Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus.

PubMed

Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J

2008-06-01

Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.

Crystallization and X-ray diffraction analysis of a catalytic domain of hyperthermophilic chitinase from Pyrococcus furiosus

PubMed Central

Mine, Shouhei; Nakamura, Tsutomu; Hirata, Kunio; Ishikawa, Kazuhiko; Hagihara, Yoshihisa; Uegaki, Koichi

2006-01-01

The crystallization and preliminary X-ray diffraction analysis of a catalytic domain of chitinase (PF1233 gene) from the hyperthermophilic archaeon Pyrococcus furiosus is reported. The recombinant protein, prepared using an Escherichia coli expression system, was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected at the undulator beamline BL44XU at SPring-8 to a resolution of 1.50 Å. The crystals belong to space group P212121, with unit-cell parameters a = 90.0, b = 92.8, c = 107.2 Å. PMID:16880559

The quaternary structure of the amidase from Geobacillus pallidus RAPc8 is revealed by its crystal packing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Agarkar, Vinod B.; Kimani, Serah W.; Cowan, Donald A.

2006-12-01

The amidase from G. pallidus RAPc8, a moderate thermophile, converts amides to the corresponding acids and ammonia and has application as an industrial catalyst. RAPc8 amidase has been cloned, expressed and purified, and then crystallized using the hanging-drop vapour-diffusion method. The amidase from Geobacillus pallidus RAPc8, a moderate thermophile, is a member of the nitrilase enzyme superfamily. It converts amides to the corresponding acids and ammonia and has application as an industrial catalyst. RAPc8 amidase has been cloned and functionally expressed in Escherichia coli and has been purified by heat treatment and a number of chromatographic steps. The enzyme wasmore » crystallized using the hanging-drop vapour-diffusion method. Crystals produced in the presence of 1.2 M sodium citrate, 400 mM NaCl, 100 mM sodium acetate pH 5.6 were selected for X-ray diffraction studies. A data set having acceptable statistics to 1.96 Å resolution was collected under cryoconditions using an in-house X-ray source. The space group was determined to be primitive cubic P4{sub 2}32, with unit-cell parameter a = 130.49 (±0.05) Å. The structure was solved by molecular replacement using the backbone of the hypothetical protein PH0642 from Pyrococcus horikoshii (PDB code 1j31) with all non-identical side chains substituted with alanine as a probe. There is one subunit per asymmetric unit. The subunits are packed as trimers of dimers with D3 point-group symmetry around the threefold axis in such a way that the dimer interface seen in the homologues is preserved.« less

Purification, Crystallization, and Preliminary Crystallographic Analysis of Deoxyuridine Triphosphate Nucleotidohydrolase from Arabidopsis Thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajaj,M.; Moriyama, H.

2007-01-01

The deoxyuridine triphosphate nucleotidohydrolase gene from Arabidopsis thaliana was expressed and the gene product was purified. Crystallization was performed by the hanging-drop vapour-diffusion method at 298 K using 2 M ammonium sulfate as the precipitant. X-ray diffraction data were collected to 2.2 Angstroms resolution using Cu K{alpha} radiation. The crystal belongs to the orthorhombic space group P212121, with unit-cell parameters a = 69.90, b = 70.86 Angstroms, c = 75.55 Angstroms . Assuming the presence of a trimer in the asymmetric unit, the solvent content was 30%, with a VM of 1.8 Angstroms 3 Da-1.

Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus

PubMed Central

Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.

2008-01-01

Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guo, Feng; Jin, Tengchuan; Howard, Andrew

The crystallization of the brazil nut allergen Ber e 2 is reported. Peanut and tree-nut allergies have attracted considerable attention because of their frequency and their lifelong persistence. Brazil-nut (Bertholletia excelsa) allergies have been well documented and the 11S legumin-like seed storage protein Ber e 2 (excelsin) is one of the two known brazil-nut allergens. In this study, Ber e 2 was extracted from brazil-nut kernels and purified to high purity by crystalline precipitation and gel-filtration chromatography. Well diffracting single crystals were obtained using the hanging-drop vapour-diffusion method. A molecular-replacement structural solution has been obtained. Refinement of the structure ismore » currently under way.« less

Expression, purification and preliminary crystallographic analysis of sucrose phosphate synthase (SPS) from Halothermothrix orenii

PubMed Central

Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.

2005-01-01

This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure. PMID:16508108

Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurz, M.; Iturbe-Ormaetxe, I.; Jarrott, R.

2008-02-01

The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, bmore » = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.« less

Crystallization and preliminary X-ray diffraction studies of the glutaminyl cyclase from Carica papaya latex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azarkan, Mohamed; Clantin, Bernard; Bompard, Coralie

2005-01-01

The glutaminyl cyclase isolated from C. papaya latex has been crystallized using the hanging-drop method. Diffraction data have been collected at ESRF beamline BM14 and processed to 1.7 Å resolution. In living systems, the intramolecular cyclization of N-terminal glutamine residues is accomplished by glutaminyl cyclase enzymes (EC 2.3.2.5). While in mammals these enzymes are involved in the synthesis of hormonal and neurotransmitter peptides, the physiological role played by the corresponding plant enzymes still remains to be unravelled. Papaya glutaminyl cyclase (PQC), a 33 kDa enzyme found in the latex of the tropical tree Carica papaya, displays an exceptional resistance tomore » chemical and thermal denaturation as well as to proteolysis. In order to elucidate its enzymatic mechanism and to gain insights into the structural determinants underlying its remarkable stability, PQC was isolated from papaya latex, purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 62.82, b = 81.23, c = 108.17 Å and two molecules per asymmetric unit. Diffraction data have been collected at ESRF beamline BM14 and processed to a resolution of 1.7 Å.« less

Crystallization and preliminary crystallographic analysis of a surface antigen glycoprotein, SAG19, from Eimeria tenella

PubMed Central

Ramly, Nur Zazarina; Rouzheinikov, Sergey N.; Sedelnikova, Svetlana E.; Baker, Patrick J.; Chow, Yock-Ping; Wan, Kiew-Lian; Nathan, Sheila; Rice, David W.

2013-01-01

Coccidiosis in chickens is caused by the apicomplexan parasite Eimeria tenella and is thought to involve a role for a superfamily of more than 20 cysteine-rich surface antigen glycoproteins (SAGs) in host–parasite interactions. A representative member of the family, SAG19, has been overexpressed in Escherichia coli, purified and crystallized by the hanging-drop method of vapour diffusion using ammonium sulfate as the precipitant. Crystals of SAG19 diffracted to beyond 1.50 Å resolution and belonged to space group I4, with unit-cell parameters a = b = 108.2, c = 37.5 Å. Calculation of possible values of V M suggests that there is a single molecule in the asymmetric unit. PMID:24316835

Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

PubMed Central

Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny; Willassen, Nils Peder

2006-01-01

Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P21, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit. PMID:16511268

Crystallization and preliminary X-ray analysis of 2,3-diketo-5-methylthiopentyl-1-phosphate enolase from Bacillus subtilis

PubMed Central

Tamura, Haruka; Ashida, Hiroki; Koga, Shogo; Saito, Yohtaro; Yadani, Tomonori; Kai, Yasushi; Inoue, Tsuyoshi; Yokota, Akiho; Matsumura, Hiroyoshi

2009-01-01

2,3-Diketo-5-methylthiopentyl-1-phosphate enolase (DK-MTP-1P enolase) from Bacillus subtilis was crystallized using the hanging-drop vapour-diffusion method. Crystals grew using PEG 3350 as the precipitant at 293 K. The crystals diffracted to 2.3 Å resolution at 100 K using synchrotron radiation and were found to belong to the monoclinic space group P21, with unit-cell parameters a = 79.3, b = 91.5, c = 107.0 Å, β = 90.8°. The asymmetric unit contained four molecules of DK-MTP-1P enolase, with a V M value of 2.2 Å3 Da−1 and a solvent content of 43%. PMID:19194007

Expression, Purification And Preliminary X-Ray Analysis of the C-Terminal Domain of An Arginine Repressor Protein From Mycobacterium Tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, G.J.; Garen, C.R.; Cherney, M.M.

2009-06-03

The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 {angstrom}. The crystals belong to space group P1 and the Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of sixmore » molecules per unit cell.« less

Purification, identification and preliminary crystallographic studies of Pru du amandin, an allergenic protein from Prunus dulcis.

PubMed

Gaur, Vineet; Sethi, Dhruv K; Salunke, Dinakar M

2008-01-01

Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presence of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P4(1) (or P4(3)), with unit-cell parameters a = b = 150.7, c = 164.9 A.

Purification, identification and preliminary crystallographic studies of Pru du amandin, an allergenic protein from Prunus dulcis

PubMed Central

Gaur, Vineet; Sethi, Dhruv K.; Salunke, Dinakar M.

2008-01-01

Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presence of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P41 (or P43), with unit-cell parameters a = b = 150.7, c = 164.9 Å. PMID:18097098

Purification, crystallization and preliminary crystallographic analysis of a 6-pyruvoyltetrahydropterin synthase homologue from Esherichia coli.

PubMed

Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho

2008-02-01

6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 A resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 A , and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 A , and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement.

Purification, crystallization and preliminary crystallographic analysis of a 6-pyruvoyltetrahydropterin synthase homologue from Esherichia coli

PubMed Central

Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho

2008-01-01

6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 Å resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 Å, and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 Å, and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement. PMID:18271114

Crystallization and preliminary X-ray diffraction analysis of a chitin-binding domain of hyperthermophilic chitinase from Pyrococcus furiosus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa

The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.

Cloning, purification, crystallization and preliminary X-ray crystallographic analysis of SET/TAF-Iß δN from Homo sapiens.

PubMed

Xu, Zhen; Yang, Weili; Shi, Nuo; Gao, Yongxiang; Teng, Maikun; Niu, Liwen

2010-08-01

The histone chaperone SET encoded by the SET gene, which is also known as template-activating factor Iß (TAF-Iß), is a multifunctional molecule that is involved in many biological phenomena such as histone binding, nucleosome assembly, chromatin remodelling, replication, transcription and apoptosis. A truncated SET/TAF-Iß ΔN protein that lacked the first 22 residues of the N-terminus but contained the C-terminal acidic domain and an additional His6 tag at the C-terminus was overexpressed in Escherichia coli and crystallized by the hanging-drop vapour-diffusion method using sodium acetate as precipitant at 283 K. The crystals diffracted to 2.7 A resolution and belonged to space group P4(3)2(1)2.

Crystallization and preliminary X-ray diffraction studies of a novel ferredoxin involved in the dioxygenation of carbazole by Novosphingobium sp. KA1

PubMed Central

Umeda, Takashi; Katsuki, Junichi; Usami, Yusuke; Inoue, Kengo; Noguchi, Haruko; Fujimoto, Zui; Ashikawa, Yuji; Yamane, Hisakazu; Nojiri, Hideaki

2008-01-01

Novosphingobium sp. KA1 uses carbazole 1,9a-dioxygenase (CARDO) as the first dioxygenase in its carbazole-degradation pathway. The CARDO of KA1 contains a terminal oxygenase component and two electron-transfer components: ferredoxin and ferredoxin reductase. In contrast to the CARDO systems of other species, the ferredoxin component of KA1 is a putidaredoxin-type protein. This novel ferredoxin was crystallized at 293 K by the hanging-drop vapour-diffusion method using PEG MME 550 as the precipitant under anaerobic conditions. The crystals belong to space group C2221 and diffraction data were collected to a resolution of 1.9 Å (the diffraction limit was 1.6 Å). PMID:18607094

Expression, purification, crystallization and preliminary X-ray analysis of the Met244Ala variant of catalase–peroxidase (KatG) from the haloarchaeon Haloarcula marismortui

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ten-i, Tomomi; Kumasaka, Takashi; Higuchi, Wataru

2007-11-01

The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. The covalent modification of the side chains of Trp95, Tyr218 and Met244 within the active site of Haloarcula marismortui catalase–peroxidase (KatG) appears to be common to all KatGs and has been demonstrated to be particularly significant formore » its bifunctionality [Smulevich et al. (2006 ▶), J. Inorg. Biochem.100, 568–585; Jakopitsch, Kolarich et al. (2003 ▶), FEBS Lett.552, 135–140; Jakopitsch, Auer et al. (2003 ▶), J. Biol. Chem.278, 20185–20191; Jakopitsch et al. (2004 ▶), J. Biol. Chem.279, 46082–46095; Regelsberger et al. (2001 ▶), Biochem. Soc. Trans.29, 99–105; Ghiladi, Knudsen et al. (2005 ▶), J. Biol. Chem.280, 22651–22663; Ghiladi, Medzihradzky et al. (2005 ▶), Biochemistry, 44, 15093–15105]. The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant showed a complete loss of catalase activity, whereas the peroxidase activity of this mutant was highly enhanced owing to an increase in its affinity for the peroxidatic substrate. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. A crystal frozen using lithium sulfate as the cryoprotectant diffracted to beyond 2.0 Å resolution. Preliminary X-ray analysis suggests the presence of a dimer in the asymmetric unit.« less

Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

PubMed

Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

1987-11-01

Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

Heterologous expression, purification, crystallization and preliminary X-ray analysis of raucaffricine glucosidase, a plant enzyme specifically involved in Rauvolfia alkaloid biosynthesis.

PubMed

Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim

2006-03-01

Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 A, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 A.

Crystallization and preliminary X-ray study of a (2R,3R)-2,3-butanediol dehydrogenase from Bacillus coagulans 2-6

PubMed Central

Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui

2013-01-01

(2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P212121, with unit-cell parameters a = 88.35, b = 128.73, c = 131.03 Å. PMID:24100567

Purification, crystallization and preliminary crystallographic study of low oxygen-affinity haemoglobin from cat (Felis silvestris catus) in two different crystal forms.

PubMed

Balasubramanian, M; Moorthy, Pon Sathya; Neelagandan, K; Ponnuswamy, M N

2009-03-01

Haemoglobin is a metalloprotein which plays a major role in the transportation of oxygen from the lungs to tissues and of carbon dioxide back to the lungs. The present work reports the preliminary crystallographic study of low oxygen-affinity haemoglobin from cat in different crystal forms. Cat blood was collected, purified by anion-exchange chromatography and crystallized in two different conditions by the hanging-drop vapour-diffusion method under unbuffered low-salt and buffered high-salt concentrations using PEG 3350 as a precipitant. Intensity data were collected using MAR345 and MAR345dtb image-plate detector systems. Cat haemoglobin crystallizes in monoclinic and orthorhombic crystal forms with one and two whole biological molecules (alpha(2)beta(2)), respectively, in the asymmetric unit.

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli.

PubMed

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke

2007-08-01

Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7''-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 A and belongs to space group P3(2)21, with unit-cell parameters a = b = 71.0, c = 125.0 A. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli

PubMed Central

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke

2007-01-01

Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3221, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein. PMID:17671368

Crystallization and preliminary X-ray study of a (2R,3R)-2,3-butanediol dehydrogenase from Bacillus coagulans 2-6.

PubMed

Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui

2013-10-01

(2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P2₁2₁2₁, with unit-cell parameters a=88.35, b=128.73, c=131.03 Å.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aoki, Ken-ichi; Tanaka, Nobutada, E-mail: ntanaka@pharm.showa-u.ac.jp; Ishikura, Shuhei

Pig heart carbonyl reductase has been crystallized in the presence of NADPH. Diffraction data have been collected using synchrotron radiation. Pig heart carbonyl reductase (PHCR), which belongs to the short-chain dehydrogenase/reductase (SDR) family, has been crystallized by the hanging-drop vapour-diffusion method. Two crystal forms (I and II) have been obtained in the presence of NADPH. Form I crystals belong to the tetragonal space group P4{sub 2}, with unit-cell parameters a = b = 109.61, c = 94.31 Å, and diffract to 1.5 Å resolution. Form II crystals belong to the tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters amore » = b = 120.10, c = 147.00 Å, and diffract to 2.2 Å resolution. Both crystal forms are suitable for X-ray structure analysis at high resolution.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niemi, Merja, E-mail: merja.niemi@joensuu.fi; Jänis, Janne; Jylhä, Sirpa

The high-resolution mass-spectrometric characterization, crystallization and X-ray diffraction studies of a recombinant IgE Fab fragment in complex with bovine β-lactoglobulin are reported. A D1 Fab fragment containing the allergen-binding variable domains of the IgE antibody was characterized by ESI FT–ICR mass spectrometry and crystallized with bovine β-lactoglobulin (BLG) using the hanging-drop vapour-diffusion method at 293 K. X-ray data suitable for structure determination were collected to 2.8 Å resolution using synchrotron radiation. The crystal belonged to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 67.0, b = 100.6, c = 168.1 Å. The three-dimensional structure ofmore » the D1 Fab fragment–BLG complex will provide the first insight into IgE antibody–allergen interactions at the molecular level.« less

Experimental and theoretical analysis of the rate of solvent equilibration in the hanging drop method of protein crystal growth

NASA Technical Reports Server (NTRS)

Fowlis, William W.; Delucas, Lawrence J.; Twigg, Pamela J.; Howard, Sandra B.; Meehan, Edward J.

1988-01-01

The principles of the hanging-drop method of crystal growth are discussed, and the rate of water evaporation in a water droplet (containing protein, buffer, and a precipitating agent) suspended above a well containing a double concentration of precipitating agent is investigated theoretically. It is shown that, on earth, the rate of evaporation may be determined from diffusion theory and the colligative properties of solutions. The parameters affecting the rate of evaporation include the temperature, the vapor pressure of water, the ionization constant of the salt, the volume of the drop, the contact angle between the droplet and the coverslip, the number of moles of salt in the droplet, the number of moles of water and salt in the well, the molar volumes of water and salt, the distance from the droplet to the well, and the coefficient of diffusion of water vapor through air. To test the theoretical equations, hanging-drop experiments were conducted using various reagent concentrations in 25-microliter droplets and measuring the evaporation times at 4 C and 25 C. The results showed good agreement with the theory.

Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

2008-04-01

Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

Heterologous expression, purification, crystallization and preliminary X-ray analysis of raucaffricine glucosidase, a plant enzyme specifically involved in Rauvolfia alkaloid biosynthesis

PubMed Central

Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim

2006-01-01

Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 Å, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 Å. PMID:16511316

Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen

2006-10-01

Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution.more » The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.« less

Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Guan-Jing; Li, Lan-Fen; Li, Dan

2007-09-01

A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, withmore » unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å.« less

Preliminary X-ray crystallographic analysis of SMU.573, a putative sugar kinase from Streptococcus mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Yan-Feng; Li, Lan-Fen; Yang, Cheng

2008-01-01

SMU.573 from S. mutans was expressed in E. coli and crystallized. The crystals belong to space group I4 and 2.5 Å resolution diffraction data were collected at an in-house chromium radiation source. SMU.573 from Streptococcus mutans is a structurally and functionally uncharacterized protein that was selected for structural biology studies. Native and SeMet-labelled proteins were expressed with an N-His tag in Escherichia coli BL21 (DE3) and purified by Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals of the SeMet-labelled protein were obtained by the hanging-drop vapour-diffusion method and a 2.5 Å resolution diffraction data set was collected using an in-house chromium radiationmore » source. The crystals belong to space group I4, with unit-cell parameters a = b = 96.53, c = 56.26 Å, α = β = γ = 90°.« less

Purification, crystallization and preliminary X-ray crystallographic analysis of rice Bowman–Birk inhibitor from Oryza sativa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Yi-Hung; Li, Hsin-Tai; Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan

2006-06-01

Rice Bowman–Birk inhibitor was expressed and crystallized. Bowman–Birk inhibitors (BBIs) are cysteine-rich proteins with inhibitory activity against proteases that are widely distributed in monocot and dicot species. The expression of rice BBI from Oryza sativa is up-regulated and induced by pathogens or insects during germination of rice seeds. The rice BBI (RBTI) of molecular weight 15 kDa has been crystallized using the hanging-drop vapour-diffusion method. According to the diffraction of rice BBI crystals at a resolution of 2.07 Å, the unit cell belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 74.37, b = 96.69, cmore » = 100.36 Å. Preliminary analysis indicates four BBI molecules in an asymmetric unit, with a solvent content of 58.29%.« less

Purification, identification and preliminary crystallographic studies of Pru du amandin, an allergenic protein from Prunus dulcis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gaur, Vineet; Sethi, Dhruv K.; Salunke, Dinakar M., E-mail: dinakar@nii.res.in

The purification, identification, crystallization and preliminary crystallographic studies of an allergy-related protein, Pru du amandin, from P. dulcis nuts are reported. Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presencemore » of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 150.7, c = 164.9 Å.« less

Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin.

PubMed

Jagadeesan, G; Malathy, P; Gunasekaran, K; Harikrishna Etti, S; Aravindhan, S

2014-11-01

Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3₁21, with unit-cell parameters a=b=55.64, c=153.38 Å, β=120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aravind, Penmatsa; Rajini, Bheemreddy; Sharma, Yogendra

The crystallization and preliminary X-ray diffraction analysis of AIM1g1, a βγ-crystallin domain of absent in melanoma (AIM1) protein from H. sapiens, is reported. AIM1g1 is a single βγ-crystallin domain from the protein absent in melanoma 1 (AIM1), which appears to play a role in the suppression of melanomas. This domain is known to bind calcium and its structure would help in identifying calcium-coordinating sites in vertebrate crystallins, which have hitherto been believed to have lost this ability during evolution. Crystallization of this domain was performed by the hanging-drop vapour-diffusion method. Crystals diffracted to a maximum resolution of 1.86 Å andmore » were found to belong to space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 54.98, c = 59.73 Å. Solvent-content analysis indicated the presence of one monomer per asymmetric unit.« less

Crystallization and preliminary crystallographic analysis of an acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morita, Hiroyuki; Kondo, Shin; Kato, Ryohei

2007-07-01

An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α =more » β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.« less

Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

DOE Office of Scientific and Technical Information (OSTI.GOV)

Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny

2006-01-01

Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, βmore » = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.« less

Crystallization and preliminary X-ray data analysis of β-alanine synthase from Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lundgren, Stina; Andersen, Birgit; Piškur, Jure

2007-10-01

β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine. Crystals of the recombinant enzyme from D. melanogaster belong to space group C2. Diffraction data to 3.3 Å resolution were collected and analyzed. β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine, which represents the main clearance route for the widely used anticancer drug 5-fluorouracil. Crystals of the recombinant enzyme from Drosophila melanogaster, which is closely related to the human enzyme, were obtained by the hanging-drop vapour-diffusion method. They diffracted to 3.3 Å at a synchrotron-radiation source, belong tomore » space group C2 (unit-cell parameters a = 278.9, b = 95.0, c = 199.3 Å, β = 125.8°) and contain 8–10 molecules per asymmetric unit.« less

Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein.

PubMed

Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla

2009-09-01

Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1

PubMed Central

Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi

2010-01-01

The hyperthermophilic archaeal Rieske-type [2Fe–2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe–2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-­terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 Å resolution and belonged to the tetragonal space group P43212, with unit-cell parameters a = 60.72, c = 83.31 Å. The asymmetric unit contains one protein molecule. PMID:20606288

Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1.

PubMed

Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi

2010-07-01

The hyperthermophilic archaeal Rieske-type [2Fe-2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe-2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 A resolution and belonged to the tetragonal space group P4(3)2(1)2, with unit-cell parameters a = 60.72, c = 83.31 A. The asymmetric unit contains one protein molecule.

Purification, characterization and preliminary crystallographic studies of a cysteine protease from Pachyrrhizus erosus seeds.

PubMed

Chang, Shaojie; Song, Xiaomin; Yan, Ming; Zhou, Zhaocai; Wu, Fang; Gong, Weimin

2004-01-01

The proteins Spe31 and Spe32, named after their respective molecular weights of about 31 and 32 kDa, were purified simultaneously from the seeds of Pachyrrhizus erosus. They cannot be separated from each other by column chromatography. N-terminal sequence analysis indicated that they belonged to the papain family of cysteine proteases. An in-gel activity assay revealed that Spe31 possesses proteolytic activity while Spe32 only displays very weak activity for protein degradation. Both of them are glycoproteins as detected by the periodic acid and Schiff's reagent method. Crystals were obtained from the protein mixture by the hanging-drop vapour-diffusion method; they diffracted to a resolution of 2.61 A on an in-house X-ray source. The crystals belong to space group P4(1(3))2(1)2, with unit-cell parameters a = b = 61.96, c = 145.61 A. Gel electrophoresis under non-denaturing conditions showed that the protein crystallized was Spe31.

Comparative analysis of tumor spheroid generation techniques for differential in vitro drug toxicity

PubMed Central

Raghavan, Shreya; Rowley, Katelyn R.; Mehta, Geeta

2016-01-01

Multicellular tumor spheroids are powerful in vitro models to perform preclinical chemosensitivity assays. We compare different methodologies to generate tumor spheroids in terms of resultant spheroid morphology, cellular arrangement and chemosensitivity. We used two cancer cell lines (MCF7 and OVCAR8) to generate spheroids using i) hanging drop array plates; ii) liquid overlay on ultra-low attachment plates; iii) liquid overlay on ultra-low attachment plates with rotating mixing (nutator plates). Analysis of spheroid morphometry indicated that cellular compaction was increased in spheroids generated on nutator and hanging drop array plates. Collagen staining also indicated higher compaction and remodeling in tumor spheroids on nutator and hanging drop arrays compared to conventional liquid overlay. Consequently, spheroids generated on nutator or hanging drop plates had increased chemoresistance to cisplatin treatment (20-60% viability) compared to spheroids on ultra low attachment plates (10-20% viability). Lastly, we used a mathematical model to demonstrate minimal changes in oxygen and cisplatin diffusion within experimentally generated spheroids. Our results demonstrate that in vitro methods of tumor spheroid generation result in varied cellular arrangement and chemosensitivity. PMID:26918944

Crystallization screening test for the whole-cell project on Thermus thermophilus HB8

PubMed Central

Iino, Hitoshi; Naitow, Hisashi; Nakamura, Yuki; Nakagawa, Noriko; Agari, Yoshihiro; Kanagawa, Mayumi; Ebihara, Akio; Shinkai, Akeo; Sugahara, Mitsuaki; Miyano, Masashi; Kamiya, Nobuo; Yokoyama, Shigeyuki; Hirotsu, Ken; Kuramitsu, Seiki

2008-01-01

It was essential for the structural genomics of Thermus thermophilus HB8 to efficiently crystallize a number of proteins. To this end, three conventional robots, an HTS-80 (sitting-drop vapour diffusion), a Crystal Finder (hanging-drop vapour diffusion) and a TERA (modified microbatch) robot, were subjected to a crystallization condition screening test involving 18 proteins from T. thermophilus HB8. In addition, a TOPAZ (microfluidic free-interface diffusion) designed specifically for initial screening was also briefly examined. The number of diffraction-quality crystals and the time of appearance of crystals increased in the order HTS-80, Crystal Finder, TERA. With the HTS-80 and Crystal Finder, the time of appearance was short and the rate of salt crystallization was low. With the TERA, the number of diffraction-quality crystals was high, while the time of appearance was long and the rate of salt crystallization was relatively high. For the protein samples exhibiting low crystallization success rates, there were few crystallization conditions that were common to the robots used. In some cases, the success rate depended greatly on the robot used. The TOPAZ showed the shortest time of appearance and the highest success rate, although the crystals obtained were too small for diffraction studies. These results showed that the combined use of different robots significantly increases the chance of obtaining crystals, especially for proteins exhibiting low crystallization success rates. The structures of 360 of 944 purified proteins have been successfully determined through the combined use of an HTS-80 and a TERA. PMID:18540056

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, fromSphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtainedP3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding usingP3 121/P3 221 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space groupP2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c= 128.1 Å. TheP2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing the cryoconditions. Phasing using the single anomalous diffractionmore » method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, from Sphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtained P3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding using P3 121/P3 2 21 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space group P2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c = 128.1 Å. The P2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing themore » cryoconditions. Phasing using the single anomalous diffraction method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Crystallization and preliminary X-ray diffraction studies of the ferredoxin reductase component in the Rieske nonhaem iron oxygenase system carbazole 1,9a-dioxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui

2007-06-01

The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less

Transport phenomena in the crystallization of lysozyme by osmotic dewatering and liquid-liquid diffusion in low gravity

NASA Technical Reports Server (NTRS)

Todd, Paul; Sportiello, Michael G.; Gregory, Derek; Cassanto, John M.; Alvarado, Ulises A.; Ostroff, Robert; Korszun, Z. R.

1993-01-01

Two methods of protein crystallization, osmotic dewatering and liquid-liquid diffusion, like the vapor diffusion (hanging-drop and sessile-drop) methods allow a gradual approach to supersaturation conditions. The crystallization of hen egg-white lysozyme, an extensively characterized protein crystal, in the presence of sodium chloride was used as an experimental model with which to compare these two methods in low gravity and in the laboratory. Comparisons of crystal growth rates by the two methods under the two conditions have, to date, indicated that the rate of crystal growth by osmotic dewatering is nearly the same in low gravity and on the ground, while much faster crystal growth rates can be achieved by the liquid-liquid diffusion method in low gravity.

Purification, crystallization and preliminary X-ray diffraction analysis of a novel keto-deoxy-d-galactarate (KDG) dehydratase from Agrobacterium tumefaciens

PubMed Central

Taberman, Helena; Andberg, Martina; Parkkinen, Tarja; Richard, Peter; Hakulinen, Nina; Koivula, Anu; Rouvinen, Juha

2014-01-01

d-Galacturonic acid is the main component of pectin. It could be used to produce affordable renewable fuels, chemicals and materials through biotechnical conversion. Keto-deoxy-d-galactarate (KDG) dehydratase is an enzyme in the oxidative pathway of d-galacturonic acid in Agrobacterium tumefaciens (At). It converts 3-deoxy-2-keto-l-threo-hexarate to α-ketoglutaric semialdehyde. At KDG dehydratase was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 169.1, b = 117.8, c = 74.3 Å, β = 112.4° and an asymmetric unit of four monomers. X-ray diffraction data were collected to 1.9 Å resolution using synchrotron radiation. The three-dimensional structure of At KDG dehydratase will provide valuable information on the function of the enzyme and will allow it to be engineered for biorefinery-based applications. PMID:24419616

Purification, crystallization and preliminary X-ray analysis of the glucosamine-6-phosphate N-acetyltransferase from human liver

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Juan; Zhou, Yan-Feng; Li, Lan-Fen

2006-11-01

Glucosamine-6-phosphate N-acetyltransferase from human liver was expressed, purified and crystallized. Diffraction data have been collected to 2.6 Å resolution. Glucosamine-6-phosphate N-acetyltransferase from human liver, which catalyzes the transfer of an acetyl group from acetyl coenzyme A (AcCoA) to the primary amine of d-glucosamine 6-phosphate to form N-acetyl-d-glucosamine 6-phosphate, was expressed in a soluble form from Escherichia coli strain BL21 (DE3). The protein was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.6 Å resolution. The crystals belonged to space group P4{sub 1}2{sub 1}2more » or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 50.08, c = 142.88 Å.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Xiong-Zhuo; National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871; Li, Lan-Fen

The SMU.961 protein from S. mutans was crystallized and preliminary characterization of the crystals, which diffracted to 2.9 Å resolution, shows them to belong to space group C2. The smu.961 gene encodes a putative protein of 183 residues in Streptococcus mutans, a major pathogen in human dental caries. The gene was cloned into expression vector pET28a and expressed in a substantial quantity in Escherichia coli strain BL21 (DE3) with a His tag at its N-terminus. The recombinant protein SMU.961 was purified to homogeneity in a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction weremore » obtained by the hanging-drop vapour-diffusion method and diffracted to 2.9 Å resolution at beamline I911-3, MAX-II-lab, Sweden. The crystal belonged to space group C2, with unit-cell parameters a = 98.62, b = 73.73, c = 184.73 Å, β = 98.82°.« less

Extracellular overproduction and preliminary crystallographic analysis of a family I.3 lipase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Angkawidjaja, Clement; You, Dong-Ju; Matsumura, Hiroyoshi

2007-03-01

A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. The crystal was grown at 277 K by the hanging-drop vapour-diffusion method. Native X-ray diffraction data were collected to 1.7 Å resolution using synchrotron radiation at station BL38B1, SPring-8. The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 48.79, b = 84.06,more » c = 87.04 Å. Assuming the presence of one molecule per asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.73 Å{sup 3} Da{sup −1} and the solvent content was 55%.« less

Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jagadeesan, G.; Malathy, P.; Gunasekaran, K.

2014-10-25

The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to themore » trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.« less

Purification, crystallization and preliminary crystallographic studies of haemoglobin from mongoose (Helogale parvula) in two different crystal forms induced by pH variation.

PubMed

Mohamed Abubakkar, M; Saraboji, K; Ponnuswamy, M N

2013-02-01

Haemoglobin (Hb) is a respiratory pigment; it is a tetrameric protein that ferries oxygen from the lungs to tissues and transports carbon dioxide on the return journey. The oxygen affinity of haemoglobin is regulated by the concentration of oxygen surrounding it and several efforts have revealed the shapes of Hb in different states and with different functions. However, study of the molecular basis of Hbs from low-oxygen-affinity species is critically needed in order to increase the understanding of the mechanism behind oxygen adaptation. The present study reports the preliminary crystallographic study of low-oxygen-affinity haemoglobin from mongoose, a burrowing mammal. Haemoglobin from mongoose was purified by anion-exchange chromatography, crystallized using the hanging-drop vapour-diffusion method and diffraction data sets were collected from monoclinic (2.3 Å resolution) and orthorhombic (2.9 Å resolution) crystal forms obtained by pH variation. The monoclinic and orthorhombic asymmetric units contained half and a whole biological molecule, respectively.

Expression, purification and preliminary X-ray analysis of the C-terminal domain of an arginine repressor protein from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, George J.; Garen, Craig R.; Cherney, Maia M.

2007-11-01

The C-terminal portion of the arginine repressor protein from M. tuberculosis H37Rv has been crystallized. The complete transcriptional factor regulates arginine biosynthesis by binding operator DNA when arginine is bound at the C-terminal domain. The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 Å. The crystals belong to space group P1 and themore » Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of six molecules per unit cell.« less

Crystallization and preliminary crystallographic study of the yeast Malassezia sympodialis allergen Mala s 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vilhelmsson, Monica, E-mail: monica.vilhelmsson@medks.ki.se; Center for Infectious Medicine, Department of Medicine, Karolinska University Hospital, Huddinge, Stockholm; Hallberg, B. Martin

2006-02-01

Crystals of the M. sympodialis allergen Mala s 1 have been obtained using the hanging-drop vapour-diffusion method. A diffraction data set has been collected from native crystals to 1.35 Å resolution. The opportunistic yeast Malassezia sympodialis can act as an allergen and elicit specific IgE- and T-cell reactivity in patients with atopic eczema. The first identified major allergen from M. sympodialis, Mala s 1, is present on the cell surface of the yeast. Recombinant Mala s 1 was expressed in Escherichia coli, purified and refolded in a soluble form. Crystals of Mala s 1 were obtained in 25% PEG 8K,more » 0.2 M (NH{sub 4}){sub 2}SO{sub 4}. Crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 44.4, b = 163.7, c = 50.6 Å, and diffract to 1.35 Å resolution.« less

Purification, crystallization and preliminary X-ray diffraction analysis of royal palm tree (Roystonea regia) peroxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.

2007-09-01

The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika

2007-08-01

The crystallization and preliminary X-ray studies of the aminoglycoside antibiotic-modifying enzyme hygromycin B phosphotransferase from E. coli are reported. Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3{submore » 2}21, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.« less

Crystallization and preliminary X-ray crystallographic analysis of BxlA, an intracellular beta-D-xylosidase from Streptomyces thermoviolaceus OPC-520.

PubMed

Morioka, Hideaki; Miki, Yasuhiro; Saito, Kei; Tomoo, Koji; Ishida, Toshimasa; Hasegawa, Tomokazu; Yamano, Akihito; Takada, Chiaki; Miyamoto, Katsushiro; Tsujibo, Hiroshi

2010-07-01

BxlA from Streptomyces thermoviolaceus OPC-520, together with the extracellular BxlE and the integral membrane proteins BxlF and BxlG, constitutes a xylanolytic system that participates in the intracellular transport of xylan-degradation products and the production of xylose. To elucidate the mechanism of the hydrolytic degradation of xylooligosaccharides to xylose at the atomic level, X-ray structural analysis of BxlA was attempted. The recombinant BxlA protein (molecular weight 82 kDa) was crystallized by the hanging-drop vapour-diffusion method at 289 K. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 142.2, b = 129.5, c = 101.4 A, beta = 119.8 degrees , and contained two molecules per asymmetric unit (V(M) = 2.47 A(3) Da(-1)). Diffraction data were collected to a resolution to 2.50 A and provided a data set with an overall R(merge) of 8.3%.

Crystallization and preliminary X-ray crystallographic analysis of the GluR0 ligand-binding core from Nostoc punctiforme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan

2005-11-01

The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less

Purification, identification and preliminary crystallographic studies of a 2S albumin seed protein from Lens culinaris

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gupta, Pankaj; Gaur, Vineet; Salunke, Dinakar M., E-mail: dinakar@nii.res.in

2008-08-01

A 2S albumin from L. culinaris was purified and crystallized and preliminary crystallographic studies were carried out. Lens culinaris (lentil) is a widely consumed high-protein-content leguminous crop. A 2S albumin protein (26.5 kDa) has been identified using NH{sub 2}-terminal sequencing from a 90% ammonium sulfate saturation fraction of total L. culinaris seed protein extract. The NH{sub 2}-terminal sequence shows very high homology to PA2, an allergy-related protein from Pisum sativum. The 2S albumin protein was purified using a combination of size-exclusion and ion-exchange chromatography. Crystals of the 2S seed albumin obtained using the hanging-drop vapour-diffusion method diffracted to 2.5 Åmore » resolution and were indexed in space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 78.6, c = 135.2 Å.« less

Cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from Thalictrum flavum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pasquo, Alessandra; Bonamore, Alessandra; Franceschini, Stefano

The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction.« less

From screen to structure with a harvestable microfluidic device.

PubMed

Stojanoff, Vivian; Jakoncic, Jean; Oren, Deena A; Nagarajan, V; Poulsen, Jens-Christian Navarro; Adams-Cioaba, Melanie A; Bergfors, Terese; Sommer, Morten O A

2011-08-01

Advances in automation have facilitated the widespread adoption of high-throughput vapour-diffusion methods for initial crystallization screening. However, for many proteins, screening thousands of crystallization conditions fails to yield crystals of sufficient quality for structural characterization. Here, the rates of crystal identification for thaumatin, catalase and myoglobin using microfluidic Crystal Former devices and sitting-drop vapour-diffusion plates are compared. It is shown that the Crystal Former results in a greater number of identified initial crystallization conditions compared with vapour diffusion. Furthermore, crystals of thaumatin and lysozyme obtained in the Crystal Former were used directly for structure determination both in situ and upon harvesting and cryocooling. On the basis of these results, a crystallization strategy is proposed that uses multiple methods with distinct kinetic trajectories through the protein phase diagram to increase the output of crystallization pipelines.

A comparison between protein crystals grown with vapor diffusion methods in microgravity and protein crystals using a gel liquid-liquid diffusion ground-based method

NASA Technical Reports Server (NTRS)

Miller, Teresa Y.; He, Xiao-Min; Carter, Daniel C.

1992-01-01

Crystals of human serum albumin have been successfully grown in a variety of gels using crystallization conditions otherwise equivalent to those utilized in the popular hanging-drop vapor-equilibrium method. Preliminary comparisons of gel grown crystals with crystals grown by the vapor diffusion method via both ground-based and microgravity methods indicate that crystals superior in size and quality may be grown by limiting solutal convection. Preliminary X-ray diffraction statistics are presented.

Crystallization and preliminary crystallographic analysis of porcine acylaminoacyl peptidase.

PubMed

Wright, Helena; Kiss, András L; Szeltner, Zoltán; Polgár, László; Fülöp, Vilmos

2005-10-01

Acylaminoacyl peptidase (also known as acylamino-acid-releasing enzyme or acylpeptide hydrolase; EC 3.4.19.1) is an unusual member of the prolyl oligopeptidase family catalysing the hydrolysis of an N-acylated peptide to an acylamino acid and a peptide with a free N-terminus. Acylaminoacyl peptidase purified from porcine liver has been crystallized in mother liquor containing 0.1 M Tris-HCl pH 7.0, 10%(w/v) polyethylene glycol 8000, 50 mM MgCl2 and 1%(w/v) CHAPS using the hanging-drop vapour-diffusion technique. A full data set to 3.4 A resolution was collected at ESRF beamline ID14-4 and space group C222 was assigned, with unit-cell parameters a = 84.8, b = 421.1, c = 212.0 A and four molecules in the asymmetric unit.

A Fiber Optic Probe for Monitoring Protein Aggregation, Nucleation, and Crystallization

NASA Technical Reports Server (NTRS)

Ansari, Rafat R.; Suh, Kwang I.; Arabshahi, Alireza; Wilson, William W.; Bray, Terry L.; DeLucas, Lawrence J.

1996-01-01

Protein crystals are experimentally grown in hanging drops in microgravity experiments on-board the Space Shuttle orbiter. The technique of dynamic light scattering (DLS) can be used to monitor crystal growth process in hanging droplets (approx. 30 (L)) in microgravity experiments, but elaborate instrumentation and optical alignment problems have made in-situ applications difficult. In this paper we demonstrate that such experiments are now feasible. We apply a newly developed fiber optic probe to various earth and space (micro- gravity) bound protein crystallization system configurations to test its capability. These include conventional batch (cuvette or capillary) systems, hanging drop method in a six-pack hanging drop vapor diffusion apparatus (HDVDA), a modified HDVDA for temperature- induced nucleation and aggregation studies, and a newly envisioned dynamically controlled vapor diffusion system (DCVDS) configuration. Our compact system exploits the principles of DLS and offers a fast (within a few seconds) means of quantitatively and non-invasively monitoring the various growth stages of protein crystallization. In addition to DLS capability, the probe can also be used for performing single-angle static light scattering measurements. It utilizes extremely low levels of laser power (approx. few (W)) without a need of having any optical alignment and vibration isolation. The compact probe is also equipped with a miniaturized microscope for visualization of macroscopic protein crystals. This new optical diagnostic system opens up enormous opportunity for exploring new ways to grow good quality crystals suitable for x-ray crystallographic analysis and may help develop a concrete scientific basis for understanding the process of crystallization.

Laser scattering in a hanging drop vapor diffusion apparatus for protein crystal growth in a microgravity environment

NASA Technical Reports Server (NTRS)

Casay, G. A.; Wilson, W. W.

1992-01-01

One type of hardware used to grow protein crystals in the microgravity environment aboard the U.S. Space Shuttle is a hanging drop vapor diffusion apparatus (HDVDA). In order to optimize crystal growth conditions, dynamic control of the HDVDA is desirable. A critical component in the dynamically controlled system is a detector for protein nucleation. We have constructed a laser scattering detector for the HDVDA capable of detecting the nucleation stage. The detector was successfully tested for several scatterers differing in size using dynamic light scattering techniques. In addition, the ability to detect protein nucleation using the HDVDA was demonstrated for lysozyme.

Crystallization and preliminary X-ray diffraction study of thermostable RNase HIII from Bacillus stearothermophilus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chon, Hyongi; Matsumura, Hiroyoshi; Koga, Yuichi

2005-03-01

A thermostable ribonuclease HIII from B. stearothermophilus (Bst RNase HIII) was crystallized and preliminary crystallographic studies were performed. Plate-like overlapping polycrystals were grown by the sitting-drop vapour-diffusion method at 283 K.

Purification, crystallization and preliminary crystallographic studies of haemoglobin from mongoose (Helogale parvula) in two different crystal forms induced by pH variation

PubMed Central

Mohamed Abubakkar, M.; Saraboji, K.; Ponnuswamy, M. N.

2013-01-01

Haemoglobin (Hb) is a respiratory pigment; it is a tetrameric protein that ferries oxygen from the lungs to tissues and transports carbon dioxide on the return journey. The oxygen affinity of haemoglobin is regulated by the concentration of oxygen surrounding it and several efforts have revealed the shapes of Hb in different states and with different functions. However, study of the molecular basis of Hbs from low-oxygen-affinity species is critically needed in order to increase the understanding of the mechanism behind oxygen adaptation. The present study reports the preliminary crystallographic study of low-oxygen-affinity haemoglobin from mongoose, a burrowing mammal. Haemoglobin from mongoose was purified by anion-exchange chromatography, crystallized using the hanging-drop vapour-diffusion method and diffraction data sets were collected from monoclinic (2.3 Å resolution) and orthorhombic (2.9 Å resolution) crystal forms obtained by pH variation. The monoclinic and orthorhombic asymmetric units contained half and a whole biological molecule, respectively. PMID:23385751

Crystallization and preliminary X-ray diffraction analysis of mouse 3(17)α-hydroxysteroid dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

El-Kabbani, Ossama, E-mail: ossama.el-kabbani@vcp.monash.edu.au; Ishikura, Syuhei; Wagner, Armin

2005-07-01

Orthorhombic crystals of mouse 3(17)α-hydroxysteroid dehydrogenase were obtained from buffered polyethylene glycol solutions. The crystals diffracted to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA. The 3(17)α-hydroxysteroid dehydrogenase from mouse is involved in the metabolism of oestrogens, androgens, neurosteroids and xenobiotic compounds. The enzyme was crystallized by the hanging-drop vapour-diffusion method in space group P222{sub 1}, with unit-cell parameters a = 84.91, b = 84.90, c = 95.83 Å. The Matthews coefficient (V{sub M}) and the solvent content were 2.21 Å{sup 3} Da{sup −1} and 44.6%, respectively, assuming the presence of two molecules in the asymmetricmore » unit. Diffraction data were collected to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA using a MAR CCD area detector and gave a data set with an overall R{sub merge} of 6.8% and a completeness of 91.1%.« less

Purification, crystallization and preliminary X-ray analysis of native and selenomethionine class I tagatose-1,6-bisphosphate aldolase from Streptococcus pyogenes.

PubMed

Liotard, Brigitte; Sygusch, Jurgen

2004-03-01

Tagatose-1,6-bisphosphate aldolase (EC 4.1.2.40) is situated at the branching of the tagatose-6-phosphate and Embden-Meyerhof-Parnas (glycolysis) metabolic pathways, where it catalyzes the reversible cleavage of tagatose-1,6-bisphosphate to dihydroxyacetone phosphate and glyceraldehyde 3-phosphate. The recombinant protein from Streptococcus pyogenes was overexpressed in Escherichia coli in its native and selenomethionine-derivative forms and purified using ion-exchange and hydrophobic interaction chromatography. Orthorhombic crystals suitable for structural analysis were obtained by the hanging-drop vapour-diffusion method for both isoforms. The crystals belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 63.7, b = 108.1, c = 238.7 A for the native form and a = 64.1, b = 108.3, c = 239.8 A for the selenomethionine derivative. The asymmetric unit contains four protomers, corresponding to a crystal volume per protein weight (V(M)) of 2.8 A(3) Da(-1) and a solvent content of 56% by volume.

Purification, partial characterization, crystallization and preliminary X-ray diffraction of a novel cardiotoxin-like basic protein from Naja naja atra (South Anhui) venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rong, Hui; Li, Yan; Lou, Xiao-hua

2007-02-01

A novel cardiotoxin-like basic protein from Naja naja atra was crystallized and diffraction data were collected to 2.35 Å resolution. A novel cardiotoxin-like basic protein was isolated from the venom of the Chinese cobra (Naja naja atra) from the south of Anhui in China. The protein inhibits the expression of vascular endothelial growth factor and basic fibroblast growth factor in human lung cancer cell line H1299 and induces the haemolysis of rabbit erythrocytes under low-lecithin conditions. After a two-step chromatographic purification, the resultant 7 kDa protein was crystallized by the hanging-drop vapour-diffusion method at room temperature. A complete data setmore » was collected to 2.35 Å resolution using an in-house X-ray diffraction system. The crystal belongs to space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 43.2, c = 147.9 Å. There are two molecules in the crystallographic asymmetric unit.« less

Crystallization and preliminary X-ray crystallographic analysis of a carbonyl reductase from Candida parapsilosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Rongzhen; Xu, Yan, E-mail: biosean@yahoo.com.cn; Sun, Ying

2008-04-01

A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. Two distinct but related crystal forms of SCR were obtained using the hanging-drop vapour-diffusion method and a reservoir solution consisting of 18%(w/v) polyethylene glycol 2000 monomethyl ether and 8%(v/v) 2-propanol as the precipitant. The crystals were rhomboid in shape with average dimensions of 0.3 × 0.3 × 0.4 mm and diffracted to a resolution of 2.7–3.0 Å. The crystal forms both belong to space group P2{sub 1}2{sub 1}2{sub 1} and have unit-cell parameters a = 104.7, b = 142.8, cmore » = 151.8 Å and a = 101.1, b = 146.0, c = 159.8 Å. The calculated values of V{sub M}, rotation-function and translation-function solutions and consideration of potential crystal packing suggest that there are eight protein subunits per asymmetric unit.« less

Purification, crystallization and preliminary X-ray crystallographic analysis of a cysteine-rich secretory protein (CRISP) from Naja atra venom.

PubMed

Wang, Yu-Ling; Goh, King-Xiang; Wu, Wen-guey; Chen, Chun-Jung

2004-10-01

Cysteine-rich secretory proteins (CRISPs) play an important role in the innate immune system and are transcriptionally regulated by androgens in several tissues. The proteins are mostly found in the epididymis and granules of mammals, whilst a number of snake venoms also contain CRISP-family proteins. The natrin protein from the venom of Naja atra (Taiwan cobra), which belongs to a family of CRISPs and has a cysteine-rich C-terminal amino-acid sequence, has been purified using a three-stage chromatography procedure and crystals suitable for X-ray analysis have been obtained using the hanging-drop vapour-diffusion method. X-ray diffraction data were collected to 1.58 A resolution using synchrotron radiation; the crystals belong to space group C222(1), with unit-cell parameters a = 59.172, b = 65.038, c = 243.156 A. There are two protein molecules in the asymmetric unit and the Matthews coefficient is estimated to be 2.35 A3 Da(-1), corresponding to a solvent content of 47.60%.

Crystallization and preliminary X-ray analysis of pyruvate kinase from Bacillus stearothermophilus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suzuki, Kenichiro; Ito, Sohei; Shimizu-Ibuka, Akiko

2005-08-01

This report describes the crystallization and X-ray diffraction data collection of three types (wild-type, W416F/V435W and C9S/C268S) of B. stearothermophilus. Crystals of C9S/C268S belonged to space group P6{sub 2}22 and diffracted to a resolution of 2.4 Å. Pyruvate kinase (PK) from a moderate thermophile, Bacillus stearothermophilus (BstPK), is an allosteric enzyme activated by AMP and ribose 5-phosphate but not by fructose 1,6-bisphosphate (FBP). However, almost all other PKs are activated by FBP. The wild-type and W416F/V435W mutant BstPKs were crystallized by the hanging-drop vapour-diffusion method. However, they were unsuitable for structural analysis because their data sets exhibited low completeness. Amore » crystal suitable for structural analysis was obtained using C9S/C268S enzyme. The crystal belonged to space group P6{sub 2}22, with unit-cell parameters a = b = 145.97, c = 118.03 Å.« less

Expression, purification and preliminary X-ray characterization of dl-2-haloacid dehalogenase from Methylobacterium sp. CPA1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Omi, Rie; Department of Chemistry, Graduate School of Science, Osaka City University, Sumiyoshi-ku, Osaka 558-8585; Jitsumori, Keiji

A recombinant form of dl-2-haloacid dehalogenase from Methylobacterium sp. CPA1 has been expressed in E. coli, purified and crystallized. The crystal belongs to space group P6{sub 3}. Diffraction data have been collected to 1.75 Å resolution. dl-2-Haloacid dehalogenase from Methylobacterium sp. CPA1 (dl-DEX Mb) is a unique enzyme that catalyzes the dehalogenation reaction without the formation of an ester intermediate. A recombinant form of dl-DEX Mb has been expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the hexagonal space group P6{sub 3}, with unit-cell parameters a = b = 186.2, c =more » 114.4 Å. The crystals are likely to contain between four and eight monomers in the asymmetric unit, with a V{sub M} value of 4.20–2.10 Å{sup 3} Da{sup −1}. A self-rotation function revealed peaks on the χ = 180° section. X-ray data have been collected to 1.75 Å resolution.« less

Crystallization and preliminary X-ray analysis of a protease inhibitor from the latex of Carica papaya

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azarkan, Mohamed; Garcia-Pino, Abel; Dibiani, Rachid

2006-12-01

The Kunitz-type trypsin/chymotrypsin inhibitor isolated from C. papaya latex has been crystallized using the hanging-drop vapour-diffusion method. Two different crystal forms are observed, diffracting to 2.6 and 1.7 Å. A Kunitz-type protease inhibitor purified from the latex of green papaya (Carica papaya) fruits was crystallized in the presence and absence of divalent metal ions. Crystal form I, which is devoid of divalent cations, diffracts to a resolution of 2.6 Å and belongs to space group P3{sub 1} or P3{sub 2}. This crystal form is a merohedral twin with two molecules in the asymmetric unit and unit-cell parameters a = bmore » = 74.70, c = 78.97 Å. Crystal form II, which was grown in the presence of Co{sup 2+}, diffracts to a resolution of 1.7 Å and belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 44.26, b = 81.99, c = 140.89 Å.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Che-Yen; Karolinska Institute Structural Virology, F68 Karolinska University Hospital, SE-14186 Stockholm; Institute of Public Health, National Yang-Ming University, 112 Taipei,Taiwan

A recombinant virus-like particle that is a potential oral hepatitis E vaccine was crystallized. Diffraction data were collected to 8.3 Å resolution and the X-ray structure was phased with the aid of a low-resolution density map determined using cryo-electron microscopy data. Hepatitis E virus (HEV) accounts for the majority of enterically transmitted hepatitis infections worldwide. Currently, there is no specific treatment for or vaccine against HEV. The major structural protein is derived from open reading frame (ORF) 2 of the viral genome. A potential oral vaccine is provided by the virus-like particles formed by a protein construct of partial ORF3more » protein (residue 70–123) fused to the N-terminus of the ORF2 protein (residues 112–608). Single crystals obtained by the hanging-drop vapour-diffusion method at 293 K diffract X-rays to 8.3 Å resolution. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 337, b = 343, c = 346 Å, α = β = γ = 90°, and contain one particle per asymmetric unit.« less

Crystallization and preliminary X-ray diffraction analyses of the redox-controlled complex of terminal oxygenase and ferredoxin components in the Rieske nonhaem iron oxygenase carbazole 1,9a-dioxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsuzawa, Jun; Aikawa, Hiroki; Umeda, Takashi

2014-09-25

A crystal was obtained of the complex between reduced terminal oxygenase and oxidized ferredoxin components of carbazole 1,9a-dioxygenase. The crystal belonged to space group P2{sub 1} and diffracted to 2.25 Å resolution. The initial reaction in bacterial carbazole degradation is catalyzed by carbazole 1,9a-dioxygenase, which consists of terminal oxygenase (Oxy), ferredoxin (Fd) and ferredoxin reductase components. The electron-transfer complex between reduced Oxy and oxidized Fd was crystallized at 293 K using the hanging-drop vapour-diffusion method with PEG 3350 as the precipitant under anaerobic conditions. The crystal diffracted to a maximum resolution of 2.25 Å and belonged to space group P2{submore » 1}, with unit-cell parameters a = 97.3, b = 81.6, c = 116.2 Å, α = γ = 90, β = 100.1°. The V{sub M} value is 2.85 Å{sup 3} Da{sup −1}, indicating a solvent content of 56.8%.« less

Expression, purification, crystallization and preliminary X-ray analysis of a C-terminal fragment of the Epstein–Barr virus ZEBRA protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morand, Patrice; Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble; Budayova-Spano, Monika

A C-terminal fragment of the Epstein–Barr virus lytic switch protein ZEBRA has been crystallized in complex with DNA. A C-terminal fragment of the Epstein–Barr virus immediate-early transcription factor ZEBRA has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. The fragment behaves as a dimer in solution, consistent with the presence of a basic region leucine-zipper (bZIP) domain. Crystals of the fragment in complex with a DNA duplex were grown by the hanging-drop vapour-diffusion technique using polyethylene glycol 4000 and magnesium acetate as crystallization agents. Crystals diffract to better than 2.5 Å resolution using synchrotron radiationmore » (λ = 0.976 Å). Crystals belong to space group C2, with unit-cell parameters a = 94.2, b = 26.5, c = 98.1 Å, β = 103.9°.« less

Expression, purification, crystallization and preliminary X-ray analysis of perakine reductase, a new member of the aldo-keto reductase enzyme superfamily from higher plants

PubMed Central

Rosenthal, Cindy; Mueller, Uwe; Panjikar, Santosh; Sun, Lianli; Ruppert, Martin; Zhao, Yu; Stöckigt, Joachim

2006-01-01

Perakine reductase (PR) is a novel member of the aldo-keto reductase enzyme superfamily from higher plants. PR from the plant Rauvolfia serpentina is involved in the biosynthesis of monoterpenoid indole alkaloids by performing NADPH-dependent reduction of perakine, yielding raucaffrinoline. However, PR can also reduce cinnamic aldehyde and some of its derivatives. After heterologous expression of a triple mutant of PR in Escherichia coli, crystals of the purified and methylated enzyme were obtained by the hanging-drop vapour-diffusion technique at 293 K with 100 mM sodium citrate pH 5.6 and 27% PEG 4000 as precipitant. Crystals belong to space group C2221 and diffract to 2.0 Å, with unit-cell parameters a = 58.9, b = 93.0, c = 143.4 Å. PMID:17142919

Cloning, purification, crystallization and preliminary structural studies of penicillin V acylase from Bacillus subtilis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rathinaswamy, Priya; Pundle, Archana V.; Prabhune, Asmita A.

An unannotated protein reported from B. subtilis has been expressed in E. coli and identified as possessing penicillin V acylase activity. The crystallization and preliminary crystallographic analysis of this penicillin V acylase is presented. Penicillin acylase proteins are amidohydrolase enzymes that cleave penicillins at the amide bond connecting the side chain to their β-lactam nucleus. An unannotated protein from Bacillus subtilis has been expressed in Escherichia coli, purified and confirmed to possess penicillin V acylase activity. The protein was crystallized using the hanging-drop vapour-diffusion method from a solution containing 4 M sodium formate in 100 mM Tris–HCl buffer pH 8.2.more » Diffraction data were collected under cryogenic conditions to a spacing of 2.5 Å. The crystals belonged to the orthorhombic space group C222{sub 1}, with unit-cell parameters a = 111.0, b = 308.0, c = 56.0 Å. The estimated Matthews coefficient was 3.23 Å{sup 3} Da{sup −1}, corresponding to 62% solvent content. The structure has been solved using molecular-replacement methods with B. sphaericus penicillin V acylase (PDB code 2pva) as the search model.« less

Efficient biotechnological approach for lentiviral transduction of induced pluripotent stem cells.

PubMed

Zare, Mehrak; Soleimani, Masoud; Mohammadian, Mozhdeh; Akbarzadeh, Abolfazl; Havasi, Parvaneh; Zarghami, Nosratollah

2016-01-01

Induced pluripotent stem (iPS) cells are generated from differentiated adult somatic cells by reprogramming them. Unlimited self-renewal, and the potential to differentiate into any cell type, make iPS cells very promising candidates for basic and clinical research. Furthermore, iPS cells can be genetically manipulated for use as therapeutic tools. DNA can be introduced into iPS cells, using lentiviral vectors, which represent a helpful choice for efficient transduction and stable integration of transgenes. In this study, we compare two methods of lentiviral transduction of iPS cells, namely, the suspension method and the hanging drop method. In contrast to the conventional suspension method, in the hanging drop method, embryoid body (EB) formation and transduction occur concurrently. The iPS cells were cultured to form EBs, and then transduced with lentiviruses, using the conventional suspension method and the hanging drop method, to express miR-128 and green fluorescent protein (GFP). The number of transduced cells were assessed by fluorescent microscopy and flow cytometry. MTT assay and real-time PCR were performed to determine the cell viability and transgene expression, respectively. Morphologically, GFP+ cells were more detectable in the hanging drop method, and this finding was quantified by flow cytometric analysis. According to the results of the MTT assay, cell viability was considerably higher in the hanging drop method, and real-time PCR represented a higher relative expression of miR-128 in the iPS cells introduced with lentiviruses in drops. Altogether, it seems that lentiviral transduction of challenging iPS cells using the hanging drop method offers a suitable and sufficient strategy in their gene transfer, with less toxicity than the conventional suspension method.

Crystallization and X-ray analysis of the salmon-egg lectin SEL24K

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murata, Kenji; Fisher, Andrew J.; Hedrick, Jerry L., E-mail: jlhedrick@ucdavis.edu

2007-05-01

The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 Å resolution. The crystal belongsmore » to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 Å, α = 90, β = 92.82, γ = 90°. The crystal is likely to contain eight molecules in the asymmetric unit (V{sub M} = 2.3 Å{sup 3} Da{sup −1}), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.« less

Analysis of models for two solution crystal growth problems

NASA Technical Reports Server (NTRS)

Fehribach, Joseph D.; Rosenberger, Franz

1989-01-01

Two diffusive solution crystal growth models are considered which are characterized by two phases separated by an interface, a lack of convective mixing in either phase, and the presence of diffusion components differing widely in diffusivity. The first model describes precipitant-driven solution crystal growth and the second model describes a hanging drop evaporation problem. It is shown that for certain proteins sharp concentration gradients may develop in the drop during evaporation, while under the same conditions the concentrations of other proteins remain uniform.

Purification, crystallization and preliminary crystallographic study of haemoglobin from camel (Camelus dromedarius): a high oxygen-affinity lowland species.

PubMed

Balasubramanian, M; Moorthy, Pon Sathya; Neelagandan, K; Ponnuswamy, M N

2009-08-01

Haemoglobin is a prototypical allosteric protein that is mainly involved in the transportation of oxygen from the lungs to tissues and of carbon dioxide back to the lungs in an intrinsically coordinated manner to maintain the viability of cells. Haemoglobin from Camelus dromedarius provides an interesting case study of adaptation to life in deserts at extremely high temperatures. An ambition to unravel the integrated structural and functional aspects of the casual survival of this animal at high temperatures led us to specifically work on this problem. The present work reports the preliminary crystallographic study of camel haemoglobin. Camel blood was collected and the haemoglobin was purified by anion-exchange chromatography and crystallized using the hanging-drop vapour-diffusion method under buffered high salt concentration using PEG 3350 as a precipitant. Intensity data were collected using a MAR 345 dtb image-plate detector system. Camel haemoglobin crystallized in the monoclinic space group P2(1), with one whole biological molecule (alpha(2)beta(2)) in the asymmetric unit and unit-cell parameters a = 52.759, b = 116.782, c = 52.807 A, beta = 120.07 degrees .

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Dongwen; Sun, Jianping; Zhao, Wei

The CRD domain of GRP from H. sapiens has been expressed, purified and crystallized and X-ray diffraction data have been collected to a resolution of 2.0 Å. Galectins are a family of animal lectins which share similar carbohydrate-recognition domains (CRDs) and an affinity for β-galactosides. A novel human galectin-related protein named GRP (galectin-related protein; previously known as HSPC159) comprises only one conserved CRD with 38 additional N-terminal residues. The C-terminal fragment of human GRP (GRP-C; residues 38–172) containing the CRD has been expressed and purified. The protein was crystallized using the hanging-drop vapour-diffusion method from a solution containing 2% PEGmore » 400 and 2M ammonium sulfate in 100 mM Tris–HCl buffer pH 7.5. Diffraction data were collected to a resolution limit of 2.0 Å at beamline 3W1A of Beijing Synchrotron Radiation Facility at 100 K. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 123.07, b = 96.67, c = 61.56 Å, β = 118.72°. The estimated Matthews coefficient was 2.6 Å{sup 3} Da{sup −1}, corresponding to 51.8% solvent content.« less

Crystallization and preliminary X-ray diffraction analysis of hemextin A: a unique anticoagulant protein from Hemachatus haemachatus venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Yajnavalka; Kumar, Sundramurthy; Jobichen, Chacko

2007-08-01

Crystals of hemextin A, a three-finger toxin isolated and purified from African Ringhals cobra (H. haemachatus), are orthorhombic, space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å, and diffract to 1.5 Å resolution. Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapour-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1more » M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å and two molecules in the asymmetric unit. They diffracted to 1.5 Å resolution at beamline X25 at BNL.« less

Purification, crystallization and preliminary X-ray analysis of a thermostable glycoside hydrolase family 43 β-xylosidase from Geobacillus thermoleovorans IT-08

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rohman, Ali; Oosterwijk, Niels van; Kralj, Slavko

2007-11-01

The β-xylosidase was crystallized using PEG 6000 as precipitant. 5% PEG 6000 yielded bipyramid-shaped tetragonal crystals diffracting to 1.55 Å resolution, and 13% PEG 6000 gave rectangular monoclinic crystals diffracting to 1.80 Å resolution. The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-β-xylanase and β-xylosidase. β-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-β-xylanase into xylose monomers. The β-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = bmore » = 62.53, c = 277.4 Å diffracted to 1.55 Å resolution. The rectangular crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 57.94, b = 142.1, c = 153.9 Å, β = 90.5°, and diffracted to 1.80 Å resolution.« less

Crystallization and preliminary crystallographic analysis of l-asparaginase from Erwinia carotovora

PubMed Central

Wikman, Linnea E. K.; Krasotkina, Julya; Kuchumova, Anastasia; Sokolov, Nikolay N.; Papageorgiou, Anastassios C.

2005-01-01

Bacterial l-asparaginases have been used as therapeutic agents in the treatment of acute childhood lymphoblastic leukaemia for over 30 y. However, their use is limited owing to the glutaminase activity of the administered enzymes, which results in serious side effects. In contrast, l-asparaginase from Erwinia carotovora exhibits low glutaminase activity at physiological concentrations of l-asparagine and l-glutamine in the blood. Recombinant Er. carotovora l-­asparaginase was crystallized in the presence of l-glutamate by the hanging-drop vapour-diffusion method using 10 mg ml−1 purified enzyme, 16–18%(w/v) PEG 3350 and 0.2 M NaF. X-ray diffraction data were collected to 2.6 Å at 293 K using an in-house rotating-anode generator. The crystals belong to the monoclinic P21 space group, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. A molecular-replacement solution has been found and refinement is currently in progress. The crystal structure may provide leads towards protein-engineering efforts aimed at safer asparaginase administration in leukaemia treatment. PMID:16511054

Trypanothione reductase from Leishmania infantum: cloning, expression, purification, crystallization and preliminary X-ray data analysis.

PubMed

Baiocco, Paola; Franceschini, Stefano; Ilari, Andrea; Colotti, Gianni

2009-01-01

The most promising targets for Leishmania-specific drug design are two key enzymes involved in the unique thiol-based metabolism, common to all parasites of the Trypanosomatidae family: trypanothione synthetase (TryS) and trypanothione reductase (TR). Recently, new inhibitors of TR have been identified such as polyamines and tricyclic compounds. The knowledge of the three-dimensional structure of Leishmania TR will shed light on the mechanism of interaction of these inhibitors with TR and will be the starting point to design novel lead candidates to facilitate the development of new effective and affordable drugs. Trypanothione reductase from Leishmania infantum has been cloned, expressed in E. coli and purified. Crystals were obtained at 294 K by the hanging drop vapour diffusion method using ammonium sulfate as precipitant agent and diffract to better than 2.95 A resolution using a synchrotron radiation source. The crystals exhibit an unusually high solvent content of 74 %, belong to the tetragonal space group P41 with units cell parameters a=b=103.45 A, c=192.62 A and two molecules in the asymmetric unit. The protein X-ray structure has been solved by Molecular Replacement and the model is under construction.

Improved expression, purification and crystallization of a putative N-acetyl-γ-glutamyl-phosphate reductase from rice (Oryza sativa)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miura-Ohnuma, Jun; Nonaka, Tsuyoshi; Katoh, Shizue

2005-12-01

Crystals of OsAGPR were obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å. N-Acetyl-γ-glutamyl-phosphate reductase (AGPR) catalyzes the third step in an eight-step arginine-biosynthetic pathway that starts with glutamate. This enzyme converts N-acetyl-γ-glutamyl phosphate to N-acetylglutamate-γ-semialdehyde by an NADPH-dependent reductive dephosphorylation. AGPR from Oryza sativa (OsAGPR) was expressed in Escherichia coli at 291 K as a soluble fusion protein with an upstream thioredoxin-hexahistidine [Trx-(His){sub 6}] extension. OsAGPR(Ala50–Pro366) was purified and crystals weremore » obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å.« less

Cloning, purification, crystallization and preliminary X-ray studies of a carbohydrate-binding module from family 64 (StX).

PubMed

Campos, Bruna Medeia; Liberato, Marcelo Vizona; Polikarpov, Igor; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio

2015-03-01

In recent years, biofuels have attracted great interest as a source of renewable energy owing to the growing global demand for energy, the dependence on fossil fuels, limited natural resources and environmental pollution. However, the cost-effective production of biofuels from plant biomass is still a challenge. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases to polysaccharides, is crucial for enzyme development. Aiming at the structural and functional characterization of novel CBMs involved in plant polysaccharide deconstruction, an analysis of the CAZy database was performed and CBM family 64 was chosen owing to its capacity to bind with high specificity to microcrystalline cellulose and to the fact that is found in thermophilic microorganisms. In this communication, the CBM-encoding module named StX was expressed, purified and crystallized, and X-ray diffraction data were collected from native and derivatized crystals to 1.8 and 2.0 Å resolution, respectively. The crystals, which were obtained by the hanging-drop vapour-diffusion method, belonged to space group P3121, with unit-cell parameters a = b = 43.42, c = 100.96 Å for the native form. The phases were found using the single-wavelength anomalous diffraction method.

Purification, crystallization and preliminary crystallographic study of an IDS-epimerase from Agrobacterium tumefaciens BY6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bäuerle, Bettina; Sandalova, Tatyana; Schneider, Gunter

2006-08-01

This is the first report of the crystallization of an IDS-epimerase from A. tumefaciens BY6 and its l-selenomethionine derivative. The initial degradation of all stereoisomers of the complexing agent iminodisuccinate (IDS) is enabled by an epimerase in the bacterial strain Agrobacterium tumefaciens BY6. This protein was produced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method. Crystals of IDS-epimerase were obtained under several conditions. The best diffracting crystals were grown in 22% PEG 3350, 0.2 M (NH{sub 4}){sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 7.2 at 293 K. These crystals belong to the monoclinic space groupmore » P2{sub 1}, with unit-cell parameters a = 55.4, b = 104.2, c = 78.6 Å, β = 103.3°, and diffracted to 1.7 Å resolution. They contain two protein molecules per asymmetric unit. In order to solve the structure using the MAD phasing method, crystals of the l-selenomethionine-substituted epimerase were grown in the presence of 20% PEG 3350, 0.2 M Na{sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 8.5.« less

Crystallization and preliminary crystallographic analysis of porcine acylaminoacyl peptidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wright, Helena; Kiss, András L.; Szeltner, Zoltán

2005-10-01

Acylaminoacyl peptidase from porcine liver has been crystallized. Data were collected to 3.4 Å from native crystals and a search for heavy-atom derivatives is in progress. Acylaminoacyl peptidase (also known as acylamino-acid-releasing enzyme or acylpeptide hydrolase; EC 3.4.19.1) is an unusual member of the prolyl oligopeptidase family catalysing the hydrolysis of an N-acylated peptide to an acylamino acid and a peptide with a free N-terminus. Acylaminoacyl peptidase purified from porcine liver has been crystallized in mother liquor containing 0.1 M Tris–HCl pH 7.0, 10%(w/v) polyethylene glycol 8000, 50 mM MgCl{sub 2} and 1%(w/v) CHAPS using the hanging-drop vapour-diffusion technique. Amore » full data set to 3.4 Å resolution was collected at ESRF beamline ID14-4 and space group C222 was assigned, with unit-cell parameters a = 84.8, b = 421.1, c = 212.0 Å and four molecules in the asymmetric unit.« less

Crystallization, X-ray diffraction analysis and preliminary structure determination of the polygalacturonase PehA from Agrobacterium vitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vordtriede, Paul B.; Yoder, Marilyn D., E-mail: yoderm@umkc.edu

2008-07-01

The acidic polygalacturonase PehA from A. vitis has been crystallized. A molecular-replacement solution indicated a right-handed parallel β-helix fold. Polygalacturonases are pectate-degrading enzymes that belong to glycoside hydrolase family 28 and hydrolyze the α-1,4 glycosidic bond between neighboring galacturonasyl residues of the homogalacturonan substrate. The acidic polygalacturonase PehA from Agrobacterium vitis was overexpressed in Escherichia coli, where it accumulated in the periplasmic fraction. It was purified to homogeneity via a two-step chromatography procedure and crystallized using the hanging-drop vapour-diffusion technique. PehA crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 52.387, b = 62.738, c = 149.165more » Å, β = 89.98°. Crystals diffracted to 1.59 Å resolution and contained two molecules per asymmetric unit. An initial structure determination by molecular replacement indicated a right-handed parallel β-helix fold.« less

Crystallization and preliminary X-ray diffraction analysis of FabG from Yersinia pestis.

PubMed

Nanson, Jeffrey David; Forwood, Jade Kenneth

2014-01-01

The type II fatty-acid biosynthesis pathway of bacteria provides enormous potential for antibacterial drug development owing to the structural differences between this and the type I fatty-acid biosynthesis system found in mammals. β-Ketoacyl-ACP reductase (FabG) is responsible for the reduction of the β-ketoacyl group linked to acyl carrier protein (ACP), and is essential for the formation of fatty acids and bacterial survival. Here, the cloning, expression, purification, crystallization and diffraction of FabG from Yersinia pestis (ypFabG), the highly virulent causative agent of plague, are reported. Recombinant FabG was expressed, purified to homogeneity and crystallized via the hanging-drop vapour-diffusion technique. Diffraction data were collected at the Australian Synchrotron to 2.30 Å resolution. The crystal displayed P2(1)2(1)2(1) symmetry, with unit-cell parameters a = 68.22, b = 98.68, c = 169.84 Å, and four ypFabG molecules in the asymmetric unit.

Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir

The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02more » Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry.« less

In vitro differentiation of mouse embryonic stem (mES) cells using the hanging drop method.

PubMed

Wang, Xiang; Yang, Phillip

2008-07-23

Stem cells have the remarkable potential to develop into many different cell types. When a stem cell divides, each new cell has the potential to either remain a stem cell or become another type of cell with a more specialized function, This promising of science is leading scientists to investigate the possibility of cell-based therapies to treat disease. When culture in suspension without antidifferentiation factors, embryonic stem cells spontaneously differentiate and form three-dimensional multicellular aggregates. These cell aggregates are called embryoid bodies(EB). Hanging drop culture is a widely used EB formation induction method. The rounded bottom of hanging drop allows the aggregation of ES cells which can provide mES cells a good environment for forming EBs. The number of ES cells aggregatied in a hanging drop can be controlled by varying the number of cells in the initial cell suspension to be hung as a drop from the lid of Petri dish. Using this method we can reproducibly form homogeneous EBs from a predetermined number of ES cells.

384 hanging drop arrays give excellent Z-factors and allow versatile formation of co-culture spheroids.

PubMed

Hsiao, Amy Y; Tung, Yi-Chung; Qu, Xianggui; Patel, Lalit R; Pienta, Kenneth J; Takayama, Shuichi

2012-05-01

We previously reported the development of a simple, user-friendly, and versatile 384 hanging drop array plate for 3D spheroid culture and the importance of utilizing 3D cellular models in anti-cancer drug sensitivity testing. The 384 hanging drop array plate allows for high-throughput capabilities and offers significant improvements over existing 3D spheroid culture methods. To allow for practical 3D cell-based high-throughput screening and enable broader use of the plate, we characterize the robustness of the 384 hanging drop array plate in terms of assay performance and demonstrate the versatility of the plate. We find that the 384 hanging drop array plate performance is robust in fluorescence- and colorimetric-based assays through Z-factor calculations. Finally, we demonstrate different plate capabilities and applications, including: spheroid transfer and retrieval for Janus spheroid formation, sequential addition of cells for concentric layer patterning of different cell types, and culture of a wide variety of cell types. Copyright © 2011 Wiley Periodicals, Inc.

384 Hanging Drop Arrays Give Excellent Z-factors and Allow Versatile Formation of Co-culture Spheroids

PubMed Central

Hsiao, Amy Y.; Tung, Yi-Chung; Qu, Xianggui; Patel, Lalit R.; Pienta, Kenneth J.; Takayama, Shuichi

2012-01-01

We previously reported the development of a simple, user-friendly, and versatile 384 hanging drop array plate for 3D spheroid culture and the importance of utilizing 3D cellular models in anti-cancer drug sensitivity testing. The 384 hanging drop array plate allows for high-throughput capabilities and offers significant improvements over existing 3D spheroid culture methods. To allow for practical 3D cell-based high-throughput screening and enable broader use of the plate, we characterize the robustness of the 384 hanging drop array plate in terms of assay performance and demonstrate the versatility of the plate. We find that the 384 hanging drop array plate performance is robust in fluorescence- and colorimetric-based assays through z-factor calculations. Finally, we demonstrate different plate capabilities and applications, including: spheroid transfer and retrieval for Janus spheroid formation, sequential addition of cells for concentric layer patterning of different cell types, and culture of a wide variety of cell types. PMID:22161651

Overexpression, purification, crystallization and preliminary structural studies of p-coumaric acid decarboxylase from Lactobacillus plantarum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rodríguez, Héctor; Rivas, Blanca de las; Muñoz, Rosario

2007-04-01

The enzyme p-coumaric acid decarboxylase (PDC) from L. plantarum has been recombinantly expressed, purified and crystallized. The structure has been solved at 2.04 Å resolution by the molecular-replacement method. The substrate-inducible p-coumaric acid decarboxylase (PDC) from Lactobacillus plantarum has been overexpressed in Escherichia coli, purified and confirmed to possess decarboxylase activity. The recombinant His{sub 6}-tagged enzyme was crystallized using the hanging-drop vapour-diffusion method from a solution containing 20%(w/v) PEG 4000, 12%(w/v) 2-propanol, 0.2 M sodium acetate, 0.1 M Tris–HCl pH 8.0 with 0.1 M barium chloride as an additive. Diffraction data were collected in-house to 2.04 Å resolution. Crystals belongedmore » to the tetragonal space group P4{sub 3}, with unit-cell parameters a = b = 43.15, c = 231.86 Å. The estimated Matthews coefficient was 2.36 Å{sup 3} Da{sup −1}, corresponding to 48% solvent content, which is consistent with the presence of two protein molecules in the asymmetric unit. The structure of PDC has been determined by the molecular-replacement method. Currently, the structure of PDC complexed with substrate analogues is in progress, with the aim of elucidating the structural basis of the catalytic mechanism.« less

Three-dimensional culture of buffalo granulosa cells in hanging drop mimics the preovulatory follicle stage.

PubMed

Yadav, Monica; Agrawal, Himanshu; Pandey, Mamta; Singh, Dheer; Onteru, Suneel K

2018-03-01

Granulosa cell (GC) culture models mimicking the intrafollicular environment are limited. Such models have a great potential in reproductive toxicity studies. The buffalo, a monovulatory species like humans, could be a better model than polyovulatory rodents. Therefore, we targeted the development and characterization of three-dimensional (3D) culture systems for buffalo GCs. The GCs from small ovarian follicles (SF) maintained the CYP19 gene expression for 144 hr in a 2D culture system. Hence, GCs from SF were cultured directly in 3D using hanging drop and Poly-([2-hydroxyethyl methacrylate]) (polyHEMA) methods in the DMEM media containing 1 ng/ml FSH and 10 ng/ml IGF-1 for 144 hr. The expression profile of nine GC-specific transcripts; CYP19, TNFAIP6, AMH, PTI, NR4A1, FSHR, RUNX, LHR, and COX2/PTGS2; revealed that 3D-spheroids developed in hanging drop method maintained the GC phenotype of preovulatory follicles. Therefore, hanging drop method is a best method for culturing GCs to mimic the intrafollicular environment. © 2017 Wiley Periodicals, Inc.

Generation of Homogenous Three-Dimensional Pancreatic Cancer Cell Spheroids Using an Improved Hanging Drop Technique

PubMed Central

Ware, Matthew J.; Colbert, Kevin; Keshishian, Vazrik; Ho, Jason; Corr, Stuart J.; Curley, Steven A.

2016-01-01

In vitro characterization of tumor cell biology or of potential anticancer drugs is usually performed using tumor cell lines cultured as a monolayer. However, it has been previously shown that three-dimensional (3D) organization of the tumor cells is important to provide insights on tumor biology and transport of therapeutics. Several methods to create 3D tumors in vitro have been proposed, with hanging drop technique being the most simple and, thus, most frequently used. However, in many cell lines this method has failed to form the desired 3D tumor structures. The aim of this study was to design and test an easy-to-use and highly reproducible modification of the hanging drop method for tumor sphere formation by adding methylcellulose polymer. Most pancreatic cancer cells do not form cohesive and manageable spheres when the original hanging drop method is used, thus we investigated these cell lines for our modified hanging drop method. The spheroids produced by this improved technique were analyzed by histology, light microscopy, immunohistochemistry, and scanning electron microscopy. Results show that using the proposed simple method; we were able to produce uniform spheroids for all five of the tested human pancreatic cancer cell lines; Panc-1, BxPC-3, Capan-1, MiaPaCa-2, and AsPC-1. We believe that this method can be used as a reliable and reproducible technique to make 3D cancer spheroids for use in tumor biology research and evaluation of therapeutic responses, and for the development of bio-artificial tissues. PMID:26830354

Generation of Homogenous Three-Dimensional Pancreatic Cancer Cell Spheroids Using an Improved Hanging Drop Technique.

PubMed

Ware, Matthew J; Colbert, Kevin; Keshishian, Vazrik; Ho, Jason; Corr, Stuart J; Curley, Steven A; Godin, Biana

2016-04-01

In vitro characterization of tumor cell biology or of potential anticancer drugs is usually performed using tumor cell lines cultured as a monolayer. However, it has been previously shown that three-dimensional (3D) organization of the tumor cells is important to provide insights on tumor biology and transport of therapeutics. Several methods to create 3D tumors in vitro have been proposed, with hanging drop technique being the most simple and, thus, most frequently used. However, in many cell lines this method has failed to form the desired 3D tumor structures. The aim of this study was to design and test an easy-to-use and highly reproducible modification of the hanging drop method for tumor sphere formation by adding methylcellulose polymer. Most pancreatic cancer cells do not form cohesive and manageable spheres when the original hanging drop method is used, thus we investigated these cell lines for our modified hanging drop method. The spheroids produced by this improved technique were analyzed by histology, light microscopy, immunohistochemistry, and scanning electron microscopy. Results show that using the proposed simple method; we were able to produce uniform spheroids for all five of the tested human pancreatic cancer cell lines; Panc-1, BxPC-3, Capan-1, MiaPaCa-2, and AsPC-1. We believe that this method can be used as a reliable and reproducible technique to make 3D cancer spheroids for use in tumor biology research and evaluation of therapeutic responses, and for the development of bio-artificial tissues.

Culturing muscle fibres in hanging drop: a novel approach to solve an old problem.

PubMed

Archacka, Karolina; Pozzobon, Michela; Repele, Andrea; Rossi, Carlo Alberto; Campanella, Michelangelo; De Coppi, Paolo

2014-02-01

The satellite cells (SCs) associated with muscle fibres play a key role in postnatal growth and regeneration of skeletal muscle. Commonly used methods of isolation and in vitro culture of SCs lead to the mixture of their subpopulations that exist within muscle. To solve this problem, we used the well established technique, the hanging drop system, to culture SCs in a three-dimensional environment and thus, to monitor them in their original niche. Using hanging drop technique, we were able to culture SCs associated with the fibre at least for 9 days with one transfer of fibres to the fresh drops. In comparison, in the classical method of myofibres culture, that is, on the dishes coated with Matrigel, SCs leave the fibres within 3 days after the isolation. Cells cultured in both systems differed in expression of Pax7 and MyoD. While almost all cells cultured in adhesion system expressed MyoD before the fifth day of the culture, the majority of SCs cultured in hanging drop still maintained expression of Pax7 and were not characterised by the presence of MyoD. Among the cells cultured with single myofibre for up to 9 days, we identified two different subclones of SCs: low proliferative clone and high proliferative clone, which differed in proliferation rate and membrane potential. The hanging drop enables the myofibres to be kept in suspension for at least 9 days, and thus, allows SCs and their niche to interact each other for prolonged time. In a consequence, SCs cultured in hanging drop maintain expression of Pax7 while those cultured in a traditional adhesion culture, that is, devoid of signals from the original niche, activate and preferentially undergo differentiation as manifested by expression of MyoD. Thus, the innovative method of SCs culturing in the hanging drop system may serve as a useful tool to study the fate of different subpopulations of these cells in their anatomical location and to determine reciprocal interactions between them and their niche. © 2013 Société Française des Microscopies and Société de Biologie Cellulaire de France. Published by John Wiley & Sons Ltd.

Model for determining vapor equilibrium rates in the hanging drop method for protein crystal growth

NASA Technical Reports Server (NTRS)

Baird, James K.; Frieden, Richard W.; Meehan, E. J., Jr.; Twigg, Pamela J.; Howard, Sandra B.; Fowlis, William A.

1987-01-01

An engineering analysis of the rate of evaporation of solvent in the hanging drop method of protein crystal growth is presented. Results are applied to 18 drop and well arrangements commonly encountered in the laboratory. The chemical nature of the salt, drop size and shape, drop concentration, well size, well concentration, and temperature are taken into account. The rate of evaporation increases with temperature, drop size, and the salt concentration difference between the drop and the well. The evaporation in this model possesses no unique half-life. Once the salt in the drop achieves 80 percent of its final concentration, further evaporation suffers from the law of diminishing returns.

Preparation of crystals for characterizing the Grb7 SH2 domain before and after complex formation with a bicyclic peptide antagonist.

PubMed

Ambaye, Nigus D; Gunzburg, Menachem J; Traore, Daouda A K; Del Borgo, Mark P; Perlmutter, Patrick; Wilce, Matthew C J; Wilce, Jacqueline A

2014-02-01

Human growth factor receptor-bound protein 7 (Grb7) is an adapter protein involved in cell growth, migration and proliferation. It is now recognized that Grb7 is an emerging therapeutic target in specific cancer subtypes. Recently, the discovery of a bicyclic peptide inhibitor that targets the Grb7 SH2 domain, named G7-B1, was reported. In an attempt to probe the foundation of its interaction with Grb7, the crystallization and preliminary data collection of both the apo and G7-B1-bound forms of the Grb7 SH2 domain are reported here. Diffraction-quality crystals were obtained using the hanging-drop vapour-diffusion method. After several rounds of microseeding, crystals of the apo Grb7 SH2 domain were obtained that diffracted to 1.8 Å resolution, while those of the G7-B1-Grb7 SH2 domain complex diffracted to 2.2 Å resolution. The apo Grb7 SH2 domain crystallized in the trigonal space group P63, whereas the G7-B1-Grb7 SH2 domain complex crystallized in the monoclinic space group P21. The experimental aspects of crystallization, crystal optimization and data collection and the preliminary data are reported.

Purification, crystallization and preliminary X-ray diffraction studies on avian haemoglobin from pigeon (Columba livia).

PubMed

Sathya Moorthy, Pon; Neelagandan, K; Balasubramanian, M; Ponnuswamy, M N

2009-02-01

Haemoglobin is a physiologically significant metalloprotein that is involved in the exchange of gases for sustaining life. The respiratory system of birds is unique and complex compared with that of mammals. Many investigations of avian haemoglobins have revealed the presence of inositol pentaphosphate (IP5), a principal allosteric effector that is involved in regulation of their function. Structural investigations of avian haemoglobins are presently not adequate to explain their function. Efforts have been made in this direction in order to understand the oxygen-binding affinity involved in adapting to hypoxia in avian haemoglobins. Fresh whole blood was collected from pigeon (Columba livia) and purified using a DEAE cellulose anion-exchange chromatographic column. Crystallization of pigeon haemoglobin was accomplished using the hanging-drop vapour-diffusion method using PEG 3350 as a precipitant in 50 mM sodium acetate buffer pH 5.5 with 1 M NaCl. Data collection was carried out using a MAR345 image-plate detector system. The crystals diffracted to 2 A resolution. Pigeon haemoglobin crystallizes in a triclinic space group, with two whole biological molecules in the asymmetric unit and with unit-cell parameters a = 55.005, b = 65.528, c = 104.370 A, alpha = 78.742, beta = 89.819, gamma = 65.320 degrees .

Crystallization and preliminary X-ray diffraction analysis of the arginine repressor of the hyperthermophile Thermotoga neapolitana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Massant, Jan, E-mail: jan.massant@vub.ac.be; Peeters, Eveline; Charlier, Daniel

2006-01-01

The arginine repressor of the hyperthermophile T. neapolitana was crystallized with and without its corepressor arginine. Both crystals diffracted to high resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with similar unit-cell parameters. The arginine repressor of Thermotoga neapolitana (ArgRTnp) is a member of the family of multifunctional bacterial arginine repressors involved in the regulation of arginine metabolism. This hyperthermophilic repressor shows unique DNA-binding features that distinguish it from its homologues. ArgRTnp exists as a homotrimeric protein that assembles into hexamers at higher protein concentrations and/or in the presence of arginine. ArgRTnp was crystallized with andmore » without its corepressor arginine using the hanging-drop vapour-diffusion method. Crystals of the aporepressor diffracted to a resolution of 2.1 Å and belong to the orthorhombic P2{sub 1}2{sub 1}2{sub 1} space group, with unit-cell parameters a = 117.73, b = 134.15, c = 139.31 Å. Crystals of the repressor in the presence of its corepressor arginine diffracted to a resolution of 2.4 Å and belong to the same space group, with similar unit-cell parameters.« less

Crystallization and preliminary X-ray analysis of binary and ternary complexes of Haloferax mediterranei glucose dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Esclapez, Julia; Britton, K. Linda; Baker, Patrick J.

2005-08-01

Single crystals of binary and ternary complexes of wild-type and D38C mutant H. mediterranei glucose dehydrogenase have been obtained by the hanging-drop vapour-diffusion method. Haloferax mediterranei glucose dehydrogenase (EC 1.1.1.47) belongs to the medium-chain alcohol dehydrogenase superfamily and requires zinc for catalysis. In the majority of these family members, the catalytic zinc is tetrahedrally coordinated by the side chains of a cysteine, a histidine, a cysteine or glutamate and a water molecule. In H. mediterranei glucose dehydrogenase, sequence analysis indicates that the zinc coordination is different, with the invariant cysteine replaced by an aspartate residue. In order to analyse themore » significance of this replacement and to contribute to an understanding of the role of the metal ion in catalysis, a range of binary and ternary complexes of the wild-type and a D38C mutant protein have been crystallized. For most of the complexes, crystals belonging to space group I222 were obtained using sodium/potassium citrate as a precipitant. However, for the binary and non-productive ternary complexes with NADPH/Zn, it was necessary to replace the citrate with 2-methyl-2,4-pentanediol. Despite the radical change in conditions, the crystals thus formed were isomorphous.« less

Crystallization of the receptor-binding domain of parathyroid hormone-related protein in complex with a neutralizing monoclonal antibody Fab fragment

DOE Office of Scientific and Technical Information (OSTI.GOV)

McKinstry, William J.; Polekhina, Galina; Diefenbach-Jagger, Hannelore

Parathyroid hormone-related protein (PTHrP) plays an important role in regulating embryonic skeletal development and is abnormally regulated in the pathogenesis of skeletal complications observed with many cancers and osteoporosis. It exerts its action through binding to a G-protein-coupled seven-transmembrane cell-surface receptor (GPCR). Structurally, GPCRs are very difficult to study by X-ray crystallography. In this study, a monoclonal antibody Fab fragment which recognizes the same region of PTHrP as its receptor, PTH1R, was used to aid in the crystallization of PTHrP. The resultant protein complex was crystallized using the hanging-drop vapour-diffusion method with polyethylene glycol as a precipitant. The crystals belongedmore » to the orthorhombic space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 72.6, b = 96.3, c = 88.5 {angstrom}, and diffracted to 2.0 {angstrom} resolution using synchrotron radiation. The crystal structure will shed light on the nature of the key residues of PTHrP that interact with the antibody and will provide insights into how the antibody is able to discriminate between PTHrP and the related molecule parathyroid homone.« less

A morphological screening of protein crystals for interferon delivery by metal ion-chelate technology.

PubMed

Jiang, Yanbo; Shi, Kai; Wang, Shuo; Li, Xuefeng; Cui, Fude

2010-12-01

This study presents a preliminary exploration on extending the half-life of therapeutic proteins by crystallization strategy without new molecular entities generation. Recombinant human interferon (rhIFN) α-2b, a model protein drug in this case, was crystallized using a hanging-drop vapor diffusion method. A novel chelating technique with metal ions was employed to promote crystals formation. The effects of key factors such as seeding protein concentration, pH of the hanging drop, ionic strength of the equilibration solution, and precipitants were investigated. Size-exclusion liquid chromatography, antiviral activity determination, and enzyme-linked immunosorbent assay indicated that both the molecular integrity and biological potency of rhIFN were not significantly affected by crystallization process. In addition, the in vitro release behavior of rhIFN from crystal lattice was characterized by an initial fast release, followed by a sustained release up to 48 hour. The work described here suggested an exciting possibility of therapeutic protein crystals as a long-acting formulation.

A hanging drop culture method to study terminal erythroid differentiation.

PubMed

Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

2005-10-01

To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

Evaporation kinetics in the hanging drop method of protein crystal growth

NASA Technical Reports Server (NTRS)

Baird, James K.; Frieden, Richard W.; Meehan, E. J., Jr.; Twigg, Pamela J.; Howard, Sandra B.; Fowlis, William A.

1987-01-01

An engineering analysis of the rate of evaporation of solvent in the hanging drop method of protein crystal growth is presented; these results are applied to 18 different drop and well arrangements commonly encountered in the laboratory, taking into account the chemical nature of the salt, the drop size and shape, the drop concentration, the well size, the well concentration, and the temperature. It is found that the rate of evaporation increases with temperature, drop size, and with the salt concentration difference between the drop and the well. The evaporation possesses no unique half-life. Once the salt in the drop achieves about 80 percent of its final concentration, further evaporation suffers from the law of diminishing returns.

Cells on Gels: Cell Behavior at the Air-Gel Interface

NASA Astrophysics Data System (ADS)

O'Bryan, Christopher; Hormel, Tristan; Bhattacharjee, Tapomoy; Sawyer, W.; Angelini, Thomas

Numerous different types of cells are often grown at air-liquid interfaces. For example, a common way to create cell spheroids is to disperse cells in a droplet of liquid media that hangs from the lid of a culture dish - the ``hanging drop'' method. Some types of epithelial cells form monolayers at the bottom of hanging drops, instead of spheroids. Corneal epithelial cells stratify and exhibit a tissue-like phenotype when attached to liquid permeable culture surfaces positioned at the air-liquid media interface (air-lifted culture). These widely used culture methods make experimentation challenging - imaging through hanging drops and air-lifted culture dishes is prohibitive. However, similar results may be achieved by culturing cells on hydrogel surfaces at the air-gel interface. In this talk we will describe a method for culturing cells at air-gel interfaces. We seed human corneal epithelial cells (hTCEpi) onto the surfaces of hydrogel networks and jammed microgels, exposed to air. Preliminary observations of cell behavior at the air-gel interface will be presented.

Cloning, overexpression, purification and preliminary crystallographic studies of a mitochondrial type II peroxiredoxin from Pisum sativum.

PubMed

Barranco-Medina, Sergio; López-Jaramillo, Francisco Javier; Bernier-Villamor, Laura; Sevilla, Francisca; Lázaro, Juan José

2006-07-01

A cDNA encoding an open reading frame of 199 amino acids corresponding to a type II peroxiredoxin from Pisum sativum with its transit peptide was isolated by RT-PCR. The 171-amino-acid mature protein (estimated molecular weight 18.6 kDa) was cloned into the pET3d vector and overexpressed in Escherichia coli. The recombinant protein was purified and crystallized by the hanging-drop vapour-diffusion technique. A full data set (98.2% completeness) was collected using a rotating-anode generator to a resolution of 2.8 angstroms from a single crystal flash-cooled at 100 K. X-ray data revealed that the protein crystallizes in space group P1, with unit-cell parameters a = 61.88, b = 66.40, c = 77.23 angstroms, alpha = 102.90, beta = 104.40, gamma = 99.07 degrees, and molecular replacement using a theoretical model predicted from the primary structure as a search model confirmed the presence of six molecules in the unit cell as expected from the Matthews coefficient. Refinement of the structure is in progress.

Expression, purification, crystallization and preliminary X-ray crystallographic studies of Deinococcus radiodurans thioredoxin reductase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Obiero, Josiah; Bonderoff, Sara A.; Goertzen, Meghan M.

2006-08-01

Recombinant D. radiodurans TrxR with a His tag at the N-terminus was expressed in Escherichia coli and purified by metal-affinity chromatography. The protein was crystallized using the sitting-drop vapour-diffusion method in the presence of 35% PEG 4000, 0.2 M ammonium acetate and citric acid buffer pH 5.1 at 293 K. Deinococcus radiodurans, a Gram-positive bacterium capable of withstanding extreme ionizing radiation, contains two thioredoxins (Trx and Trx1) and a single thioredoxin reductase (TrxR) as part of its response to oxidative stress. Thioredoxin reductase is a member of the family of pyridine nucleotide-disulfide oxidoreductase flavoenzymes. Recombinant D. radiodurans TrxR with amore » His tag at the N-terminus was expressed in Escherichia coli and purified by metal-affinity chromatography. The protein was crystallized using the sitting-drop vapour-diffusion method in the presence of 35% PEG 4000, 0.2 M ammonium acetate and citric acid buffer pH 5.1 at 293 K. X-ray diffraction data were collected on a cryocooled crystal to a resolution of 1.9 Å using a synchrotron-radiation source. The space group was determined to be P3{sub 2}21, with unit-cell parameters a = b = 84.33, c = 159.88 Å. The structure of the enzyme has been solved by molecular-replacement methods and structure refinement is in progress.« less

High-throughput method for optimum solubility screening for homogeneity and crystallization of proteins

DOEpatents

Kim, Sung-Hou [Moraga, CA; Kim, Rosalind [Moraga, CA; Jancarik, Jamila [Walnut Creek, CA

2012-01-31

An optimum solubility screen in which a panel of buffers and many additives are provided in order to obtain the most homogeneous and monodisperse protein condition for protein crystallization. The present methods are useful for proteins that aggregate and cannot be concentrated prior to setting up crystallization screens. A high-throughput method using the hanging-drop method and vapor diffusion equilibrium and a panel of twenty-four buffers is further provided. Using the present methods, 14 poorly behaving proteins have been screened, resulting in 11 of the proteins having highly improved dynamic light scattering results allowing concentration of the proteins, and 9 were crystallized.

Crystallization and preliminary crystallographic studies of the Pasteurella multocida toxin catalytic domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyazawa, Masayuki; Kitadokoro, Kengo; Kamitani, Shigeki

2006-09-01

The C-terminal catalytic domain of P. multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. The C-terminal catalytic domain of Pasteurella multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. Native diffraction data to 1.9 Å resolution were obtained at the BL44XU beamline of SPring-8 from a flash-frozen crystal at 100 K. The crystals belong to space group C2, with unit-cell parameters a = 111.0, b = 150.4,more » c = 77.1 Å, β = 105.5°, and are likely to contain one C-PMT (726 residues) per asymmetric unit.« less

Purification, crystallization and preliminary X-ray diffraction studies on avian haemoglobin from pigeon (Columba livia)

PubMed Central

Sathya Moorthy, Pon.; Neelagandan, K.; Balasubramanian, M.; Ponnuswamy, M. N.

2009-01-01

Haemoglobin is a physiologically significant metalloprotein that is involved in the exchange of gases for sustaining life. The respiratory system of birds is unique and complex compared with that of mammals. Many investigations of avian haemoglobins have revealed the presence of inositol pentaphosphate (IP5), a principal allosteric effector that is involved in regulation of their function. Structural investigations of avian haemoglobins are presently not adequate to explain their function. Efforts have been made in this direction in order to understand the oxygen-binding affinity involved in adapting to hypoxia in avian haemoglobins. Fresh whole blood was collected from pigeon (Columba livia) and purified using a DEAE cellulose anion-exchange chromatographic column. Crystallization of pigeon haemoglobin was accomplished using the hanging-drop vapour-diffusion method using PEG 3350 as a precipitant in 50 mM sodium acetate buffer pH 5.5 with 1 M NaCl. Data collection was carried out using a MAR345 image-plate detector system. The crystals diffracted to 2 Å resolution. Pigeon haemoglobin crystallizes in a triclinic space group, with two whole biological molecules in the asymmetric unit and with unit-cell parameters a = 55.005, b = 65.528, c = 104.370 Å, α = 78.742, β = 89.819, γ = 65.320°. PMID:19194000

Structural studies of haemoglobin from pisces species shortfin mako shark (Isurus oxyrinchus) at 1.9 Å resolution.

PubMed

Ramesh, Pandian; Sundaresan, S S; Sathya Moorthy, Pon; Balasubramanian, M; Ponnuswamy, M N

2013-11-01

Haemoglobin (Hb) is a tetrameric iron-containing protein that carries oxygen from the lungs to tissues and carbon dioxide from tissues back to the lungs. Pisces are the advanced aquatic vertebrates capable of surviving at wide depth ranges. The shortfin mako shark (SMS) is the pelagic, largest, fastest and most sophisticated species of the shark kingdom with well developed eyes. Mostly the pisces species are cold blooded in nature. Distinctly, the SMSs are warm-blooded animals with an advanced circulatory system. SMSs are capable of maintaining elevated muscle temperatures up to 33 K above the ambient water temperatures at a depth of 150-500 m. SMSs have a diverged air-breathing mechanism compared with other vertebrates. The haemoglobin molecule consists of four polypeptide chains, namely two α chains, each with 140 amino acids and two β chains each having 136 amino acids. The SMS Hb was found to crystallize in monoclinic space group P21 using the hanging-drop vapour-diffusion method at room temperature. The crystal packing parameters for the SMS Hb structure contain one whole biological molecule in the asymmetric unit with a solvent content of 47%. The SMS Hb quaternary structural features interface-interface interactions and heme binding sites are discussed with different state Hbs and the results reveal that SMS Hb adopts an unliganded deoxy T state conformation.

Purification, crystallization and preliminary X-ray analysis of haemoglobin from ostrich (Struthio camelus).

PubMed

Sundaresan, S S; Ramesh, P; Sivakumar, K; Ponnuswamy, M N

2009-07-01

Haemoglobin is a tetrameric protein that carries oxygen from the lungs to tissues and carbon dioxide from tissues back to the lungs. The oxygen-binding properties of haemoglobin are regulated through the binding of allosteric effectors. The respiratory system of avian species is unique and complex in nature when compared with that of mammals. In avian species, inositol pentaphosphate (inositol-P(5)) is present in the erythrocytes of the adult and is thought to be the major factor responsible for the relatively high oxygen affinity of the whole blood. The ostrich (Struthio camelus) is a large flightless bird which contains inositol tetrakisphosphate (inositol-P(4)) in its erythrocytes and its whole blood oxygen affinity is higher. Efforts have been made to explore the structure-function relationship of ostrich haemoglobin. Ostrich haemoglobin was purified using ion-exchange chromatography. Haemoglobin crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350 as the precipitant in 50 mM phosphate buffer pH 7.2. Data were collected using a MAR345 image-plate detector system. The crystals of ostrich haemoglobin diffracted to 2.2 A resolution. They belonged to the orthorhombic space group P2(1)2(1)2(1) with one whole biological molecule in the asymmetric unit; the unit-cell parameters were a = 80.93, b = 81.68, c = 102.05 A.

Purification, crystallization and preliminary crystallographic studies of plant S-adenosyl-l-homocysteine hydrolase (Lupinus luteus)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brzezinski, Krzysztof; Department of Crystallography, Faculty of Chemistry, A. Mickiewicz University, Poznan; Bujacz, Grzegorz

2008-07-01

Single crystals of recombinant S-adenosyl-l-homocysteine hydrolase from L. luteus in complex with adenosine diffract X-rays to 1.17 Å resolution at 100 K. The crystals are tetragonal, space group P4{sub 3}2{sub 1}2, and contain one copy of the dimeric enzyme in the asymmetric unit. By degrading S-adenosyl-l-homocysteine, which is a byproduct of S-adenosyl-l-methionine-dependent methylation reactions, S-adenosyl-l-homocysteine hydrolase (SAHase) acts as a regulator of cellular methylation processes. S-Adenosyl-l-homocysteine hydrolase from the leguminose plant yellow lupin (Lupinus luteus), LlSAHase, which is composed of 485 amino acids and has a molecular weight of 55 kDa, has been cloned, expressed in Escherichia coli and purified.more » Crystals of LlSAHase in complex with adenosine were obtained by the hanging-drop vapour-diffusion method using 20%(w/v) PEG 4000 and 10%(v/v) 2-propanol as precipitants in 0.1 M Tris–HCl buffer pH 8.0. The crystals were tetragonal, space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 122.4, c = 126.5 Å and contained two protein molecules in the asymmetric unit, corresponding to the functional dimeric form of the enzyme. Atomic resolution (1.17 Å) X-ray diffraction data have been collected using synchrotron radiation.« less

Purification, crystallization and preliminary X-ray diffraction analysis of saxthrombin, a thrombin-like enzyme from Gloydius saxatilis venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, Wenqing; Zhao, Wei; Key Laboratory of Structural Biology, Chinese Academy of Sciences, 96 Jinzhai Road, Hefei, Anhui 230027

2007-08-01

The thrombin-like enzyme saxthrombin has been purified from G. saxatilis snake venom. Crystallization conditions were found and a data set was obtained to 1.43 Å. The snake-venom thrombin-like enzymes (SVTLEs) are a class of serine proteinases that show fibrinogen-clotting and esterolytic activities. Most TLEs convert fibrinogen to fibrin by releasing either fibrinopeptide A or fibrinopeptide B and cannot activate factor XIII. The enzymes hydrolyze fibrinogen to produce non-cross-linked fibrins, which are susceptible to the lytic action of plasmin. Because of these physiological properties, TLEs have important medical applications in myocardial infarction, ischaemic stroke and thrombotic diseases. Here, a three-step chromatographymore » procedure was used to purify saxthrombin (AAP20638) from Gloydius saxatilis venom to homogeneity. Its molecular weight is about 30 kDa as estimated by SDS–PAGE. A saxthrombin crystal was obtained using the hanging-drop vapour-diffusion method and diffracted to a resolution limit of 1.43 Å. The crystal belongs to space group C2, with unit-cell parameters a = 97.23, b = 52.21, c = 50.10 Å, β = 96.72°, and the Matthews coefficient (V{sub M}) was calculated to be 2.13 Å{sup 3} Da{sup −1} with one molecule in the asymmetric unit.« less

Preliminary X-ray analysis of twinned crystals of the Q88Y25_Lacpl esterase from Lactobacillus plantarum WCFS1

PubMed Central

Álvarez, Yanaisis; Esteban-Torres, María; Acebrón, Iván; de las Rivas, Blanca; Muñoz, Rosario; Martínez-Ripoll, Martín; Mancheño, José M.

2011-01-01

Q88Y25_Lacpl is an esterase produced by the lactic acid bacterium Lactobacillus plantarum WCFS1 that shows amino-acid sequence similarity to carboxyl­esterases from the hormone-sensitive lipase family, in particular the AFEST esterase from the archaeon Archaeoglobus fulgidus and the hyperthermophilic esterase EstEI isolated from a metagenomic library. N-­terminally His6-tagged Q88Y25_Lacpl has been overexpressed in Escherichia coli BL21 (DE3) cells, purified and crystallized at 291 K using the hanging-drop vapour-diffusion method. Mass spectrometry was used to determine the purity and homogeneity of the enzyme. Crystals of His6-tagged Q88Y25_Lacpl were prepared in a solution containing 2.8 M sodium acetate trihydrate pH 7.0. X-ray diffraction data were collected to 2.24 Å resolution on beamline ID29 at the ESRF. The apparent crystal point group was 422; however, initial global analysis of the intensity statistics (data processed with high symmetry in space group I422) and subsequent tests on data processed with low symmetry (space group I4) showed that the crystals were almost perfectly merohedrally twinned. Most probably, the true space group is I4, with unit-cell parameters a = 169.05, b = 169.05, c = 183.62 Å. PMID:22102251

Colony, hanging drop, and methylcellulose three dimensional hypoxic growth optimization of renal cell carcinoma cell lines.

PubMed

Matak, Damian; Brodaczewska, Klaudia K; Lipiec, Monika; Szymanski, Łukasz; Szczylik, Cezary; Czarnecka, Anna M

2017-08-01

Renal cell carcinoma (RCC) is the most lethal of the common urologic malignancies, comprising 3% of all human neoplasms, and the incidence of kidney cancer is rising annually. We need new approaches to target tumor cells that are resistant to current therapies and that give rise to recurrence and treatment failure. In this study, we focused on low oxygen tension and three-dimensional (3D) cell culture incorporation to develop a new RCC growth model. We used the hanging drop and colony formation methods, which are common in 3D culture, as well as a unique methylcellulose (MC) method. For the experiments, we used human primary RCC cell lines, metastatic RCC cell lines, human kidney cancer stem cells, and human healthy epithelial cells. In the hanging drop assay, we verified the potential of various cell lines to create solid aggregates in hypoxic and normoxic conditions. With the semi-soft agar method, we also determined the ability of various cell lines to create colonies under different oxygen conditions. Different cell behavior observed in the MC method versus the hanging drop and colony formation assays suggests that these three assays may be useful to test various cell properties. However, MC seems to be a particularly valuable alternative for 3D cell culture, as its higher efficiency of aggregate formation and serum independency are of interest in different areas of cancer biology.

Imaging transport phenomena during lysozyme protein crystal growth by the hanging drop technique

NASA Astrophysics Data System (ADS)

Sethia Gupta, Anamika; Gupta, Rajive; Panigrahi, P. K.; Muralidhar, K.

2013-06-01

The present study reports the transport process that occurs during the growth of lysozyme protein crystals by the hanging drop technique. A rainbow schlieren technique has been employed for imaging changes in salt concentration. A one dimensional color filter is used to record the deflection of the light beam. An optical microscope and an X-ray crystallography unit are used to characterize the size, tetragonal shape and Bravais lattice constants of the grown crystals. A parametric study on the effect of drop composition, drop size, reservoir height and number of drops on the crystal size and quality is reported. Changes in refractive index are not large enough to create a meaningful schlieren image in the air gap between the drop and the reservoir. However, condensation of fresh water over the reservoir solution creates large changes in the concentration of NaCl, giving rise to clear color patterns in the schlieren images. These have been analyzed to obtain salt concentration profiles near the free surface of the reservoir solution as a function of time. The diffusion of fresh water into the reservoir solution at the early stages of crystal growth followed by the mass flux of salt from the bulk solution towards the free surface has been recorded. The overall crystal growth process can be classified into two regimes, as demarcated by the changes in slope of salt concentration within the reservoir. The salt concentration in the reservoir equilibrates at long times when the crystallization process is complete. Thus, transport processes in the reservoir emerge as the route to monitor protein crystal growth in the hanging drop configuration. Results show that crystal growth rate is faster for a higher lysozyme concentration, smaller drops, and larger reservoir heights.

Hangman's fracture: a historical and biomechanical perspective.

PubMed

Rayes, Mahmoud; Mittal, Monika; Rengachary, Setti S; Mittal, Sandeep

2011-02-01

The execution technique of hanging, introduced by the Angle, Saxon, and Jute Germanic tribes during their invasions of the Roman Empire and Britain in the 5th century, has remained largely unchanged over time. The earliest form of a gallows was a tree on which prisoners were hanged. Despite the introduction of several modifications such as a trap door, the main mechanism of death remained asphyxiation. This created the opportunity for attempted revival after the execution, and indeed several well-known cases of survival following judicial hanging have been reported. It was not until the introduction of the standard drop by Dr. Samuel Haughton in 1866, and the so-called long drop by William Marwood in 1872 that hanging became a standard, humane means to achieve instantaneous death. Hangmen, however, fearing knot slippage, started substituting the subaural knot for the traditional submental knot. Subaural knots were not as effective, and cases of decapitation were recorded. Standardization of the long drop was further propagated by John Berry, an executioner who used mathematical calculations to estimate the correct drop length for each individual to be hanged. A British committee on capital sentences, led by Lord Aberdare, studied the execution method, and advocated for the submental knot. However, it was not until Frederic Wood-Jones published his seminal work in 1913 that cervical fractures were identified as the main mechanism of death following hanging in which the long drop and a submental knot were used. Schneider introduced the term "hangman's fracture" in 1965, and reported on the biomechanics and other similarities of the cervical fractures seen following judicial hangings and those caused by motor vehicle accidents.

Protein crystal growth in space

NASA Technical Reports Server (NTRS)

Bugg, C. E.; Clifford, D. W.

1987-01-01

The advantages of protein crystallization in space, and the applications of protein crystallography to drug design, protein engineering, and the design of synthetic vaccines are examined. The steps involved in using protein crystallography to determine the three-dimensional structure of a protein are discussed. The growth chamber design and the hand-held apparatus developed for protein crystal growth by vapor diffusion techniques (hanging-drop method) are described; the experimental data from the four Shuttle missions are utilized to develop hardware for protein crystal growth in space and to evaluate the effects of gravity on protein crystal growth.

Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer.

PubMed

Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

2010-05-01

The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq-RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq-RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 A, while the type 2 Hfq-RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 A. Diffraction data were collected to a resolution of 2.20 A from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis.

Protein Crystal Movements and Fluid Flows During Microgravity Growth

NASA Technical Reports Server (NTRS)

Boggon, Titus J.; Chayen, Naomi E.; Snell, Edward H.; Dong, Jun; Lautenschlager, Peter; Potthast, Lothar; Siddons, D. Peter; Stojanoff, Vivian; Gordon, Elspeth; Thompson, Andrew W.;

Expression, purification and preliminary crystallographic analysis of oligopeptidase B from Trypanosoma brucei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rea, Dean; Hazell, Carole; Andrews, Norma W.

2006-08-01

Recombinant oligopeptidase B from T. brucei has been prepared and crystallized. Data were collected to 2.7 Å. Heavy-atom soaks and preparation of selenomethionine-substituted protein are in progress for structure determination by MAD or MIR. African sleeping sickness, also called trypanosomiasis, is a significant cause of morbidity and mortality in sub-Saharan Africa. Peptidases from Trypanosoma brucei, the causative agent, include the serine peptidase oligopeptidase B, a documented virulence factor and therapeutic target. Determination of the three-dimensional structure of oligopeptidase B is desirable to facilitate the development of novel inhibitors. Oligopeptidase B was overexpressed in Escherichia coli as an N-terminally hexahistidine-tagged fusionmore » protein, purified using metal-affinity chromatography and crystallized using the hanging-drop vapour-diffusion technique in 7%(w/v) polyethylene glycol 6000, 1 M LiCl, 0.1 M bis-tris propane pH 7.5. Diffraction data to 2.7 Å resolution were collected using synchrotron radiation. The crystals belong to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 124.5, c = 249.9 Å. A complete data set to 2.7 Å was collected using synchrotron radiation.« less

Pendant-Drop Surface-Tension Measurement On Molten Metal

NASA Technical Reports Server (NTRS)

Man, Kin Fung; Thiessen, David

1996-01-01

Method of measuring surface tension of molten metal based on pendant-drop method implemented in quasi-containerless manner and augmented with digital processing of image data. Electrons bombard lower end of sample rod in vacuum, generating hanging drop of molten metal. Surface tension of drop computed from its shape. Technique minimizes effects of contamination.

A PDMS-Based Microfluidic Hanging Drop Chip for Embryoid Body Formation.

PubMed

Wu, Huei-Wen; Hsiao, Yi-Hsing; Chen, Chih-Chen; Yet, Shaw-Fang; Hsu, Chia-Hsien

2016-07-06

The conventional hanging drop technique is the most widely used method for embryoid body (EB) formation. However, this method is labor intensive and limited by the difficulty in exchanging the medium. Here, we report a microfluidic chip-based approach for high-throughput formation of EBs. The device consists of microfluidic channels with 6 × 12 opening wells in PDMS supported by a glass substrate. The PDMS channels were fabricated by replicating polydimethyl-siloxane (PDMS) from SU-8 mold. The droplet formation in the chip was tested with different hydrostatic pressures to obtain optimal operation pressures for the wells with 1000 μm diameter openings. The droplets formed at the opening wells were used to culture mouse embryonic stem cells which could subsequently developed into EBs in the hanging droplets. This device also allows for medium exchange of the hanging droplets making it possible to perform immunochemistry staining and characterize EBs on chip.

Axisymmetric Liquid Hanging Drops

ERIC Educational Resources Information Center

Meister, Erich C.; Latychevskaia, Tatiana Yu

2006-01-01

The geometry of drops hanging on a circular capillary can be determined by numerically solving a dimensionless differential equation that is independent on any material properties, which enables one to follow the change of the height, surface area, and contact angle of drops hanging on a particular capillary. The results show that the application…

Intracellular localization of pregnane X receptor in HepG2 cells cultured by the hanging drop method.

PubMed

Yokobori, Kosuke; Kobayashi, Kaoru; Azuma, Ikuko; Akita, Hidetaka; Chiba, Kan

2017-10-01

Pregnane X receptor (PXR) is localized in the cytoplasm of liver cells, whereas it is localized in the nucleus of monolayer-cultured HepG2 cells. Since cultured cells are affected by the microenvironment in which they are grown, we studied the effect of three-dimensional (3D) culture on the localization of PXR in HepG2 cells using the hanging drop method. The results showed that PXR was retained in the cytoplasm of HepG2 cells and other human hepatocarcinoma cell lines (FLC5, FLC7 and Huh7) when they were cultured by the hanging drop method. Treatment with rifampicin, a ligand of PXR, translocated PXR from the cytoplasm to nucleus and increased expression levels of CYP3A4 mRNA in HepG2 cells cultured by the hanging drop method. These findings suggest that 3D culture is a key factor determining the intracellular localization of PXR in human hepatocarcinoma cells and that PXR that becomes retained in the cytoplasm of HepG2 cells with 3D culture has functions of nuclear translocation and regulation of target genes in response to human PXR ligands. Three-dimensionally cultured hepatocarcinoma cells would be a useful tool to evaluate induction potency of drug candidates and also to study mechanisms of nuclear translocation of PXR by human PXR ligands. Copyright © 2017 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.

Crystallization and X-ray diffraction analysis of an l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii and a d-xylonate dehydratase from Caulobacter crescentus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahman, Mohammad Mubinur; Andberg, Martina; Koivula, Anu

l-Arabinonate dehydratase and d-xylonate dehydratase from the IlvD/EDD family were crystallized by the vapour-diffusion method. Diffraction data sets were collected to resolutions of 2.40 and 2.66 Å from crystals of l-arabinonate dehydratase and d-xylonate dehydratase, respectively. l-Arabinonate dehydratase (EC 4.2.1.25) and d-xylonate dehydratase (EC 4.2.1.82) are two enzymes that are involved in a nonphosphorylative oxidation pathway of pentose sugars. l-Arabinonate dehydratase converts l-arabinonate into 2-dehydro-3-deoxy-l-arabinonate, and d-xylonate dehydratase catalyzes the dehydration of d-xylonate to 2-dehydro-3-deoxy-d-xylonate. l-Arabinonate and d-xylonate dehydratases belong to the IlvD/EDD family, together with 6-phosphogluconate dehydratases and dihydroxyacid dehydratases. No crystal structure of any l-arabinonate or d-xylonate dehydratasemore » is available in the PDB. In this study, recombinant l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii (RlArDHT) and d-xylonate dehydratase from Caulobacter crescentus (CcXyDHT) were heterologously expressed in Escherichia coli and purified by the use of affinity chromatography followed by gel-filtration chromatography. The purified proteins were crystallized using the hanging-drop vapour-diffusion method at 293 K. Crystals of RlArDHT that diffracted to 2.40 Å resolution were obtained using sodium formate as a precipitating agent. They belonged to space group P2{sub 1}, with unit-cell parameters a = 106.07, b = 208.61, c = 147.09 Å, β = 90.43°. Eight RlArDHT molecules (two tetramers) in the asymmetric unit give a V{sub M} value of 3.2 Å{sup 3} Da{sup −1} and a solvent content of 62%. Crystals of CcXyDHT that diffracted to 2.66 Å resolution were obtained using sodium formate and polyethylene glycol 3350. They belonged to space group C2, with unit-cell parameters a = 270.42, b = 236.13, c = 65.17 Å, β = 97.38°. Four CcXyDHT molecules (a tetramer) in the asymmetric unit give a V{sub M} value of 4.0 Å{sup 3} Da{sup −1} and a solvent content of 69%.« less

Fabrication and Operation of Microfluidic Hanging-Drop Networks.

PubMed

Misun, Patrick M; Birchler, Axel K; Lang, Moritz; Hierlemann, Andreas; Frey, Olivier

2018-01-01

The hanging-drop network (HDN) is a technology platform based on a completely open microfluidic network at the bottom of an inverted, surface-patterned substrate. The platform is predominantly used for the formation, culturing, and interaction of self-assembled spherical microtissues (spheroids) under precisely controlled flow conditions. Here, we describe design, fabrication, and operation of microfluidic hanging-drop networks.

Application of hanging drop technique for stem cell differentiation and cytotoxicity studies.

PubMed

Banerjee, Meenal; Bhonde, Ramesh R

2006-05-01

The aim of our study is to explore the possibility of using an ancient method of culture technique- the hanging drop technique for stem cell differentiation and cytotoxicity testing. We demonstrate here a variety of novel applications of this age old technique not only to harness the differentiation potential of stem cells into specific lineages but also for cytotoxicity studies. Here we have prepared hanging drop cultures by placing 20 microl micro-drops of nutrient media and 10% Fetal Calf Serum (FCS) containing cells of interest on the lids of 60 mm dishes. Bottom plates of the dishes were filled with sterile Phosphate Buffer Saline (PBS) to avoid desiccation of samples. Lids were then placed on the bottom plates to achieve hanging drop cultures. We utilized this technique for cultivation of ciliated epithelia to study cytotoxicity and differentiation of bone marrow stromal cells. Most importantly the modified culture technique presented here is simple, economical and cost effective in terms of the time taken and the reagents required and are amenable to goal specific modification such as cytotoxicity testing. It is advantageous over the existing system in terms of retention of viability and functionality for longer duration and for providing three dimensional growth micro-environment making it useful for organotypic cultures and in vivo simulation.

[Culture of pancreatic progenitor cells in hanging drop and on floating filter].

PubMed

Ma, Feng-xia; Chen, Fang; Chi, Ying; Yang, Shao-guang; Lu, Shi-hong; Han, Zhong-chao

2013-06-01

To construct a method to culture pancreatic progenitor cells in hanging drop and on floating filter,and to examine if pancreatic progenitor cells can differentiate into mature endocrine cells with this method. Murine embryos at day 12.5 were isolated and digested into single cells,which were then cultured in hanging drop for 24h and formed spheres.Spheres were cultured on the filter for 6 days,which floated in the dish containing medium.During culture,the expressions of pancreas duodenum homeobox-1(PDX-1)and neurogenin3(Ngn3)were determined.The expressions of endocrine and exocrine markers,insulin,glucagon,and carboxypeptidase(CPA)were determined on day 7 by immunohistochemistry.Insulin secretion of spheres stimulated by glucose was detected by ELISA.The changes of pancreatic marker expressions during culture were monitored by real-time polymerase chain reaction(PCR). One day after the culture,there were still a large amount of PDX-1 positive cells in pancreatic spheres,and these cells proliferated.On day 3,high expression of Ngn3 was detected,and the Ngn3-positive cells did not proliferate.On day 7,The expressions of endocrine and exocrine markers in the differentiated pancreatic progenitor cells were detected,which were consistent with that in vivo.Insulin was secreted by spheres upon the stimulation of glucose. In hanging drop and on floating filter,pancreatic progenitor cells can differentiate into mature endocrine cells.

The influence of gravity on the distribution of the deposit formed onto a substrate by sessile, hanging, and sandwiched hanging drop evaporation.

PubMed

Sandu, Ion; Fleaca, Claudiu Teodor

2011-06-15

The focus of the present article is the study of the influence of gravity on the particle deposition profiles on a solid substrate during the evaporation of sessile, hanging and sandwiched hanging drops of colloidal particle suspensions. For concentrations of nanoparticles in the colloidal solutions in the range 0.0001-1 wt.%, highly diluted suspensions will preferentially form rings while concentrated suspensions will preferentially form spots in both sessile and hanging drop evaporation. For intermediary concentrations, the particle deposition profiles will depend on the nanoparticle aggregation dynamics in the suspension during the evaporation process, gravity and on the detailed evaporation geometry. The evaporation of a drop of toluene/carbon nanoparticle suspension hanging from a pendant water drop will leave on the substrate a circular spot with no visible external ring. By contrast, a clear external ring is formed on the substrate by the sessile evaporation of a similar drop of suspension sandwiched between a water drop and the substrate. From the application viewpoint, these processes can be used to create preferential electrical conductive carbon networks and contacts for arrays of self-assembled nanostructures fabricated on solid substrates as well as on flexible polymeric substrates. Copyright © 2011 Elsevier Inc. All rights reserved.

Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.

2010-11-12

Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.

Preliminary investigations of protein crystal growth using the Space Shuttle

NASA Technical Reports Server (NTRS)

Delucas, L. J.; Suddath, F. L.; Snyder, R.; Naumann, R.; Broom, M. B.; Pusey, M.; Yost, V.; Herren, B .; Carter, D.

1986-01-01

Four preliminary Shuttle experiments are described which have been used to develop prototype hardware for a more advanced system that will evaluate effects of gravity on protein crystal growth. The first phase of these experiments has centered on the development of micromethods for protein crystal growth by vapor-diffusion techniques (using a space version of the hanging-drop method) and on dialysis using microdialysis cells. Results suggest that the elimination of density-driven sedimentation can effect crystal morphology. In the dialysis experiment, space-grown crystals of concanavalin B were three times longer and 1/3 the thickness of earth-grown crystals.

Crystallization and diffraction analysis of [beta]-N-acetylhexosaminidase from Aspergillus oryzae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vanek, Ondrej; Brynd, Jirí; Hofbauerová, Katerina

2012-05-08

Fungal {beta}-N-acetylhexosaminidases are enzymes that are used in the chemoenzymatic synthesis of biologically interesting oligosaccharides. The enzyme from Aspergillus oryzae was produced and purified from its natural source and crystallized using the hanging-drop vapor-diffusion method. Diffraction data from two crystal forms (primitive monoclinic and primitive tetragonal) were collected to resolutions of 3.2 and 2.4 {angstrom}, respectively. Electrophoretic and quantitative N-terminal protein-sequencing analyses confirmed that the crystals are formed by a complete biologically active enzyme consisting of a glycosylated catalytic unit and a noncovalently attached propeptide.

Discovery of novel inhibitors for Leishmania nucleoside diphosphatase kinase (NDK) based on its structural and functional characterization

NASA Astrophysics Data System (ADS)

Mishra, Arjun K.; Singh, Nidhi; Agnihotri, Pragati; Mishra, Shikha; Singh, Saurabh P.; Kolli, Bala K.; Chang, Kwang Poo; Sahasrabuddhe, Amogh A.; Siddiqi, M. I.; Pratap, J. Venkatesh

2017-06-01

Nucleoside diphosphate kinases (NDKs) are ubiquitous enzymes that catalyze the transfer of the γ-phosphate moiety from an NTP donor to an NDP acceptor, crucial for maintaining the cellular level of nucleoside triphosphates (NTPs). The inability of trypanosomatids to synthesize purines de novo and their dependence on the salvage pathway makes NDK an attractive target to develop drugs for the diseases they cause. Here we report the discovery of novel inhibitors for Leishmania NDK based on the structural and functional characterization of purified recombinant NDK from Leishmania amazonensis. Recombinant LaNDK possesses auto-phosphorylation, phosphotransferase and kinase activities with Histidine 117 playing an essential role. LaNDK crystals were grown by hanging drop vapour diffusion method in a solution containing 18% PEG-MME 500, 100 mM Bis-Tris propane pH 6.0 and 50 mM MgCl2. It belongs to the hexagonal space group P6322 with unit cell parameters a = b = 115.18, c = 62.18 Å and α = β = 90°, γ = 120°. The structure solved by molecular replacement methods was refined to crystallographic R-factor and Rfree values of 22.54 and 26.52%, respectively. Molecular docking and dynamics simulation -based virtual screening identified putative binding compounds. Protein inhibition studies of selected hits identified five inhibitors effective at micromolar concentrations. One of the compounds showed 45% inhibition of Leishmania promastigotes proliferation. Analysis of inhibitor-NDK complexes reveals the mode of their binding, facilitating design of new compounds for optimization of activities as drugs against leishmaniasis.

Crystallization and preliminary crystallographic studies of LipA, a secretory lipase/esterase from Xanthomonas oryzae pv. oryzae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aparna, Gudlur; Chatterjee, Avradip; Jha, Gopaljee

2007-08-01

The crystallization and preliminary crystallographic studies of LipA, a lipase/esterase secreted by X. oryzae pv. oryzae during its infection of rice plants, are reported. Xanthomonas oryzae pv. oryzae is the causal agent of bacterial leaf blight, a serious disease of rice. Several enzymes that are secreted through the type II secretion system of this bacterium play an important role in the plant–microbe interaction, being important for virulence and also being able to induce potent host defence responses. One of these enzymes is a secretory lipase/esterase, LipA, which shows a very weak homology to other bacterial lipases and gives a positivemore » tributyrin plate assay. In this study, LipA was purified from the culture supernatant of an overexpressing clone of X. oryzae pv. oryzae and two types of crystals belonging to space group C2 but with two different unit-cell parameters were obtained using the hanging-drop vapour-diffusion method. Type I crystals diffract to a maximum resolution of 1.89 Å and have unit-cell parameters a = 93.1, b = 62.3, c = 66.1 Å, β = 90.8°. Type II crystals have unit-cell parameters a = 103.6, b = 54.6, c = 66.3 Å, β = 92.6° and diffract to 1.86 Å. Solvent-content analysis shows one monomer in the asymmetric unit in both the crystal forms.« less

Cloning, overexpression, purification and preliminary X-ray analysis of a feast/famine regulatory protein (Rv2779c) from Mycobacterium tuberculosis H37Rv.

PubMed

Dey, Abhishek; Ramachandran, Ravishankar

2014-01-01

Rv2779c from Mycobacterium tuberculosis is a feast/famine regulatory protein. This class of proteins are also known as the leucine-responsive regulatory protein/asparagine synthase C family (Lrp/AsnC) of transcriptional regulators and are known to be involved in various metabolic processes in bacteria and fungi. They contain a RAM (regulator of amino-acid metabolism) domain that is rarely found in humans and acts as the oligomerization domain. Since the oligomeric status is often linked to the particular functional role in these proteins, binding of ligands to the domain can elicit specific functional responses. Full-length Rv2779c corresponding to a molecular mass of 19.8 kDa and 179 residues was cloned and purified to homogeneity following transformation into Escherichia coli C41 (DE3) cells. Crystals were grown by vapour diffusion using the hanging-drop method. Diffraction data extending to 2.8 Å resolution were collected from a single crystal that belonged to space group P2(1)2(1)2, with unit-cell parameters a = 99.6, b = 146.0, c = 49.9 Å. Matthews coefficient (VM) calculations suggest that four molecules are present in the asymmetric unit, corresponding to a solvent content of ∼46%. Molecular-replacement calculations using the crystal structure of a homologue, Rv3291c, as the search model gave an unambiguous solution corresponding to four subunits in the asymmetric unit.

Crystallization and preliminary X-ray diffraction studies of delta-toxin from Clostridium perfringens.

PubMed

Huyet, Jessica; Gilbert, Maryse; Popoff, Michel R; Basak, Ajit

2011-03-01

Clostridium perfringens is a Gram-positive anaerobic bacterium that is responsible for a wide range of diseases in humans and both wild and domesticated animals, including birds. C. perfringens is notable for its ability to produce a plethora of toxins, e.g. phospholipases C (alpha-toxin), pore-forming toxins (epsilon-toxin, beta-toxin and enterotoxin) and binary toxins (iota-toxin). Based on alpha-, beta-, epsilon- and iota-toxin production, the bacterium is classified into five different toxinotypes (A-E). Delta-toxin, which is a 32.6 kDa protein with 290 amino acids, is one of three haemolysins released by type C and possibly by type B strains of C. perfringens. This toxin is immunogenic and lytic to erythrocytes from the even-toed ungulates sheep, goats and pigs, and is cytotoxic to other cell types such as rabbit macrophages, human monocytes and blood platelets from goats, rabbits, guinea pigs and humans. The recombinant delta-toxin has been cloned, expressed, purified and crystallized in two different crystal forms by the hanging-drop vapour-diffusion method. Of these two different crystal forms, only the form II crystal diffracted to atomic resolution (dmin=2.4 Å), while the form I crystal diffracted to only 15 Å resolution. The form II crystals belonged to space group P2(1)2(1)2, with one molecule in the crystallographic asymmetric unit and unit-cell parameters a=49.66, b=58.48, c=112.93 Å.

Enrichment of cardiac differentiation of mouse embryonic stem cells by optimizing the hanging drop method.

PubMed

Chen, Ming; Lin, Yong-Qing; Xie, Shuang-Lun; Wu, Hong-Fu; Wang, Jing-Feng

2011-04-01

Hanging drop (HD) culture is used to induce differentiation of embryonic stem cells (ESCs) into other cell types including cardiomyocytes. However, the factors affecting cardiac differentiation of ESCs with this method remain incompletely understood. We have investigated the effects of the starting number of ESCs in embryoid bodies (EBs) and the time of EB adherence to gelatin-coated plates on cardiac differentiation: cardiac differentiation was increased in the EBs by a larger number of ESCs and was decreased by plating EBs at day 4 or earlier. These two factors can thus be optimized to enrich the cardiac differentiation in ESCs using the HD method.

Redifferentiation of in vitro expanded adult articular chondrocytes by combining the hanging-drop cultivation method with hypoxic environment.

PubMed

Martinez, Inigo; Elvenes, Jan; Olsen, Randi; Bertheussen, Kjell; Johansen, Oddmund

2008-01-01

The main purpose of this work has been to establish a new culturing technique to improve the chondrogenic commitment of isolated adult human chondrocytes, with the aim of being used during cell-based therapies or tissue engineering strategies. By using a rather novel technique to generate scaffold-free three-dimensional (3D) structures from in vitro expanded chondrocytes, we have explored the effects of different culture environments on cartilage formation. Three-dimensional chondrospheroids were developed by applying the hanging-drop technique. Cartilage tissue formation was attempted after combining critical factors such as serum-containing or serum-free media and atmospheric (20%) or low (2.5%) oxygen tensions. The quality of the formed microtissues was analyzed by histology, immunohistochemistry, electron microscopy, and real-time PCR, and directly compared with native adult cartilage. Our results revealed highly organized, 3D tissue-like structures developed by the hanging-drop method. All culture conditions allowed formation of 3D spheroids; however, cartilage generated under low oxygen tension had a bigger size, enhanced matrix deposition, and higher quality of cartilage formation. Real-time PCR demonstrated enhanced expression of cartilage-specific genes such us collagen type II and aggrecan in 3D cultures when compared to monolayers. Cartilage-specific matrix proteins and genes expressed in hanging-drop-developed spheroids were comparable to the expression obtained by applying the pellet culture system. In summary, our results indicate that a combination of 3D cultures of chondrocytes in hanging drops and a low oxygen environment represent an easy and convenient way to generate cartilage-like microstructures. We also show that a new specially tailored serum-free medium is suitable for in vitro cartilage tissue formation. This new methodology opens up the possibility of using autogenously produced solid 3D structures with redifferentiated chondrocytes as an attractive alternative to the currently used autologous chondrocyte transplantation for cartilage repair.

Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer

PubMed Central

Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

2010-01-01

The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq–RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq–RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 Å, while the type 2 Hfq–RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 Å. Diffraction data were collected to a resolution of 2.20 Å from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis. PMID:20445260

Cloning, overexpression, purification and preliminary crystallographic studies of a mitochondrial type II peroxiredoxin from Pisum sativum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barranco-Medina, Sergio; López-Jaramillo, Francisco Javier, E-mail: fjljara@ugr.es; Bernier-Villamor, Laura

2006-07-01

The isolation, purification, crystallization and molecular-replacement solution of mitochondrial type II peroxiredoxin from P. sativum is reported. A cDNA encoding an open reading frame of 199 amino acids corresponding to a type II peroxiredoxin from Pisum sativum with its transit peptide was isolated by RT-PCR. The 171-amino-acid mature protein (estimated molecular weight 18.6 kDa) was cloned into the pET3d vector and overexpressed in Escherichia coli. The recombinant protein was purified and crystallized by the hanging-drop vapour-diffusion technique. A full data set (98.2% completeness) was collected using a rotating-anode generator to a resolution of 2.8 Å from a single crystal flash-cooledmore » at 100 K. X-ray data revealed that the protein crystallizes in space group P1, with unit-cell parameters a = 61.88, b = 66.40, c = 77.23 Å, α = 102.90, β = 104.40, γ = 99.07°, and molecular replacement using a theoretical model predicted from the primary structure as a search model confirmed the presence of six molecules in the unit cell as expected from the Matthews coefficient. Refinement of the structure is in progress.« less

Crystallization and preliminary X-ray diffraction studies of trypsin-like proteases from the gastric fluid of the marine crab Cancer pagurus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hehemann, Jan-Hendrik; Redecke, Lars; Perbandt, Markus

2007-03-01

Two trypsins from the gastric fluid of the marine crab C. pagurus were purified and crystallized and X-ray data were collected to 0.97 and 3.2 Å resolution. The digestive fluid of the marine crab Cancer pagurus (Decapoda, Brachyura) contains highly stable proteases which display enhanced activity in aqueous mixtures of organic solvents. Three trypsins were isolated from the gastric fluid and two of them, C.p.TryII and C.p.TryIII, were purified to homogeneity by anion-exchange chromatography and crystallized by hanging-drop vapour diffusion. Diffraction data were collected at a synchrotron to 0.97 and 3.2 Å resolution, respectively. The crystal of C.p.TryII belongs tomore » the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.06, b = 62.00, c = 71.66 Å. Based on the Matthews coefficient, one protein molecule per asymmetric unit is suggested. In contrast, crystals of C.p.TryIII, which belong to the cubic space group P2{sub 1}3 with unit-cell parameters a = b = c = 215.4 Å, are assumed to contain 12 molecules per asymmetric unit.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marana, S. R.; Cançado, F. C.; Valério, A. A.

The digestive lysozymes 1 and 2 from M. domestica were crystallized by vapour diffusion. The crystallographic data were processed to a maximum resolution of 1.9 Å in both cases. Lysozymes are mostly known for their defensive role against bacteria, but in several animals lysozymes have a digestive function. Here, the initial crystallographic characterization of two digestive lysozymes from Musca domestica are presented. The proteins were crystallized using the sitting-drop vapour-diffusion method in the presence of ammonium sulfate or PEG/2-propanol as the precipitant. X-ray diffraction data were collected to a maximum resolution of 1.9 Å using synchrotron radiation. The lysozyme 1more » and 2 crystals belong to the monoclinic space group P2{sub 1} (unit-cell parameters a = 36.52, b = 79.44, c = 45.20 Å, β = 102.97°) and the orthorhombic space group P2{sub 1}2{sub 1}2 (unit-cell parameters a = 73.90, b = 96.40, c = 33.27 Å), respectively. The crystal structures were solved by molecular replacement and structure refinement is in progress.« less

Determination of trace arsenic on hanging copper amalgam drop electrode.

PubMed

Piech, Robert; Baś, Bogusław; Niewiara, Ewa; Kubiak, Władysław W

2007-04-30

Hanging copper amalgam drop electrode has been applied for trace determination of arsenic by cathodic stripping analysis. Detection limit for As(III) as low as 0.33nM (0.02mug/L) at deposition time (240s) could be obtained. For seven successive determinations of As(III) at concentration of 5nM relative standard deviation was 2.5% (n=7). Interferences from selected metals and surfactant substances were examined. Absence of copper ions in sample solution causes easier optimization and makes method less vulnerable on contamination. The developed method was validated by analysis of certified reference materials (CRMs) and applied to arsenic determinations in natural water samples.

An optimized protocol for handling and processing fragile acini cultured with the hanging drop technique.

PubMed

Snyman, Celia; Elliott, Edith

2011-12-15

The hanging drop three-dimensional culture technique allows cultivation of functional three-dimensional mammary constructs without exogenous extracellular matrix. The fragile acini are, however, difficult to preserve during processing steps for advanced microscopic investigation. We describe adaptations to the protocol for handling of hanging drop cultures to include investigation using confocal, scanning, and electron microscopy, with minimal loss of cell culture components. Copyright © 2011 Elsevier Inc. All rights reserved.

Adding the 'heart' to hanging drop networks for microphysiological multi-tissue experiments.

PubMed

Rismani Yazdi, Saeed; Shadmani, Amir; Bürgel, Sebastian C; Misun, Patrick M; Hierlemann, Andreas; Frey, Olivier

2015-11-07

Microfluidic hanging-drop networks enable culturing and analysis of 3D microtissue spheroids derived from different cell types under controlled perfusion and investigating inter-tissue communication in multi-tissue formats. In this paper we introduce a compact on-chip pumping approach for flow control in hanging-drop networks. The pump includes one pneumatic chamber located directly above one of the hanging drops and uses the surface tension at the liquid-air-interface for flow actuation. Control of the pneumatic protocol provides a wide range of unidirectional pulsatile and continuous flow profiles. With the proposed concept several independent hanging-drop networks can be operated in parallel with only one single pneumatic actuation line at high fidelity. Closed-loop medium circulation between different organ models for multi-tissue formats and multiple simultaneous assays in parallel are possible. Finally, we implemented a real-time feedback control-loop of the pump actuation based on the beating of a human iPS-derived cardiac microtissue cultured in the same system. This configuration allows for simulating physiological effects on the heart and their impact on flow circulation between the organ models on chip.

Seamless Combination of Fluorescence-Activated Cell Sorting and Hanging-Drop Networks for Individual Handling and Culturing of Stem Cells and Microtissue Spheroids.

PubMed

Birchler, Axel; Berger, Mischa; Jäggin, Verena; Lopes, Telma; Etzrodt, Martin; Misun, Patrick Mark; Pena-Francesch, Maria; Schroeder, Timm; Hierlemann, Andreas; Frey, Olivier

2016-01-19

Open microfluidic cell culturing devices offer new possibilities to simplify loading, culturing, and harvesting of individual cells or microtissues due to the fact that liquids and cells/microtissues are directly accessible. We present a complete workflow for microfluidic handling and culturing of individual cells and microtissue spheroids, which is based on the hanging-drop network concept: The open microfluidic devices are seamlessly combined with fluorescence-activated cell sorting (FACS), so that individual cells, including stem cells, can be directly sorted into specified culturing compartments in a fully automated way and at high accuracy. Moreover, already assembled microtissue spheroids can be loaded into the microfluidic structures by using a conventional pipet. Cell and microtissue culturing is then performed in hanging drops under controlled perfusion. On-chip drop size control measures were applied to stabilize the system. Cells and microtissue spheroids can be retrieved from the chip by using a parallelized transfer method. The presented methodology holds great promise for combinatorial screening of stem-cell and multicellular-spheroid cultures.

Convection effects in protein crystal growth

NASA Technical Reports Server (NTRS)

Roberts, Glyn O.

1988-01-01

Protein crystals for X-ray diffraction study are usually grown resting on the bottom of a hanging drop of a saturated protein solution, with slow evaporation to the air in a small enclosed cell. The evaporation rate is controlled by hanging the drop above a reservoir of water, with its saturation vapor pressure decreased by a low concentration of a passive solute. The drop has a lower solute concentration, and its volume shrinks by evaporation until the molecular concentrations match. Protein crystals can also be grown from a seed crystal suspended or supported in the interior of a supersaturated solution. The main analysis of this report concerns this case because it is less complicated than hanging-drop growth. Convection effects have been suggested as the reason for the apparent cessation of growth at a certain rather small crystal size. It seeems that as the crystal grows, the number of dislocations increases to a point where further growth is hindered. Growth in the microgravity environment of an orbiting space vehicle has been proposed as a method for obtaining larger crystals. Experimental observations of convection effects during the growth of protein crystals have been reported.

The preparation of Drosophila embryos for live-imaging using the hanging drop protocol.

PubMed

Reed, Bruce H; McMillan, Stephanie C; Chaudhary, Roopali

2009-03-13

Green fluorescent protein (GFP)-based timelapse live-imaging is a powerful technique for studying the genetic regulation of dynamic processes such as tissue morphogenesis, cell-cell adhesion, or cell death. Drosophila embryos expressing GFP are readily imaged using either stereoscopic or confocal microscopy. A goal of any live-imaging protocol is to minimize detrimental effects such as dehydration and hypoxia. Previous protocols for preparing Drosophila embryos for live-imaging analysis have involved placing dechorionated embryos in halocarbon oil and sandwiching them between a halocarbon gas-permeable membrane and a coverslip. The introduction of compression through mounting embryos in this manner represents an undesirable complication for any biomechanical-based analysis of morphogenesis. Our method, which we call the hanging drop protocol, results in excellent viability of embryos during live imaging and does not require that embryos be compressed. Briefly, the hanging drop protocol involves the placement of embryos in a drop of halocarbon oil that is suspended from a coverslip, which is, in turn, fixed in position over a humid chamber. In addition to providing gas exchange and preventing dehydration, this arrangement takes advantage of the buoyancy of embryos in halocarbon oil to prevent them from drifting out of position during timelapse acquisition. This video describes in detail how to collect and prepare Drosophila embryos for live imaging using the hanging drop protocol. This protocol is suitable for imaging dechorionated embryos using stereomicroscopy or any upright compound fluorescence microscope.

Application of Hanging Drop Technique for Kidney Tissue Culture.

PubMed

Wang, Shaohui; Wang, Ximing; Boone, Jasmine; Wie, Jin; Yip, Kay-Pong; Zhang, Jie; Wang, Lei; Liu, Ruisheng

2017-01-01

The hanging drop technique is a well-established method used in culture of animal tissues. However, this method has not been used in adult kidney tissue culture yet. This study was to explore the feasibility of using this technique for culturing adult kidney cortex to study the time course of RNA viability in the tubules and vasculature, as well as the tissue structural integrity. In each Petri dish with the plate covered with sterile buffer, a section of mouse renal cortex was cultured within a drop of DMEM culture medium on the inner surface of the lip facing downward. The tissue were then harvested at each specific time points for Real-time PCR analysis and histological studies. The results showed that the mRNA level of most Na+ related transporters and cotransporters were stably maintained within 6 hours in culture, and that the mRNA level of most receptors found in the vasculature and glomeruli were stably maintained for up to 9 days in culture. Paraffin sections of the cultured renal cortex indicated that the tubules began to lose tubular integrity after 6 hours, but the glomeruli and vasculatures were still recognizable up to 9 days in culture. We concluded that adult kidney tissue culture by hanging drop method can be used to study gene expressions in vasculature and glomeruli. © 2017 The Author(s). Published by S. Karger AG, Basel.

Crystallization and initial X-ray diffraction studies of scaffolding protein (gp7) of bacteriophage ϕ29

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badasso, Mohammed O., E-mail: badas001@umn.edu; Anderson, Dwight L.; Department of Oral Science, University of Minnesota, Minneapolis, MN 55455

2005-04-01

ϕ29 bacteriophage scaffolding protein (gp7) has been overproduced in E. coli, purified, crystallized and characterized by X-ray diffraction. Two distinct crystal forms were obtained and a diffraction data set was collected to 1.8 Å resolution. The Bacillus subtilis bacteriophage ϕ29 scaffolding protein (gp7) has been crystallized by the hanging-drop vapour-diffusion method at 293 K. Two new distinct crystal forms that both differed from a previously crystallized and solved scaffolding protein were grown under the same conditions. Form I belongs to the primitive tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 77.13, c = 37.12 Å.more » Form II crystals exhibit an orthorhombic crystal form, with space group C222 and unit-cell parameters a = 107.50, b = 107. 80, c = 37.34 Å. Complete data sets have been collected to 1.78 and 1.80 Å for forms I and II, respectively, at 100 K using Cu Kα X-rays from a rotating-anode generator. Calculation of a V{sub M} value of 2.46 Å{sup 3} Da{sup −1} for form I suggests the presence of one molecule in the asymmetric unit, corresponding to a solvent content of 50.90%, whereas form II has a V{sub M} of 4.80 Å{sup 3} Da{sup −1} with a solvent content of 48.76% and two molecules in the asymmetric unit. The structures of both crystal forms are being determined by the molecular-replacement method using the coordinates of the published crystal structure of gp7.« less

Crystallization and preliminary X-ray diffraction studies of vitamin D3 hydroxylase, a novel cytochrome P450 isolated from Pseudonocardia autotrophica

PubMed Central

Yasutake, Yoshiaki; Fujii, Yoshikazu; Cheon, Woo-Kwang; Arisawa, Akira; Tamura, Tomohiro

2009-01-01

Vitamin D3 hydroxylase (Vdh) is a novel cytochrome P450 monooxygenase isolated from the actinomycete Pseudonocardia autotrophica and consisting of 403 amino-acid residues. Vdh catalyzes the activation of vitamin D3 via sequential hydroxylation reactions: these reactions involve the conversion of vitamin D3 (cholecalciferol or VD3) to 25-hydroxyvitamin D3 [25(OH)VD3] and the subsequent conversion of 25(OH)VD3 to 1α,25-dihydroxyvitamin D3 [calciferol or 1α,25(OH)2VD3]. Overexpression of recombinant Vdh was carried out using a Rhodococcus erythropolis expression system and the protein was subsequently purified and crystallized. Two different crystal forms were obtained by the hanging-drop vapour-diffusion method at 293 K using polyethylene glycol as a precipitant. The form I crystal belonged to the trigonal space group P31, with unit-cell parameters a = b = 61.7, c = 98.8 Å. There is one Vdh molecule in the asymmetric unit, with a solvent content of 47.6%. The form II crystal was grown in the presence of 25(OH)VD3 and belonged to the orthorhombic system P212121, with unit-cell parameters a = 63.4, b = 65.6 c = 102.2 Å. There is one Vdh molecule in the asymmetric unit, with a solvent content of 46.7%. Native data sets were collected to resolutions of 1.75 and 3.05 Å for form I and form II crystals, respectively, using synchrotron radiation. The structure solution was obtained by the molecular-replacement method and model refinement is in progress for the form I crystal. PMID:19342783

Purification, crystallization and preliminary X-ray crystallographic studies of Rv3705c from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Feifei; Gao, Feng; Li, Honglin

The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.

Hanging drop crystal growth apparatus and method

NASA Technical Reports Server (NTRS)

Carter, Daniel C. (Inventor); Smith, Robbie E. (Inventor)

1989-01-01

An apparatus (10) is constructed having a cylindrical enclosure (16) within which a disc-shaped wicking element (18) is positioned. A well or recess (22) is cut into an upper side (24) of this wicking element, and a glass cover plate or slip (28) having a protein drop disposed thereon is sealably positioned on the wicking element (18), with drop (12) being positioned over well or recess (22). A flow of control fluid is generated by a programmable gradient former (16), with this control fluid having a vapor pressure that is selectively variable. This flow of control fluid is coupled to the wicking element (18) where control fluid vapor diffusing from walls (26) of the recess (22) is exposed to the drop (12), forming a vapor pressure gradient between the drop (12) and the control fluid vapor. Initially, this gradient is adjusted to draw solvent from the drop (12) at a relatively high rate, and as the critical supersaturation point is approached (the point at which crystal nucleation occurs), the gradient is reduced to more slowly draw solvent from the drop (12). This allows discrete protein molecules more time to orient themselves into an ordered crystalline lattice, producing protein crystals which, when processed by X-ray crystallography, possess a high degree of resolution.

Hanging drop: an in vitro air toxic exposure model using human lung cells in 2D and 3D structures.

PubMed

Liu, Faye F; Peng, Cheng; Escher, Beate I; Fantino, Emmanuelle; Giles, Cindy; Were, Stephen; Duffy, Lesley; Ng, Jack C

2013-10-15

Using benzene as a candidate air toxicant and A549 cells as an in vitro cell model, we have developed and validated a hanging drop (HD) air exposure system that mimics an air liquid interface exposure to the lung for periods of 1h to over 20 days. Dose response curves were highly reproducible for 2D cultures but more variable for 3D cultures. By comparing the HD exposure method with other classically used air exposure systems, we found that the HD exposure method is more sensitive, more reliable and cheaper to run than medium diffusion methods and the CULTEX(®) system. The concentration causing 50% of reduction of cell viability (EC50) for benzene, toluene, p-xylene, m-xylene and o-xylene to A549 cells for 1h exposure in the HD system were similar to previous in vitro static air exposure. Not only cell viability could be assessed but also sub lethal biological endpoints such as DNA damage and interleukin expressions. An advantage of the HD exposure system is that bioavailability and cell concentrations can be derived from published physicochemical properties using a four compartment mass balance model. The modelled cellular effect concentrations EC50cell for 1h exposure were very similar for benzene, toluene and three xylenes and ranged from 5 to 15 mmol/kgdry weight, which corresponds to the intracellular concentration of narcotic chemicals in many aquatic species, confirming the high sensitivity of this exposure method. Copyright © 2013 Elsevier B.V. All rights reserved.

Crystallization and X-ray diffraction analysis of the HMG domain of the chondrogenesis master regulator Sox9 in complex with a ChIP-Seq-identified DNA element

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vivekanandan, Saravanan; Moovarkumudalvan, Balasubramanian; Lescar, Julien

Sox9 is a fundamental sex-determining gene and the master regulator of chondrogenesis, and is involved in the development of various vital organs such as testes, kidney, heart and brain, and in skeletal development. Similar to other known Sox transcription factors, Sox9 recognizes and binds DNA with the consensus sequence C(T/A)TTG(T/A)(T/A) through the highly conserved HMG domain. Nonetheless, the molecular basis of the functional specificity of Sox9 in key developmental processes is still unclear. As an initial step towards a mechanistic understanding of Sox9 transcriptional regulation, the current work describes the details of the purification of the mouse Sox9 HMG domainmore » (mSox9HMG), its crystallization in complex with a ChIP-Seq-identified FOXP2 promoter DNA element and the X-ray diffraction data analysis of this complex. The mSox9HMG–FOXP2 promoter DNA complex was crystallized by the hanging-drop vapour-diffusion method using 20% PEG 3350 in 200 mMsodium/potassium phosphate with 100 mMbis-tris propane at pH 8.5. The crystals diffracted to 2.7 Å resolution and the complex crystallized in the tetragonal space groupP4 12 12, with unit-cell parametersa=b= 99.49,c= 45.89 Å. Crystal-packing parameters revealed that asymmetric unit contained one mSox9HMG–FOXP2 promoter DNA complex with an estimated solvent content of 64%.« less

Crystallization and preliminary crystallographic analysis of l-asparaginase from Erwinia carotovora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wikman, Linnea E. K.; Krasotkina, Julya; Kuchumova, Anastasia

2005-04-01

Er. carotovoral-asparaginase, a potential antileukaemic agent, has been crystallized. Crystals diffract to 2.6 Å using a rotating-anode source and belong to space group P2{sub 1}, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. Bacterial l-asparaginases have been used as therapeutic agents in the treatment of acute childhood lymphoblastic leukaemia for over 30 y. However, their use is limited owing to the glutaminase activity of the administered enzymes, which results in serious side effects. In contrast, l-asparaginase from Erwinia carotovora exhibits low glutaminase activity atmore » physiological concentrations of l-asparagine and l-glutamine in the blood. Recombinant Er. carotovoral-asparaginase was crystallized in the presence of l-glutamate by the hanging-drop vapour-diffusion method using 10 mg ml{sup −1} purified enzyme, 16–18%(w/v) PEG 3350 and 0.2 M NaF. X-ray diffraction data were collected to 2.6 Å at 293 K using an in-house rotating-anode generator. The crystals belong to the monoclinic P2{sub 1} space group, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. A molecular-replacement solution has been found and refinement is currently in progress. The crystal structure may provide leads towards protein-engineering efforts aimed at safer asparaginase administration in leukaemia treatment.« less

Characterization and reproducibility of HepG2 hanging drop spheroids toxicology in vitro.

PubMed

Hurrell, Tracey; Ellero, Andrea Antonio; Masso, Zelie Flavienne; Cromarty, Allan Duncan

2018-02-21

Hepatotoxicity remains a major challenge in drug development despite preclinical toxicity screening using hepatocytes of human origin. To overcome some limitations of reproducing the hepatic phenotype, more structurally and functionally authentic cultures in vitro can be introduced by growing cells in 3D spheroid cultures. Characterisation and reproducibility of HepG2 spheroid cultures using a high-throughput hanging drop technique was performed and features contributing to potential phenotypic variation highlighted. Cultured HepG2 cells were seeded into Perfecta 3D® 96-well hanging drop plates and assessed over time for morphology, viability, cell cycle distribution, protein content and protein-mass profiles. Divergent aspects which were assessed included cell stocks, seeding density, volume of culture medium and use of extracellular matrix additives. Hanging drops are advantageous due to no complex culture matrix being present, enabling background free extractions for downstream experimentation. Varying characteristics were observed across cell stocks and batches, seeding density, culture medium volume and extracellular matrix when using immortalized HepG2 cells. These factors contribute to wide-ranging cellular responses and highlights concerns with respect to generating a reproducible phenotype in HepG2 hanging drop spheroids. Copyright © 2018 Elsevier Ltd. All rights reserved.

Water collection behavior and hanging ability of bioinspired fiber.

PubMed

Hou, Yongping; Chen, Yuan; Xue, Yan; Zheng, Yongmei; Jiang, Lei

2012-03-13

Since the water-collecting ability of the wetted cribellate spider capture silk is the result of a unique fiber structure, bioinspired fibers have been researched significantly so as to expose a new water-acquiring route in fogging-collection projects. However, the design of the geometry of bioinspired fiber is related to the ability of hanging drops, which has not been investigated in depth so far. Here, we fabricate bioinspired fibers to investigate the water collection behavior and the influence of geometry (i.e., periodicity of spindle knot) on the hanging-drop ability. We especially discuss water collection related to the periodicity of geometry on the bioinspired fiber. We reveal the length of the three phase contact line (TCL) at threshold conditions in conjunction with the maximal volume of a hanging drop at different modes. The study demonstrates that the geometrical structure of bioinspired fiber induces much stronger water hanging ability than that of uniform fiber, attributed to such special geometry that offers effectively an increasing TCL length or limits the contact length to be shorted. In addition, the geometry also improves the fog-collection efficiency by controlling tiny water drops to be collected in the large water drops at a given location.

Adding the ‘heart’ to hanging drop networks for microphysiological multi-tissue experiments†

PubMed Central

Yazdi, Saeed Rismani; Shadmani, Amir; Bürgel, Sebastian C.; Misun, Patrick M.; Hierlemann, Andreas; Frey, Olivier

2017-01-01

Microfluidic hanging-drop networks enable culturing and analysis of 3D microtissue spheroids derived from different cell types under controlled perfusion and investigating inter-tissue communication in multi-tissue formats. In this paper we introduce a compact on-chip pumping approach for flow control in hanging-drop networks. The pump includes one pneumatic chamber located directly above one of the hanging drops and uses the surface tension at the liquid–air-interface for flow actuation. Control of the pneumatic protocol provides a wide range of unidirectional pulsatile and continuous flow profiles. With the proposed concept several independent hanging-drop networks can be operated in parallel with only one single pneumatic actuation line at high fidelity. Closed-loop medium circulation between different organ models for multi-tissue formats and multiple simultaneous assays in parallel are possible. Finally, we implemented a real-time feedback control-loop of the pump actuation based on the beating of a human iPS-derived cardiac microtissue cultured in the same system. This configuration allows for simulating physiological effects on the heart and their impact on flow circulation between the organ models on chip. PMID:26401602

Generation of multicellular tumor spheroids by the hanging-drop method.

PubMed

Timmins, Nicholas E; Nielsen, Lars K

2007-01-01

Owing to their in vivo-like characteristics, three-dimensional (3D) multicellular tumor spheroid (MCTS) cultures are gaining increasing popularity as an in vitro model of tumors. A straightforward and simple approach to the cultivation of these MCTS is the hanging-drop method. Cells are suspended in droplets of medium, where they develop into coherent 3D aggregates and are readily accessed for analysis. In addition to being simple, the method eliminates surface interactions with an underlying substratum (e.g., polystyrene plastic or agarose), requires only a low number of starting cells, and is highly reproducible. This method has also been applied to the co-cultivation of mixed cell populations, including the co-cultivation of endothelial cells and tumor cells as a model of early tumor angiogenesis.

Hanging drop culture enhances differentiation of human adipose-derived stem cells into anterior neuroectodermal cells using small molecules.

PubMed

Amirpour, Noushin; Razavi, Shahnaz; Esfandiari, Ebrahim; Hashemibeni, Batoul; Kazemi, Mohammad; Salehi, Hossein

2017-06-01

Inspired by in vivo developmental process, several studies were conducted to design a protocol for differentiating of mesenchymal stem cells into neural cells in vitro. Human adipose-derived stem cells (hADSCs) as mesenchymal stem cells are a promising source for this purpose. At current study, we applied a defined neural induction medium by using small molecules for direct differentiation of hADSCs into anterior neuroectodermal cells. Anterior neuroectodermal differentiation of hADSCs was performed by hanging drop and monolayer protocols. At these methods, three small molecules were used to suppress the BMP, Nodal, and Wnt signaling pathways in order to obtain anterior neuroectodermal (eye field) cells from hADSCs. After two and three weeks of induction, the differentiated cells with neural morphology expressed anterior neuroectodermal markers such as OTX2, SIX3, β-TUB III and PAX6. The protein expression of such markers was confirmed by real time, RT-PCR and immunocytochemistry methods According to our data, it seems that the hanging drop method is a proper approach for neuroectodermal induction of hADSCs. Considering wide availability and immunosuppressive properties of hADSCs, these cells may open a way for autologous cell therapy of neurodegenerative disorders. Copyright © 2017 ISDN. Published by Elsevier Ltd. All rights reserved.

Mouse ES cells have a potential to differentiate into odontoblast-like cells using hanging drop method.

PubMed

Kawai, R; Ozeki, N; Yamaguchi, H; Tanaka, T; Nakata, K; Mogi, M; Nakamura, H

2014-05-01

We examined whether mouse embryonic stem (ES) cells can differentiate into odontoblast-like cells without epithelial-mesenchymal interaction. Cells were cultured by the 'hanging drop' method using a collagen type-I scaffold (CS) combined with bone morphogenetic protein (BMP)-4 (CS/BMP-4). Expression of odontoblast-related mRNA and protein, and cell proliferation were performed by reverse transcription-polymerase chain reaction (RT-PCR), immunofluorescence staining and WST-1 assay, respectively. Cells potently expressed odontoblast-related cell marker mRNAs following induction of odontoblastic differentiation. Dentin sialophosphoprotein, a marker of mature odontoblasts, was strongly expressed in differentiated ES cells. The cells also acquired an odontoblast-like functional phenotype, as evidenced by the appearance of alkaline phosphatase activity and calcification. The cell-surface expression of α2, α6, αV and αVβ3 integrin proteins was rapidly upregulated in differentiated cells. Finally, anti-α2 integrin antibody suppressed the expression of odontoblastic markers in cells grown using this culture system, suggesting that α2 integrin expression in ES cells triggers their differentiation into odontoblast-like cells. Mouse ES cells cultured by the 'hanging drop' method are able to differentiate into cells with odontoblast-specific physiological functions and cell-surface integrin protein expression. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

The effect of body position on the 'hanging drop' method for identifying the extradural space in anaesthetized dogs.

PubMed

Naganobu, Kiyokazu; Hagio, Mitsuyoshi

2007-01-01

To assess the accuracy of the 'hanging drop method' for identifying the extradural space in anaesthetized dogs positioned in sternal or lateral recumbency. Prospective randomized-experimental study. Seventeen clinically healthy adult dogs, 10 females and seven males weighing 8.4-26.2 kg. Dogs were positioned in either sternal (n = 8) or lateral (n = 9) recumbency under general anaesthesia. A 20 SWG spinal needle pre-filled with 0.9% saline was advanced through the skin into the lumbosacral extradural space and the response of the saline drop recorded, i.e. whether it: 1) was aspirated from the hub into the needle; 2) remained within the hub, or 3) moved synchronously with i) spontaneous respiration, ii) heart beat or iii) manual lung inflation. The position of the needle tip was ultimately determined by positive contrast radiography. One dog positioned in lateral recumbency was excluded from the study because bleeding occurred from the needle hub. Saline was aspirated into the needle in seven of eight dogs held in sternal recumbency but in none of the dogs positioned in lateral recumbency. Accurate needle tip placement in the extradural space was confirmed by positive contrast radiography in all dogs. The 'hanging drop' method, when performed with a spinal needle, appears to be a useful technique for identifying the location of the extradural space in anaesthetized medium-sized dogs positioned in sternal, but not in lateral recumbency. The technique may yield 'false negative' results when performed in dogs positioned in sternal recumbency.

Micro-Ring Structures Stabilize Microdroplets to Enable Long Term Spheroid Culture in 384 Hanging Drop Array Plates

PubMed Central

Hsiao, Amy Y.; Tung, Yi-Chung; Kuo, Chuan-Hsien; Mosadegh, Bobak; Bedenis, Rachel; Pienta, Kenneth J.; Takayama, Shuichi

2012-01-01

Using stereolithography, 20 different structural variations comprised of millimeter diameter holes surrounded by trenches, plateaus, or micro-ring structures were prepared and tested for their ability to stably hold arrays of microliter sized droplets within the structures over an extended period of time. The micro-ring structures were the most effective in stabilizing droplets against mechanical and chemical perturbations. After confirming the importance of micro-ring structures using rapid prototyping, we developed an injection molding tool for mass production of polystyrene 3D cell culture plates with an array of 384 such micro-ring surrounded through-hole structures. These newly designed and injection molded polystyrene 384 hanging drop array plates with micro-rings were stable and robust against mechanical perturbations as well as surface fouling-facilitated droplet spreading making them capable of long term cell spheroid culture of up to 22 days within the droplet array. This is a significant improvement over previously reported 384 hanging drop array plates which are susceptible to small mechanical shocks and could not reliably maintain hanging drops for longer than a few days. With enhanced droplet stability, the hanging drop array plates with micro-ring structures provide better platforms and open up new opportunities for high-throughput preparation of microscale 3D cell constructs for drug screening and cell analysis. PMID:22057945

Micro-ring structures stabilize microdroplets to enable long term spheroid culture in 384 hanging drop array plates.

PubMed

Hsiao, Amy Y; Tung, Yi-Chung; Kuo, Chuan-Hsien; Mosadegh, Bobak; Bedenis, Rachel; Pienta, Kenneth J; Takayama, Shuichi

2012-04-01

Using stereolithography, 20 different structural variations comprised of millimeter diameter holes surrounded by trenches, plateaus, or micro-ring structures were prepared and tested for their ability to stably hold arrays of microliter sized droplets within the structures over an extended period of time. The micro-ring structures were the most effective in stabilizing droplets against mechanical and chemical perturbations. After confirming the importance of micro-ring structures using rapid prototyping, we developed an injection molding tool for mass production of polystyrene 3D cell culture plates with an array of 384 such micro-ring surrounded through-hole structures. These newly designed and injection molded polystyrene 384 hanging drop array plates with micro-rings were stable and robust against mechanical perturbations as well as surface fouling-facilitated droplet spreading making them capable of long term cell spheroid culture of up to 22 days within the droplet array. This is a significant improvement over previously reported 384 hanging drop array plates which are susceptible to small mechanical shocks and could not reliably maintain hanging drops for longer than a few days. With enhanced droplet stability, the hanging drop array plates with micro-ring structures provide better platforms and open up new opportunities for high-throughput preparation of microscale 3D cell constructs for drug screening and cell analysis.

Exposure assessment of ETBE in gas station workers and gasoline tanker truck drivers.

PubMed

Eitaki, Yoko; Kawai, Toshio; Omae, Kazuyuki

2011-01-01

In order to measure occupational exposure concentrations of ethyl tertiary-butyl ether (ETBE), we developed a diffusive sampling method for monitoring ETBE and performed an ETBE exposure assessment. The applicability of diffusive samplers was examined by exposing the samplers to ETBE vapor in test chambers. The personal exposure levels of workers and airborne concentrations were measured at 4 gas stations. The ETBE sampling rate for the diffusive samplers (VOC-SD, Sigma-Aldrich Japan) was 25.04 ml/min (25°C). Compared with the active sampling method, the diffusive samplers could be used for short-term measurements and in environments containing a mixture of organic solvents. The geometric mean (GM) of TWA-8h ETBE was 0.08 ppm (0.02-0.28 ppm) in 28 gas station workers and 0.04 ppm (0.01-0.21 ppm) in 2 gasoline tanker truck drivers. With regard to ETBE airborne concentrations, the GM was 4.12 ppm (0.93-8.71 ppm) at the handles of hanging pumps but dropped to less than 0.01 ppm (less than 0.01-0.01 ppm) at the side of a public road. The diffusive sampling method can be used for the measurement of occupational ETBE exposure. The threshold limit of TLV-TWA 5 ppm recommended by the ACGIH was not exceeded in any of the workers in this study.

Mixing of multiple metal vapours into an arc plasma in gas tungsten arc welding of stainless steel

NASA Astrophysics Data System (ADS)

Park, Hunkwan; Trautmann, Marcus; Tanaka, Keigo; Tanaka, Manabu; Murphy, Anthony B.

2017-11-01

A computational model of the mixing of multiple metal vapours, formed by vaporization of the surface of an alloy workpiece, into the thermal arc plasma in gas tungsten arc welding (GTAW) is presented. The model incorporates the combined diffusion coefficient method extended to allow treatment of three gases, and is applied to treat the transport of both chromium and iron vapour in the helium arc plasma. In contrast to previous models of GTAW, which predict that metal vapours are swept away to the edge of the arc by the plasma flow, it is found that the metal vapours penetrate strongly into the arc plasma, reaching the cathode region. The predicted results are consistent with published measurements of the intensity of atomic line radiation from the metal vapours. The concentration of chromium vapour is predicted to be higher than that of iron vapour due to its larger vaporization rate. An accumulation of chromium vapour is predicted to occur on the cathode at about 1.5 mm from the cathode tip, in agreement with published measurements. The arc temperature is predicted to be strongly reduced due to the strong radiative emission from the metal vapours. The driving forces causing the diffusion of metal vapours into the helium arc are examined, and it is found that diffusion due to the applied electric field (cataphoresis) is dominant. This is explained in terms of large ionization energies and the small mass of helium compared to those of the metal vapours.

Structure of the buffalo secretory signalling glycoprotein at 2.8 Å resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ethayathulla, Abdul S.; Srivastava, Devendra B.; Kumar, Janesh

2007-04-01

The crystal structure of a signalling glycoprotein isolated from buffalo dry secretions (SPB-40) has been determined at 2.8 Å resolution. Two unique residues, Tyr120 and Glu269, found in SPB-40 distort the shape of the sugar-binding groove considerably. The water structure in the groove is also different. The conformations of three flexible loops, His188–His197, Phe202–Arg212 and Tyr244–Pro260, also differ from those found in other structurally similar proteins. The crystal structure of a 40 kDa signalling glycoprotein from buffalo (SPB-40) has been determined at 2.8 Å resolution. SPB-40 acts as a protective signalling factor by binding to viable cells during the earlymore » phase of involution, during which extensive tissue remodelling occurs. It was isolated from the dry secretions of Murrah buffalo. It was purified and crystallized using the hanging-drop vapour-diffusion method with 19% ethanol as the precipitant. The protein was also cloned and its complete nucleotide and amino-acid sequences were determined. When compared with the sequences of other members of the family, the sequence of SPB-40 revealed two very important mutations in the sugar-binding region, in which Tyr120 changed to Trp120 and Glu269 changed to Trp269. The structure showed a significant distortion in the shape of the sugar-binding groove. The water structure in the groove is also drastically altered. The folding of the protein chain in the flexible region comprising segments His188–His197, Phe202–Arg212 and Tyr244–Pro260 shows large variations when compared with other proteins of the family.« less

Crystallization and preliminary X-ray crystallographic analysis of an ice-binding protein (FfIBP) from Flavobacterium frigoris PS1.

PubMed

Do, Hackwon; Lee, Jun Hyuck; Lee, Sung Gu; Kim, Hak Jun

2012-07-01

Ice growth in a cold environment is fatal for polar organisms, not only because of the physical destruction of inner cell organelles but also because of the resulting chemical damage owing to processes such as osmotic shock. The properties of ice-binding proteins (IBPs), which include antifreeze proteins (AFPs), have been characterized and IBPs exhibit the ability to inhibit ice growth by binding to specific ice planes and lowering the freezing point. An ice-binding protein (FfIBP) from the Gram-negative bacterium Flavobacterium frigoris PS1, which was isolated from the Antarctic, has recently been overexpressed. Interestingly, the thermal hysteresis activity of FfIBP was approximately 2.5 K at 50 µM, which is ten times higher than that of the moderately active IBP from Arctic yeast (LeIBP). Although FfIBP closely resembles LeIBP in its amino-acid sequence, the antifreeze activity of FfIBP appears to be much greater than that of LeIBP. In an effort to understand the reason for this difference, an attempt was made to solve the crystal structure of FfIBP. Here, the crystallization and X-ray diffraction data of FfIBP are reported. FfIBP was crystallized using the hanging-drop vapour-diffusion method with 0.1 M sodium acetate pH 4.4 and 3 M sodium chloride as precipitant. A complete diffraction data set was collected to a resolution of 2.9 Å. The crystal belonged to space group P4(1)22, with unit-cell parameters a = b = 69.4, c = 178.2 Å. The asymmetric unit contained one monomer.

Expression, purification and crystallization of two major envelope proteins from white spot syndrome virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Xuhua; Hew, Choy Leong, E-mail: dbshewcl@nus.edu.sg

2007-07-01

The crystallization of the N-terminal transmembrane region-truncated VP26 and VP28 of white spot syndrome virus is described. White spot syndrome virus (WSSV) is a major virulent pathogen known to infect penaeid shrimp and other crustaceans. VP26 and VP28, two major envelope proteins from WSSV, have been identified and overexpressed in Escherichia coli. In order to facilitate purification and crystallization, predicted N-terminal transmembrane regions of approximately 35 amino acids have been truncated from both VP26 and VP28. Truncated VP26 and VP28 and their corresponding SeMet-labelled proteins were purified and the SeMet proteins were crystallized by the hanging-drop vapour-diffusion method. Crystals ofmore » SeMet-labelled VP26 were obtained using a reservoir consisting of 0.1 M citric acid pH 3.5, 3.0 M sodium chloride and 1%(w/v) polyethylene glycol 3350, whereas SeMet VP28 was crystallized using a reservoir solution consisting of 25% polyethylene glycol 8000, 0.2 M calcium acetate, 0.1 M Na HEPES pH 7.5 and 1.5%(w/v) 1,2,3-heptanetriol. Crystals of SeMet-labelled VP26 diffract to 2.2 Å resolution and belong to space group R32, with unit-cell parameters a = b = 73.92, c = 199.31 Å. SeMet-labelled VP28 crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 105.33, b = 106.71, c = 200.37 Å, and diffracts to 2.0 Å resolution.« less

Crystallization and preliminary X-ray diffraction studies of Seneca Valley Virus-001, a new member of the Picornaviridae family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Venkataraman, Sangita; Reddy, Seshidhar P.; Loo, Jackie

2008-04-01

Seneca Valley Virus-001 of the Picornavirdae family was crystallized in the space group R3 and X-ray diffraction data was collected to a resolution of 2.3 Å. Rotation-function studies suggested the presence of two distict sets of 20 protomers that belong to two different virus particles in the crystallographic asymmetric unit. Seneca Valley Virus-001 (SVV-001) is a newly found species in the Picornaviridae family. SVV-001 is the first naturally occurring nonpathogenic picorna@@virus observed to mediate selective cytotoxicity towards tumor cells with neuroendocrine cancer features. The nonsegmented (+)ssRNA genome of SVV-001 shares closest sequence similarity to the genomes of the members ofmore » the Cardiovirus genus. However, based on the distinct characteristics of the genome organization and other biochemical properties, it has been suggested that SVV-001 represents a new genus, namely ‘Senecavirus’, in the Picornaviridae family. In order to understand the oncolytic properties of SVV-001, the native virus was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group R3, with unit-cell parameters (in the hexagonal setting) a = b = 311.5, c = 1526.4 Å. Although the SVV crystals diffracted to better than 2.3 Å resolution, the data quality is acceptable [I/σ(I) > 2.0] to 2.6 Å resolution. The unit-cell volume and the locked rotation-function analysis suggest that six particles could be accommodated in the unit cell, with two distinct sets of one third of a particle, each containing 20 protomers, occupying the crystallographic asymmetric unit.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kish, Kevin; McDonnell, Patricia A.; Goldfarb, Valentina

Protein tyrosine phosphatase {gamma} is a membrane-bound receptor and is designated RPTP{gamma}. RPTP{gamma} and two mutants, RPTP{gamma}(V948I, S970T) and RPTP{gamma}(C858S, S970T), were recombinantly expressed and purified for X-ray crystallographic studies. The purified enzymes were crystallized using the hanging-drop vapor-diffusion method. Crystallographic data were obtained from several different crystal forms in the absence and the presence of inhibitor. In this paper, a description is given of how three different crystal forms were obtained that were used with various ligands. An orthorhombic crystal form and a trigonal crystal form were obtained both with and without ligand, and a monoclinic crystal form wasmore » only obtained in the presence of a particularly elaborated inhibitor.« less

Liquid-liquid diffusion crystallization improves the X-ray diffraction of EndoS, an endo-β-N-acetylglucosaminidase from Streptococcus pyogenes with activity on human IgG.

PubMed

Trastoy, Beatriz; Lomino, Joseph V; Wang, Lai Xi; Sundberg, Eric J

2013-12-01

Endoglycosidase S (EndoS) is an enzyme secreted by Streptococcus pyogenes that specifically hydrolyzes the β-1,4-di-N-acetylchitobiose core glycan on immunoglobulin G (IgG) antibodies. One of the most common human pathogens and the cause of group A streptococcal infections, S. pyogenes secretes EndoS in order to evade the host immune system by rendering IgG effector mechanisms dysfunctional. On account of its specificity for IgG, EndoS has also been used extensively for chemoenzymatic synthesis of homogeneous IgG glycoprotein preparations and is being developed as a novel therapeutic for a wide range of autoimmune diseases. The structural basis of its enzymatic activity and substrate specificity, however, remains unknown. Here, the purification and crystallization of EndoS are reported. Using traditional hanging-drop and sitting-drop vapor-diffusion crystallization, crystals of EndoS were grown that diffracted to a maximum of 3.5 Å resolution but suffered from severe anisotropy, the data from which could only be reasonably processed to 7.5 Å resolution. When EndoS was crystallized by liquid-liquid diffusion, it was possible to grow crystals with a different space group to those obtained by vapor diffusion. Crystals of wild-type endoglycosidase and glycosynthase constructs of EndoS grown by liquid-liquid diffusion diffracted to 2.6 and 1.9 Å resolution, respectively, with a greatly diminished anisotropy. Despite extensive efforts, the failure to reproduce these liquid-liquid diffusion-grown crystals by vapor diffusion suggests that these crystallization methods each sample a distinct crystallization space.

Overexpression, purification, crystallization and preliminary structural studies of catabolic ornithine transcarbamylase from Lactobacillus hilgardii

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rivas, Blanca de las; Rodríguez, Héctor; Angulo, Iván

2007-07-01

The catabolic ornithine transcarbamylase (cOTC) from L. hilgardii has been overexpressed in E. coli, purified and crystallized under two different experimental conditions. The structure has been solved by the molecular-replacement method using the atomic coordinates of catabolic ornithine transcarbamylase from P. aeruginosa as the search model. The catabolic ornithine transcarbamylase (cOTC; EC 2.1.3.3) from the lactic acid bacteria Lactobacillus hilgardii is a key protein involved in the degradation of arginine during malolactic fermentation. cOTC containing an N-terminal His{sub 6} tag has been overexpressed in Escherichia coli, purified and crystallized under two different experimental conditions using the hanging-drop vapour-diffusion method. Crystalsmore » obtained from a solution containing 8%(w/v) PEG 4000, 75 mM sodium acetate pH 4.6 belong to the trigonal space group P321 and have unit-cell parameters a = b = 157.04, c = 79.28 Å. Conversely, crystals grown in 20%(v/v) 2-methyl-2,4-pentanediol, 7.5%(w/v) PEG 4000, 100 mM HEPES pH 7.8 belong to the monoclinic space group C2 and have unit-cell parameters a = 80.06, b = 148.90, c = 91.67 Å, β = 100.25°. Diffraction data were collected in-house to 3.00 and 2.91 Å resolution for trigonal and monoclinic crystals, respectively. The estimated Matthews coefficient for the crystal forms were 2.36 and 2.24 Å{sup 3} Da{sup −1}, respectively, corresponding to 48% and 45% solvent content. In both cases, the results are consistent with the presence of three protein subunits in the asymmetric unit. The structure of cOTC has been determined by the molecular-replacement method using the atomic coordinates of cOTC from Pseudomonas aeruginosa (PDB code) as the search model.« less

A hollow sphere soft lithography approach for long-term hanging drop methods.

PubMed

Lee, Won Gu; Ortmann, Daniel; Hancock, Matthew J; Bae, Hojae; Khademhosseini, Ali

2010-04-01

In conventional hanging drop (HD) methods, embryonic stem cell aggregates or embryoid bodies (EBs) are often maintained in small inverted droplets. Gravity limits the volumes of these droplets to less than 50 microL, and hence such cell cultures can only be sustained for a few days without frequent media changes. Here we present a new approach to performing long-term HD methods (10-15 days) that can provide larger media reservoirs in a HD format to maintain more consistent culture media conditions. To implement this approach, we fabricated hollow sphere (HS) structures by injecting liquid drops into noncured poly(dimethylsiloxane) mixtures. These structures served as cell culture chambers with large media volumes (500 microL in each sphere) where EBs could grow without media depletion. The results showed that the sizes of the EBs cultured in the HS structures in a long-term HD format were approximately twice those of conventional HD methods after 10 days in culture. Further, HS cultures showed multilineage differentiation, similar to EBs cultured in the HD method. Due to its ease of fabrication and enhanced features, this approach may be of potential benefit as a stem cell culture method for regenerative medicine.

A Hollow Sphere Soft Lithography Approach for Long-Term Hanging Drop Methods

PubMed Central

Lee, Won Gu; Ortmann, Daniel; Hancock, Matthew J.; Bae, Hojae

2010-01-01

In conventional hanging drop (HD) methods, embryonic stem cell aggregates or embryoid bodies (EBs) are often maintained in small inverted droplets. Gravity limits the volumes of these droplets to less than 50 μL, and hence such cell cultures can only be sustained for a few days without frequent media changes. Here we present a new approach to performing long-term HD methods (10–15 days) that can provide larger media reservoirs in a HD format to maintain more consistent culture media conditions. To implement this approach, we fabricated hollow sphere (HS) structures by injecting liquid drops into noncured poly(dimethylsiloxane) mixtures. These structures served as cell culture chambers with large media volumes (500 μL in each sphere) where EBs could grow without media depletion. The results showed that the sizes of the EBs cultured in the HS structures in a long-term HD format were approximately twice those of conventional HD methods after 10 days in culture. Further, HS cultures showed multilineage differentiation, similar to EBs cultured in the HD method. Due to its ease of fabrication and enhanced features, this approach may be of potential benefit as a stem cell culture method for regenerative medicine. PMID:19505251

Controlling Vapor Pressure In Hanging-Drop Crystallization

NASA Technical Reports Server (NTRS)

Carter, Daniel C.; Smith, Robbie

1988-01-01

Rate of evaporation adjusted to produce larger crystals. Device helps to control vapor pressure of water and other solvents in vicinity of hanging drop of solution containing dissolved enzyme protein. Well of porous frit (sintered glass) holds solution in proximity to drop of solution containing protein or enzyme. Vapor from solution in frit controls evaporation of solvent from drop to control precipitation of protein or enzyme. With device, rate of nucleation limited to decrease number and increase size (and perhaps quality) of crystals - large crystals of higher quality needed for x-ray diffraction studies of macromolecules.

Purification and crystallization of the ABC-type transport substrate-binding protein OppA from Thermoanaerobacter tengcongensis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Jinlan; Li, Xiaolu; Tsinghua-Peking Joint Center for Life Sciences, Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing 100084, People's Republic of China

2012-06-22

Highlights: Black-Right-Pointing-Pointer We truncated the signal peptide of OppA{sub TTE0054} to make it express in Escherichia coli as a soluble protein. Black-Right-Pointing-Pointer Crystals of OppA{sub TTE0054} were grown by sitting-drop vapor diffusion method. Black-Right-Pointing-Pointer The crystal of OppA{sub TTE0054} diffracted to 2.25 A. -- Abstract: Di- and oligopeptide- binding protein OppAs play important roles in solute and nutrient uptake, sporulation, biofilm formation, cell wall muropeptides recycling, peptide-dependent quorum-sensing responses, adherence to host cells, and a variety of other biological processes. Soluble OppA from Thermoanaerobacter tengcongensis was expressed in Escherichia coli. The protein was found to be >95% pure with SDS-PAGEmore » after a series of purification steps and the purity was further verified by mass spectrometry. The protein was crystallized using the sitting-drop vapour-diffusion method with PEG 400 as the precipitant. Crystal diffraction extended to 2.25 A. The crystal belonged to space group C222{sub 1}, with unit-cell parameters of a = 69.395, b = 199.572, c = 131.673 A, and {alpha} = {beta} = {gamma} = 90 Degree-Sign .« less

Crystallization and X-ray diffraction analysis of 6-­aminohexanoate-dimer hydrolase from Arthrobacter sp. KI72

PubMed Central

Ohki, Taku; Mizuno, Nobuhiro; Shibata, Naoki; Takeo, Masahiro; Negoro, Seiji; Higuchi, Yoshiki

2005-01-01

To investigate the structure–function relationship between 6-aminohexanoate-dimer hydrolase (EII) from Arthrobacter sp. and a cryptic protein (EII′) which shows 88% sequence identity to EII, a hybrid protein (named Hyb-24) of EII and EII′ was overexpressed, purified and crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant in MES buffer pH 6.5. The crystal belongs to space group P3121 or P3221, with unit-cell parameters a = b = 96.37, c = 113.09 Å. Diffraction data were collected from native and methylmercuric chloride derivative crystals to resolutions of 1.75 and 1.80 Å, respectively. PMID:16511198

Purification, crystallization and preliminary X-ray diffraction studies of N-acetylglucosamine-phosphate mutase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi

2006-04-01

Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.

Optimization of the formation of embedded multicellular spheroids of MCF-7 cells: How to reliably produce a biomimetic 3D model.

PubMed

Zhang, Wenli; Li, Caibin; Baguley, Bruce C; Zhou, Fang; Zhou, Weisai; Shaw, John P; Wang, Zhen; Wu, Zimei; Liu, Jianping

2016-12-15

To obtain a multicellular MCF-7 spheroid model to mimic the three-dimensional (3D) of tumors, the microwell liquid overlay (A) and hanging-drop/agar (B) methods were first compared for their technical parameters. Then a method for embedding spheroids within collagen was optimized. For method A, centrifugation assisted cells form irregular aggregates but not spheroids. For method B, an extended sedimentation period of over 24 h for cell suspensions and increased viscosity of the culture medium using methylcellulose were necessary to harvest a dense and regular cell spheroid. When the number was less than 5000 cells/drop, embedded spheroids showed no tight cores and higher viability than the unembedded. However, above 5000 cells/drop, cellular viability of embedded spheroids was not significantly different from unembedded spheroids and cells invading through the collagen were in a sun-burst pattern with tight cores. Propidium Iodide staining indicated that spheroids had necrotic cores. The doxorubicin cytotoxicity demonstrated that spheroids were less susceptible to DOX than their monolayer cells. A reliable and reproducible method for embedding spheroids using the hanging-drop/agarose method within collagen is described herein. The cell culture model can be used to guide experimental manipulation of 3D cell cultures and to evaluate anticancer drug efficacy. Copyright © 2016 Elsevier Inc. All rights reserved.

Hanging Drop, A Best Three-Dimensional (3D) Culture Method for Primary Buffalo and Sheep Hepatocytes.

PubMed

Shri, Meena; Agrawal, Himanshu; Rani, Payal; Singh, Dheer; Onteru, Suneel Kumar

2017-04-26

Livestock, having close resemblance to humans, could be a better source of primary hepatocytes than rodents. Herein, we successfully developed three-dimensional (3D) culturing system for primary sheep and buffalo hepatocytes. The 3D-structures of sheep hepatocytes were formed on the fifth-day and maintained until the tenth-day on polyHEMA-coated plates and in hanging drops with William's E media (HDW). Between the cultured and fresh cells, we observed a similar expression of GAPDH, HNF4α, ALB, CYP1A1, CK8 and CK18. Interestingly, a statistically significant increase was noted in the TAT, CPS, AFP, AAT, GSP and PCNA expression. In buffalo hepatocytes culture, 3D-like structures were formed on the third-day and maintained until the sixth-day on polyHEMA and HDW. The expression of HNF4α, GSP, CPS, AFP, AAT, PCNA and CK18 was similar between cultured and fresh cells. Further, a statistically significant increase in the TAT and CK8 expression, and a decrease in the GAPDH, CYP1A1 and ALB expression were noted. Among the culture systems, HDW maintained the liver transcript markers more or less similar to the fresh hepatocytes of the sheep and buffalo for ten and six days, respectively. Taken together, hanging drop is an efficient method for 3D culturing of primary sheep and buffalo hepatocytes.

Reconfigurable microfluidic hanging drop network for multi-tissue interaction and analysis.

PubMed

Frey, Olivier; Misun, Patrick M; Fluri, David A; Hengstler, Jan G; Hierlemann, Andreas

2014-06-30

Integration of multiple three-dimensional microtissues into microfluidic networks enables new insights in how different organs or tissues of an organism interact. Here, we present a platform that extends the hanging-drop technology, used for multi-cellular spheroid formation, to multifunctional complex microfluidic networks. Engineered as completely open, 'hanging' microfluidic system at the bottom of a substrate, the platform features high flexibility in microtissue arrangements and interconnections, while fabrication is simple and operation robust. Multiple spheroids of different cell types are formed in parallel on the same platform; the different tissues are then connected in physiological order for multi-tissue experiments through reconfiguration of the fluidic network. Liquid flow is precisely controlled through the hanging drops, which enable nutrient supply, substance dosage and inter-organ metabolic communication. The possibility to perform parallelized microtissue formation on the same chip that is subsequently used for complex multi-tissue experiments renders the developed platform a promising technology for 'body-on-a-chip'-related research.

Transfer, Imaging, and Analysis Plate for Facile Handling of 384 Hanging Drop 3D Tissue Spheroids

PubMed Central

Cavnar, Stephen P.; Salomonsson, Emma; Luker, Kathryn E.; Luker, Gary D.; Takayama, Shuichi

2014-01-01

Three-dimensional culture systems bridge the experimental gap between in vivo and in vitro physiology. However, nonstandardized formation and limited downstream adaptability of 3D cultures have hindered mainstream adoption of these systems for biological applications, especially for low- and moderate-throughput assays commonly used in biomedical research. Here we build on our recent development of a 384-well hanging drop plate for spheroid culture to design a complementary spheroid transfer and imaging (TRIM) plate. The low-aspect ratio wells of the TRIM plate facilitated highfidelity, user-independent, contact-based collection of hanging drop spheroids. Using the TRIM plate, we demonstrated several downstream analyses, including bulk tissue collection for flow cytometry, high-resolution low working-distance immersion imaging, and timely reagent delivery for enzymatic studies. Low working-distance multiphoton imaging revealed a cell type–dependent, macroscopic spheroid structure. Unlike ovarian cancer spheroids, which formed loose, disk-shaped spheroids, human mammary fibroblasts formed tight, spherical, and nutrient-limited spheroids. Beyond the applications we describe here, we expect the hanging drop spheroid plate and complementary TRIM plate to facilitate analyses of spheroids across the spectrum of throughput, particularly for bulk collection of spheroids and high-content imaging. PMID:24051516

Transfer, imaging, and analysis plate for facile handling of 384 hanging drop 3D tissue spheroids.

PubMed

Cavnar, Stephen P; Salomonsson, Emma; Luker, Kathryn E; Luker, Gary D; Takayama, Shuichi

2014-04-01

Three-dimensional culture systems bridge the experimental gap between in vivo and in vitro physiology. However, nonstandardized formation and limited downstream adaptability of 3D cultures have hindered mainstream adoption of these systems for biological applications, especially for low- and moderate-throughput assays commonly used in biomedical research. Here we build on our recent development of a 384-well hanging drop plate for spheroid culture to design a complementary spheroid transfer and imaging (TRIM) plate. The low-aspect ratio wells of the TRIM plate facilitated high-fidelity, user-independent, contact-based collection of hanging drop spheroids. Using the TRIM plate, we demonstrated several downstream analyses, including bulk tissue collection for flow cytometry, high-resolution low working-distance immersion imaging, and timely reagent delivery for enzymatic studies. Low working-distance multiphoton imaging revealed a cell type-dependent, macroscopic spheroid structure. Unlike ovarian cancer spheroids, which formed loose, disk-shaped spheroids, human mammary fibroblasts formed tight, spherical, and nutrient-limited spheroids. Beyond the applications we describe here, we expect the hanging drop spheroid plate and complementary TRIM plate to facilitate analyses of spheroids across the spectrum of throughput, particularly for bulk collection of spheroids and high-content imaging.

Systematic Improvement of Protein Crystals by Determining the Supersolubility Curves of Phase Diagrams

PubMed Central

Saridakis, Emmanuel; Chayen, Naomi E.

2003-01-01

A systematic approach for improving protein crystals by growing them in the metastable zone using the vapor diffusion technique is described. This is a simple technique for optimization of crystallization conditions. Screening around known conditions is performed to establish a working phase diagram for the crystallization of the protein. Dilutions of the crystallization drops across the supersolubility curve into the metastable zone are then carried out as follows: the coverslips holding the hanging drops are transferred, after being incubated for some time at conditions normally giving many small crystals, over reservoirs at concentrations which normally yield clear drops. Fewer, much larger crystals are obtained when the incubation times are optimized, compared with conventional crystallization at similar conditions. This systematic approach has led to the structure determination of the light-harvesting protein C-phycocyanin to the highest-ever resolution of 1.45 Å. PMID:12547801

Determination of nitrobenzene in wastewater using a hanging mercury drop electrode.

PubMed

Liang, Shu-Xuan; Zhang, Huan-Kun; Lu, Da

2007-06-01

The determination of trace amount nitrobenzene in wastewater on a hanging mercury drop electrode was studied. The determination conditions of pH, supporting electrolyte, accumulation potential, accumulation time, and voltammetric response were optimized. The sharp peak of the nitrobenzene was appeared at 0.05 V. The peak electric current was proportional to the concentration of nitrobenzene in the range of 1.47 x 10(-5) approximately 1.0 x 10(-3) mol/l with relative standard deviations of 3.99 approximately 8.94%. The detection limit of the nitrobenzene in water was 5 x 10(-6) mol/l. The proposed method offered low limit of determination, easy operation, the use of simple instrumentation, high sensitivity and good reproducibility. It was applied to the determination of nitrobenzene in wastewater with an average recovery of 94.0% approximately 105%. The proposed method provided fast, sensitive and sometimes real time detection of nitrobenzene.

Protein crystal growth in a microgravity environment

NASA Technical Reports Server (NTRS)

Bugg, Charles E.

1988-01-01

Protein crystal growth is a major experimental problem and is the bottleneck in widespread applications of protein crystallography. Research efforts now being pursued and sponsored by NASA are making fundamental contributions to the understanding of the science of protein crystal growth. Microgravity environments offer the possibility of performing new types of experiments that may produce a better understanding of protein crystal growth processes and may permit growth environments that are more favorable for obtaining high quality protein crystals. A series of protein crystal growth experiments using the space shuttle was initiated. The first phase of these experiments was focused on the development of micro-methods for protein crystal growth by vapor diffusion techniques, using a space version of the hanging drop method. The preliminary space experiments were used to evolve prototype hardware that will form the basis for a more advanced system that can be used to evaluate effects of gravity on protein crystal growth.

Hanging drop cultures of human testis and testis cancer samples: a model used to investigate activin treatment effects in a preserved niche

PubMed Central

Jørgensen, A; Young, J; Nielsen, J E; Joensen, U N; Toft, B G; Rajpert-De Meyts, E; Loveland, K L

2014-01-01

Background: Testicular germ cell tumours of young adults, seminoma or non-seminomas, are preceded by a pre-invasive precursor, carcinoma in situ (CIS), understood to arise through differentiation arrest of embryonic germ cells. Knowledge about the malignant transformation of germ cells is currently limited by the lack of experimental models. The aim of this study was to establish an experimental tissue culture model to maintain normal and malignant germ cells within their niche and allow investigation of treatment effects. Methods: Human testis and testis cancer specimens from orchidectomies were cultured in ‘hanging drops' and effects of activin A and follistatin treatment were investigated in seminoma cultures. Results: Testis fragments with normal spermatogenesis or CIS cells were cultured for 14 days with sustained proliferation of germ cells and CIS cells and without increased apoptosis. Seminoma cultures survived 7 days, with proliferating cells detectable during the first 5 days. Activin A treatment significantly reduced KIT transcript and protein levels in seminoma cultures, thereby demonstrating a specific treatment response. Conclusions: Hanging drop cultures of human testis and testis cancer samples can be employed to delineate mechanisms governing growth of normal, CIS and tumorigenic germ cells retained within their niche. PMID:24781282

Energy stability of droplets and dry spots in a thin film model of hanging drops

NASA Astrophysics Data System (ADS)

Cheung, Ka-Luen; Chou, Kai-Seng

2017-10-01

The 2-D thin film equation describing the evolution of hang drops is studied. All radially symmetric steady states are classified, and their energy stability is determined. It is shown that the droplet with zero contact angle is the only global energy minimizer and the dry spot with zero contact angle is a strict local energy minimizer.

Crystallization and crystallographic studies of kallistatin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Fang; Zhou, Aiwu; Wei, Zhenquan, E-mail: weizhq@gmail.com

2015-08-25

The crystallization of human kallistatin in the relaxed conformation is reported. Kallistatin is a serine protease inhibitor (serpin) which specifically inhibits human tissue kallikrein; however, its inhibitory activity is inhibited by heparin. In order to elucidate the underlying mechanism, recombinant human kallistatin was prepared in Escherichia coli and the protein was crystallized by the sitting-drop vapour-diffusion method. X-ray diffraction data were collected to 1.9 Å resolution. The crystals were found to belong to space group P6{sub 1}, with unit-cell parameters a = 113.51, b = 113.51, c = 76.17 Å. Initial analysis indicated that the crystallized kallistatin was in amore » relaxed conformation, with its reactive-centre loop inserted in the central β-sheet.« less

Expression, purification, crystallization and preliminary X-ray diffraction analysis of Bifidobacterium adolescentis xylose isomerase

PubMed Central

dos Reis, Caio Vinicius; Bernardes, Amanda; Polikarpov, Igor

2013-01-01

Xylose isomerase (EC 5.3.1.5) is a key enzyme in xylose metabolism which is industrially important for the transformation of glucose and xylose into fructose and xylulose, respectively. The Bifidobacterium adolescentis xylA gene (NC_008618.1) encoding xylose isomerase (XI) was cloned and the enzyme was overexpressed in Escherichia coli. Purified recombinant XI was crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol 3350 as the precipitating agent. A complete native data set was collected to 1.7 Å resolution using a synchrotron-radiation source. The crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 88.78, b = 123.98, c = 78.63 Å. PMID:23695585

Crystallization and preliminary X-ray analysis of PH1566, a putative ribosomal RNA-processing factor from the hyperthermophilic archaeon Pyrococcus horikoshii OT3

PubMed Central

Jia, Min Ze; Ohtsuka, Jun; Lee, Woo Cheol; Nagata, Koji; Tanokura, Masaru

2006-01-01

A putative ribosomal RNA-processing factor consisting of two KH domains from Pyrococcus horikoshii OT3 (PH1566; 25 kDa) was crystallized by the sitting-drop vapour-diffusion method using PEG 3000 as the precipitant. The crystals diffracted X-rays to beyond 2.0 Å resolution using a synchrotron-radiation source. The space group of the crystals was determined as primitive orthorhombic P212121, with unit-cell parameters a = 45.9, b = 47.4, c = 95.7 Å. The crystals contain one molecule in the asymmetric unit (V M = 2.5 Å3 Da−1) and have a solvent content of 50%. PMID:16511260

Enhanced differentiation of human embryonic stem cells into cardiomyocytes by combining hanging drop culture and 5-azacytidine treatment.

PubMed

Yoon, Byung Sun; Yoo, Seung Jun; Lee, Jeoung Eun; You, Seungkwon; Lee, Hoon Taek; Yoon, Hyun Soo

2006-04-01

Cell replacement therapy is a promising approach for the treatment of cardiac diseases. It is, however, challenged by a limited supply of appropriate cells. Therefore, we have investigated whether functional cardiomyocytes can be efficiently generated from human embryonic stem cells (hESCs). In this study, we developed an efficient protocol for the generation of functional cardiomyocytes from hESCs by combining hanging drop culture and 5-azacytidine, a well-known demethylating agent, and then evaluated the expression of cardiac-specific markers. hESCs were cultured both in the medium without or with 0.1, 1, or 10 microM of 5-azacytidine under a hanging drop culture. The expression of several cardiac-specific markers was determined by real-time PCR, RT-PCR, immunofluorescence, and confocal microscopy. To verify the structural and functional properties of hESC-derived cardiomyocytes, we performed electron microscopy and electrophysiological recording. The efficiency of beating cell generation was significantly improved in the hanging drop culture compared with that in suspension culture. Treatment of hESCs with 0.1 microM of 5-azacytidine for 1-3 days significantly increased the number of beating cells and simultaneously enhanced the expression of cardiac-specific markers. Transmission electron microscopy and electrophysiological recording showed that hESC-derived cardiomyocytes acquired structural and functional properties of cardiomyocytes. In conclusion, these results suggest that differentiation of hESCs into cardiomyocytes can be enhanced by the combination of hanging drop culture and 5-azacytidine treatment. Also the methylation status of genes related to cardiomyocyte development may play an important role in the differentiation of hESCs into cardiomyocytes.

A three-dimensional in vitro HepG2 cells liver spheroid model for genotoxicity studies.

PubMed

Shah, Ume-Kulsoom; Mallia, Jefferson de Oliveira; Singh, Neenu; Chapman, Katherine E; Doak, Shareen H; Jenkins, Gareth J S

2018-01-01

The liver's role in metabolism of chemicals makes it an appropriate tissue for toxicity testing. Current testing protocols, such as animal testing and two-dimensional liver cell systems, offer limited resemblance to in vivo liver cell behaviour, in terms of gene expression profiles and metabolic competence; thus, they do not always accurately predict human toxicology. In vitro three-dimensional liver cell models offer an attractive alternative. This study reports on the development of a 3D liver model, using HepG2 cells, by a hanging-drop technique, with a focus on evaluating spheroid growth characteristics and suitability for genotoxicity testing. The cytokinesis-blocked micronucleus assay protocol was adapted to enable micronucleus (MN) detection in the 3D spheroid models. This involved evaluating the difference between hanging vs non-hanging drop positions for dosing of the test agents and comparison of automated Metafer scoring with manual scoring for MN detection in HepG2 spheroids. The initial seeding density, used for all experiments, was 5000 cells/20 μl drop hanging spheroids, harvested on day 4, with >75% cell viability. Albumin secretion (7.8 g/l) and both CYP1A1 and CYP1A2 gene expression were highest in the 3D environment at day 4. Exposure to metabolically activated genotoxicants for 24 h resulted in a 6-fold increase in CYP1A1 enzyme activity (3 μM B[a]P) and a 30-fold increase in CYP1A2 enzyme activity (5 μM PhIP) in 3D hanging spheroids. MN inductions in response to B[a]P or PhIP were 2-fold and 3-fold, respectively, and were greater in 3D hanging spheroids than in 2D format, showing that hanging spheroids are more sensitive to genotoxic agents. HepG2 hanging-drop spheroids are an exciting new alternative system for genotoxicity studies, due to their improved structural and physiological properties, relative to 2D cultures. Copyright © 2017 Elsevier B.V. All rights reserved.

The stopped-drop method: a novel setup for containment-free and time-resolved measurements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schiener, Andreas; Seifert, Soenke; Magerl, Andreas

2016-03-01

A novel setup for containment-free time-resolved experiments at a free-hanging drop is reported. Within a dead-time of 100 ms a drop of mixed reactant solutions is formed and the time evolution of a reaction can be followed from thereon by various techniques. As an example, a small-angle X-ray scattering study on the formation mechanism of EDTA-stabilized CdS both at a synchrotron and a laboratory X-ray source is presented here. While the evolution can be followed with one drop only at a synchrotron source, a stroboscopic mode with many drops is preferable for the laboratory source.

Human HepaRG Cells can be Cultured in Hanging-drop Plates for Cytochrome P450 Induction and Function Assays.

PubMed

Murayama, Norie; Usui, Takashi; Slawny, Nicky; Chesné, Christophe; Yamazaki, Hiroshi

2015-01-01

Recent guidance/guidelines for industry recommend that cytochrome P450 induction can be assessed using human hepatocyte enzyme activity and/or mRNA levels to evaluate potential drug- drug interactions. To evaluate time-dependent cytochrome P450 induction precisely, induction of CYP1A2, CYP2B6, and CYP3A4 mRNA was confirmed (>2-fold) by the treatment with omeprazole, phenobarbital, and rifampicin, respectively, for 24 or 48 h on day 3 from the start of culture. After 24 h, the fold induction of CYP1A2 with 3.6 and 1.8x10(4) HepaRG cells per well was lower than that for 7.2x10(4) cells. CYP1A2 induction levels at 24 h were higher than those after 48 h. In contrast, higher CYP2B6 inductions were confirmed after 48 h exposure than after 24 h, independent of the number of cells per well. To help reduce the use of human cryopreserved hepatocytes, typical P450-dependent enzyme activities were investigated in human HepaRG cells cultured in commercial hanging-drop plates. Newly designed 96-well hanging-drop plates were capable of maintaining human CYP3A-dependent midazolam hydroxylation activities for up to 4 days using only 10% of the recommended initial 7.2x10(4) cells per well. Favorable HepaRG function using hanging-drop plates was confirmed by detecting 1'- hydroxymidazolam O-glucuronide on day 3, suggesting an improvement over traditional control plates in which this metabolite can be detected for 24-well plates. These results suggest that the catalytic function and/or induction of CYP1A2, CYP2B6, and CYP3A4 can be readily assessed with reduced numbers of starting HepaRG cells cultured in three-dimensional cultures in drops prepared with hanging-drop plates.

Crystallization and preliminary X-ray analysis of the atrial natriuretic peptide (ANP) receptor extracellular domain complex with ANP: use of ammonium sulfate as the cryosalt.

PubMed

Ogawa, Haruo; Zhang, Xiaolun; Qiu, Yue; Ogata, Craig M; Misono, Kunio S

2003-10-01

Atrial natriuretic peptide (ANP) plays a major role in blood pressure and volume regulation owing to its natriuretic and vasodilatory activities. The ANP receptor is a single-span transmembrane receptor coupled to its intrinsic guanylyl cyclase activity. The extracellular hormone-binding domain of rat ANP receptor (ANPR) was overexpressed by permanent transfection in CHO cells and purified. ANPR complexed with ANP was crystallized at 301 K by the hanging-drop vapor-diffusion method. The crystals were frozen in 3.4 M ammonium sulfate used as a cryoprotectant. The crystals diffracted to 3.1 A resolution using synchrotron radiation and belonged to the hexagonal space group P6(1), with unit-cell parameters a = b = 100.3, c = 258.6 A.

Crystallization and Preliminary X-ray Diffraction Analysis of Hemextin A: A Unique Anticoagulant Protein from Hemachatus haemachatus Venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee,Y.; Kumar, S.; Jobichen, C.

2007-01-01

Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapor-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1 M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 {angstrom} and two molecules in the asymmetricmore » unit. They diffracted to 1.5 {angstrom} resolution at beamline X25 at BNL.« less

Increased sensitivity of anodic stripping voltammetry at the hanging mercury drop electrode by ultracathodic deposition.

PubMed

Rodrigues, José A; Rodrigues, Carlos M; Almeida, Paulo J; Valente, Inês M; Gonçalves, Luís M; Compton, Richard G; Barros, Aquiles A

2011-09-09

An improved approach to the anodic stripping voltammetric (ASV) determination of heavy metals, using the hanging mercury drop electrode (HMDE), is reported. It was discovered that using very cathodic accumulation potentials, at which the solvent reduction occurs (overpotential deposition), the voltammetric signals of zinc(II), cadmium(II), lead(II) and copper(II) increase. When compared with the classical methodology a 5 to 10-fold signal increase is obtained. This effect is likely due to both mercury drop oscillation at such cathodic potentials and added local convection at the mercury drop surface caused by the evolution of hydrogen bubbles. Copyright © 2011 Elsevier B.V. All rights reserved.

Effects of hanging drop culture conditions on embryoid body formation and neuronal cell differentiation using mouse embryonic stem cells: optimization of culture conditions for the formation of well-controlled embryoid bodies.

PubMed

Ohnuki, Yoshitsugu; Kurosawa, Hiroshi

2013-05-01

Hanging drop (HD) cultures were carried out with a drop volume of either 20 or 30 μl. An incubation period of 3 days was determined to be appropriate for the formation of well-controlled embryoid bodies (EBs), and the initial cell number was identified as the most critical factor in the growth and neuronal cell differentiation of EBs. Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Comparison of the hanging-drop technique and running-drip method for identifying the epidural space in dogs.

PubMed

Martinez-Taboada, Fernando; Redondo, José I

2017-03-01

To compare the running-drip and hanging-drop techniques for locating the epidural space in dogs. Prospective, randomized, clinical trial. Forty-five healthy dogs requiring epidural anaesthesia. Dogs were randomized into four groups and administered epidural anaesthesia in sternal (S) or lateral (L) recumbency. All blocks were performed by the same person using Tuohy needles with either a fluid-prefilled hub (HDo) or connected to a drip set attached to a fluid bag elevated 60 cm (RDi). The number of attempts, 'pop' sensation, clear drop aspiration or fluid dripping, time to locate the epidural space (TTLES) and presence of cerebrospinal fluid (CSF) were recorded. A morphine-bupivacaine combination was injected after positive identification. The success of the block was assessed by experienced observers based on perioperative usage of rescue analgesia. Data were checked for normality. Binomial variables were analysed with the chi-squared or Fisher's exact test as appropriate. Non-parametric data were analysed using Kruskal-Wallis and Mann-Whitney tests. Normal data were studied with an anova followed by a Tukey's means comparison for groups of the same size. A p-value of < 0.05 was considered to indicate statistical significance. Lateral recumbency HDo required more attempts (six of 11 dogs required more than one attempt) than SRDi (none of 11 dogs) (p = 0.0062). Drop aspiration was observed more often in SHDo (nine of 11 dogs) than in LHDo (two of 11 dogs) (p = 0.045). Mean (range) TTLES was longer in LHDo [47 (18-82) seconds] than in SHDo [20 (14-79) seconds] (p = 0.006) and SRDi [(34 (17-53) seconds] (p = 0.038). There were no differences in 'pop' sensation, presence of CSF, rescue analgesia or pain scores between the groups. The running-drip method is a useful and fast alternative technique for identifying the epidural space in dogs. The hanging-drop technique in lateral recumbency was more difficult to perform than the other methods, requiring more time and attempts. Copyright © 2017 Association of Veterinary Anaesthetists and American College of Veterinary Anesthesia and Analgesia. Published by Elsevier Ltd. All rights reserved.

Hematopoietic Stem and Progenitor Cell Expansion in Contact with Mesenchymal Stromal Cells in a Hanging Drop Model Uncovers Disadvantages of 3D Culture

PubMed Central

Schmal, Olga; Seifert, Jan; Schäffer, Tilman E.; Walter, Christina B.; Aicher, Wilhelm K.; Klein, Gerd

2016-01-01

Efficient ex vivo expansion of hematopoietic stem cells with a concomitant preservation of stemness and self-renewal potential is still an unresolved ambition. Increased numbers of methods approaching this issue using three-dimensional (3D) cultures were reported. Here, we describe a simplified 3D hanging drop model for the coculture of cord blood-derived CD34+ hematopoietic stem and progenitor cells (HSPCs) with bone marrow-derived mesenchymal stromal cells (MSCs). When seeded as a mixed cell suspension, MSCs segregated into tight spheroids. Despite the high expression of niche-specific extracellular matrix components by spheroid-forming MSCs, HSPCs did not migrate into the spheroids in the initial phase of coculture, indicating strong homotypic interactions of MSCs. After one week, however, HSPC attachment increased considerably, leading to spheroid collapse as demonstrated by electron microscopy and immunofluorescence staining. In terms of HSPC proliferation, the conventional 2D coculture system was superior to the hanging drop model. Furthermore, expansion of primitive hematopoietic progenitors was more favored in 2D than in 3D, as analyzed in colony-forming assays. Conclusively, our data demonstrate that MSCs, when arranged with a spread (monolayer) shape, exhibit better HSPC supportive qualities than spheroid-forming MSCs. Therefore, 3D systems are not necessarily superior to traditional 2D culture in this regard. PMID:26839560

Hematopoietic Stem and Progenitor Cell Expansion in Contact with Mesenchymal Stromal Cells in a Hanging Drop Model Uncovers Disadvantages of 3D Culture.

PubMed

Schmal, Olga; Seifert, Jan; Schäffer, Tilman E; Walter, Christina B; Aicher, Wilhelm K; Klein, Gerd

2016-01-01

Efficient ex vivo expansion of hematopoietic stem cells with a concomitant preservation of stemness and self-renewal potential is still an unresolved ambition. Increased numbers of methods approaching this issue using three-dimensional (3D) cultures were reported. Here, we describe a simplified 3D hanging drop model for the coculture of cord blood-derived CD34(+) hematopoietic stem and progenitor cells (HSPCs) with bone marrow-derived mesenchymal stromal cells (MSCs). When seeded as a mixed cell suspension, MSCs segregated into tight spheroids. Despite the high expression of niche-specific extracellular matrix components by spheroid-forming MSCs, HSPCs did not migrate into the spheroids in the initial phase of coculture, indicating strong homotypic interactions of MSCs. After one week, however, HSPC attachment increased considerably, leading to spheroid collapse as demonstrated by electron microscopy and immunofluorescence staining. In terms of HSPC proliferation, the conventional 2D coculture system was superior to the hanging drop model. Furthermore, expansion of primitive hematopoietic progenitors was more favored in 2D than in 3D, as analyzed in colony-forming assays. Conclusively, our data demonstrate that MSCs, when arranged with a spread (monolayer) shape, exhibit better HSPC supportive qualities than spheroid-forming MSCs. Therefore, 3D systems are not necessarily superior to traditional 2D culture in this regard.

Dynamics of contracting surfactant-covered filaments

NASA Astrophysics Data System (ADS)

Kamat, Pritish; Thete, Sumeet; Xu, Qi; Basaran, Osman

2013-11-01

When drops are produced from a nozzle, a thin liquid thread connects the primary drop that is about to form to the rest of the liquid in the nozzle. Often, the thread becomes disconnected from both the primary drop and the remnant liquid mass hanging from the nozzle and thereby gives rise to a free filament. Due to surface tension, the free filament then contracts or recoils. During recoil, the filament can either contract into a single satellite droplet or break up into several small satellites. Such satellite droplets are undesirable in applications where they can, for example, cause misting in a manufacturing environment and mar product quality in ink-jet printing. In many applications, the filaments are coated with a monolayer of surfactant. In this work, we study the dynamics of contraction of slender filaments of a Newtonian fluid that are covered with a monolayer of surfactant when the surrounding fluid is a passive gas. Taking advantage of the fact that the filaments are long and slender, we use a 1D-slender-jet approximation of the governing system of equations consisting of the Navier-Stokes system and the convection-diffusion equation for surfactant transport. We solve the 1D system of equations by a finite element based numerical method.

Self-Renewal and CSCs In Vitro Enrichment: Growth as Floating Spheres

PubMed Central

Mehta, Pooja; Novak, Caymen; Raghavan, Shreya; Ward, Maria; Mehta, Geeta

2018-01-01

Cancer stem cells (CSC) are a vital component to the progression and reoccurrence of cancers, making them a primary target of study for both fundamental understanding of cancer biology and the development of effective and targeted treatments. CSCs reside in a complex 3D microenvironment, and the 3D spheroids are an indispensable tool in tumor biology due to their 3D structure and replication of the tumor microenvironment. Within this chapter the methodology for CSC isolation, suspension culture in hanging drop model, and characterization assays for CSC are described. First, the methodology for identifying and isolating CSCs from patient tumors, ascites, or cancer cell lines is described through the use of FACS analysis. Next, a detailed description of 3D hanging drop model for generating CSC spheroids is provided, followed by maintenance and monitoring techniques for extended 3D culture. Analysis methods are described for the quantification of CSC spheroid proliferation and viability tracking, throughout culture by on-plate alamarBlue fluorescence. Additional viability assays are described utilizing confocal microscopy with Live/Dead Viability/Cytotoxicity Kit. The characterization of CSCs populations within spheroids is described through FACS analysis. Further, an immunohistochemistry procedure is described for cell-cell and cell-matrix interaction assessment. Finally, several notes and tips for successful experiments with 3D CSC spheroids on the hanging drop model are provided. These methods are not only applicable to CSCs within a variety of tumor cell types, for not only understanding the fundamental tumor biology, but also for drug screening and development of preclinical chemotherapeutic strategies. PMID:28986887

Instrumentation and Methodology for Generation of an Electrochemical Data Base for Pattern Recognition.

DTIC Science & Technology

1982-05-01

and mercury drop hang time all produced changes in cyclic differential capacity curves and -..-- DD 0A" 1473 EDITION OF 1 NOV 6S IS OBSOLETE S/N 0102...scan rate, and mercury drop hang time all produced changes in cyclic differential capacity curves and cyclic staircase voltammograms which were unique...Faradaic measurements with staircase voltammetry have been enumerated elewhere (24, 25). -4- EXPERIMENTAL Experimental Design The seven variables which

Purification, crystallization and preliminary X-ray diffraction of the C-terminal bromodomain from human BRD2

PubMed Central

Umehara, Takashi; Wakamori, Masatoshi; Tanaka, Akiko; Padmanabhan, Balasundaram; Yokoyama, Shigeyuki

2007-01-01

BRD2 is a bromodomain-containing BET-family protein that associates with acetylated histones throughout the cell cycle. Although the tertiary structures of the bromodomains involved in histone acetyl transfer are already known, the structures of the BET-type bromodomains, which are required for tight association with acetylated chromatin, are poorly understood. Here, the expression, purification and crystallization of the C-terminal bromodomain of human BRD2 are reported. The protein was crystallized by the sitting-drop vapour-diffusion method in the orthorhombic space group P21212, with unit-cell parameters a = 71.78, b = 52.60, c = 32.06 Å and one molecule per asymmetric unit. The crystal diffracted beyond 1.80 Å resolution using synchrotron radiation. PMID:17620725

Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4.

PubMed

Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

2012-08-01

Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P2(1), with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed.

Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4

PubMed Central

Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

2012-01-01

Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P21, with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed. PMID:22869128

Preliminary X-ray diffraction analysis of a thermophilic β-1,3-1,4-glucanase from Clostridium thermocellum.

PubMed

Zhang, Lilan; Zhao, Puya; Chen, Chun-Chi; Huang, Chun-Hsiang; Ko, Tzu-Ping; Zheng, Yingying; Guo, Rey-Ting

2014-07-01

β-1,3-1,4-Glucanases catalyze the specific hydrolysis of internal β-1,4-glycosidic bonds adjacent to the 3-O-substituted glucose residues in mixed-linked β-glucans. The thermophilic glycoside hydrolase CtGlu16A from Clostridium thermocellum exhibits superior thermal profiles, high specific activity and broad pH adaptability. Here, the catalytic domain of CtGlu16A was expressed in Escherichia coli, purified and crystallized in the trigonal space group P3121, with unit-cell parameters a=b=74.5, c=182.9 Å, by the sitting-drop vapour-diffusion method and diffracted to 1.95 Å resolution. The crystal contains two protein molecules in an asymmetric unit. Further structural determination and refinement are in progress.

Crystallization and preliminary crystallographic analysis of human common-type acylphosphatase

PubMed Central

Yeung, Rachel C. Y.; Lam, Sonia Y.; Wong, Kam-Bo

2006-01-01

Human acylphosphatase, an 11 kDa enzyme that catalyzes the hydrolysis of carboxyl phosphate bonds, has been studied extensively as a model system for amyloid-fibril formation. However, the structure is still not known of any isoform of human acylphosphatase. Here, the crystallization and preliminary X-­ray diffraction data analysis of human common-type acylphosphatase are reported. Crystals of human common-type acylphosphatase have been grown by the sitting-drop vapour-diffusion method at 289 K using polyethylene glycol 4000 as precipitant. Diffraction data were collected to 1.45 Å resolution at 100 K. The crystals belong to space group P212121, with unit-cell parameters a = 42.58, b = 47.23, c = 57.26 Å. PMID:16511269

The millennium water vapour drop in chemistry-climate model simulations

NASA Astrophysics Data System (ADS)

Brinkop, Sabine; Dameris, Martin; Jöckel, Patrick; Garny, Hella; Lossow, Stefan; Stiller, Gabriele

2016-07-01

This study investigates the abrupt and severe water vapour decline in the stratosphere beginning in the year 2000 (the "millennium water vapour drop") and other similarly strong stratospheric water vapour reductions by means of various simulations with the state-of-the-art Chemistry-Climate Model (CCM) EMAC (ECHAM/MESSy Atmospheric Chemistry Model). The model simulations differ with respect to the prescribed sea surface temperatures (SSTs) and whether nudging is applied or not. The CCM EMAC is able to most closely reproduce the signature and pattern of the water vapour drop in agreement with those derived from satellite observations if the model is nudged. Model results confirm that this extraordinary water vapour decline is particularly obvious in the tropical lower stratosphere and is related to a large decrease in cold point temperature. The drop signal propagates under dilution to the higher stratosphere and to the poles via the Brewer-Dobson circulation (BDC). We found that the driving forces for this significant decline in water vapour mixing ratios are tropical sea surface temperature (SST) changes due to a coincidence with a preceding strong El Niño-Southern Oscillation event (1997/1998) followed by a strong La Niña event (1999/2000) and supported by the change of the westerly to the easterly phase of the equatorial stratospheric quasi-biennial oscillation (QBO) in 2000. Correct (observed) SSTs are important for triggering the strong decline in water vapour. There are indications that, at least partly, SSTs contribute to the long period of low water vapour values from 2001 to 2006. For this period, the specific dynamical state of the atmosphere (overall atmospheric large-scale wind and temperature distribution) is important as well, as it causes the observed persistent low cold point temperatures. These are induced by a period of increased upwelling, which, however, has no corresponding pronounced signature in SSTs anomalies in the tropics. Our free-running simulations do not capture the drop as observed, because a) the cold point temperature has a low bias and thus the water vapour variability is reduced and b) because they do not simulate the appropriate dynamical state. Large negative water vapour declines are also found in other years and seem to be a feature which can be found after strong combined El Niño/La Niña events if the QBO west phase during La Niña changes to the east phase.

Automation of Vapor-Diffusion Growth of Protein Crystals

NASA Technical Reports Server (NTRS)

Hamrick, David T.; Bray, Terry L.

2005-01-01

Some improvements have been made in a system of laboratory equipment developed previously for studying the crystallization of proteins from solution by use of dynamically controlled flows of dry gas. The improvements involve mainly (1) automation of dispensing of liquids for starting experiments, (2) automatic control of drying of protein solutions during the experiments, and (3) provision for automated acquisition of video images for monitoring experiments in progress and for post-experiment analysis. The automation of dispensing of liquids was effected by adding an automated liquid-handling robot that can aspirate source solutions and dispense them in either a hanging-drop or a sitting-drop configuration, whichever is specified, in each of 48 experiment chambers. A video camera of approximately the size and shape of a lipstick dispenser was added to a mobile stage that is part of the robot, in order to enable automated acquisition of images in each experiment chamber. The experiment chambers were redesigned to enable the use of sitting drops, enable backlighting of each specimen, and facilitate automation.

Cervical spine injuries in suicidal hanging without a long-drop--patterns and possible underlying mechanisms of injury: an autopsy study.

PubMed

Nikolić, Slobodan; Zivković, Vladimir

2014-06-01

The incidence of cervical spine injuries in suicidal hangings with a short-drop has been reported to be extremely low or non-existent. The aim of this study was to determine the frequency and pattern of cervical spine injuries in suicidal hanging. A retrospective autopsy study was performed and short-drop suicidal hanging cases with documented cervical spine injuries were identified. This group was further analyzed with regard to the gender and age of the deceased, the position of the ligature knot, the presence of hyoid-laryngeal fractures, and the level of cervical spine injury. Cervical spine injuries were present in 25 of the 766 cases, with an average age of 71.9 ± 10.7 years (range 39-88 years). In 16 of these 25 cases, the ligature knot was in the anterior position. The most common pattern of cervical spine injury included partial or complete disruption of the anterior longitudinal ligament and widening of the lower cervical spine disk spaces, associated with absence of hyoid-laryngeal fractures. Cervical spine injuries are not commonly found in short-drop suicidal hanging, occurring in only 3.3 % of all observed cases. Cervical spine injury may be occurring in 80 % of subjects aged 66.5 years and above. The most common pattern of cervical spine injury included anterior longitudinal ligament disruption of the lower cervical spine, disk space widening, and no vertebral body displacement. These injuries were mainly associated with an anterior knot position, and may be a consequence of loop pressure to the posterior neck and cervical spine hyperextension.

Hanging colloidal drop: A new photonic crystal synthesis route

NASA Astrophysics Data System (ADS)

Sandu, Ion; Dumitru, Marius; Fleaca, Claudiu Teodor; Dumitrache, Florian

2018-05-01

High-quality photonic crystals (hundreds of micrometres in thickness) were grown by the free evaporation of a colloidal drop consisting of silica and polystyrene nanospheres with dimensions of 300 nm, 500 nm, and 1000 nm. The essence of experimental findings is that the drop has to hang on a pillar. This leads to the inhibition of the droplet spreading, the minimisation of the convective force, and the zeroing of the static frictional force between nanospheres and the liquid/air interface, where the first layer is formed. The theoretical essence is the continuous adjustment of nanospheres positions during the growth of photonic crystal, a key condition of the self-assembling phenomenon.

Formation of gut-like structures in vitro from mouse embryonic stem cells.

PubMed

Torihashi, Shigeko

2006-01-01

Embryonic stem (ES) cells have the potential to differentiate into all cell types originating from the three germ layers; however, there are still few reports about the formation of functional organs from embryonic stem cells. Recently, we reported that by hanging drops of mouse ES cells, embryoid bodies (EBs) formed gut-like structures in vitro composed of three layers corresponding to the epithelium, lamina propria, and musculature. The morphological features and the process of formation are similar to gut and its organogenesis in vivo. Thus, this is a good model for development of the gut and a useful tool for analysis of the factors required for gut organogenesis. The protocol basically involves a method of hanging drops to make EBs, which are then plated on coated dishes for outgrowth. EBs develop to form gut-like structures when induced to spontaneously enter a program of differentiation in vitro without addition of any extrinsic factors.

Crystallization and identification of the glycosylated moieties of two isoforms of the main allergen Hev b 2 and preliminary X-ray analysis of two polymorphs of isoform II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fuentes-Silva, D.; Mendoza-Hernández, G.; Stojanoff, V.

2007-09-01

Crystallization of important glycoenzymes involved in IgE-mediated latex allergy. Latex from Hevea brasiliensis contains several allergenic proteins that are involved in type I allergy. One of them is Hev b 2, which is a β-1,3-glucanase enzyme that exists in different isoforms with variable glycosylation content. Two glucanase isoforms were isolated from trees of the GV-42 clone by gel filtration, affinity and ion-exchange chromatography. Isoform I had a carbohydrate content of about 20%, with N-linked N-acetyl-glucosamine, N-acetyl-galactosamine, fucose and galactose residues as the main sugars, while isoform II showed 6% carbohydrate content constisting of N-acetyl-glucosamine, fucose, mannose and xylose. Both isoformsmore » were crystallized by the hanging-drop vapour-diffusion method. Isoform I crystals were grown using 0.2 M trisodium citrate dihydrate, 0.1 M Na HEPES pH 7.5 and 20%(v/v) 2-propanol, but these crystals were not appropriate for data collection. Isoform II crystals were obtained under two conditions and X-ray diffraction data were collected from both. In the first condition (0.2 M trisodium citrate, 0.1 M sodium cacodylate pH 6.5, 30% 2-propanol), crystals belonging to the tetragonal space group P4{sub 1} with unit-cell parameters a = b = 150.17, c = 77.41 Å were obtained. In the second condition [0.2 M ammonium acetate, 0.1 M trisodium citrate dihydrate pH 5.6, 30%(w/v) polyethylene glycol 4000] the isoform II crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 85.08, b = 89.67, c = 101.80 Å, β = 113.6°. Preliminary analysis suggests that there are four molecules of isoform II in both asymmetric units.« less

X-ray crystallographic studies on C-phycocyanins from cyanobacteria from different habitats: marine and freshwater

DOE Office of Scientific and Technical Information (OSTI.GOV)

Satyanarayana, L.; Suresh, C. G., E-mail: cgsuresh@ncl.res.in; Patel, Anamika

2005-09-01

The protein C-phycocyanin, involved in photosynthesis, has been purified from three cyanobacterial species: Spirulina, Phormidium and Lyngbya. These three proteins have been crystallized and characterized using X-ray crystallography. C-phycocyanins from three cyanobacterial cultures of freshwater and marine habitat, Spirulina, Phormidium and Lyngbya spp., were purified to homogeneity and crystallized using the hanging-drop vapour-diffusion method. Blue-coloured crystals in different crystal forms, monoclinic and hexagonal, were obtained for the three species. The crystals took 1–12 weeks to grow to full size using polyethylene glycols of different molecular weights as precipitants. The amino-acid sequences of these proteins show high similarity to other knownmore » C-phycocyanins from related organisms; however, the C-phycocyanins reported here showed different biochemical and biophysical properties, i.e. molecular weight, stability etc. The X-ray diffraction data were collected at resolutions of 3.0 Å for the monoclinic and 3.2 and 3.6 Å for the hexagonal forms. The unit-cell parameters corresponding to the monoclinic space group P2{sub 1} are a = 107.33, b = 115.64, c = 183.26 Å, β = 90.03° for Spirulina sp. C-phycocyanin and are similar for crystals of Phormidium and Lyngbya spp. C-phycocyanins. Crystals belonging to the hexagonal space group P6{sub 3}, with unit-cell parameters a = b = 154.97, c = 40.35 Å and a = b = 151.96, c = 39.06 Å, were also obtained for the C-phycocyanins from Spirulina and Lyngbya spp., respectively. The estimated solvent content is around 50% for the monoclinic crystals of all three species assuming the presence of two hexamers per asymmetric unit. The solvent content is 66.5 and 64.1% for the hexagonal crystals of C-phycocyanin from Spirulina and Lyngbya spp. assuming the presence of one αβ monomer per asymmetric unit.« less

Imprinted polymer-modified hanging mercury drop electrode for differential pulse cathodic stripping voltammetric analysis of creatine.

PubMed

Lakshmi, Dhana; Sharma, Piyush S; Prasad, Bhim B

2007-06-15

The molecularly imprinted polymer [poly(p-aminobenzoicacid-co-1,2-dichloroethane)] film casting was made on the surface of a hanging mercury drop electrode by drop-coating method for the selective and sensitive evaluation of creatine in water, blood serum and pharmaceutical samples. The molecular recognition of creatine by the imprinted polymer was found to be specific via non-covalent (electrostatic) imprinting. The creatine binding could easily be detected by differential pulse, cathodic stripping voltammetric signal at optimised operational conditions: accumulation potential -0.01 V (versus Ag/AgCl), polymer deposition time 15s, template accumulation time 60s, pH 7.1 (supporting electrolyte< or =5 x 10(-4)M NaOH), scan rate 10 mV s(-1), pulse amplitude 25 mV. The modified sensor in the present study was found to be highly reproducible and selective with detection limit 0.11 ng mL(-1) of creatine. Cross-reactivity studies revealed no response to the addition of urea, creatinine and phenylalanine; however, some insignificant magnitude of current was observed for tryptophan and histidine in the test samples.

Heat transfer and pressure drop of condensation of hydrocarbons in tubes

NASA Astrophysics Data System (ADS)

Fries, Simon; Skusa, Severin; Luke, Andrea

2018-03-01

The heat transfer coefficient and pressure drop are investigated for propane. Two different mild steel plain tubes and saturation pressures are considered for varying mass flux and vapour quality. The pressure drop is compared to the Friedel-Correlation with two different approaches to determine the friction factor. The first is calculation as proposed by Friedel and the second is through single phase pressure drop investigations. For lower vapour qualities the experimental results are in better agreement with the approach of the calculated friction factor. For higher vapour qualities the experimental friction factor is more precise. The pressure drop increases for a decreasing tube diameter and saturation pressure. The circumferential temperature profile and heat transfer coefficients are shown for a constant vapour quality at varying mass fluxes. The subcooling is highest for the bottom of the tube and lowest for the top. The average subcooling as well as the circumferential deviation decreases for rising mass fluxes. The averaged heat transfer coefficients are compared to the model proposed by Thome and Cavallini. The experimental results are in good agreement with both correlations, however the trend is better described with the correlation from Thome. The experimental heat transfer coefficients are under predicted by Thome and over predicted by Cavallini.

Three-dimensional structure of Erwinia carotovora L-asparaginase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kislitsyn, Yu. A.; Kravchenko, O. V.; Nikonov, S. V.

2006-10-15

Three-dimensional structure of Erwinia carotovora L-asparaginase, which has antitumor activity and is used for the treatment of acute lymphoblastic leukemia, was solved at 3 A resolution and refined to R{sub cryst} = 20% and R{sub free} = 28%. Crystals of recombinant Erwinia carotovora L-asparaginase were grown by the hanging-drop vapor-diffusion method from protein solutions in a HEPES buffer (pH 6.5) and PEG MME 5000 solutions in a cacodylate buffer (pH 6.5) as the precipitant. Three-dimensional X-ray diffraction data were collected up to 3 A resolution from one crystal at room temperature. The structure was solved by the molecular replacement methodmore » using the coordinates of Erwinia chrysanthemi L-asparaginase as the starting model. The coordinates refined with the use of the CNS program package were deposited in the Protein Data Bank (PDB code 1ZCF)« less

Crystallization and X-ray analysis of the salmon-egg lectin SEL24K.

PubMed

Murata, Kenji; Fisher, Andrew J; Hedrick, Jerry L

2007-05-01

The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 A resolution. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 A, alpha = 90, beta = 92.82, gamma = 90 degrees. The crystal is likely to contain eight molecules in the asymmetric unit (V(M) = 2.3 A3 Da(-1)), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.

Purification and crystallization of Bacillus subtilis NrnA, a novel enzyme involved in nanoRNA degradation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nelersa, Claudiu M.; Schmier, Brad J.; Malhotra, Arun

2012-05-08

The final step in RNA degradation is the hydrolysis of RNA fragments five nucleotides or less in length (nanoRNA) to mononucleotides. In Escherichia coli this step is carried out by oligoribonuclease (Orn), a DEDD-family exoribonuclease that is conserved throughout eukaryotes. However, many bacteria lack Orn homologs, and an unrelated DHH-family phosphoesterase, NrnA, has recently been identified as one of the enzymes responsible for nanoRNA degradation in Bacillus subtilis. To understand its mechanism of action, B. subtilis NrnA was purified and crystallized at room temperature using the hanging-drop vapor-diffusion method with PEG 4000, PEG 3350 or PEG MME 2000 as precipitant.more » The crystals belonged to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 50.62, b = 121.3, c = 123.4 {angstrom}, {alpha} = 90, {beta} = 91.31, {gamma} = 90{sup o}.« less

Purification, crystallization and preliminary X-ray diffraction analysis of the Escherichia coli common pilus chaperone EcpB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garnett, James A.; Diallo, Mamou; Matthews, Steve J., E-mail: s.j.matthews@imperial.ac.uk

In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher pathway that plays a major role in both early biofilm formation and host-cell adhesion. Initial attempts at crystallizing the chaperone EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. This is the first time that this refolding strategy has been used to purify CU chaperones. Pili are key cell-surface components that allow the attachment of bacteria to both biological andmore » abiotic solid surfaces, whilst also mediating interactions between themselves. In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher (CU) pathway that plays a major role in both early biofilm formation and host-cell adhesion. The chaperone EcpB is involved in the biogenesis of the filament, which is composed of EcpA and EcpD. Initial attempts at crystallizing EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.4 Å resolution. These crystals belonged to the trigonal space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 62.65, c = 121.14 Å and one monomer in the asymmetric unit. Molecular replacement was unsuccessful, but selenomethionine-substituted protein and heavy-atom derivatives are being prepared for phasing. The three-dimensional structure of EcpB will provide invaluable information on the subtle mechanistic differences in biogenesis between the alternative and classical CU pathways. Furthermore, this is the first time that this refolding strategy has been used to purify CU chaperones, and it could be implemented in similar systems where it has not been possible to obtain highly ordered crystals.« less

The formation of intestinal organoids in a hanging drop culture.

PubMed

Panek, Malgorzata; Grabacka, Maja; Pierzchalska, Malgorzata

2018-01-25

Recently organoids have become widely used in vitro models of many tissue and organs. These type of structures, originated from embryonic or adult mammalian intestines, are called "mini guts". They organize spontaneously when intestinal crypts or stem cells are embedded in the extracellular matrix proteins preparation scaffold (Matrigel). This approach has some disadvantages, as Matrigel is undefined (the concentrations of growth factors and other biologically active components in it may vary from batch to batch), difficult to handle and expensive. Here we show that the organoids derived from chicken embryo intestine are formed in a hanging drop without embedding, providing an attractive alternative for currently used protocols. Using this technique we obtained compact structures composed of contiguous organoids, which were generally similar to chicken organoids cultured in Matrigel in terms of morphology and expression of intestinal epithelial markers. Due to the simplicity, high reproducibility and throughput capacity of hanging drop technique our model may be applied in various studies concerning the gut biology.

Hanging drop crystal growth apparatus

NASA Technical Reports Server (NTRS)

Naumann, Robert J. (Inventor); Witherow, William K. (Inventor); Carter, Daniel C. (Inventor); Bugg, Charles E. (Inventor); Suddath, Fred L. (Inventor)

1990-01-01

This invention relates generally to control systems for controlling crystal growth, and more particularly to such a system which uses a beam of light refracted by the fluid in which crystals are growing to detect concentration of solutes in the liquid. In a hanging drop apparatus, a laser beam is directed onto drop which refracts the laser light into primary and secondary bows, respectively, which in turn fall upon linear diode detector arrays. As concentration of solutes in drop increases due to solvent removal, these bows move farther apart on the arrays, with the relative separation being detected by arrays and used by a computer to adjust solvent vapor transport from the drop. A forward scattering detector is used to detect crystal nucleation in drop, and a humidity detector is used, in one embodiment, to detect relative humidity in the enclosure wherein drop is suspended. The novelty of this invention lies in utilizing angular variance of light refracted from drop to infer, by a computer algorithm, concentration of solutes therein. Additional novelty is believed to lie in using a forward scattering detector to detect nucleating crystallites in drop.

Open-tube diffusion techniques for InP/LnGaAs heterojunctior bipolar transistors

NASA Astrophysics Data System (ADS)

Schuitemaker, P.; Houston, P. A.

1986-11-01

Open-tube diffusion techniques used between 450 and 600° C are described which involve the supply of diffusant from a vapour source (via a solution) and a solid evaporated metal source. Investigations of Zn into InP and InGaAs(P) have been undertaken using both sources. SIMS profile analyses show that in the case of the vapour source the profiles indicate a concentration-dependent diffusion coefficient while the solid source diffusions can be well described by a Gaussian-type profile. The usefulness of the vapour source method has been demonstrated in the fabrication of bipolar transistors which exhibit good d.c. characteristics. The solid source method is limited by the slow diffusion velocity and more gradual profile. The InGaAs(P)/InP materials system has important applications in optical communications and future high speed microwave and switching devices. Useful technologies allied to the introduction of impurities into Si by diffusion, have gradually been emerging for use in the III-V semiconductor family. Closed tube systems1 have been used in order to contain the volatile group V species and prevent surface erosion. In addition, simpler open tube systems2,3 have been developed that maintain a sufficient overpressure of the group V element. Zn and Cd p-dopants have been studied extensively because of the volatility and relatively large diffusion rates in III-V semiconductors. Opentube diffusion into both InP and InGaAs2-6 has been studied but little detail has appeared concerning InGaAs and InGaAsP. In this paper we describe a comprehensive study of the diffusion of Zn into InP and InGaAs(P) using both open-tube vapour source and a Au/Zn/Au evaporated solid source with SiNx acting both as a mask and also an encapsulant to prevent loss of Zn and decomposition of the substrate material. The techniques have been successfully applied to the fabrication of InP/lnGaAs heterojunction bipolar transistors which show good dc characteristics. Reference to InGaAs in the text implies the InP lattice-matched composition In0.53Ga0.47As.

A sensor of alcohol vapours based on thin polyaniline base film and quartz crystal microbalance.

PubMed

Ayad, Mohamad M; El-Hefnawey, Gad; Torad, Nagy L

2009-08-30

Thin films of polyaniline base, emeraldine base (EB), coating on the quartz crystal microbalance (QCM) electrode were used as a sensitive layer for the detection of a number of primary aliphatic alcohols such as ethanol, methanol, 2-propanol and 1-propanol vapours. The frequency shifts (Deltaf) of the QCM were increased due to the vapour adsorption into the EB film. Deltaf were found to be linearly correlated with the concentrations of alcohols vapour in part per million (ppm). The sensitivity of the sensor was found to be governed by the chemical structure of the alcohol. The sensor shows a good reproducibility and reversibility. The diffusions of different alcohols vapour were studied and the diffusion coefficients (D) were calculated. It is concluded that the diffusion of the vapours into the EB film follows Fickian kinetics.

Nucleation and growth control in protein crystallization

NASA Technical Reports Server (NTRS)

Rosenberger, Franz; Nyce, Thomas A.; Meehan, Edward J.; Sowers, Jennifer W.; Monaco, Lisa A.

1990-01-01

The five topics summarized in this final report are as follows: (1) a technique for the expedient, semi-automated determination of protein solubilities as a function of temperature and application of this technique to proteins other than lysozyme; (2) a small solution cell with adjustable temperature gradients for the growth of proteins at a predetermined location through temperature programming; (3) a microscopy system with image storage and processing capability for high resolution optical studies of temperature controlled protein growth and etching kinetics; (4) growth experiments with lysozyme in thermosyphon flow ; and (5) a mathematical model for the evolution of evaporation/diffusion induced concentration gradients in the hanging drop protein crystallization technique.

Purification, crystallization and preliminary X-ray diffraction analysis of GatD, a glutamine amidotransferase-like protein from Staphylococcus aureus peptidoglycan

PubMed Central

Vieira, Diana; Figueiredo, Teresa A.; Verma, Anil; Sobral, Rita G.; Ludovice, Ana M.; de Lencastre, Hermínia; Trincao, Jose

2014-01-01

Amidation of peptidoglycan is an essential feature in Staphylococcus aureus that is necessary for resistance to β-lactams and lysozyme. GatD, a 27 kDa type I glutamine amidotransferase-like protein, together with MurT ligase, catalyses the amidation reaction of the glutamic acid residues of the peptidoglycan of S. aureus. The native and the selenomethionine-derivative proteins were crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol, sodium acetate and calcium acetate. The crystals obtained diffracted beyond 1.85 and 2.25 Å, respectively, and belonged to space group P212121. X-ray diffraction data sets were collected at Diamond Light Source (on beamlines I02 and I04) and were used to obtain initial phases. PMID:24817726

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum.

PubMed

Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J

2014-06-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum

PubMed Central

Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.

2014-01-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099

Expression, purification, crystallization and preliminary X-ray analysis of tannase from Lactobacillus plantarum.

PubMed

Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J; Ren, Bin

2013-04-01

Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell parameters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution.

3D Hanging Drop Culture to Establish Prostate Cancer Organoids.

PubMed

Eder, Theresa; Eder, Iris E

2017-01-01

Three-dimensional (3D) cell culture enables the growth of cells in a multidimensional and multicellular manner compared to conventional cell culture techniques. Especially in prostate cancer research there is a big need for more tissue-recapitulating models to get a better understanding of the mechanisms driving prostate cancer as well as to screen for more efficient drugs that can be used for treatment. In this chapter we describe a 3D hanging drop system that can be used to culture prostate cancer organoids as tumor epithelial monocultures and as epithelial-stromal cocultures.

Tetrazolium chloride as an indicator of pine pollen germinability

Treesearch

Stanton A. Cook; Robert G. Stanley

1960-01-01

Controlled pollination in forest tree breeding requires pollen of known germination capacity. Methods of determining pollen viability include germination in a hanging drop, in a moist atmosphere, on agar gel, or in a sugar solution (DUFFIELD, 1954; DILLON et al., 1957). Errors commonly arise in the application of these techniques because maximum...

Transplantation of co-aggregates of Sertoli cells and islet cells into liver without immunosuppression.

PubMed

Takemoto, Naohiro; Liu, Xibao; Takii, Kento; Teramura, Yuji; Iwata, Hiroo

2014-02-15

Transplantation of islets of Langerhans (islets) was used to treat insulin-dependent diabetes mellitus. However, islet grafts must be maintained by administration of immunosuppressive drugs, which can lead to complications in the long term. An approach that avoids immunosuppressive drug use is desirable. Co-aggregates of Sertoli cells and islet cells from BALB/c mice that were prepared by the hanging drop method were transplanted into C57BL/6 mouse liver through the portal vein as in human clinical islet transplantation. The core part of the aggregates contained mainly Sertoli cells, and these cells were surrounded by islet cells. The co-aggregates retained the functions of both Sertoli and islet cells. When 800 co-aggregates were transplanted into seven C57BL/6 mice via the portal vein, six of seven recipient mice demonstrated quasi-normoglycemia for more than 100 days. The hanging drop method is suitable for preparing aggregates of Sertoli and islet cells for transplantation. Notably, transplantation of these allogeneic co-aggregates into mice with chemically induced diabetes via the portal vein resulted in long-term graft survival without systemic immunosuppression.

Linear scan voltammetric indirect determination of Al(III) by the catalytic cathodic response of norepinephrine at the hanging mercury drop electrode.

PubMed

Zhang, Fuping; Ji, Ming; Xu, Quan; Yang, Li; Bi, Shuping

2005-09-01

The biological effects of aluminum (Al) have received much attention in recent years. Al is of basic relevance as concern with its reactivity and bioavailability. In this paper, the electrochemical behaviors of norepinephrine (NE) in the absence and presence of Al(III) at the hanging mercury drop electrode have been studied and applied to the practical analysis. Highly selective catalytic cathodic peak of NE is yielded by linear scan voltammetry (LSV) at -1.32 V (vs. SCE). A linear relationship holds between the cathodic peak current and the Al(III) concentration. It has been successfully applied to the determination of Al(III) in real waters and synthetic biological samples with satisfying results, which are in accordance with those obtained by ICP-AES method. The electrochemical properties and the mechanisms of the peaks in the presence and absence of Al(III) have been explored. The results show that they are irreversible adsorptive hydrogen catalytic waves. These studies not only enrich the methods of determining Al, but also lay foundations of further understanding of the mechanisms of neurodementia.

Life-History Traits of the Model Organism Pristionchus pacificus Recorded Using the Hanging Drop Method: Comparison with Caenorhabditis elegans.

PubMed

Gilarte, Patricia; Kreuzinger-Janik, Bianca; Majdi, Nabil; Traunspurger, Walter

2015-01-01

The nematode Pristionchus pacificus is of growing interest as a model organism in evolutionary biology. However, despite multiple studies of its genetics, developmental cues, and ecology, the basic life-history traits (LHTs) of P. pacificus remain unknown. In this study, we used the hanging drop method to follow P. pacificus at the individual level and thereby quantify its LHTs. This approach allowed direct comparisons with the LHTs of Caenorhabditis elegans recently determined using this method. When provided with 5×10(9) Escherichia coli cells ml(-1) at 20°C, the intrinsic rate of natural increase of P. pacificus was 1.125 (individually, per day); mean net production was 115 juveniles produced during the life-time of each individual, and each nematode laid an average of 270 eggs (both fertile and unfertile). The mean age of P. pacificus individuals at first reproduction was 65 h, and the average life span was 22 days. The life cycle of P. pacificus is therefore slightly longer than that of C. elegans, with a longer average life span and hatching time and the production of fewer progeny.

Media additives to promote spheroid circularity and compactness in hanging drop platform.

PubMed

Leung, Brendan M; Lesher-Perez, Sasha Cai; Matsuoka, Toshiki; Moraes, Christopher; Takayama, Shuichi

2015-02-01

Three-dimensional spheroid cultures have become increasingly popular as drug screening platforms, especially with the advent of different high throughput spheroid forming technologies. However, comparing drug efficacy across different cell types in spheroid culture can be difficult due to variations in spheroid morphologies and transport characteristics. Improving the reproducibility of compact, circular spheroids contributes to standardizing and increasing the fidelity of the desired gradient profiles in these drug screening three-dimensional tissue cultures. In this study we discuss the role that circularity and compaction has on spheroids, and demonstrate the impact methylcellulose (MethoCel) and collagen additives in the culture media can contribute to more compact and circular spheroid morphology. We demonstrate that improved spheroid formation is not a simple function of increased viscosity of the different macromolecule additives, suggesting that other macromolecular characteristics contribute to improved spheroid formation. Of the various macromolecular additives tested for hanging drop culture, MethoCel provided the most desirable spheroid formation. Additionally, the higher viscosity of MethoCel-containing media improved the ease of imaging of cellular spheroids within hanging drop cultures by reducing motion-induced image blur.

High-throughput 3D spheroid culture and drug testing using a 384 hanging drop array.

PubMed

Tung, Yi-Chung; Hsiao, Amy Y; Allen, Steven G; Torisawa, Yu-suke; Ho, Mitchell; Takayama, Shuichi

2011-02-07

Culture of cells as three-dimensional (3D) aggregates can enhance in vitro tests for basic biological research as well as for therapeutics development. Such 3D culture models, however, are often more complicated, cumbersome, and expensive than two-dimensional (2D) cultures. This paper describes a 384-well format hanging drop culture plate that makes spheroid formation, culture, and subsequent drug testing on the obtained 3D cellular constructs as straightforward to perform and adapt to existing high-throughput screening (HTS) instruments as conventional 2D cultures. Using this platform, we show that drugs with different modes of action produce distinct responses in the physiological 3D cell spheroids compared to conventional 2D cell monolayers. Specifically, the anticancer drug 5-fluorouracil (5-FU) has higher anti-proliferative effects on 2D cultures whereas the hypoxia activated drug commonly referred to as tirapazamine (TPZ) are more effective against 3D cultures. The multiplexed 3D hanging drop culture and testing plate provides an efficient way to obtain biological insights that are often lost in 2D platforms.

Crystallization, optimization and preliminary X-ray characterization of a metal-dependent PI-PLC from Streptomyces antibioticus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jackson, Michael R.; Selby, Thomas L.

2012-10-30

A recombinant metal-dependent phosphatidylinositol-specific phospholipase C (PI-PLC) fromStreptomyces antibioticushas been crystallized by the hanging-drop method with and without heavy metals. The native crystals belonged to the orthorhombic space groupP222, with unit-cell parametersa= 41.26,b= 51.86,c = 154.78 Å. The X-ray diffraction results showed significant differences in the crystal quality of samples soaked with heavy atoms. Additionally, drop pinning, which increases the surface area of the drops, was also used to improve crystal growth and quality. The combination of heavy-metal soaks and drop pinning was found to be critical for producing high-quality crystals that diffracted to 1.23 Å resolution.

Development of an automated large-scale protein-crystallization and monitoring system for high-throughput protein-structure analyses.

PubMed

Hiraki, Masahiko; Kato, Ryuichi; Nagai, Minoru; Satoh, Tadashi; Hirano, Satoshi; Ihara, Kentaro; Kudo, Norio; Nagae, Masamichi; Kobayashi, Masanori; Inoue, Michio; Uejima, Tamami; Oda, Shunichiro; Chavas, Leonard M G; Akutsu, Masato; Yamada, Yusuke; Kawasaki, Masato; Matsugaki, Naohiro; Igarashi, Noriyuki; Suzuki, Mamoru; Wakatsuki, Soichi

2006-09-01

Protein crystallization remains one of the bottlenecks in crystallographic analysis of macromolecules. An automated large-scale protein-crystallization system named PXS has been developed consisting of the following subsystems, which proceed in parallel under unified control software: dispensing precipitants and protein solutions, sealing crystallization plates, carrying robot, incubators, observation system and image-storage server. A sitting-drop crystallization plate specialized for PXS has also been designed and developed. PXS can set up 7680 drops for vapour diffusion per hour, which includes time for replenishing supplies such as disposable tips and crystallization plates. Images of the crystallization drops are automatically recorded according to a preprogrammed schedule and can be viewed by users remotely using web-based browser software. A number of protein crystals were successfully produced and several protein structures could be determined directly from crystals grown by PXS. In other cases, X-ray quality crystals were obtained by further optimization by manual screening based on the conditions found by PXS.

Comparative study of P19 EC stem cell differentiation in between conventional hanging drop and the zebrafish chorion as a bio-derived material.

PubMed

Dae Seok Na; Lee, Hwang; Sun Uk Kim; Chang Nam Hwang; Sang Ho Lee; Ji Yoon Kang; Jai Kyeong Kim; James Jungho Pak

2008-07-01

Various materials including glass and polymers have been widely used for stem cell culture due to their biocompatibility. However, the roles of these materials are fundamentally limited because they cannot realize or imitate the complex biological functions of living tissues, except in very simple cases. Here, the development of a bio-derived material suitable for stem cell culture and improvement of differentiation efficiency to specific cell lineages with no stimulating agents by using a chorion obtained from a fertilized zebrafish egg through the removal of the yolk and embryonic cell mass from the egg is reported. Mouse P19 EC stem cells introduced into the empty chorion form a uniform embryoid body (EB) without addition of any inducing agent. It is demonstrated that the zebrafish chorion with nanopores improves efficiencies greatly in the EB formation, cell proliferation, and lineage-specific differentiations compared to those of the conventional hanging drop culture method.

Electrochemical behavior of phytochelatins and related peptides at the hanging mercury drop electrode in the presence of cobalt(II) ions.

PubMed

Dorcák, Vlastimil; Sestáková, Ivana

2006-01-01

Direct current voltammetry and differential pulse voltammetry have been used to investigate the electrochemical behaviour of two phytochelatins: heptapeptide (gamma-Glu-Cys)3-Gly and pentapeptide (gamma-Glu-Cys)2-Gly, tripeptide glutathione gamma-Glu-Cys-Gly and its fragments: dipeptides Cys-Gly and gamma-Glu-Cys at the hanging mercury drop electrode in the presence of cobalt(II) ions. Most interesting results were obtained with direct current voltammetry in the potential region of -0.80 V up to -1.80 V. Differential pulse voltammetry of the same solutions of Co(II) with peptides gives more complicated voltammograms with overlapping peaks, probably in connection with the influence of adsorption at slow scan rates necessarily used in this method. However, in using Brdicka catalytic currents for analytical purposes, differential pulse voltammograms seem to be more helpful. Presented investigations have shown that particularly the prewave of cobalt(II) allows distinguishing among phytochelatins, glutathione, and its fragments.

Comparison of the lateral retention forces on sessile and pendant water drops on a solid surface

NASA Astrophysics Data System (ADS)

de la Madrid, Rafael; Whitehead, Taylor; Irwin, George M.

2015-06-01

We present a simple experiment that demonstrates how a water drop hanging from a Plexiglas surface (pendant drop) experiences a lateral retention force that is comparable to, and in some cases larger than, the lateral retention force on a drop resting on top of the surface (sessile drop). The experiment also affords a simple demonstration of the Coriolis effect in two dimensions.

Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jens, Jason; Raghunathan, Kannan; Vago, Frank

2010-01-12

EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 {angstrom} and belonged to space group P2{sub 1}, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 {angstrom}.

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

PubMed Central

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-01-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

PubMed

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-11-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

Crystallization and preliminary X-ray diffraction analysis of P30, the transmembrane domain of pertactin, an autotransporter from Bordetella pertussis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Yanshi; Black, Isobel; Roszak, Aleksander W.

2007-07-01

P30, the transmembrane C-terminal domain of pertactin from B. pertussis has been crystallized after refolding in vitro. Preliminary X-ray crystallographic data are reported. P30, the 32 kDa transmembrane C-terminal domain of pertactin from Bordetella pertussis, is supposed to form a β-barrel inserted into the outer membrane for the translocation of the passenger domain. P30 was cloned and expressed in inclusion bodies in Escherichia coli. After refolding and purification, the protein was crystallized using the sitting-drop vapour-diffusion method at 292 K. The crystals diffract to a resolution limit of 3.5 Å using synchrotron radiation and belong to the hexagonal space groupmore » P6{sub 1}22, with unit-cell parameters a = b = 123.27, c = 134.43 Å.« less

Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya

2007-11-01

A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis

PubMed Central

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-01-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase σ factor SigB. In order to elucidate the structural–functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 Å resolution with an R merge of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 Å, α = 98.8, β = 90.0, γ = 108.4°. PMID:19923733

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis.

PubMed

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-11-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.

Purification, crystallization and preliminary X-ray diffraction studies of UDP-N-acetylglucosamine pyrophosphorylase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi

2006-12-01

UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the productmore » complex belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å.« less

Recombinant expression, purification, crystallization and preliminary X-ray diffraction analysis of the C-terminal DUF490(963-1138) domain of TamB from Escherichia coli.

PubMed

Josts, Inokentijs; Grinter, Rhys; Kelly, Sharon M; Mosbahi, Khedidja; Roszak, Aleksander; Cogdell, Richard; Smith, Brian O; Byron, Olwyn; Walker, Daniel

2014-09-01

TamB is a recently described inner membrane protein that, together with its partner protein TamA, is required for the efficient secretion of a subset of autotransporter proteins in Gram-negative bacteria. In this study, the C-terminal DUF490963-1138 domain of TamB was overexpressed in Escherichia coli K-12, purified and crystallized using the sitting-drop vapour-diffusion method. The crystals belonged to the primitive trigonal space group P3121, with unit-cell parameters a = b = 57.34, c = 220.74 Å, and diffracted to 2.1 Å resolution. Preliminary secondary-structure and X-ray diffraction analyses are reported. Two molecules are predicted to be present in the asymmetric unit. Experimental phasing using selenomethionine-labelled protein will be undertaken in the future.

Expression, purification, crystallization and preliminary X-ray analysis of tannase from Lactobacillus plantarum

PubMed Central

Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J.; Ren, Bin

2013-01-01

Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell paramters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution. PMID:23545659

Crystallization and preliminary X-ray diffraction analysis of the P3 RNA domain of yeast ribonuclease MRP in a complex with RNase P/MRP protein components Pop6 and Pop7.

PubMed

Perederina, Anna; Esakova, Olga; Quan, Chao; Khanova, Elena; Krasilnikov, Andrey S

2010-01-01

Eukaryotic ribonucleases P and MRP are closely related RNA-based enzymes which contain a catalytic RNA component and several protein subunits. The roles of the protein subunits in the structure and function of eukaryotic ribonucleases P and MRP are not clear. Crystals of a complex that included a circularly permuted 46-nucleotide-long P3 domain of the RNA component of Saccharomyces cerevisiae ribonuclease MRP and selenomethionine derivatives of the shared ribonuclease P/MRP protein components Pop6 (18.2 kDa) and Pop7 (15.8 kDa) were obtained using the sitting-drop vapour-diffusion method. The crystals belonged to space group P4(2)22 (unit-cell parameters a = b = 127.2, c = 76.8 A, alpha = beta = gamma = 90 degrees ) and diffracted to 3.25 A resolution.

Purification, crystallization and preliminary crystallographic analysis of Streptococcus pyogenes laminin-binding protein Lbp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linke, Christian, E-mail: clin180@ec.auckland.ac.nz; Caradoc-Davies, Tom T.; Australian Synchrotron, Clayton, Victoria 3168

2008-02-01

The S. pyogenes laminin-binding protein Lbp, which is essential for adhesion to human laminin, has been expressed, purified and crystallized. The laminin-binding protein Lbp (Spy2007) from Streptococcus pyogenes (a group A streptococcus) mediates adhesion to the human basal lamina glycoprotein laminin. Accordingly, Lbp is essential in in vitro models of cell adhesion and invasion. However, the molecular and structural basis of laminin binding by bacteria remains unknown. Therefore, the lbp gene has been cloned for recombinant expression in Escherichia coli. Lbp has been purified and crystallized from 30%(w/v) PEG 1500 by the sitting-drop vapour-diffusion method. The crystals belonged to themore » monoclinic space group P2{sub 1}, with unit-cell parameters a = 42.62, b = 92.16, c = 70.61 Å, β = 106.27°, and diffracted to 2.5 Å resolution.« less

Crystallization and preliminary X-ray analysis of CTP:phosphoethanolamine cytidylyltransferase (ECT) from Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohtsuka, Jun; Nagata, Koji; Lee, Woo Cheol

2006-10-01

CTP:phosphoethanolamine cytidylyltransferase from S. cerevisiae has been expressed, purified and crystallized. CTP:phosphoethanolamine cytidylyltransferase (ECT) is the enzyme that catalyzes the conversion of phosphoethanolamine to CDP-ethanolamine in the phosphatidylethanolamine-biosynthetic pathway (Kennedy pathway). ECT from Saccharomyces cerevisiae was crystallized by the sitting-drop vapour-diffusion method using PEG 4000 as precipitant. The crystals diffracted X-rays from a synchrotron-radiation source to 1.88 Å resolution. The space group was assigned as primitive tetragonal, P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 66.3, c = 150.8 Å. The crystals contain one ECT molecule in the asymmetric unit (V{sub M} = 2.2more » Å{sup 3} Da{sup −1}), with a solvent content of 43%.« less

Crystallization and preliminary X-ray analysis of the NADPH-dependent 3-quinuclidinone reductase from Rhodotorula rubra

PubMed Central

Takeshita, Daijiro; Kataoka, Michihiko; Miyakawa, Takuya; Miyazono, Ken-ichi; Uzura, Atsuko; Nagata, Koji; Shimizu, Sakayu; Tanokura, Masaru

2009-01-01

(R)-3-Quinuclidinol is a useful compound that is applicable to the synthesis of various pharmaceuticals. The NADPH-dependent carbonyl reductase 3-­quinuclidinone reductase from Rhodotorula rubra catalyzes the stereospecific reduction of 3-quinuclidinone to (R)-3-quinuclidinol and is expected to be utilized in industrial production of this alcohol. 3-Quinuclidinone reductase from R. rubra was expressed in Escherichia coli and purified using Ni-affinity and ion-exchange column chromatography. Crystals of the protein were obtained by the sitting-drop vapour-diffusion method using PEG 8000 as the precipitant. The crystals belonged to space group P41212, with unit-cell parameters a = b = 91.3, c = 265.4 Å, and diffracted X-rays to 2.2 Å resolution. The asymmetric unit contained four molecules of the protein and the solvent content was 48.4%. PMID:19478454

Crystallization and preliminary X-ray analysis of the NAD+-reducing [NiFe] hydrogenase from Hydrogenophilus thermoluteolus TH-1

PubMed Central

Taketa, Midori; Nakagawa, Hanae; Habukawa, Mao; Osuka, Hisao; Kihira, Kiyohito; Komori, Hirofumi; Shibata, Naoki; Ishii, Masaharu; Igarashi, Yasuo; Nishihara, Hirofumi; Yoon, Ki-Seok; Ogo, Seiji; Shomura, Yasuhito; Higuchi, Yoshiki

2015-01-01

NAD+-reducing [NiFe] hydrogenases catalyze the oxidoreduction of dihydrogen concomitant with the interconversion of NAD+ and NADH. Here, the isolation, purification and crystallization of the NAD+-reducing [NiFe] hydrogenase from Hydrogenophilus thermoluteolus TH-1 are reported. Crystals of the NAD+-reducing [NiFe] hydrogenase were obtained within one week from a solution containing polyethylene glycol using the sitting-drop vapour-diffusion method and micro-seeding. The crystal diffracted to 2.58 Å resolution and belonged to space group C2, with unit-cell parameters a = 131.43, b = 189.71, c = 124.59 Å, β = 109.42°. Assuming the presence of two NAD+-reducing [NiFe] hydrogenase molecules in the asymmetric unit, V M was calculated to be 2.2 Å3  Da−1, which corresponds to a solvent content of 43%. Initial phases were determined by the single-wavelength anomalous dispersion method using the anomalous signal from the Fe atoms. PMID:25615977

Comparison of spring-loaded, loss of resistance and hanging drop techniques in lumbar epidural blocks.

PubMed

Gülen, Güven; Akkaya, Taylan; Ozkan, Derya; Kaydul, Mehmet; Gözaydin, Orhan; Gümüş, Haluk

2012-01-01

The spring-loaded syringe is a loss of resistance syringe that provide a more objective sign that the epidural space has been entered compared with the traditional techniques. The aim of this study was to compare the time required to locate the epidural space and the backache incidence with the spring-loaded (SL), loss of resistance (LOR) and the hanging drop (HD) techniques for epidural blocks in patients undergoing transurethral resection procedure. Sixty patients undergoing transurethral resections were enrolled in the study. The patients were randomly assigned to one of three groups. Epidural block was performed in the first group with a spring-loaded syringe (n=20), in the second group with loss-of-resistance syringe (n=20), and in the third group with the hanging drop technique (n=20). The required time to locate the epidural space, the number of attempts, the incidence of dural puncture and the backache incidence were assessed during the procedure and for four weeks after the procedure in all patients. The required time to locate the epidural space was 29.1 ± 9.16 seconds in Group 1; 45.25 ± 19.58 seconds in Group 2, and 47.35 ± 11.42 seconds in Group 3 (p<0.001). In Group 1 this was significantly shorter than the other two groups. There was no significant difference in the number of attempts, the incidence of dural puncture and backache incidence between the three groups (p>0.05). The use of SL syringe was found to have a shorter time period to locate the epidural space when compared with the LOR syringe and hanging drop technique.

Retrospective Analysis of Hanging Deaths in Ontario.

PubMed

Tugaleva, Elena; Gorassini, Donald R; Shkrum, Michael J

2016-11-01

Hanging deaths from investigation standpoint are rarely problematic. Unusual circumstances can on occasion raise suspicion of foul play. Associated neck injuries are reported in the literature with variable frequency (from 0% to 76.8%). This study retrospectively analyzed 755 hanging deaths in Ontario (Canada) to evaluate the demographic features and circumstances of hanging fatalities, and the frequency of hanging-related neck injuries. A number of cases showed unusual/special circumstances (e.g., complex, double suicides, restraints). Among 632 cases with complete autopsies, hyoid and larynx fractures were present in 46 cases (7.3%) with the most common being isolated hyoid fractures. The incidence of cricoid fractures was 0.5% and cervical spine injuries, 1.1%. A higher incidence of neck injuries occurred among males, long drop hangings, and in cases with complete suspension. There was a tendency for the number of fractures to increase with increasing age and weight of the deceased. © 2016 American Academy of Forensic Sciences.

Suicidal Decapitation by Hanging-A Population-based Study.

PubMed

Byard, Roger W; Gilbert, John D

2018-05-01

A prospective study was undertaken at Forensic Science SA over a 15-year period from July 2002 to June 2017 for all cases of adult (>18 years) suicidal hangings with decapitation. A total of 1446 cases of suicidal hangings were identified from a general population of approximately 1.5 million (1206 males-age range 18-97 years, average 42.6; and 240 females-age range 18-96 years, average 40.1). Only three cases of decapitation were found, all from long-drop hangings; these consisted of three males (ages 32-55 years; average 45 years). Spinal transections had occurred between the first and second, second and third, and third and fourth cervical vertebrae, respectively. In this study, the number of suicidal hangings with decapitation represented only 0.2% of the total number of hangings. These events are therefore extremely rare, most likely due to most suicidal hangings occurring from relatively low levels in a domestic environment. © 2017 American Academy of Forensic Sciences.

Inhibition of hexokinase-2 with targeted liposomal 3-bromopyruvate in an ovarian tumor spheroid model of aerobic glycolysis

PubMed Central

Gandham, Srujan Kumar; Talekar, Meghna; Singh, Amit; Amiji, Mansoor M

2015-01-01

Background The objective of this study was to evaluate the expression levels of glycolytic markers, especially hexokinase-2 (HK2), using a three-dimensional multicellular spheroid model of human ovarian adenocarcinoma (SKOV-3) cells and to develop an epidermal growth factor receptor-targeted liposomal formulation for improving inhibition of HK2 and the cytotoxicity of 3-bromopyruvate (3-BPA). Methods Multicellular SKOV-3 tumor spheroids were developed using the hanging drop method and expression levels of glycolytic markers were examined. Non-targeted and epidermal growth factor receptor-targeted liposomal formulations of 3-BPA were formulated and characterized. Permeability and cellular uptake of the liposomal formulations in three-dimensional SKOV-3 spheroids was evaluated using confocal microscopy. The cytotoxicity and HK2 inhibition potential of solution form of 3-BPA was compared to the corresponding liposomal formulation by using cell proliferation and HK2 enzymatic assays. Results SKOV-3 spheroids were reproducibly developed using the 96-well hanging drop method, with an average size of 900 µm by day 5. HK2 enzyme activity levels under hypoxic conditions were found to be higher than under normoxic conditions (P<0.0001, Student’s t-test, unpaired and two-tailed). Liposomal formulations (both non-targeted and targeted) of 3-BPA showed a more potent inhibitory effect (P<0.001, Student’s t-test, unpaired and two-tailed) at a dose of 50 µM than the aqueous solution form at 3, 6, and 24 hours post administration. Similarly, the cytotoxic activity 3-BPA at various concentrations (10 µM–100 µM) showed that the liposomal formulations had an enhanced cytotoxic effect of 2–5-fold (P<0.0001, Student’s t-test, unpaired and two-tailed) when compared to the aqueous solution form for both 10 µM and 25 µM concentrations. Conclusion SKOV-3 spheroids developed by the hanging drop method can be used as a tumor aerobic glycolysis model for evaluation of therapies targeting the glycolytic pathway in cancer cells. Encapsulation of 3-BPA in a liposomal formulation improved permeability, HK2 inhibition, and cytotoxicity in the multicellular spheroid model. PMID:26185443

Deer mouse hemoglobin exhibits a lowered oxygen affinity owing to mobility of the E helix.

PubMed

Inoguchi, Noriko; Oshlo, Jake R; Natarajan, Chandrasekhar; Weber, Roy E; Fago, Angela; Storz, Jay F; Moriyama, Hideaki

2013-04-01

The deer mouse, Peromyscus maniculatus, exhibits altitude-associated variation in hemoglobin oxygen affinity. To examine the structural basis of this functional variation, the structure of the hemoglobin was solved. Recombinant hemoglobin was expressed in Escherichia coli and was purified by ion-exchange chromatography. Recombinant hemoglobin was crystallized by the hanging-drop vapor-diffusion method using polyethylene glycol as a precipitant. The obtained orthorhombic crystal contained two subunits in the asymmetric unit. The refined structure was interpreted as the aquo-met form. Structural comparisons were performed among hemoglobins from deer mouse, house mouse and human. In contrast to human hemoglobin, deer mouse hemoglobin lacks the hydrogen bond between α1Trp14 in the A helix and α1Thr67 in the E helix owing to the Thr67Ala substitution. In addition, deer mouse hemoglobin has a unique hydrogen bond at the α1β1 interface between residues α1Cys34 and β1Ser128.

Deer mouse hemoglobin exhibits a lowered oxygen affinity owing to mobility of the E helix

PubMed Central

Inoguchi, Noriko; Oshlo, Jake R.; Natarajan, Chandrasekhar; Weber, Roy E.; Fago, Angela; Storz, Jay F.; Moriyama, Hideaki

2013-01-01

The deer mouse, Peromyscus maniculatus, exhibits altitude-associated variation in hemoglobin oxygen affinity. To examine the structural basis of this functional variation, the structure of the hemoglobin was solved. Recombinant hemoglobin was expressed in Escherichia coli and was purified by ion-exchange chromatography. Recombinant hemoglobin was crystallized by the hanging-drop vapor-diffusion method using polyethylene glycol as a precipitant. The obtained orthorhombic crystal contained two subunits in the asymmetric unit. The refined structure was interpreted as the aquo-met form. Structural comparisons were performed among hemoglobins from deer mouse, house mouse and human. In contrast to human hemoglobin, deer mouse hemoglobin lacks the hydrogen bond between α1Trp14 in the A helix and α1Thr67 in the E helix owing to the Thr67Ala substitution. In addition, deer mouse hemoglobin has a unique hydrogen bond at the α1β1 interface between residues α1Cys34 and β1Ser128. PMID:23545644

Study of the voltammetric behaviour of the ethalfluralin and methalpropalin and its determination in environmental matrices at hanging mercury drop electrode.

PubMed

Thriveni, T; Kumar, J Rajesh; Lee, Jin Young; Sreedhar, N Y

2009-04-01

An electroanalytical method has been developed for the determination of the herbicides ethalfluralin[N-ethyl-N-(2-methyl-2-propenyl)-2,6-dinitro-4-(trifluoromethyl) bezenamine] and methalpropalin [N-(2-methyl-2-propenyl)-2, 6-dinitro-N-propyl-4 (trifluoromethyl) benzenamine] by differential pulse adsorptive stripping voltammetry (DP-AdSV) on a hanging mercury drop electrode (HMDE) with universal buffer as supporting electrolyte. The optimum adsorption conditions were found to be pH 6.0, an accumulation potential of -0.6 V (HMDE vs SCE), an accumulation time of 80 s. and scan rate 45 mVs(-1). Calibration curve is linear in the range 1.30 x 10(-9) to 1.32 x 10(-5) M of ethalfluralin and 1.13 x 10(-5) to 2.0 x 10(-8) M of methalpropalin with detection limits of 1.08 x 10(-9) and 1.87 x 10(-8) M, respectively. The relative SD and correlation coefficients were found to be 1.24%, 0.998 and 1.34%, 0.995, respectively for ten replicates. The method is applied to the determination of the ethalfluralin and methalpropalin in formulations and environmental matrices.

Crystallization and preliminary crystallographic analysis of orotidine 5′-monophosphate decarboxylase from the human malaria parasite Plasmodium falciparum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krungkrai, Sudaratana R.; Department of Molecular Protozoology, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita, Osaka 565-0871; Tokuoka, Keiji

Orotidine 5′-monophosphate decarboxylase of human malaria parasite P. falciparum was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation. Orotidine 5′-monophosphate (OMP) decarboxylase (OMPDC; EC 4.1.1.23) catalyzes the final step in the de novo synthesis of uridine 5′-monophosphate (UMP) and defects in the enzyme are lethal in the malaria parasite Plasmodium falciparum. Active recombinant P. falciparum OMPDC (PfOMPDC) was crystallized by the seeding method in a hanging drop using PEG 3000 asmore » a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation at the Swiss Light Source. The crystal exhibits trigonal symmetry (space group R3), with hexagonal unit-cell parameters a = b = 201.81, c = 44.03 Å. With a dimer in the asymmetric unit, the solvent content is 46% (V{sub M} = 2.3 Å{sup 3} Da{sup −1})« less

Electrochemistry of moexipril: experimental and computational approach and voltammetric determination.

PubMed

Taşdemir, Hüdai I; Kiliç, E

2014-09-01

The electrochemistry of moexipril (MOE) was studied by electrochemical methods with theoretical calculations performed at B3LYP/6-31 + G (d)//AM1. Cyclic voltammetric studies were carried out based on a reversible and adsorption-controlled reduction peak at -1.35 V on a hanging mercury drop electrode (HMDE). Concurrently irreversible diffusion-controlled oxidation peak at 1.15 V on glassy carbon electrode (GCE) was also employed. Potential values are according to Ag/AgCI, (3.0 M KCI) and measurements were performed in Britton-Robinson buffer of pH 5.5. Tentative electrode mechanisms were proposed according to experimental results and ab-initio calculations. Square-wave adsorptive stripping voltammetric methods have been developed and validated for quantification of MOE in pharmaceutical preparations. Linear working range was established as 0.03-1.35 microM for HMDE and 0.2-20.0 microM for GCE. Limit of quantification (LOQ) was calculated to be 0.032 and 0.47 microM for HMDE and GCE, respectively. Methods were successfully applied to assay the drug in tablets by calibration and standard addition methods with good recoveries between 97.1% and 106.2% having relative standard deviation less than 10%.

Hanging drop cultures of human testis and testis cancer samples: a model used to investigate activin treatment effects in a preserved niche.

PubMed

Jørgensen, A; Young, J; Nielsen, J E; Joensen, U N; Toft, B G; Rajpert-De Meyts, E; Loveland, K L

2014-05-13

Testicular germ cell tumours of young adults, seminoma or non-seminomas, are preceded by a pre-invasive precursor, carcinoma in situ (CIS), understood to arise through differentiation arrest of embryonic germ cells. Knowledge about the malignant transformation of germ cells is currently limited by the lack of experimental models. The aim of this study was to establish an experimental tissue culture model to maintain normal and malignant germ cells within their niche and allow investigation of treatment effects. Human testis and testis cancer specimens from orchidectomies were cultured in 'hanging drops' and effects of activin A and follistatin treatment were investigated in seminoma cultures. Testis fragments with normal spermatogenesis or CIS cells were cultured for 14 days with sustained proliferation of germ cells and CIS cells and without increased apoptosis. Seminoma cultures survived 7 days, with proliferating cells detectable during the first 5 days. Activin A treatment significantly reduced KIT transcript and protein levels in seminoma cultures, thereby demonstrating a specific treatment response. Hanging drop cultures of human testis and testis cancer samples can be employed to delineate mechanisms governing growth of normal, CIS and tumorigenic germ cells retained within their niche.

Real-time fluorescence quenching-based detection of nitro-containing explosive vapours: what are the key processes?

PubMed

Shaw, P E; Burn, P L

2017-11-15

The detection of explosives continues to be a pressing global challenge with many potential technologies being pursued by the scientific research community. Luminescence-based detection of explosive vapours with an organic semiconductor has attracted much interest because of its potential for detectors that have high sensitivity, compact form factor, simple operation and low-cost. Despite the abundance of literature on novel sensor materials systems there are relatively few mechanistic studies targeted towards vapour-based sensing. In this Perspective, we will review the progress that has been made in understanding the processes that control the real-time luminescence quenching of thin films by analyte vapours. These are the non-radiative quenching process by which the sensor exciton decays, the analyte-sensor intermolecular binding interaction, and the diffusion process for the analyte vapours in the film. We comment on the contributions of each of these processes towards the sensing response and, in particular, the relative roles of analyte diffusion and exciton diffusion. While the latter has been historically judged to be one of, if not the primary, causes for the high sensitivity of many conjugated polymers to nitrated vapours, recent evidence suggests that long exciton diffusion lengths are unnecessary. The implications of these results on the development of sensor materials for real-time detection are discussed.

Formation of stable small cell number three-dimensional ovarian cancer spheroids using hanging drop arrays for preclinical drug sensitivity assays

PubMed Central

Raghavan, Shreya; Ward, Maria R.; Rowley, Katelyn R.; Wold, Rachel M.; Takayama, Shuichi; Buckanovich, Ronald J.; Mehta, Geeta

2015-01-01

Background Ovarian cancer grows and metastasizes from multicellular spheroidal aggregates within the ascites fluid. Multicellular tumor spheroids are therefore physiologically significant3Din vitro models for ovarian cancer research. Conventional hanging drop cultures require high starting cell numbers, and are tedious for long-term maintenance. In this study, we generate stable, uniform multicellular spheroids using very small number of ovarian cancer cells in a novel 384 well hanging drop array platform. Methods We used novel tumor spheroid platform and two ovarian cancer cell lines (A2780 and OVCAR3) to demonstrate the stable incorporation of as few as 10 cells into a single spheroid. Results Spheroids had uniform geometry, with projected areas (42.60 × 103 μm–475.22 × 103 μm2 for A2780 spheroids and 37.24 × 103 μm2–281.01 × 103 μm2 for OVCAR3 spheroids) that varied as a function of the initial cell seeding density. Phalloidin and nuclear stains indicated cells formed tightly packed spheroids with demarcated boundaries and cell–cell interaction within spheroids. Cells within spheroids demonstrated over 85% viability. 3D tumor spheroids demonstrated greater resistance (70–80% viability) to cisplatin chemotherapy compared to 2D cultures (30–50% viability). Conclusions Ovarian cancer spheroids can be generated from limited cell numbers in high throughput 384 well plates with high viability. Spheroids demonstrate therapeutic resistance relative to cells in traditional 2D culture. Stable incorporation of low cell numbers is advantageous when translating this research to rare patient-derived cells. This system can be used to understand ovarian cancer spheroid biology, as well as carry out preclinical drug sensitivity assays. PMID:25913133

Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG

PubMed Central

Jens, Jason; Raghunathan, Kannan; Vago, Frank; Arvidson, Dennis

2009-01-01

EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 Å and belonged to space group P21, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 Å. PMID:19478449

Inhibition of hexokinase-2 with targeted liposomal 3-bromopyruvate in an ovarian tumor spheroid model of aerobic glycolysis.

PubMed

Gandham, Srujan Kumar; Talekar, Meghna; Singh, Amit; Amiji, Mansoor M

2015-01-01

The objective of this study was to evaluate the expression levels of glycolytic markers, especially hexokinase-2 (HK2), using a three-dimensional multicellular spheroid model of human ovarian adenocarcinoma (SKOV-3) cells and to develop an epidermal growth factor receptor-targeted liposomal formulation for improving inhibition of HK2 and the cytotoxicity of 3-bromopyruvate (3-BPA). Multicellular SKOV-3 tumor spheroids were developed using the hanging drop method and expression levels of glycolytic markers were examined. Non-targeted and epidermal growth factor receptor-targeted liposomal formulations of 3-BPA were formulated and characterized. Permeability and cellular uptake of the liposomal formulations in three-dimensional SKOV-3 spheroids was evaluated using confocal microscopy. The cytotoxicity and HK2 inhibition potential of solution form of 3-BPA was compared to the corresponding liposomal formulation by using cell proliferation and HK2 enzymatic assays. SKOV-3 spheroids were reproducibly developed using the 96-well hanging drop method, with an average size of 900 µm by day 5. HK2 enzyme activity levels under hypoxic conditions were found to be higher than under normoxic conditions (P<0.0001, Student's t-test, unpaired and two-tailed). Liposomal formulations (both non-targeted and targeted) of 3-BPA showed a more potent inhibitory effect (P<0.001, Student's t-test, unpaired and two-tailed) at a dose of 50 µM than the aqueous solution form at 3, 6, and 24 hours post administration. Similarly, the cytotoxic activity 3-BPA at various concentrations (10 µM-100 µM) showed that the liposomal formulations had an enhanced cytotoxic effect of 2-5-fold (P<0.0001, Student's t-test, unpaired and two-tailed) when compared to the aqueous solution form for both 10 µM and 25 µM concentrations. SKOV-3 spheroids developed by the hanging drop method can be used as a tumor aerobic glycolysis model for evaluation of therapies targeting the glycolytic pathway in cancer cells. Encapsulation of 3-BPA in a liposomal formulation improved permeability, HK2 inhibition, and cytotoxicity in the multicellular spheroid model.

First steps towards the successful surface-based cultivation of human embryonic stem cells in hanging drop systems.

PubMed

Schulz, Julia C; Stumpf, Patrick S; Katsen-Globa, Alisa; Sachinidis, Agapios; Hescheler, Jürgen; Zimmermann, Heiko

2012-11-01

Miniaturization and parallelization of cell culture procedures are in focus of research in order to develop test platforms with low material consumption and increased standardization for toxicity and drug screenings. The cultivation in hanging drops (HDs) is a convenient and versatile tool for biological applications and represents an interesting model system for the screening applications due to its uniform shape, the advantageous gas supply, and the small volume. However, its application has so far been limited to non-adherent and aggregate forming cells. Here, we describe for the first time the proof-of-principle regarding the adherent cultivation of human embryonic stem cells in HD. For this microcarriers were added to the droplet as dynamic cultivation surfaces resulting in a maintained pluripotency and proliferation capacity for 10 days. This enables the HD technique to be extended to the cultivation of adherence-dependent stem cells. Also, the possible automation of this method by implementation of liquid handling systems opens new possibilities for miniaturized screenings, the improvement of cultivation and differentiation conditions, and toxicity and drug development.

Preparation of anti-inflammatory mesenchymal stem/precursor cells (MSCs) through sphere formation using hanging-drop culture technique.

PubMed

Bartosh, Thomas J; Ylostalo, Joni H

2014-02-06

Herein, we describe a protocol for preparation of pre-activated anti-inflammatory human mesenchymal stem/precursor cells (MSCs) in 3-D culture without addition of exogenous chemicals or gene-transfer approaches. MSCs are an easily procurable source of multipotent adult stem cells with therapeutic potential largely attributed to their paracrine regulation of inflammation and immunity. However, the culture conditions to prepare the ideal MSCs for cell therapy remain elusive. Furthermore, the reported lag time for activation in experimental models has prompted investigations on pre-activating the cells prior to their administration. In this protocol, standard 2-D culture-expanded MSCs are activated by aggregation into 3-D spheres using hanging-drop cultures. MSC activation is evaluated by real-time PCR and/or ELISA for anti-inflammatory factors (TSG-6, STC-1, PGE2), and by a functional assay using lipopolysaccharide-stimulated macrophage cultures. Further, we elucidate methods to prepare MSC-sphere conditioned medium, intact spheres, and suspension of single cells from spheres for experimental and clinical applications. Copyright © 2014 John Wiley & Sons, Inc.

First steps towards the successful surface-based cultivation of human embryonic stem cells in hanging drop systems

PubMed Central

Schulz, Julia C; Stumpf, Patrick S; Katsen-Globa, Alisa; Sachinidis, Agapios; Hescheler, Jürgen; Zimmermann, Heiko

2012-01-01

Miniaturization and parallelization of cell culture procedures are in focus of research in order to develop test platforms with low material consumption and increased standardization for toxicity and drug screenings. The cultivation in hanging drops (HDs) is a convenient and versatile tool for biological applications and represents an interesting model system for the screening applications due to its uniform shape, the advantageous gas supply, and the small volume. However, its application has so far been limited to non‐adherent and aggregate forming cells. Here, we describe for the first time the proof-of-principle regarding the adherent cultivation of human embryonic stem cells in HD. For this microcarriers were added to the droplet as dynamic cultivation surfaces resulting in a maintained pluripotency and proliferation capacity for 10 days. This enables the HD technique to be extended to the cultivation of adherence-dependent stem cells. Also, the possible automation of this method by implementation of liquid handling systems opens new possibilities for miniaturized screenings, the improvement of cultivation and differentiation conditions, and toxicity and drug development. PMID:23486530

Preparation of anti-inflammatory mesenchymal stem/precursor cells (MSCs) through sphere formation using hanging drop culture technique

PubMed Central

Bartosh, Thomas J.

2014-01-01

Herein, we describe a protocol for preparation of pre-activated anti-inflammatory human mesenchymal stem/precursor cells (MSCs) in 3D culture without addition of exogenous chemicals or gene transfer approaches. MSCs are an easily procurable source of multipotent adult stem cells with therapeutic potential largely attributed to their paracrine regulation of inflammation and immunity. However, the culture conditions to prepare the ideal MSCs for cell therapy remain elusive. Furthermore, reported lag time for activation in experimental models have prompted investigations to pre-activate the cells prior to their administration. In this protocol, standard 2D culture expanded MSCs are activated by aggregation into 3D spheres using hanging drop cultures. MSC activation is evaluated by real-time PCR and/or ELISA for anti-inflammatory factors (TSG-6, STC-1, PGE2), and by a functional assay using lipopolysaccharide-stimulated macrophage cultures. Furthermore, we elucidate methods to prepare MSC sphere conditioned medium, intact spheres, and suspension of single cells from spheres for experimental and clinical applications. PMID:24510769

Isolation, expansion, and differentiation of goat adipose-derived stem cells.

PubMed

Ren, Yu; Wu, Haiqing; Zhou, Xueyuan; Wen, Jianxun; Jin, Muzi; Cang, Ming; Guo, Xudong; Wang, Qinglian; Liu, Dongjun; Ma, Yuzhen

2012-08-01

A goat adipose-derived stem cell (ADSC) line was established and compared to a rat line. Goat ADSC cells had normal diploidy after subculture. Proliferation of goat ADSCs was faster than rat cells in the same conditions. Both rat and goat ADSCs stained positively for vimentin, CD49d, CD44 and CD13, but stained negatively for CD34 and CD106. Bone nodules were apparent, and alizarin staining was positive after osteogenic induction. Cells expressing osteocalcin were positive by alkaline phosphatase (ALP) staining. After osteogenic induction, ossification nodules of goat ADSCs were larger than in rats, with dense ALP staining. Adipogenic induction resulting in lipid droplets and peroxisome proliferator-activated receptor (PPARγ2) expression were observed. Cartilage lacunae were formed and COL2A1 was expressed. More cartilage lacunae with better morphology were seen following differentiation of goat ADSC's using the hang-drop method. For goat ADSCs, results with both adherent-induced and hanging-drop induced cultures were better than for three-dimensional cultures. Copyright © 2012. Published by Elsevier India Pvt Ltd.

X-RAY INDUCED INCORPORATION OF TRITIATED THYMIDINE INTO GRASSHOPPER NEUROBLAST CHROMOSOMES

DOE Office of Scientific and Technical Information (OSTI.GOV)

McGrath, R.A.

1962-01-01

Neuroblasts of the grasshopper Chortophage viridifasciata (De Geer) were used to study incorporation of tritiated thymidine (H/sub 3/Thd), a deoxyribonucleic acid (DNA) precursor, into chromosomes. Embryos were made into hanging drop cultures which contained H/sub 3/Thd and exposed to 32 or 250 r of x rays. Individual cells were identified and observed by bright field microscopy for periods of time which ranged from 15 min to 6 hrs after irradiation. At the end of the observation period embryos were either sectioned or made into squash preparations. In the former case preselected neuroblasts were reidentified: in the latter they were not.more » Results of observations of living neuroblasts in hanging drop cultures are presented. Autoradiograms were prepared for the assay of H/sub 3/Thd incorporation by grain counting methods. Information obtained from the autoradiograms is discussed. Results are interpreted as a reflection of repair of x-ray-damaged DNA. A correlation is suggested between detectable chromosome breakage, the normal DNA synthesis period, and labeling of delayed, stopped or reverted prophase neuroblasts. (M.P.G.)« less

Studying electron transfer through alkanethiol self-assembled monolayers on a hanging mercury drop electrode using potentiometric measurements.

PubMed

Cohen-Atiya, Meirav; Mandler, Daniel

2006-10-14

A new approach based on measuring the change of the open-circuit potential (OCP) of a hanging mercury drop electrode (HMDE), modified with alkanethiols of different chain length conducted in a solution containing a mixture of Ru(NH3)6(2+) and Ru(NH3)6(3+) is used for studying electron transfer across the monolayer. Following the time dependence of the OCP allowed the extraction of the kinetic parameters, such as the charge transfer resistance (R(ct)) and the electron transfer rate constant (k(et)), for different alkanethiol monolayers. An electron tunneling coefficient, beta, of 0.9 A(-1) was calculated for the monolayers on Hg.

Thermostatic tissue platform for intravital microscopy: 'the hanging drop' model.

PubMed

Pavlovic, Dragan; Frieling, Helge; Lauer, Kai-Stephan; Bac, Vo Hoai; Richter, Joern; Wendt, Michael; Lehmann, Christian; Usichenko, Taras; Meissner, Konrad; Gruendling, Matthias

2006-11-01

Intravital microscopy imposes the particular problem of the combined control of the body temperature of the animal and the local temperature of the observed organ or tissues. We constructed and tested, in the rat ileum microcirculation preparation, a new organ-support platform. The platform consisted of an organ bath filled with physiological solution, and contained a suction tube, a superfusion tube, an intestine-support hand that was attached to a micromanipulator and a thermometer probe. To cover the intestine we used a cover glass plate with a plastic ring glued on its upper surface. After a routine procedure (anaesthesia, monitoring and surgery), the intestine segment (2-3 cm long) was gently exteriorized and placed on the 'hand' of the organ support. A small part of the intestine formed a small 'island' in the bath that was filled with physiological salt solution. The cover glass was secured in place. The physiological salt solution from the superfusion tube, which was pointed to the lower surface of the cover glass, formed a 'hanging drop'. The objective of the microscope was then immersed into distilled water that was formed by the cover glass plastic ring. The 'hanging drop' technique prevented any tissue quenching, ensured undisturbed microcirculation, provided for stable temperature and humidity, and permitted a clear visual field.

Digital microfluidics for automated hanging drop cell spheroid culture.

PubMed

Aijian, Andrew P; Garrell, Robin L

2015-06-01

Cell spheroids are multicellular aggregates, grown in vitro, that mimic the three-dimensional morphology of physiological tissues. Although there are numerous benefits to using spheroids in cell-based assays, the adoption of spheroids in routine biomedical research has been limited, in part, by the tedious workflow associated with spheroid formation and analysis. Here we describe a digital microfluidic platform that has been developed to automate liquid-handling protocols for the formation, maintenance, and analysis of multicellular spheroids in hanging drop culture. We show that droplets of liquid can be added to and extracted from through-holes, or "wells," and fabricated in the bottom plate of a digital microfluidic device, enabling the formation and assaying of hanging drops. Using this digital microfluidic platform, spheroids of mouse mesenchymal stem cells were formed and maintained in situ for 72 h, exhibiting good viability (>90%) and size uniformity (% coefficient of variation <10% intraexperiment, <20% interexperiment). A proof-of-principle drug screen was performed on human colorectal adenocarcinoma spheroids to demonstrate the ability to recapitulate physiologically relevant phenomena such as insulin-induced drug resistance. With automatable and flexible liquid handling, and a wide range of in situ sample preparation and analysis capabilities, the digital microfluidic platform provides a viable tool for automating cell spheroid culture and analysis. © 2014 Society for Laboratory Automation and Screening.

Sizing of colloidal particle and protein molecules in a hanging fluid drop

NASA Technical Reports Server (NTRS)

Ansari, Rafat R.; Suh, Kwang I.

1995-01-01

We report non-invasive particle size measurements of polystyrene latex colloidal particles and bovine serum albumin (BSA) protein molecules suspended in tiny hanging fluid drops of 30 micro-Liter volume using a newly designed fiber optic probe. The probe is based upon the principles of the technique of dynamic light scattering (DLS). The motivation for this work comes from growing protein crystals in outer space. Protein crystals have been grown previously in hanging drops in microgravity experiments on-board the space shuttle orbiter. However, obtaining quantitative information on nucleation and growth of the protein crystals in real time has always been a desired goal, but hitherto not achieved. Several protein researchers have shown interest in using DLS to monitor crystal growth process in a droplet, but elaborate instrumentation and optical alignment problems have made in-situ applications difficult. We demonstrate that such an experiment is now possible. Our system offers fast (5 seconds) determination of particle size, utilize safe levels of very low laser power (less than or equal to 0.2 mW), a small scattering volume (approximately 2 x 10(exp -5) cu mm) and high spatial coherence (Beta) values. This is a major step forward when compared to currently available DLS systems.

Electrodeless electro-hydrodynamic gentle printing of personalized medicines

NASA Astrophysics Data System (ADS)

Khusid, Boris; Elele, Ezinwa; Shen, Yueyang

2010-11-01

Drop-on-demand (DOD) principle appears to be a particular promising approach for manufacturing personalized treatments carefully tailored to a patient's genetic background. The authors have recently developed a DOD method for gentle printing of personalized medicines. A fluid is infused into an electrically insulating nozzle to form a pendant drop. A sufficiently strong voltage pulse is applied to external electrodes to stretch the pendant drop until it touches an electrically insulating film and forms a liquid bridge. As the liquid bridge is intentionally formed in an unstable configuration, it breaks up, creating two drops, one on the film and the other hanging from the nozzle. To prove the validity and versatility of the method, experiments are conducted on fluids whose viscosity, conductivity, dielectric constant, and surface tension vary over a broad range, respectively: 1-1045 cP, 0.02-290 μS/cm, 9-78, and 41-72 dyn/cm. We present a scaling analysis that captures the essential physics of drop evolution and provides the critical design guidelines. The work was supported by NSF Engineering Research Center on Structured Organic Particulate Systems.

A new approach to stability and oscillations of constrained drops and capillary bridges

NASA Astrophysics Data System (ADS)

Fabre, David; Chireux, Veronique; Risso, Frederic; Tordjeman, Philippe

2014-11-01

Static equilibria of liquid inclusions under the effect of gravity and capillarity is a large class of situations which encompasses drops hanging from a ceiling or from a capillary, sessile drops, liquid bridges, etc... In such equilibria the surface shape is governed by the Yong-Laplace equation, which is usually solved in a local way using a ``shooting'' method. We introduce a new method which solves the Laplace-Young in a global way, using an iterative deformation of the shape towards the equilibrium shape. The method is easy to implement and versatile, and allows to prescribe constraints such as the volume of liquid, the angle of attachment, etc... We subsequently consider the issue of stability and oscillations of such configurations. Using finite elements and considering small-amplitude displacements of the surface with respect to the static configuration previously computed, we introduce a global stability approach which allows to predict the stability limits, the oscillation frequencies and the eigenmode shapes for quite general geometries. The approach will be illustrated and compared with experiments in two situations, namely a drop attached to a capilary and a liquid bridge resulting from the coalescence of two facing millimetric drops.

Factors affecting the morphology of isocitrate lyase crystals

NASA Technical Reports Server (NTRS)

Demattei, Robert C.; Feigelson, Robert S.; Weber, Patricia C.

1992-01-01

Isocitrate lyase crystals have been grown by the hanging drop vapor equilibration method in both 1-g and microgravity and by vapor equilibrium in small capillaries. The crystal morphologies obtained have ranged from dendritic to 'octagonal' prisms. Theoretical evaporation models have been applied to these growth regimes. The results of these analyses along with other experimental results, indicate the factors which must be controlled to produce good growth morphologies.

Electrochemical methods for monitoring of environmental carcinogens.

PubMed

Barek, J; Cvacka, J; Muck, A; Quaiserová, V; Zima, J

2001-04-01

The use of modern electroanalytical techniques, namely differential pulse polarography, differential pulse voltammetry on hanging mercury drop electrode or carbon paste electrode, adsorptive stripping voltammetry and high performance liquid chromatography with electrochemical detection for the determination of trace amounts of carcinogenic N-nitroso compounds, azo compounds, heterocyclic compounds, nitrated polycyclic aromatic hydrocarbons and aromatic and heterocyclic amines is discussed. Scope and limitations of these methods are described and some practical applications based on their combination with liquid-liquid or solid phase extraction are given.

Optimal formation of genetically modified and functional pancreatic islet spheroids by using hanging-drop strategy.

PubMed

Kim, H J; Alam, Z; Hwang, J W; Hwang, Y H; Kim, M J; Yoon, S; Byun, Y; Lee, D Y

2013-03-01

Rejection and hypoxia are important factors causing islet loss at an early stage after pancreatic islet transplantation. Recently, islets have been dissociated into single cells for reaggregation into so-called islet spheroids. Herein, we used a hanging-drop strategy to form islet spheroids to achieve functional equivalence to intact islets. To obtain single islet cells, we dissociated islets with trypsin-EDTA digestion for 10 minutes. To obtain spheroids, we dropped various numbers of single cells (125, 250, or 500 cells/30 μL drop) onto a Petri dish, that was inverted for incubation in humidified air containing 5% CO(2) at 37 °C for 7 days. The aggregated spheroids in the droplets were harvested for further culture. The size of the aggregated islet spheroids depended on the number of single cells (125-500 cells/30 μL droplet). Their morphology was similar to that of intact islets without any cellular damage. When treated with various concentrations of glucose to evaluate responsiveness, their glucose-mediated stimulation index value was similar to that of intact islets, an observation that was attributed to strong cell-to-cell interactions in islet spheroids. However, islet spheroids aggregated in general culture dishes showed abnormal glucose responsiveness owing to weak cell-to-cell interactions. Cell-to-cell interactions in islet spheroids were confirmed with an anti-connexin-36 monoclonal antibody. Finally, nonviral poly(ethylene imine)-mediated interleukin-10 cytokine gene delivered beforehand into dissociated single cells before formation of islet spheroids increased the gene transfection efficacy and interleukin-10 secretion from islet spheroids >4-fold compared with intact islets. These results demonstrated the potential application of genetically modified, functional islet spheroids with of controlled size and morphology using an hanging-drop technique. Copyright © 2013 Elsevier Inc. All rights reserved.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Capillary Thinning of Particle-laden Drops

NASA Astrophysics Data System (ADS)

Wagoner, Brayden; Thete, Sumeet; Jahns, Matt; Doshi, Pankaj; Basaran, Osman

2015-11-01

Drop formation is central in many applications such as ink-jet printing, microfluidic devices, and atomization. During drop formation, a thinning filament is created between the about-to-form drop and the fluid hanging from the nozzle. Therefore, the physics of capillary thinning of filaments is key to understanding drop formation and has been thoroughly studied for pure Newtonian fluids. The thinning dynamics is, however, altered completely when the fluid contains particles, the physics of which is not well understood. In this work, we explore the impact of solid particles on filament thinning and drop formation by using a combination of experiments and numerical simulations.

Crystallization and initial crystallographic characterization of the Corynebacterium glutamicum nitrilotriacetate monooxygenase component A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Kyung-Jin, E-mail: kkj@postech.ac.kr; Kim, Sujin; Lee, Sujin

2006-11-01

The Corynebacterium glutamicum NTA monooxygenase component A protein, which plays the central role in NTA biodegradation, was crystallized. The initial X-ray crystallographic characterization is reported. Safety and environmental concerns have recently dictated the proper disposal of nitrilotriacetate (NTA). Biodegradation of NTA is initiated by NTA monooxygenase, which is composed of two proteins: component A and component B. The NTA monooxygenase component A protein from Corynebacterium glutamicum was crystallized using the sitting-drop vapour-diffusion method in the presence of ammonium sulfate as the precipitant. X-ray diffraction data were collected to a maximum resolution of 2.5 Å on a synchrotron beamline. The crystalmore » belongs to the monoclinic space group C2, with unit-cell parameters a = 111.04, b = 98.51, c = 171.61 Å, β = 101.94°. The asymmetric unit consists of four molecules, corresponding to a packing density of 2.3 Å{sup 3} Da{sup −1}. The structure was solved by molecular replacement. Structure refinement is in progress.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saijo, Shinya; Sato, Takao; Kumasaka, Takashi

The reaction center–light-harvesting 1 core complex from R. viridis was crystallized and X-ray diffraction data were collected to 8.0 Å resolution. The reaction center–light-harvesting 1 (RC–LH1) core complex is the photosynthetic apparatus in the membrane of the purple photosynthetic bacterium Rhodopseudomonas viridis. The RC is surrounded by an LH1 complex that is constituted of oligomers of three types of apoproteins (α, β and γ chains) with associated bacteriochlorophyll bs and carotenoid. It has been crystallized by the sitting-drop vapour-diffusion method. A promising crystal diffracted to beyond 8.0 Å resolution. It belonged to space group P1, with unit-cell parameters a =more » 141.4, b = 136.9, c = 185.3 Å, α = 104.6, β = 94.0, γ = 110.7°. A Patterson function calculated using data between 15.0 and 8.0 Å resolution suggested that the LH1 complex is distributed with quasi-16-fold rotational symmetry around the RC.« less

Cloning, purification, crystallization and preliminary X-ray studies of a carbohydrate-binding module (CBM_E1) derived from sugarcane soil metagenome.

PubMed

Campos, Bruna Medeia; Alvarez, Thabata Maria; Liberato, Marcelo Vizona; Polikarpov, Igor; Gilbert, Harry J; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio

2014-09-01

In recent years, owing to the growing global demand for energy, dependence on fossil fuels, limited natural resources and environmental pollution, biofuels have attracted great interest as a source of renewable energy. However, the production of biofuels from plant biomass is still considered to be an expensive technology. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases for polysaccharide degradation, is attracting growing attention. Aiming at the identification of new CBMs, a sugarcane soil metagenomic library was analyzed and an uncharacterized CBM (CBM_E1) was identified. In this study, CBM_E1 was expressed, purified and crystallized. X-ray diffraction data were collected to 1.95 Å resolution. The crystals, which were obtained by the sitting-drop vapour-diffusion method, belonged to space group I23, with unit-cell parameters a = b = c = 88.07 Å.

Expression, purification, crystallization and preliminary X-ray diffraction analysis of the pectin methylesterase from the sugar cane weevil Sphenophorus levis.

PubMed

Evangelista, Danilo Elton; Schutzer de Godoy, Andre; Fonseca Pereira de Paula, Fernando; Henrique-Silva, Flavio; Polikarpov, Igor

2014-03-01

Pectin methylesterase removes the methyl groups from the main chain of pectin, the major component of the middle lamella of the plant cell wall. The enzyme is involved in plant cell-wall development, is part of the enzymatic arsenal used by microorganisms to attack plants and also has a wide range of applications in the industrial sector. Therefore, there is a considerable interest in studies of the structure and function of this enzyme. In this work, the pectin methylesterase from Sphenophorus levis was produced in Pichia pastoris and purified. Crystals belonging to the monoclinic space group C2, with unit-cell parameters a = 122.181, b = 82.213, c = 41.176 Å, β = 97.48°, were obtained by the sitting-drop vapour-diffusion method and an X-ray diffraction data set was collected to 2.1 Å resolution. Structure refinement and model building are in progress.

Crystallization and preliminary crystallographic analysis of maganese(II)-dependent 2,3-dihydroxybiphenyl 1,2-dioxygenase from Bacillus sp. JF8

PubMed Central

Senda, Miki; Hatta, Takashi; Kimbara, Kazuhide; Senda, Toshiya

2010-01-01

A thermostable manganese(II)-dependent 2,3-dihydroxybiphenyl-1,2-dioxygenase derived from Bacillus sp. JF8 was crystallized. The initial screening for crystallization was performed by the sitting-drop vapour-diffusion method using a crystallization robot, resulting in the growth of two crystal forms. The first crystal belonged to space group P1, with unit-cell parameters a = 62.7, b = 71.4, c = 93.6 Å, α = 71.2, β = 81.0, γ = 64.0°, and diffracted to 1.3 Å resolution. The second crystal belonged to space group I222, with unit-cell parameters a = 74.2, b = 90.8, c = 104.3 Å, and diffracted to 1.3 Å resolution. Molecular-replacement trials using homoprotocatechuate 2,3-dioxygenase from Arthrobacter globiformis (28% amino-acid sequence identity) as a search model provided a satisfactory solution for both crystal forms. PMID:20208161

Crystallization and preliminary X-ray analysis of gamma-glutamyltranspeptidase from Escherichia coli K-12.

PubMed

Kumagai, H; Nohara, S; Suzuki, H; Hashimoto, W; Yamamoto, K; Sakai, H; Sakabe, K; Fukuyama, K; Sakabe, N

1993-12-20

gamma-Glutamyltranspeptidase (EC 2.3.2.2) from Escherichia coli K-12 has been purified and crystallized by means of vapor diffusion in hanging drops. Two kinds of crystals on cell dimensions were found for X-ray diffraction analysis, one from ammonium sulfate and the other from polyethylene glycol 6000 as precipitants. The crystals of the orthorhombic form grown in the presence of 15% polyethylene glycol and 20 mM sodium acetate buffer were chosen for further analysis. The crystals belonged to space group P2(1)2(1)2(1), with cell dimensions of a = 128.1, b = 129.9 and c = 79.2 A, and two molecules constitute an asymmetric unit. These crystals diffracted to 2.0 A resolution and were suitable for X-ray crystallographic studies.

Computation of shear-induced collective-diffusivity in emulsions

NASA Astrophysics Data System (ADS)

Malipeddi, Abhilash Reddy; Sarkar, Kausik

2017-11-01

The shear-induced collective-diffusivity of drops in an emulsion is calculated through simulation. A front-tracking finite difference method is used to integrate the Navier-Stokes equations. When a cloud of drops is subjected to shear flow, after a certain time, the width of the cloud increases with the 1/3 power of time. This scaling of drop-cloud-width with time is characteristic of (sub-)diffusion that arises from irreversible two-drop interactions. The collective diffusivity is calculated from this relationship. A feature of the procedure adopted here is the modest computational requirement, wherein, a few drops ( 70) in shear for short time ( 70 strain) is found to be sufficient to get a good estimate. As far as we know, collective-diffusivity has not been calculated for drops through simulation till now. The computed values match with experimental measurements reported in the literature. The diffusivity in emulsions is calculated for a range of Capillary (Ca) and Reynolds (Re) numbers. It is found to be a unimodal function of Ca , similar to self-diffusivity. A sub-linear increase of the diffusivity with Re is seen for Re < 5 . This work has been limited to a viscosity matched case.

Preliminary Crystallographic Study of Hemoglobin from Buffalo (Bubalus bubalis): A Low Oxygen Affinity Species.

PubMed

Balasubramanian, Moovarkumudalvan; Moorthy, Ponnuraj Sathya; Neelagandan, Kamariah; Ponnuswamy, Mondikalipudur Nanjappa Gounder

2009-01-01

Hemoglobin is a tetrameric, iron-containing metalloprotein, which plays a vital role in the transportation of oxygen from lungs to tissues and carbon dioxide back to lungs. Though good amount of work has already been done on hemoglobins, the scarcity of data on three dimensional structures pertaining to low oxygen affinity hemoglobins from mammalian species, motivated our group to work on this problem specifically. Herein, we report the preliminary crystallographic analysis of buffalo hemoglobin, which belongs to low oxygen affinity species. The buffalo blood was collected, purified by anion exchange chromatography and crystallized with PEG 3350 using 50mM phosphate buffer at pH 6.7 as a precipitant by hanging drop vapor diffusion method. Data collection was carried out using mar345dtb image plate detector system. Buffalo hemoglobin crystallizes in orthorhombic space group P2(1)2(1)2(1) with one whole biological molecule (alpha2beta2) in the asymmetric unit with cell dimensions a=63.064A, b=74.677A, c=110.224A.

Alcohol vapours sensor based on thin polyaniline salt film and quartz crystal microbalance.

PubMed

Ayad, Mohamad M; Torad, Nagy L

2009-06-15

A sensor based on the quartz crystal microbalance (QCM) technique was developed for detection of a number of primary aliphatic alcohols such as ethanol, methanol, 1-propanol, and 2-propanol vapours. Detection was based on a sensitive and a thin film of polyaniline, emeraldine salt (ES), coated the QCM electrode. The frequency shifts (Delta f) of the QCM were increased due to the vapour absorption into the ES film. The values of Delta f were found to be linearly correlated with the concentrations of alcohols vapour in mg L(-1). The changes in frequency are due to the hydrophilic character of the ES and the electrostatic interaction as well as the type of the alcohol. The sensor shows a good reproducibility and reversibility. The diffusion and diffusion coefficient (D) of different alcohols vapour were determined. It was found that the sensor follows Fickian kinetics.

Growth factors mediated differentiation of mesenchymal stem cells to cardiac polymicrotissue using hanging drop and bioreactor.

PubMed

Konstantinou, Dimitrios; Lei, Ming; Xia, Zhidao; Kanamarlapudi, Venkateswarlu

2015-04-01

Heart disease is the major leading cause of death worldwide and the use of stem cells promises new ways for its treatment. The relatively easy and quick acquisition of human umbilical cord matrix mesenchymal stem cells (HUMSCs) and their properties make them useful for the treatment of cardiac diseases. Therefore, the main aim of this investigation was to create cardiac polymicrotissue from HUMSCs using a combination of growth factors [sphingosine-1-phosphate (S1P) and suramin] and techniques (hanging drop and bioreactor). Using designated culture conditions of the growth factors (100 nM S1P and 500 µM suramin), cardiomyocyte differentiation medium (CDM), hanging drop, bioreactor and differentiation for 7 days, a potential specific cardiac polymicrotissue was derived from HUMSCs. The effectiveness of growth factors alone or in combination in differentiation of HUMSCs to cardiac polymicrotissue was analysed by assessing the presence of cardiac markers by immunocytochemistry. This analysis demonstrated the importance of those growth factors for the differentiation. This study for the first time demonstrated the formation of a cardiac polymicrotissue under specific culture conditions. The polymicrotissue thus obtained may be used in future as a 'patch' to cover the injured cardiac region and would thereby be useful for the treatment of heart diseases. © 2014 International Federation for Cell Biology.

The frequency-dependent response of single aerosol particles to vapour phase oscillations and its application in measuring diffusion coefficients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Preston, Thomas C.; Davies, James F.; Wilson, Kevin R.

A new method for measuring diffusion in the condensed phase of single aerosol particles is proposed and demonstrated. The technique is based on the frequency-dependent response of a binary particle to oscillations in the vapour phase of one of its chemical components. Here, we discuss how this physical situation allows for what would typically be a non-linear boundary value problem to be approximately reduced to a linear boundary value problem. For the case of aqueous aerosol particles, we investigate the accuracy of the closed-form analytical solution to this linear problem through a comparison with the numerical solution of the fullmore » problem. Then, using experimentally measured whispering gallery modes to track the frequency-dependent response of aqueous particles to relative humidity oscillations, we determine diffusion coefficients as a function of water activity. The measured diffusion coefficients are compared to previously reported values found using the two common experiments: (i) the analysis of the sorption/desorption of water from a particle after a step-wise change to the surrounding relative humidity and (ii) the isotopic exchange of water between a particle and the vapour phase. The technique presented here has two main strengths: first, when compared to the sorption/desorption experiment, it does not require the numerical evaluation of a boundary value problem during the fitting process as a closed-form expression is available. Second, when compared to the isotope exchange experiment, it does not require the use of labeled molecules. Therefore, the frequency-dependent experiment retains the advantages of these two commonly used methods but does not suffer from their drawbacks.« less

The frequency-dependent response of single aerosol particles to vapour phase oscillations and its application in measuring diffusion coefficients

DOE PAGES

Preston, Thomas C.; Davies, James F.; Wilson, Kevin R.

2017-01-13

A new method for measuring diffusion in the condensed phase of single aerosol particles is proposed and demonstrated. The technique is based on the frequency-dependent response of a binary particle to oscillations in the vapour phase of one of its chemical components. Here, we discuss how this physical situation allows for what would typically be a non-linear boundary value problem to be approximately reduced to a linear boundary value problem. For the case of aqueous aerosol particles, we investigate the accuracy of the closed-form analytical solution to this linear problem through a comparison with the numerical solution of the fullmore » problem. Then, using experimentally measured whispering gallery modes to track the frequency-dependent response of aqueous particles to relative humidity oscillations, we determine diffusion coefficients as a function of water activity. The measured diffusion coefficients are compared to previously reported values found using the two common experiments: (i) the analysis of the sorption/desorption of water from a particle after a step-wise change to the surrounding relative humidity and (ii) the isotopic exchange of water between a particle and the vapour phase. The technique presented here has two main strengths: first, when compared to the sorption/desorption experiment, it does not require the numerical evaluation of a boundary value problem during the fitting process as a closed-form expression is available. Second, when compared to the isotope exchange experiment, it does not require the use of labeled molecules. Therefore, the frequency-dependent experiment retains the advantages of these two commonly used methods but does not suffer from their drawbacks.« less

Surface tension isotherms of the dioxane-acetone-water and glycerol-ethanol-water ternary systems

NASA Astrophysics Data System (ADS)

Dzhambulatov, R. S.; Dadashev, R. Kh.; Elimkhanov, D. Z.; Dadashev, I. N.

2016-10-01

The results of the experimental and theoretical studies of the concentration dependence of surface tension of aqueous solutions of the 1,4-dioxane-acetone-water and glycerol-ethanol-water ternary systems were given. The studies were performed by the hanging-drop method on a DSA100 tensiometer. The maximum error of surface tension was 1%. The theoretical models for calculating the surface tension of the ternary systems of organic solutions were analyzed.

Low-level determination of silicon in steels by anodic stripping voltammetry on a hanging mercury drop electrode.

PubMed

Rahier, A H; Lunardi, S; Nicolle, F; George, S M

2010-10-15

The sensitive differential pulse anodic stripping voltammetry (DPASV) proposed originally by Ishiyama et al. (2001) has been revised and improved to allow the accurate measurement of silicon on a hanging mercury drop electrode (HMDE) instead of a glassy carbon electrode. We assessed the rate of formation of the partially reduced β-silicododecamolybdate and found that metallic mercury promotes the reaction in the presence of a large concentration of Fe(3+). The scope of the method has been broadened by carrying out the measurements in the presence of a constant amount of Fe(3+). The limit of detection (LOD) of the method described in the present paper is 100 μg Sig(-1) of steel, with a relative precision ranging from 5% to 12%. It can be further enhanced to 700 ng Sig(-1) of steel provided the weight of the sample, the dilution factors, the duration of the electrolysis and the ballast of iron are adequately revised. The tolerance to several interfering species has been examined, especially regarding Al(3+), Cr(3+) and Cr VI species. The method was validated using four low-alloy ferritic steels certified by the National Institute of Standards and Technology (NIST). Its application to nickel base alloys as well as to less complicated matrixes is straightforward. It has also been successfully applied to the determination of free silicon into silicon carbide nano-powder. Copyright © 2010 Elsevier B.V. All rights reserved.

Evaporation Flux Distribution of Drops on a Hydrophilic or Hydrophobic Flat Surface by Molecular Simulations.

PubMed

Xie, Chiyu; Liu, Guangzhi; Wang, Moran

2016-08-16

The evaporation flux distribution of sessile drops is investigated by molecular dynamic simulations. Three evaporating modes are classified, including the diffusion dominant mode, the substrate heating mode, and the environment heating mode. Both hydrophilic and hydrophobic drop-substrate interactions are considered. To count the evaporation flux distribution, which is position dependent, we proposed an azimuthal-angle-based division method under the assumption of spherical crown shape of drops. The modeling results show that the edge evaporation, i.e., near the contact line, is enhanced for hydrophilic drops in all the three modes. The surface diffusion of liquid molecular absorbed on solid substrate for hydrophilic cases plays an important role as well as the space diffusion on the enhanced evaporation rate at the edge. For hydrophobic drops, the edge evaporation flux is higher for the substrate heating mode, but lower than elsewhere of the drop for the diffusion dominant mode; however, a nearly uniform distribution is found for the environment heating mode. The evidence shows that the temperature distribution inside drops plays a key role in the position-dependent evaporation flux.

CO 2-fluxing collapses metal mobility in magmatic vapour

DOE PAGES

van Hinsberg, V. J.; Berlo, K.; Migdisov, A. A.; ...

2016-05-18

Magmatic systems host many types of ore deposits, including world-class deposits of copper and gold. Magmas are commonly an important source of metals and ore-forming fluids in these systems. In many magmatic-hydrothermal systems, low-density aqueous fluids, or vapours, are significant metal carriers. Such vapours are water-dominated shallowly, but fluxing of CO 2-rich vapour exsolved from deeper magma is now recognised as ubiquitous during open-system magma degassing. Furthermore, we show that such CO 2-fluxing leads to a sharp drop in element solubility, up to a factor of 10,000 for Cu, and thereby provides a highly efficient, but as yet unrecognised mechanismmore » for metal deposition.« less

A simple apparatus for controlling nucleation and size in protein crystal growth

NASA Technical Reports Server (NTRS)

Gernert, Kim M.; Smith, Robert; Carter, Daniel C.

1988-01-01

A simple device is described for controlling vapor equilibrium in macromolecular crystallization as applied to the protein crystal growth technique commonly referred to as the 'hanging drop' method. Crystal growth experiments with hen egg white lysozyme have demonstrated control of the nucleation rate. Nucleation rate and final crystal size have been found to be highly dependent upon the rate at which critical supersaturation is approached. Slower approaches show a marked decrease in the nucleation rate and an increase in crystal size.

Compact Apparatus Grows Protein Crystals

NASA Technical Reports Server (NTRS)

Bugg, Charles E.; Delucas, Lawrence J.; Suddath, Fred L.; Snyder, Robert S.; Herren, Blair J.; Carter, Daniel C.; Yost, Vaughn H.

1989-01-01

Laboratory apparatus provides delicately balanced combination of materials and chemical conditions for growth of protein crystals. Apparatus and technique for growth based on hanging-drop method for crystallization of macromolecules. Includes pair of syringes with ganged plungers. One syringe contains protein solution; other contains precipitating-agent solution. Syringes intrude into cavity lined with porous reservoir material saturated with 1 mL or more of similar precipitating-agent solution. Prior to activation, ends of syringes plugged to prevent transport of water vapor among three solutions.

Before the Drop: Engineers Ready Supersonic Decelerator

NASA Image and Video Library

2014-05-21

A saucer-shaped vehicle part of NASA Low-Density Supersonic Decelerator LDSD project designed to test interplanetary landing devices hangs on a tower in preparation for launch at the Pacific Missile Range Facility in Kauai, Hawaii.

HTR8/SVneo cells display trophoblast progenitor cell-like characteristics indicative of self-renewal, repopulation activity, and expression of "stemness-" associated transcription factors.

PubMed

Weber, Maja; Knoefler, Ilka; Schleussner, Ekkehard; Markert, Udo R; Fitzgerald, Justine S

2013-01-01

JEG3 is a choriocarcinoma--and HTR8/SVneo a transformed extravillous trophoblast--cell line often used to model the physiologically invasive extravillous trophoblast. Past studies suggest that these cell lines possess some stem or progenitor cell characteristics. Aim was to study whether these cells fulfill minimum criteria used to identify stem-like (progenitor) cells. In summary, we found that the expression profile of HTR8/SVneo (CDX2+, NOTCH1+, SOX2+, NANOG+, and OCT-) is distinct from JEG3 (CDX2+ and NOTCH1+) as seen only in human-serum blocked immunocytochemistry. This correlates with HTR8/SVneo's self-renewal capacities, as made visible via spheroid formation and multi-passagability in hanging drops protocols paralleling those used to maintain embryoid bodies. JEG3 displayed only low propensity to form and reform spheroids. HTR8/SVneo spheroids migrated to cover and seemingly repopulate human chorionic villi during confrontation cultures with placental explants in hanging drops. We conclude that HTR8/SVneo spheroid cells possess progenitor cell traits that are probably attained through corruption of "stemness-" associated transcription factor networks. Furthermore, trophoblastic cells are highly prone to unspecific binding, which is resistant to conventional blocking methods, but which can be alleviated through blockage with human serum.

Etiology and use of the "hanging drop" technique: a review.

PubMed

Todorov, Ludmil; VadeBoncouer, Timothy

2014-01-01

Background. The hanging drop (HD) technique presumably relies on the presence of subatmospheric epidural pressure. It is not clear whether this negative pressure is intrinsic or an artifact and how it is affected by body position. There are few data to indicate how often HD is currently being used. Methods. We identified studies that measured subatmospheric pressures and looked at the effect of the sitting position. We also looked at the technique used for cervical and thoracic epidural anesthesia in the last 10 years. Results. Intrinsic subatmospheric pressures were measured in the thoracic and cervical spine. Three trials studied the effect of body position, indicating a higher incidence of subatmospheric pressures when sitting. The results show lower epidural pressure (-10.7 mmHg) with the sitting position. 28.8% of trials of cervical and thoracic epidural anesthesia that documented the technique used, utilized the HD technique. When adjusting for possible bias, the rate of HD use can be as low as 11.7%. Conclusions. Intrinsic negative pressure might be present in the cervical and thoracic epidural space. This effect is more pronounced when sitting. This position might be preferable when using HD. Future studies are needed to compare it with the loss of resistance technique.

Direct voltammetric specific recognition of dopamine using AlIII-DA complexes at the hanging mercury drop electrode.

PubMed

Zhang, Fuping; Zhang, Min; Cheng, Jiongjia; Yang, Li; Ji, Ming; Bi, Shuping

2007-11-01

In this paper, we firstly report the direct voltammetric recognition and determination of dopamine (DA) by using Al(III)-DA complexes at the hanging mercury drop electrode (HMDE). A new sensitive cathodic peak of Al(III)-DA can be detected at -900 mV (vs. SCE) in 0.1 M NH(4)Cl-NH(3).H(2)O-0.1 M KCl buffer solution at pH 8.5. This unique -900 mV cathodic peak arises from the specific interaction between Al(III) and DA on the HMDE, whereas other substances with similar structures, such as L-dopa, epinephrine (EP), norepinephrine (NE), catechols, caffeic acid (CA), trihydric phenols and tiron, do not yield any new peak on the voltammograms in the potential range from -100 to -1200 mV when Al(III) is added. The distinct voltammetric characteristic of the recognition of DA can effectively inhibit the interferences of both ascorbic acid and uric acid in the DA determination by the direct electrochemistry, which is a major difficulty when a solid electrode is used. The proposed method can be anticipated as an effective means for the recognition of DA in the elucidation of the mechanisms of Parkinson's disease (PD) and Alzheimer's disease (AD) in the presence of Al(III).

Sequential Coating of Insulin Secreting Beta Cells within Multilayers of Polysaccharide Nanogels.

PubMed

Bal, Tugba; Oran, Dilem Ceren; Sasaki, Yoshihiro; Akiyoshi, Kazunari; Kizilel, Seda

2018-05-01

Pancreatic islet transplantation has emerged as a promising treatment for type-1 diabetes (T1D); however, its clinical application is still limited by the life-long use of immunosuppressive drugs, insufficient number of islets to achieve normoglycemia, and large transplantation volume. This paper reports a unique approach for nanothin coating of insulin secreting beta cell aggregates. The coating is based on hydrophobic and covalent interactions between natural acrylate modified cholesterol bearing pullulan (CHPOA) nanogels and MIN6 beta cell aggregates. Beta cell aggregates are prepared as spheroids through hanging drop method, which is optimized with respect to hanging drop volume and initial number of beta cells. These aggregates, defined as pseudoislets, are coated with sequential layers of nanogels and are evaluated as viable and functional for insulin secretion. Coating experiments are carried out using physiologically compatible medium, where pseudoislets are not brought in contact with toxic prepolymer solutions used in existing approaches. This study offers new opportunities through coating of islets with advanced functional materials under completely physiological conditions for clinical translation of cell transplantation technology. The technique developed here will establish a new paradigm for creating tolerable grafts for other chronic diseases such as anemia, cancer, central nervous system (CNS) diseases. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Crystallization and preliminary X-ray analysis of ginkbilobin-2 from Ginkgo biloba seeds: a novel antifungal protein with homology to the extracellular domain of plant cysteine-rich receptor-like kinases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyakawa, Takuya; Sawano, Yoriko; Miyazono, Ken-ichi

Purification and crystallization of ginkbilobin-2 and its selenomethionine derivative allowed the collection of complete data to 2.38 Å resolution and multiwavelength anomalous diffraction data sets, respectively. The antifungal protein ginkbilobin-2 (Gnk2) from Ginkgo biloba seeds does not show homology to other pathogenesis-related proteins, but does show homology to the extracellular domain of plant cysteine-rich receptor-like kinases. Native Gnk2 purified from ginkgo nuts and the selenomethionine derivative of recombinant Gnk2 (SeMet-rGnk2) were crystallized by the sitting-drop vapour-diffusion method using different precipitants. X-ray diffraction data were collected from Gnk2 at 2.38 Å resolution and from SeMet-rGnk2 at 2.79 Å resolution using amore » synchrotron-radiation source. The crystals of both proteins belonged to the primitive cubic space group P2{sub 1}3, with unit-cell parameters a = b = c = 143.2 Å.« less

Crystallization and preliminary X-ray diffraction analysis of an endo-1,4-β-D-glucanase from Aspergillus aculeatus F-50.

PubMed

Chen, Yun; Huang, Jian Wen; Chen, Chun Chi; Lai, Hui Lin; Jin, Jian; Guo, Rey Ting

2015-04-01

Cellulose is the most abundant renewable biomass on earth, and its decomposition has proven to be very useful in a wide variety of industries. Endo-1,4-β-D-glucanase (EC 3.2.1.4; endoglucanase), which can catalyze the random hydrolysis of β-1,4-glycosidic bonds to cleave cellulose into smaller fragments, is a key cellulolytic enzyme. An endoglucanase isolated from Aspergillus aculeatus F-50 (FI-CMCase) that was classified into glycoside hydrolase family 12 has been found to be effectively expressed in the industrial strain Pichia pastoris. Here, recombinant FI-CMCase was crystallized. Crystals belonging to the orthorhombic space group C222₁, with unit-cell parameters a = 74.2, b = 75.1, c = 188.4 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.6 Å resolution. Initial phase determination by molecular replacement clearly shows that the crystal contains two protein molecules in the asymmetric unit. Further model building and structure refinement are in progress.

Crystallization and preliminary X-ray crystallographic analysis of hydroquinone dioxygenase from Sphingomonas sp. TTNP3

PubMed Central

Da Vela, Stefano; Ferraroni, Marta; Kolvenbach, Boris A.; Keller, Eva; Corvini, Philippe F. X.; Scozzafava, Andrea; Briganti, Fabrizio

2012-01-01

Hydroquinone dioxygenase (HQDO), a novel FeII ring-fission dioxygenase from Sphingomonas sp. strain TTNP3 which oxidizes a wide range of hydroquinones to the corresponding 4-hydroxymuconic semialdehydes, has been crystallized. The enzyme is an α2β2 heterotetramer constituted of two subunits of 19 and 38 kDa. Diffraction-quality crystals of HQDO were obtained using the sitting-drop vapour-diffusion method at 277 K from a solution consisting of 16% PEG 4000, 0.3 M MgCl2, 0.1 M Tris pH 8.5. The crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 88.4, b = 125.4, c = 90.8 Å, β = 105.3°. The asymmetric unit contained two heterotetramers, i.e. four copies of each of the two different subunits related by noncrystallographic 222 symmetry. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 0.980 Å. PMID:22691794

Crystallization and preliminary X-ray diffraction analysis of the TetR-family transcriptional repressor YhgD from Bacillus halodurans

PubMed Central

Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young

2013-01-01

YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (V M) of 2.05 Å3 Da−1 and a solvent content of 40.2%. PMID:23695570

Crystallization and preliminary X-ray diffraction analysis of the TetR-family transcriptional repressor YhgD from Bacillus halodurans.

PubMed

Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young

2013-05-01

YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (VM) of 2.05 Å(3) Da(-1) and a solvent content of 40.2%.

Predictive model to describe water migration in cellular solid foods during storage.

PubMed

Voogt, Juliën A; Hirte, Anita; Meinders, Marcel B J

2011-11-01

Water migration in cellular solid foods during storage causes loss of crispness. To improve crispness retention, physical understanding of this process is needed. Mathematical models are suitable tools to gain this physical knowledge. Water migration in cellular solid foods involves migration through both the air cells and the solid matrix. For systems in which the water migration distance is large compared with the cell wall thickness of the solid matrix, the overall water flux through the system is dominated by the flux through the air. For these systems, water migration can be approximated well by a Fickian diffusion model. The effective diffusion coefficient can be expressed in terms of the material properties of the solid matrix (i.e. the density, sorption isotherm and diffusion coefficient of water in the solid matrix) and the morphological properties of the cellular structure (i.e. water vapour permeability and volume fraction of the solid matrix). The water vapour permeability is estimated from finite element method modelling using a simplified model for the cellular structure. It is shown that experimentally observed dynamical water profiles of bread rolls that differ in crust permeability are predicted well by the Fickian diffusion model. Copyright © 2011 Society of Chemical Industry.

Role of Marangoni stress during breakup of surfactant-covered liquid threads: Reduced rates of thinning and microthread cascades

NASA Astrophysics Data System (ADS)

Kamat, Pritish M.; Wagoner, Brayden W.; Thete, Sumeet S.; Basaran, Osman A.

2018-04-01

Adsorption onto and lowering of surface tension σ of fluid interfaces by surfactants is exploited in drop formation (e.g., inkjet printing) where a thinning liquid thread (radius h ) connects an about-to-form drop to the liquid that remains hanging from the nozzle when the former falls from it. Surfactants can affect thread pinch-off in two ways: first, by lowering σ , they lower capillary pressure (σ /h ), and second, as surfactant concentration along the interface can be nonuniform, they cause the interface to be subjected to a surface tension gradient or Marangoni stress. Recent studies show that the location where the thread breaks is devoid of surfactant, and others assert that the influence of Marangoni stress on pinch-off is negligible. We demonstrate by simulations and experiments that surfactants play a major role in drop formation and that Marangoni stresses acting near but not at the pinch point give rise to reduced rates of thread thinning and formation of multiple microthreads that distinguish pinch-off of surfactant-covered threads from surfactant-free ones. Thinning at finite Reynolds and Peclet numbers, Re and Pe, is shown to exhibit intermediate scaling regimes that have heretofore only been observed during pinch-off of threads undergoing creeping flow (Re=0 ) while convection of surfactant is weak compared to its diffusion (Pe<1 ).

Formation and hematopoietic differentiation of human embryoid bodies by suspension and hanging drop cultures.

PubMed

Cerdan, Chantal; Hong, Seok Ho; Bhatia, Mickie

2007-10-01

The in vitro aggregation of human embryonic stem cells (hESCs) into clusters termed embryoid bodies (EBs) allows for the spontaneous differentiation of cells representing endoderm, mesoderm, and ectoderm lineages. This stochastic process results however, in the generation of low numbers of differentiated cells, and can be enhanced to some extent by the addition of exogenous growth factors or overexpression of regulatory genes. In the authors' laboratory, the use of hematopoietic cytokines in combination with the mesoderm inducer bone morphogenetic protein-4 (BMP-4) was able to generate up to 90% of CD45(+) hematopoietic cells with colony-forming unit (CFU) activity. This unit describes two protocols that have been successfully applied in the authors' laboratory for the generation of EBs in (1) suspension and (2) hanging drop (HD) cultures from enzymatically digested clumps of undifferentiated hESC colonies.

A novel hanging spherical drop system for the generation of cellular spheroids and high throughput combinatorial drug screening.

PubMed

Neto, A I; Correia, C R; Oliveira, M B; Rial-Hermida, M I; Alvarez-Lorenzo, C; Reis, R L; Mano, J F

2015-04-01

We propose a novel hanging spherical drop system for anchoring arrays of droplets of cell suspension based on the use of biomimetic superhydrophobic flat substrates, with controlled positional adhesion and minimum contact with a solid substrate. By facing down the platform, it was possible to generate independent spheroid bodies in a high throughput manner, in order to mimic in vivo tumour models on the lab-on-chip scale. To validate this system for drug screening purposes, the toxicity of the anti-cancer drug doxorubicin in cell spheroids was tested and compared to cells in 2D culture. The advantages presented by this platform, such as feasibility of the system and the ability to control the size uniformity of the spheroid, emphasize its potential to be used as a new low cost toolbox for high-throughput drug screening and in cell or tissue engineering.

Voltammetric analysis of N-containing drugs using the hanging galinstan drop electrode (HGDE).

PubMed

Channaa, H; Surmann, P

2009-03-01

The electrochemical behaviour of several N-containing voltammetric active drugs such as 1,4-benzodiazepines (chlordiazepoxide, nitrazepam and diazepam) as well as one nitro-compound (nitrofurantoin) and one azo-compound (phenazopyridine) is described using a new kind of liquid electrode, the hanging galinstan drop electrode. Concentrations of 10(-5) - 10(-8) mol L(-1) are generally measurable. Differential pulse and adsorptive stripping voltammograms are recorded in different supporting electrolytes, like 0.1 M KNO3, acetate buffer solution pH = 4.6 and phosphate buffer solution pH = 7.0. The effects of varying the starting potentials, U(start) for DPV and accumulation times, t(acc) for AdSV are considered. Briefly, it is shown that the novel galinstan electrode is suitable for reducing several functional groups in organic substances, here presented for N-oxide-, azomethine-, nitro- and azo-groups.

Factors Associated with Correct and Consistent Insecticide Treated Curtain Use in Iquitos, Peru

PubMed Central

Scott, Thomas W.; Elder, John P.; Alexander, Neal; Halsey, Eric S.; McCall, Philip J.

2016-01-01

Dengue is an arthropod-borne virus of great public health importance, and control of its mosquito vectors is currently the only available method for prevention. Previous research has suggested that insecticide treated curtains (ITCs) can lower dengue vector infestations in houses. This observational study investigated individual and household-level socio-demographic factors associated with correct and consistent use of ITCs in Iquitos, Peru. A baseline knowledge, attitudes, and practices (KAP) survey was administered to 1,333 study participants, and ITCs were then distributed to 593 households as part of a cluster-randomized trial. Follow up KAP surveys and ITC-monitoring checklists were conducted at 9, 18, and 27 months post-ITC distribution. At 9 months post-distribution, almost 70% of ITCs were hanging properly (e.g. hanging fully extended or tied up), particularly those hung on walls compared to other locations. Proper ITC hanging dropped at 18 months to 45.7%. The odds of hanging ITCs correctly and consistently were significantly greater among those participants who were housewives, knew three or more correct symptoms of dengue and at least one correct treatment for dengue, knew a relative or close friend who had had dengue, had children sleeping under a mosquito net, or perceived a change in the amount of mosquitoes in the home. Additionally, the odds of recommending ITCs in the future were significantly greater among those who perceived a change in the amount of mosquitoes in the home (e.g. perceived the ITCs to be effective). Despite various challenges associated with the sustained effectiveness of the selected ITCs, almost half of the ITCs were still hanging at 18 months, suggesting a feasible vector control strategy for sustained community use. PMID:26967157

Measurement of the densities of Cu and Ag vapours in a low-voltage switch using the hook method

NASA Astrophysics Data System (ADS)

Lins, Günter

2012-05-01

In a research model of a low-voltage circuit breaker with fixed contacts and windows for optical access, arcs powered by either a high-current transformer or a capacitor bank were initiated by the explosion of tungsten wires. Air at atmospheric pressure was the switching medium. The number densities of neutral silver and copper vapours from contacts and arc runners were measured simultaneously by the hook method using a Mach-Zehnder interferometer combined with a 1 m spectrograph and a gated intensified CCD camera. When an arc current was flowing, a substantial fraction of the metal vapour was ionized, and thus not amenable to a density measurement with the technique chosen. To nevertheless obtain approximate density values, the arc current was forced to zero within 8 to 10 µs at a preset time and measurements were carried out 100 µs after extinction of the arc. At that time the metal vapour was expected to have recombined to a large extent but not yet diffused to the walls in significant amounts. Depending on the current amplitude reached within the arc duration the arc remained anchored to the silver contacts or commutated to the copper arc runners. At a maximum current amplitude of 650 A Ag vapour densities of the order of 1022 m-3 were observed near the anode outweighing the Cu vapour density by a factor of 20. When at 1600 A the arc commutated to the arc runners a Cu vapour density of 8 × 1021 m-3 was reached while the Ag density remained limited to 2 × 1021 m-3.

Purification, crystallization and preliminary X-ray diffraction studies on goat (Capra hircus) hemoglobin - a low oxygen affinity species.

PubMed

Moorthy, Ponnuraj Sathya; Neelagandan, Kamariah; Balasubramanian, Moovarkumudalvan; Ponnuswamy, Mondikalipudur Nanjappa Gounder

2009-01-01

Hemoglobin is a vital protein present in almost all higher species. It is a transport protein involved in carrying oxygen from lungs to tissues and carbon dioxide back to lungs by an intrinsically coordinated manner. Even though a good amount of work has been carried out in this direction there exists scarcity of structural insight on low oxygen affinity species. Attempts are being made to unravel the structural insight of this low oxygen affinity species. Goat blood plasma was collected, treated with EDTA to avoid blood clotting and purification was accomplished using DEAE-anion chromatographic column. The goat hemoglobin was crystallized using 50mM of phosphate buffer at pH 6.7 with 1M NaCl and PEG 3350 as precipitant by hanging drop vapor diffusion method. Crystals obtained are screened and suitable crystals are taken for data collection using mar345dtb as image plate detector system. Goat hemoglobin crystal diffracted up to 2.61 A resolution. Goat hemoglobin crystallizes in orthorhombic space group P212(1)2(1) as a whole biological molecule in the asymmetric unit with cell dimensions a=53.568A, b=67.365A, c=154.183A.

Dispersible oxygen microsensors map oxygen gradients in three-dimensional cell cultures.

PubMed

Lesher-Pérez, Sasha Cai; Kim, Ge-Ah; Kuo, Chuan-Hsien; Leung, Brendan M; Mong, Sanda; Kojima, Taisuke; Moraes, Christopher; Thouless, M D; Luker, Gary D; Takayama, Shuichi

2017-09-26

Phase fluorimetry, unlike the more commonly used intensity-based measurement, is not affected by differences in light paths from culture vessels or by optical attenuation through dense 3D cell cultures and hydrogels thereby minimizing dependence on signal intensity for accurate measurements. This work describes the use of phase fluorimetry on oxygen-sensor microbeads to perform oxygen measurements in different microtissue culture environments. In one example, cell spheroids were observed to deplete oxygen from the cell-culture medium filling the bottom of conventional microwells within minutes, whereas oxygen concentrations remained close to ambient levels for several days in hanging-drop cultures. By dispersing multiple oxygen microsensors in cell-laden hydrogels, we also mapped cell-generated oxygen gradients. The spatial oxygen mapping was sufficiently precise to enable the use of computational models of oxygen diffusion and uptake to give estimates of the cellular oxygen uptake rate and the half-saturation constant. The results show the importance of integrated design and analysis of 3D cell cultures from both biomaterial and oxygen supply aspects. While this paper specifically tests spheroids and cell-laden gel cultures, the described methods should be useful for measuring pericellular oxygen concentrations in a variety of biomaterials and culture formats.

Promoting protein crystallization using a plate with simple geometry.

PubMed

Chen, Rui-Qing; Yin, Da-Chuan; Liu, Yong-Ming; Lu, Qin-Qin; He, Jin; Liu, Yue

2014-03-01

Increasing the probability of obtaining protein crystals in crystallization screening is always an important goal for protein crystallography. In this paper, a new method called the cross-diffusion microbatch (CDM) method is presented, which aims to efficiently promote protein crystallization and increase the chance of obtaining protein crystals. In this method, a very simple crystallization plate was designed in which all crystallization droplets are in one sealed space, so that a variety of volatile components from one droplet can diffuse into any other droplet via vapour diffusion. Crystallization screening and reproducibility tests indicate that this method could be a potentially powerful technique in practical protein crystallization screening. It can help to obtain crystals with higher probability and at a lower cost, while using a simple and easy procedure.

Development of a sequential injection-square wave voltammetry method for determination of paraquat in water samples employing the hanging mercury drop electrode.

PubMed

dos Santos, Luciana B O; Infante, Carlos M C; Masini, Jorge C

2010-03-01

This work describes the development and optimization of a sequential injection method to automate the determination of paraquat by square-wave voltammetry employing a hanging mercury drop electrode. Automation by sequential injection enhanced the sampling throughput, improving the sensitivity and precision of the measurements as a consequence of the highly reproducible and efficient conditions of mass transport of the analyte toward the electrode surface. For instance, 212 analyses can be made per hour if the sample/standard solution is prepared off-line and the sequential injection system is used just to inject the solution towards the flow cell. In-line sample conditioning reduces the sampling frequency to 44 h(-1). Experiments were performed in 0.10 M NaCl, which was the carrier solution, using a frequency of 200 Hz, a pulse height of 25 mV, a potential step of 2 mV, and a flow rate of 100 µL s(-1). For a concentration range between 0.010 and 0.25 mg L(-1), the current (i(p), µA) read at the potential corresponding to the peak maximum fitted the following linear equation with the paraquat concentration (mg L(-1)): i(p) = (-20.5 ± 0.3)C (paraquat) - (0.02 ± 0.03). The limits of detection and quantification were 2.0 and 7.0 µg L(-1), respectively. The accuracy of the method was evaluated by recovery studies using spiked water samples that were also analyzed by molecular absorption spectrophotometry after reduction of paraquat with sodium dithionite in an alkaline medium. No evidence of statistically significant differences between the two methods was observed at the 95% confidence level.

Propelling a water drop with the vapor-mediated Marangoni effect

NASA Astrophysics Data System (ADS)

Kim, Seungho; Kim, Ho-Young

2013-11-01

We show that a water drop on solid surfaces can be propelled just by placing a volatile alcohol drop nearby. It is found to be because the water-air interface near the alcohol drop mixes with alcohol vapor, thereby locally lowering the surface tension. The surface-tension-gradient induces the motion of the water drop, enabling the trajectory control of water drops through the motion of remote alcohol drops. This vapor-mediated Marangoni effect also gives rise to other interesting interfacial flow phenomena, such as nucleation of holes on a water film and ballooning of a water drop hanging from a syringe needle with the approach of an alcohol drop. We visualize such interfacial dynamics with a high-speed camera and rationalize their salient features by scaling analysis. This work was supported by the National Research Foundation of Korea (grant no. 2012-008023).

Method and apparatus for determining minority carrier diffusion length in semiconductors

DOEpatents

Moore, Arnold R.

1984-01-01

Method and apparatus are provided for determining the diffusion length of minority carriers in semiconductor material, particularly amorphous silicon which has a significantly small minority carrier diffusion length using the constant magnitude surface-photovoltage (SPV) method. Steady or modulated illumination at several wavelengths provides the light excitation on the surface of the material to generate the SPV. A manually controlled or automatic servo system maintains a constant predetermined value of the SPV for each wavelength. A drop of a transparent electrolyte solution containing redox couples (preferably quinhydrone) having an oxidation-reduction potential (E) in the order of +0.6 to -1.65 volts couples the SPV to a measurement system. The drop of redox couple solution functions to create a liquid Schottky barrier at the surface of the material. Illumination light is passed through a transparent rod supported over the surface and through the drop of transparent electrolyte. The drop is held in the gap between the rod and the surface. Steady red light is also used as an optical bias to reduce deleterious space-charge effects that occur in amorphous silicon.

Batch crystallization of rhodopsin for structural dynamics using an X-ray free-electron laser

DOE PAGES

Wu, Wenting; Nogly, Przemyslaw; Rheinberger, Jan; ...

2015-06-27

Rhodopsin is a membrane protein from the G protein-coupled receptor family. Together with its ligand retinal, it forms the visual pigment responsible for night vision. In order to perform ultrafast dynamics studies, a time-resolved serial femtosecond crystallography method is required owing to the nonreversible activation of rhodopsin. In such an approach, microcrystals in suspension are delivered into the X-ray pulses of an X-ray free-electron laser (XFEL) after a precise photoactivation delay. Here in this study, a millilitre batch production of high-density microcrystals was developed by four methodical conversion steps starting from known vapour-diffusion crystallization protocols: (i) screening the low-salt crystallizationmore » conditions preferred for serial crystallography by vapour diffusion, (ii) optimization of batch crystallization, (iii) testing the crystal size and quality using second-harmonic generation (SHG) imaging and X-ray powder diffraction and (iv) production of millilitres of rhodopsin crystal suspension in batches for serial crystallography tests; these crystals diffracted at an XFEL at the Linac Coherent Light Source using a liquid-jet setup.« less

Unambiguous detection of nitrated explosive vapours by fluorescence quenching of dendrimer films

NASA Astrophysics Data System (ADS)

Geng, Yan; Ali, Mohammad A.; Clulow, Andrew J.; Fan, Shengqiang; Burn, Paul L.; Gentle, Ian R.; Meredith, Paul; Shaw, Paul E.

2015-09-01

Unambiguous and selective standoff (non-contact) infield detection of nitro-containing explosives and taggants is an important goal but difficult to achieve with standard analytical techniques. Oxidative fluorescence quenching is emerging as a high sensitivity method for detecting such materials but is prone to false positives--everyday items such as perfumes elicit similar responses. Here we report thin films of light-emitting dendrimers that detect vapours of explosives and taggants selectively--fluorescence quenching is not observed for a range of common interferents. Using a combination of neutron reflectometry, quartz crystal microbalance and photophysical measurements we show that the origin of the selectivity is primarily electronic and not the diffusion kinetics of the analyte or its distribution in the film. The results are a major advance in the development of sensing materials for the standoff detection of nitro-based explosive vapours, and deliver significant insights into the physical processes that govern the sensing efficacy.

Unambiguous detection of nitrated explosive vapours by fluorescence quenching of dendrimer films.

PubMed

Geng, Yan; Ali, Mohammad A; Clulow, Andrew J; Fan, Shengqiang; Burn, Paul L; Gentle, Ian R; Meredith, Paul; Shaw, Paul E

2015-09-15

Unambiguous and selective standoff (non-contact) infield detection of nitro-containing explosives and taggants is an important goal but difficult to achieve with standard analytical techniques. Oxidative fluorescence quenching is emerging as a high sensitivity method for detecting such materials but is prone to false positives—everyday items such as perfumes elicit similar responses. Here we report thin films of light-emitting dendrimers that detect vapours of explosives and taggants selectively—fluorescence quenching is not observed for a range of common interferents. Using a combination of neutron reflectometry, quartz crystal microbalance and photophysical measurements we show that the origin of the selectivity is primarily electronic and not the diffusion kinetics of the analyte or its distribution in the film. The results are a major advance in the development of sensing materials for the standoff detection of nitro-based explosive vapours, and deliver significant insights into the physical processes that govern the sensing efficacy.

Unambiguous detection of nitrated explosive vapours by fluorescence quenching of dendrimer films

PubMed Central

Geng, Yan; Ali, Mohammad A.; Clulow, Andrew J.; Fan, Shengqiang; Burn, Paul L.; Gentle, Ian R.; Meredith, Paul; Shaw, Paul E.

2015-01-01

Unambiguous and selective standoff (non-contact) infield detection of nitro-containing explosives and taggants is an important goal but difficult to achieve with standard analytical techniques. Oxidative fluorescence quenching is emerging as a high sensitivity method for detecting such materials but is prone to false positives—everyday items such as perfumes elicit similar responses. Here we report thin films of light-emitting dendrimers that detect vapours of explosives and taggants selectively—fluorescence quenching is not observed for a range of common interferents. Using a combination of neutron reflectometry, quartz crystal microbalance and photophysical measurements we show that the origin of the selectivity is primarily electronic and not the diffusion kinetics of the analyte or its distribution in the film. The results are a major advance in the development of sensing materials for the standoff detection of nitro-based explosive vapours, and deliver significant insights into the physical processes that govern the sensing efficacy. PMID:26370931

Comparative Analysis of 3D Bladder Tumor Spheroids Obtained by Forced Floating and Hanging Drop Methods for Drug Screening.

PubMed

Amaral, Robson L F; Miranda, Mariza; Marcato, Priscyla D; Swiech, Kamilla

2017-01-01

Introduction: Cell-based assays using three-dimensional (3D) cell cultures may reflect the antitumor activity of compounds more accurately, since these models reproduce the tumor microenvironment better. Methods: Here, we report a comparative analysis of cell behavior in the two most widely employed methods for 3D spheroid culture, forced floating (Ultra-low Attachment, ULA, plates), and hanging drop (HD) methods, using the RT4 human bladder cancer cell line as a model. The morphology parameters and growth/metabolism of the spheroids generated were first characterized, using four different cell-seeding concentrations (0.5, 1.25, 2.5, and 3.75 × 10 4 cells/mL), and then, subjected to drug resistance evaluation. Results: Both methods generated spheroids with a smooth surface and round shape in a spheroidization time of about 48 h, regardless of the cell-seeding concentration used. Reduced cell growth and metabolism was observed in 3D cultures compared to two-dimensional (2D) cultures. The optimal range of spheroid diameter (300-500 μm) was obtained using cultures initiated with 0.5 and 1.25 × 10 4 cells/mL for the ULA method and 2.5 and 3.75 × 10 4 cells/mL for the HD method. RT4 cells cultured under 3D conditions also exhibited a higher resistance to doxorubicin (IC 50 of 1.00 and 0.83 μg/mL for the ULA and HD methods, respectively) compared to 2D cultures (IC 50 ranging from 0.39 to 0.43). Conclusions: Comparing the results, we concluded that the forced floating method using ULA plates was considered more suitable and straightforward to generate RT4 spheroids for drug screening/cytotoxicity assays. The results presented here also contribute to the improvement in the standardization of the 3D cultures required for widespread application.

Comparative Analysis of 3D Bladder Tumor Spheroids Obtained by Forced Floating and Hanging Drop Methods for Drug Screening

PubMed Central

Amaral, Robson L. F.; Miranda, Mariza; Marcato, Priscyla D.; Swiech, Kamilla

2017-01-01

Introduction: Cell-based assays using three-dimensional (3D) cell cultures may reflect the antitumor activity of compounds more accurately, since these models reproduce the tumor microenvironment better. Methods: Here, we report a comparative analysis of cell behavior in the two most widely employed methods for 3D spheroid culture, forced floating (Ultra-low Attachment, ULA, plates), and hanging drop (HD) methods, using the RT4 human bladder cancer cell line as a model. The morphology parameters and growth/metabolism of the spheroids generated were first characterized, using four different cell-seeding concentrations (0.5, 1.25, 2.5, and 3.75 × 104 cells/mL), and then, subjected to drug resistance evaluation. Results: Both methods generated spheroids with a smooth surface and round shape in a spheroidization time of about 48 h, regardless of the cell-seeding concentration used. Reduced cell growth and metabolism was observed in 3D cultures compared to two-dimensional (2D) cultures. The optimal range of spheroid diameter (300–500 μm) was obtained using cultures initiated with 0.5 and 1.25 × 104 cells/mL for the ULA method and 2.5 and 3.75 × 104 cells/mL for the HD method. RT4 cells cultured under 3D conditions also exhibited a higher resistance to doxorubicin (IC50 of 1.00 and 0.83 μg/mL for the ULA and HD methods, respectively) compared to 2D cultures (IC50 ranging from 0.39 to 0.43). Conclusions: Comparing the results, we concluded that the forced floating method using ULA plates was considered more suitable and straightforward to generate RT4 spheroids for drug screening/cytotoxicity assays. The results presented here also contribute to the improvement in the standardization of the 3D cultures required for widespread application. PMID:28878686

Design of 3-D adipospheres for quantitative metabolic study

PubMed Central

Akama, Takeshi; Leung, Brendan M.; Labuz, Joseph M.; Takayama, Shuichi; Chun, Tae-Hwa

2017-01-01

Quantitative assessment of adipose mitochondrial activity is critical for better understanding of adipose tissue function in obesity and diabetes. While the two-dimensional (2-D) tissue culture method has been sufficient to discover key molecules that regulate adipocyte differentiation and function, the method is insufficient to determine the role of extracellular matrix (ECM) molecules and their modifiers, such as matrix metalloproteinases (MMPs), in regulating adipocyte function in three-dimensional (3-D) in vivo-like microenvironments. By using a 3-D hanging drop tissue culture system, we are able to produce scalable 3-D adipospheres that are suitable for quantitative mitochondrial study in 3-D microenvironment. PMID:28244051

The use of inverse gas chromatography and gravimetric vapour sorption to study transitions in amorphous lactose.

PubMed

Ambarkhane, Ameet V; Pincott, Kim; Buckton, Graham

2005-04-27

The aim of this study was to measure the glass transition of amorphous lactose under well-controlled temperature and humidity, using inverse gas chromatography (IGC) and to relate these data to gravimetric vapour sorption experiments. Amorphous lactose (spray-dried) was exposed to a stepwise increment in the relative humidity (%RH) under isothermal conditions in an IGC. At the end of each conditioning step a decane injection was made, and the retention volumes were calculated using the maximum peak height (V(max)) method. The pressure drop across the column was recorded using the pressure transducers. These measurements were performed at various temperatures from 25 to 40 degrees C. The extent of water sorption at identical humidity (%RH) and temperature conditions was determined gravimetrically using dynamic vapour sorption (DVS). At each T, it was possible to determine: (1) a transition at low RH relating to the onset of mobility; (2) changes in retention volume relating to the point, where T(g) = T; (3) changes in pressure drop, which were related to the sample collapse. The rate and extent of water sorption was seen to alter at T(g) and also at a collapse point. Combinations of temperature and critical %RH (%cRH required to lower the dry glass transition temperature to the experimental temperature) obtained from IGC were comparable to those obtained from DVS. It was shown that at each T, the sample spontaneously crystallised, when T(g) was 32 degrees C below T. Inverse gas chromatograph can be used in this novel way to reveal the series of transitions that occur in amorphous materials.

Vaporization of a solid surface in an ambient gas

NASA Astrophysics Data System (ADS)

Benilov, M. S.; Jacobsson, S.; Kaddani, A.; Zahrai, S.

2001-07-01

The net flux of vapour from a solid surface in an ambient gas is analysed with the aim to estimate the effect of vaporization cooling on the energy balance of an arc cathode under conditions typical for a high-power current breaker. If the ratio of the equilibrium vapour pressure pv to the ambient pressure p∞ is smaller than unity, the removal of vapour from the surface is due to diffusion into the bulk of the gas. As a consequence, the net flux of the vapour from the surface is much smaller than the emitted flux. An estimate of the diffusion rate under conditions typical for a high-power current breaker indicates that vaporization cooling plays a minor role in the energy balance of the cathode in this case. If ratio pv/p∞ is above unity, the flow of the vapour from the surface appears and the net flux is comparable to the emitted flux. A simple analytical solution has been obtained for this case, which is in a good agreement with results of the Monte Carlo modelling of preceding authors. If pv/p∞ exceeds approximately 4.5, vaporization occurs as into vacuum and the net flux is about 0.82 of the emitted flux.

A variational approach to the study of capillary phenomena

NASA Technical Reports Server (NTRS)

Emmer, M.; Gonzalez, E.; Tamanini, I.

1982-01-01

The problem of determining the free surface of a liquid in a capillary tube, and of a liquid drop, sitting first on a horizontal plane and then on more general surfaces is considered. With some modifications, the method applies to the study of pendent drops and of rotating drops as well. The standard capillary problem, i.e. the determination of the free surface of a liquid in a thin tube of general cross section, which resuls from the simultaneous action of surface tension, boundary adhesion and gravity is discussed. It turns out that in this case the existence of the solution surface depends heavily on the validity of a simple geometric condition about the mean curvature of the boundary curve of the cross section of the capillary tube. Some particular examples of physical interest are also be discussed. Liquid drops sitting on or hanging from a fixed horizontal plane are discussed. The symmetry of the solutions (which can actually be proved, as consequence of a general symmetrization argument) now plays the chief role in deriving both the existence and the regularity of energy-minimizing configurations. When symmetry fails (this is the case, for example, when the contact angle between the drop and the plate is not constant, or when the supporting surface is not itself symmetric), then more sophisticated methods must be used. Extensions in this direction are outlined.

In vitro culture of early secondary preantral follicles in hanging drop of ovarian cell-conditioned medium to obtain MII oocytes from outbred deer mice.

PubMed

Choi, Jung Kyu; Agarwal, Pranay; He, Xiaoming

2013-12-01

The ovarian follicle (each contains a single oocyte) is the fundamental functional tissue unit of mammalian ovaries. In humans, it has been long held true that females are born with a maximum number of follicles (or oocytes) that are not only nonrenewable, but also undergoing degeneration with time with a sharply decreased oocyte quality after the age of ∼35. Therefore, it is of importance to isolate and bank ovarian follicles for in vitro culture to obtain fertilizable oocytes later, to preserve the fertility of professional women who may want to delay childbearing, young and unmarried women who may lose gonadal function because of exposure to environmental/occupational hazards or aggressive medical treatments, such as radiation and chemotherapy, and even endangered species and breeds. Although they contributed significantly to the understanding of follicle science and biology, most studies reported to date on this topic were done using the man-made, unnatural inbred animal species. It was found in this study that the conventional two-dimensional microliter drop and three-dimensional hanging drop (HD) methods, reported to be effective for in vitro culture of preantral follicles from inbred mice, are not directly transferrable to outbred deer mice. Therefore, a modified HD method was developed in this study to achieve a much higher (>5 times compared to the best conventional methods) percentage of developing early secondary preantral follicles from the outbred mice to the antral stage, for which, the use of an ovarian cell-conditioned medium and multiple follicles per HD were identified to be crucial. It was further found that the method for in vitro maturation of oocytes in antral follicles obtained by in vitro culture of preantral follicles could be very different from that for oocytes in antral follicles obtained by hormone stimulation in vivo. Therefore, this study should provide important guidance for establishing effective protocols of in vitro follicle culture to preserve the fertility of wildlife and humans outbred by nature.

In Vitro Culture of Early Secondary Preantral Follicles in Hanging Drop of Ovarian Cell-Conditioned Medium to Obtain MII Oocytes from Outbred Deer Mice

PubMed Central

Choi, Jung Kyu; Agarwal, Pranay

2013-01-01

The ovarian follicle (each contains a single oocyte) is the fundamental functional tissue unit of mammalian ovaries. In humans, it has been long held true that females are born with a maximum number of follicles (or oocytes) that are not only nonrenewable, but also undergoing degeneration with time with a sharply decreased oocyte quality after the age of ∼35. Therefore, it is of importance to isolate and bank ovarian follicles for in vitro culture to obtain fertilizable oocytes later, to preserve the fertility of professional women who may want to delay childbearing, young and unmarried women who may lose gonadal function because of exposure to environmental/occupational hazards or aggressive medical treatments, such as radiation and chemotherapy, and even endangered species and breeds. Although they contributed significantly to the understanding of follicle science and biology, most studies reported to date on this topic were done using the man-made, unnatural inbred animal species. It was found in this study that the conventional two-dimensional microliter drop and three-dimensional hanging drop (HD) methods, reported to be effective for in vitro culture of preantral follicles from inbred mice, are not directly transferrable to outbred deer mice. Therefore, a modified HD method was developed in this study to achieve a much higher (>5 times compared to the best conventional methods) percentage of developing early secondary preantral follicles from the outbred mice to the antral stage, for which, the use of an ovarian cell-conditioned medium and multiple follicles per HD were identified to be crucial. It was further found that the method for in vitro maturation of oocytes in antral follicles obtained by in vitro culture of preantral follicles could be very different from that for oocytes in antral follicles obtained by hormone stimulation in vivo. Therefore, this study should provide important guidance for establishing effective protocols of in vitro follicle culture to preserve the fertility of wildlife and humans outbred by nature. PMID:23789595

Formation of stable small cell number three-dimensional ovarian cancer spheroids using hanging drop arrays for preclinical drug sensitivity assays.

PubMed

Raghavan, Shreya; Ward, Maria R; Rowley, Katelyn R; Wold, Rachel M; Takayama, Shuichi; Buckanovich, Ronald J; Mehta, Geeta

2015-07-01

Ovarian cancer grows and metastasizes from multicellular spheroidal aggregates within the ascites fluid. Multicellular tumor spheroids are therefore physiologically significant 3D in vitro models for ovarian cancer research. Conventional hanging drop cultures require high starting cell numbers, and are tedious for long-term maintenance. In this study, we generate stable, uniform multicellular spheroids using very small number of ovarian cancer cells in a novel 384 well hanging drop array platform. We used novel tumor spheroid platform and two ovarian cancer cell lines (A2780 and OVCAR3) to demonstrate the stable incorporation of as few as 10 cells into a single spheroid. Spheroids had uniform geometry, with projected areas (42.60×10(3)μm-475.22×10(3)μm(2) for A2780 spheroids and 37.24×10(3)μm(2)-281.01×10(3)μm(2) for OVCAR3 spheroids) that varied as a function of the initial cell seeding density. Phalloidin and nuclear stains indicated cells formed tightly packed spheroids with demarcated boundaries and cell-cell interaction within spheroids. Cells within spheroids demonstrated over 85% viability. 3D tumor spheroids demonstrated greater resistance (70-80% viability) to cisplatin chemotherapy compared to 2D cultures (30-50% viability). Ovarian cancer spheroids can be generated from limited cell numbers in high throughput 384 well plates with high viability. Spheroids demonstrate therapeutic resistance relative to cells in traditional 2D culture. Stable incorporation of low cell numbers is advantageous when translating this research to rare patient-derived cells. This system can be used to understand ovarian cancer spheroid biology, as well as carry out preclinical drug sensitivity assays. Copyright © 2015 Elsevier Inc. All rights reserved.

Rat pancreatic islet size standardization by the "hanging drop" technique.

PubMed

Cavallari, G; Zuellig, R A; Lehmann, R; Weber, M; Moritz, W

2007-01-01

Rejection and hypoxia are the main factors that limit islet engraftment in the recipient liver in the immediate posttransplant period. Recently authors have reported a negative relationship of graft function and islet size, concluding that small islets are superior to large islets. Islets can be dissociated into single cells and reaggregated into so called "pseudoislets," which are functionally equivalent to intact islets but exhibit reduced immunogenicity. The aim of our study was develop a technique that enabled one to obtain pseudoislets of defined, preferably small, dimensions. Islets were harvested from Lewis rats by the collagenase digestion procedure. After purification, the isolated islets were dissociated into single cells by trypsin digestion. Fractions with different cell numbers were seeded into single drops onto cell culture dishes, which were inverted and incubated for 5 to 8 days under cell culture conditions. Newly formed pseudoislets were analyzed for dimension, morphology, and cellular composition. The volume of reaggregated pseudoislets strongly correlated with the cell number (r(2) = .995). The average diameter of a 250-cell aggregate was 95 +/- 8 microm (mean +/- SD) compared with 122 +/- 46 microm of freshly isolated islets. Islet cell loss may be minimized by performing reaggregation in the presence of medium glucose (11 mmol/L) and the GLP-1 analogue Exendin-4. Morphology, cellular composition, and architecture of reaggregated islets were comparable to intact islets. The "hanging drop" culture method allowed us to obtain pseudoislets of standardized size and regular shape, which did not differ from intact islets in terms of cellular composition or architecture. Further investigations are required to minimize cell loss and test in vivo function of transplanted pseudoislets.

Growth of carbon nanotubes (CNTs) on metallic underlayers by diffusion plasma-enhanced chemical vapour deposition (DPECVD)

NASA Astrophysics Data System (ADS)

Kim, S. M.; Gangloff, L.

2009-10-01

Here, we demonstrate the low-temperature (480-612 °C) synthesis of carbon nanotubes (CNTs) on different metallic underlayers (i.e., NiV, Ir, Ag, Pt, W, and Ta) using diffusion (dc) plasma-enhanced (~20 W, -600 V) chemical vapour deposition (DPECVD). The catalyst used is bi-layered Fe/Al and the feedstock used is a mixture of C 2H 2 and NH 3 (1:4). The crucial component is the diffusion of radical ions and hydrogen generated such as H 2/H +/H 2+/NH 3+/CH 2+/C 2H 2+ (which are confirmed by in-situ mass spectroscopy) from the nozzle, where it is inserted for most effective plasma diffusion between a substrate and a gas distributor.

Monitoring of exposure to methylpentanes by diffusive sampling and urine analysis for alcoholic metabolites.

PubMed Central

Kawai, T; Mizunuma, K; Yasugi, T; Horiguchi, S; Iguchi, H; Mutti, A; Ghittori, S; Ikeda, M

1995-01-01

OBJECTIVES--To investigate the possibilities of personal ambient monitoring and biological monitoring for methylpentane isomers. METHODS--The performance of activated carbon cloth to absorb 2- and 3-methylpentane was studied by experimental vapour exposure followed by solvent extraction and gas chromatography (GC). Urine from workers and rats exposed to 2- and 3-methylpentane was analysed by GC with or without acid or enzymatic hydrolysis. RESULTS--Carbon cloth absorbed 2- and 3-methylpentane linearly to exposures up to eight hours and to 400 ppm, and was sensitive enough to detect a 15 minute peak of exposure. The two isomers were clearly separated from hexane on a DB-1 column. For analysis of the urine, enzymatic hydrolysis was superior to acid hydrolysis. Exposure of rats to methylpentane vapours showed that 2-methyl-2-pentanol and 3-methyl-2-pentanol were excreted in urine in proportion to the dose of 2-methylpentane and 3-methylpentane, respectively. 2-Methyl derivatives of 1-, 3-, and 4-propanol, 2-methylpentane-2,4-diol, and 3-methyl-2-pentanol were minor metabolites. Analysis of urine from the exposed workers showed that 2-methyl- and 3-methyl-2-pentanol are leading urinary metabolites after exposure to the corresponding methylpentane. CONCLUSIONS--Diffusive sampling is applicable to monitor 2- and 3-methylpentane vapours as is the case for hexane vapour. 2-Methyl-2-pentanol and 3-methyl-2-pentanol will be markers of occupational exposure to 2-methylpentane and 3-methylpentane, respectively. Also, 2-methylpentane-2,4-diol might be a marker of exposure to 2-methylpentane. PMID:8535496

Three-dimensional spheroid culture targeting versatile tissue bioassays using a PDMS-based hanging drop array.

PubMed

Kuo, Ching-Te; Wang, Jong-Yueh; Lin, Yu-Fen; Wo, Andrew M; Chen, Benjamin P C; Lee, Hsinyu

2017-06-29

Biomaterial-based tissue culture platforms have emerged as useful tools to mimic in vivo physiological microenvironments in experimental cell biology and clinical studies. We describe herein a three-dimensional (3D) tissue culture platform using a polydimethylsiloxane (PDMS)-based hanging drop array (PDMS-HDA) methodology. Multicellular spheroids can be achieved within 24 h and further boosted by incorporating collagen fibrils in PDMS-HDA. In addition, the spheroids generated from different human tumor cells exhibited distinct sensitivities toward drug chemotherapeutic agents and radiation as compared with two-dimensional (2D) cultures that often lack in vivo-like biological insights. We also demonstrated that multicellular spheroids may enable key hallmarks of tissue-based bioassays, including drug screening, tumor dissemination, cell co-culture, and tumor invasion. Taken together, these results offer new opportunities not only to achieve the active control of 3D multicellular spheroids on demand, but also to establish a rapid and cost-effective platform to study anti-cancer therapeutics and tumor microenvironments.

A simple hanging drop cell culture protocol for generation of 3D spheroids.

PubMed

Foty, Ramsey

2011-05-06

Studies of cell-cell cohesion and cell-substratum adhesion have historically been performed on monolayer cultures adherent to rigid substrates. Cells within a tissue, however, are typically encased within a closely packed tissue mass in which cells establish intimate connections with many near-neighbors and with extracellular matrix components. Accordingly, the chemical milieu and physical forces experienced by cells within a 3D tissue are fundamentally different than those experienced by cells grown in monolayer culture. This has been shown to markedly impact cellular morphology and signaling. Several methods have been devised to generate 3D cell cultures including encapsulation of cells in collagen gels or in biomaterial scaffolds. Such methods, while useful, do not recapitulate the intimate direct cell-cell adhesion architecture found in normal tissues. Rather, they more closely approximate culture systems in which single cells are loosely dispersed within a 3D meshwork of ECM products. Here, we describe a simple method in which cells are placed in hanging drop culture and incubated under physiological conditions until they form true 3D spheroids in which cells are in direct contact with each other and with extracellular matrix components. The method requires no specialized equipment and can be adapted to include addition of any biological agent in very small quantities that may be of interest in elucidating effects on cell-cell or cell-ECM interaction. The method can also be used to co-culture two (or more) different cell populations so as to elucidate the role of cell-cell or cell-ECM interactions in specifying spatial relationships between cells. Cell-cell cohesion and cell-ECM adhesion are the cornerstones of studies of embryonic development, tumor-stromal cell interaction in malignant invasion, wound healing, and for applications to tissue engineering. This simple method will provide a means of generating tissue-like cellular aggregates for measurement of biomechanical properties or for molecular and biochemical analysis in a physiologically relevant model. Copyright © 2011 Journal of Visualized Experiments

Crystallization and preliminary X-ray diffraction studies of the lipopolysaccharide core biosynthetic enzyme ADP-L-glycero-D-mannoheptose 6-epimerase from Escherichia coli K-12.

PubMed

Ding, L; Zhang, Y; Deacon, A M; Ealick, S E; Ni, Y; Sun, P; Coleman, W G

1999-03-01

ADP-L-glycero-D-mannoheptose 6-epimerase is a 240 kDa NAD-dependent nucleotide diphosphosugar epimerase from Escherichia coli K12 which catalyzes the interconversion of ADP-D-glycero-D-mannoheptose and ADP-L-glycero-D-mannoheptose. ADP-L-glycero-D-mannoheptose is a required intermediate for lipopolysaccharide inner-core and outer-membrane biosynthesis in several genera of pathogenic and non-pathogenic Gram-negative bacteria. ADP-L-glycero-D-mannoheptose 6-epimerase was overexpressed in E. coli and purified to apparent homogeneity by chromatographic methods. Three crystal forms of the epimerase were obtained by a hanging-drop vapor-diffusion method. A native data set for crystal form III was collected in-house on a Rigaku R-AXIS-IIC image plate at 3.0 A resolution. The form III crystals belong to the monoclinic space group P21. The unit-cell parameters are a = 98.94, b = 110.53, c = 180.68 A and beta = 90.94 degrees. Our recent results show that these crystals diffract to 2.0 A resolution at the Cornell High Energy Synchrotron Source. The crystal probably contains six 40 kDa monomers per asymmetric unit, with a corresponding volume per protein mass (Vm) of 4.11 A3 Da-1 and a solvent fraction of 70%.

The specific diffusion behaviour in paper and migration modelling from recycled board into dry foodstuffs.

PubMed

Hauder, J; Benz, H; Rüter, M; Piringer, O-G

2013-01-01

Recycled board plays an important role in food packaging, but the great variety of organic impurities must be considered as potential food contaminants. The diffusion behaviour of the impurities is significantly different from that in plastic materials. The two-layer concept for paper and board introduced recently is now treated in more detail. In the rate-determining surface region the diffusion coefficients of the n-alkanes in the homologous series with 15-35 carbon atoms decrease proportionally as their vapour pressures. This leads to a different equation of the diffusion coefficients in comparison with that for the core layer. Different polarities of the migrants have additional influences on the diffusion due to their interactions with the fibre matrix. A new analytical method for the quantification of aromatic impurities has previously been developed. Based on this method and on the described diffusion behaviour, a migration model for specific and global mass transfer of impurities from recycled board into dry food and food simulants is given.

[Expression, crystallization and crystallographic study of the 1st IgV domain of human CD96].

PubMed

Jiang, Wenjing; Zhang, Shuijun; Yan, Jinghua; Guo, Ning

2013-05-01

CD96 (Tactile) is an adhesion receptor expressed mainly on activated T cells, NK cells. As a family member of the immunoglobulin-like cell receptor, CD96 consists of three immunoglobulin-like domains (V1, V2/C and C) in the extracellular region. Recent studies have shown that the 1st IgV domain of CD96 (CD96V1) plays an essential role in cell adhesion and NK cell-mediated killing. In this study, the 1st IgV domain of human CD96 (hCD96V1) was cloned and expressed in Escherichia coli (BL21). The soluble protein was obtained by refolding of the hCD96V1 inclusion bodies. From analytical ultracentrifugation, we could predict that CD96 V1 maily exists as dimer with approximate molecular weight of 26.9 kDa. The protein was then successfully crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.9 angstrom resolution and belonged to space group P21, with unit-cell parameters a = 35.1, b = 69.5, c = 49.6A, alpha=gamma=90 degrees, beta=105.4 degrees.

Recombinant production, crystallization and X-ray crystallographic structure determination of the peptidyl-tRNA hydrolase of Pseudomonas aeruginosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hughes, Ronny C.; McFeeters, Hana; Coates, Leighton

The peptidyl-tRNA hydrolase enzyme from the pathogenic bacterium Pseudomonas aeruginosa (Pth; EC 3.1.1.29) has been cloned, expressed in Escherichia coli and crystallized for X-ray structural analysis. Suitable crystals were grown using the sitting-drop vapour-diffusion method after one week of incubation against a reservoir solution consisting of 20% polyethylene glycol 4000, 100 mM Tris pH 7.5, 10%(v/v) isopropyl alcohol. The crystals were used to obtain the three-dimensional structure of the native protein at 1.77 Å resolution. The structure was determined by molecular replacement of the crystallographic data processed in space group P6122 with unit-cell parameters a = b = 63.62,c =more » 155.20 Å, α = β = 90, γ = 120°. The asymmetric unit of the crystallographic lattice was composed of a single copy of the enzyme molecule with a 43% solvent fraction, corresponding to a Matthews coefficient of 2.43 Å3 Da-1. The crystallographic structure reported here will serve as the foundation for future structure-guided efforts towards the development of novel small-molecule inhibitors specific to bacterial Pths.« less

Crystallization and preliminary X-ray studies of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hou, Jing; Li, Ming; Chen, Jiashu

Crystals of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of A. acutus have been obtained and characterized by X-ray diffraction. A non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus has been crystallized by the hanging-drop method. The crystals belong to space group P3{sub 1}21, with unit-cell parameters a = b = 80.57, c = 66.77 Å and one molecule in the asymmetric unit. X-ray diffraction data were collected to 1.86 Å resolution.

Estimation of Tegaserod Maleate by Differential Pulse Polarography

PubMed Central

Rajput, S. J.; Raj, H. A.

2009-01-01

A highly sensitive differential pulse polarographic method has been developed for the estimation of tegaserod maleate after treating it with hydrogen peroxide solution. The oxidation of tegaserod maleate is a reversible process as the oxidized product could be reduced at hanging mercury drop electrode in a quantitative manner using differential pulse polarography mode. The limit of quantification was 0.1ng/ml. The voltametric peak was obtained at -1.05 volts in presence of 0.1M potassium chloride as supporting electrolyte. The technique could be used successfully to analyze tegaserod maleate in its tablet formulation. PMID:20177456

Surface fractal dimension, water adsorption efficiency, and cloud nucleation activity of insoluble aerosol.

PubMed

Laaksonen, Ari; Malila, Jussi; Nenes, Athanasios; Hung, Hui-Ming; Chen, Jen-Ping

2016-05-03

Surface porosity affects the ability of a substance to adsorb gases. The surface fractal dimension D is a measure that indicates the amount that a surface fills a space, and can thereby be used to characterize the surface porosity. Here we propose a new method for determining D, based on measuring both the water vapour adsorption isotherm of a given substance, and its ability to act as a cloud condensation nucleus when introduced to humidified air in aerosol form. We show that our method agrees well with previous methods based on measurement of nitrogen adsorption. Besides proving the usefulness of the new method for general surface characterization of materials, our results show that the surface fractal dimension is an important determinant in cloud drop formation on water insoluble particles. We suggest that a closure can be obtained between experimental critical supersaturation for cloud drop activation and that calculated based on water adsorption data, if the latter is corrected using the surface fractal dimension of the insoluble cloud nucleus.

Surface fractal dimension, water adsorption efficiency, and cloud nucleation activity of insoluble aerosol

NASA Astrophysics Data System (ADS)

Laaksonen, Ari; Malila, Jussi; Nenes, Athanasios; Hung, Hui-Ming; Chen, Jen-Ping

2016-05-01

Surface porosity affects the ability of a substance to adsorb gases. The surface fractal dimension D is a measure that indicates the amount that a surface fills a space, and can thereby be used to characterize the surface porosity. Here we propose a new method for determining D, based on measuring both the water vapour adsorption isotherm of a given substance, and its ability to act as a cloud condensation nucleus when introduced to humidified air in aerosol form. We show that our method agrees well with previous methods based on measurement of nitrogen adsorption. Besides proving the usefulness of the new method for general surface characterization of materials, our results show that the surface fractal dimension is an important determinant in cloud drop formation on water insoluble particles. We suggest that a closure can be obtained between experimental critical supersaturation for cloud drop activation and that calculated based on water adsorption data, if the latter is corrected using the surface fractal dimension of the insoluble cloud nucleus.

Common Cause Case Study: An Estimated Probability of Four Solid Rocket Booster Hold-down Post Stud Hang-ups

NASA Technical Reports Server (NTRS)

Cross, Robert

2005-01-01

Until Solid Rocket Motor ignition, the Space Shuttle is mated to the Mobil Launch Platform in part via eight (8) Solid Rocket Booster (SRB) hold-down bolts. The bolts are fractured using redundant pyrotechnics, and are designed to drop through a hold-down post on the Mobile Launch Platform before the Space Shuttle begins movement. The Space Shuttle program has experienced numerous failures where a bolt has "hung-up." That is, it did not clear the hold-down post before liftoff and was caught by the SRBs. This places an additional structural load on the vehicle that was not included in the original certification requirements. The Space Shuttle is currently being certified to withstand the loads induced by up to three (3) of eight (8) SRB hold-down post studs experiencing a "hang-up." The results af loads analyses performed for four (4) stud-hang ups indicate that the internal vehicle loads exceed current structural certification limits at several locations. To determine the risk to the vehicle from four (4) stud hang-ups, the likelihood of the scenario occurring must first be evaluated. Prior to the analysis discussed in this paper, the likelihood of occurrence had been estimated assuming that the stud hang-ups were completely independent events. That is, it was assumed that no common causes or factors existed between the individual stud hang-up events. A review of the data associated with the hang-up events, showed that a common factor (timing skew) was present. This paper summarizes a revised likelihood evaluation performed for the four (4) stud hang-ups case considering that there are common factors associated with the stud hang-ups. The results show that explicitly (i.e. not using standard common cause methodologies such as beta factor or Multiple Greek Letter modeling) taking into account the common factor of timing skew results in an increase in the estimated likelihood of four (4) stud hang-ups of an order of magnitude over the independent failure case.

Common Cause Case Study: An Estimated Probability of Four Solid Rocket Booster Hold-Down Post Stud Hang-ups

NASA Technical Reports Server (NTRS)

Cross, Robert

2005-01-01

Until Solid Rocket Motor ignition, the Space Shuttle is mated to the Mobil Launch Platform in part via eight (8) Solid Rocket Booster (SRB) hold-down bolts. The bolts are fractured using redundant pyrotechnics, and are designed to drop through a hold-down post on the Mobile Launch Platform before the Space Shuttle begins movement. The Space Shuttle program has experienced numerous failures where a bolt has hung up. That is, it did not clear the hold-down post before liftoff and was caught by the SRBs. This places an additional structural load on the vehicle that was not included in the original certification requirements. The Space Shuttle is currently being certified to withstand the loads induced by up to three (3) of eight (8) SRB hold-down experiencing a "hang-up". The results of loads analyses performed for (4) stud hang-ups indicate that the internal vehicle loads exceed current structural certification limits at several locations. To determine the risk to the vehicle from four (4) stud hang-ups, the likelihood of the scenario occurring must first be evaluated. Prior to the analysis discussed in this paper, the likelihood of occurrence had been estimated assuming that the stud hang-ups were completely independent events. That is, it was assumed that no common causes or factors existed between the individual stud hang-up events. A review of the data associated with the hang-up events, showed that a common factor (timing skew) was present. This paper summarizes a revised likelihood evaluation performed for the four (4) stud hang-ups case considering that there are common factors associated with the stud hang-ups. The results show that explicitly (i.e. not using standard common cause methodologies such as beta factor or Multiple Greek Letter modeling) taking into account the common factor of timing skew results in an increase in the estimated likelihood of four (4) stud hang-ups of an order of magnitude over the independent failure case.

Crystallization and preliminary X-ray analysis of an exotype alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, a member of polysaccharide lyase family 15

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ochiai, Akihito; Yamasaki, Masayuki; Mikami, Bunzo

2006-05-01

The crystallization and preliminary X-ray characterization of a family PL-15 exotype alginate lyase are presented. Almost all alginate lyases depolymerize alginate in an endolytical fashion via a β-elimination reaction. The alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, consisting of 776 amino-acid residues, is a novel exotype alginate lyase classified into polysaccharide lyase family 15. The enzyme was crystallized at 293 K by sitting-drop vapour diffusion with polyethylene glycol 4000 as a precipitant. Preliminary X-ray analysis showed that the Atu3025 crystal belonged to space group P2{sub 1} and diffracted to 2.8 Å resolution, with unit-cell parameters a = 107.7, bmore » = 108.3, c = 149.5 Å, β = 91.5°.« less

Hanging drop monoculture for selection of optimal antioxidants during in vitro maturation of porcine oocytes.

PubMed

Ishikawa, S; Machida, R; Hiraga, K; Hiradate, Y; Suda, Y; Tanemura, K

2014-04-01

We analysed the effect of three antioxidants that have different functional mechanisms on the in vitro maturation (IVM) of porcine oocytes. Single oocyte monoculture using the hanging drop (HD) system has some advantages such as improving analysis efficiency brought by the smaller number of samples than the number of oocytes cultured in one drop. Direct effects of ligands on single oocytes could also be detected without considering the effects of paracrine factors from other oocytes. After 22 h of pre-culture, denuded oocytes were cultured for 22 h with 0.01 and 0.1 μg/ml of L-carnitine (LC), lactoferrin (LF) or sulforaphane (SF) in the presence/non-presence of oxidant stress induced by H2O2 supplementation to evaluate the reducing effects against oxidative stress on nuclear maturation. As a result, compared with LC and SF, LF showed effective reduction in oxidative stress at a lower concentration (0.01 μg/ml), suggesting that LF is a more effective antioxidant in porcine oocyte IVM. Additionally, LF also increased maturation rate even in culture without H2O2. Our results clearly suggest that the HD monoculture system is useful for screening the substances that affect porcine oocyte culture. © 2014 Blackwell Verlag GmbH.

In Vitro Culture of Ovarian Follicles from Peromyscus

PubMed Central

He, Xiaoming; Toth, Thomas L.

2016-01-01

The ovarian follicle is the fundamental functional tissue unit of mammalian ovary. Each ovarian follicle contains one single oocyte. Isolation and in vitro culture of ovarian follicles to obtain fertilizable oocytes have been regarded as a promising strategy for women to combat infertility. The follicles from Peromyscus are considered as a better model than that from inbred mice for studying follicle culture. This is because Peromyscus mice are outbred (as with humans) with an increased life span. In this article, we reviewed studies on this subject conducted using Peromyscus follicles. These studies show that the conventional 2D micro-drop and 3D hanging-drop approaches established for in vitro culture of early preantral follicles from inbred mice are not directly applicable for cultivating the follicles from Peromyscus However, the efficiency could be significantly improved by culturing multiple early preantral follicles in one hanging drop of Peromyscus ovarian cell-conditioned medium. It is further revealed that the mechanical heterogeneity in the extracellular matrix of ovary is crucial for developing early preantral follicles to the antral stage and for the subsequent ovulation to release cumulus-oocyte complex. These findings may provide valuable guidance for furthering the technology of in vitro follicle culture to restore fertility in the clinic. PMID:27397871

R245fa Flow Boiling inside a 4.2 mm ID Microfin Tube

NASA Astrophysics Data System (ADS)

Longo, G. A.; Mancin, S.; Righetti, G.; Zilio, C.

2017-11-01

This paper presents the R245fa flow boiling heat transfer and pressure drop measurements inside a mini microfin tube with internal diameter at the fin tip of 4.2 mm, having 40 fins, 0.15 mm high with a helix angle of 18°. The tube was brazed inside a copper plate and electrically heated from the bottom. Sixteen T-type thermocouples are located in the copper plate to monitor the wall temperature. The experimental measurements were carried out at constant mean saturation temperature of 30 °C, by varying the refrigerant mass velocity between 100 kg m-2 s-1 and 300 kg m-2 s-1, the vapour quality from 0.15 to 0.95, at two different heat fluxes: 30 and 60 kW m-2. The experimental results are presented in terms of two-phase heat transfer coefficient, onset dryout vapour quality, and frictional pressure drop. Moreover, the experimental measurements are compared against the most updated models for boiling heat transfer coefficient and frictional pressure drop estimations available in the open literature for microfin tubes.

Differentiation of mouse embryonic stem cells into cardiomyocytes via the hanging-drop and mass culture methods.

PubMed

Fuegemann, Christopher J; Samraj, Ajoy K; Walsh, Stuart; Fleischmann, Bernd K; Jovinge, Stefan; Breitbach, Martin

2010-12-01

Herein, we describe two protocols for the in vitro differentiation of mouse embryonic stem cells (mESCs) into cardiomyocytes. mESCs are pluripotent and can be differentiated into cells of all three germ layers, including cardiomyocytes. The methods described here facilitate the differentiation of mESCs into the different cardiac subtypes (atrial-, ventricular-, nodal-like cells). The duration of cell culture determines whether preferentially early- or late-developmental stage cardiomyocytes can be obtained preferentially. This approach allows the investigation of cardiomyocyte development and differentiation in vitro, and also allows for the enrichment and isolation of physiologically intact cardiomyocytes for transplantation purposes. © 2010 by John Wiley & Sons, Inc.

Purification, crystallization and preliminary X-ray characterization of prunin-1, a major component of the almond (Prunus dulcis) allergen amandin.

PubMed

Albillos, Silvia M; Jin, Tengchuan; Howard, Andrew; Zhang, Yuzhu; Kothary, Mahendra H; Fu, Tong-Jen

2008-07-09

The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond ( Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0 A and belong to the tetragonal space group P4(1)22, with unit cell parameters of a = b = 150.912 A, c = 165.248 A. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.

Purification of a Multidrug Resistance Transporter for Crystallization Studies

PubMed Central

Alegre, Kamela O.; Law, Christopher J.

2015-01-01

Crystallization of integral membrane proteins is a challenging field and much effort has been invested in optimizing the overexpression and purification steps needed to obtain milligram amounts of pure, stable, monodisperse protein sample for crystallography studies. Our current work involves the structural and functional characterization of the Escherichia coli multidrug resistance transporter MdtM, a member of the major facilitator superfamily (MFS). Here we present a protocol for isolation of MdtM to increase yields of recombinant protein to the milligram quantities necessary for pursuit of structural studies using X-ray crystallography. Purification of MdtM was enhanced by introduction of an elongated His-tag, followed by identification and subsequent removal of chaperonin contamination. For crystallization trials of MdtM, detergent screening using size exclusion chromatography determined that decylmaltoside (DM) was the shortest-chain detergent that maintained the protein in a stable, monodispersed state. Crystallization trials of MdtM performed using the hanging-drop diffusion method with commercially available crystallization screens yielded 3D protein crystals under several different conditions. We contend that the purification protocol described here may be employed for production of high-quality protein of other multidrug efflux members of the MFS, a ubiquitous, physiologically and clinically important class of membrane transporters. PMID:27025617

Lysozyme

NASA Technical Reports Server (NTRS)

2004-01-01

Protein isolated from hen egg-white and functions as a bacteriostatic enzyme by degrading bacterial cell walls. First enzyme ever characterized by protein crystallography. It is used as an excellent model system for better understanding parameters involved in microgravity experiments with data from laboratory experiments to study the equilibrium rate of hanging drop experiments in microgravity.

Microgravity

NASA Image and Video Library

2004-04-15

Protein isolated from hen egg-white and functions as a bacteriostatic enzyme by degrading bacterial cell walls. First enzyme ever characterized by protein crystallography. It is used as an excellent model system for better understanding parameters involved in microgravity experiments with data from laboratory experiments to study the equilibrium rate of hanging drop experiments in microgravity.

Self-Diffusion of Drops in a Dilute Sheared Emulsion

NASA Technical Reports Server (NTRS)

Loewenberg, Michael; Hinch, E. J.

1996-01-01

Self-diffusion coefficients that describe cross-flow migration of non-Brownian drops in a dilute sheared emulsion were obtained by trajectory calculations. A boundary integral formulation was used to describe pairwise interactions between deformable drops; interactions between undeformed drops were described with mobility functions for spherical drops. The results indicate that drops have large anisotropic self-diffusivities which depend strongly on the drop viscosity and modestly on the shear-rate. Pairwise interactions between drops in shear-flow do not appreciably promote drop breakup.

Implementation of an axisymmetric drop shape apparatus using a Raspberry-Pi single-board computer and a web camera

NASA Astrophysics Data System (ADS)

Carlà, Marcello; Orlando, Antonio

2018-07-01

This paper describes the implementation of an axisymmetric drop shape apparatus for the measurement of surface or interfacial tension of a hanging liquid drop, using only cheap resources like a common web camera and a single-board microcomputer. The mechanics of the apparatus is composed of stubs of commonly available aluminium bar, with all other mechanical parts manufactured with an amateur 3D printer. All of the required software, either for handling the camera and taking the images, or for processing the drop images to get the drop profile and fit it with the Bashforth and Adams equation, is freely available under an open source license. Despite the very limited cost of the whole setup, an extensive test has demonstrated an overall accuracy of ±0.2% or better.

An internal affinity-tag for purification and crystallization of the siderophore receptor FhuA, integral outer membrane protein from Escherichia coli K-12.

PubMed

Ferguson, A D; Breed, J; Diederichs, K; Welte, W; Coulton, J W

1998-07-01

FhuA (Mr 78,992, 714 amino acids), siderophore receptor for ferrichrome-iron in the outer membrane of Escherichia coli, was affinity tagged, rapidly purified, and crystallized. To obtain FhuA in quantities sufficient for crystallization, a hexahistidine tag was genetically inserted into the fhuA gene after amino acid 405, which resides in a known surface-exposed loop. Recombinant FhuA405.H6 was overexpressed in an E. coli strain that is devoid of several major porins and using metal-chelate chromatography was purified in large amounts to homogeneity. FhuA crystals were grown using the hanging drop vapor diffusion technique and were suitable for X-ray diffraction analysis. On a rotating anode X-ray source, diffraction was observed to 3.0 A resolution. The crystals belong to space group P6(1) or P6(5) with unit cell dimensions of a=b=174 A, c=88 A (alpha=beta=90 degrees, gamma=120 degrees).

Transformation of atmospheric components near a spark discharge at the anode polarization of a metallic electrode hanging over a solution

NASA Astrophysics Data System (ADS)

Orlov, A. M.; Yavtushenko, I. O.; Bodnarskii, D. S.

2013-03-01

The variation of the pressure of a gas phase activated by spark discharges between an aqueous electrolyte solution (liquid cathode) and a metallic electrode (anode) hanging over the solution is studied. A mathematical model of the proceeding reaction kinetics is constructed, and the variation of the partial pressures of all initial and produced components in the gas phase is calculated. Both the Faraday and non-Faraday mechanisms of gas component production from water are confirmed. It is found that a large overhanging drop responsible for additional supply of simultaneously produced H2 and O2 molecules forms rapidly at the end face of the anodically polarized electrode.

Device For Controlling Crystallization Of Protein

NASA Technical Reports Server (NTRS)

Noever, David A.

1993-01-01

Variable sandwich spacer enables optimization of evaporative driving force that governs crystallization of protein from solution. Mechanically more rigid than hanging-drop and sitting-drop devices. Large oscillations and dislodgment of drop of solution in response to vibrations suppressed by glass plates. Other advantages include: suitable for automated delivery, stable handling, and programmable evaporation of protein solution; controlled configuration enables simple and accurate determination of volume of solution without disrupting crystallization; pH and concentration of precipitant controlled dynamically because pH and concentration coupled to rate of evaporation, controllable via adjustment of gap between plates; and enables variation of ratio between surface area and volume of protein solution. Alternative version, plates oriented vertically instead of horizontally.

Hanging an Airplane: A Case Study in Static Equilibrium

ERIC Educational Resources Information Center

Katz, Debora M.

2009-01-01

Our classrooms are filled with engineering majors who take a semester-long course in static equilibrium. Many students find this class too challenging and drop their engineering major. In our introductory physics class, we often breeze through static equilibrium; to physicists equilibrium is just a special case of Newton's second law. While it is…

Atomic origins of water-vapour-promoted alloy oxidation

NASA Astrophysics Data System (ADS)

Luo, Langli; Su, Mao; Yan, Pengfei; Zou, Lianfeng; Schreiber, Daniel K.; Baer, Donald R.; Zhu, Zihua; Zhou, Guangwen; Wang, Yanting; Bruemmer, Stephen M.; Xu, Zhijie; Wang, Chongmin

2018-06-01

The presence of water vapour, intentional or unavoidable, is crucial to many materials applications, such as in steam generators, turbine engines, fuel cells, catalysts and corrosion1-4. Phenomenologically, water vapour has been noted to accelerate oxidation of metals and alloys5,6. However, the atomistic mechanisms behind such oxidation remain elusive. Through direct in situ atomic-scale transmission electron microscopy observations and density functional theory calculations, we reveal that water-vapour-enhanced oxidation of a nickel-chromium alloy is associated with proton-dissolution-promoted formation, migration, and clustering of both cation and anion vacancies. Protons derived from water dissociation can occupy interstitial positions in the oxide lattice, consequently lowering vacancy formation energy and decreasing the diffusion barrier of both cations and anions, which leads to enhanced oxidation in moist environments at elevated temperatures. This work provides insights into water-vapour-enhanced alloy oxidation and has significant implications in other material and chemical processes involving water vapour, such as corrosion, heterogeneous catalysis and ionic conduction.

Atomic origins of water-vapour-promoted alloy oxidation.

PubMed

Luo, Langli; Su, Mao; Yan, Pengfei; Zou, Lianfeng; Schreiber, Daniel K; Baer, Donald R; Zhu, Zihua; Zhou, Guangwen; Wang, Yanting; Bruemmer, Stephen M; Xu, Zhijie; Wang, Chongmin

2018-06-01

The presence of water vapour, intentional or unavoidable, is crucial to many materials applications, such as in steam generators, turbine engines, fuel cells, catalysts and corrosion 1-4 . Phenomenologically, water vapour has been noted to accelerate oxidation of metals and alloys 5,6 . However, the atomistic mechanisms behind such oxidation remain elusive. Through direct in situ atomic-scale transmission electron microscopy observations and density functional theory calculations, we reveal that water-vapour-enhanced oxidation of a nickel-chromium alloy is associated with proton-dissolution-promoted formation, migration, and clustering of both cation and anion vacancies. Protons derived from water dissociation can occupy interstitial positions in the oxide lattice, consequently lowering vacancy formation energy and decreasing the diffusion barrier of both cations and anions, which leads to enhanced oxidation in moist environments at elevated temperatures. This work provides insights into water-vapour-enhanced alloy oxidation and has significant implications in other material and chemical processes involving water vapour, such as corrosion, heterogeneous catalysis and ionic conduction.

Studies on the Safety of DDVP for the Disinsection of Commercial Aircraft*

PubMed Central

Witter, Robert F.; Gaines, Thomas B.; Short, J. Gordon; Sedlak, V. A.; Maddock, D. R.

1961-01-01

There is a need for a more effective method for the disinsection of intercontinental aircraft. A study was made of the possible toxic hazard associated with a new method of disinsection using DDVP vapour (O,O-dimethyl-2,2-dichlorovinyl phosphate) as the insecticidal agent. In these experiments, men and monkeys were exposed four times over one- or two-hour periods for a total of 4-8 hours to DDVP vapour in a simulated aircraft cabin. The concentration of DDVP was higher and the exposure periods were longer than those planned for use in disinsection. Concentrations up to 0.7 μg per litre of air produced no effect on the cholinesterase of men or monkeys. It was found that a concentration of DDVP of 0.9-3.5 μg per litre of air caused a slight decrease in plasma cholinesterase of the men and the monkeys. At a DDVP concentration of 7.5-17.9 μg per litre, monkeys exhibited a marked drop in red cell and plasma cholinesterase and showed miosis, but no other signs of poisoning. PMID:13786106

Cloning, overexpression, crystallization and preliminary X-ray crystallographic analysis of a slow-processing mutant of penicillin G acylase from Kluyvera citrophila.

PubMed

Varshney, Nishant Kumar; Ramasamy, Sureshkumar; Brannigan, James A; Wilkinson, Anthony J; Suresh, C G

2013-08-01

Kluyvera citrophila penicillin G acylase (KcPGA) has recently attracted increased attention relative to the well studied and commonly used Escherichia coli PGA (EcPGA) because KcPGA is more resilient to harsh conditions and is easier to immobilize for the industrial hydrolysis of natural penicillins to generate the 6-aminopenicillin (6-APA) nucleus, which is the starting material for semi-synthetic antibiotic production. Like other penicillin acylases, KcPGA is synthesized as a single-chain inactive pro-PGA, which upon autocatalytic processing becomes an active heterodimer of α and β chains. Here, the cloning of the pac gene encoding KcPGA and the preparation of a slow-processing mutant precursor are reported. The purification, crystallization and preliminary X-ray analysis of crystals of this precursor protein are described. The protein crystallized in two different space groups, P1, with unit-cell parameters a = 54.0, b = 124.6, c = 135.1 Å, α = 104.1, β = 101.4, γ = 96.5°, and C2, with unit-cell parameters a = 265.1, b = 54.0, c = 249.2 Å, β = 104.4°, using the sitting-drop vapour-diffusion method. Diffraction data were collected at 100 K and the phases were determined using the molecular-replacement method. The initial maps revealed electron density for the spacer peptide.

Theoretical model of the Bergeron-Findeisen mechanism of ice crystal growth in clouds

NASA Astrophysics Data System (ADS)

Castellano, N. E.; Avila, E. E.; Saunders, C. P. R.

A numerical study of growth rate of ice particles in an array of water droplets (Bergeron-Findeisen mechanism) has used the method of electrostatic image charges to determine the vapour field in which a particle grows. Analysis of growth rate in various conditions of relevance to clouds has shown that it is proportional to liquid water content and to ice particle size, while it is inversely proportional to cloud droplet size. The results show that growth rate is enhanced by several percent relative to the usual treatment in which vapour is assumed to diffuse from infinity towards a growing ice particle. The study was performed for ice particles between 25 and 150 μm radii, water droplet sizes between 6 and 20 μm diameter and a wide range of liquid water contents. A study was also made to determine the effect of reducing the vapour source at infinity so that the droplets alone provided the vapour for particle growth. A parameterisation of ice particle growth rate is given as a function of liquid water content and ice particle and droplet sizes. These studies are of importance to considerations in thunderstorm electrification processes, where the mechanism of charge transfer between ice particles and graupel could take place.

Crystallization and preliminary X-ray diffraction studies of two thermostable α-galactosidases from glycoside hydrolase family 36

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foucault, M.; Watzlawick, H.; Mattes, R.

2006-02-01

The α-galactosidases AgaA, AgaB and AgaA A355E mutant from Geobacillus stearothermophilus have been overexpressed in Escherichia coli. Crystals of AgaB and AgaA A355E have been obtained by the vapour-diffusion method and synchrotron data have been collected to 2.0 and 2.8 Å resolution, respectively. α-Galactosidases from thermophilic organisms have gained interest owing to their applications in the sugar industry. The α-galactosidases AgaA, AgaB and AgaA A355E mutant from Geobacillus stearothermophilus have been overexpressed in Escherichia coli. Crystals of AgaB and AgaA A355E have been obtained by the vapour-diffusion method and synchrotron data have been collected to 2.0 and 2.8 Å resolution,more » respectively. Crystals of AgaB belong to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 87.5, b = 113.3, c = 161.6 Å. Crystals of AgaA A355E belong to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 150.1, c = 233.2 Å.« less

Spore-to-spore agar culture of the myxomycete Physarum globuliferum.

PubMed

Liu, Pu; Wang, Qi; Li, Yu

2010-02-01

The ontogeny of the myxomycete Physarum globuliferum was observed on corn meal agar and hanging drop cultures without adding sterile oat flakes, bacteria or other microorganisms. Its complete life cycle including spore germination, myxamoebae, swarm cells, plasmodial development, and maturity of fructifications was demonstrated. Details of spore-to-spore development are described and illustrated.

Determination of picloram in natural waters employing sequential injection square wave voltammetry using the hanging mercury drop electrode.

PubMed

Dos Santos, Luciana B O; Masini, Jorge C

2007-05-15

This paper describes the development of a sequential injection analysis method to automate the determination of picloram by square wave voltammetry exploiting the concept of monosegmented flow analysis to perform in-line sample conditioning and standard addition. To perform these tasks, an 800muL monosegment is formed, composed by 400muL of sample and 400muL of conditioning/standard solution, in medium of 0.10molL(-1) H(2)SO(4). Homogenization of the monosegment is achieved by three flow reversals. After homogenization the mixture zone is injected toward the flow cell, which is adapted to the capillary of a hanging drop mercury electrode, at a flow rate of 50muLs(-1). After a suitable delay time, the potential is scanned from -0.5 to -1.0V versus Ag/AgCl at frequency of 300Hz and pulse height of 25mV. The linear dynamic range is observed for picloram concentrations between 0.10 and 2.50mgL(-1) fitting to the linear equation I(p)=(-2.19+/-0.03)C(picloram)+(0.096+/-0.039), with R(2)=0.9996, for which the slope is given in muALmg(-1). The detection and quantification limits are 0.036 and 0.12mgL(-1), respectively. The sampling frequency is 37h(-1) when the standard addition protocol is followed, but can be increased to 41h(-1) if the protocol to obtain in-line external calibration curve is used for quantification. The method was applied for determination of picloram in spiked water samples and the accuracy was evaluated by comparison with high performance liquid chromatography using molecular absorption at 220nm for detection. No evidences of statistically significant differences between the two methods were observed.

Prediction and validation of diffusion coefficients in a model drug delivery system using microsecond atomistic molecular dynamics simulation and vapour sorption analysis.

PubMed

Forrey, Christopher; Saylor, David M; Silverstein, Joshua S; Douglas, Jack F; Davis, Eric M; Elabd, Yossef A

2014-10-14

Diffusion of small to medium sized molecules in polymeric medical device materials underlies a broad range of public health concerns related to unintended leaching from or uptake into implantable medical devices. However, obtaining accurate diffusion coefficients for such systems at physiological temperature represents a formidable challenge, both experimentally and computationally. While molecular dynamics simulation has been used to accurately predict the diffusion coefficients, D, of a handful of gases in various polymers, this success has not been extended to molecules larger than gases, e.g., condensable vapours, liquids, and drugs. We present atomistic molecular dynamics simulation predictions of diffusion in a model drug eluting system that represent a dramatic improvement in accuracy compared to previous simulation predictions for comparable systems. We find that, for simulations of insufficient duration, sub-diffusive dynamics can lead to dramatic over-prediction of D. We present useful metrics for monitoring the extent of sub-diffusive dynamics and explore how these metrics correlate to error in D. We also identify a relationship between diffusion and fast dynamics in our system, which may serve as a means to more rapidly predict diffusion in slowly diffusing systems. Our work provides important precedent and essential insights for utilizing atomistic molecular dynamics simulations to predict diffusion coefficients of small to medium sized molecules in condensed soft matter systems.

A highly accurate boundary integral equation method for surfactant-laden drops in 3D

NASA Astrophysics Data System (ADS)

Sorgentone, Chiara; Tornberg, Anna-Karin

2018-05-01

The presence of surfactants alters the dynamics of viscous drops immersed in an ambient viscous fluid. This is specifically true at small scales, such as in applications of droplet based microfluidics, where the interface dynamics become of increased importance. At such small scales, viscous forces dominate and inertial effects are often negligible. Considering Stokes flow, a numerical method based on a boundary integral formulation is presented for simulating 3D drops covered by an insoluble surfactant. The method is able to simulate drops with different viscosities and close interactions, automatically controlling the time step size and maintaining high accuracy also when substantial drop deformation appears. To achieve this, the drop surfaces as well as the surfactant concentration on each surface are represented by spherical harmonics expansions. A novel reparameterization method is introduced to ensure a high-quality representation of the drops also under deformation, specialized quadrature methods for singular and nearly singular integrals that appear in the formulation are evoked and the adaptive time stepping scheme for the coupled drop and surfactant evolution is designed with a preconditioned implicit treatment of the surfactant diffusion.

The effect of lemon, orange and bergamot essential oils and their components on the survival of Campylobacter jejuni, Escherichia coli O157, Listeria monocytogenes, Bacillus cereus and Staphylococcus aureus in vitro and in food systems.

PubMed

Fisher, K; Phillips, C A

2006-12-01

To investigate the effectiveness of oils and vapours of lemon (Citrus limon), sweet orange (Citrus sinensis) and bergamot (Citrus bergamia) and their components against a number of common foodborne pathogens. The disc diffusion method was used to screen the oils and vapours against Listeria monocytogenes, Staphylococcus aureus, Bacillus cereus, Escherichia coli O157 and Campylobacter jejuni. The survival of each species, demonstrated to be susceptible in the in vitro studies, was tested on cabbage leaf for 60 s by direct contact and on chicken skin for 10 min by direct contact and 24 h by vapour. The results indicate that bergamot was the most inhibitory essential oil (EO) and citral and linalool mimicked its effect (P > 0.001). Citral and linalool vapours produced 6 log reductions in L. monocytogenes, Staph. aureus and B. cereus populations on cabbage leaf after 8-10 h exposure but bergamot vapour exposure, while producing a similar reduction in L. monocytogenes and B. cereus populations, had no effect on Staph. aureus. Bergamot was the most effective of the oils tested and linalool the most effective anti-bacterial component. Gram-positive bacteria were more susceptible than Gram-negative bacteria in vitro, although Camp. jejuni and E. coli O157 were inhibited by bergamot and linalool oils and by linalool vapour. All bacteria tested were less susceptible in food systems than in vitro. Of the Gram-positive bacteria tested Staph. aureus was the least susceptible to both the oils and the components tested. Results suggest the possibility that citrus EOs, particularly bergamot, could be used as a way of combating the growth of common causes of food poisoning.

Langmuir-Blodgett nanotemplates for protein crystallography.

PubMed

Pechkova, Eugenia; Nicolini, Claudio

2017-12-01

The new generation of synchrotrons and microfocused beamlines has enabled great progress in X-ray protein crystallography, resulting in new 3D atomic structures for proteins of high interest to the pharmaceutical industry and life sciences. It is, however, often still challenging to produce protein crystals of sufficient size and quality (order, intensity of diffraction, radiation stability). In this protocol, we provide instructions for performing the Langmuir-Blodgett (LB) nanotemplate method, a crystallization approach that can be used for any protein (including membrane proteins). We describe how to produce highly ordered 2D LB protein monolayers at the air-water interface and deposit them on glass slides. LB-film formation can be observed by surface-pressure measurements and Brewster angle microscopy (BAM), although its quality can be characterized by atomic force microscopy (AFM) and nanogravimetry. Such films are then used as a 2D template for triggering 3D protein crystal formation by hanging-drop vapor diffusion. The procedure for forming the 2D template takes a few minutes. Structural information about the protein reorganization in the LB film during the crystallization process on the nano level can be obtained using an in situ submicron GISAXS (grazing-incidence small-angle X-ray scattering) method. MicroGISAXS spectra, measured directly at the interface of the LB films and protein solution in real time, as described in this protocol, can be interpreted in terms of the buildup of layers, islands, or holes. In our experience, the obtained LB crystals take 1-10 d to prepare and they are more ordered and radiation stable as compared with those produced using other crystallization methods.

Ionic liquid-based single-drop microextraction/gas chromatographic/mass spectrometric determination of benzene, toluene, ethylbenzene and xylene isomers in waters.

PubMed

Aguilera-Herrador, Eva; Lucena, Rafael; Cárdenas, Soledad; Valcárcel, Miguel

2008-08-01

The direct coupling between ionic liquid-based single-drop microextraction and gas chromatography/mass spectrometry is proposed for the rapid and simple determination of benzene, toluene, ethylbenzene and xylenes isomers (BTEX) in water samples. The extraction procedure exploits not only the high affinity of the selected ionic liquid (1-methyl-3-octyl-imidazolium hexaflourophosphate) to these aromatic compounds but also its special properties like viscosity, low vapour pressure and immiscibility with water. All the variables involved in the extraction process have been studied in depth. The developed method allows the determination of these single-ring compounds in water under the reference concentration level fixed by the international legislation. In this case, limits of detection were in the range 20 ng L(-1) (obtained for benzene) and 91 ng L(-1) (for o-xylene). The repeatability of the proposed method, expressed as RSD (n=5), varied between 3.0% (o-xylene) and 5.2% (toluene).

Growth of microorganisms in Martian-like shallow subsurface conditions: laboratory modelling

NASA Astrophysics Data System (ADS)

Pavlov, A. K.; Shelegedin, V. N.; Vdovina, M. A.; Pavlov, A. A.

2010-01-01

Low atmospheric pressures on Mars and the lack of substantial amounts of liquid water were suggested to be among the major limiting factors for the potential Martian biosphere. However, large amounts of ice were detected in the relatively shallow subsurface layers of Mars by the Odyssey Mission and when ice sublimates the water vapour can diffuse through the porous surface layer of the soil. Here we studied the possibility for the active growth of microorganisms in such a vapour diffusion layer. Our results showed the possibility of metabolism and the reproduction of non-extremophile terrestrial microorganisms (Vibrio sp.) under very low (0.01-0.1 mbar) atmospheric pressures in a Martian-like shallow subsurface regolith.

Phormidium phycoerythrin forms hexamers in crystals: a crystallographic study

PubMed Central

Sonani, Ravi Raghav; Sharma, Mahima; Gupta, Gagan Deep; Kumar, Vinay; Madamwar, Datta

2015-01-01

The crystallographic analysis of a marine cyanobacterium (Phormidium sp. A09DM) phycoerythrin (PE) that shows distinct sequence features compared with known PE structures from cyanobacteria and red algae is reported. Phormidium PE was crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant. Diffraction data were collected on the protein crystallography beamline at the Indus-2 synchrotron. The crystals diffracted to about 2.1 Å resolution at 100 K. The crystals, with an apparent hexagonal morphology, belonged to space group P1, with unit-cell parameters a = 108.3, b = 108.4 Å, c = 116.6 Å, α = 78.94, β = 82.50, γ = 60.34°. The molecular-replacement solution confirmed the presence of 12 αβ monomers in the P1 cell. The Phormidium PE elutes as an (αβ)3 trimer of αβ monomers from a molecular-sieve column and exists as [(αβ)3]2 hexamers in the crystal lattice. Unlike red algal PE proteins, the hexamers of Phormidium PE do not form higher-order structures in the crystals. The existence of only one characteristic visual absorption band at 564 nm suggests the presence of phycoerythrobilin chromophores, and the absence of any other types of bilins, in the Phormidium PE assembly. PMID:26249689

Crystallization and X-ray diffraction analysis of the CH domain of the cotton kinesin GhKCH2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qin, Xinghua; The Fourth Military Medical University, No. 169 Changlexi Road, Xincheng District, Xi’an 710032, People’s Republic of; Chen, Ziwei

The cloning, expression, purification and crystallization of the CH domain of the plant-specific kinesin GhKCH2 is reported. GhKCH2 belongs to a group of plant-specific kinesins (KCHs) containing an actin-binding calponin homology (CH) domain in the N-terminus. Previous studies revealed that the GhKCH2 CH domain (GhKCH2-CH) had a higher affinity for F-actin (K{sub d} = 0.42 ± 0.02 µM) than most other CH-domain-containing proteins. To understand the underlying mechanism, prokaryotically expressed GhKCH2-CH (amino acids 30–166) was purified and crystallized. Crystals were grown by the sitting-drop vapour-diffusion method using 0.1 M Tris–HCl pH 7.0, 20%(w/v) PEG 8000 as a precipitant. The crystalsmore » diffracted to a resolution of 2.5 Å and belonged to space group P2{sub 1}, with unit-cell parameters a = 41.57, b = 81.92, c = 83.00 Å, α = 90.00, β = 97.31, γ = 90.00°. Four molecules were found in the asymmetric unit with a Matthews coefficient of 2.22 Å{sup 3} Da{sup −1}, corresponding to a solvent content of 44.8%.« less

Simplified conditions holding at the gas-liquid interface during evaporation

NASA Astrophysics Data System (ADS)

Morris, S. J. S.

2017-11-01

We show that on the gas side of the interface between a pure liquid and a binary mixture of its vapour with an insoluble gas, the normal derivative of vapour partial pressure pv satisfies ∂pv/∂n +αc/2 πpD (P -pv) (p -pv) = 0 . Constants α, c, D denote the dimensionless accommodation coefficient, a molecular speed and the diffusivity. Provided the continuum approximation holds within the gas, and α = O(1) , this boundary condition implies that evaporation can take one of two forms. (a) If the coexistence pressure P evaluated at the interface is less than the constant total gas pressure p, liquid at the interface is in local thermodynamic equilibrium with its vapour, and the evaporation rate is determined by diffusion through the gas. (b) Conversely, if P > p , gas at the interface consists of pure vapour, and the evaporation rate is determined by processes within the liquid. In the Wayner theory of the heated evaporating meniscus, such as that in a heat pipe, case (b) is assumed. As an application of our result, we show that some of the published experiments intended to test the Wayner theory instead operate under conditions in which case (a) holds. As a result, they do not perform the test intended.

Purification, Crystallization and Preliminary X-ray Characterization of Prunin-1, a Major Component of the Almond (Prunus dulcis) Allergen Amandin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Albillos, Silvia M.; Jin, Tengchuan; Howard, Andrew

2008-08-04

The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond (Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0more » {angstrom} and belong to the tetragonal space group P4{sub 1}22, with unit cell parameters of a = b = 150.912 {angstrom}, c = 165.248 {angstrom}. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.« less

Transport mechanisms through PE-CVD coatings: influence of temperature, coating properties and defects on permeation of water vapour

NASA Astrophysics Data System (ADS)

Kirchheim, Dennis; Jaritz, Montgomery; Mitschker, Felix; Gebhard, Maximilian; Brochhagen, Markus; Hopmann, Christian; Böke, Marc; Devi, Anjana; Awakowicz, Peter; Dahlmann, Rainer

2017-03-01

Gas transport mechanisms through plastics are usually described by the temperature-dependent Arrhenius-model and compositions of several plastic layers are represented by the CLT. When it comes to thin films such as plasma-enhanced chemical vapour deposition (PE-CVD) or plasma-enhanced atomic layer deposition (PE-ALD) coatings on substrates of polymeric material, a universal model is lacking. While existing models describe diffusion through defects, these models presume that permeation does not occur by other means of transport mechanisms. This paper correlates the existing transport models with data from water vapour transmission experiments.

First Protein Crystallization Experiments on The International Space Station: Sweet Success in Space With Thaumatin

NASA Technical Reports Server (NTRS)

Kundrot, Craig E.; Barnes, Cindy L.; Snell, Eddie H.; Achari, Aniruddha; Whitaker, Ann F. (Technical Monitor)

2001-01-01

We determined the room temperature 1.2 A structure of thaumatin using a crystal grown in the first protein crystallization experiment conducted aboard the International Space Station (ISS). The crystals were grown in the Enhanced Gaseous Nitrogen Dewar (EGN) developed by Alexander McPherson and co-workers. EGN transports frozen solutions contained in tygon tubing in a liquid nitrogen Dewar to ISS where the tubes then thaw. Batch, free interface diffusion (FID), or vapor diffusion crystallization occurs after thawing. EGN was flown to the ISS on STS-106 on September 8, 2000. This was a "risk mitigation" flight that tested EGN performance and the process of conducting experiments on ISS. We focused on how to map a hanging drop crystallization recipe to the EGN FID method. Thaumatin was chosen as the test system. Three series of crystallization recipes were set-up. Each series tested different volume ratios of protein-rich solution to precipitant-rich solution. The series differed from each other by fixing either the protein concentration or the amount of protein in the solutions. Upon return of the samples to Earth on October 24 by STS-92, bubbles that spanned the diameter of the tubing were observed in all tubes. Such bubbles interrupt liquid-liquid diffusion and force vapor diffusion equilibration to occur instead. Nonetheless, crystals grew in 9 of 30 tubes. Many large crystals were grown, the largest being 2.0 x 1.1 x 1.0 cubic mm. The largest crystal was used to collect data at room temperature on beamline 7-1 of the Stanford Synchrotron Radiation Source to a maximum resolution of 1.2 A. The structure was refined anisotropically using SHELX with a data to parameter ratio of 4.5 to give an R(sub factor) of 15.8% (R(sub free) = 18.2%) for ail reflections without generated hydrogens. This refinement is proceeding. Comparisons of this 1.2 A microgravity structure to previous reports of the thaumatin structure at 1.75 A and to ground control crystals will be presented.

Derivation and characterization of gut-like structures from embryonic stem cells.

PubMed

Yamada, Takatsugu; Nakajima, Yoshiyuki

2006-01-01

Embryonic stem (ES) cells have a pluripotent ability to differentiate into a variety of cell lineages of all three embryonic germ layers in vitro. The hanging drop culture of ES cell suspension in the absence of leukemia inhibitory factor induces aggregation and differentiation of the cells into simple or cystic embryoid bodies (EBs). After 6 d of hanging drop culture, the resulting EBs are plated onto plastic dishes for the outgrowth culture. At d 21 after outgrowth culture, cell populations of EBs can give rise to three-dimensional gut-like structures that exhibit spontaneous contraction and highly coordinated peristalsis. The gut-like structures have large lumens surrounded by three layers: epithelium, lamina propria, and muscularis. Ganglia are scattered along the periphery, and interstitial cells of Cajal are distributed among the smooth muscle cells. The fundamental process of formation of the in vitro organized gut-like structures is similar to embryonic gastrointestinal development in vivo. The EBs at the 6-d egg-cylinder stage may have the potential to regulate developmental programs associated with cell lineage commitment and provide an appropriate microenvironment to differentiate ES cells into enteric derivatives of all three embryonic germ layers and reproduce the gut organization process in vitro.

Searching for new features of intravitality of hanging based on macro- and microscopic evaluation of the proximal attachment of the sternocleidomastoid muscle and the mastoid process of the temporal bone.

PubMed

Szleszkowski, Ł; Hałoń, A; Thannhäuser, A; Jurek, T

2015-01-01

Assessment of the usefulness of intravital lesions in the proximal attachment of the sternocleidomastoid muscle and the mastoid process of the temporal bone in medico-legal evaluation of death by hanging. The study material was obtained from the bodies of 35 people who died by hanging. The control group comprised specimens collected from 30 people who died of non-traumatic causes. The structures under study were examined macro- and microscopically. The basic change which could be recognized as a marker of intravitality of hanging was the presence of a macroscopically extensive blotchy area of abundant ecchymosis in the proximal muscle attachment, similar to that found in the distal attachment, and the presence of abundant diffuse intraosseous ecchymoses in the mastoid process. None of the cases revealed any ecchymoses in the proximal attachment of the muscle that would be similar to those present in the distal attachment. Discolourations within the mastoid processes, macroscopically suggestive of extensive intraosseous effusions arising from the mechanism of stretching, were not confirmed by microscopic evaluation and occurred at the same frequency as in the control group. Limitations of the study were related to the method which involved sample collection by means of bone chisels, decalcification and preparation of specimens, which had an effect, for example, on the measurable evaluation of the degree of congestion. The study has failed to provide convincing and unambiguous data on the usefulness of examining mastoid processes and proximal attachments of the sternocleidomastoid muscles during autopsy to determine the presence of intravitality features of hanging. A description of research methodology and its associated difficulties, e.g. with the interpretation of results, can also be useful for the planning of similar studies by other researchers.

Numerical analysis of moving contact line with contact angle hysteresis using feedback deceleration technique

NASA Astrophysics Data System (ADS)

Park, Jun Kwon; Kang, Kwan Hyoung

2012-04-01

Contact angle (CA) hysteresis is important in many natural and engineering wetting processes, but predicting it numerically is difficult. We developed an algorithm that considers CA hysteresis when analyzing the motion of the contact line (CL). This algorithm employs feedback control of CA which decelerates CL speed to make the CL stationary in the hysteretic range of CA, and one control coefficient should be heuristically determined depending on characteristic time of the simulated system. The algorithm requires embedding only a simple additional routine with little modification of a code which considers the dynamic CA. The method is non-iterative and explicit, and also has less computational load than other algorithms. For a drop hanging on a wire, the proposed algorithm accurately predicts the theoretical equilibrium CA. For the drop impacting on a dry surface, the results of the proposed algorithm agree well with experimental results including the intermittent occurrence of the pinning of CL. The proposed algorithm is as accurate as other algorithms, but faster.

Self-spinning nanoparticle laden microdroplets for sensing and energy harvesting

NASA Astrophysics Data System (ADS)

Bhattacharjee, Mitradip; Pasumarthi, Viswanath; Chaudhuri, Joydip; Singh, Amit Kumar; Nemade, Harshal; Bandyopadhyay, Dipankar

2016-03-01

Exposure of a volatile organic vapour could set in powerful rotational motion a microdroplet composed of an aqueous salt solution loaded with metal nanoparticles. The solutal Marangoni motion on the surface originating from the sharp difference in the surface tension of water and organic vapour stimulated the strong vortices inside the droplet. The vapour sources of methanol, ethanol, diethyl ether, toluene, and chloroform stimulated motions of different magnitudes could easily be correlated to the surface tension gradient on the drop surface. Interestingly, when the nanoparticle laden droplet of aqueous salt solution was connected to an external electric circuit through a pair of electrodes, an ~85-95% reduction in the electrical resistance was observed across the spinning droplet. The extent of reduction in the resistance was found to have a correlation with the difference in the surface tension of the vapour source and the water droplet, which could be employed to distinguish the vapour sources. Remarkably, the power density of the same prototype was estimated to be around 7 μW cm-2, which indicated the potential of the phenomenon in converting surface energy into electrical in a non-destructive manner and under ambient conditions. Theoretical analysis uncovered that the difference in the ζ-potential near the electrodes was the major reason for the voltage generation. The prototype could also detect the repeated exposure and withdrawal of vapour sources, which helped in the development of a proof-of-concept detector to sense alcohol issuing out of the human breathing system.Exposure of a volatile organic vapour could set in powerful rotational motion a microdroplet composed of an aqueous salt solution loaded with metal nanoparticles. The solutal Marangoni motion on the surface originating from the sharp difference in the surface tension of water and organic vapour stimulated the strong vortices inside the droplet. The vapour sources of methanol, ethanol, diethyl ether, toluene, and chloroform stimulated motions of different magnitudes could easily be correlated to the surface tension gradient on the drop surface. Interestingly, when the nanoparticle laden droplet of aqueous salt solution was connected to an external electric circuit through a pair of electrodes, an ~85-95% reduction in the electrical resistance was observed across the spinning droplet. The extent of reduction in the resistance was found to have a correlation with the difference in the surface tension of the vapour source and the water droplet, which could be employed to distinguish the vapour sources. Remarkably, the power density of the same prototype was estimated to be around 7 μW cm-2, which indicated the potential of the phenomenon in converting surface energy into electrical in a non-destructive manner and under ambient conditions. Theoretical analysis uncovered that the difference in the ζ-potential near the electrodes was the major reason for the voltage generation. The prototype could also detect the repeated exposure and withdrawal of vapour sources, which helped in the development of a proof-of-concept detector to sense alcohol issuing out of the human breathing system. Electronic supplementary information (ESI) available: Discussion of simulation with results, characterization and movies of particle motion inside droplets along with detailed explanation. See DOI: 10.1039/c6nr00217j

Surface Tension Guided Hanging-Drop: Producing Controllable 3D Spheroid of High-Passaged Human Dermal Papilla Cells and Forming Inductive Microtissues for Hair-Follicle Regeneration.

PubMed

Lin, Bojie; Miao, Yong; Wang, Jin; Fan, Zhexiang; Du, Lijuan; Su, Yongsheng; Liu, Bingcheng; Hu, Zhiqi; Xing, Malcolm

2016-03-09

Human dermal papilla (DP) cells have been studied extensively when grown in the conventional monolayer. However, because of great deviation from the real in vivo three-dimensional (3D) environment, these two-dimensional (2D) grown cells tend to lose the hair-inducible capability during passaging. Hence, these 2D caused concerns have motivated the development of novel 3D culture techniques to produce cellular microtissues with suitable mimics. The hanging-drop approach is based on surface tension-based technique and the interaction between surface tension and gravity field that makes a convergence of liquid drops. This study used this technique in a converged drop to form cellular spheroids of dermal papilla cells. It leads to a controllable 3Dspheroid model for scalable fabrication of inductive DP microtissues. The optimal conditions for culturing high-passaged (P8) DP spheroids were determined first. Then, the morphological, histological and functional studies were performed. In addition, expressions of hair-inductive markers including alkaline phosphatase, α-smooth muscle actin and neural cell adhesion molecule were also analyzed by quantitative RT-PCR, immunostaining and immunoblotting. Finally, P8-DP microtissues were coimplanted with newborn mouse epidermal cells (EPCs) into nude mice. Our results indicated that the formation of 3D microtissues not only endowed P8-DP microtissues many similarities to primary DP, but also confer these microtissues an enhanced ability to induce hair-follicle (HF) neogenesis in vivo. This model provides a potential to elucidate the native biology of human DP, and also shows the promising for the controllable and scalable production of inductive DP cells applied in future follicle regeneration.

Process modelling for space station experiments

NASA Technical Reports Server (NTRS)

Rosenberger, Franz; Alexander, J. Iwan D.

1988-01-01

The work performed during the first year 1 Oct. 1987 to 30 Sept. 1988 involved analyses of crystal growth from the melt and from solution. The particular melt growth technique under investigation is directional solidification by the Bridgman-Stockbarger method. Two types of solution growth systems are also being studied. One involves growth from solution in a closed container, the other concerns growth of protein crystals by the hanging drop method. Following discussions with Dr. R. J. Naumann of the Low Gravity Science Division at MSFC it was decided to tackle the analysis of crystal growth from the melt earlier than originally proposed. Rapid progress was made in this area. Work is on schedule and full calculations were underway for some time. Progress was also made in the formulation of the two solution growth models.

How far can Tarzan jump?

NASA Astrophysics Data System (ADS)

Shima, Hiroyuki

2012-11-01

The tree-based rope swing is a popular recreational facility, often installed in outdoor areas. Hanging from a rope, users drop from a high platform and then swing at great speed like ‘Tarzan’, finally jumping ahead to land on the ground. The question naturally arises, how far can Tarzan jump using the swing? In this paper, I present an introductory analysis of the mechanics of the Tarzan swing, a large pendulum-like swing with Tarzan himself attached as weight. This enables determination of how much further forward Tarzan can jump using a given swing apparatus. The discussion is based on elementary mechanics and is, therefore, expected to provide rich opportunities for investigations using analytic and numerical methods.

Creatinine sensor based on a molecularly imprinted polymer-modified hanging mercury drop electrode.

PubMed

Lakshmi, Dhana; Prasad, Bhim Bali; Sharma, Piyush Sindhu

2006-09-15

Molecularly imprinted polymers (MIP) have been elucidated to work as artificial receptors. In our present study, a MIP was applied as a molecular recognition element to a chemical sensor. We have constructed a creatinine sensor based on a MIP layer selective for creatinine and its differential pulse, cathodic stripping voltammetric detection (DPCSV) on a hanging mercury drop electrode (HMDE). The creatinine sensor was fabricated by the drop coating of dimethylformamide (DMF) solution of a creatinine-imprinted polymer onto the surface of HMDE. The modified-HMDE, preanodised in neutral medium at +0.4V versus Ag/AgCl for 120s, exhibited a marked enhancement in DPCSV current in comparison to the less anodised (

Laterally Overgrown Structures as Substrates for Lattice Mismatched Epitaxy

DTIC Science & Technology

2002-06-03

low supersaturation substrate [3]. Therefore, equilibrium growth techniques as liquid buffer with TD phase epitaxy (LPE) or vapour phase epitaxy (VPE...phase diffusion during MBE growth, so lateral over- low cost semiconductor devices. Therefore, vapour growth must rely on the surface mobility of...is replaced by graphite film not wetted For the GaAs on GaAs ELO system we attributed by the gallium melt [35]. Similarly, tungsten has been broadening

Unsaturation of vapour pressure inside leaves of two conifer species

DOE PAGES

Cernusak, Lucas A.; Ubierna, Nerea; Jenkins, Michael W.; ...

2018-05-16

Stomatal conductance (g s) impacts both photosynthesis and transpiration, and is therefore fundamental to the global carbon and water cycles, food production, and ecosystem services. Mathematical models provide the primary means of analysing this important leaf gas exchange parameter. A nearly universal assumption in such models is that the vapour pressure inside leaves (e i) remains saturated under all conditions. The validity of this assumption has not been well tested, because so far e i cannot be measured directly. Here, we test this assumption using a novel technique, based on coupled measurements of leaf gas exchange and the stable isotopemore » compositions of CO 2 and water vapour passing over the leaf. We applied this technique to mature individuals of two semiarid conifer species. In both species, e i routinely dropped below saturation when leaves were exposed to moderate to high air vapour pressure deficits. Typical values of relative humidity in the intercellular air spaces were as low 0.9 in Juniperus monosperma and 0.8 in Pinus edulis. These departures of e i from saturation caused significant biases in calculations of g s and the intercellular CO 2 concentration. Thus, our results refute the longstanding assumption of saturated vapour pressure in plant leaves under all conditions.« less

Unsaturation of vapour pressure inside leaves of two conifer species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cernusak, Lucas A.; Ubierna, Nerea; Jenkins, Michael W.

Stomatal conductance (g s) impacts both photosynthesis and transpiration, and is therefore fundamental to the global carbon and water cycles, food production, and ecosystem services. Mathematical models provide the primary means of analysing this important leaf gas exchange parameter. A nearly universal assumption in such models is that the vapour pressure inside leaves (e i) remains saturated under all conditions. The validity of this assumption has not been well tested, because so far e i cannot be measured directly. Here, we test this assumption using a novel technique, based on coupled measurements of leaf gas exchange and the stable isotopemore » compositions of CO 2 and water vapour passing over the leaf. We applied this technique to mature individuals of two semiarid conifer species. In both species, e i routinely dropped below saturation when leaves were exposed to moderate to high air vapour pressure deficits. Typical values of relative humidity in the intercellular air spaces were as low 0.9 in Juniperus monosperma and 0.8 in Pinus edulis. These departures of e i from saturation caused significant biases in calculations of g s and the intercellular CO 2 concentration. Thus, our results refute the longstanding assumption of saturated vapour pressure in plant leaves under all conditions.« less

The possible equilibrium shapes of static pendant drops

NASA Astrophysics Data System (ADS)

Sumesh, P. T.; Govindarajan, Rama

2010-10-01

Analytical and numerical studies are carried out on the shapes of two-dimensional and axisymmetric pendant drops hanging under gravity from a solid surface. Drop shapes with both pinned and equilibrium contact angles are obtained naturally from a single boundary condition in the analytical energy optimization procedure. The numerical procedure also yields optimum energy shapes, satisfying Young's equation without the explicit imposition of a boundary condition at the plate. It is shown analytically that a static pendant two-dimensional drop can never be longer than 3.42 times the capillary length. A related finding is that a range of existing solutions for long two-dimensional drops correspond to unphysical drop shapes. Therefore, two-dimensional drops of small volume display only one static solution. In contrast, it is known that axisymmetric drops can display multiple solutions for a given volume. We demonstrate numerically that there is no limit to the height of multiple-lobed Kelvin drops, but the total volume is finite, with the volume of successive lobes forming a convergent series. The stability of such drops is in question, though. Drops of small volume can attain large heights. A bifurcation is found within the one-parameter space of Laplacian shapes, with a range of longer drops displaying a minimum in energy in the investigated space. Axisymmetric Kelvin drops exhibit an infinite number of bifurcations.

Scaling during capillary thinning of particle-laden drops

NASA Astrophysics Data System (ADS)

Thete, Sumeet; Wagoner, Brayden; Basaran, Osman

2017-11-01

A fundamental understanding of drop formation is crucial in many applications such as ink-jet printing, microfluidic devices, and atomization. During drop formation, the about-to-form drop is connected to the fluid hanging from the nozzle via a thinning filament. Therefore, the physics of capillary thinning of filaments is key to understanding drop formation and has been thoroughly studied for pure Newtonian fluids using theory, simulations, and experiments. In some of the applications however, the forming drop and hence the thinning filament may contain solid particles. The thinning dynamics of such particle-laden filaments differs radically from that of particle-free filaments. Moreover, our understanding of filament thinning in the former case is poor compared to that in the latter case despite the growing interest in pinch-off of particle-laden filaments. In this work, we go beyond similar studies and experimentally explore the impact of solid particles on filament thinning by measuring both the radial and axial scalings in the neck region. The results are summarized in terms of a phase diagram of capillary thinning of particle-laden filaments.

Investigation for the differentiation process of mouse ES cells by Raman spectroscopy

NASA Astrophysics Data System (ADS)

Yamaguchi, Yoshinori; El-Hagrasy, Maha A.; Shimizu, Eiichi; Saito, Masato; Tamiya, Eiichi

2012-03-01

The arrangement of differentiated pluripotent embryonic stem cells into three-dimensional aggregates, which are known as embryonic bodies, is a main step for progressing the embryonic stem cells differentiation. In this work, embryonic stem cells that were directly produced from the hanging drop step as a three-dimensional structure with no further twodimensional differentiation were diagnosed with Raman spectroscopy as a non-invasive and label-free technique. Raman spectroscopy was employed to discriminate between mouse embryonic bodies of different degrees of maturation. EBs were prepared applying the hanging drop method. The Raman scattering measurements were obtained in vitro with a Nanophoton RAMAN-11 micro-spectrometer (Japan: URL: www.nanophoton.jp equipped with an Olympus XLUM Plan FLN 20X/NA= 1.0 objective lens. Spectral data were smoothed, baseline corrected and normalized to the a welldefined intense 1003 cm-1 band (phenylalanine) which is insensitive to changes in conformation or environment. The differentiation process of embryonic stem cells is initiated by the removal of LIF from culture medium. 1, 7 and 17-dayold embryonic stem cells were collected and investigated by Raman spectroscopy. The main differences involve bands which decreased with maturation such as: 784 cm-1 (U, T, C ring br DNA/RNA, O-P-O str); 1177 cm-1 (cytosine, guanine) and 1578 cm-1 (G, A). It was found that with the progress of differentiation the protein content was amplified. The increase of protein to nucleic acid ratio was also previously observed with the progress of the differentiation process. Raman spectroscopy has the potential to distinguish between the Raman signatures of live embryonic stem cells with different degrees of maturation.

Self-spinning nanoparticle laden microdroplets for sensing and energy harvesting.

PubMed

Bhattacharjee, Mitradip; Pasumarthi, Viswanath; Chaudhuri, Joydip; Singh, Amit Kumar; Nemade, Harshal; Bandyopadhyay, Dipankar

2016-03-21

Exposure of a volatile organic vapour could set in powerful rotational motion a microdroplet composed of an aqueous salt solution loaded with metal nanoparticles. The solutal Marangoni motion on the surface originating from the sharp difference in the surface tension of water and organic vapour stimulated the strong vortices inside the droplet. The vapour sources of methanol, ethanol, diethyl ether, toluene, and chloroform stimulated motions of different magnitudes could easily be correlated to the surface tension gradient on the drop surface. Interestingly, when the nanoparticle laden droplet of aqueous salt solution was connected to an external electric circuit through a pair of electrodes, an ∼85-95% reduction in the electrical resistance was observed across the spinning droplet. The extent of reduction in the resistance was found to have a correlation with the difference in the surface tension of the vapour source and the water droplet, which could be employed to distinguish the vapour sources. Remarkably, the power density of the same prototype was estimated to be around 7 μW cm(-2), which indicated the potential of the phenomenon in converting surface energy into electrical in a non-destructive manner and under ambient conditions. Theoretical analysis uncovered that the difference in the ζ-potential near the electrodes was the major reason for the voltage generation. The prototype could also detect the repeated exposure and withdrawal of vapour sources, which helped in the development of a proof-of-concept detector to sense alcohol issuing out of the human breathing system.

Major diffusion leaks of clamp-on leaf cuvettes still unaccounted: how erroneous are the estimates of Farquhar et al. model parameters?

PubMed

Rodeghiero, Mirco; Niinemets, Ulo; Cescatti, Alessandro

2007-08-01

Estimates of leaf gas-exchange characteristics using standard clamp-on leaf chambers are prone to errors because of diffusion leaks. While some consideration has been given to CO(2) diffusion leaks, potential water vapour diffusion leaks through chamber gaskets have been neglected. We estimated diffusion leaks of two clamp-on Li-Cor LI-6400 (Li-Cor, Inc., Lincoln, NE, USA) leaf chambers with polymer foam gaskets and enclosing either 2 or 6 cm(2) leaf area, and conducted a sensitivity analysis of the diffusion leak effects on Farquhar et al. photosynthesis model parameters - the maximum carboxylase activity of ribulose 1 x 5-bisphosphate carboxylase/oxygenase (Rubisco) (V(cmax)), capacity for photosynthetic electron transport (J(max)) and non-photorespiratory respiration rate in light (R(d)). In addition, net assimilation rate (A(n)) versus intercellular CO(2) (C(i)) responses were measured in leaves of Mediterranean evergreen species Quercus ilex L. enclosing the whole leaf chamber in a polyvinyl fluoride bag flushed with the exhaust air of leaf chamber, thereby effectively reducing the CO(2) and water vapour gradients between ambient air and leaf chamber. For the empty chambers, average diffusion leak for CO(2), K(CO2), (molar flow rate corresponding to unit CO(2) mole fraction difference) was ca. 0.40 micromol s(-1). K(CO2) increased ca. 50% if a dead leaf was clamped between the leaf chamber. Average diffusion leak for H(2)O was ca. 5- to 10-fold larger than the diffusion leak for CO(2). Sensitivity analyses demonstrated that the consequence of a CO(2) diffusion leak was apparent enhancement of A(n) at high CO(2) mole fraction and reduction at lower CO(2) mole fraction, and overall compression of C(i) range. As the result of these modifications, Farquhar et al. model parameters were overestimated. The degree of overestimation increased in the order of V(cmax) < J(max) < R(d), and was larger for smaller chambers and for leaves with lower photosynthetic capacity, leading to overestimation of all three parameters by 70-290% for 2 cm(2), and by 10-60% for 6 cm(2) chamber. Significant diffusion corrections (5-36%) were even required for leaves with high photosynthetic capacity measured in largest chamber. Water vapour diffusion leaks further enhanced the overestimation of model parameters. For small chambers and low photosynthetic capacities, apparent C(i) was simulated to decrease with increasing A(n) because of simultaneous CO(2) and H(2)O diffusion leaks. Measurements in low photosynthetic capacity Quercus ilex leaves enclosed in 2 cm(2) leaf chamber exhibited negative apparent C(i) values at highest A(n). For the same leaves measured with the entire leaf chamber enclosed in the polyvinyl fluoride bag, C(i) and A(n) increased monotonically. While the measurements without the bag could be corrected for diffusion leaks, the required correction in A(n) and transpiration rates was 100-500%, and there was large uncertainty in Farquhar et al. model parameters derived from 'corrected'A(n)/C(i) response curves because of uncertainties in true diffusion leaks. These data demonstrate that both CO(2) and water vapour diffusion leaks need consideration in measurements with clamp-on leaf cuvettes. As plants in natural environments are often characterized by low photosynthetic capacities, cuvette designs need to be improved for reliable measurements in such species.

The survival of three strains of Arcobacter butzleri in the presence of lemon, orange and bergamot essential oils and their components in vitro and on food.

PubMed

Fisher, K; Rowe, C; Phillips, C A

2007-05-01

To test the effect of oils and vapours of lemon, sweet orange and bergamot and their components against three Arcobacter butzleri strains. The disc diffusion method was used to screen the oils and vapours against three strains of A. butzleri. In vitro bergamot was the most inhibitory essential oil (EO) and both citral and linalool were effective. On cabbage leaf, the water isolate was the least susceptible to bergamot EO, citral and linalool (1-2 log reduction), with the chicken isolate being the most susceptible (6-8 log reduction). However, the latter appeared not to be susceptible to vapours over 24 h although type strain and water isolate populations reduced by 8 logs. On chicken skin, the effectiveness of the oils was reduced compared with that on cabbage leaf. Bergamot was the most effective of the oils tested and linalool the most effective component. All strains tested were less susceptible in food systems than in vitro. Arcobacter isolates vary in their response to EO suggesting that the results of type strain studies should be interpreted with caution. Bergamot EO has the potential for the inhibition of this 'emerging' pathogen.

Impact of the Bergeron-Findeisen process on the release of aerosol particles during the evolution of cloud ice

NASA Astrophysics Data System (ADS)

Schwarzenböck, A.; Mertes, S.; Heintzenberg, J.; Wobrock, W.; Laj, P.

The paper focuses on the redistribution of aerosol particles (APs) during the artificial nucleation and subsequent growth of ice crystals in a supercooled cloud. A significant number of the supercooled cloud droplets during icing periods (seeding agents: C 3H 8, CO 2) did not freeze as was presumed prior to the experiment but instead evaporated. The net mass flux of water vapour from the evaporating droplets to the nucleating ice crystals (Bergeron-Findeisen mechanism) led to the release of residual particles that simultaneously appeared in the interstitial phase. The strong decrease of the droplet residuals confirms the nucleation of ice particles on seeding germs without natural aerosol particles serving as ice nuclei. As the number of residual particles during the seedings did not drop to zero, other processes such as heterogeneous ice nucleation, spontaneous freezing, entrainment of supercooled droplets and diffusion to the created particle-free ice germs must have contributed to the experimental findings. During the icing periods, residual mass concentrations in the condensed phase dropped by a factor of 1.1-6.7, as compared to the unperturbed supercooled cloud. As the Bergeron-Findeisen process also occurs without artificial seeding in the atmosphere, this study demonstrated that the hydrometeors in mixed-phase clouds might be much cleaner than anticipated for the simple freezing process of supercooled droplets in tropospheric mid latitude clouds.

New method to assess the water vapour permeance of wound coverings.

PubMed

Jonkman, M F; Molenaar, I; Nieuwenhuis, P; Bruin, P; Pennings, A J

1988-05-01

A new method for assessing the permeability to water vapour of wound coverings is presented, using the evaporimeter developed by Nilsson. This new method combines the water vapour transmission rate (WVTR) and the vapour pressure difference across a wound covering in one absolute measure: the water vapour permeance (WVP). The WVP of a wound covering is the steady flow (g) of water vapour per unit (m2) area of surface in unit (h) time induced by unit (kPa) vapour pressure difference, g.m-2.h-1.kPa-1. Since the WVP of a wound covering is a more accurate measure for the permeability than the WVTR is, it facilitates the prediction of the water exchange of a wound covering in clinical situations.

Time-dependent calculations of molten pool formation and thermal plasma with metal vapour in gas tungsten arc welding

NASA Astrophysics Data System (ADS)

Tanaka, M.; Yamamoto, K.; Tashiro, S.; Nakata, K.; Yamamoto, E.; Yamazaki, K.; Suzuki, K.; Murphy, A. B.; Lowke, J. J.

2010-11-01

A gas tungsten arc (GTA) was modelled taking into account the contamination of the plasma by metal vapour from the molten anode. The whole region of GTA atmosphere including the tungsten cathode, the arc plasma and the anode was treated using a unified numerical model. A viscosity approximation was used to express the diffusion coefficient in terms of viscosity of the shielding gas and metal vapour. The transient two-dimensional distributions of temperature, velocity of plasma flow and iron vapour concentration were predicted, together with the molten pool as a function of time for a 150 A arc current at atmospheric pressure, both for helium and argon gases. It was shown that the thermal plasma in the GTA was influenced by iron vapour from the molten pool surface and that the concentration of iron vapour in the plasma was dependent on the temperature of the molten pool. GTA on high sulfur stainless steel was calculated to discuss the differences between a low sulfur and a high sulfur stainless steel anode. Helium was selected as the shielding gas because a helium GTA produces more metal vapour than an argon GTA. In the GTA on a high sulfur stainless steel anode, iron vapour and current path were constricted. Radiative emission density in the GTA on high sulfur stainless steel was also concentrated in the centre area of the arc plasma together with the iron vapour although the temperature distributions were almost the same as that in the case of a low sulfur stainless steel anode.

Intrinsic Hydrophobicity of Rammed Earth

NASA Astrophysics Data System (ADS)

Holub, M.; Stone, C.; Balintova, M.; Grul, R.

2015-11-01

Rammed earth is well known for its vapour diffusion properties, its ability to regulate humidity within the built environment. Rammed earth is also an aesthetically iconic material such as marble or granite and therefore is preferably left exposed. However exposed rammed earth is often coated with silane/siloxane water repellents or the structure is modified architecturally (large roof overhangs) to accommodate for the hydrophilic nature of the material. This paper sets out to find out optimal hydrophobicity for rammed earth based on natural composite fibres and surface coating without adversely affecting the vapour diffusivity of the material. The material is not required to be waterproof, but should resist at least driving rain. In order to evaluate different approaches to increase hydrophobicity of rammed earth surface, peat fibres and four types of repellents were used.

Drop deployment system for crystal growth apparatus

NASA Technical Reports Server (NTRS)

Rhodes, Percy (Inventor); Snyder, Robert S. (Inventor); Pusey, Marc L. (Inventor)

1990-01-01

A crystal growth apparatus is presented. It utilizes a vapor diffusion method for growing protein crystals, and particularly such an apparatus wherein a ball mixer is used to mix the fluids that form a drop within which crystals are grown. Particular novelty of this invention lies in utilizing a ball mixer to completely mix the precipitate and protein solutions prior to forming the drop. Additional novelty lies in details of construction of the vials, the fluid deployment system, and the fluid storage system of the preferred embodiment.

Sensitive determination of mercury by a miniaturized spectrophotometer after in situ single-drop microextraction.

PubMed

Yang, Fangwen; Liu, Rui; Tan, Zhiqiang; Wen, Xiaodong; Zheng, Chengbin; Lv, Yi

2010-11-15

An in situ single-drop microextraction (SDME) method was developed for trace mercury determination by a miniaturized spectrophotometer, in which a simple and cheap light-emitting diode (LED) was employed as the light source, and a handheld charge coupled device (CCD) was served as the detector. A droplet of 0.006% dithizone-CCl(4) (m/v) was used as extraction phase and hanged on a rolled PTFE tube. LED light was adjusted carefully to pass through the centre of the droplet and the entrance slit of the CCD detector. The radiation intensities of 475 nm before and after SDME (I(0) and I(i)) were recorded for quantification. Under the optimum conditions, the system provided a linear range of 2-50 μg L(-1), with a correlation coefficient of 0.9983 and a limit of detection (3σ) of 0.2 μg L(-1). The enrichment factor was about 69. The present method showed the merits of high sensitivity, simplicity, rapidity, low reagent consumption and field analysis potential. Finally, this method was successfully applied for the determination of the total mercury in spiked tap water sample, spiked river water sample and certified reference material (GBW (E) 080393, simulated water). Copyright © 2010 Elsevier B.V. All rights reserved.

Newtonian Analysis of a Folded Chain Drop

ERIC Educational Resources Information Center

Mungan, Carl E.

2018-01-01

Consider a chain of length L that hangs in a U shape with end A fixed to a rigid support and free end E released from rest starting from the same initial height (call it y = 0) as A. Figure 1 sketches the chain after end E has fallen a distance y. Points O and A are assumed to be close enough to each other and the chain flexible enough that the…

Method and apparatus for the production of metal oxide powder

DOEpatents

Harris, Michael T.; Scott, Timothy C.; Byers, Charles H.

1993-01-01

The present invention provides a method for preparing metal oxide powder. A first solution, which is substantially organic, is prepared. A second solution, which is an aqueous solution substantially immiscible in the first solution, is prepared and delivered as drops to the first solution. The drops of the second solution are atomized by a pulsed electric field forming micro-drops of the second solution. Reagents in the first solution diffuse into and react with reactants in the micro-drops of the second solution forming metal hydroxide or oxalate particles. The metal hydroxide or metal oxalate particles are then recovered and dried to produce the metal oxide powder. An apparatus for preparing a metal oxide powder is also disclosed.

Method and apparatus for the production of metal oxide powder

DOEpatents

Harris, Michael T.; Scott, Timothy C.; Byers, Charles H.

1992-01-01

The present invention provides a method for preparing metal oxide powder. A first solution, which is substantially organic, is prepared. A second solution, which is an aqueous solution substantially immiscible in the first solution, is prepared and delivered as drops to the first solution. The drops of the second solution are atomized by a pulsed electric field forming micro-drops of the second solution. Reagents in the first solution diffuse into and react with reactants in the micro-drops of the second solution forming metal hydroxide or oxalate particles. The metal hydroxide or metal oxalate particles are then recovered and dried to produce the metal oxide powder. An apparatus for preparing a metal oxide powder is also disclosed.

Method and apparatus for the production of metal oxide powder

DOEpatents

Harris, M.T.; Scott, T.C.; Byers, C.H.

1992-06-16

The present invention provides a method for preparing metal oxide powder. A first solution, which is substantially organic, is prepared. A second solution, which is an aqueous solution substantially immiscible in the first solution, is prepared and delivered as drops to the first solution. The drops of the second solution are atomized by a pulsed electric field forming micro-drops of the second solution. Reagents in the first solution diffuse into and react with reactants in the micro-drops of the second solution forming metal hydroxide or oxalate particles. The metal hydroxide or metal oxalate particles are then recovered and dried to produce the metal oxide powder. An apparatus for preparing a metal oxide powder is also disclosed. 2 figs.

Reassembly of Anterior Pituitary Organization by Hanging Drop Three-Dimensional Cell Culture

PubMed Central

Tsukada, Takehiro; Kouki, Tom; Fujiwara, Ken; Ramadhani, Dini; Horiguchi, Kotaro; Kikuchi, Motoshi; Yashiro, Takashi

2013-01-01

The anterior pituitary gland comprises 5 types of hormone-producing cells and non-endocrine cells, such as folliculostellate (FS) cells. The cells form a lobular structure surrounded by extracellular matrix (ECM) but are not randomly distributed in each lobule; hormone-producing cells have affinities for specific cell types (topographic affinity), and FS cells form a homotypic meshwork. To determine whether this cell and ECM organization can be reproduced in vitro, we developed a 3-dimensional (3D) model that utilizes hanging drop cell culture. We found that the topographic affinities of hormone-producing cells were indeed maintained (ie, GH to ACTH cells, GH to TSH cells, PRL to LH/FSH cells). Fine structures in hormone-producing cells retained their normal appearance. In addition, FS cells displayed well-developed cytoplasmic protrusions, which interconnected with adjacent FS cells to form a 3D meshwork. In addition, reassembly of gap junctions and pseudofollicles among FS cells was observed in cell aggregates. Major ECM components—collagens and laminin—were deposited and distributed around the cells. In sum, the dissociated anterior pituitary cells largely maintained their in vivo anterior pituitary architectures. This culture system appears to be a powerful experimental tool for detailed analysis of anterior pituitary cell organization. PMID:24023396

Mixture effects of benzene, toluene, ethylbenzene, and xylenes (BTEX) on lung carcinoma cells via a hanging drop air exposure system.

PubMed

Liu, Faye F; Escher, Beate I; Were, Stephen; Duffy, Lesley; Ng, Jack C

2014-06-16

A recently developed hanging drop air exposure system for toxicity studies of volatile chemicals was applied to evaluate the cell viability of lung carcinoma A549 cells after 1 and 24 h of exposure to benzene, toluene, ethylbenzene, and xylenes (BTEX) as individual compounds and as mixtures of four or six components. The cellular chemical concentrations causing 50% reduction of cell viability (EC50) were calculated using a mass balance model and came to 17, 12, 11, 9, 4, and 4 mmol/kg cell dry weight for benzene, toluene, ethylbenzene, m-xylene, o-xylene, and p-xylene, respectively, after 1 h of exposure. The EC50 decreased by a factor of 4 after 24 h of exposure. All mixture effects were best described by the mixture toxicity model of concentration addition, which is valid for chemicals with the same mode of action. Good agreement with the model predictions was found for benzene, toluene, ethylbenzene, and m-xylene at four different representative fixed concentration ratios after 1 h of exposure, but lower agreement with mixture prediction was obtained after 24 h of exposure. A recreated car exhaust mixture, which involved the contribution of the more toxic p-xylene and o-xylene, yielded an acceptable, but lower quality, prediction as well.

Reassembly of anterior pituitary organization by hanging drop three-dimensional cell culture.

PubMed

Tsukada, Takehiro; Kouki, Tom; Fujiwara, Ken; Ramadhani, Dini; Horiguchi, Kotaro; Kikuchi, Motoshi; Yashiro, Takashi

2013-08-29

The anterior pituitary gland comprises 5 types of hormone-producing cells and non-endocrine cells, such as folliculostellate (FS) cells. The cells form a lobular structure surrounded by extracellular matrix (ECM) but are not randomly distributed in each lobule; hormone-producing cells have affinities for specific cell types (topographic affinity), and FS cells form a homotypic meshwork. To determine whether this cell and ECM organization can be reproduced in vitro, we developed a 3-dimensional (3D) model that utilizes hanging drop cell culture. We found that the topographic affinities of hormone-producing cells were indeed maintained (ie, GH to ACTH cells, GH to TSH cells, PRL to LH/FSH cells). Fine structures in hormone-producing cells retained their normal appearance. In addition, FS cells displayed well-developed cytoplasmic protrusions, which interconnected with adjacent FS cells to form a 3D meshwork. In addition, reassembly of gap junctions and pseudofollicles among FS cells was observed in cell aggregates. Major ECM components-collagens and laminin-were deposited and distributed around the cells. In sum, the dissociated anterior pituitary cells largely maintained their in vivo anterior pituitary architectures. This culture system appears to be a powerful experimental tool for detailed analysis of anterior pituitary cell organization.

Linkage between canopy water storage and drop size distributions of leaf drips

NASA Astrophysics Data System (ADS)

Nanko, Kazuki; Watanabe, Ai; Hotta, Norifumi; Suzuki, Masakazu

2013-04-01

Differences in drop size distribution (DSD) of leaf drips among tree species have been estimated and physically interpreted to clarify the leaf drip generation process. Leaf drip generation experiments for nine species were conducted in an indoor location without foliage vibration using an automatic mist spray. Broad-leaved species produced a similar DSD among species whose leaves had a matte surface and a second similar DSD among species whose leaves had a coated surface. The matte broad leaves produced a larger and wider range of DSDs than the coated broad leaves. Coated coniferous needles had a wider range of DSDs than the coated broad leaves and different DSDs were observed for different species. The species with shorter dense needles generated a larger DSD. The leaf drip diameter was calculated through the estimation of a state of equilibrium of a hanging drop on the leaves based on physical theory. The calculations indicated that the maximum diameter of leaf drips was determined by the contact angle, and the range of DSDs was determined by the variation in contact length and the contact diameter at the hanging points. The results revealed that leaf drip DSD changed due to variations in leaf hydrophobicity, leaf roughness, leaf geometry and leaf inclination among the different tree species. This study allows the modelization of throughfall DSD. Furthermore, it indicates the possibility of interpreting canopy water processes from canopy water storage to drainage through the contact angle and leaf drip DSD. The part of this study is published in Nanko et al. (2013, Agric. Forest. Meteorol. 169, 74-84).

Course of Near-hanging Victims Succumbed to Death: A Seven Year Study

PubMed Central

Mugadlimath, Anand B.; Zine, K.U.; Farooqui, Jamebaseer M.; Phalke, Balaji J.

2015-01-01

Introduction: Near hanging refers to victims who survive a hanging injury following attempted hanging, long enough to reach hospital. Delayed deaths in near hanging patients are mostly due to complication of hanging. The purpose of this study was to evaluate the demographics, mortality patterns and cause of delayed deaths in near hanging victims. Materials and Methods: In this study autopsy files over a seven year period from 2007 to 2013 were reviewed, and data of near hanging deaths (attempted hanging cases who succumbed to death and subjected for medicolegal autopsy) was extracted. Records of 14,000 autopsies was reviewed, and 10 deceased having died delayed deaths after near hanging episode were identified. In each case, the patients’ details, including gender, age, type of suspension, type of ligature material used for hanging and subsequent hanging mark produced were reviewed using autopsy reports and photographs taken during autopsy. Results: Demographic and pathological aspects of the each case discussed to throw light on autopsy findings in victims who died following near hanging. Complete suspension was present in 3 cases, while partial suspension was present in 7 cases. Survivals in delayed death after near hanging episode have ranged from 9 h to 72 d. Hypoxic encephalopathy was the most common cause of death, followed by pneumonia. Conclusion: Most of the near hanging patients did succumb to hypoxic encephalopathy; however, consolidation of lungs (pneumonia) was the next common cause of death reflecting need for aggressive oxygen therapy and selective resuscitation should be performed in all such cases. PMID:25954634

Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus

PubMed Central

Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

2014-01-01

Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294 K from a solution consisting of 1.8 M sodium formate, 0.1 M Tris–HCl pH 8.5. The crystals belonged to the tetragonal space group P41212 or P43212, with unit-cell parameters a = 126.6, c = 53.9 Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 1.140 Å. PMID:24419623

Crystallization of Spätzle, a cystine-knot protein involved in embryonic development and innate immunity in Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoffmann, Anita; Neumann, Piotr; Schierhorn, Angelika

2008-08-01

Crystallization of the cystine-knot protein Spätzle occurred following serendipitous limited degradation of the pro-Spätzle propeptide during the crystallization experiment. The Spätzle protein is involved in both the definition of the dorsal–ventral axis during embryonic development and in the adult innate immune response. The disulfide-linked dimeric cystine-knot protein has been expressed as a proprotein in inclusion bodies in Escherichia coli and refolded in vitro by rapid dilution. Initial orthorhombic crystals that diffracted to 7 Å resolution were obtained after three months by the sitting-drop vapour-diffusion method. Optimization of the crystallization conditions resulted in orthorhombic crystals (space group P2{sub 1}2{sub 1}2{sub 1},more » with unit-cell parameters a = 53.0, b = 59.2, c = 62.5 Å) that diffracted to 2.8 Å resolution in-house. The small volume of the asymmetric unit indicated that it was not possible for the crystals to contain the complete pro-Spätzle dimer. Mass spectrometry, N-terminal sequencing and Western-blot analysis revealed that the crystals contained the C-terminal disulfide-linked cystine-knot dimer. Comparison of various crystallization experiments indicated that degradation of the N-terminal prodomain was dependent on the buffer conditions.« less

Cloning, expression, purification, crystallization and X-ray crystallographic analysis of recombinant human C1ORF123 protein.

PubMed

Rahaman, Siti Nurulnabila A; Mat Yusop, Jastina; Mohamed-Hussein, Zeti-Azura; Ho, Kok Lian; Teh, Aik-Hong; Waterman, Jitka; Ng, Chyan Leong

2016-03-01

C1ORF123 is a human hypothetical protein found in open reading frame 123 of chromosome 1. The protein belongs to the DUF866 protein family comprising eukaryote-conserved proteins with unknown function. Recent proteomic and bioinformatic analyses identified the presence of C1ORF123 in brain, frontal cortex and synapses, as well as its involvement in endocrine function and polycystic ovary syndrome (PCOS), indicating the importance of its biological role. In order to provide a better understanding of the biological function of the human C1ORF123 protein, the characterization and analysis of recombinant C1ORF123 (rC1ORF123), including overexpression and purification, verification by mass spectrometry and a Western blot using anti-C1ORF123 antibodies, crystallization and X-ray diffraction analysis of the protein crystals, are reported here. The rC1ORF123 protein was crystallized by the hanging-drop vapor-diffusion method with a reservoir solution comprised of 20% PEG 3350, 0.2 M magnesium chloride hexahydrate, 0.1 M sodium citrate pH 6.5. The crystals diffracted to 1.9 Å resolution and belonged to an orthorhombic space group with unit-cell parameters a = 59.32, b = 65.35, c = 95.05 Å. The calculated Matthews coefficient (VM) value of 2.27 Å(3) Da(-1) suggests that there are two molecules per asymmetric unit, with an estimated solvent content of 45.7%.

Expression, Purification, Crystallization of Two Major Envelope Proteins from White Spot Syndrome Virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang,X.; Hew, C.

2007-01-01

White spot syndrome virus (WSSV) is a major virulent pathogen known to infect penaeid shrimp and other crustaceans. VP26 and VP28, two major envelope proteins from WSSV, have been identified and overexpressed in Escherichia coli. In order to facilitate purification and crystallization, predicted N-terminal transmembrane regions of approximately 35 amino acids have been truncated from both VP26 and VP28. Truncated VP26 and VP28 and their corresponding SeMet-labelled proteins were purified and the SeMet proteins were crystallized by the hanging-drop vapor-diffusion method. Crystals of SeMet-labelled VP26 were obtained using a reservoir consisting of 0.1 M citric acid pH 3.5, 3.0 Mmore » sodium chloride and 1%(w/v) polyethylene glycol 3350, whereas SeMet VP28 was crystallized using a reservoir solution consisting of 25% polyethylene glycol 8000, 0.2 M calcium acetate, 0.1 M Na HEPES pH 7.5 and 1.5%(w/v) 1,2,3-heptanetriol. Crystals of SeMet-labelled VP26 diffract to 2.2 {angstrom} resolution and belong to space group R32, with unit-cell parameters a = b = 73.92, c = 199.31 {angstrom}. SeMet-labelled VP28 crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 105.33, b = 106.71, c = 200.37 {angstrom}, and diffracts to 2.0 {angstrom} resolution.« less

The structure of evaporating and combusting sprays: Measurements and predictions

NASA Technical Reports Server (NTRS)

Shuen, J. S.; Solomon, A. S. P.; Faeth, G. M.

1984-01-01

An apparatus developed, to allow observations of monodisperse sprays, consists of a methane-fueled turbulent jet diffusion flame with monodisperse methanol drops injected at the burner exit. Mean and fluctuating-phase velocities, drop sizes, drop-mass fluxes and mean-gas temperatures were measured. Initial drop diameters of 100 and 180 microns are being considered in order to vary drop penetration in the flow and effects of turbulent dispersion. Baseline tests of the burner flame with no drops present were also conducted. Calibration tests, needed to establish methods for predicting drop transport, involve drops supported in the post-flame region of a flat-flame burner operated at various mixture ratios. Spray models which are being evaluated include: (1) locally homogeneous flow (LFH) analysis, (2) deterministic separated flow (DSF) analysis and (3) stochastic separated flow (SSF) analysis.

EDITORIAL: Humidity sensors Humidity sensors

NASA Astrophysics Data System (ADS)

Regtien, Paul P. L.

2012-01-01

All matter is more or less hygroscopic. The moisture content varies with vapour concentration of the surrounding air and, as a consequence, most material properties change with humidity. Mechanical and thermal properties of many materials, such as the tensile strength of adhesives, stiffness of plastics, stoutness of building and packaging materials or the thermal resistivity of isolation materials, all decrease with increasing environmental humidity or cyclic humidity changes. The presence of water vapour may have a detrimental influence on many electrical constructions and systems exposed to humid air, from high-power systems to microcircuits. Water vapour penetrates through coatings, cable insulations and integrated-circuit packages, exerting a fatal influence on the performance of the enclosed systems. For these and many other applications, knowledge of the relationship between moisture content or humidity and material properties or system behaviour is indispensable. This requires hygrometers for process control or test and calibration chambers with high accuracy in the appropriate temperature and humidity range. Humidity measurement methods can roughly be categorized into four groups: water vapour removal (the mass before and after removal is measured); saturation (the air is brought to saturation and the `effort' to reach that state is measured); humidity-dependent parameters (measurement of properties of humid air with a known relation between a specific property and the vapour content, for instance the refractive index, electromagnetic spectrum and acoustic velocity); and absorption (based on the known relation between characteristic properties of non-hydrophobic materials and the amount of absorbed water from the gas to which these materials are exposed). The many basic principles to measure air humidity are described in, for instance, the extensive compilations by Wexler [1] and Sonntag [2]. Absorption-type hygrometers have small dimensions and can be produced at relatively low cost. Therefore, they find wide use in lots of applications. However, the method requires a material that possesses some conflicting properties: stable and reproducible relations between air humidity, moisture uptake and a specific property (for instance the length of a hair, the electrical impedance of the material), fast absorption and desorption of the water vapour (to obtain a short response time), small hysteresis, wide range of relative humidity (RH) and temperature-independent output (only responsive to RH). For these reasons, much research is done and is still going on to find suitable materials that combine high performance and low price. In this special feature, three of the four papers report on absorption sensors, all with different focus. Aziz et al describe experiments with newly developed materials. The surface structure is extensively studied, in view of its ability to rapidly absorb water vapour and exhibit a reproducible change in the resistance and capacitance of the device. Sanchez et al employ optical fibres coated with a thin moisture-absorbing layer as a sensitive humidity sensor. They have studied various coating materials and investigated the possibility of using changes in optical properties of the fibre (here the lossy mode resonance) due to a change in humidity of the surrounding air. The third paper, by Weremczuk et al, focuses on a cheap fabrication method for absorption-based humidity sensors. The inkjet technology appears to be suitable for mass fabrication of such sensors, which is demonstrated by extensive measurements of the electrical properties (resistance and capacitance) of the absorbing layers. Moreover, they have developed a model that describes the relation between humidity and the electrical parameters of the moisture-sensitive layer. Despite intensive research, absorption sensors still do not meet the requirements for high accuracy applications. The dew-point temperature method is more appropriate, since it uses the accurately known relation between temperature and saturation vapour pressure in air. When an object exposed to humid air is cooled down below the dew-point water vapour condenses as drops on its cold surface. The temperature can be kept exactly at the dew point by controlling the amount of dew (equilibrium between evaporation and condensation). In most dew-point hygrometers dew is detected with optical or capacitive means. In the former the dew drops on a reflective surface (chilled mirror) scatter incident light, and the capacitive method uses the change in capacitance due to the large dielectric constant of liquid water (80) compared to air (1). Kunze et al, in the fourth paper of this special feature, use another property of water to detect dew: the relatively high value of the thermal capacitance of liquid water. In traditional technology this method would not be sensitive enough, but with MEMS technology a sufficient detectivity of dew can be achieved, which is demonstrated in this paper. A control system keeps the temperature of the substrate just at the dew-point temperature, the latter being measured by an on-chip diode. The accuracy achieved is comparable with traditional dew-point hygrometers. These four papers in this issue are nice examples of research leading to significant advances in hygrometry. References [1] Wexler A (ed) 1965 Humidity and Moisture. Vol. I: Principles and Methods of Measuring Humidity in Gases; Vol. II: Applications; Vol. III: Fundamentals and Standards; Vol. IV: Principles and Methods of Measuring Moisture in Liquids and Solids (New York: Reinhold) [2] Sonntag D 1966-1968 Hygrometrie (Berlin: Akademie Verlag)

Etiology and Use of the “Hanging Drop” Technique: A Review

PubMed Central

Todorov, Ludmil; VadeBoncouer, Timothy

2014-01-01

Background. The hanging drop (HD) technique presumably relies on the presence of subatmospheric epidural pressure. It is not clear whether this negative pressure is intrinsic or an artifact and how it is affected by body position. There are few data to indicate how often HD is currently being used. Methods. We identified studies that measured subatmospheric pressures and looked at the effect of the sitting position. We also looked at the technique used for cervical and thoracic epidural anesthesia in the last 10 years. Results. Intrinsic subatmospheric pressures were measured in the thoracic and cervical spine. Three trials studied the effect of body position, indicating a higher incidence of subatmospheric pressures when sitting. The results show lower epidural pressure (−10.7 mmHg) with the sitting position. 28.8% of trials of cervical and thoracic epidural anesthesia that documented the technique used, utilized the HD technique. When adjusting for possible bias, the rate of HD use can be as low as 11.7%. Conclusions. Intrinsic negative pressure might be present in the cervical and thoracic epidural space. This effect is more pronounced when sitting. This position might be preferable when using HD. Future studies are needed to compare it with the loss of resistance technique. PMID:24839558

The rate of collisions due to Brownian or gravitational motion of small drops

NASA Technical Reports Server (NTRS)

Zhang, Xiaoguang; Davis, Robert H.

1991-01-01

Quantitative predictions of the collision rate of two spherical drops undergoing Brownian diffusion or gravitational sedimentation are presented. The diffusion equation for relative Brownian motion of two drops is derived, and the relative motion of pairs of drops in gravitational sedimentation is traced via a trajectory analysis in order to develop theoretical models to determine the collision efficiencies, both with and without interparticle forces applied between the drops. It is concluded that finite collision rates between nondeforming fluid drops are possible for Brownian diffusion or gravitational sedimentation in the absence of attractive forces, in stark contrast to the prediction that lubrication forces prevent rigid spheres from contacting each other unless an attractive force that becomes infinite as the separation approaches zero is applied. Collision rates are shown to increase as the viscosity of the drop-phase decreases. In general, hydrodynamic interactions reduce the collision rates more for gravitational collisions than for Brownian collisions.

Determination of trace and minor elements in alloys by atomic-absorption spectroscopy using an induction-heated graphite-well furnace as atom source-II.

PubMed

Ashy, M A; Headridge, J B; Sowerbutts, A

1974-06-01

Results are presented for the atomic-absorption spectrophotometric determination of zinc in aluminium and aluminium-silicon alloys, and aluminium, antimony and tin in steels, by means of solid samples dropped into an induction-heated graphite-well furnace to produce the atomic vapour.

High-Throughput Platform for Patient-Derived, Small Cell Number, Three-Dimensional Ovarian Cancer Spheroids

DTIC Science & Technology

2014-09-01

these small cell number spheroids show 3-D morphology (Figure 3). We also observed differences in the expression of mesenchymal markers when...Scale bar =100 µm. Figure 3: Small cell number spheroids demonstrate 3-D morphology . 3-D reconstructions of confocal z-stacks are shown for...formation was observed with the addition of MSCs, and subsequent co-culture in hanging drop plates preserved spheroid morphology indicated in the phase

An intercomparison of methods for solving the stochastic collection equation with a focus on cloud radar Doppler spectra in drizzling stratocumulus

NASA Astrophysics Data System (ADS)

Lee, H.; Fridlind, A. M.; Ackerman, A. S.; Kollias, P.

2017-12-01

Cloud radar Doppler spectra provide rich information for evaluating the fidelity of particle size distributions from cloud models. The intrinsic simplifications of bulk microphysics schemes generally preclude the generation of plausible Doppler spectra, unlike bin microphysics schemes, which develop particle size distributions more organically at substantial computational expense. However, bin microphysics schemes face the difficulty of numerical diffusion leading to overly rapid large drop formation, particularly while solving the stochastic collection equation (SCE). Because such numerical diffusion can cause an even greater overestimation of radar reflectivity, an accurate method for solving the SCE is essential for bin microphysics schemes to accurately simulate Doppler spectra. While several methods have been proposed to solve the SCE, here we examine those of Berry and Reinhardt (1974, BR74), Jacobson et al. (1994, J94), and Bott (2000, B00). Using a simple box model to simulate drop size distribution evolution during precipitation formation with a realistic kernel, it is shown that each method yields a converged solution as the resolution of the drop size grid increases. However, the BR74 and B00 methods yield nearly identical size distributions in time, whereas the J94 method produces consistently larger drops throughout the simulation. In contrast to an earlier study, the performance of the B00 method is found to be satisfactory; it converges at relatively low resolution and long time steps, and its computational efficiency is the best among the three methods considered here. Finally, a series of idealized stratocumulus large-eddy simulations are performed using the J94 and B00 methods. The reflectivity size distributions and Doppler spectra obtained from the different SCE solution methods are presented and compared with observations.

Human serum albumin crystals and method of preparation

NASA Technical Reports Server (NTRS)

Carter, Daniel C. (Inventor)

1989-01-01

Human serum albumin (HSA) crystals are provided in the form of tetragonal plates having the space groups P42(sub 1)2, the crystals being grown to sizes in excess of 0.5 mm in two dimensions and a thickness of 0.1 mm. Growth of the crystals is carried out by a hanging drop method wherein a precipitant solution containing polyethylene glycol (PEG) and a phosphate buffer is mixed with an HSA solution, and a droplet of mixed solution is suspended over a well of precipitant solution. Crystals grow to the desired size in 3 to 7 days. Concentration of reagents, pH and other parameters are controlled within prescribed limits. The resulting crystals exhibit a size and quality such as to allow performance of x ray diffraction studies and enable the conduct of drug binding studies as well as genetic engineering studies.

Determination of low solvent concentration by nano-porous silicon photonic sensors using volatile organic compound method.

PubMed

Bui, Huy; Pham, Van Hoi; Pham, Van Dai; Hoang, Thi Hong Cam; Pham, Thanh Binh; Do, Thuy Chi; Ngo, Quang Minh; Nguyen, Thuy Van

2018-05-07

A vast majority of the organic solvents used in industry and laboratories are volatile, hazardous and toxic organic compounds, they are considered as a potent problem for human health and a cause of environmental pollution. Although analytical laboratory methods can determine extremely low solvent concentration, the sensing method with low cost and high sensitivity remains a conundrum. This paper presents and compares three methods (volatile organic compound (VOC), liquid drop and saturated vapour pressure) for determination of organic solvents in liquid environment by using photonic sensor based on nano-porous silicon (pSi) microcavity structures. Among those, the VOC method provides the highest sensitivity at low solvent volume concentrations because it can create a high vapour pressure of the analyte on the sensor surface owing to the capillary deposition of organic solvent into the silicon pores. This VOC method consists of three steps: heating the solution with its particular boiling temperature, controlling the flowing gas through liquid and cooling sensor. It delivers the highest sensitivity of 6.9 nm/% at concentration of 5% and the limit of detection (LOD) of pSi-sensor is 0.014% in case of ethanol in water when using an optical system with a resolution of 0.1 nm. Especially, the VOC method is capable of detecting low volume concentration of methanol in two tested ethanol solutions of 30% (v/v) and 45% (v/v) with the LOD of pSi-sensor up to 0.01% and 0.04%, respectively. This result will help pave a way to control the quality of contaminated liquor beverages.

A simplified counter diffusion method combined with a 1D simulation program for optimizing crystallization conditions.

PubMed

Tanaka, Hiroaki; Inaka, Koji; Sugiyama, Shigeru; Takahashi, Sachiko; Sano, Satoshi; Sato, Masaru; Yoshitomi, Susumu

2004-01-01

We developed a new protein crystallization method has been developed using a simplified counter-diffusion method for optimizing crystallization condition. It is composed of only a single capillary, the gel in the silicon tube and the screw-top test tube, which are readily available in the laboratory. The one capillary can continuously scan a wide range of crystallization conditions (combination of the concentrations of the precipitant and the protein) unless crystallization occurs, which means that it corresponds to many drops in the vapor-diffusion method. The amount of the precipitant and the protein solutions can be much less than in conventional methods. In this study, lysozyme and alpha-amylase were used as model proteins for demonstrating the efficiency of this method. In addition, one-dimensional (1-D) simulations of the crystal growth were performed based on the 1-D diffusion model. The optimized conditions can be applied to the initial crystallization conditions for both other counter-diffusion methods with the Granada Crystallization Box (GCB) and for the vapor-diffusion method after some modification.

Spontaneous jumping, bouncing and trampolining of hydrogel drops on a heated plate.

PubMed

Pham, Jonathan T; Paven, Maxime; Wooh, Sanghyuk; Kajiya, Tadashi; Butt, Hans-Jürgen; Vollmer, Doris

2017-10-13

The contact between liquid drops and hot solid surfaces is of practical importance for industrial processes, such as thermal spraying and spray cooling. The contact and bouncing of solid spheres is also an important event encountered in ball milling, powder processing, and everyday activities, such as ball sports. Using high speed video microscopy, we demonstrate that hydrogel drops, initially at rest on a surface, spontaneously jump upon rapid heating and continue to bounce with increasing amplitudes. Jumping is governed by the surface wettability, surface temperature, hydrogel elasticity, and adhesion. A combination of low-adhesion impact behavior and fast water vapor formation supports continuous bouncing and trampolining. Our results illustrate how the interplay between solid and liquid characteristics of hydrogels results in intriguing dynamics, as reflected by spontaneous jumping, bouncing, trampolining, and extremely short contact times.Drops of liquid on a hot surface can exhibit fascinating behaviour such as the Leidenfrost effect in which drops hover on a vapour layer. Here Pham et al. show that when hydrogel drops are placed on a rapidly heated plate they bounce to increasing heights even if they were initially at rest.

Purification, crystallization and preliminary crystallographic study of a recombinant plant aminoaldehyde dehydrogenase from Pisum sativum

PubMed Central

Tylichová, Martina; Briozzo, Pierre; Kopečný, David; Ferrero, Julien; Moréra, Solange; Joly, Nathalie; Snégaroff, Jacques; Šebela, Marek

2008-01-01

Aminoaldehydes are products of polyamine degradation and are known to be reactive metabolites that are toxic to living cells at high concentrations. These compounds are catabolized by aminoaldehyde dehydrogenases, which are enzymes that contain a nicotinamide adenine dinucleotide coenzyme. Amino­aldehyde dehydrogenase from Pisum sativum was overexpressed in Escherichia coli, purified and crystallized using the hanging-drop method. A complete data set was collected to 2.8 Å resolution at 100 K. Crystals belong to the monoclinic space group P21, with unit-cell parameters a = 86.4, b = 216.6, c = 205.4 Å, β = 98.1°. Molecular replacement was performed and led to the identification of six dimers per asymmetric unit. PMID:18259056

The effects analysis of two neonicotinoid insecticides on in vitro maturation of porcine oocytes using hanging drop monoculture method.

PubMed

Ishikawa, Sadamasa; Hiraga, Kou; Hiradate, Yuuki; Tanemura, Kentaro

2015-06-01

Acetamiprid (ACE) and imidacroprid (IMI) are known neonicotinoid insecticides with strong affinities for the insect-selective nicotinic acetylcholine receptor. These provide insect control by hyperstimulating insect nerves and are used for agricultural pest management. However, it has also been reported that ACE and IMI affect mammalian reproductive function. We determined the effects of ACE and IMI on the in vitro maturation of porcine oocytes. Significant decreases in nuclear maturation rates were observed in the ACE or IMI-exposed groups. Also, in matured oocytes from the ACE or IMI-exposed groups, irregular chromosomes were observed. Our results suggest that ACE and IMI exposure was detrimental to porcine oocytes and the extent of the effects depends on the concentration of exposure.

Cloning, sequencing, purification, and crystal structure of Grenache (Vitis vinifera) polyphenol oxidase.

PubMed

Virador, Victoria M; Reyes Grajeda, Juan P; Blanco-Labra, Alejandro; Mendiola-Olaya, Elizabeth; Smith, Gary M; Moreno, Abel; Whitaker, John R

2010-01-27

The full-length cDNA sequence (P93622_VITVI) of polyphenol oxidase (PPO) cDNA from grape Vitis vinifera L., cv Grenache, was found to encode a translated protein of 607 amino acids with an expected molecular weight of ca. 67 kDa and a predicted pI of 6.83. The translated amino acid sequence was 99%, identical to that of a white grape berry PPO (1) (5 out of 607 amino acid potential sequence differences). The protein was purified from Grenache grape berries by using traditional methods, and it was crystallized with ammonium acetate by the hanging-drop vapor diffusion method. The crystals were orthorhombic, space group C222(1). The structure was obtained at 2.2 A resolution using synchrotron radiation using the 39 kDa isozyme of sweet potato PPO (PDB code: 1BT1 ) as a phase donor. The basic symmetry of the cell parameters (a, b, and c and alpha, beta, and gamma) as well as in the number of asymmetric units in the unit cell of the crystals of PPO, differed between the two proteins. The structures of the two enzymes are quite similar in overall fold, the location of the helix bundles at the core, and the active site in which three histidines bind each of the two catalytic copper ions, and one of the histidines is engaged in a thioether linkage with a cysteine residue. The possibility that the formation of the Cys-His thioether linkage constitutes the activation step is proposed. No evidence of phosphorylation or glycoslyation was found in the electron density map. The mass of the crystallized protein appears to be only 38.4 kDa, and the processing that occurs in the grape berry that leads to this smaller size is discussed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Virador, V.; Reyes Grajeda, J; Blanco-Labra, A

The full-length cDNA sequence (P93622{_}VITVI) of polyphenol oxidase (PPO) cDNA from grape Vitis vinifera L., cv Grenache, was found to encode a translated protein of 607 amino acids with an expected molecular weight of ca. 67 kDa and a predicted pI of 6.83. The translated amino acid sequence was 99%, identical to that of a white grape berry PPO (1) (5 out of 607 amino acid potential sequence differences). The protein was purified from Grenache grape berries by using traditional methods, and it was crystallized with ammonium acetate by the hanging-drop vapor diffusion method. The crystals were orthorhombic, space groupmore » C2221. The structure was obtained at 2.2 {angstrom} resolution using synchrotron radiation using the 39 kDa isozyme of sweet potato PPO (PDB code: 1BT1) as a phase donor. The basic symmetry of the cell parameters (a, b, and c and {alpha}, {beta}, and {gamma}) as well as in the number of asymmetric units in the unit cell of the crystals of PPO, differed between the two proteins. The structures of the two enzymes are quite similar in overall fold, the location of the helix bundles at the core, and the active site in which three histidines bind each of the two catalytic copper ions, and one of the histidines is engaged in a thioether linkage with a cysteine residue. The possibility that the formation of the Cys-His thioether linkage constitutes the activation step is proposed. No evidence of phosphorylation or glycoslyation was found in the electron density map. The mass of the crystallized protein appears to be only 38.4 kDa, and the processing that occurs in the grape berry that leads to this smaller size is discussed.« less

Leidenfrost Point and Estimate of the Vapour Layer Thickness

ERIC Educational Resources Information Center

Gianino, Concetto

2008-01-01

In this article I describe an experiment involving the Leidenfrost phenomenon, which is the long lifetime of a water drop when it is deposited on a metal that is much hotter than the boiling point of water. The experiment was carried out with high-school students. The Leidenfrost point is measured and the heat laws are used to estimate the…

A mechanical-force-driven physical vapour deposition approach to fabricating complex hydride nanostructures.

PubMed

Pang, Yuepeng; Liu, Yongfeng; Gao, Mingxia; Ouyang, Liuzhang; Liu, Jiangwen; Wang, Hui; Zhu, Min; Pan, Hongge

2014-03-24

Nanoscale hydrides desorb and absorb hydrogen at faster rates and lower temperatures than bulk hydrides because of their high surface areas, abundant grain boundaries and short diffusion distances. No current methods exist for the direct fabrication of nanoscale complex hydrides (for example, alanates, borohydrides) with unique morphologies because of their extremely high reducibility, relatively low thermodynamic stability and complicated elemental composition. Here, we demonstrate a mechanical-force-driven physical vapour deposition procedure for preparing nanoscale complex hydrides without scaffolds or supports. Magnesium alanate nanorods measuring 20-40 nm in diameter and lithium borohydride nanobelts measuring 10-40 nm in width are successfully synthesised on the basis of the one-dimensional structure of the corresponding organic coordination polymers. The dehydrogenation kinetics of the magnesium alanate nanorods are improved, and the nanorod morphology persists through the dehydrogenation-hydrogenation process. Our findings may facilitate the fabrication of such hydrides with improved hydrogen storage properties for practical applications.

A mechanical-force-driven physical vapour deposition approach to fabricating complex hydride nanostructures

NASA Astrophysics Data System (ADS)

Pang, Yuepeng; Liu, Yongfeng; Gao, Mingxia; Ouyang, Liuzhang; Liu, Jiangwen; Wang, Hui; Zhu, Min; Pan, Hongge

2014-03-01

Nanoscale hydrides desorb and absorb hydrogen at faster rates and lower temperatures than bulk hydrides because of their high surface areas, abundant grain boundaries and short diffusion distances. No current methods exist for the direct fabrication of nanoscale complex hydrides (for example, alanates, borohydrides) with unique morphologies because of their extremely high reducibility, relatively low thermodynamic stability and complicated elemental composition. Here, we demonstrate a mechanical-force-driven physical vapour deposition procedure for preparing nanoscale complex hydrides without scaffolds or supports. Magnesium alanate nanorods measuring 20-40 nm in diameter and lithium borohydride nanobelts measuring 10-40 nm in width are successfully synthesised on the basis of the one-dimensional structure of the corresponding organic coordination polymers. The dehydrogenation kinetics of the magnesium alanate nanorods are improved, and the nanorod morphology persists through the dehydrogenation-hydrogenation process. Our findings may facilitate the fabrication of such hydrides with improved hydrogen storage properties for practical applications.

An in-vitro evaluation of silicone elastomer latex for topical drug delivery.

PubMed

Li, L C; Vu, N T

1995-06-01

A silicone elastomer latex was evaluated as a topical drug-delivery system. With the addition of a fumed silica and the removal of water, the latex produced elastomeric solid films. The water vapour permeability of the solid film was found to be a function of the film composition. An increase in silica content and the incorporation of a water-soluble component, PEG 3350, rendered the silicone elastomer-free film even more permeable to water vapour. The release of hydrocortisone from the elastomer film can be described by a matrix-diffusion-controlled mechanism. Drug diffusion is thought to occur through the hydrophobic silicone polymer network and the hydrated hydrophilic silica region in the film matrix. Silicone elastomer film with a higher silica content exhibited a faster drug-release rate. The addition of PEG 3350 to the film further enhanced the drug-release rate.

A replacement for methoxyflurane (Metofane) in open-circuit anaesthesia.

PubMed

Itah, Refael; Gitelman, Inna; Davis, Claytus

2004-07-01

Methoxyflurane (Metofane) has been widely used as an open-circuit anaesthetic in small laboratory animals for several decades. Its low vapour pressure and high blood solubility have permitted its use in convenient and simple drop-chamber/nose-cone setups. Recently, following the decision by the primary manufacturer to discontinue production, it has become increasingly difficult to obtain methoxyflurane. We describe here a simple and effective adaptation of isoflurane, an excellent inhalation anaesthetic, to open-circuit drop-chamber/nose-cone anaesthesia. It was found that the vapour concentration of isoflurane could be continuously varied by dissolving the anaesthetic in propylene glycol and that a 20% solution produced effective anaesthesia such that in adult mice, 2 ml of 20% isoflurane in propylene glycol induced anaesthesia within 2 min in a one-litre drop chamber. Furthermore, anaesthesia maintenance with 20% isoflurane was tested in two sets of mice. In one set, surgical plane anaesthesia was maintained for 10 min in a head chamber. After removal of the chamber, the animals awoke within one minute and recovered without any indication of post-anaesthetic distress. The second set contained pregnant mice; here anaesthesia was maintained for between 10 and 12 min, during which laparotomy, exposure of one uterine horn, intrauterine injection and wound closure were completed. The recovery from anaesthesia was also within a minute and with no signs of distress. Healthy litters were delivered after a normal gestation. This isoflurane/propylene glycol procedure is simple, effective and humane, and is a good substitute for methoxyflurane.

Fracture development within a stratovolcano: The Karaha-Telaga Bodas geothermal field, Java volcanic arc

USGS Publications Warehouse

Nemcok, M.; Moore, J.N.; Allis, R.; McCulloch, J.

2004-01-01

Karaha-Telaga Bodas, a vapour-dominated geothermal system located in an active volcano in western Java, is penetrated by more than two dozen deep geothermal wells reaching depths of 3 km. Detailed paragenetic and fluid-inclusion studies from over 1000 natural fractures define the liquid-dominated, transitional and vapour-dominated stages in the evolution of this system. The liquid-dominated stage was initiated by ashallow magma intrusion into the base of the volcanic cone. Lava and pyroclastic flows capped a geothermal system. The uppermost andesite flows were only weakly fractured due to the insulating effect of the intervening altered pyroclastics, which absorbed the deformation. Shear and tensile fractures that developed were filled with carbonates at shallow depths, and by quartz, epidote and actinolite at depths and temperatures over 1 km and 300??C. The system underwent numerous cycles of overpressuring, documented by subhorizontal tensile fractures, anastomosing tensile fracture patterns and implosion breccias. The development of the liquidsystem was interrupted by a catastrophic drop in fluid pressures. As the fluids boiled in response to this pressure drop, chalcedony and quartz were selectively deposited in fractures that had the largest apertures and steep dips. The orientations of these fractures indicate that the escaping overpressured fluids used the shortest possible paths to the surface. Vapour-dominated conditions were initiated at this time within a vertical chimney overlying the still hot intrusion. As pressures declined, these conditions spread outward to form the marginal vapour-dominated region encountered in the drill holes. Downward migration of the chimney, accompanied by growth of the marginal vapour-dominated regime, occurred as the intrusion cooled and the brittle-ductile transition migrated to greater depths. As the liquids boiled off, condensate that formed at the top of the vapour-dominated zone percolated downward and low-salinity meteoric water entered the marginal parts of the system. Calcite, anhydrite and fluorite precipitated in fractures on heating. Progressive sealing of the fractures resulted in the downward migration of the cap rock. In response to decreased pore pressure in the expanding vapour zone, walls of the fracture system within the vapour-dominated reservoir progressively collapsed. It left only residual permeability in the remaining fracture volume, with apertures supported only by asperities or propping breccia. In places where normal stresses acting on the fracture walls exceeded the compressive strength of the wall rock, the fractures have completely collapsed. Fractures within the present-day cap rock include strike- and oblique-slip faults, normal faults and tensile fractures, all controlled by a strike-slip stress regime. The reservoir is characterized by normal faults and tensile fractures controlled by a normal-fault stress regime. The fractures show no evidence that the orientation of the stress field has changed since fracture propagation began. Fluid migration in the lava and pyroclastic flows is controlled by fractures. Matrix permeability controls fluid flow in the sedimentary sections of the reservoir. Productive fractures are typically roughly perpendicular to the minimum compressive stress, ??3, and are prone to slip and dilation within the modern stress regime. ?? The Geological Society of London 2004.

D.R.O.P: The Durable Reconnaissance and Observation Platform

NASA Technical Reports Server (NTRS)

McKenzie, Clifford; Parness, Aaron

2011-01-01

Robots can provide a remote presence in areas that are either inaccessible or too dangerous for humans. However, robots are often limited by their ability to adapt to the terrain or resist environmental factors. The Durable Reconnaissance and Observation Platform (DROP) is a lightweight robot that addresses these challenges with the capability to survive falls from significant heights, carry a useable payload, and traverse a variety of surfaces, including climbing vertical surfaces like wood, stone, and concrete. DROP is manufactured using a combination of rapid prototyping and shape deposition manufacturing. It uses microspine technology to create a new wheel-like design for vertical climbing. To date, DROP has successfully engaged several vertical surfaces, hanging statically without assistance, and traversed horizontal surfaces at approximately 30 cm/s. Unassisted vertical climbing is capable on surfaces up to 85deg at a rate of approximately 25cm*s(sup -1). DROP can also survive falls from up to 3 meters and has the ability to be thrown off of and onto rooftops. Future efforts will focus on improving the microspine wheels, selecting more resilient materials, customizing the controls, and performing more rigorous and quantifiable testing.

A modified method for diffusive monitoring of 3-ethenylpyridine as a specific marker of environmental tobacco smoke

NASA Astrophysics Data System (ADS)

Kuusimäki, Leea; Peltonen, Kimmo; Vainiotalo, Sinikka

A previously introduced method for monitoring environmental tobacco smoke (ETS) was further validated. The method is based on diffusive sampling of a vapour-phase marker, 3-ethenylpyridine (3-EP), with 3 M passive monitors (type 3500). Experiments were done in a dynamic chamber to assess diffusive sampling in comparison with active sampling in charcoal tubes or XAD-4 tubes. The sampling rate for 3-EP collected on the diffusive sampler was 23.1±0.6 mL min -1. The relative standard deviation for parallel samples ( n=6) ranged from 4% to 14% among experiments ( n=9). No marked reverse diffusion of 3-EP was detected nor any significant effect of relative humidity at 20%, 50% or 80%. The diffusive sampling of 3-EP was validated in field measurements in 15 restaurants in comparison with 3-EP and nicotine measurements using active sampling. The 3-EP concentration in restaurants ranged from 0.01 to 9.8 μg m -3, and the uptake rate for 3-EP based on 92 parallel samples was 24.0±0.4 mL min -1. A linear correlation ( r=0.98) was observed between 3-EP and nicotine concentrations, the average ratio of 3-EP to nicotine being 1:8. Active sampling of 3-EP and nicotine in charcoal tubes provided more reliable results than sampling in XAD-4 tubes. All samples were analysed using gas chromatography-mass spectrometry after elution with a 15% solution of pyridine in toluene. For nicotine, the limit of quantification of the charcoal tube method was 4 ng per sample, corresponding to 0.04 μg m -3 for an air sample of 96 L. For 3-EP, the limit of quantification of the diffusive method was 0.5-1.0 ng per sample, corresponding to 0.04-0.09 μg m -3 for 8 h sampling. The diffusive method proved suitable for ETS monitoring, even at low levels of ETS.

3-D simulation of hanging wall effect at dam site

NASA Astrophysics Data System (ADS)

Zhang, L.; Xu, Y.

2017-12-01

Hanging wall effect is one of the near fault effects. This paper focuses on the difference of the ground motions on the hanging wall side between the footwall side of the fault at dam site considering the key factors, such as actual topography, the rupture process. For this purpose, 3-D ground motions are numerically simulated by the spectrum element method (SEM), which takes into account the physical mechanism of generation and propagation of seismic waves. With the SEM model of 548 million DOFs, excitation and propagation of seismic waves are simulated to compare the difference between the ground motion on the hanging wall side and that on the footwall side. Take Dagangshan region located in China as an example, several seismogenic finite faults with different dip angle are simulated to investigate the hanging wall effect. Furthermore, by comparing the ground motions of the receiving points, the influence of several factors on hanging wall effect is investigated, such as the dip of the fault and the fault type (strike slip fault or dip-slip fault). The peak acceleration on the hanging wall side is obviously larger than those on the footwall side, which numerically evidences the hanging wall effect. Besides, the simulation shows that only when the dip is less than 70° does the hanging wall effect deserve attention.

Heat and mass transfer in flames

NASA Technical Reports Server (NTRS)

Faeth, G. M.

1986-01-01

Heat- and mass-transfer processes in turbulent diffusion flames are discussed, considering turbulent mixing and the structure of single-phase flames, drop processes in spray flames, and nonluminous and luminous flame radiation. Interactions between turbulence and other phenomena are emphasized, concentrating on past work of the author and his associates. The conserved-scalar formalism, along with the laminar-flamelet approximation, is shown to provide reasonable estimates of the structure of gas flames, with modest levels of empiricism. Extending this approach to spray flames has highlighted the importance of drop/turbulence interactions; e.g., turbulent dispersion of drops, modification of turbulence by drops, etc. Stochastic methods being developed to treat these phenomena are yielding encouraging results.

Crystallization and preliminary X-ray diffraction studies of the cysteine protease ervatamin A from Ervatamia coronaria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Sibani; Biswas, Sampa; Chakrabarti, Chandana

2005-06-01

Ervatamin A is a papain-family cysteine protease with high activity and stability. It has been isolated and purified from the latex of the medicinal flowering plant E. coronaria and crystallized by the vapour-diffusion technique. Crystals diffracted to 2.1 Å and the structure was solved by molecular replacement. The ervatamins are highly stable cysteine proteases that are present in the latex of the medicinal plant Ervatamia coronaria and belong to the papain family, members of which share similar amino-acid sequences and also a similar fold comprising two domains. Ervatamin A from this family, a highly active protease compared with others frommore » the same source, has been purified to homogeneity by ion-exchange chromatography and crystallized by the vapour-diffusion method. Needle-shaped crystals of ervatamin A diffract to 2.1 Å resolution and belong to space group C222{sub 1}, with unit-cell parameters a = 31.10, b = 144.17, c = 108.61 Å. The solvent content using an ervatamin A molecular weight of 27.6 kDa is 43.9%, with a V{sub M} value of 2.19 Å{sup 3} Da{sup −1} assuming one protein molecule in the asymmetric unit. A molecular-replacement solution has been found using the structure of ervatamin C as a search model.« less

STUDIES UPON THE EFFECT OF LIGHT ON BLOOD AND TISSUE CELLS

PubMed Central

Earle, W. R.

1928-01-01

1. An extreme and rapid degeneration which occurred in tissue cultures of leucocytes from the blood of cats, guinea pigs, and rabbits, is described in detail. 2. This degeneration was found to appear in the culture when the cells were planted in any of the culture media tried, some of which were autogenous heparin plasma, autogenous plasma, autogenous serum, Tyrode solution, and mixtures of these with embryo juice. 3. The specific cellular changes which occurred are described for the different leucocytes. In general, there was first a latent period during which no change could be observed in the cell. Following this there was a period of stimulation during which the motion of the cell was greatly accelerated. This second stage has been observed in all cells except the lymphocyte, in which it may possibly occur to a slight degree. Finally there was the terminal stage, the stage of degeneration, in which the cell rounded up, lost its motility, and either became badly swollen or else underwent a more or less complete coagulation. 4. The factor causing this degeneration was found to be exposure of the culture to light, as, for example, during microscopic examination. 5. By a reduction of the infrared part of the spectrum, it was indicated that the effect was not due to a heat coagulation of the cells. 6. This degeneration was also found to occur in the complete absence of ultra-violet wave-lengths. 7. Further, it was shown that this degeneration was caused by light which lay within each of the three wave-length zones (1) 430µµ to 550µµ; infra-red; (2) 475µµ to 630µµ; 690µµ to infra-red; (3) 600µµ to infra-red. 8. No indication was given as to whether all regions of these zones were active in causing the degeneration, or whether the active rays are limited to certain wave-length bands lying within these zones. 9. This degeneration of the leucocytes under the action of light was also found to occur upon irradiation of hanging drops of whole blood. This is interpreted as showing conclusively that the degeneration was not dependent upon the additional factors of centrifugation, continued lowering of temperature, or the presence of abnormal saline solution. 10. It was noted, however, that the leucocytes in hanging drop cultures required a markedly longer time for their degeneration under the action of light than did the leucocytes in cultures prepared from the buffy coat and inoculated in serum. This is considered as possibly due, either to injury to the cell during centrifugation and subsequent handling, or to some action of the red blood cells present in large amounts in the hanging drops of whole blood. 11. In these hanging drop cultures of whole blood degeneration of the leucocytes was also found to occur when the light reaching the culture was first freed from the larger part of its infra-red and from all of its ultra-violet. 12. It was also shown that the same degeneration was produced by wave-lengths of light lying within each of the three wave-length zones defined in Section 6 of this summary. PMID:19869498

Gender differences in suicide methods.

PubMed

Callanan, Valerie J; Davis, Mark S

2012-06-01

Gender differences in suicide completion rates have been attributed to the differences in lethality of suicide methods chosen by men and women, but few empirical studies have investigated factors other than demographic characteristics that might explain this differential. Data from the 621 suicides in Summit County, Ohio during 1997-2006 were disaggregated by gender to compare known correlates of suicide risk on three methods of suicide-firearm, hanging and drug poisoning. Compared to women, men who completed suicide with firearms were more likely to be married and committed the act at home. Unmarried men were likelier to hang themselves than married men, but unmarried women were less likely to hang themselves than married women. Men with a history of depression were more likely to suicide by hanging, but women with depression were half as likely to hang themselves compared to the women without a history of depression. Men with a history of substance abuse were more likely to suicide by poisoning than men without such history, but substance abuse history had no influence on women's use of poisoning to suicide. For both sexes, the odds of suicide by poisoning were significantly higher for those on psychiatric medications.

Purification, crystallization and characterization of the Pseudomonas outer membrane protein FapF, a functional amyloid transporter.

PubMed

Rouse, Sarah L; Hawthorne, Wlliam J; Lambert, Sebastian; Morgan, Marc L; Hare, Stephen A; Matthews, Stephen

2016-12-01

Bacteria often produce extracellular amyloid fibres via a multi-component secretion system. Aggregation-prone, unstructured subunits cross the periplasm and are secreted through the outer membrane, after which they self-assemble. Here, significant progress is presented towards solving the high-resolution crystal structure of the novel amyloid transporter FapF from Pseudomonas, which facilitates the secretion of the amyloid-forming polypeptide FapC across the bacterial outer membrane. This represents the first step towards obtaining structural insight into the products of the Pseudomonas fap operon. Initial attempts at crystallizing full-length and N-terminally truncated constructs by refolding techniques were not successful; however, after preparing FapF 106-430 from the membrane fraction, reproducible crystals were obtained using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.5 Å resolution. These crystals belonged to the monoclinic space group C121, with unit-cell parameters a = 143.4, b = 124.6, c = 80.4 Å, α = γ = 90, β = 96.32° and three monomers in the asymmetric unit. It was found that the switch to complete detergent exchange into C8E4 was crucial for forming well diffracting crystals, and it is suggested that this combined with limited proteolysis is a potentially useful protocol for membrane β-barrel protein crystallography. The three-dimensional structure of FapF will provide invaluable information on the mechanistic differences of biogenesis between the curli and Fap functional amyloid systems.

Optimization of crystals from nanodrops: crystallization and preliminary crystallographic study of a pheromone-binding protein from the honeybee Apis mellifera L.

PubMed

Lartigue, Audrey; Gruez, Arnaud; Briand, Loïc; Pernollet, Jean-Claude; Spinelli, Silvia; Tegoni, Mariella; Cambillau, Christian

2003-05-01

Pheromone-binding proteins (PBPs) are small helical proteins ( approximately 13-17 kDa) present in various sensory organs from moths and other insect species. They are involved in the transport of pheromones from the sensillar lymph to the olfactory receptors. Here, crystals of a PBP (Amel-ASP1) originating from honeybee (Apis mellifera L.) antennae and expressed as recombinant protein using the yeast Pichia pastoris are reported. Crystals of Amel-ASP1 have been obtained by the sitting-drop vapour-diffusion method using a nanodrop-dispensing robot under the following conditions: 200 nl of 40 mg ml(-1) protein solution in 10 mM Tris, 25 mM NaCl pH 8.0 was mixed with 100 nl of well solution containing 0.15 M sodium citrate, 1.5 M ammonium sulfate pH 5.5. The protein crystallizes in space group C222(1), with unit-cell parameters a = 74.8, b = 85.8, c = 50.2 A. With one molecule in the asymmetric unit, V(M) is 3.05 A(3) Da(-1) and the solvent content is 60%. A complete data set has been collected at 1.6 A resolution on beamline ID14-2 (ESRF, Grenoble). The nanodrop crystallization technique used with a novel optimization procedure made it possible to consume small amounts of protein and to obtain a unique crystal per nanodrop, suitable directly for data collection in-house or at a synchrotron-radiation source.