground state conformations. The failure of the triplet to undergo electron transfer reactions on the 7 ns time scale of our measurements is attributed to the low triplet energy and reduction potential of the twisted triplet state. Hairpins possessing both a Michler's ketone linker and a perylenediimide base surrogate separated by four base pairs undergo photoinduced hole transport from the diimide to Michler's ketone upon excitation of the diimide. The efficiency of hole transport is dependent upon the sequence of the intervening purine bases. © 2014 The American Society of Photobiology.
Zhao, Di; Wang, Wei; Wang, Hao; Peng, Honghai; Liu, Xiangjuan; Guo, Weixing; Su, Guohai; Zhao, Zhuo
2017-01-01
Growing evidence shows that protein kinase D (PKD) plays an important role in the development of pressure overload-induced cardiac hypertrophy. However, the mechanisms involved are not clear. This study tested our hypothesis that PKD might mediate cardiac hypertrophy by negatively regulating autophagy using the technique of PKD knockdown by siRNA. Cardiac hypertrophy was induced in 8-week old male C57BL/6 mice by transverse aortic constriction (TAC). TAC mice were then divided into five groups receiving the treatments of vehicle (DMSO), an autophagy inducer rapamycin (1 mg/kg/day, i.p.), control siRNA, lentiviral PKD siRNA (2×10 8 transducing units/0.1 ml, i.v. injection in one day after surgery, and repeated in 2 weeks after surgery), and PKD siRNA plus 3-methyladenine (3-MA, an autophagy inhibitor, 20 mg/kg/day, i.p.), respectively. Four weeks after TAC surgery, echocardiographic study, hematoxylin and eosin (HE) staining, and Masson's staining showed mice with TAC had significantly hypertrophy and remodeling compared with sham animals. Treatments with PKD siRNA or rapamycin significantly ameliorated the cardiac hypertrophy and dysfunction. Moreover, PKD siRNA increased cardiac autophagic activity determined by electron micrographic study and the biomarkers by Western blot, accompanied with the downregulated AKT/mTOR/S6K signaling pathway. All the cardiac effects of PDK knockdown were inhibited by co-treatment with 3-MA. These results suggest that PKD is involved in the development of cardiac hypertrophy by inhibiting cardiac autophagy via AKT/mTOR pathway.
Zhao, Di; Wang, Wei; Wang, Hao; Peng, Honghai; Liu, Xiangjuan; Guo, Weixing; Su, Guohai; Zhao, Zhuo
2017-01-01
Growing evidence shows that protein kinase D (PKD) plays an important role in the development of pressure overload-induced cardiac hypertrophy. However, the mechanisms involved are not clear. This study tested our hypothesis that PKD might mediate cardiac hypertrophy by negatively regulating autophagy using the technique of PKD knockdown by siRNA. Cardiac hypertrophy was induced in 8-week old male C57BL/6 mice by transverse aortic constriction (TAC). TAC mice were then divided into five groups receiving the treatments of vehicle (DMSO), an autophagy inducer rapamycin (1 mg/kg/day, i.p.), control siRNA, lentiviral PKD siRNA (2×108 transducing units/0.1 ml, i.v. injection in one day after surgery, and repeated in 2 weeks after surgery), and PKD siRNA plus 3-methyladenine (3-MA, an autophagy inhibitor, 20 mg/kg/day, i.p.), respectively. Four weeks after TAC surgery, echocardiographic study, hematoxylin and eosin (HE) staining, and Masson's staining showed mice with TAC had significantly hypertrophy and remodeling compared with sham animals. Treatments with PKD siRNA or rapamycin significantly ameliorated the cardiac hypertrophy and dysfunction. Moreover, PKD siRNA increased cardiac autophagic activity determined by electron micrographic study and the biomarkers by Western blot, accompanied with the downregulated AKT/mTOR/S6K signaling pathway. All the cardiac effects of PDK knockdown were inhibited by co-treatment with 3-MA. These results suggest that PKD is involved in the development of cardiac hypertrophy by inhibiting cardiac autophagy via AKT/mTOR pathway. PMID:28367092
Rapid Creation and Quantitative Monitoring of High Coverage shRNA Libraries
Bassik, Michael C.; Lebbink, Robert Jan; Churchman, L. Stirling; Ingolia, Nicholas T.; Patena, Weronika; LeProust, Emily M.; Schuldiner, Maya; Weissman, Jonathan S.; McManus, Michael T.
2009-01-01
Short hairpin RNA (shRNA) libraries are limited by the low efficacy of many shRNAs, giving false negatives, and off-target effects, giving false positives. Here we present a strategy for rapidly creating expanded shRNA pools (∼30 shRNAs/gene) that are analyzed by deep-sequencing (EXPAND). This approach enables identification of multiple effective target-specific shRNAs from a complex pool, allowing a rigorous statistical evaluation of whether a gene is a true hit. PMID:19448642
Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin
2012-01-01
Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150
Pressure modulates the self-cleavage step of the hairpin ribozyme
NASA Astrophysics Data System (ADS)
Schuabb, Caroline; Kumar, Narendra; Pataraia, Salome; Marx, Dominik; Winter, Roland
2017-03-01
The ability of certain RNAs, denoted as ribozymes, to not only store genetic information but also catalyse chemical reactions gave support to the RNA world hypothesis as a putative step in the development of early life on Earth. This, however, might have evolved under extreme environmental conditions, including the deep sea with pressures in the kbar regime. Here we study pressure-induced effects on the self-cleavage of hairpin ribozyme by following structural changes in real-time. Our results suggest that compression of the ribozyme leads to an accelerated transesterification reaction, being the self-cleavage step, although the overall process is retarded in the high-pressure regime. The results reveal that favourable interactions between the reaction site and neighbouring nucleobases are strengthened under pressure, resulting therefore in an accelerated self-cleavage step upon compression. These results suggest that properly engineered ribozymes may also act as piezophilic biocatalysts in addition to their hitherto known properties.
Naeem, Aishath S; Tommasi, Cristina; Cole, Christian; Brown, Stuart J; Zhu, Yanan; Way, Benjamin; Willis Owen, Saffron A G; Moffatt, Miriam; Cookson, William O; Harper, John I; Di, Wei-Li; Brown, Sara J; Reinheckel, Thomas; O'Shaughnessy, Ryan F L
2017-04-01
Filaggrin, which is encoded by the filaggrin gene (FLG), is an important component of the skin's barrier to the external environment, and genetic defects in FLG strongly associate with atopic dermatitis (AD). However, not all patients with AD have FLG mutations. We hypothesized that these patients might possess other defects in filaggrin expression and processing contributing to barrier disruption and AD, and therefore we present novel therapeutic targets for this disease. We describe the relationship between the mechanistic target of rapamycin complex 1/2 protein subunit regulatory associated protein of the MTOR complex 1 (RAPTOR), the serine/threonine kinase V-Akt murine thymoma viral oncogene homolog 1 (AKT1), and the protease cathepsin H (CTSH), for which we establish a role in filaggrin expression and processing. Increased RAPTOR levels correlated with decreased filaggrin expression in patients with AD. In keratinocyte cell cultures RAPTOR upregulation or AKT1 short hairpin RNA knockdown reduced expression of the protease CTSH. Skin of CTSH-deficient mice and CTSH short hairpin RNA knockdown keratinocytes showed reduced filaggrin processing, and the mouse had both impaired skin barrier function and a mild proinflammatory phenotype. Our findings highlight a novel and potentially treatable signaling axis controlling filaggrin expression and processing that is defective in patients with AD. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Jing, Junjie; Wang, Chengfeng; Liang, Qinchuan; Zhao, Yang; Zhao, Qingshuang; Wang, Shousen; Ma, Jie
2015-01-01
Tectonic family member 1 (TCTN1) encodes a member of the tectonic family which are evolutionarily conserved secreted and transmembrane proteins, involving in a diverse variety of developmental processes. It has been demonstrated that tectonics expressed in regions that participate in Hedgehog (Hh) signaling during mouse embryonic development and was imperative for Hh-mediated patterning of the ventral neural tube. However, the expression and regulation of tectonics in human tumor is still not clear. In this study, shRNA-expressing lentivirus was constructed to knockdown TCTN1 in medulloblastoma cell line Daoy. The results showed that knockdown of TCTN1 inhibited cell proliferation and colony formation in Daoy cell line, also caused cell cycle arrest at the G2/M boundary. Taken all together, our data suggest that TCTN1 might play an important role in the progression of medulloblastoma. PMID:26550235
Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker
2016-09-01
Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.
NASA Astrophysics Data System (ADS)
Wu, Sangwook
2015-03-01
DNA hairpin plays a critical role in the regulation of gene expression and DNA recombination. We studied the conformation of the DNA hairpin, d(ATCCAT-GTTA-TAGGAT) (PDB id:1AC7), employing molecular dynamics (MD) simulation. Despite the non-canonical Watson-Crick base pair (G:A) in the tetraloop (GTTA), MD simulation reveals that the conformation of the DNA hairpin is remarkably stable. In this study, we discuss about the physical/chemical origin of the stability of the DNA hairpin. Department of Biomedical Engineering, Korea University, Seoul 136-703, Korea.
Single-molecule RNA observation in vivo reveals dynamics of co-transcriptional splicing
NASA Astrophysics Data System (ADS)
Ferguson, M. L.; Coulon, A.; de Turris, V.; Palangat, M.; Chow, C. C.; Singer, R. H.; Larson, D. R.
2013-03-01
The synthesis of pre-mRNA and the splicing of that pre-mRNA to form completed transcripts requires coordination between two large multi-subunit complexes (the transcription elongation complex and the spliceosome). How this coordination occurs in vivo is unknown. Here we report the first experimental observation of transcription and splicing occurring at the same gene in living cells. By utilizing the PP7/MS2 fluorescent RNA reporter system, we can directly observe two distinct regions of the nascent RNA, allowing us to measure the rise and fall time of the intron and exon of a reporter gene stably integrated into a human cell line. The reporter gene consists of a beta globin gene where we have inserted a 24 RNA hairpin cassette into the intron/exon. Upon synthesis, the RNA hairpins are tightly bound by fluorescently-labeled PP7/MS2 bacteriophage coat proteins. After gene induction, a single locus of active transcription in the nucleus shows fluorescence intensity changes characteristic of the synthesis and excision of the intron/exon. Using fluctuation analysis, we determine the elongation rate to be 1.5 kb/min. From the temporal cross correlation function, we determine that splicing of this gene must be co-transcriptional with a splicing time of ~100 seconds before termination and a ~200 second pause at termination. We propose that dual-color RNA imaging may be extended to investigate other mechanisms of transcription, gene regulation, and RNA processing.
Bao, Xing; Ren, Tingting; Huang, Yi; Sun, Kunkun; Wang, Shidong; Liu, Kuisheng; Zheng, Bingxin; Guo, Wei
2017-01-01
Current practices for the therapy of chondrosarcoma, including wide-margin surgical resection and chemotherapy, are less than satisfactory. Recently, emerging evidence has demonstrated that long non-coding RNAs (lncRNAs) have an essential role in the initiation and progression of tumors. As a typical lncRNA, HOTAIR is significantly overexpressed in various tumors. However, the function and potential biological mechanisms of HOTAIR in human chondrosarcoma remain unknown. Quantitative RT-PCR demonstrated that HOTAIR expression was upregulated in chondrosarcoma tissues and cell lines. High HOTAIR expression is correlated with tumor stage and poor prognosis. Functional experiments reveal that HOTAIR knockdown leads to growth inhibition of human chondrosarcoma cells in vitro and in vivo. In addition to cycle arrest and apoptosis, knockdown of HOTAIR inhibits autophagy, which favors cell death. Mechanistically, we demonstrated that HOTAIR induced DNA methylation of miR-454-3p by recruiting EZH2 and DNMT1 to the miR-454-3p promoter regions, which markedly silences miR-454-3p expression. Further analysis revealed that STAT3 and ATG12 are targets of miR-454-3p, initiate HOTAIR deficiency-induced apoptosis and reduce autophagy. Collectively, our data reveal the roles and functional mechanisms of HOTAIR in human chondrosarcoma and suggest that HOTAIR may act as a prognostic biomarker and potential therapeutic target for chondrosarcoma. PMID:28182000
Bao, Xing; Ren, Tingting; Huang, Yi; Sun, Kunkun; Wang, Shidong; Liu, Kuisheng; Zheng, Bingxin; Guo, Wei
2017-02-09
Current practices for the therapy of chondrosarcoma, including wide-margin surgical resection and chemotherapy, are less than satisfactory. Recently, emerging evidence has demonstrated that long non-coding RNAs (lncRNAs) have an essential role in the initiation and progression of tumors. As a typical lncRNA, HOTAIR is significantly overexpressed in various tumors. However, the function and potential biological mechanisms of HOTAIR in human chondrosarcoma remain unknown. Quantitative RT-PCR demonstrated that HOTAIR expression was upregulated in chondrosarcoma tissues and cell lines. High HOTAIR expression is correlated with tumor stage and poor prognosis. Functional experiments reveal that HOTAIR knockdown leads to growth inhibition of human chondrosarcoma cells in vitro and in vivo. In addition to cycle arrest and apoptosis, knockdown of HOTAIR inhibits autophagy, which favors cell death. Mechanistically, we demonstrated that HOTAIR induced DNA methylation of miR-454-3p by recruiting EZH2 and DNMT1 to the miR-454-3p promoter regions, which markedly silences miR-454-3p expression. Further analysis revealed that STAT3 and ATG12 are targets of miR-454-3p, initiate HOTAIR deficiency-induced apoptosis and reduce autophagy. Collectively, our data reveal the roles and functional mechanisms of HOTAIR in human chondrosarcoma and suggest that HOTAIR may act as a prognostic biomarker and potential therapeutic target for chondrosarcoma.
Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.
Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu
2014-02-04
TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.
Garaigorta, Urtzi; Heim, Markus H; Boyd, Bryan; Wieland, Stefan; Chisari, Francis V
2012-10-01
Stress granules (SGs) are cytoplasmic structures that are induced in response to environmental stress, including viral infections. Here we report that hepatitis C virus (HCV) triggers the appearance of SGs in a PKR- and interferon (IFN)-dependent manner. Moreover, we show an inverse correlation between the presence of stress granules and the induction of IFN-stimulated proteins, i.e., MxA and USP18, in HCV-infected cells despite high-level expression of the corresponding MxA and USP18 mRNAs, suggesting that interferon-stimulated gene translation is inhibited in stress granule-containing HCV-infected cells. Finally, in short hairpin RNA (shRNA) knockdown experiments, we found that the stress granule proteins T-cell-restricted intracellular antigen 1 (TIA-1), TIA1-related protein (TIAR), and RasGAP-SH3 domain binding protein 1 (G3BP1) are required for efficient HCV RNA and protein accumulation at early time points in the infection and that G3BP1 and TIA-1 are required for intracellular and extracellular infectious virus production late in the infection, suggesting that they are required for virus assembly. In contrast, TIAR downregulation decreases extracellular infectious virus titers with little effect on intracellular RNA content or infectivity late in the infection, suggesting that it is required for infectious particle release. Collectively, these results illustrate that HCV exploits the stress granule machinery at least two ways: by inducing the formation of SGs by triggering PKR phosphorylation, thereby downregulating the translation of antiviral interferon-stimulated genes, and by co-opting SG proteins for its replication, assembly, and egress.
Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann
2016-08-01
A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world.
Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann
2016-01-01
A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201
Toward a General Approach for RNA-Templated Hierarchical Assembly of Split-Proteins
Furman, Jennifer L.; Badran, Ahmed H.; Ajulo, Oluyomi; Porter, Jason R.; Stains, Cliff I.; Segal, David J.; Ghosh, Indraneel
2010-01-01
The ability to conditionally turn on a signal or induce a function in the presence of a user-defined RNA target has potential applications in medicine and synthetic biology. Although sequence-specific pumilio repeat proteins can target a limited set of ssRNA sequences, there are no general methods for targeting ssRNA with designed proteins. As a first step toward RNA recognition, we utilized the RNA binding domain of argonaute, implicated in RNA interference, for specifically targeting generic 2-nucleotide, 3' overhangs of any dsRNA. We tested the reassembly of a split-luciferase enzyme guided by argonaute-mediated recognition of newly generated nucleotide overhangs when ssRNA is targeted by a designed complementary guide sequence. This approach was successful when argonaute was utilized in conjunction with a pumilio repeat and expanded the scope of potential ssRNA targets. However, targeting any desired ssRNA remained elusive as two argonaute domains provided minimal reassembled split-luciferase. We next designed and tested a second hierarchical assembly, wherein ssDNA guides are appended to DNA hairpins that serve as a scaffold for high affinity zinc fingers attached to split-luciferase. In the presence of a ssRNA target containing adjacent sequences complementary to the guides, the hairpins are brought into proximity, allowing for zinc finger binding and concomitant reassembly of the fragmented luciferase. The scope of this new approach was validated by specifically targeting RNA encoding VEGF, hDM2, and HER2. These approaches provide potentially general design paradigms for the conditional reassembly of fragmented proteins in the presence of any desired ssRNA target. PMID:20681585
Novel liposomal combination treatments using dual genes knockdown in oral cancer treatment
NASA Astrophysics Data System (ADS)
Wu, Jyun-Sian; Yeh, Chia-Hsien; Huang, Leaf; Hsu, Yih-Chih
2018-02-01
Small interfering RNA (siRNA) can be used to treat tumor because it can effectively knockdown target oncoprotein expression and it leads to cancer cell death and apoptosis. Hypoxia-inducible factors-1 (HIF-1) is a transcription factor gene. Its high expression of tumor hypoxia cells, activation of transcription factor HIF-1α and angiogenesis found in most cancerous tissues. HIF-1α protein in cancer cells are critical to cell survival, tumor growth and proliferation. Epidermal growth factor receptor (EGFR) gene is another common head and neck oncogene. The dual self-designed siRNA sequences were encapsulated in the lipid-calcium-phosphate (LCP) and targeted to sigma receptors on the surface of cancer cells via binding to amino ethyl anisamide (AEAA). We used human oral cancer cells to establish the xenograft animal model to study the combination therapy for therapeutic results.
Liu, Jianghai; Mak, Timothy Chun-Ping; Banigesh, Ali; Desai, Kaushik; Wang, Rui; Wu, Lingyun
2012-01-01
We used cultured endothelial cells as a model to examine whether up-regulation of aldolase B and enhanced methylglyoxal (MG) formation play an important role in high glucose-induced overproduction of advanced glycosylation endproducts (AGEs), oxidative stress and cellular dysfunction. High glucose (25 mM) incubation up-regulated mRNA levels of aldose reductase (an enzyme converting glucose to fructose) and aldolase B (a key enzyme that catalyzes MG formation from fructose) and enhanced MG formation in human umbilical vein endothelial cells (HUVECs) and HUVEC-derived EA. hy926 cells. High glucose-increased MG production in EA. hy926 cells was completely prevented by siRNA knockdown of aldolase B, but unaffected by siRNA knockdown of aldolase A, an enzyme responsible for MG formation during glycolysis. In addition, inhibition of cytochrome P450 2E1 or semicarbazide-sensitive amine oxidase which produces MG during the metabolism of lipid and proteins, respectively, did not alter MG production. Both high glucose (25 mM) and MG (30, 100 µM) increased the formation of N(ε)-carboxyethyl-lysine (CEL, a MG-induced AGE), oxidative stress (determined by the generation of oxidized DCF, H(2)O(2), protein carbonyls and 8-oxo-dG), O-GlcNAc modification (product of the hexosamine pathway), membrane protein kinase C activity and nuclear translocation of NF-κB in EA. hy926 cells. However, the above metabolic and signaling alterations induced by high glucose were completely prevented by knockdown of aldolase B and partially by application of aminoguanidine (a MG scavenger) or alagebrium (an AGEs breaker). In conclusion, efficient inhibition of aldolase B can prevent high glucose-induced overproduction of MG and related cellular dysfunction in endothelial cells.
NASA Astrophysics Data System (ADS)
Franch, Oskar; Iacovelli, Federico; Falconi, Mattia; Juul, Sissel; Ottaviani, Alessio; Benvenuti, Claudia; Biocca, Silvia; Ho, Yi-Ping; Knudsen, Birgitta R.; Desideri, Alessandro
2016-07-01
In the present study we investigate the mechanism behind temperature controlled cargo uptake using a truncated octahedral DNA cage scaffold functionalized with one, two, three or four hairpin forming DNA strands inserted in one corner of the structure. This investigation was inspired by our previous demonstration of temperature controlled reversible encapsulation of the cargo enzyme, horseradish peroxidase, in the cage with four hairpin forming strands. However, in this previous study the mechanism of cargo uptake was not directly addressed (Juul, et al., Temperature-Controlled Encapsulation and Release of an Active Enzyme in the Cavity of a Self-Assembled DNA Nanocage, ACS Nano, 2013, 7, 9724-9734). In the present study we use a combination of molecular dynamics simulations and in vitro analyses to unravel the mechanism of cargo uptake in hairpin containing DNA cages. We find that two hairpin forming strands are necessary and sufficient to facilitate efficient cargo uptake, which argues against a full opening-closing of one corner of the structure being responsible for encapsulation. Molecular dynamics simulations were carried out to evaluate the atomistic motions responsible for encapsulation and showed that the two hairpin forming strands facilitated extension of at least one of the face surfaces of the cage scaffold, allowing entrance of the cargo protein into the cavity of the structure. Hence, the presented data demonstrate that cargo uptake does not involve a full opening of the structure. Rather, the uptake mechanism represents a feature of increased flexibility integrated in this nanocage structure upon the addition of at least two hairpin-forming strands.In the present study we investigate the mechanism behind temperature controlled cargo uptake using a truncated octahedral DNA cage scaffold functionalized with one, two, three or four hairpin forming DNA strands inserted in one corner of the structure. This investigation was inspired by our previous
Gulec, Sukru; Collins, James F.
2014-01-01
The Menkes copper-transporting ATPase (Atp7a) gene is induced in rat duodenum during iron deficiency, consistent with copper accumulation in the intestinal mucosa and liver. To test the hypothesis that ATP7A influences intestinal iron metabolism, the Atp7a gene was silenced in rat intestinal epithelial (IEC-6) cells using short hairpin RNA (shRNA) technology. Perturbations in intracellular copper homeostasis were noted in knockdown cells, consistent with the dual roles of ATP7A in pumping copper into the trans-Golgi (for cuproenzyme synthesis) and exporting copper from cells. Intracellular iron concentrations were unaffected by Atp7a knockdown. Unexpectedly, however, vectorial iron (59Fe) transport increased (∼33%) in knockdown cells grown in bicameral inserts and increased further (∼70%) by iron deprivation (compared with negative control shRNA-transfected cells). Additional experiments were designed to elucidate the molecular mechanism of increased transepithelial iron flux. Enhanced iron uptake by knockdown cells was associated with increased expression of a ferrireductase (duodenal cytochrome b) and activity of a cell-surface ferrireductase. Increased iron efflux from knockdown cells was likely mediated via transcriptional activation of the ferroportin 1 gene (by an unknown mechanism). Moreover, Atp7a knockdown significantly attenuated expression of an iron oxidase [hephaestin (HEPH); by ∼80%] and membrane ferroxidase activity (by ∼50%). Cytosolic ferroxidase activity, however, was retained in knockdown cells (75% of control cells), perhaps compensating for diminished HEPH activity. This investigation has thus documented alterations in iron homeostasis associated with Atp7a knockdown in enterocyte-like cells. Alterations in copper transport, trafficking, or distribution may underlie the increase in transepithelial iron flux noted when ATP7A activity is diminished. PMID:24174620
Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Elaswad, Ahmed; Alsaqufi, Ahmed; Perera, Dayan A; Qin, Zhenkui; Odin, Ramji; Vo, Khoi; Drescher, David; Robinson, Dalton; Dong, Sheng; Zhang, Dan; Shang, Mei; Abass, Nermeen; Das, Sanjay K; Bangs, Max; Dunham, Rex A
2018-06-01
Repressible knockdown approaches were investigated to manipulate for transgenic sterilization in channel catfish, Ictalurus punctatus. Two primordial germ cell (PGC) marker genes, nanos and dead end, were targeted for knockdown and an off-target gene, vasa, was monitored. Two potentially copper-sensitive repressible promoters, yeast ctr3 (M) and ctr3-reduced (Mctr), were coupled with four knockdown strategies separately including: ds-sh RNA targeting the 5' end (N1) or 3' end (N2) of channel catfish nanos, full-length cDNA sequence of channel catfish nanos for overexpression (cDNA), and ds-sh RNA-targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with copper sulfate as the repressor compound. Spawning rates of full-sibling P 1 fish exposed or not exposed to the constructs as treated and untreated embryos were 85 and 54%, respectively, indicating potential sterilization of fish and repression of the constructs. In F 1 fish, mRNA expressions of PGC marker genes for most constructs were downregulated in the untreated group and the knockdown was repressed in the treated group. Gonad development in transgenic, untreated F 1 channel catfish was reduced compared to non-transgenic fish for MctrN2, MN1, MN2, and MDND. For 3-year-old adults, gonad size in the transgenic untreated group was 93.4% smaller than the non-transgenic group for females and 92.3% for males. However, mean body weight of transgenic females (781.8 g) and males (883.8 g) was smaller than of non-transgenic counterparts (984.2 and 1254.3 g) at 3 years of age, a 25.8 and 41.9% difference for females and males, respectively. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but negative pleiotropic effects can result.
Langdon, Jacqueline M.; Schroeder, John T.; Vonakis, Becky M.; Bieneman, Anja P.; Chichester, Kristin; MacDonald, Susan M.
2008-01-01
Previously, we demonstrated a negative correlation between histamine release to histamine-releasing factor/translationally controlled tumor protein (HRF/TCTP) and protein levels of SHIP-1 in human basophils. The present study was conducted to investigate whether suppressing SHIP-1 using small interfering (si)RNA technology would alter the releasability of culture-derived mast cells and basophils, as determined by HRF/TCTP histamine release. Frozen CD34+ cells were obtained from the Fred Hutchinson Cancer Research Center (Seattle, WA, USA). Cells were grown in StemPro-34 medium containing cytokines: mast cells with IL-6 and stem cell factor (100 ng/ml each) for 6–8 weeks and basophils with IL-3 (6.7 ng/ml) for 2–3 weeks. siRNA transfections were performed during Week 6 for mast cells and Week 2 for basophils with siRNA for SHIP-1 or a negative control siRNA. Changes in SHIP-1 expression were determined by Western blot. The functional knockdown was measured by HRF/TCTP-induced histamine release. siRNA knockdown of SHIP-1 in mast cells ranged from 31% to 82%, mean 65 ± 12%, compared with control (n=4). Histamine release to HRF/TCTP was increased only slightly in two experiments. SHIP-1 knockdown in basophils ranged from 34% to 69%, mean 51.8 ± 7% (n=4). Histamine release to HRF/TCTP in these basophils was dependent on the amount of SHIP knockdown. Mast cells and basophils derived from CD34+ precursor cells represent suitable models for transfection studies. Reducing SHIP-1 protein in cultured mast cells and in cultured basophils increases releasability of the cells. PMID:18625911
Walter, N G; Burke, J M
1997-01-01
Current methods for evaluating the kinetics of ribozyme-catalyzed reactions rely primarily on the use of radiolabeled RNA substrates, and so require tedious electrophoretic separation and quantitation of reaction products for each data point in any experiment. Here, we report the use of fluorescent substrates for real-time analysis of the time course of reactions of the hairpin ribozyme. Fluorescence of 3' fluorescein-labeled substrates was quenched upon binding to the hairpin ribozyme or its isolated substrate-binding strand (SBS), under conditions of ribozyme or SBS excess. This decrease was accompanied by an increase in anisotropy, and resulted from a base-specific quenching by a guanosine residue added to the 5' end of the SBS, close to fluorescein in the complex. Fluorescence quenching was used to determine rate constants for substrate binding (1.4 x 10(8) M(-1) min(-1)), cleavage (0.15 min(-1)), and substrate dissociation (0.010 min(-1)) by a structurally well-defined ribozyme at 25 degrees C in 50 mM Tris-HCI, pH 7.5, 12 mM MgCl2. These rates are in excellent agreement with those obtained using traditional radioisotopic methods. Measurements of dissociation rates provided physical support for interdomain interactions within the substrate-ribozyme complex. We estimate that 2.1 kcal/mol of additional substrate binding energy is provided by the B domain of the ribozyme. Part of this free energy apparently stems from coaxial stacking of helices in the hinge region between domains, and it is plausible that the remainder might be contributed by direct interactions with loop B. The fluorescence quenching and dequenching methods described here should be readily adaptable to studying a wide variety of RNA interactions and reactions using ribozymes and other model systems. PMID:9085846
A novel DANP-coupled hairpin RT-PCR for rapid detection of Chikungunya virus.
Chen, Huixin; Takei, Fumie; Koay, Evelyn Siew-Chuan; Nakatani, Kazuhiko; Chu, Justin Jang Hann
2013-03-01
Chikungunya has re-emerged as an important arboviral infection of global health significance. Because of lack of a vaccine and effective treatment, rapid diagnosis plays an important role in early clinical management of patients. In this study, we have developed a novel molecular diagnostic platform that ensures a rapid and cost-effective one-step RT-PCR assay, with high sensitivity and specificity, for the early detection of the Chikungunya virus (CHIKV). It uses 2,7-diamino-1,8-naphthyridine derivative (DANP)-labeled cytosine-bulge hairpin primers to amplify the nsP2 region of the CHIKV genome, followed by measurement of the fluorescence emitted from DANP-primer complexes after PCRs. The detection limit of our assay was 0.01 plaque-forming units per reaction of CHIKV. Furthermore, the HP-nsP2 primers were highly specific in detecting CHIKV, without any cross-reactivity with the panel of RNA viruses validated in this study. The feasibility of the DANP-coupled hairpin RT-PCR for clinical diagnosis was evaluated using clinical serum samples from CHIKV-infected patients, and the specificity and sensitivity were 100% (95% CI, 80.0% to 100%) and 95.5% (95% CI, 75.1% to 99.8%), respectively. These findings confirmed its potential as a point-of-care clinical molecular diagnostic assay for CHIKV in acute-phase patient serum samples. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Phenotypic effects induced by knock-down of the period clock gene in Bombyx mori.
Sandrelli, Federica; Cappellozza, Silvia; Benna, Clara; Saviane, Alessio; Mastella, Antonio; Mazzotta, Gabriella M; Moreau, Stephane; Pegoraro, Mirko; Piccin, Alberto; Zordan, Mauro A; Cappellozza, Luciano; Kyriacou, Charalambos P; Costa, Rodolfo
2007-04-01
The lepidopteran Bombyx mori is an insect of considerable scientific and economic importance. Recently, the B. mori circadian clock gene period has been molecularly characterized. We have transformed a B. mori strain with a construct encoding a period double-strand RNA in order to knock-down period gene expression. We observe that this post-transcriptional silencing produces a small but detectable disruption in the egg-hatching rhythm, as well as a reduction in egg-to-adult developmental time, without altering silk production parameters. Thus we show that both circadian and non-circadian phenotypes can be altered by changing per expression, and, at a practical level, these results suggest that per knock-down may provide a suitable strategy for improving the efficiency of rearing, without affecting silk productivity.
PNA containing isocytidine nucleobase: synthesis and recognition of double helical RNA
Zengeya, Thomas; Li, Ming; Rozners, Eriks
2011-01-01
Peptide nucleic acid (PNA1) containing a 5-methylisocytidine (iC) nucleobase has been synthesized. Triple helix formation between PNA1 and RNA hairpins having variable base pairs interacting with iC was studied using isothermal titration calorimetry. The iC nucleobase recognized the proposed target, C-G inversion in polypurine tract of RNA, with slightly higher affinity than the natural nucleobases, though the sequence selectivity of recognition was low. Compared to non-modified PNA, PNA1 had lower affinity for its RNA target. PMID:21333533
Using RNA interference to knock down the adhesion protein TES.
Griffith, Elen
2007-01-01
RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most
[MACF1 knockdown in glioblastoma multiforme cells increases temozolomide-induced cytotoxicity].
Xie, Si-di; Chen, Zi-Yang; Wang, Hai; He, Min-Yi; Lu, Yun-Tao; Lei, Bing-Xi; Li, He-Zhen; Liu, Ya-Wei; Qi, Song-Tao
2017-09-20
To investigate the role of microtubule-actin crosslinking factor 1 (MACF1) in the response of glioma cells to temozolomide (TMZ). TMZ was applied to a human gliomablastoma cell line (U87) and changes in the protein expression and cellular localization were determined with Western blot, RT-PCR, and immunofluorescence. The responses of the cells with MACF1 expression knockdown by RNA interference to TMZ were assessed. TMZ-induced effects on MACF1 expression were also assessed by immunohistochemistry in a nude mouse model bearing human glioblastoma xenografts. TMZ resulted in significantly increased MACF1 expression (by about 2 folds) and changes in its localization in the gliomablastoma cells both in vitro and in vivo (P<0.01). Knockdown of MACF1 reduced the proliferation (by 45%) of human glioma cell lines treated with TMZ (P<0.01). TMZ-induced changes in MACF1 expression was accompanied by cytoskeletal rearrangement. MACF1 may be a potential therapeutic target for glioblastoma.
Le, Binh Huy; Seo, Young Jun
2018-01-25
We have developed a gold nanoparticle (AuNP)-based CTG repeat probing system displaying high quenching capability and combined it with isothermal amplification for the detection of miRNA 146a. This method of using a AuNP-based CTG repeat probing system with isothermal amplification allowed the highly sensitive (14 aM) and selective detection of miRNA 146a. A AuNP-based CTG repeat probing system having a hairpin structure and a dT F fluorophore exhibited highly efficient quenching because the CTG repeat-based stable hairpin structure imposed a close distance between the AuNP and the dT F residue. A small amount of miRNA 146a induced multiple copies of the CAG repeat sequence during rolling circle amplification; the AuNP-based CTG repeat probing system then bound to the complementary multiple-copy CAG repeat sequence, thereby inducing a structural change from a hairpin to a linear structure with amplified fluorescence. This AuNP-based CTG probing system combined with isothermal amplification could also discriminate target miRNA 146a from one- and two-base-mismatched miRNAs (ORN 1 and ORN 2, respectively). This simple AuNP-based CTG probing system, combined with isothermal amplification to induce a highly sensitive change in fluorescence, allows the detection of miRNA 146a with high sensitivity (14 aM) and selectivity. Copyright © 2017 Elsevier B.V. All rights reserved.
Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.
Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H
2016-03-20
RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.
López-Aguilar, Celeste; Romero-López, Cristina; Espinosa, Manuel; Berzal-Herranz, Alfredo; del Solar, Gloria
2015-01-01
Rolling-circle replication of streptococcal plasmid pMV158 is controlled by the concerted action of two trans-acting elements, namely transcriptional repressor CopG and antisense RNAII, which inhibit expression of the repB gene encoding the replication initiator protein. The pMV158-encoded antisense RNAII exerts its activity of replication control by inhibiting translation of the essential repB gene. RNAII is the smallest and simplest among the characterized antisense RNAs involved in control of plasmid replication. Structure analysis of RNAII revealed that it folds into an 8-bp-long stem containing a 1-nt bulge and closed by a 6-nt apical loop. This hairpin is flanked by a 17-nt-long single-stranded 5′-tail and an 8-nt-long 3′-terminal U-rich stretch. Here, the 3′ and 5′ regions of the 5′-tail of RNAII are shown to play a critical role in the binding to the target mRNA and in the inhibition of repB translation, respectively. In contrast, the apical loop of the single hairpin of RNAII plays a rather secondary role and the upper stem region hardly contributes to the binding or inhibition processes. The entire 5′-tail is required for efficient inhibition of repB translation, though only the 8-nt-long region adjacent to the hairpin seems to be essential for rapid binding to the mRNA. These results show that a “kissing” interaction involving base-pairing between complementary hairpin loops in RNAII and mRNA is not critical for efficient RNA/RNA binding or repB translation inhibition. A singular binding mechanism is envisaged whereby initial pairing between complementary single-stranded regions in the antisense and sense RNAs progresses upwards into the corresponding hairpin stems to form the intermolecular duplex. PMID:26175752
(CAG)(n)-hairpin DNA binds to Msh2-Msh3 and changes properties of mismatch recognition.
Owen, Barbara A L; Yang, Zungyoon; Lai, Maoyi; Gajec, Maciej; Gajek, Maciez; Badger, John D; Hayes, Jeffrey J; Edelmann, Winfried; Kucherlapati, Raju; Wilson, Teresa M; McMurray, Cynthia T
2005-08-01
Cells have evolved sophisticated DNA repair systems to correct damaged DNA. However, the human DNA mismatch repair protein Msh2-Msh3 is involved in the process of trinucleotide (CNG) DNA expansion rather than repair. Using purified protein and synthetic DNA substrates, we show that Msh2-Msh3 binds to CAG-hairpin DNA, a prime candidate for an expansion intermediate. CAG-hairpin binding inhibits the ATPase activity of Msh2-Msh3 and alters both nucleotide (ADP and ATP) affinity and binding interfaces between protein and DNA. These changes in Msh2-Msh3 function depend on the presence of A.A mispaired bases in the stem of the hairpin and on the hairpin DNA structure per se. These studies identify critical functional defects in the Msh2-Msh3-CAG hairpin complex that could misdirect the DNA repair process.
2009-01-01
Background Recent studies show that transcriptional activation of GTP cyclohydrolase I (GCH1) in dorsal root ganglia (DRG) is significantly involved in the development and persistency of pain symptoms. We thus hypothesize that neuropathic pain may be attenuated by down-regulation of GCH1 expression, and propose a gene silencing system for this purpose. Results To interrupt GCH1 synthesis, we designed a bidirectional recombinant adeno-associated virus encoding both a small hairpin RNA against GCH1 and a GFP reporter gene (rAAV-shGCH1). After rAAV-shGCH1 was introduced into the sciatic nerve prior to or following pain-inducing surgery, therapeutic efficacy and the underlying mechanisms were subsequently validated in animal models. The GFP expression data indicates that rAAV effectively delivered transgenes to DRG. Subsequently reduced GCH1 expression was evident from immunohistochemistry and western-blotting analysis. Along with the down-regulation of GCH1, the von Frey test correspondingly indicated a sharp decline in pain symptoms upon both pre- and post-treatment with rAAV-shGCH1. Interestingly, GCH1 down-regulation additionally led to decreased microglial activation in the dorsal horn, implying an association between pain attenuation and reduced inflammation. Conclusion Therefore, the data suggests that GCH1 levels can be reduced by introducing rAAV-shGCH1, leading to pain relief. Based on the results, we propose that GCH1 modulation may be developed as a clinically applicable gene therapy strategy to treat neuropathic pain. PMID:19922668
Kaplan, Oktay I; Berber, Burak; Hekim, Nezih; Doluca, Osman
2016-11-02
Many studies show that short non-coding sequences are widely conserved among regulatory elements. More and more conserved sequences are being discovered since the development of next generation sequencing technology. A common approach to identify conserved sequences with regulatory roles relies on topological changes such as hairpin formation at the DNA or RNA level. G-quadruplexes, non-canonical nucleic acid topologies with little established biological roles, are increasingly considered for conserved regulatory element discovery. Since the tertiary structure of G-quadruplexes is strongly dependent on the loop sequence which is disregarded by the generally accepted algorithm, we hypothesized that G-quadruplexes with similar topology and, indirectly, similar interaction patterns, can be determined using phylogenetic clustering based on differences in the loop sequences. Phylogenetic analysis of 52 G-quadruplex forming sequences in the Escherichia coli genome revealed two conserved G-quadruplex motifs with a potential regulatory role. Further analysis revealed that both motifs tend to form hairpins and G quadruplexes, as supported by circular dichroism studies. The phylogenetic analysis as described in this work can greatly improve the discovery of functional G-quadruplex structures and may explain unknown regulatory patterns. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Okamura, Masumi; Yamanaka, Yasutaka; Shigemoto, Maki; Kitadani, Yuya; Kobayashi, Yuhko; Kambe, Taiho; Nagao, Masaya; Kobayashi, Issei; Okumura, Katsuzumi
2018-01-01
DBP5, also known as DDX19, GLE1 and inositol hexakisphosphate (IP6) function in messenger RNA (mRNA) export at the cytoplasmic surface of the nuclear pore complex in eukaryotic cells. DBP5 is a DEAD-box RNA helicase, and its activity is stimulated by interactions with GLE1 and IP6. In addition, these three factors also have unique role(s). To investigate how these factors influenced the cytoplasmic mRNA expression and cell phenotype change, we performed RNA microarray analysis to detect the effect and function of DBP5, GLE1 and IP6 on the cytoplasmic mRNA expression. The expression of some cytoplasmic mRNA subsets (e.g. cell cycle, DNA replication) was commonly suppressed by the knock-down of DBP5, GLE1 and IPPK (IP6 synthetic enzyme). The GLE1 knock-down selectively reduced the cytoplasmic mRNA expression required for mitotic progression, results in an abnormal spindle phenotype and caused the delay of mitotic process. Meanwhile, G1/S cell cycle arrest was observed in DBP5 and IPPK knock-down cells. Several factors that function in immune response were also down-regulated in DBP5 or IPPK knock-down cells. Thereby, IFNβ-1 mRNA transcription evoked by poly(I:C) treatment was suppressed. These results imply that DBP5, GLE1 and IP6 have a conserved and individual function in the cytoplasmic mRNA expression. Variations in phenotype are due to the difference in each function of DBP5, GLE1 and IPPK in intracellular mRNA metabolism. PMID:29746542
Li-Byarlay, Hongmei; Li, Yang; Stroud, Hume; Feng, Suhua; Newman, Thomas C.; Kaneda, Megan; Hou, Kirk K.; Worley, Kim C.; Elsik, Christine G.; Wickline, Samuel A.; Jacobsen, Steven E.; Ma, Jian; Robinson, Gene E.
2013-01-01
Studies of DNA methylation from fungi, plants, and animals indicate that gene body methylation is ancient and highly conserved in eukaryotic genomes, but its role has not been clearly defined. It has been postulated that regulation of alternative splicing of transcripts was an original function of DNA methylation, but a direct experimental test of the effect of methylation on alternative slicing at the whole genome level has never been performed. To do this, we developed a unique method to administer RNA interference (RNAi) in a high-throughput and noninvasive manner and then used it to knock down the expression of DNA methyl-transferase 3 (dnmt3), which is required for de novo DNA methylation. We chose the honey bee (Apis mellifera) for this test because it has recently emerged as an important model organism for studying the effects of DNA methylation on development and social behavior, and DNA methylation in honey bees is predominantly on gene bodies. Here we show that dnmt3 RNAi decreased global genomic methylation level as expected and in addition caused widespread and diverse changes in alternative splicing in fat tissue. Four different types of splicing events were affected by dnmt3 gene knockdown, and change in two types, exon skipping and intron retention, was directly related to decreased methylation. These results demonstrate that one function of gene body DNA methylation is to regulate alternative splicing. PMID:23852726
Hua, Yingqi; Gorshkov, Kirill; Yang, Yanwen; Wang, Wenyi; Zhang, Nianxiang; Hughes, Dennis P M
2012-10-15
Neuroblastoma (NBL) is a common pediatric solid tumor, and outcomes for patients with advanced neuroblastoma remain poor despite extremely aggressive treatment. Chemotherapy resistance at relapse contributes heavily to treatment failure. The poor survival of patients with high-risk NBL prompted this investigation into novel treatment options with the objective of gaining a better understanding of resistance mechanisms. On the basis of previous work and on data from publicly available studies, the authors hypothesized that human epidermal growth factor receptor 4 (Her4) contributes to resistance. Her4 expression was reduced with small-hairpin RNA (shRNA) to over express intracellular HER4, and the authors tested its impact on tumor cell survival under various culture conditions. The resulting changes in gene expression after HER4 knockdown were measured by using a messenger RNA (mRNA) array. HER4 expression was up-regulated in tumor spheres compared with the expression in monolayer culture. With HER4 knockdown, NBL cells became less resistant to anoikis and serum starvation. Moreover, HER4 knockdown increased the chemosensitivity of NBL cells to cisplatin, doxorubicin, etoposide, and activated ifosfamide. In mRNA array analysis, HER4 knockdown predominately altered genes related to cell cycle regulation. In NBL spheres compared with monolayers, cell proliferation was decreased, and cyclin D expression was reduced. HER4 knockdown reversed cyclin D suppression. Overexpressed intracellular HER4 slowed the cell cycle and induced chemoresistance. The current results indicated that HER4 protects NBL cells from multiple exogenous apoptotic stimuli, including anoikis, nutrient deficiency, and cytotoxic chemotherapy. The intracellular fragment of HER4 was sufficient to confer this phenotype. HER4 functions as a cell cycle suppressor, maintaining resistance to cellular stress. The current findings indicate that HER4 overexpression may be associated with refractory disease
The role of MMP-1 in breast cancer growth and metastasis to the brain in a xenograft model.
Liu, Hui; Kato, Yukinari; Erzinger, Stephanie A; Kiriakova, Galina M; Qian, Yongzhen; Palmieri, Diane; Steeg, Patricia S; Price, Janet E
2012-12-07
Brain metastasis is an increasingly common complication for breast cancer patients; approximately 15- 30% of breast cancer patients develop brain metastasis. However, relatively little is known about how these metastases form, and what phenotypes are characteristic of cells with brain metastasizing potential. In this study, we show that the targeted knockdown of MMP-1 in breast cancer cells with enhanced brain metastatic ability not only reduced primary tumor growth, but also significantly inhibited brain metastasis. Two variants of the MDA-MB-231 human breast cancer cell line selected for enhanced ability to form brain metastases in nude mice (231-BR and 231-BR3 cells) were found to express high levels of matrix metalloproteinase-1 (MMP-1). Short hairpin RNA-mediated stable knockdown of MMP-1 in 231-BR and 231-BR3 cells were established to analyze tumorigenic ability and metastatic ability. Short hairpin RNA-mediated stable knockdown of MMP-1 inhibited the invasive ability of MDA-MB 231 variant cells in vitro, and inhibited breast cancer growth when the cells were injected into the mammary fat pad of nude mice. Reduction of MMP-1 expression significantly attenuated brain metastasis and lung metastasis formation following injection of cells into the left ventricle of the heart and tail vein, respectively. There were significantly fewer proliferating cells in brain metastases of cells with reduced MMP-1 expression. Furthermore, reduced MMP-1 expression was associated with decreased TGFα release and phospho-EGFR expression in 231-BR and BR3 cells. Our results show that elevated expression of MMP-1 can promote the local growth and the formation of brain metastases by breast cancer cells.
Takahashi, Melissa K.; Watters, Kyle E.; Gasper, Paul M.; Abbott, Timothy R.; Carlson, Paul D.; Chen, Alan A.
2016-01-01
Antisense RNA-mediated transcriptional regulators are powerful tools for controlling gene expression and creating synthetic gene networks. RNA transcriptional repressors derived from natural mechanisms called attenuators are particularly versatile, though their mechanistic complexity has made them difficult to engineer. Here we identify a new structure–function design principle for attenuators that enables the forward engineering of new RNA transcriptional repressors. Using in-cell SHAPE-Seq to characterize the structures of attenuator variants within Escherichia coli, we show that attenuator hairpins that facilitate interaction with antisense RNAs require interior loops for proper function. Molecular dynamics simulations of these attenuator variants suggest these interior loops impart structural flexibility. We further observe hairpin flexibility in the cellular structures of natural RNA mechanisms that use antisense RNA interactions to repress translation, confirming earlier results from in vitro studies. Finally, we design new transcriptional attenuators in silico using an interior loop as a structural requirement and show that they function as desired in vivo. This work establishes interior loops as an important structural element for designing synthetic RNA gene regulators. We anticipate that the coupling of experimental measurement of cellular RNA structure and function with computational modeling will enable rapid discovery of structure–function design principles for a diverse array of natural and synthetic RNA regulators. PMID:27103533
Knockdown of miR-210 decreases hypoxic glioma stem cells stemness and radioresistance.
Yang, Wei; Wei, Jing; Guo, Tiantian; Shen, Yueming; Liu, Fenju
2014-08-01
Glioma contains abundant hypoxic regions which provide niches to promote the maintenance and expansion of glioma stem cells (GSCs), which are resistant to conventional therapies and responsible for recurrence. Given the fact that miR-210 plays a vital role in cellular adaption to hypoxia and in stem cell survival and stemness maintenance, strategies correcting the aberrantly expressed miR-210 might open up a new therapeutic avenue to hypoxia GSCs. In the present study, to explore the possibility of miR-210 as an effective therapeutic target to hypoxic GSCs, we employed a lentiviral-mediated anti-sense miR-210 gene transfer technique to knockdown miR-210 expression and analyze phenotypic changes in hypoxic U87s and SHG44s cells. We found that hypoxia led to an increased HIF-2α mRNA expression and miR-210 expression in GSCs. Knockdown of miR-210 decreased neurosphere formation capacity, stem cell marker expression and cell viability, and induced differentiation and G0/G1 arrest in hypoxic GSCs by partially rescued Myc antagonist (MNT) protein expression. Knockdown of MNT could reverse the gene expression changes and the growth inhibition resulting from knockdown of miR-210 in hypoxic GSCs. Moreover, knockdown of miR-210 led to increased apoptotic rate and Caspase-3/7 activity and decreased invasive capacity, reactive oxygen species (ROS) and lactate production and radioresistance in hypoxic GSCs. These findings suggest that miR-210 might be a potential therapeutic target to eliminate GSCs located in hypoxic niches. Copyright © 2014 Elsevier Inc. All rights reserved.
Shao, Qiang; Yang, Lijiang; Gao, Yi Qin
2011-12-21
Our previous study showed that for the tested polypeptides which have similar β-hairpin structures but different sequences, their folding free energy pathways are dominantly determined by the turn conformational propensity. In this study, we study how the turn conformational propensity affects the structure of hairpins. The folding of two mutants of GB1p peptide (GB1m2 and GB1m3), which have the optimized turn sequence ((6)DDATK(11)T → (6)NPATG(11)K) with native structures unsolved, were simulated using integrated tempering sampling molecular dynamics simulations and the predicted stable structures were compared to wild-type GB1p. It was observed that the turn optimization of GB1p generates a more favored 5-residue type I(') turn in addition to the 6-residue type I turn in wild-type GB1p. As a result two distinctly different hairpin structures are formed corresponding to the "misfolded" (M) and the "folded" (F) states. M state is a one-residue-shifted asymmetric β-hairpin structure whereas F state has the similar symmetric hairpin structure as wild-type GB1p. The formation of the favored type I(') turn has a small free energy barrier and leads to the shifted β-hairpin structure, following the modified "zipping" model. The presence of disfavored type I turn structure makes the folding of a β-hairpin consistent with the "hydrophobic-core-centric" model. On the other hand, the folding simulations on other two GB1p mutants (GB1r1 and GBr2), which have the position of the hydrophobic core cluster further away from the turn compared to wild-type GB1p, showed that moving the hydrophobic core cluster away from the turn region destabilizes but does not change the hairpin structure. Therefore, the present study showed that the turn conformational propensity is a key factor in affecting not only the folding pathways but also the stable structure of β-hairpins, and the turn conformational change induced by the turn optimization leads to significant changes of β-hairpin
Hunter, Lydia J. R.; Brockington, Samuel F.; Murphy, Alex M.; Pate, Adrienne E.; Gruden, Kristina; MacFarlane, Stuart A.; Palukaitis, Peter; Carr, John P.
2016-01-01
Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7. PMID:26979928
Hunter, Lydia J R; Brockington, Samuel F; Murphy, Alex M; Pate, Adrienne E; Gruden, Kristina; MacFarlane, Stuart A; Palukaitis, Peter; Carr, John P
2016-03-16
Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7.
Circadian clock gene plays a key role on ovarian cycle and spontaneous abortion.
Li, Ruiwen; Cheng, Shuting; Wang, Zhengrong
2015-01-01
Circadian locomotor output cycles protein kaput (CLOCK) plays a key role in maintaining circadian rhythms and activation of downstream elements. However, its function on human female reproductive system remains unknown. To investigate the potential role of CLOCK, CLOCK-shRNAs were transfected into mouse 129 ES cells or injected into the ovaries of adult female mice. Western blotting was utilized to analyze the protein interactions and flow cytometry was used to assess apoptosis. The expression of CLOCK peaked at the 6th week in the healthy fetuses. However, an abnormal expression of CLOCK was detected in fetuses from spontaneous miscarriage. To determine the effect of CLOCK on female fertility, a small hairpin RNA (shRNA) strategy was used to specifically knockdown the CLOCK gene expression in vitro and in vivo. Knockdown of CLOCK induced apoptosis in mouse embryonic stem (mES) cells and inhibited the proliferation in mES cells in vitro. CLOCK knockdown also led to decreased release of oocytes and smaller litter size compared with control in vivo. Collectively, theses findings indicate that CLOCK plays an important role in fertility and that the CLOCK knockdown leads to reduction in reproduction and increased miscarriage risk. © 2015 S. Karger AG, Basel.
ARMOUR - A Rice miRNA: mRNA Interaction Resource.
Sanan-Mishra, Neeti; Tripathi, Anita; Goswami, Kavita; Shukla, Rohit N; Vasudevan, Madavan; Goswami, Hitesh
2018-01-01
ARMOUR was developed as A Rice miRNA:mRNA interaction resource. This informative and interactive database includes the experimentally validated expression profiles of miRNAs under different developmental and abiotic stress conditions across seven Indian rice cultivars. This comprehensive database covers 689 known and 1664 predicted novel miRNAs and their expression profiles in more than 38 different tissues or conditions along with their predicted/known target transcripts. The understanding of miRNA:mRNA interactome in regulation of functional cellular machinery is supported by the sequence information of the mature and hairpin structures. ARMOUR provides flexibility to users in querying the database using multiple ways like known gene identifiers, gene ontology identifiers, KEGG identifiers and also allows on the fly fold change analysis and sequence search query with inbuilt BLAST algorithm. ARMOUR database provides a cohesive platform for novel and mature miRNAs and their expression in different experimental conditions and allows searching for their interacting mRNA targets, GO annotation and their involvement in various biological pathways. The ARMOUR database includes a provision for adding more experimental data from users, with an aim to develop it as a platform for sharing and comparing experimental data contributed by research groups working on rice.
Pten Knockdown in vivo Increases Excitatory Drive onto Dentate Granule Cells
Luikart, Bryan W.; Schnell, Eric; Washburn, Eric K.; Bensen, AeSoon L.; Tovar, Kenneth R.; Westbrook, Gary L.
2011-01-01
Some cases of autism spectrum disorder (ASD) have mutations in the lipid phosphatase, Pten (phosphatase and tensin homolog on chromosome 10). Tissue specific deletion of Pten in the hippocampus and cortex of mice causes anatomical and behavioral abnormalities similar to human autism. However, the impact of reductions in Pten on synaptic and circuit function remains unexplored. We used in vivo stereotaxic injections of lentivirus expressing an shRNA to knockdown Pten in mouse neonatal and young adult dentate granule cells. We then assessed the morphology and synaptic physiology between two weeks and four months later. Confocal imaging of the hippocampus revealed a marked increase in granule cell size and an increase in dendritic spine density. The onset of morphological changes occurred earlier in neonatal mice than in young adults. We used whole-cell recordings from granule cells in acute slices to assess synaptic function following Pten knockdown. Consistent with the increase in dendritic spines, the frequency of excitatory miniature and spontaneous postsynaptic currents increased. However, there was little or no effect on inhibitory postsynaptic currents. Thus Pten knockdown results in an imbalance between excitatory and inhibitory synaptic activity. Because reductions in Pten affected mature granule cells as well as developing granule cells, we suggest that the disruption of circuit function by Pten hypofunction may be ongoing well beyond early development. PMID:21411674
The Histone Acetyltransferase MOF Promotes Induces Generation of Pluripotent Stem Cells.
Mu, Xupeng; Yan, Shaohua; Fu, Changhao; Wei, Anhui
2015-08-01
Histone modification plays an important role in maintaining pluripotency and self-renewal of embryonic stem cells (ESCs). The histone acetyltransferase MOF is a key regulator of ESCs; however, the role of MOF in the process of reprogramming back to induced pluripotent stem cells (iPSCs) remains unclear. In this study, we investigated the function of MOF on the generation of iPSCs. We show that iPSCs contain high levels of MOF mRNA, and the expression level of MOF protein is dramatically upregulated following reprogramming. Most importantly, overexpression of MOF improves reprogramming efficiency and facilitates the formation of iPSCs, whereas small hairpin RNA (shRNA)-mediated knockdown of MOF impairs iPSCs generation during reprogramming. Further investigation reveals that MOF interacts with the H3K4 methyltransferase Wdr5 to promote endogenous Oct4 expression during the reprogramming process. Knockdown of MOF reduces H4K16ac and H3K4me3 modification at the Oct4 promoter. In conclusion, our data indicate that MOF is an important epigenetic regulator that is critical for efficient reprogramming.
β-Hairpin-Mediated Formation of Structurally Distinct Multimers of Neurotoxic Prion Peptides
Gill, Andrew C.
2014-01-01
Protein misfolding disorders are associated with conformational changes in specific proteins, leading to the formation of potentially neurotoxic amyloid fibrils. During pathogenesis of prion disease, the prion protein misfolds into β-sheet rich, protease-resistant isoforms. A key, hydrophobic domain within the prion protein, comprising residues 109–122, recapitulates many properties of the full protein, such as helix-to-sheet structural transition, formation of fibrils and cytotoxicity of the misfolded isoform. Using all-atom, molecular simulations, it is demonstrated that the monomeric 109–122 peptide has a preference for α-helical conformations, but that this peptide can also form β-hairpin structures resulting from turns around specific glycine residues of the peptide. Altering a single amino acid within the 109–122 peptide (A117V, associated with familial prion disease) increases the prevalence of β-hairpin formation and these observations are replicated in a longer peptide, comprising residues 106–126. Multi-molecule simulations of aggregation yield different assemblies of peptide molecules composed of conformationally-distinct monomer units. Small molecular assemblies, consistent with oligomers, comprise peptide monomers in a β-hairpin-like conformation and in many simulations appear to exist only transiently. Conversely, larger assemblies are comprised of extended peptides in predominately antiparallel β-sheets and are stable relative to the length of the simulations. These larger assemblies are consistent with amyloid fibrils, show cross-β structure and can form through elongation of monomer units within pre-existing oligomers. In some simulations, assemblies containing both β-hairpin and linear peptides are evident. Thus, in this work oligomers are on pathway to fibril formation and a preference for β-hairpin structure should enhance oligomer formation whilst inhibiting maturation into fibrils. These simulations provide an important new
Hacking RNA: Hakai promotes tumorigenesis by switching on the RNA-binding function of PSF
Figueroa, Angélica; Fujita, Yasuyuki; Gorospe, Myriam
2009-01-01
Hakai, an E3 ubiquitin ligase for the E-cadherin complex, plays a crucial role in lowering cell-cell contacts in epithelial cells, a hallmark feature of tumor progression. Recently, Hakai was also found to interact with PSF (PTB-associated splicing factor). While PSF can function as a DNA-binding protein with a tumor suppressive function, its association with Hakai promotes PSF’s RNA-binding ability and post-transcriptional influence on target mRNAs. Hakai overexpression enhanced the binding of PSF to mRNAs encoding cancer-related proteins, while knockdown of Hakai reduced the RNA-binding ability of PSF. Furthermore, the knockdown of PSF suppressed Hakai-induced cell proliferation. Thus, Hakai can affect the oncogenic phenotype both by altering E-cadherin-based intercellular adhesions and by increasing PSF’s ability to bind RNAs that promote cancer-related gene expression. PMID:19855157
Nanocapsule-mediated cytosolic siRNA delivery for anti-inflammatory treatment.
Jiang, Ying; Hardie, Joseph; Liu, Yuanchang; Ray, Moumita; Luo, Xiang; Das, Riddha; Landis, Ryan F; Farkas, Michelle E; Rotello, Vincent M
2018-06-05
The use of nanoparticle-stabilized nanocapsules for cytosolic siRNA delivery for immunomodulation in vitro and in vivo is reported. These NPSCs deliver siRNA directly to the cytosol of macrophages in vitro with concomitant knockdown of gene expression. In vivo studies showed directed delivery of NPSCs to the spleen, enabling gene silencing of macrophages, with preliminary studies showing 70% gene knockdown at a siRNA dose of 0.28 mg/kg. Significantly, the delivery of siRNA targeting tumor necrosis factor-α efficiently silenced TNF-α expression in LPS-challenged mice, demonstrating efficacy in modulating immune response in an organ-selective manner. This research highlights the potential of the NPSC platform for targeted immunotherapy and further manipulation of the immune system. Copyright © 2018 Elsevier B.V. All rights reserved.
Wu, Tinghuai; Tian, Jane; Cutler, Roy G.; Telljohann, Richard S.; Bernlohr, David; Mattson, Mark P.; Handa, James T.
2010-01-01
To maintain normal retinal function, retinal pigment epithelial (RPE) cells engulf photoreceptor outer segments (ROS) enriched in free fatty acids (FFAs). We have previously demonstrated fatty acid-binding protein 5 (FABP5) down-regulation in the RPE/choroidal complex in a mouse model of aging and early age-related macular degeneration. FABPs are involved in intracellular transport of FFAs and their targeting to specific metabolic pathways. To elucidate the role of FABP5 in lipid metabolism, the production of the FABP5 protein in a human RPE cell line was inhibited using RNA interference technology. As a result, the levels of cholesterol and cholesterol ester were decreased by about 40%, whereas FFAs and triglycerides were increased by 18 and 67% after siRNA treatment, respectively. Some species of phospholipids were decreased in siRNA-treated cells. Cellular lipid droplets were evident and apoB secretion was decreased by 76% in these cells. Additionally, we discovered that ARPE-19 cells could synthesize and secrete Apolipoprotein B100 (apoB100), which may serve as a backbone structure for the formation of lipoprotein particles in these cells. Our results indicate that FABP5 mRNA knockdown results in the accumulation of cellular triglycerides, decreased cholesterol levels, and reduced secretion of apoB100 protein and lipoprotein-like particles. These observations indicated that FABP5 plays a critical role in lipid metabolism in RPE cells, suggesting that FABP5 down-regulation in the RPE/choroid complex in vivo might contribute to aging and early age-related macular degeneration. PMID:19434059
Knockdown of human deubiquitinase PSMD14 induces cell cycle arrest and senescence
DOE Office of Scientific and Technical Information (OSTI.GOV)
Byrne, Ann; McLaren, Rajashree P.; Mason, Paul
2010-01-15
The PSMD14 (POH1, also known as Rpn11/MPR1/S13/CepP1) protein within the 19S complex (19S cap; PA700) is responsible for substrate deubiquitination during proteasomal degradation. The role of PSMD14 in cell proliferation and senescence was explored using siRNA knockdown in carcinoma cell lines. Our results reveal that down-regulation of PSMD14 by siRNA transfection had a considerable impact on cell viability causing cell arrest in the G0-G1 phase, ultimately leading to senescence. The molecular events associated with decreased cell proliferation, cell cycle arrest and senescence include down-regulation of cyclin B1-CDK1-CDC25C, down-regulation of cyclin D1 and up-regulation of p21{sup /Cip} and p27{sup /Kip1}. Mostmore » notably, phosphorylation of the retinoblastoma protein was markedly reduced in PSMD14 knockdown cells. A comparative study with PSMB5, a subunit of the 20S proteasome, revealed that PSMB5 and PSMD14 have different effects on cell cycle, senescence and associated molecular events. These data support the view that the 19S and 20S subunits of the proteasome have distinct biological functions and imply that targeting 19S and 20S would have distinct molecular consequences on tumor cells.« less
Exploring the free energy landscape of a model β-hairpin peptide and its isoform.
Narayanan, Chitra; Dias, Cristiano L
2014-10-01
Secondary structural transitions from α-helix to β-sheet conformations are observed in several misfolding diseases including Alzheimer's and Parkinson's. Determining factors contributing favorably to the formation of each of these secondary structures is therefore essential to better understand these disease states. β-hairpin peptides form basic components of anti-parallel β-sheets and are suitable model systems for characterizing the fundamental forces stabilizing β-sheets in fibrillar structures. In this study, we explore the free energy landscape of the model β-hairpin peptide GB1 and its E2 isoform that preferentially adopts α-helical conformations at ambient conditions. Umbrella sampling simulations using all-atom models and explicit solvent are performed over a large range of end-to-end distances. Our results show the strong preference of GB1 and the E2 isoform for β-hairpin and α-helical conformations, respectively, consistent with previous studies. We show that the unfolded states of GB1 are largely populated by misfolded β-hairpin structures which differ from each other in the position of the β-turn. We discuss the energetic factors contributing favorably to the formation of α-helix and β-hairpin conformations in these peptides and highlight the energetic role of hydrogen bonds and non-bonded interactions. © 2014 Wiley Periodicals, Inc.
Shi, Shuang; Zhong, Dong; Xiao, Yao; Wang, Bing; Wang, Wentao; Zhang, Fu'an; Huang, Haoyang
2017-06-20
Recent studies have shown that increased syndecan-1 (SDC1) expression in human glioma is associated with higher tumor grades and poor prognoses, but its oncogenic functions and the underlying molecular mechanisms remain unknown. Here, we examined SDC1 expression in datasets from The Cancer Genome Atlas and the National Center for Biotechnology Information Gene Expression Omnibus. Elevated SDC1 expression in glioma was closely associated with increases in tumor progression and shorter survival. We also examined SDC1 expression and evaluated the effects of stable SDC1 knockdown in glioma cell lines. SDC1 knockdown attenuated proliferation and invasion by glioma cells and markedly decreased PCNA and MMP-9 mRNA and protein expression. In a xenograft model, SDC1 knockdown suppressed the tumorigenic effects of U87 cells in vivo. SDC1 knockdown decreased phosphorylation of the c-src/FAK complex and its downstream signaling molecules, Erk, Akt and p38 MAPK. These results suggest that SDC1 may be a novel therapeutic target in the treatment of glioma.
Facile conversion of ATP-binding RNA aptamer to quencher-free molecular aptamer beacon.
Park, Yoojin; Nim-Anussornkul, Duangrat; Vilaivan, Tirayut; Morii, Takashi; Kim, Byeang Hyean
2018-01-15
We have developed RNA-based quencher-free molecular aptamer beacons (RNA-based QF-MABs) for the detection of ATP, taking advantage of the conformational changes associated with ATP binding to the ATP-binding RNA aptamer. The RNA aptamer, with its well-defined structure, was readily converted to the fluorescence sensors by incorporating a fluorophore into the loop region of the hairpin structure. These RNA-based QF-MABs exhibited fluorescence signals in the presence of ATP relative to their low background signals in the absence of ATP. The fluorescence emission intensity increased upon formation of a RNA-based QF-MAB·ATP complex. Copyright © 2017 Elsevier Ltd. All rights reserved.
Takahashi, Melissa K; Watters, Kyle E; Gasper, Paul M; Abbott, Timothy R; Carlson, Paul D; Chen, Alan A; Lucks, Julius B
2016-06-01
Antisense RNA-mediated transcriptional regulators are powerful tools for controlling gene expression and creating synthetic gene networks. RNA transcriptional repressors derived from natural mechanisms called attenuators are particularly versatile, though their mechanistic complexity has made them difficult to engineer. Here we identify a new structure-function design principle for attenuators that enables the forward engineering of new RNA transcriptional repressors. Using in-cell SHAPE-Seq to characterize the structures of attenuator variants within Escherichia coli, we show that attenuator hairpins that facilitate interaction with antisense RNAs require interior loops for proper function. Molecular dynamics simulations of these attenuator variants suggest these interior loops impart structural flexibility. We further observe hairpin flexibility in the cellular structures of natural RNA mechanisms that use antisense RNA interactions to repress translation, confirming earlier results from in vitro studies. Finally, we design new transcriptional attenuators in silico using an interior loop as a structural requirement and show that they function as desired in vivo. This work establishes interior loops as an important structural element for designing synthetic RNA gene regulators. We anticipate that the coupling of experimental measurement of cellular RNA structure and function with computational modeling will enable rapid discovery of structure-function design principles for a diverse array of natural and synthetic RNA regulators. © 2016 Takahashi et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Zhang, Xu; Wadkins, Randy M.
2009-01-01
Structures formed by single-strand DNA have become increasingly interesting because of their roles in a number of biological processes, particularly transcription and its regulation. Of particular importance is the fact that antitumor drugs such as Actinomycin D can selectively bind DNA hairpins over fully paired, double-strand DNA. A new fluorescent base analog, pyrrolo-deoxycytidine (PdC), can now be routinely incorporated into single-strand DNA. The fluorescence of PdC is particularly useful for studying the formation of single-strand DNA in regions of double-strand DNA. The fluorescence is quenched when PdC is paired with a complementary guanine residue, and thus is greatly enhanced upon formation of single-strand DNA. Hence, any process that results in melting or opening of DNA strands produces an increase in the fluorescence intensity of this base analog. In this study we measured the structural effects of incorporating PdC into DNA hairpins, and the effect of this incorporation on the binding of the hairpins by a fluorescent analog of the drug Actinomycin D. Two hairpin DNAs were used: one with PdC in the stem (basepaired) and one with PdC in the loop (unpaired). The thermal stability, 7-aminoactinomycin D binding, and three-dimensional structures of PdC incorporated into these DNA hairpins were all quite similar as compared to the hairpins containing an unmodified dC residue. Fluorescence lifetime measurements indicate that two lifetimes are present in PdC, and that the increase in fluorescence of the unpaired PdC residue compared to the basepaired PdC is due to an increase in the contribution of the longer lifetime to the average fluorescence lifetime. Our data indicate that PdC can be used effectively to differentiate paired and unpaired bases in DNA hairpin secondary structures, and should be similarly applicable for related structures such as cruciforms and quadruplexes. Further, our data indicate that PdC can act as a fluorescence resonance energy
Zhang, Xu; Wadkins, Randy M
2009-03-04
Structures formed by single-strand DNA have become increasingly interesting because of their roles in a number of biological processes, particularly transcription and its regulation. Of particular importance is the fact that antitumor drugs such as Actinomycin D can selectively bind DNA hairpins over fully paired, double-strand DNA. A new fluorescent base analog, pyrrolo-deoxycytidine (PdC), can now be routinely incorporated into single-strand DNA. The fluorescence of PdC is particularly useful for studying the formation of single-strand DNA in regions of double-strand DNA. The fluorescence is quenched when PdC is paired with a complementary guanine residue, and thus is greatly enhanced upon formation of single-strand DNA. Hence, any process that results in melting or opening of DNA strands produces an increase in the fluorescence intensity of this base analog. In this study we measured the structural effects of incorporating PdC into DNA hairpins, and the effect of this incorporation on the binding of the hairpins by a fluorescent analog of the drug Actinomycin D. Two hairpin DNAs were used: one with PdC in the stem (basepaired) and one with PdC in the loop (unpaired). The thermal stability, 7-aminoactinomycin D binding, and three-dimensional structures of PdC incorporated into these DNA hairpins were all quite similar as compared to the hairpins containing an unmodified dC residue. Fluorescence lifetime measurements indicate that two lifetimes are present in PdC, and that the increase in fluorescence of the unpaired PdC residue compared to the basepaired PdC is due to an increase in the contribution of the longer lifetime to the average fluorescence lifetime. Our data indicate that PdC can be used effectively to differentiate paired and unpaired bases in DNA hairpin secondary structures, and should be similarly applicable for related structures such as cruciforms and quadruplexes. Further, our data indicate that PdC can act as a fluorescence resonance energy
Role of different β-turns in β-hairpin conformation and stability studied by optical spectroscopy.
Wu, Ling; McElheny, Dan; Setnicka, Vladimír; Hilario, Jovencio; Keiderling, Timothy A
2012-01-01
Model β-hairpin peptides based on variations in the turn sequence of Cochran's tryptophan zipper peptide, SWTWENGKWTWK, were studied using electronic circular dichroism (ECD), fluorescence, and infrared (IR) spectroscopies. The trpzip2 Asn-Gly turn sequence was substituted with Thr-Gly, Aib-Gly, (D)Pro-Gly, and Gly-Asn (trpzip1) to study the impact of turn stability on β-hairpin formation. Stability and conformational changes of these hairpins were monitored by thermodynamic analyses of the temperature variation of both FTIR (amide I') and ECD spectral intensities. These changes were fit to a two-state model which yielded different T(m) values, representing the folding/unfolding process, for hairpins with different β-turns. Different β-turns show systematic contributions to hairpin structure formation, and their inclusion in hairpin design can modify the folding pathways. Aib-Gly or (D)Pro-Gly sequences stabilize the turn resulting in residual Trp-Trp interaction at high temperatures, but at the same time the β-structure (cross strand H-bonds) can become less stable due to constraints of the turn, as seen for (D)Pro-Gly. The structure of the Aib-Gly turn containing hairpin was determined by NMR and was shown to be like trpzip2 (Asn-Gly turn) as regards turn and strand geometries, but to differ from trpzip1 (Gly-Asn turn). The Munoz and Eaton statistical mechanically derived multistate model, tested as an alternate point of view, represented contributions from H-bonds and hydrophobic interactions as well as conformational change as interdependent. Use of different spectral methods that vary in dependence on these physical interactions along with the structural variations provided insight to the complex folding pathways of these small, well-folded peptides. Copyright © 2011 Wiley Periodicals, Inc.
Nrf2 Knockdown Disrupts the Protective Effect of Curcumin on Alcohol-Induced Hepatocyte Necroptosis.
Lu, Chunfeng; Xu, Wenxuan; Zhang, Feng; Shao, Jiangjuan; Zheng, Shizhong
2016-12-05
It has emerged that hepatocyte necroptosis plays a critical role in chronic alcoholic liver disease (ALD). Our previous study has identified that the beneficial therapeutic effect of curcumin on alcohol-caused liver injury might be attributed to activation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2), whereas the role of curcumin in regulating necroptosis and the underlying mechanism remain to be determined. We first found that chronic alcohol consumption triggered obvious hepatocyte necroptosis, leading to increased expression of receptor-interacting protein 1, receptor-interacting protein 3, high-mobility group box 1, and phosphorylated mixed lineage kinase domain-like in murine livers. Curcumin dose-dependently ameliorated hepatocyte necroptosis and alleviated alcohol-caused decrease in hepatic Nrf2 expression in alcoholic mice. Then Nrf2 shRNA lentivirus was introduced to generate Nrf2-knockdown mice. Our results indicated that Nrf2 knockdown aggravated the effects of alcohol on liver injury and necroptosis and even abrogated the inhibitory effect of curcumin on necroptosis. Further, activated Nrf2 by curcumin inhibited p53 expression in both livers and cultured hepatocytes under alcohol stimulation. The next in vitro experiments, similar to in vivo ones, revealed that although Nrf2 knockdown abolished the suppression of curcumin on necroptosis of hepatocytes exposed to ethanol, p53 siRNA could clearly rescued the relative effect of curcumin. In summary, for the first time, we concluded that curcumin attenuated alcohol-induced hepatocyte necroptosis in a Nrf2/p53-dependent mechanism. These findings make curcumin an excellent candidate for ALD treatment and advance the understanding of ALD mechanisms associated with hepatocyte necroptosis.
NASA Astrophysics Data System (ADS)
Yu, Hang; Han, Wei; Ma, Wen; Schulten, Klaus
2015-12-01
Parkinson's disease, originating from the intrinsically disordered peptide α-synuclein, is a common neurodegenerative disorder that affects more than 5% of the population above age 85. It remains unclear how α-synuclein monomers undergo conformational changes leading to aggregation and formation of fibrils characteristic for the disease. In the present study, we perform molecular dynamics simulations (over 180 μs in aggregated time) using a hybrid-resolution model, Proteins with Atomic details in Coarse-grained Environment (PACE), to characterize in atomic detail structural ensembles of wild type and mutant monomeric α-synuclein in aqueous solution. The simulations reproduce structural properties of α-synuclein characterized in experiments, such as secondary structure content, long-range contacts, chemical shifts, and 3J(HNHCα)-coupling constants. Most notably, the simulations reveal that a short fragment encompassing region 38-53, adjacent to the non-amyloid-β component region, exhibits a high probability of forming a β-hairpin; this fragment, when isolated from the remainder of α-synuclein, fluctuates frequently into its β-hairpin conformation. Two disease-prone mutations, namely, A30P and A53T, significantly accelerate the formation of a β-hairpin in the stated fragment. We conclude that the formation of a β-hairpin in region 38-53 is a key event during α-synuclein aggregation. We predict further that the G47V mutation impedes the formation of a turn in the β-hairpin and slows down β-hairpin formation, thereby retarding α-synuclein aggregation.
PlGF gene knockdown in human retinal pigment epithelial cells.
Akrami, Hassan; Soheili, Zahra-Soheila; Sadeghizadeh, Majid; Ahmadieh, Hamid; Rezaeikanavi, Mozhgan; Samiei, Shahram; Khalooghi, Keynoush
2011-04-01
To evaluate the knockdown of placental growth factor (PlGF) gene expression in human retinal pigment epithelium (RPE) cells and its effect on cell proliferation, apoptosis and angiogenic potential of RPE cells. Human RPE cells were isolated by dispase I solution and cultured in DMEM/F12 supplemented with 10% fetal calf serum (FCS). A small interfering RNA (siRNA) corresponding to PlGF mRNA and a scrambled siRNA (scRNA) were introduced into the cells. Cell proliferation and cell death were examined by ELISA. PlGF mRNA and protein were quantified by real-time polymerase chain reaction (PCR) and western blot. The levels of gene expression for human retinal pigment epithelium-specific protein 65 kDa (RPE65), cellular retinaldehyde-binding protein (CRALBP) and tyrosinase were examined by real-time PCR. The angiogenic activity of RPE cell-derived conditioned media was assayed by a tube formation assay using human umbilical vein endothelial cells (HUVECs). At a final siRNA concentration of 20 pmol/ml, the transfection efficiency was about 80%. The amount of PlGF transcripts was reduced to 10% after 36 h of incubation, and the amount of PlGF protein in culture supernatant was significantly decreased. Suppression of PlGF gene had no effect on RPE cell proliferation and survival, and there were no notable changes in the transcript levels of RPE65, CRALBP or tyrosinase for the cultures treated by siRNA cognate to PlGF. Vascular tube formation was efficiently reduced in HUVECs. Our findings present PlGF as a key modulator of angiogenic potential in RPE cells of the human retina.
Affinity maturation of a portable Fab–RNA module for chaperone-assisted RNA crystallography
Koirala, Deepak; Shelke, Sandip A; Dupont, Marcel; Ruiz, Stormy; DasGupta, Saurja; Bailey, Lucas J; Benner, Steven A; Piccirilli, Joseph A
2018-01-01
Abstract Antibody fragments such as Fabs possess properties that can enhance protein and RNA crystallization and therefore can facilitate macromolecular structure determination. In particular, Fab BL3–6 binds to an AAACA RNA pentaloop closed by a GC pair with ∼100 nM affinity. The Fab and hairpin have served as a portable module for RNA crystallization. The potential for general application make it desirable to adjust the properties of this crystallization module in a manner that facilitates its use for RNA structure determination, such as ease of purification, surface entropy or binding affinity. In this work, we used both in vitro RNA selection and phage display selection to alter the epitope and paratope sides of the binding interface, respectively, for improved binding affinity. We identified a 5′-GNGACCC-3′ consensus motif in the RNA and S97N mutation in complimentarity determining region L3 of the Fab that independently impart about an order of magnitude improvement in affinity, resulting from new hydrogen bonding interactions. Using a model RNA, these modifications facilitated crystallization under a wider range of conditions and improved diffraction. The improved features of the Fab–RNA module may facilitate its use as an affinity tag for RNA purification and imaging and as a chaperone for RNA crystallography. PMID:29309709
Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C
2006-12-01
Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.
Xu, Lu-lu; Lu, Yun-tao; Zhang, Jing; Wu, Lian; Merrilees, Mervyn J; Qu, Jie-ming
2015-08-15
COPD lung is characterized by loss of alveolar elastic fibers and an increase in the chondroitin sulfate (CS) matrix proteoglycan versican V1 (V1). V1 is a known inhibitor of elastic fiber deposition and this study investigates the effects of knockdown of V1, and add-back of CS, on CCL-210 lung fibroblasts treated with cigarette smoke extract (CSE) as a model for COPD. CSE inhibited fibroblast proliferation, viability, tropoelastin synthesis, and elastin deposition, and increased V1 synthesis and secretion. V1 siRNA decreased V1 and constituent CS, did not affect tropoelastin production, but blocked the CSE-induced loss in insoluble elastin. Exogenous CS reduced insoluble elastin, even in the presence of V1 siRNA. These findings confirm that V1 and CS impair the assembly of tropoelastin monomers into insoluble fibers, and further demonstrate that specific knockdown of V1 alleviates the impaired assembly of elastin seen in cultures of pulmonary fibroblasts exposed to CSE, indicating a regulatory role for this protein in the pathophysiology of COPD. Copyright © 2015 Elsevier B.V. All rights reserved.
RNA nanopatterning on graphene
NASA Astrophysics Data System (ADS)
Li, Q.; Froning, J. P.; Pykal, M.; Zhang, S.; Wang, Z.; Vondrák, M.; Banáš, P.; Čépe, K.; Jurečka, P.; Šponer, J.; Zbořil, R.; Dong, M.; Otyepka, M.
2018-07-01
Graphene-based materials enable the sensing of diverse biomolecules using experimental approaches based on electrochemistry, spectroscopy, or other methods. Although basic sensing was achieved, it had until now not been possible to understand and control biomolecules’ structural and morphological organization on graphene surfaces (i.e. their stacking, folding/unfolding, self-assembly, and nano-patterning). Here we present the insight into structural and morphological organization of biomolecules on graphene in water, using an RNA hairpin as a model system. We show that the key parameters governing the RNA’s behavior on the graphene surface are the number of graphene layers, RNA concentration, and temperature. At high concentrations, the RNA forms a film on the graphene surface with entrapped nanobubbles. The density and the size of the bubbles depend on the number of graphene layers. At lower concentrations, unfolded RNA stacks on the graphene and forms molecular clusters on the surface. Such a control over the conformational behavior of interacting biomolecules at graphene/water interfaces would facilitate new applications of graphene derivatives in biotechnology and biomedicine.
Gonzalez, Eva; Nagiel, Aaron; Lin, Alison J; Golan, David E; Michel, Thomas
2004-09-24
Caveolin-1 is a scaffolding/regulatory protein that interacts with diverse signaling molecules in endothelial cells. To explore the role of this protein in receptor-modulated signaling pathways, we transfected bovine aortic endothelial cells (BAEC) with small interfering RNA (siRNA) duplexes to down-regulate caveolin-1 expression. Transfection of BAEC with duplex siRNA targeted against caveolin-1 mRNA selectively "knocked-down" the expression of caveolin-1 by approximately 90%, as demonstrated by immunoblot analyses of BAEC lysates. We used discontinuous sucrose gradients to purify caveolin-containing lipid rafts from siRNA-treated endothelial cells. Despite the near-total down-regulation of caveolin-1 expression, the lipid raft targeting of diverse signaling proteins (including the endothelial isoform of nitric-oxide synthase, Src-family tyrosine kinases, Galphaq and the insulin receptor) was unchanged. We explored the consequences of caveolin-1 knockdown on kinase pathways modulated by the agonists sphingosine-1 phosphate (S1P) and vascular endothelial growth factor (VEGF). siRNA-mediated caveolin-1 knockdown enhanced basal as well as S1P- and VEGF-induced phosphorylation of the protein kinase Akt and did not modify the basal or agonist-induced phosphorylation of extracellular signal-regulated kinases 1/2. Caveolin-1 knock-down also significantly enhanced the basal and agonist-induced activity of the small GTPase Rac. We used siRNA to down-regulate Rac expression in BAEC, and we observed that Rac knockdown significantly reduced basal, S1P-, and VEGF-induced Akt phosphorylation, suggesting a role for Rac activation in the caveolin siRNA-mediated increase in Akt phosphorylation. By using siRNA to knockdown caveolin-1 and Rac expression in cultured endothelial cells, we have found that caveolin-1 does not seem to be required for the targeting of signaling molecules to caveolae/lipid rafts and that caveolin-1 differentially modulates specific kinase pathways in
Poerschke, Robyn L.; Moos, Philip J.
2010-01-01
Thioredoxin reductase (TR1) is a selenoprotein that is involved in cellular redox status control and deoxyribonucleotide biosynthesis. Many cancers, including lung, overexpress TR1, making it a potential cancer therapy target. Previous work has shown that TR1 knockdown enhances the sensitivity of cancer cells to anticancer treatments, as well as certain selenocompounds. However, it is unknown if TR1 knockdown produces similar effect on the sensitivity of human lung cancer cells. To further elucidate the role of TR1 in the mechanism of selenocompounds in lung cancer, a lentiviral microRNA delivery system to knockdown TR1 expression in A549 human lung adenocarcinoma cells was utilized. Cell viability was assessed after 48 hr treatment with the selenocysteine prodrug selenazolidines 2-butylselenazolidine-4(R)-carboxylic acid (BSCA) and 2-cyclohexylselenazolidine-4-(R)-carboxylic acid (ChSCA), selenocystine (SECY), methylseleninic acid (MSA), 1,4-phenylenebis(methylene)selenocyanate (p-XSC), and selenomethionine (SEM). TR1 knockdown increased the cytotoxicity of BSCA, ChSCA, and SECY but did not sensitize cells to MSA, SEM, or p-XSC. GSH and TR1 depletion together decreased cell viability, while no change was observed with GSH depletion alone. Reactive oxygen species generation was induced only in TR1 knockdown cells treated with the selenazolidines or SECY. These three compounds also decreased total intracellular glutathione levels and oxidized thioredoxin, but in a TR1 independent manner. TR1 knockdown increased selenazolidine and SECY-induced mitochondrial membrane depolarization, as well as DNA strand breaks and AIF translocation from the mitochondria. These results indicate the ability of TR1 to modulate the cytotoxic effects of BSCA, ChSCA and SECY in human lung cancer cells through mitochondrial dysfunction. PMID:20920480
Effect of the reflectional symmetry on the coherent hole transport across DNA hairpins
NASA Astrophysics Data System (ADS)
Zarea, Mehdi; Berlin, Yuri; Ratner, Mark A.
2017-03-01
The coherent hole transfer in three types of DNA hairpins containing strands with adenine (A) and guanine (G) nucleobases has been studied. The investigated hairpins involve An+1GGAn, AnGAGAn, or (AG)2nA strands that connect the hole donor and hole acceptor located on opposite ends of hairpins. The positive charge transfer from the photo-excited donor to the acceptor is shown to be slower for An+1GGAn in comparison with AnGAGAn and (AG)2nA sequences. We have revealed that this is due to the reflectional symmetry of the last two sequences with respect to the axis passing through the middle base. As has been demonstrated, the symmetry of the sequence structure manifests itself in the reflectional symmetry of the energy eigenstates. In addition, it has been shown that (AG)2nA is the only symmetric sequence with a zero energy state in the middle of the LUMO tight-binding energy band. Based on our theoretical findings, we predict that the hairpin with this sequence should have the fastest coherent hole transfer rate among the class of base sequences studied.
Haga, Kei; Ohno, Shin-ichi; Yugawa, Takashi; Narisawa-Saito, Mako; Fujita, Masatoshi; Sakamoto, Michiie; Galloway, Denise A; Kiyono, Tohru
2007-02-01
Activation of telomerase is sufficient for immortalization of some types of human cells but additional factors may also be essential. It has been proposed that stress imposed by inadequate culture conditions induces senescence due to accumulation of p16(INK4a). Here, we present evidence that many human cell types undergo senescence by activation of the p16(INK4a)/Rb pathway, and that introduction of Bmi-1 can inhibit p16(INK4a) expression and extend the life span of human epithelial cells derived from skin, mammary gland and lung. Introduction of p16(INK4a)-specific short hairpin RNA, as well as Bmi-1, suppressed p16(INK4a) expression in human mammary epithelial cells without promoter methylation, and extended their life span. Subsequent introduction of hTERT, the telomerase catalytic subunit, into cells with low p16(INK4a) levels resulted in efficient immortalization of three cell types without crisis or growth arrest. The majority of the human mammary epithelial cells thus immortalized showed almost normal ploidy as judged by G-banding and spectral karyotyping analysis. Our data suggest that inhibition of p16(INK4a) and introduction of hTERT can immortalize many human cell types with little chromosomal instability.
Gene expression profiling of selenophosphate synthetase 2 knockdown in Drosophila melanogaster.
Li, Gaopeng; Liu, Liying; Li, Ping; Chen, Luonan; Song, Haiyun; Zhang, Yan
2016-03-01
Selenium (Se) is an important trace element for many organisms and is incorporated into selenoproteins as selenocysteine (Sec). In eukaryotes, selenophosphate synthetase SPS2 is essential for Sec biosynthesis. In recent years, genetic disruptions of both Sec biosynthesis genes and selenoprotein genes have been investigated in different animal models, which provide important clues for understanding the Se metabolism and function in these organisms. However, a systematic study on the knockdown of SPS2 has not been performed in vivo. Herein, we conducted microarray experiments to study the transcriptome of fruit flies with knockdown of SPS2 in larval and adult stages. Several hundred differentially expressed genes were identified in each stage. In spite that the expression levels of other Sec biosynthesis genes and selenoprotein genes were not significantly changed, it is possible that selenoprotein translation might be reduced without impacting the mRNA level. Functional enrichment and network-based analyses revealed that although different sets of differentially expressed genes were obtained in each stage, they were both significantly enriched in the carbohydrate metabolism and redox processes. Furthermore, protein-protein interaction (PPI)-based network clustering analysis implied that several hub genes detected in the top modules, such as Nimrod C1 and regucalcin, could be considered as key regulators that are responsible for the complex responses caused by SPS2 knockdown. Overall, our data provide new insights into the relationship between Se utilization and several fundamental cellular processes as well as diseases.
Bottom-up design of small molecules that stimulate exon 10 skipping in mutant MAPT pre-mRNA.
Luo, Yiling; Disney, Matthew D
2014-09-22
One challenge in chemical biology is to develop small molecules that control cellular protein content. The amount and identity of proteins are influenced by the RNAs that encode them; thus, protein content in a cell could be affected by targeting mRNA. However, RNA has been traditionally difficult to target with small molecules. In this report, we describe controlling the protein products of the mutated microtubule-associated protein tau (MAPT) mature mRNA with a small molecule. MAPT mutations in exon 10 are associated with inherited frontotemporal dementia and Parkinsonism linked to chromosome 17 (FTDP-17), an incurable disease that is directly caused by increased inclusion of exon 10 in MAPT mRNA. Recent studies have shown that mutations within a hairpin at the MAPT exon 10-intron junction decrease the thermodynamic stability of the RNA, increasing binding to U1 snRNP and thus exon 10 inclusion. Therefore, we designed small molecules that bind and stabilize a mutant MAPT by using Inforna, a computational approach based on information about RNA-small-molecule interactions. The optimal compound selectively bound the mutant MAPT hairpin and thermodynamically stabilized its folding, facilitating exon 10 exclusion. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Application of ion mobility-mass spectrometry to microRNA analysis.
Takebayashi, Kosuke; Hirose, Kenji; Izumi, Yoshihiro; Bamba, Takeshi; Fukusaki, Eiichiro
2013-03-01
Liquid chromatography/mass spectrometry is widely used for studying sequence determination and modification analysis of small RNAs. However, the efficiency of liquid chromatography-based separation of intact small RNA species is insufficient, since the physiochemical properties among small RNAs are very similar. In this study, we focused on ion mobility-mass spectrometry (IM-MS), which is a gas-phase separation technique coupled with mass spectrometry; we have evaluated the utility of IM-MS for microRNA (miRNA) analysis. A multiply charged deprotonated ion derived from an 18-24-nt-long miRNA was formed by electrospray ionization, and then the time, called the "drift time", taken by each ion to migrate through a buffer gas was measured. Each multivalent ion was temporally separated on the basis of the charge state and structural formation; 3 types of unique mass-mobility correlation patterns (i.e., chainlike-form, hairpin-form, and dimer-form) were present on the two-dimensional mobility-mass spectrum. Moreover, we found that the ion size (sequence length) and the secondary structures of the small RNAs strongly contributed to the IM-MS-based separation, although solvent conditions such as pH had no effect. Therefore, sequence isomers could also be discerned by the selection of each specific charged ion, i.e., the 6(-) charged ion reflected a majority among chainlike-, hairpin-, and other structures. We concluded that the IM-MS provides additional capability for separation; thus, this analytical method will be a powerful tool for comprehensive small RNA analysis. Copyright © 2012. Published by Elsevier B.V.
Structural Plasticity and Rapid Evolution in a Viral RNA Revealed by In Vivo Genetic Selection▿ †
Guo, Rong; Lin, Wai; Zhang, Jiuchun; Simon, Anne E.; Kushner, David B.
2009-01-01
Satellite RNAs usually lack substantial homology with their helper viruses. The 356-nucleotide satC of Turnip crinkle virus (TCV) is unusual in that its 3′-half shares high sequence similarity with the TCV 3′ end. Computer modeling, structure probing, and/or compensatory mutagenesis identified four hairpins and three pseudoknots in this TCV region that participate in replication and/or translation. Two hairpins and two pseudoknots have been confirmed as important for satC replication. One portion of the related 3′ end of satC that remains poorly characterized corresponds to juxtaposed TCV hairpins H4a and H4b and pseudoknot ψ3, which are required for the TCV-specific requirement of translation (V. A. Stupina et al., RNA 14:2379-2393, 2008). Replacement of satC H4a with randomized sequence and scoring for fitness in plants by in vivo genetic selection (SELEX) resulted in winning sequences that contain an H4a-like stem-loop, which can have additional upstream sequence composing a portion of the stem. SELEX of the combined H4a and H4b region in satC generated three distinct groups of winning sequences. One group models into two stem-loops similar to H4a and H4b of TCV. However, the selected sequences in the other two groups model into single hairpins. Evolution of these single-hairpin SELEX winners in plants resulted in satC that can accumulate to wild-type (wt) levels in protoplasts but remain less fit in planta when competed against wt satC. These data indicate that two highly distinct RNA conformations in the H4a and H4b region can mediate satC fitness in protoplasts. PMID:19004956
2006-12-01
Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE r/sYDEFENSE Gene Knockdown of Venezuelan Equine...Further research is required to develop an antiviral against VEE that is both safe and effective. One antiviral strategy that has shown considerable...Novagen, Madison, WI)) on a MJ Research PTC-200 DNA engine (Bio-Rad, formerly MJ Research , Mississauga, ON). Amplification products (5 pL) were
Jiang, Jing; Shi, Sheng-Hong; Li, Xu-Jun; Sun, Long; Ge, Qi-Dong; Li, Chao; Zhang, Wei
2018-06-01
Long non-coding RNAs (lncRNAs) are primary regulators of cancer development via their involvement in almost every aspect of cell biology. Recent studies have indicated that lncRNAs serve pivotal roles in breast cancer (BC) progression; however, to the best of our knowledge, the role of the lncRNA BRAF-regulated lncRNA 1 (BANCR) in BC has not yet been elucidated. The present study revealed that BANCR was overexpressed in BC cell lines and tissues, and could promote the clinical progression of disease, including increases in tumor size, lymph node metastasis and Tumor-Node-Metastasis stage. Furthermore, high BANCR expression was demonstrated to be associated with poor overall survival rates and early recurrence of BC in patients. Additionally, univariate and multivariate COX regression analyses identified high BANCR expression as an independent risk factor of poor prognosis of patients with BC. In addition, to verify the function of BANCR in BC cell lines, BANCR expression was silenced using short hairpin RNAs in MDA-MB-231 cells and overexpressed in MDA-MB-468 cells. An MTT assay and colony formation assay indicated that BANCR knockdown could suppress the proliferation of BC cells, whereas BANCR upregulation induced the proliferation of BC cells. Furthermore, BANCR silencing also reduced the migration and invasion of BC cells, as demonstrated via transwell migration and invasion assays. Consistently, the migration and invasion of BC cells increased upon BANCR ectopic overexpression in MDA-MB-468 cells. Mechanistically, matrix metallopeptidase 2/9 and epithelial-mesenchymal transition markers may be the potential targets of BANCR in regulating BC metastasis. In conclusion, BANCR overexpression could promote the clinical progression, metastasis and proliferation of BC and indicate poor prognosis of patients with BC. BANCR may therefore be a potential prognostic marker and therapeutic target of patients with BC.
Wigington, Callie P.; Morris, Kevin J.; Newman, Laura E.; Corbett, Anita H.
2016-01-01
Polyadenosine RNA-binding proteins (Pabs) regulate multiple steps in gene expression. This protein family includes the well studied Pabs, PABPN1 and PABPC1, as well as the newly characterized Pab, zinc finger CCCH-type containing protein 14 (ZC3H14). Mutations in ZC3H14 are linked to a form of intellectual disability. To probe the function of ZC3H14, we performed a transcriptome-wide analysis of cells depleted of either ZC3H14 or the control Pab, PABPN1. Depletion of PABPN1 affected ∼17% of expressed transcripts, whereas ZC3H14 affected only ∼1% of expressed transcripts. To assess the function of ZC3H14 in modulating target mRNAs, we selected the gene encoding the ATP synthase F0 subunit C (ATP5G1) transcript. Knockdown of ZC3H14 significantly reduced ATP5G1 steady-state mRNA levels. Consistent with results suggesting that ATP5G1 turnover increases upon depletion of ZC3H14, double knockdown of ZC3H14 and the nonsense-mediated decay factor, UPF1, rescues ATP5G1 transcript levels. Furthermore, fractionation reveals an increase in the amount of ATP5G1 pre-mRNA that reaches the cytoplasm when ZC3H14 is depleted and that ZC3H14 binds to ATP5G1 pre-mRNA in the nucleus. These data support a role for ZC3H14 in ensuring proper nuclear processing and retention of ATP5G1 pre-mRNA. Consistent with the observation that ATP5G1 is a rate-limiting component for ATP synthase activity, knockdown of ZC3H14 decreases cellular ATP levels and causes mitochondrial fragmentation. These data suggest that ZC3H14 modulates pre-mRNA processing of select mRNA transcripts and plays a critical role in regulating cellular energy levels, observations that have broad implications for proper neuronal function. PMID:27563065
Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins
NASA Astrophysics Data System (ADS)
Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John
2017-01-01
DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.
Unfolding and folding internal friction of β-hairpins is smaller than that of α-helices.
Schulz, Julius C F; Miettinen, Markus S; Netz, R R
2015-04-02
By the forced unfolding of polyglutamine and polyalanine homopeptides in competing α-helix and β-hairpin secondary structures, we disentangle equilibrium free energetics from nonequilibrium dissipative effects. We find that α-helices are characterized by larger friction or dissipation upon unfolding, regardless of whether they are free energetically preferred over β-hairpins or not. Our analysis, based on MD simulations for atomistic peptide models with explicit water, suggests that this difference is related to the internal friction and mostly caused by the different number of intrapeptide hydrogen bonds in the α-helix and β-hairpin states.
Zheng, Jiao; Li, Ningxing; Li, Chunrong; Wang, Xinxin; Liu, Yucheng; Mao, Guobin; Ji, Xinghu; He, Zhike
2018-06-01
Synthetic enzyme-free DNA nanomachine performs quasi-mechanical movements in response to external intervention, suggesting the promise of constructing sensitive and specific biosensors. Herein, a smart DNA nanomachine biosensor for biomolecule (such as nucleic acid, thrombin and adenosine) detection is developed by target-assisted enzyme-free hairpin DNA cascade amplifier. The whole DNA nanomachine system is constructed on gold nanoparticle which decorated with hundreds of locked hairpin substrate strands serving as DNA tracks, and the DNA nanomachine could be activated by target molecule toehold-mediated exchange on gold nanoparticle surface, resulted in the fluorescence recovery of fluorophore. The process is repeated so that each copy of the target can open multiplex fluorophore-labeled hairpin substrate strands, resulted in amplification of the fluorescence signal. Compared with the conventional biosensors of catalytic hairpin assembly (CHA) without substrate in solution, the DNA nanomachine could generate 2-3 orders of magnitude higher fluorescence signal. Furthermore, the DNA nanomachine could be used for nucleic acid, thrombin and adenosine highly sensitive specific detection based on isothermal, and homogeneous hairpin DNA cascade signal amplification in both buffer and a complicated biomatrix, and this kind of DNA nanomachine could be efficiently applied in the field of biomedical analysis. Copyright © 2018 Elsevier B.V. All rights reserved.
A Therapeutic Potential of Animal β-hairpin Antimicrobial Peptides.
Panteleev, Pavel V; Balandin, Sergey V; Ivanov, Vadim T; Ovchinnikova, Tatiana V
2017-01-01
Endogenous antimicrobial peptides (AMPs) are evolutionary ancient molecular factors of innate immunity that play the key role in host defense. Because of the low resistance rate, AMPs have caught extensive attention as possible alternatives to conventional antibiotics. Over the last years, it has become evident that biological functions of AMPs are beyond direct killing of microbial cells. This review focuses on a relatively small family of animal host defense peptides with the β-hairpin structure stabilized by disulfide bridges. Their small size, rigid structure, stability to proteases, and plethora of biological functions, including antibacterial, antifungal, antiviral, anticancer, endotoxin-binding, metabolism- and immune- modulating activities, make natural β-hairpin AMPs an attractive molecular basis for drug design. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
α-helix to β-hairpin transition of human amylin monomer
NASA Astrophysics Data System (ADS)
Singh, Sadanand; Chiu, Chi-cheng; Reddy, Allam S.; de Pablo, Juan J.
2013-04-01
The human islet amylin polypeptide is produced along with insulin by pancreatic islets. Under some circumstances, amylin can aggregate to form amyloid fibrils, whose presence in pancreatic cells is a common pathological feature of Type II diabetes. A growing body of evidence indicates that small, early stage aggregates of amylin are cytotoxic. A better understanding of the early stages of the amylin aggregation process and, in particular, of the nucleation events leading to fibril growth could help identify therapeutic strategies. Recent studies have shown that, in dilute solution, human amylin can adopt an α-helical conformation, a β-hairpin conformation, or an unstructured coil conformation. While such states have comparable free energies, the β-hairpin state exhibits a large propensity towards aggregation. In this work, we present a detailed computational analysis of the folding pathways that arise between the various conformational states of human amylin in water. A free energy surface for amylin in explicit water is first constructed by resorting to advanced sampling techniques. Extensive transition path sampling simulations are then employed to identify the preferred folding mechanisms between distinct minima on that surface. Our results reveal that the α-helical conformer of amylin undergoes a transformation into the β-hairpin monomer through one of two mechanisms. In the first, misfolding begins through formation of specific contacts near the turn region, and proceeds via a zipping mechanism. In the second, misfolding occurs through an unstructured coil intermediate. The transition states for these processes are identified. Taken together, the findings presented in this work suggest that the inter-conversion of amylin between an α-helix and a β-hairpin is an activated process and could constitute the nucleation event for fibril growth.
Cheng, Feng; Pan, Ying; Lu, Yi-Min; Zhu, Lei; Chen, Shuzheng
2017-01-01
RNA-binding proteins (RBPs) and miRNAs are capable of controlling processes in normal development and cancer. Both of them could determine RNA transcripts fate from synthesis to decay. One such RBP, Dead end (Dnd1), is essential for regulating germ-cell viability and suppresses the germ-cell tumors development, yet how it exerts its functions in breast cancer has remained unresolved. The level of Dnd1 was detected in 21 cancerous tissues paired with neighboring normal tissues by qRT-PCR. We further annotated TCGA (The Cancer Genome Atlas) mRNA expression profiles and found that the expression of Dnd1 and Bim is positively correlated ( p = 0.04). Patients with higher Dnd1 expression level had longer overall survival ( p = 0.0014) by KM Plotter tool. Dnd1 knockdown in MCF-7 cells decreased Bim expression levels and inhibited apoptosis. While knockdown of Dnd1 promoted the decay of Bim mRNA 3'UTR, the stability of Bim-5'UTR was not affected. In addition, mutation of miR-221-binding site in Bim-3'UTR canceled the effect of Dnd1 on Bim mRNA. Knockdown of Dnd1 in MCF-7 cells confirmed that Dnd1 antagonized miR-221-inhibitory effects on Bim expression. Overall, our findings indicate that Dnd1 facilitates apoptosis by increasing the expression of Bim via its competitive combining with miR-221 in Bim-3'UTR. The new function of Dnd1 may contribute to a vital role in breast cancer development.
Long non-coding RNA SNHG6 promotes glioma tumorigenesis by sponging miR-101-3p.
Meng, Qiang; Yang, Bao-Ying; Liu, Bei; Yang, Ji-Xue; Sun, Yang
2018-05-01
Glioma is the most common primary brain tumor. The small nucleolar RNA host gene (SNHG) SNHG6 is a potential oncogene in the development of several types of cancers. In this study, we investigated the functional role of long non-coding RNA (lncRNA) SNHG6 in the malignancy of glioma in cell lines and transplanted nude mice. We found that the expression of lncRNA SNHG6 was higher in glioma tissues and cells than in normal brain tissues and cells. The expression of lncRNA SNHG6 was positively correlated with the malignancy and poor prognosis of glioma patients. microRNA (miR)-101-3p expression was decreased in glioma tissues and cells and was negatively correlated with the malignancy and poor prognosis of glioma patients. In glioma tissues, the expression of lncRNA SNHG6 was negatively correlated with the expression of miR-101-3p. SNHG6 contained a binding site of miR-101-3p. Knockdown of SNHG6 expression resulted in a significant increase of miR-101-3p expression. miR-101-3p mimic markedly decreased the luciferase activity of SNHG6. Knockdown of SNHG6 inhibited glioma cell proliferation, migration, and epithelial-mesenchymal transition (EMT), and increased apoptosis. miR-101-3p mimic enhanced knockdown of SNHG6-induced inhibition of cell proliferation, migration, and EMT, and an increase of apoptosis. Anti-miR-101-3p reversed the the effects of si-SNHG6 on cell malignancy. Knockdown of SNHG6 remarkably reduced the increase of tumor volumes in xenograft mouse models. In tumor tissues, knockdown of SNHG6 increased the expression of miR-101-3p and reduced EMT biomarker expression. Our study provides novel insights into the functions of lncRNA SNHG6/miR-101-3p axis in the tumorigenesis of glioma.
Transmembrane Segments Form Tertiary Hairpins in the Folding Vestibule of the Ribosome.
Tu, LiWei; Khanna, Pooja; Deutsch, Carol
2013-01-01
Folding of membrane proteins begins in the ribosome as the peptide is elongated. During this process, the nascent peptide navigates along 100 Å of tunnel from the peptidyltransferase center to the exit port. Proximal to the exit port is a ‘folding vestibule’ that permits the nascent peptide to compact and explore conformational space for potential tertiary folding partners. The latter occurs for cytosolic subdomains, but has not yet been shown for transmembrane segments. We now demonstrate, using an accessibility assay and an improved, intramolecular crosslinking assay, that the helical transmembrane S3b-S4 hairpin (‘paddle’) of a voltage-gated potassium (Kv) channel, a critical region of the Kv voltage sensor, forms in the vestibule. S3-S4 hairpin interactions are detected at an early stage of Kv biogenesis. Moreover, this vestibule hairpin is consistent with a closed-state conformation of the Kv channel in the plasma membrane. PMID:24055377
Revisiting Criteria for Plant MicroRNA Annotation in the Era of Big Data[OPEN
2018-01-01
MicroRNAs (miRNAs) are ∼21-nucleotide-long regulatory RNAs that arise from endonucleolytic processing of hairpin precursors. Many function as essential posttranscriptional regulators of target mRNAs and long noncoding RNAs. Alongside miRNAs, plants also produce large numbers of short interfering RNAs (siRNAs), which are distinguished from miRNAs primarily by their biogenesis (typically processed from long double-stranded RNA instead of single-stranded hairpins) and functions (typically via roles in transcriptional regulation instead of posttranscriptional regulation). Next-generation DNA sequencing methods have yielded extensive data sets of plant small RNAs, resulting in many miRNA annotations. However, it has become clear that many miRNA annotations are questionable. The sheer number of endogenous siRNAs compared with miRNAs has been a major factor in the erroneous annotation of siRNAs as miRNAs. Here, we provide updated criteria for the confident annotation of plant miRNAs, suitable for the era of “big data” from DNA sequencing. The updated criteria emphasize replication and the minimization of false positives, and they require next-generation sequencing of small RNAs. We argue that improved annotation systems are needed for miRNAs and all other classes of plant small RNAs. Finally, to illustrate the complexities of miRNA and siRNA annotation, we review the evolution and functions of miRNAs and siRNAs in plants. PMID:29343505
Gabriele, Lilian Gobbo; Morandini, Ana Carolina; Dionísio, Thiago José; Santos, Carlos Ferreira
2017-01-01
The renin-angiotensin (Ang) system (RAS) has been reported as an important modulator of inflammatory and immune responses. Evidence suggests an alternative Ang 1-7/Mas receptor axis as counter-regulatory to the classic RAS Ang II/Ang II Type 1 (AT1) receptor axis. It is known that periodontal pathogens elicit host-derived immune response due to release of cytokines such as interleukin (IL)-1β, and fibroblasts are among the most numerous sentinel cells that contribute to this production. The aim of this study is to determine whether AT1 receptor (AT1R) contributes to production of inflammatory cytokines that are important for periodontal pathogenesis using primary human gingival fibroblasts (HGFs) and human periodontal ligament fibroblasts (HPLFs) stimulated with IL-1β. Through RNA interference or pharmacologic inhibition using AT1R antagonist losartan, HGF and HPLF were stimulated by IL-1β for 3 (messenger RNA [mRNA]) or 24 (protein) hours. IL-1β upregulated mRNA expression of AT1R, IL-1β, IL-6, IL-8, tumor necrosis factor-alpha, and osteoprotegerin (OPG) in HGF and HPLF. AT1R knockdown impaired IL-1β-induced IL-6 and IL-8 secretion in cultured HGF and HPLF. AT1R silencing also increased OPG gene expression in HGF only. Pharmacologic inhibition of AT1R through losartan modulated mRNA transcription of IL-6 and IL-8 in HPLF but not in HGF. In contrast, IL-1β-induced secretion of IL-6 and IL-8 was not influenced by losartan in HGF or HPLF. These results suggest that AT1R knockdown and AT1R pharmacologic blockade by losartan may differently control balance of inflammatory cytokines, such as IL-6 and IL-8, in primary human periodontal fibroblasts.
Terova, Genciana; Rimoldi, Simona; Bernardini, Giovanni; Saroglia, Marco
2013-06-01
Myostatin (MSTN), previously referred to as growth differentiation factor 8 (GDF8), is a negative regulator of skeletal muscle growth. In accordance with this role, natural mutations that inactivate the gene disrupting the function of the protein are associated with excessive muscle growth and double-muscling phenotype in several mammalian species. Recent studies using transgenic MSTN deficient zebrafish and medaka support the idea that this gene inhibits skeletal muscle growth even in fish. If the atrophic actions of mammalian MSTN are indeed conserved in fish, strategies capable of inhibiting the expression of this gene could be applied to enhance growth performance in livestock production. Gene silencing by RNA interference has emerged as a promising new method of inhibiting the expression of targeted genes and inducing knockdown of associated proteins both in vitro and in vivo. Accordingly, we investigated here whether double-stranded RNA (dsRNA) or different plasmids expressing short-hairpin interfering RNAs (shRNAs) against myostatin and transduced by in vivo electroporation would increase skeletal muscle mass in reared European sea bass. After 7 weeks of intramuscular injections on a weekly basis followed by in vivo electrically mediated dsRNA delivery, no increase in the condition factor (K) of fish was observed as compared to the controls. Analogously, mean body weight and K of sea bass injected with three shRNAs were not higher than those of the control fish. On the other hand, MSTN transcript quantification via real-time RT-PCR revealed a significant inhibition of gene expression in the muscle of the dsRNA-injected fish and in the muscle of fish injected with one of the three tested shRNA-expressing vector constructs. In conclusion, in vivo electric-mediated delivery of dsRNA- or shRNA-expressing vectors against MSTN inhibits MSTN gene expression in adult sea bass muscle, but this is associated with an inconsistent double-muscle phenotype.
Takemasa, Tohru; Yakushiji, Naohisa; Kikuchi, Dale Manjiro; Deocaris, Custer; Widodo; Machida, Masanao; Kiyosawa, Hidenori
2012-01-01
To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs) against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA) muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control. Key pointsUsing a myostatin knockdown plasmid, we have succeeded in creating a model system for gene doping using mice that resulted in muscle hypertrophy greater than that reported previously.We confirmed that there was a limit of gene doping detection using real-time PCR, either from serum or muscle smple.This model experimental system can be utilized for examining indirect methods of gene doping detection such as immune responses to gene transfer or a profiling approach using DNA microarray.
Takemasa, Tohru; Yakushiji, Naohisa; Kikuchi, Dale Manjiro; Deocaris, Custer; Widodo; Machida, Masanao; Kiyosawa, Hidenori
2012-01-01
To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs) against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA) muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control. Key pointsUsing a myostatin knockdown plasmid, we have succeeded in creating a model system for gene doping using mice that resulted in muscle hypertrophy greater than that reported previously.We confirmed that there was a limit of gene doping detection using real-time PCR, either from serum or muscle smple.This model experimental system can be utilized for examining indirect methods of gene doping detection such as immune responses to gene transfer or a profiling approach using DNA microarray. PMID:24149203
On the application of a hairpin vortex model of wall turbulence to trailing edge noise prediction
NASA Technical Reports Server (NTRS)
Liu, N. S.; Shamroth, S. J.
1985-01-01
The goal is to develop a technique via a hairpin vortex model of the turbulent boundary layer, which would lead to the estimation of the aerodynamic input for use in trailing edge noise prediction theories. The work described represents an initial step in reaching this goal. The hairpin vortex is considered as the underlying structure of the wall turbulence and the turbulent boundary layer is viewed as an ensemble of typical hairpin vortices of different sizes. A synthesis technique is examined which links the mean flow and various turbulence quantities via these typical vortices. The distribution of turbulence quantities among vortices of different scales follows directly from the probability distribution needed to give the measured mean flow vorticity. The main features of individual representative hairpin vortices are discussed in detail and a preliminary assessment of the synthesis approach is made.
Soto, Patricia; Zangi, Ronen
2005-01-27
The stability of secondary structure motifs found in proteins is influenced by the choice of the configuration of the chiral centers present in the amino acid residues (i.e., D vs L). Experimental studies showed that the structural properties of the tetrapeptide (L)V(L)P(L)A(L)L (all-L) are drastically altered upon mutating the L-proline and the L-alanine by their d-enantiomers [J. Am. Chem. Soc. 1996, 118, 6975]. The all-L diastereomer is unstructured, experiencing little or no beta-hairpin formation, while the (L)V(D)P(D)A(L)L peptide exhibits a substantial population of beta-hairpin conformation. In this study, we perform molecular dynamics simulations to investigate the folding propensity of these two model peptides. The results confirm the experimental findings, namely, that the presence of d-amino acids in the loop region strongly induces beta-hairpin formation (a population increase from about 1.5% to 50% is observed). The major factor determining the different behavior is found to be the large difference in energy between the two diastereomers, approximately 22 kJ/mol, when they adopt a beta-hairpin structure. The higher energy observed for the all-L peptide is a consequence of none-ideal hydrogen bond formation and of steric repulsions. The results suggest that selective incorporation of D-amino acids in proteins can be used to enhance certain secondary structure elements. The kinetic behavior of the folding process observed in the simulations is also investigated. We find that the decay rate of the folded structure fits to a biexponential function, suggesting that the folding/unfolding process of a beta-hairpin is governed by two different mechanisms.
Folding and unfolding single RNA molecules under tension
Woodside, Michael T; García-García, Cuauhtémoc; Block, Steven M
2010-01-01
Single-molecule force spectroscopy constitutes a powerful method for probing RNA folding: it allows the kinetic, energetic, and structural properties of intermediate and transition states to be determined quantitatively, yielding new insights into folding pathways and energy landscapes. Recent advances in experimental and theoretical methods, including fluctuation theorems, kinetic theories, novel force clamps, and ultrastable instruments, have opened new avenues for study. These tools have been used to probe folding in simple model systems, for example, RNA and DNA hairpins. Knowledge gained from such systems is helping to build our understanding of more complex RNA structures composed of multiple elements, as well as how nucleic acids interact with proteins involved in key cellular activities, such as transcription and translation. PMID:18786653
Multimodality Imaging of RNA Interference
Nayak, Tapas R.; Krasteva, Lazura K.; Cai, Weibo
2013-01-01
The discovery of small interfering RNAs (siRNAs) and their potential to knock down virtually any gene of interest has ushered in a new era of RNA interference (RNAi). Clinical use of RNAi faces severe limitations due to inefficiency delivery of siRNA or short hairpin RNA (shRNA). Many molecular imaging techniques have been adopted in RNAi-related research for evaluation of siRNA/shRNA delivery, biodistribution, pharmacokinetics, and the therapeutic effect. In this review article, we summarize the current status of in vivo imaging of RNAi. The molecular imaging techniques that have been employed include bioluminescence/fluorescence imaging, magnetic resonance imaging/spectroscopy, positron emission tomography, single-photon emission computed tomography, and various combinations of these techniques. Further development of non-invasive imaging strategies for RNAi, not only focusing on the delivery of siRNA/shRNA but also the therapeutic efficacy, is critical for future clinical translation. Rigorous validation will be needed to confirm that biodistribution of the carrier is correlated with that of siRNA/shRNA, since imaging only detects the label (e.g. radioisotopes) but not the gene or carrier themselves. It is also essential to develop multimodality imaging approaches for realizing the full potential of therapeutic RNAi, as no single imaging modality may be sufficient to simultaneously monitor both the gene delivery and silencing effect of RNAi. PMID:23745567
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Wai Mun; DaGloria, Jeanne; Fox, Heather
2012-09-05
Agrobacterium tumefaciens C58, the pathogenic bacteria that causes crown gall disease in plants, harbors one circular and one linear chromosome and two circular plasmids. The telomeres of its unusual linear chromosome are covalently closed hairpins. The circular and linear chromosomes co-segregate and are stably maintained in the organism. We have determined the sequence of the two ends of the linear chromosome thus completing the previously published genome sequence of A. tumefaciens C58. We found that the telomeres carry nearly identical 25-bp sequences at the hairpin ends that are related by dyad symmetry. We further showed that its Atu2523 gene encodesmore » a protelomerase (resolvase) and that the purified enzyme can generate the linear chromosomal closed hairpin ends in a sequence-specific manner. Agrobacterium protelomerase, whose presence is apparently limited to biovar 1 strains, acts via a cleavage-and-religation mechanism by making a pair of transient staggered nicks invariably at 6-bp spacing as the reaction intermediate. The enzyme can be significantly shortened at both the N and C termini and still maintain its enzymatic activity. Although the full-length enzyme can uniquely bind to its product telomeres, the N-terminal truncations cannot. The target site can also be shortened from the native 50-bp inverted repeat to 26 bp; thus, the Agrobacterium hairpin-generating system represents the most compact activity of all hairpin linear chromosome- and plasmid-generating systems to date. The biochemical analyses of the protelomerase reactions further revealed that the tip of the hairpin telomere may be unusually polymorphically capable of accommodating any nucleotide.« less
Potter, Kristine D.; Merlino, Natalie M.; Jacobs, Timothy; Gollnick, Paul
2011-01-01
The Bacillus subtilis trpEDCFBA operon is regulated by a transcription attenuation mechanism controlled by the trp RNA-binding attenuation protein (TRAP). TRAP binds to 11 (G/U)AG repeats in the trp leader transcript and prevents formation of an antiterminator, which allows formation of an intrinsic terminator (attenuator). Previously, formation of the attenuator RNA structure was believed to be solely responsible for signaling RNA polymerase (RNAP) to halt transcription. However, base substitutions that prevent formation of the antiterminator, and thus allow the attenuator structure to form constitutively, do not result in efficient transcription termination. The observation that the attenuator requires the presence of TRAP bound to the nascent RNA to cause efficient transcription termination suggests TRAP has an additional role in causing termination at the attenuator. We show that the trp attenuator is a weak intrinsic terminator due to low GC content of the hairpin stem and interruptions in the U-stretch following the hairpin. We also provide evidence that termination at the trp attenuator requires forward translocation of RNA polymerase and that TRAP binding to the nascent transcript can induce this activity. PMID:21097886
Potter, Kristine D; Merlino, Natalie M; Jacobs, Timothy; Gollnick, Paul
2011-03-01
The Bacillus subtilis trpEDCFBA operon is regulated by a transcription attenuation mechanism controlled by the trp RNA-binding attenuation protein (TRAP). TRAP binds to 11 (G/U)AG repeats in the trp leader transcript and prevents formation of an antiterminator, which allows formation of an intrinsic terminator (attenuator). Previously, formation of the attenuator RNA structure was believed to be solely responsible for signaling RNA polymerase (RNAP) to halt transcription. However, base substitutions that prevent formation of the antiterminator, and thus allow the attenuator structure to form constitutively, do not result in efficient transcription termination. The observation that the attenuator requires the presence of TRAP bound to the nascent RNA to cause efficient transcription termination suggests TRAP has an additional role in causing termination at the attenuator. We show that the trp attenuator is a weak intrinsic terminator due to low GC content of the hairpin stem and interruptions in the U-stretch following the hairpin. We also provide evidence that termination at the trp attenuator requires forward translocation of RNA polymerase and that TRAP binding to the nascent transcript can induce this activity.
Hyldahl, Robert D; O'Fallon, Kevin S; Schwartz, Lawrence M; Clarkson, Priscilla M
2010-11-01
Skeletal muscle atrophy is a significant health problem that results in decreased muscle size and function and has been associated with increases in oxidative stress. The molecular mechanisms that regulate muscle atrophy, however, are largely unknown. The metallothioneins (MT), a family of genes with antioxidant properties, have been found to be consistently upregulated during muscle atrophy, although their function during muscle atrophy is unknown. Therefore, we hypothesized that MT knockdown would result in greater oxidative stress and an enhanced atrophy response in C(2)C(12) myotubes subjected to serum reduction (SR), a novel atrophy-inducing stimulus. Forty-eight hours before SR, myotubes were transfected with small interfering RNA (siRNA) sequences designed to decrease MT expression. Muscle atrophy and oxidative stress were then measured at baseline and for 72 h following SR. Muscle atrophy was quantified by immunocytochemistry and myotube diameter measurements. Oxidative stress was measured using the fluorescent probe 5-(and-6)-carboxy-2',7'-dichlorodihydrofluorescein. SR resulted in a significant increase in oxidative stress and a decrease in myotube size and protein content. However, there were no differences observed in the extent of muscle atrophy or oxidant activity following MT knockdown. We therefore conclude that the novel SR model results in a strong atrophy response and an increase in oxidant activity in cultured myotubes and that knockdown of MT does not affect that response.
Takata, Nozomu; Sakakura, Eriko; Kasukawa, Takeya; Sakuma, Tetsushi; Yamamoto, Takashi; Sasai, Yoshiki
2016-06-01
The epiblast (foremost embryonic ectoderm) generates all three germ layers and therefore has crucial roles in the formation of all mammalian body cells. However, regulation of epiblast gene expression is poorly understood because of the difficulty of manipulating epiblast tissues in vivo. In the present study, using the self-organizing properties of mouse embryonic stem cell (ESC), we generated and characterized epiblast-like tissue in three-dimensional culture. We identified significant genome-wide gene expression changes in this epiblast-like tissue by transcriptomic analysis. In addition, we identified the particular significance of the Erk/Mapk and integrin-linked kinase pathways, and genes related to ectoderm/epithelial formation, using the bioinformatics resources IPA and DAVID. Here, we focused on Fgf5, which ranked in the top 10 among the discovered genes. To develop a functional analysis of Fgf5, we created an efficient method combining CRISPR/Cas9-mediated genome engineering and RNA interference (RNAi). Notably, we show one-step generation of various Fgf5 reporter lines including heterozygous and homozygous knockins (the GET method). For time- and dose-dependent depletion of fgf5 over the course of development, we generated an ESC line harboring Tol2 transposon-mediated integration of an inducible short hairpin RNA interference system (pdiRNAi). Our findings raised the possibility that Fgf/Erk signaling and apicobasal epithelial integrity are important factors in epiblast development. In addition, our methods provide a framework for a broad array of applications in the areas of mammalian genetics and molecular biology to understand development and to improve future therapeutics.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karpus, Olga N.; Hsiao, Cheng-Chih; Kort, Hanneke de
Fibroblast-like synoviocytes (FLS) express functional membranous and cytoplasmic sensors for double-stranded (ds)RNA. Notably, FLS undergo apoptosis upon transfection with the synthetic dsRNA analog poly(I:C). We here studied the mechanism of intracellular poly(I:C) recognition and subsequent cell death in FLS. FLS responded similarly to poly(I:C) or 3pRNA transfection; however, only intracellular delivery of poly(I:C) induced significant cell death, accompanied by upregulation of pro-apoptotic proteins Puma and Noxa, caspase 3 cleavage, and nuclear segregation. Knockdown of the DExD/H-box helicase MDA5 did not affect the response to intracellular poly(I:C); in contrast, knockdown of RIG-I abrogated the response to 3pRNA. Knockdown of the downstreammore » adaptor proteins IPS, STING, and TRIF or inhibition of TBK1 did not affect the response to intracellular poly(I:C), while knockdown of IFNAR blocked intracellular poly(I:C)-mediated signaling and cell death. We conclude that a so far unknown intracellular sensor recognizes linear dsRNA and induces apoptosis in FLS. - Highlights: • Intracellular poly(I:C) and 3pRNA evoke immune responses in FLS. • Only intracellular delivery of poly(I:C) induces FLS apoptosis. • FLS do not require MDA5 for their response to intracellular poly(I:C). • FLS respond to intracellular poly(I:C) independent of IPS and STING. • An unknown intracellular sensor recognizes linear dsRNA in FLS.« less
Minimization and Optimization of Designed β-Hairpin Folds
Andersen, Niels H.; Olsen, Katherine A.; Fesinmeyer, R. Matthew; Tan, Xu; Hudson, F. Michael; Eidenschink, Lisa A.; Farazi, Shabnam R.
2011-01-01
Mimimized β hairpins have provided additional data on the geometric preferences of Trp interactions in TW-loop-WT motifs. This motif imparts significant fold stability to peptides as short as 8 residues. High-resolution NMR structures of a 16- (KKWTWNPATGKWTWQE, ΔGU298 ≥ +7 kJ/mol) and 12-residue (KTWNPATGKWTE, ΔGU298 = +5.05 kJ/mol) hairpin reveal a common turn geometry and edge-to-face (EtF) packing motif and a cation-π interaction between Lys1 and the Trp residue nearest the C-terminus. The magnitude of a CD exciton couplet (due to the two Trp residues) and the chemical shifts of a Trp Hε3 site (shifted upfield by 2.4 ppm due to the EtF stacking geometry) provided near-identical measures of folding. CD melts of representative peptides with the –TW-loop-WT- motif provided the thermodynamic parameters for folding, which reflect enthalpically driven folding at laboratory temperatures with a small ΔCp for unfolding (+420 JK−1/mol). In the case of Asx-Pro-Xaa-Thr-Gly-Xaa loops, mutations established that the two most important residues in this class of direction-reversing loops are Asx and Gly: mutation to alanine is destabilizing by about 6 and 2 kJ/mol, respectively. All indicators of structuring are retained in a minimized 8-residue construct (Ac-WNPATGKW-NH2) with the fold stability reduced to ΔGU278 = −0.7 kJ/mol. NMR and CD comparisons indicate that -TWXNGKWT- (X = S, I) sequences also forms the same hairpin-stabilizing W/W interaction. PMID:16669679
Tethering of human Ago proteins to mRNA mimics the miRNA-mediated repression of protein synthesis.
Pillai, Ramesh S; Artus, Caroline G; Filipowicz, Witold
2004-10-01
MicroRNAs (miRNAs) are approximately 21-nt-long RNAs involved in regulating development, differentiation, and other processes in eukaryotes. In metazoa, nearly all miRNAs control gene expression by imperfectly base-pairing with the 3'-untranslated region (3'-UTR) of target mRNAs and repressing protein synthesis by an unknown mechanism. It is also unknown whether miRNA-mRNA duplexes containing mismatches and bulges provide specific features that are recognized by factors mediating the repression. miRNAs form part of ribonucleoprotein complexes, miRNPs, that contain Argonaute (Ago) and other proteins. Here we demonstrate that effects of miRNAs on translation can be mimicked in human HeLa cells by the miRNA-independent tethering of Ago proteins to the 3'-UTR of a reporter mRNA. Inhibition of protein synthesis occurred without a change in the reporter mRNA level and was dependent on the number, but not the position, of the hairpins tethering hAgo2 to the 3'-UTR. These findings indicate that a primary function of miRNAs is to guide their associated proteins to the mRNA. Copyright 2004 RNA Society
Hermanstyne, Tracey O.; Mellor, Rebecca L.
2017-01-01
Abstract Rapidly activating and inactivating A-type K+ currents (IA) encoded by Kv4.2 and Kv4.3 pore-forming (α) subunits of the Kv4 subfamily are key regulators of neuronal excitability. Previous studies have suggested a role for Kv4.1 α-subunits in regulating the firing properties of mouse suprachiasmatic nucleus (SCN) neurons. To test this, we utilized an RNA-interference strategy to knockdown Kv4.1, acutely and selectively, in the SCN. Current-clamp recordings revealed that the in vivo knockdown of Kv4.1 significantly (p < 0.0001) increased mean ± SEM repetitive firing rates in SCN neurons during the day (6.4 ± 0.5 Hz) and at night (4.3 ± 0.6 Hz), compared with nontargeted shRNA-expressing SCN neurons (day: 3.1 ± 0.5 Hz; night: 1.6 ± 0.3 Hz). IA was also significantly (p < 0.05) reduced in Kv4.1-targeted shRNA-expressing SCN neurons (day: 80.3 ± 11.8 pA/pF; night: 55.3 ± 7.7 pA/pF), compared with nontargeted shRNA-expressing (day: 121.7 ± 10.2 pA/pF; night: 120.6 ± 16.5 pA/pF) SCN neurons. The magnitude of the effect of Kv4.1-targeted shRNA expression on firing rates and IA was larger at night. In addition, Kv4.1-targeted shRNA expression significantly (p < 0.001) increased mean ± SEM nighttime input resistance (Rin; 2256 ± 166 MΩ), compared to nontargeted shRNA-expressing SCN neurons (1143 ± 93 MΩ). Additional experiments revealed that acute knockdown of Kv4.1 significantly (p < 0.01) shortened, by ∼0.5 h, the circadian period of spontaneous electrical activity, clock gene expression and locomotor activity demonstrating a physiological role for Kv4.1-encoded IA channels in regulating circadian rhythms in neuronal excitability and behavior. PMID:28560311
Hermanstyne, Tracey O; Granados-Fuentes, Daniel; Mellor, Rebecca L; Herzog, Erik D; Nerbonne, Jeanne M
2017-01-01
Rapidly activating and inactivating A-type K + currents (I A ) encoded by Kv4.2 and Kv4.3 pore-forming (α) subunits of the Kv4 subfamily are key regulators of neuronal excitability. Previous studies have suggested a role for Kv4.1 α-subunits in regulating the firing properties of mouse suprachiasmatic nucleus (SCN) neurons. To test this, we utilized an RNA-interference strategy to knockdown Kv4.1, acutely and selectively, in the SCN. Current-clamp recordings revealed that the in vivo knockdown of Kv4.1 significantly ( p < 0.0001) increased mean ± SEM repetitive firing rates in SCN neurons during the day (6.4 ± 0.5 Hz) and at night (4.3 ± 0.6 Hz), compared with nontargeted shRNA-expressing SCN neurons (day: 3.1 ± 0.5 Hz; night: 1.6 ± 0.3 Hz). I A was also significantly ( p < 0.05) reduced in Kv4.1-targeted shRNA-expressing SCN neurons (day: 80.3 ± 11.8 pA/pF; night: 55.3 ± 7.7 pA/pF), compared with nontargeted shRNA-expressing (day: 121.7 ± 10.2 pA/pF; night: 120.6 ± 16.5 pA/pF) SCN neurons. The magnitude of the effect of Kv4.1-targeted shRNA expression on firing rates and I A was larger at night. In addition, Kv4.1-targeted shRNA expression significantly ( p < 0.001) increased mean ± SEM nighttime input resistance (R in ; 2256 ± 166 MΩ), compared to nontargeted shRNA-expressing SCN neurons (1143 ± 93 MΩ). Additional experiments revealed that acute knockdown of Kv4.1 significantly ( p < 0.01) shortened, by ∼0.5 h, the circadian period of spontaneous electrical activity, clock gene expression and locomotor activity demonstrating a physiological role for Kv4.1-encoded I A channels in regulating circadian rhythms in neuronal excitability and behavior.
The tripartite motif coiled-coil is an elongated antiparallel hairpin dimer.
Sanchez, Jacint G; Okreglicka, Katarzyna; Chandrasekaran, Viswanathan; Welker, Jordan M; Sundquist, Wesley I; Pornillos, Owen
2014-02-18
Tripartite motif (TRIM) proteins make up a large family of coiled-coil-containing RING E3 ligases that function in many cellular processes, particularly innate antiviral response pathways. Both dimerization and higher-order assembly are important elements of TRIM protein function, but the atomic details of TRIM tertiary and quaternary structure have not been fully understood. Here, we present crystallographic and biochemical analyses of the TRIM coiled-coil and show that TRIM proteins dimerize by forming interdigitating antiparallel helical hairpins that position the N-terminal catalytic RING domains at opposite ends of the dimer and the C-terminal substrate-binding domains at the center. The dimer core comprises an antiparallel coiled-coil with a distinctive, symmetric pattern of flanking heptad and central hendecad repeats that appear to be conserved across the entire TRIM family. Our studies reveal how the coiled-coil organizes TRIM25 to polyubiquitylate the RIG-I/viral RNA recognition complex and how dimers of the TRIM5α protein are arranged within hexagonal arrays that recognize the HIV-1 capsid lattice and restrict retroviral replication.
The tripartite motif coiled-coil is an elongated antiparallel hairpin dimer
Sanchez, Jacint G.; Okreglicka, Katarzyna; Chandrasekaran, Viswanathan; Welker, Jordan M.; Sundquist, Wesley I.; Pornillos, Owen
2014-01-01
Tripartite motif (TRIM) proteins make up a large family of coiled-coil-containing RING E3 ligases that function in many cellular processes, particularly innate antiviral response pathways. Both dimerization and higher-order assembly are important elements of TRIM protein function, but the atomic details of TRIM tertiary and quaternary structure have not been fully understood. Here, we present crystallographic and biochemical analyses of the TRIM coiled-coil and show that TRIM proteins dimerize by forming interdigitating antiparallel helical hairpins that position the N-terminal catalytic RING domains at opposite ends of the dimer and the C-terminal substrate-binding domains at the center. The dimer core comprises an antiparallel coiled-coil with a distinctive, symmetric pattern of flanking heptad and central hendecad repeats that appear to be conserved across the entire TRIM family. Our studies reveal how the coiled-coil organizes TRIM25 to polyubiquitylate the RIG-I/viral RNA recognition complex and how dimers of the TRIM5α protein are arranged within hexagonal arrays that recognize the HIV-1 capsid lattice and restrict retroviral replication. PMID:24550273
An RNA Origami Octahedron with Intrinsic siRNAs for Potent Gene Knockdown.
Høiberg, Hans Christian; Sparvath, Steffen M; Andersen, Veronica L; Kjems, Jørgen; Andersen, Ebbe S
2018-05-26
The fields of DNA and RNA nanotechnology have established nucleic acids as valuable building blocks for functional nanodevices with applications in nanomedicine. Here, a simple method for designing and assembling a 3D scaffolded RNA origami wireframe structure with intrinsic functioning small interfering RNAs (siRNAs) embedded is introduced. Uniquely, the method uses an mRNA fragment as scaffold strand, which is folded by sequence-complementarity of nine shorter synthetic strands. High-yield production of the intended 3D structure is verified by transmission electron microscopy (TEM). Production of functional siRNAs is facilitated by incorporating recognition sites for Dicer at selected locations in the structure, and efficient silencing of a target reporter gene is demonstrated. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zhong, Jian-Bin; Li, Xie; Zhong, Si-Ming; Liu, Jiu-Di; Chen, Chi-Bang; Wu, Xiao-Yan
2017-09-27
Brain-derived neurotrophic factor (BDNF) plays an important role in neuronal cell apoptosis. The antisense RNA of brain-derived neurotrophic factor (BDNF-AS) is a natural antisense transcript that is transcribed opposite the gene that encodes BDNF. The aim of this study was to determine whether knockdown of BDNF-AS can suppress hypoxia/reoxygenation (H/R)-induced neuronal cell apoptosis and whether this is mediated by the BDNF-TrkB-PI3K/Akt pathway. We detected the expression of BDNF and BDNF-AS in brain tissue from 20 patients with cerebral infarction and five patients with other diseases (but no cerebral ischemia). We found that BDNF expression was significantly downregulated in patients with cerebral infarction, whereas the expression of BDNF-AS was significantly upregulated. In both human cortical neurons (HCN2) and human astrocytes, H/R significantly induced the expression of BDNF-AS, but significantly decreased BDNF expression. H/R also significantly induced apoptosis and reduced the mitochondrial membrane potential in these cells. Following downregulation of BDNF-AS by siRNA in human cortical neurons and human astrocyte cells, BDNF expression was significantly upregulated and the H/R-induced upregulation of BDNF-AS was significantly attenuated. BDNF-AS siRNA inhibited H/R-induced cell apoptosis and ameliorated the H/R-induced suppression of mitochondrial membrane potential. H/R inhibited the expression of BDNF, p-AKT/AKT, and TrKB, and this inhibition was recovered by BDNF-AS siRNA. In summary, this study indicates that BDNF-AS siRNA induces activation of the BDNF-TrkB-PI3K/Akt pathway following H/R-induced neurotoxicity. These findings will be useful toward the application of BDNF-AS siRNA for the treatment of neurodegenerative diseases.
Jas, Gouri S; Hegefeld, Wendy A; Middaugh, C Russell; Johnson, Carey K; Kuczera, Krzysztof
2014-07-03
We present a combined experimental and computational study of unfolding pathways of a model 21-residue α-helical heteropeptide (W1H5-21) and a 16-residue β-hairpin (GB41-56). Experimentally, we measured fluorescence energy transfer efficiency as a function of temperature, employing natural tryptophans as donors and dansylated lysines as acceptors. Secondary structural analysis was performed with circular dichroism and Fourier transform infrared spectroscopy. Our studies present markedly different unfolding pathways of the two elementary secondary structural elements. During thermal denaturation, the helical peptide exhibits an initial decrease in length, followed by an increase, while the hairpin undergoes a systematic increase in length. In the complementary computational part of the project, we performed microsecond length replica-exchange molecular dynamics simulations of the peptides in explicit solvent, yielding a detailed microscopic picture of the unfolding processes. For the α-helical peptide, we found a large heterogeneous population of intermediates that are primarily frayed single helices or helix-turn-helix motifs. Unfolding starts at the termini and proceeds through a stable helical region in the interior of the peptide but shifted off-center toward the C-terminus. The simulations explain the experimentally observed non-monotonic variation of helix length with temperature as due primarily to the presence of frayed-end single-helix intermediate structures. For the β-hairpin peptide, our simulations indicate that folding is initiated at the turn, followed by formation of the hairpin in zipper-like fashion, with Cα···Cα contacts propagating from the turn to termini and hairpin hydrogen bonds forming in parallel with these contacts. In the early stages of hairpin formation, the hydrophobic side-chain contacts are only partly populated. Intermediate structures with low numbers of β-hairpin hydrogen bonds have very low populations. This is in
Morris, Elizabeth R.; Hall, Gareth; Li, Chan; Heeb, Stephan; Kulkarni, Rahul V.; Lovelock, Laura; Silistre, Hazel; Messina, Marco; Cámara, Miguel; Emsley, Jonas; Williams, Paul; Searle, Mark S.
2013-01-01
Summary In bacteria, the highly conserved RsmA/CsrA family of RNA-binding proteins functions as global posttranscriptional regulators acting on mRNA translation and stability. Through phenotypic complementation of an rsmA mutant in Pseudomonas aeruginosa, we discovered a family member, termed RsmN. Elucidation of the RsmN crystal structure and that of the complex with a hairpin from the sRNA, RsmZ, reveals a uniquely inserted α helix, which redirects the polypeptide chain to form a distinctly different protein fold to the domain-swapped dimeric structure of RsmA homologs. The overall β sheet structure required for RNA recognition is, however, preserved with compensatory sequence and structure differences, allowing the RsmN dimer to target binding motifs in both structured hairpin loops and flexible disordered RNAs. Phylogenetic analysis indicates that, although RsmN appears unique to P. aeruginosa, homologous proteins with the inserted α helix are more widespread and arose as a consequence of a gene duplication event. PMID:23954502
Ablation of the Sam68 RNA Binding Protein Protects Mice from Age-Related Bone Loss
Richard, Stéphane; Torabi, Nazi; Franco, Gladys Valverde; Tremblay, Guy A; Chen, Taiping; Vogel, Gillian; Morel, Mélanie; Cléroux, Patrick; Forget-Richard, Alexandre; Komarova, Svetlana; Tremblay, Michel L; Li, Wei; Li, Ailian; Gao, Yun Jing; Henderson, Janet E
2005-01-01
The Src substrate associated in mitosis of 68 kDa (Sam68) is a KH-type RNA binding protein that has been shown to regulate several aspects of RNA metabolism; however, its physiologic role has remained elusive. Herein we report the generation of Sam68-null mice by homologous recombination. Aged Sam68−/− mice preserved their bone mass, in sharp contrast with 12-month-old wild-type littermates in which bone mass was decreased up to approximately 75%. In fact, the bone volume of the 12-month-old Sam68−/− mice was virtually indistinguishable from that of 4-month-old wild-type or Sam68−/− mice. Sam68−/− bone marrow stromal cells had a differentiation advantage for the osteogenic pathway. Moreover, the knockdown of Sam68 using short hairpin RNA in the embryonic mesenchymal multipotential progenitor C3H10T1/2 cells resulted in more pronounced expression of the mature osteoblast marker osteocalcin when differentiation was induced with bone morphogenetic protein-2. Cultures of mouse embryo fibroblasts generated from Sam68+/+ and Sam68−/− littermates were induced to differentiate into adipocytes with culture medium containing pioglitazone and the Sam68−/− mouse embryo fibroblasts shown to have impaired adipocyte differentiation. Furthermore, in vivo it was shown that sections of bone from 12-month-old Sam68−/− mice had few marrow adipocytes compared with their age-matched wild-type littermate controls, which exhibited fatty bone marrow. Our findings identify endogenous Sam68 as a positive regulator of adipocyte differentiation and a negative regulator of osteoblast differentiation, which is consistent with Sam68 being a modulator of bone marrow mesenchymal cell differentiation, and hence bone metabolism, in aged mice. PMID:16362077
RNA secondary structure prediction using soft computing.
Ray, Shubhra Sankar; Pal, Sankar K
2013-01-01
Prediction of RNA structure is invaluable in creating new drugs and understanding genetic diseases. Several deterministic algorithms and soft computing-based techniques have been developed for more than a decade to determine the structure from a known RNA sequence. Soft computing gained importance with the need to get approximate solutions for RNA sequences by considering the issues related with kinetic effects, cotranscriptional folding, and estimation of certain energy parameters. A brief description of some of the soft computing-based techniques, developed for RNA secondary structure prediction, is presented along with their relevance. The basic concepts of RNA and its different structural elements like helix, bulge, hairpin loop, internal loop, and multiloop are described. These are followed by different methodologies, employing genetic algorithms, artificial neural networks, and fuzzy logic. The role of various metaheuristics, like simulated annealing, particle swarm optimization, ant colony optimization, and tabu search is also discussed. A relative comparison among different techniques, in predicting 12 known RNA secondary structures, is presented, as an example. Future challenging issues are then mentioned.
Liu, Shuqing; Wang, Jiasheng; Guo, Chunmei; Qi, Houbao; Sun, Ming-Zhong
2015-03-01
Annexin A11 (Anxa11), a Ca(2+)-regulated phospholipid-binding protein, is involved in cell apoptosis, differentiation, vesicle trafficking, cancer progression and autoimmune diseases. Previous study from our group indicated that Anxa11 was associated with lymphatic metastatic potential of murine hepatocarcinoma cells. Herein, we investigated the effects and action mechanism of Anxa11 knockdown on in vitro cell proliferation and apoptosis of Hca-F, a murine hepatocarcinoma cell with∼75% lymph node metastatic potential. Real-time PCR and western blotting assays indicated that Anxa11 was significantly downregulated in monoclonal Anxa11-shRNA-transfected Hca-F cells. Anxa11 knockdown in Hca-F suppressed its in vitro proliferation and cell apoptosis capacities. Following Anxa11 knockdown in Hca-F cells, Bax/Bcl-2 expression level ratio, Akt2 and FoxO1 (pSer319) expression levels as well as MMP-9 mRNA and active MMP-9 protein levels were significantly elevated in Hca-F cells. In conclusion, Annexin A11 knockdown inhibits the in vitro proliferation and cell apoptosis of Hca-F cell via Akt2/FoxO1 and/or MMP-9 expression pathway. Anxa11 might play an important role in hepatocarcinoma cell invasion and metastasis and hepatocarcinoma malignancy. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
NASA Astrophysics Data System (ADS)
Pei, Zheng; Shi, Guoli; Kondo, Saki; Ito, Masahiko; Maekawa, Aya; Suzuki, Mariko; Saito, Izumu; Suzuki, Tetsuro; Kanegae, Yumi
2013-12-01
First-generation adenovirus vectors (FG AdVs) expressing short-hairpin RNA (shRNA) effectively downregulate the expressions of target genes. However, this vector, in fact, expresses not only the transgene product, but also virus-associated RNAs (VA RNAs) that disturb cellular RNAi machinery. We have established a production method for VA-deleted AdVs lacking expression of VA RNAs. Here, we showed that the highest shRNA activity was obtained when the shRNA was inserted not at the popularly used E1 site, but at the E4 site. We then compared the activities of shRNAs against hepatitis C virus (HCV) expressed from VA-deleted AdVs or conventional AdVs. The VA-deleted AdVs inhibited HCV production much more efficiently. Therefore, VA-deleted AdVs were more effective than the currently used AdVs for shRNA downregulation, probably because of the lack of competition between VA RNAs and the shRNAs. These VA-deleted AdVs might enable more effective gene therapies for chronic hepatitis C.
Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S
2012-01-01
Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.
The universality of β-hairpin misfolding indicated by molecular dynamics simulations.
Shao, Qiang; Wang, Jinan; Shi, Jiye; Zhu, Weiliang
2013-10-28
Previous molecular dynamics simulations showed that besides the experimentally measured folded structures, several β-structured polypeptides could also have misfolded "out-of-register" structures. Through the enhanced sampling molecular dynamics simulations on a series of polypeptides using either implicit or explicit solvent model, the present study systematically investigated the universality of β-hairpin misfolding and its determinants. It was observed that the misfolding could take place for almost all polypeptides under study, especially in the presence of weak side chain hydrophobicity. Moreover, the observed misfolded structures for various polypeptides share the following common features: (1) the turn length in misfolded structure is one-residue shorter than that in folded structure; (2) the hydrophobic side chains on the two strands are pointed to the opposite directions instead of packing in the same direction to form hydrophobic core cluster in the folded structure; and (3) the misfolded structure is one-residue-shifted asymmetric β-hairpin structure. The detailed analysis suggested that the misfolding of β-hairpin is the result of the competition between the formation of the alterable turn configurations and the inter-strand hydrophobic interactions. These predictions are desired to be tested by experiments.
The universality of β-hairpin misfolding indicated by molecular dynamics simulations
NASA Astrophysics Data System (ADS)
Shao, Qiang; Wang, Jinan; Shi, Jiye; Zhu, Weiliang
2013-10-01
Previous molecular dynamics simulations showed that besides the experimentally measured folded structures, several β-structured polypeptides could also have misfolded "out-of-register" structures. Through the enhanced sampling molecular dynamics simulations on a series of polypeptides using either implicit or explicit solvent model, the present study systematically investigated the universality of β-hairpin misfolding and its determinants. It was observed that the misfolding could take place for almost all polypeptides under study, especially in the presence of weak side chain hydrophobicity. Moreover, the observed misfolded structures for various polypeptides share the following common features: (1) the turn length in misfolded structure is one-residue shorter than that in folded structure; (2) the hydrophobic side chains on the two strands are pointed to the opposite directions instead of packing in the same direction to form hydrophobic core cluster in the folded structure; and (3) the misfolded structure is one-residue-shifted asymmetric β-hairpin structure. The detailed analysis suggested that the misfolding of β-hairpin is the result of the competition between the formation of the alterable turn configurations and the inter-strand hydrophobic interactions. These predictions are desired to be tested by experiments.
Pley, H W; Flaherty, K M; McKay, D B
1994-11-03
In large structured RNAs, RNA hairpins in which the strands of the duplex stem are connected by a tetraloop of the consensus sequence 5'-GNRA (where N is any nucleotide, and R is either G or A) are unusually frequent. In group I introns there is a covariation in sequence between nucleotides in the third and fourth positions of the loop with specific distant base pairs in putative RNA duplex stems: GNAA loops correlate with successive 5'-C-C.G-C base pairs in stems, whereas GNGA loops correlate with 5'-C-U.G-A. This has led to the suggestion that GNRA tetraloops may be involved in specific long-range tertiary interactions, with each A in position 3 or 4 of the loop interacting with a C-G base pair in the duplex, and G in position 3 interacting with a U-A base pair. This idea is supported experimentally for the GAAA loop of the P5b extension of the group I intron of Tetrahymena thermophila and the L9 GUGA terminal loop of the td intron of bacteriophage T4 (ref. 4). NMR has revealed the overall structure of the tetraloop for 12-nucleotide hairpins with GCAA and GAAA loops and models have been proposed for the interaction of GNRA tetraloops with base pairs in the minor groove of A-form RNA. Here we describe the crystal structure of an intermolecular complex between a GAAA tetraloop and an RNA helix. The interactions we observe correlate with the specificity of GNRA tetraloops inferred from phylogenetic studies, suggesting that this complex is a legitimate model for intramolecular tertiary interactions mediated by GNRA tetraloops in large structured RNAs.
The ribosome uses two active mechanisms to unwind messenger RNA during translation.
Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio
2011-07-06
The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved
Nano-cone optical fiber array sensors for MiRNA profiling
NASA Astrophysics Data System (ADS)
Wang, Yunshan; Senapati, Satyajyoti; Stoddart, Paul; Howard, Scott; Chang, Hsueh-Chia
2013-09-01
Up/down regulation of microRNA panels has been correlated to cardiovascular diseases and cancer. Frequent miRNA profiling at home can hence allow early cancer diagnosis and home-use chronic disease monitoring, thus reducing both mortality rate and healthcare cost. However, lifetime of miRNAs is less than 1 hour without preservation and their concentrations range from pM to mM. Despite rapid progress in the last decade, modern nucleic acid analysis methods still do not allow personalized miRNA profiling---Real-time PCR and DNA micro-array both require elaborate miRNA preservation steps and expensive equipment and nano pore sensors cannot selectively quantify a large panel with a large dynamic range. We report a novel and low-cost optical fiber sensing platform, which has the potential to profile a panel of miRNA with simple LED light sources and detectors. The individual tips of an optical imaging fiber bundle (mm in diameter with 7000 fiber cores) were etched into cones with 10 nm radius of curvature and coated with Au. FRET (Forster Resonant Energy Transfer) hairpin oligo probes, with the loop complementary to a specific miRNA that can release the hairpin, were functionalized onto the conic tips. Exciting light in the optical fiber waveguide is optimally coupled to surface plasmonics on the gold surface, which then converges to the conic tips with two orders of magnitude enhancement in intensity. Unlike nanoparticle plasmonics, tip plasmonics can be excited over a large band width and hence the plasmonic enhanced fluorescence signal of the FRET reporter is also focused towards the tip--- and is further enhanced with the periodic resonant grid of the fiber array which gives rise to pronounced standing wave interference patterns. Multiplexing is realized by functionalizing different probes onto one fiber bundle using a photoactivation process.
NASA Technical Reports Server (NTRS)
Zhang, Ying; Lim, Chang U K.; Williams, Eli S.; Zhou, Junqing; Zhang, Qinming; Fox, Michael H.; Bailey, Susan M.; Liber, Howard L.
2005-01-01
Hypomorphic mutations which lead to decreased function of the NBS1 gene are responsible for Nijmegen breakage syndrome, a rare autosomal recessive hereditary disorder that imparts an increased predisposition to development of malignancy. The NBS1 protein is a component of the MRE11/RAD50/NBS1 complex that plays a critical role in cellular responses to DNA damage and the maintenance of chromosomal integrity. Using small interfering RNA transfection, we have knocked down NBS1 protein levels and analyzed relevant phenotypes in two closely related human lymphoblastoid cell lines with different p53 status, namely wild-type TK6 and mutated WTK1. Both TK6 and WTK1 cells showed an increased level of ionizing radiation-induced mutation at the TK and HPRT loci, impaired phosphorylation of H2AX (gamma-H2AX), and impaired activation of the cell cycle checkpoint regulating kinase, Chk2. In TK6 cells, ionizing radiation-induced accumulation of p53/p21 and apoptosis were reduced. There was a differential response to ionizing radiation-induced cell killing between TK6 and WTK1 cells after NBS1 knockdown; TK6 cells were more resistant to killing, whereas WTK1 cells were more sensitive. NBS1 deficiency also resulted in a significant increase in telomere association that was independent of radiation exposure and p53 status. Our results provide the first experimental evidence that NBS1 deficiency in human cells leads to hypermutability and telomere associations, phenotypes that may contribute to the cancer predisposition seen among patients with this disease.
Sackett, Kelly; Nethercott, Matthew J.; Shai, Yechiel; Weliky, David P.
2009-01-01
Conformational changes in the HIV gp41 protein are directly correlated with fusion between the HIV and target cell plasma membranes which is the initial step of infection. Key gp41 fusion conformations include an early extended conformation termed pre-hairpin which contains exposed regions and a final low energy conformation termed hairpin which has compact six-helix bundle structure. Current fusion models debate the roles of hairpin and pre-hairpin conformations in the process of membrane merger. In the present work, gp41 constructs have been engineered which correspond to fusion relevant parts of both pre-hairpin and hairpin conformations, and have been analyzed for their ability to induce lipid mixing between membrane vesicles. The data correlate membrane fusion function with the pre-hairpin conformation and suggest that one of the roles of the final hairpin conformation is sequestration of membrane perturbing gp41 regions with consequent loss of the membrane disruption induced earlier by the pre-hairpin structure. To our knowledge, this is the first biophysical study to delineate the membrane fusion potential of gp41 constructs modeling key fusion conformations. PMID:19222185
Knockdown of Rice microRNA166 by Short Tandem Target Mimic (STTM).
Teotia, Sachin; Zhang, Dabing; Tang, Guiliang
2017-01-01
Small RNAs, including microRNAs (miRNAs), are abundant in plants and play key roles in controlling plant development and physiology. miRNAs regulate the expression of the target genes involved in key plant processes. Due to functional redundancy among miRNA family members in plants, an ideal approach to silence the expression of all members simultaneously, for their functional characterization, is desirable. Target mimic (TM) was the first approach to achieve this goal. Short tandem target mimic (STTM) is a potent approach complementing TM for silencing miRNAs in plants. STTMs have been successfully used in dicots to block miRNA functions. Here, we describe in detail the protocol for designing STTM construct to block miRNA functions in rice. Such approach can be applied to silence miRNAs in other monocots as well.
Yu, H; Xue, Y; Wang, P; Liu, X; Ma, J; Zheng, J; Li, Z; Li, Z; Cai, H; Liu, Y
2017-01-01
Antiangiogenic therapy plays a significant role in combined glioma treatment. However, poor permeability of the blood–tumor barrier (BTB) limits the transport of chemotherapeutic agents, including antiangiogenic drugs, into tumor tissues. Long non-coding RNAs (lncRNAs) have been implicated in various diseases, especially malignant tumors. The present study found that lncRNA X-inactive-specific transcript (XIST) was upregulated in endothelial cells that were obtained in a BTB model in vitro. XIST knockdown increased BTB permeability and inhibited glioma angiogenesis. The analysis of the mechanism of action revealed that the reduction of XIST inhibited the expression of the transcription factor forkhead box C1 (FOXC1) and zonula occludens 2 (ZO-2) by upregulating miR-137. FOXC1 decreased BTB permeability by increasing the promoter activity and expression of ZO-1 and occludin, and promoted glioma angiogenesis by increasing the promoter activity and expression of chemokine (C–X–C motif) receptor 7b (CXCR7). Overall, the present study demonstrates that XIST plays a pivotal role in BTB permeability and glioma angiogenesis, and the inhibition of XIST may be a potential target for the clinical management of glioma. PMID:28287613
Belkacemi, Louiza; Hebb, Matthew O
2014-09-01
The heat-shock proteins HSP27 and HSP90 perpetuate the malignant nature of glioblastoma multiforme (GBM) and offer promise as targets for novel cancer therapeutics. The present study sought to define synergistic antitumor benefits of concurrent HSP27-knockdown and the HSP90 inhibitor, 17-N-allylamino-17-demethoxygeldanamycin (17-AAG) or, comparatively, the non-selective kinase inhibitor, staurosporine, in GBM cells. Dose-response relations were determined for 17-AAG and staurosporine in three GBM cell lines. HSP27-targeted siRNA was administered alone or in combination with subtherapeutic concentrations of each drug and cells were evaluated for viability, proliferation and apoptosis. Adjuvant HSP27 knockdown with 17-AAG or staurosporine produced marked and synergistic decrease in GBM cell viability and proliferation, with robust elevation of apoptotic fractions and caspase-3 activation. HSP27 knockdown confers potent chemosensitization of GBM cells. These novel data support the development of HSP-targeting strategies and, specifically, anti-HSP27 agents for the treatment of GBM. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
CXCL5 knockdown expression inhibits human bladder cancer T24 cells proliferation and migration
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zheng, Jiajia; Zhu, Xi; Zhang, Jie, E-mail: zhangjiebjmu@163.com
2014-03-28
Highlights: • We first demonstrated CXCL5 is highly expressed in human bladder tumor tissues and cells. • CXCL5 knockdown inhibits proliferation, migration and promotes apoptosis in T24 cells. • CXCL5 knockdown inhibits Snail, PI3K-AKT and ERK1/2 signaling pathways in T24 cells. • CXCL5 is critical for bladder tumor growth and progression. - Abstract: CXCL5 (epithelial neutrophil activating peptide-78) which acts as a potent chemoattractant and activator of neutrophil function was reported to play a multifaceted role in tumorigenesis. To investigate the role of CXCL5 in bladder cancer progression, we examined the CXCL5 expression in bladder cancer tissues by real-time PCRmore » and Western blot, additionally, we used shRNA-mediated silencing to generate stable CXCL5 silenced bladder cancer T24 cells and defined its biological functions. Our results demonstrated that mRNA and protein of CXCL5 is increased in human bladder tumor tissues and cell lines, down-regulation of CXCL5 in T24 cells resulted in significantly decreased cell proliferation, migration and increased cell apoptosis in vitro through Snail, PI3K-AKT and ERK1/2 signaling pathways. These data suggest that CXCL5 is critical for bladder tumor growth and progression, it may represent a potential application in cancer diagnosis and therapy.« less
Nanomanipulation of Single RNA Molecules by Optical Tweezers
Stephenson, William; Wan, Gorby; Tenenbaum, Scott A.; Li, Pan T. X.
2014-01-01
A large portion of the human genome is transcribed but not translated. In this post genomic era, regulatory functions of RNA have been shown to be increasingly important. As RNA function often depends on its ability to adopt alternative structures, it is difficult to predict RNA three-dimensional structures directly from sequence. Single-molecule approaches show potentials to solve the problem of RNA structural polymorphism by monitoring molecular structures one molecule at a time. This work presents a method to precisely manipulate the folding and structure of single RNA molecules using optical tweezers. First, methods to synthesize molecules suitable for single-molecule mechanical work are described. Next, various calibration procedures to ensure the proper operations of the optical tweezers are discussed. Next, various experiments are explained. To demonstrate the utility of the technique, results of mechanically unfolding RNA hairpins and a single RNA kissing complex are used as evidence. In these examples, the nanomanipulation technique was used to study folding of each structural domain, including secondary and tertiary, independently. Lastly, the limitations and future applications of the method are discussed. PMID:25177917
Repairing RNA Transcripts that Mediate Breast Cancer Susceptibility
2005-08-01
is actually the yield of TES product plus the yield of cryptic is in contrast to hammerhead and hairpin ribozymes , which products. This increases the...therapeutics. To this end, we have developed a novel biomolecule (a ribozyme ) that can specifically excise regions from RNA transcripts. In this work, we...designed a ribozyme that excises an insertion mutation that is linked to breast cancer predisposition from a short mimic of the p53 transcript in a
Chou, Shuli; Shao, Changxuan; Wang, Jiajun; Shan, Anshan; Xu, Lin; Dong, Na; Li, Zhongyu
2016-01-01
The β-hairpin structure has been proposed to exhibit potent antimicrobial properties with low cytotoxicity, thus, multiple β-hairpin structures have been proved to be highly stable in structures containing tightly packed hydrophobic cores. The aim of this study was to develop peptide-based synthetic strategies for generating short, but effective AMPs as inexpensive antimicrobial agents. Multiple-stranded β-hairpin peptides with the same β-hairpin unit, (WRXxRW)n where n=1, 2, 3, or 4 and Xx represent the turn sequence, were synthesized, and their potential as antimicrobial agents was evaluated. Owning to the tightly packed hydrophobic core and paired Trp of this multiple-stranded β-hairpin structure, all the 12-residues peptides exhibited high cell selectivity towards bacterial cells over human red blood cells (hRBCs), and the peptide W2 exhibited stronger antimicrobial activities with the MIC values of 2-8μM against various tested bacteria. Not only that, but W2 also showed obvious synergy with streptomycin and chloramphenicol against Escherichia coli, and displayed synergy with ciprofloxacin against Staphylococcus aureus with the FICI values ⩽0.5. Fluorescence spectroscopy and electron microscopy analyses indicated that W2 kills microbial cells by permeabilizing the cell membrane and damaging membrane integrity. Collectively, based on the multiple β-hairpin peptides, the ability to develop libraries of short and effective peptides will be a powerful approach to the discovery of novel antimicrobial agents. We successfully screened a peptide W2 ((WRPGRW)2) from a series of multiple-stranded β-hairpin antimicrobial peptides based on the "S-shaped" motif that induced the formation of a globular structure, and Trp zipper was used to replace the disulfide bonds to reduce the cost of production. This novel structure applied to AMPs improved cell selectivity and salt stability. The findings of this study will promote the development of peptide
Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B
1993-09-25
To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.
Davydova, Elena K.; Kaganman, Irene; Kazmierczak, Krystyna M.; Rothman-Denes, Lucia B.
2009-01-01
Bacteriophage N4 mini-virion RNA polymerase (mini-vRNAP), the 1106-amino acid transcriptionally active domain of vRNAP, recognizes single-stranded DNA template-containing promoters composed of conserved sequences and a 3-base loop–5-base pair stem hairpin structure. The major promoter recognition determinants are a purine located at the center of the hairpin loop (–11G) and a base at the hairpin stem (–8G). Mini-vRNAP is an evolutionarily highly diverged member of the T7 family of RNAPs. A two-plasmid system was developed to measure the in vivo activity of mutant mini-vRNAP enzymes. Five mini-vRNAP derivatives, each containing a pair of cysteine residues separated by ∼100 amino acids and single cysteine-containing enzymes, were generated. These reagents were used to determine the smallest catalytically active polypeptide and to map promoter, substrate, and RNA-DNA hybrid contact sites to single amino acid residues in the enzyme by using end-labeled 5-iododeoxyuridine- and azidophenacyl-substituted oligonucleotides, cross-linkable derivatives of the initiating nucleotide, and RNA products with 5-iodouridine incorporated at specific positions. Localization of functionally important amino acid residues in the recently determined crystal structures of apomini-vRNAP and the mini-vRNAP-promoter complex and comparison with the crystal structures of the T7 RNAP initiation and elongation complexes allowed us to predict major rearrangements in mini-vRNAP in the transition from transcription initiation to elongation similar to those observed in T7 RNAP, a task otherwise precluded by the lack of sequence homology between N4 mini-vRNAP and T7 RNAP. PMID:19015264
MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts
Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng
2014-01-01
Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645
Xu, Xiao-Tao; Tao, Ze-Zhang; Song, Qi-Bin; Yao, Yi; Ruan, Peng
2012-09-01
In order to investigate the effects of RNA interference of decoy receptor 3 (DcR3) on the sensitivity of gastric cancer cells to 5-fluorouracil (5-FU) and the relevant mechanisms, siRNA against DcR3 was transfected into the gastric cancer cell line AGS. AGS cells were treated with different doses of 5-FU or for different time periods. The sensitivity of AGS cells to 5-FU was determined. The cell survival rate was detected by MTT assay. The apoptotic rate was determined by DAPI staining, and the expression of related proteins were detected by western blot analysis. The results showed that the cell survival rate was significanlty decreased in the knockdown group compared to the control group at different doses of 5-FU (P<0.01). After different time periods of treatment with 5-FU, the cell survival rate in the knockdown group was significantly decreased compared to the control group, respectively (P<0.01). The apoptotic rate of AGS cells in the knockdown group was increased along with the increasing dose of siRNA. The siRNA against DcR3 enhanced the expression of Fas, FasL, caspase-3 and caspase-8. In conclusion, knockdown of DcR3 by RNA interference enhances apoptosis and inhibits the growth of gastric cancer cells. Downregulation of DcR3 enhances the sensitivity of gastric cancer cells to 5-FU and increased the expression of Fas, FasL and caspase-3/8.
Kaushik, Mahima; Kukreti, Shrikant
2015-01-01
Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.
Generation of stable human cell lines with Tetracycline-inducible (Tet-on) shRNA or cDNA expression.
Gomez-Martinez, Marta; Schmitz, Debora; Hergovich, Alexander
2013-03-05
A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon(1), to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells(2,3). In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here. Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells(4), vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs(5-11). However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.(12) modified the shRNA expression vector pSUPER(5) by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of
Zhao, Huazhou; Zhang, Kecheng; Wang, Ting; Cui, Jianxin; Xi, Hongqing; Wang, Yi; Song, Yanjing; Zhao, Xudong; Wei, Bo; Chen, Lin
2018-06-01
Gastric cancer (GC) is the second-leading cause of cancer-associated mortality worldwide. AFAP1-antisense RNA 1 (AFAP1-AS1), a long non-coding RNA (lncRNA), is believed to promote the aggressive progression of cancer; however, its role in GC remains largely unknown. In the present study, the expression of AFAP1-AS1 in GC tissues and cell lines was measured using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Knockdown of AFAP1-AS1 was performed using a lentiviral vector containing a short hairpin RNA. The proliferation of GC cells was measured using Cell Counting kit-8. The migration and invasion of GC cells were analyzed using a QCM Laminin Migration Assay kit and a Cell Invasion Assay kit. The levels of epithelial-mesenchymal transition (EMT)-associated proteins were detected by western blot analysis. The cut-off value of the expression of AFAP1-AS1 was evaluated using receiver operating characteristic (ROC) curves and patient survival rate was analyzed using Kaplan-Meier. The expression of AFAP1-AS1 was significantly increased in the primary tumor tissues of GC patients with lymph node metastasis or tumor node metastasis stage (stage III or IV; P<0.01). ROC curve analysis revealed that the expression of AFAP-AS1, at a cut-off value of 0.5040, could distinguish GC tissues from the matched normal tissues, with an AUC of 0.8802, sensitivity of 81.25% and specificity of 83.75%. The overexpression of AFAP1-AS1 was positively associated with the poor survival rates of GC patients. Furthermore, the downregulation of AFAP1-AS1 significantly inhibited the proliferation, migration and invasion of GC cells in vitro (P<0.01). The decrease in AFAP1-AS1 expression significantly suppressed the expression level of N-cadherin protein in GC cells and increased that of E-cadherin. The present study demonstrated that the expression signature of AFAP1-AS1 may serve as a biomarker for the diagnosis and prognosis of GC, and its downregulation may repress the
Computational Prediction of miRNA Genes from Small RNA Sequencing Data
Kang, Wenjing; Friedländer, Marc R.
2015-01-01
Next-generation sequencing now for the first time allows researchers to gage the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. microRNAs (miRNAs) are 22 nucleotide small RNAs (sRNAs) that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq), which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here, we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field. PMID:25674563
Seligmann, Hervé
2016-01-01
In mitochondria, secondary structures punctuate post-transcriptional RNA processing. Recently described transcripts match the human mitogenome after systematic deletions of every 4th, respectively every 4th and 5th nucleotides, called delRNAs. Here I explore predicted stem-loop hairpin formation by delRNAs, and their associations with delRNA transcription and detected peptides matching their translation. Despite missing 25, respectively 40% of the nucleotides in the original sequence, del-transformed sequences form significantly more secondary structures than corresponding randomly shuffled sequences, indicating biological function, independently of, and in combination with, previously detected delRNA and thereof translated peptides. Self-hybridization decreases delRNA abundances, indicating downregulation. Systematic deletions of the human mitogenome reveal new, unsuspected coding and structural informations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.