Sample records for haplotype association mapping

  1. iXora: exact haplotype inferencing and trait association.

    PubMed

    Utro, Filippo; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar E; Royaert, Stefan; Schnell, Raymond J; Motamayor, Juan Carlos; Kuhn, David N; Parida, Laxmi

    2013-06-06

    We address the task of extracting accurate haplotypes from genotype data of individuals of large F1 populations for mapping studies. While methods for inferring parental haplotype assignments on large F1 populations exist in theory, these approaches do not work in practice at high levels of accuracy. We have designed iXora (Identifying crossovers and recombining alleles), a robust method for extracting reliable haplotypes of a mapping population, as well as parental haplotypes, that runs in linear time. Each allele in the progeny is assigned not just to a parent, but more precisely to a haplotype inherited from the parent. iXora shows an improvement of at least 15% in accuracy over similar systems in literature. Furthermore, iXora provides an easy-to-use, comprehensive environment for association studies and hypothesis checking in populations of related individuals. iXora provides detailed resolution in parental inheritance, along with the capability of handling very large populations, which allows for accurate haplotype extraction and trait association. iXora is available for non-commercial use from http://researcher.ibm.com/project/3430.

  2. [Construction of haplotype and haplotype block based on tag single nucleotide polymorphisms and their applications in association studies].

    PubMed

    Gu, Ming-liang; Chu, Jia-you

    2007-12-01

    Human genome has structures of haplotype and haplotype block which provide valuable information on human evolutionary history and may lead to the development of more efficient strategies to identify genetic variants that increase susceptibility to complex diseases. Haplotype block can be divided into discrete blocks of limited haplotype diversity. In each block, a small fraction of ptag SNPsq can be used to distinguish a large fraction of the haplotypes. These tag SNPs can be potentially useful for construction of haplotype and haplotype block, and association studies in complex diseases. There are two general classes of methods to construct haplotype and haplotype blocks based on genotypes on large pedigrees and statistical algorithms respectively. The author evaluate several construction methods to assess the power of different association tests with a variety of disease models and block-partitioning criteria. The advantages, limitations and applications of each method and the application in the association studies are discussed equitably. With the completion of the HapMap and development of statistical algorithms for addressing haplotype reconstruction, ideas of construction of haplotype based on combination of mathematics, physics, and computer science etc will have profound impacts on population genetics, location and cloning for susceptible genes in complex diseases, and related domain with life science etc.

  3. Detecting local haplotype sharing and haplotype association

    USDA-ARS?s Scientific Manuscript database

    A novel haplotype association method is presented, and its power is demonstrated. Relying on a statistical model for linkage disequilibrium (LD), the method first infers ancestral haplotypes and their loadings at each marker for each individual. The loadings are then used to quantify local haplotype...

  4. Single Marker and Haplotype-Based Association Analysis of Semolina and Pasta Colour in Elite Durum Wheat Breeding Lines Using a High-Density Consensus Map.

    PubMed

    N'Diaye, Amidou; Haile, Jemanesh K; Cory, Aron T; Clarke, Fran R; Clarke, John M; Knox, Ron E; Pozniak, Curtis J

    2017-01-01

    Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype

  5. Single Marker and Haplotype-Based Association Analysis of Semolina and Pasta Colour in Elite Durum Wheat Breeding Lines Using a High-Density Consensus Map

    PubMed Central

    Haile, Jemanesh K.; Cory, Aron T.; Clarke, Fran R.; Clarke, John M.; Knox, Ron E.; Pozniak, Curtis J.

    2017-01-01

    Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype

  6. Strain screen and haplotype association mapping of wheel running in inbred mouse strains.

    PubMed

    Lightfoot, J Timothy; Leamy, Larry; Pomp, Daniel; Turner, Michael J; Fodor, Anthony A; Knab, Amy; Bowen, Robert S; Ferguson, David; Moore-Harrison, Trudy; Hamilton, Alicia

    2010-09-01

    Previous genetic association studies of physical activity, in both animal and human models, have been limited in number of subjects and genetically homozygous strains used as well as number of genomic markers available for analysis. Expansion of the available mouse physical activity strain screens and the recently published dense single-nucleotide polymorphism (SNP) map of the mouse genome (approximately 8.3 million SNPs) and associated statistical methods allowed us to construct a more generalizable map of the quantitative trait loci (QTL) associated with physical activity. Specifically, we measured wheel running activity in male and female mice (average age 9 wk) in 41 inbred strains and used activity data from 38 of these strains in a haplotype association mapping analysis to determine QTL associated with activity. As seen previously, there was a large range of activity patterns among the strains, with the highest and lowest strains differing significantly in daily distance run (27.4-fold), duration of activity (23.6-fold), and speed (2.9-fold). On a daily basis, female mice ran further (24%), longer (13%), and faster (11%). Twelve QTL were identified, with three (on Chr. 12, 18, and 19) in both male and female mice, five specific to males, and four specific to females. Eight of the 12 QTL, including the 3 general QTL found for both sexes, fell into intergenic areas. The results of this study further support the findings of a moderate to high heritability of physical activity and add general genomic areas applicable to a large number of mouse strains that can be further mined for candidate genes associated with regulation of physical activity. Additionally, results suggest that potential genetic mechanisms arising from traditional noncoding regions of the genome may be involved in regulation of physical activity.

  7. Computational intelligence in bioinformatics: SNP/haplotype data in genetic association study for common diseases.

    PubMed

    Kelemen, Arpad; Vasilakos, Athanasios V; Liang, Yulan

    2009-09-01

    Comprehensive evaluation of common genetic variations through association of single-nucleotide polymorphism (SNP) structure with common complex disease in the genome-wide scale is currently a hot area in human genome research due to the recent development of the Human Genome Project and HapMap Project. Computational science, which includes computational intelligence (CI), has recently become the third method of scientific enquiry besides theory and experimentation. There have been fast growing interests in developing and applying CI in disease mapping using SNP and haplotype data. Some of the recent studies have demonstrated the promise and importance of CI for common complex diseases in genomic association study using SNP/haplotype data, especially for tackling challenges, such as gene-gene and gene-environment interactions, and the notorious "curse of dimensionality" problem. This review provides coverage of recent developments of CI approaches for complex diseases in genetic association study with SNP/haplotype data.

  8. Haplotype-based approach to known MS-associated regions increases the amount of explained risk

    PubMed Central

    Khankhanian, Pouya; Gourraud, Pierre-Antoine; Lizee, Antoine; Goodin, Douglas S

    2015-01-01

    Genome-wide association studies (GWAS), using single nucleotide polymorphisms (SNPs), have yielded 110 non-human leucocyte antigen genomic regions that are associated with multiple sclerosis (MS). Despite this large number of associations, however, only 28% of MS-heritability can currently be explained. Here we compare the use of multi-SNP-haplotypes to the use of single-SNPs as alternative methods to describe MS genetic risk. SNP-haplotypes (of various lengths from 1 up to 15 contiguous SNPs) were constructed at each of the 110 previously identified, MS-associated, genomic regions. Even after correcting for the larger number of statistical comparisons made when using the haplotype-method, in 32 of the regions, the SNP-haplotype based model was markedly more significant than the single-SNP based model. By contrast, in no region was the single-SNP based model similarly more significant than the SNP-haplotype based model. Moreover, when we included the 932 MS-associated SNP-haplotypes (that we identified from 102 regions) as independent variables into a logistic linear model, the amount of MS-heritability, as assessed by Nagelkerke's R-squared, was 38%, which was considerably better than 29%, which was obtained by using only single-SNPs. This study demonstrates that SNP-haplotypes can be used to fine-map the genetic associations within regions of interest previously identified by single-SNP GWAS. Moreover, the amount of the MS genetic risk explained by the SNP-haplotype associations in the 110 MS-associated genomic regions was considerably greater when using SNP-haplotypes than when using single-SNPs. Also, the use of SNP-haplotypes can lead to the discovery of new regions of interest, which have not been identified by a single-SNP GWAS. PMID:26185143

  9. HAPRAP: a haplotype-based iterative method for statistical fine mapping using GWAS summary statistics.

    PubMed

    Zheng, Jie; Rodriguez, Santiago; Laurin, Charles; Baird, Denis; Trela-Larsen, Lea; Erzurumluoglu, Mesut A; Zheng, Yi; White, Jon; Giambartolomei, Claudia; Zabaneh, Delilah; Morris, Richard; Kumari, Meena; Casas, Juan P; Hingorani, Aroon D; Evans, David M; Gaunt, Tom R; Day, Ian N M

    2017-01-01

    Fine mapping is a widely used approach for identifying the causal variant(s) at disease-associated loci. Standard methods (e.g. multiple regression) require individual level genotypes. Recent fine mapping methods using summary-level data require the pairwise correlation coefficients ([Formula: see text]) of the variants. However, haplotypes rather than pairwise [Formula: see text], are the true biological representation of linkage disequilibrium (LD) among multiple loci. In this article, we present an empirical iterative method, HAPlotype Regional Association analysis Program (HAPRAP), that enables fine mapping using summary statistics and haplotype information from an individual-level reference panel. Simulations with individual-level genotypes show that the results of HAPRAP and multiple regression are highly consistent. In simulation with summary-level data, we demonstrate that HAPRAP is less sensitive to poor LD estimates. In a parametric simulation using Genetic Investigation of ANthropometric Traits height data, HAPRAP performs well with a small training sample size (N < 2000) while other methods become suboptimal. Moreover, HAPRAP's performance is not affected substantially by single nucleotide polymorphisms (SNPs) with low minor allele frequencies. We applied the method to existing quantitative trait and binary outcome meta-analyses (human height, QTc interval and gallbladder disease); all previous reported association signals were replicated and two additional variants were independently associated with human height. Due to the growing availability of summary level data, the value of HAPRAP is likely to increase markedly for future analyses (e.g. functional prediction and identification of instruments for Mendelian randomization). The HAPRAP package and documentation are available at http://apps.biocompute.org.uk/haprap/ CONTACT: : jie.zheng@bristol.ac.uk or tom.gaunt@bristol.ac.ukSupplementary information: Supplementary data are available at

  10. Ancestral haplotype-based association mapping with generalized linear mixed models accounting for stratification.

    PubMed

    Zhang, Z; Guillaume, F; Sartelet, A; Charlier, C; Georges, M; Farnir, F; Druet, T

    2012-10-01

    In many situations, genome-wide association studies are performed in populations presenting stratification. Mixed models including a kinship matrix accounting for genetic relatedness among individuals have been shown to correct for population and/or family structure. Here we extend this methodology to generalized linear mixed models which properly model data under various distributions. In addition we perform association with ancestral haplotypes inferred using a hidden Markov model. The method was shown to properly account for stratification under various simulated scenari presenting population and/or family structure. Use of ancestral haplotypes resulted in higher power than SNPs on simulated datasets. Application to real data demonstrates the usefulness of the developed model. Full analysis of a dataset with 4600 individuals and 500 000 SNPs was performed in 2 h 36 min and required 2.28 Gb of RAM. The software GLASCOW can be freely downloaded from www.giga.ulg.ac.be/jcms/prod_381171/software. francois.guillaume@jouy.inra.fr Supplementary data are available at Bioinformatics online.

  11. The effect of missing data on linkage disequilibrium mapping and haplotype association analysis in the GAW14 simulated datasets

    PubMed Central

    McCaskie, Pamela A; Carter, Kim W; McCaskie, Simon R; Palmer, Lyle J

    2005-01-01

    We used our newly developed linkage disequilibrium (LD) plotting software, JLIN, to plot linkage disequilibrium between pairs of single-nucleotide polymorphisms (SNPs) for three chromosomes of the Genetic Analysis Workshop 14 Aipotu simulated population to assess the effect of missing data on LD calculations. Our haplotype analysis program, SIMHAP, was used to assess the effect of missing data on haplotype-phenotype association. Genotype data was removed at random, at levels of 1%, 5%, and 10%, and the LD calculations and haplotype association results for these levels of missingness were compared to those for the complete dataset. It was concluded that ignoring individuals with missing data substantially affects the number of regions of LD detected which, in turn, could affect tagging SNPs chosen to generate haplotypes. PMID:16451612

  12. Haplotyping for disease association: a combinatorial approach.

    PubMed

    Lancia, Giuseppe; Ravi, R; Rizzi, Romeo

    2008-01-01

    We consider a combinatorial problem derived from haplotyping a population with respect to a genetic disease, either recessive or dominant. Given a set of individuals, partitioned into healthy and diseased, and the corresponding sets of genotypes, we want to infer "bad'' and "good'' haplotypes to account for these genotypes and for the disease. Assume e.g. the disease is recessive. Then, the resolving haplotypes must consist of bad and good haplotypes, so that (i) each genotype belonging to a diseased individual is explained by a pair of bad haplotypes and (ii) each genotype belonging to a healthy individual is explained by a pair of haplotypes of which at least one is good. We prove that the associated decision problem is NP-complete. However, we also prove that there is a simple solution, provided the data satisfy a very weak requirement.

  13. Haplotype-Based Association Analysis via Variance-Components Score Test

    PubMed Central

    Tzeng, Jung-Ying ; Zhang, Daowen 

    2007-01-01

    Haplotypes provide a more informative format of polymorphisms for genetic association analysis than do individual single-nucleotide polymorphisms. However, the practical efficacy of haplotype-based association analysis is challenged by a trade-off between the benefits of modeling abundant variation and the cost of the extra degrees of freedom. To reduce the degrees of freedom, several strategies have been considered in the literature. They include (1) clustering evolutionarily close haplotypes, (2) modeling the level of haplotype sharing, and (3) smoothing haplotype effects by introducing a correlation structure for haplotype effects and studying the variance components (VC) for association. Although the first two strategies enjoy a fair extent of power gain, empirical evidence showed that VC methods may exhibit only similar or less power than the standard haplotype regression method, even in cases of many haplotypes. In this study, we report possible reasons that cause the underpowered phenomenon and show how the power of the VC strategy can be improved. We construct a score test based on the restricted maximum likelihood or the marginal likelihood function of the VC and identify its nontypical limiting distribution. Through simulation, we demonstrate the validity of the test and investigate the power performance of the VC approach and that of the standard haplotype regression approach. With suitable choices for the correlation structure, the proposed method can be directly applied to unphased genotypic data. Our method is applicable to a wide-ranging class of models and is computationally efficient and easy to implement. The broad coverage and the fast and easy implementation of this method make the VC strategy an effective tool for haplotype analysis, even in modern genomewide association studies. PMID:17924336

  14. Construction of the third-generation Zea mays haplotype map.

    PubMed

    Bukowski, Robert; Guo, Xiaosen; Lu, Yanli; Zou, Cheng; He, Bing; Rong, Zhengqin; Wang, Bo; Xu, Dawen; Yang, Bicheng; Xie, Chuanxiao; Fan, Longjiang; Gao, Shibin; Xu, Xun; Zhang, Gengyun; Li, Yingrui; Jiao, Yinping; Doebley, John F; Ross-Ibarra, Jeffrey; Lorant, Anne; Buffalo, Vince; Romay, M Cinta; Buckler, Edward S; Ware, Doreen; Lai, Jinsheng; Sun, Qi; Xu, Yunbi

    2018-04-01

    Characterization of genetic variations in maize has been challenging, mainly due to deterioration of collinearity between individual genomes in the species. An international consortium of maize research groups combined resources to develop the maize haplotype version 3 (HapMap 3), built from whole-genome sequencing data from 1218 maize lines, covering predomestication and domesticated Zea mays varieties across the world. A new computational pipeline was set up to process more than 12 trillion bp of sequencing data, and a set of population genetics filters was applied to identify more than 83 million variant sites. We identified polymorphisms in regions where collinearity is largely preserved in the maize species. However, the fact that the B73 genome used as the reference only represents a fraction of all haplotypes is still an important limiting factor.

  15. Cassava haplotype map highlights fixation of deleterious mutations during clonal propagation

    USDA-ARS?s Scientific Manuscript database

    Cassava (Manihot esculenta Crantz) is an important staple food crop in Africa and South America whose fitness may be severely reduced by ubiquitous deleterious variation. To evaluate these deleterious mutations in cassava genome, we constructed a cassava haplotype map by deep sequencing of 241 diver...

  16. Construction of the third-generation Zea mays haplotype map

    PubMed Central

    Bukowski, Robert; Guo, Xiaosen; Lu, Yanli; Zou, Cheng; He, Bing; Rong, Zhengqin; Wang, Bo; Xu, Dawen; Yang, Bicheng; Xie, Chuanxiao; Fan, Longjiang; Gao, Shibin; Xu, Xun; Zhang, Gengyun; Li, Yingrui; Jiao, Yinping; Doebley, John F; Ross-Ibarra, Jeffrey; Lorant, Anne; Buffalo, Vince; Romay, M Cinta; Buckler, Edward S; Ware, Doreen; Lai, Jinsheng; Sun, Qi

    2017-01-01

    Abstract Background Characterization of genetic variations in maize has been challenging, mainly due to deterioration of collinearity between individual genomes in the species. An international consortium of maize research groups combined resources to develop the maize haplotype version 3 (HapMap 3), built from whole-genome sequencing data from 1218 maize lines, covering predomestication and domesticated Zea mays varieties across the world. Results A new computational pipeline was set up to process more than 12 trillion bp of sequencing data, and a set of population genetics filters was applied to identify more than 83 million variant sites. Conclusions We identified polymorphisms in regions where collinearity is largely preserved in the maize species. However, the fact that the B73 genome used as the reference only represents a fraction of all haplotypes is still an important limiting factor. PMID:29300887

  17. A haplotype map of genomic variations and genome-wide association studies of agronomic traits in foxtail millet (Setaria italica).

    PubMed

    Jia, Guanqing; Huang, Xuehui; Zhi, Hui; Zhao, Yan; Zhao, Qiang; Li, Wenjun; Chai, Yang; Yang, Lifang; Liu, Kunyan; Lu, Hengyun; Zhu, Chuanrang; Lu, Yiqi; Zhou, Congcong; Fan, Danlin; Weng, Qijun; Guo, Yunli; Huang, Tao; Zhang, Lei; Lu, Tingting; Feng, Qi; Hao, Hangfei; Liu, Hongkuan; Lu, Ping; Zhang, Ning; Li, Yuhui; Guo, Erhu; Wang, Shujun; Wang, Suying; Liu, Jinrong; Zhang, Wenfei; Chen, Guoqiu; Zhang, Baojin; Li, Wei; Wang, Yongfang; Li, Haiquan; Zhao, Baohua; Li, Jiayang; Diao, Xianmin; Han, Bin

    2013-08-01

    Foxtail millet (Setaria italica) is an important grain crop that is grown in arid regions. Here we sequenced 916 diverse foxtail millet varieties, identified 2.58 million SNPs and used 0.8 million common SNPs to construct a haplotype map of the foxtail millet genome. We classified the foxtail millet varieties into two divergent groups that are strongly correlated with early and late flowering times. We phenotyped the 916 varieties under five different environments and identified 512 loci associated with 47 agronomic traits by genome-wide association studies. We performed a de novo assembly of deeply sequenced genomes of a Setaria viridis accession (the wild progenitor of S. italica) and an S. italica variety and identified complex interspecies and intraspecies variants. We also identified 36 selective sweeps that seem to have occurred during modern breeding. This study provides fundamental resources for genetics research and genetic improvement in foxtail millet.

  18. Kullback-Leibler divergence for detection of rare haplotype common disease association.

    PubMed

    Lin, Shili

    2015-11-01

    Rare haplotypes may tag rare causal variants of common diseases; hence, detection of such rare haplotypes may also contribute to our understanding of complex disease etiology. Because rare haplotypes frequently result from common single-nucleotide polymorphisms (SNPs), focusing on rare haplotypes is much more economical compared with using rare single-nucleotide variants (SNVs) from sequencing, as SNPs are available and 'free' from already amassed genome-wide studies. Further, associated haplotypes may shed light on the underlying disease causal mechanism, a feat unmatched by SNV-based collapsing methods. In recent years, data mining approaches have been adapted to detect rare haplotype association. However, as they rely on an assumed underlying disease model and require the specification of a null haplotype, results can be erroneous if such assumptions are violated. In this paper, we present a haplotype association method based on Kullback-Leibler divergence (hapKL) for case-control samples. The idea is to compare haplotype frequencies for the cases versus the controls by computing symmetrical divergence measures. An important property of such measures is that both the frequencies and logarithms of the frequencies contribute in parallel, thus balancing the contributions from rare and common, and accommodating both deleterious and protective, haplotypes. A simulation study under various scenarios shows that hapKL has well-controlled type I error rates and good power compared with existing data mining methods. Application of hapKL to age-related macular degeneration (AMD) shows a strong association of the complement factor H (CFH) gene with AMD, identifying several individual rare haplotypes with strong signals.

  19. APC Yin-Yang haplotype associated with colorectal cancer risk

    PubMed Central

    GARRE, P.; DE LA HOYA, M.; INIESTA, P.; ROMERA, A.; LLOVET, P.; GONZALEZ, S.; PEREZ-SEGURA, P.; CAPELLA, G.; DIAZ-RUBIO, E.; CALDES, T.

    2010-01-01

    The Yin-Yang haplotype is defined as two mismatched haplotypes (Yin and Yang) representing the majority of the existing haplotypes in a particular genomic region. The human adenomatous polyposis coli (APC) gene shows a Yin-Yang haplotype pattern accounting for 84% of all of the haplotypes existing in the Spanish population. Several association studies have been published regarding APC gene variants (SNPs and haplotypes) and colorectal cancer (CRC) risk. However, no studies concerning diplotype structure and CRC risk have been conducted. The aim of the present study was to investigate whether the APC Yin-Yang homozygote diplotype is over-represented in patients with sporadic CRC when compared to its distribution in controls, and its association with CRC risk. TaqMan® assays were used to genotype three tagSNPs selected across the APC Yin-Yang region. Frequencies of the APC Yin-Yang tagSNP alleles, haplotype and diplotype of 378 CRC cases and 642 controls were compared. Two Spanish CRC group samples were included [Hospital Clínico San Carlos in Madrid (HCSC) and Instituto Catalán de Oncología in Barcelona (ICO)]. Analysis of 157 consecutive CRC patients and 405 control subjects from HCSC showed a significative effect for the risk of CRC (OR=1.93; 95% CI 1.32–2.81; P=0.001). However, this effect was not confirmed in 221 CRC patients and 237 control subjects from ICO (OR=0.89; 95% CI 0.61–1.28; P=0.521). We found a significant association between the APC homozygote Yin-Yang diplotype and the risk of colorectal cancer in the HCSC samples. However, we did not observe this association in the ICO samples. These observations suggest that a study with a larger Spanish cohort is necessary to confirm the effects of the APC Yin-Yang diplotype on the risk of CRC. PMID:22993613

  20. APC Yin-Yang haplotype associated with colorectal cancer risk.

    PubMed

    Garre, P; DE LA Hoya, M; Iniesta, P; Romera, A; Llovet, P; Gonzalez, S; Perez-Segura, P; Capella, G; Diaz-Rubio, E; Caldes, T

    2010-09-01

    The Yin-Yang haplotype is defined as two mismatched haplotypes (Yin and Yang) representing the majority of the existing haplotypes in a particular genomic region. The human adenomatous polyposis coli (APC) gene shows a Yin-Yang haplotype pattern accounting for 84% of all of the haplotypes existing in the Spanish population. Several association studies have been published regarding APC gene variants (SNPs and haplotypes) and colorectal cancer (CRC) risk. However, no studies concerning diplotype structure and CRC risk have been conducted. The aim of the present study was to investigate whether the APC Yin-Yang homozygote diplotype is over-represented in patients with sporadic CRC when compared to its distribution in controls, and its association with CRC risk. TaqMan(®) assays were used to genotype three tagSNPs selected across the APC Yin-Yang region. Frequencies of the APC Yin-Yang tagSNP alleles, haplotype and diplotype of 378 CRC cases and 642 controls were compared. Two Spanish CRC group samples were included [Hospital Clínico San Carlos in Madrid (HCSC) and Instituto Catalán de Oncología in Barcelona (ICO)]. Analysis of 157 consecutive CRC patients and 405 control subjects from HCSC showed a significative effect for the risk of CRC (OR=1.93; 95% CI 1.32-2.81; P=0.001). However, this effect was not confirmed in 221 CRC patients and 237 control subjects from ICO (OR=0.89; 95% CI 0.61-1.28; P=0.521). We found a significant association between the APC homozygote Yin-Yang diplotype and the risk of colorectal cancer in the HCSC samples. However, we did not observe this association in the ICO samples. These observations suggest that a study with a larger Spanish cohort is necessary to confirm the effects of the APC Yin-Yang diplotype on the risk of CRC.

  1. HLA-G Haplotypes Are Differentially Associated with Asthmatic Features.

    PubMed

    Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie

    2018-01-01

    Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA - G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter

  2. HLA-G Haplotypes Are Differentially Associated with Asthmatic Features

    PubMed Central

    Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie

    2018-01-01

    Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA-G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter

  3. Mapping of HLA- DQ haplotypes in a group of Danish patients with celiac disease.

    PubMed

    Lund, Flemming; Hermansen, Mette N; Pedersen, Merete F; Hillig, Thore; Toft-Hansen, Henrik; Sölétormos, György

    2015-10-01

    A cost-effective identification of HLA- DQ risk haplotypes using the single nucleotide polymorphism (SNP) technique has recently been applied in the diagnosis of celiac disease (CD) in four European populations. The objective of the study was to map risk HLA- DQ haplotypes in a group of Danish CD patients using the SNP technique. Cohort A: Among 65 patients with gastrointestinal symptoms we compared the HLA- DQ2 and HLA- DQ8 risk haplotypes obtained by the SNP technique (method 1) with results based on a sequence specific primer amplification technique (method 2) and a technique used in an assay from BioDiagene (method 3). Cohort B: 128 patients with histologically verified CD were tested for CD risk haplotypes (method 1). Patients with negative results were further tested for sub-haplotypes of HLA- DQ2 (methods 2 and 3). Cohort A: The three applied methods provided the same HLA- DQ2 and HLA- DQ8 results among 61 patients. Four patients were negative for the HLA- DQ2 and HLA- DQ8 haplotypes (method 1) but were positive for the HLA- DQ2.5-trans and HLA- DQ2.2 haplotypes (methods 2 and 3). Cohort B: A total of 120 patients were positive for the HLA- DQ2.5-cis and HLA- DQ8 haplotypes (method 1). The remaining seven patients were positive for HLA- DQ2.5-trans or HLA- DQ2.2 haplotypes (methods 2 and 3). One patient was negative with all three HLA methods. The HLA- DQ risk haplotypes were detected in 93.8% of the CD patients using the SNP technique (method 1). The sensitivity increased to 99.2% by combining methods 1 - 3.

  4. Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR.

    PubMed

    Tyson, Jess; Armour, John A L

    2012-12-11

    Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.

  5. Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR

    PubMed Central

    2012-01-01

    Background Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. Results In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. Conclusion This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example. PMID:23231411

  6. Haplotype diversity in 11 candidate genes across four populations.

    PubMed

    Beaty, T H; Fallin, M D; Hetmanski, J B; McIntosh, I; Chong, S S; Ingersoll, R; Sheng, X; Chakraborty, R; Scott, A F

    2005-09-01

    Analysis of haplotypes based on multiple single-nucleotide polymorphisms (SNP) is becoming common for both candidate gene and fine-mapping studies. Before embarking on studies of haplotypes from genetically distinct populations, however, it is important to consider variation both in linkage disequilibrium (LD) and in haplotype frequencies within and across populations, as both vary. Such diversity will influence the choice of "tagging" SNPs for candidate gene or whole-genome association studies because some markers will not be polymorphic in all samples and some haplotypes will be poorly represented or completely absent. Here we analyze 11 genes, originally chosen as candidate genes for oral clefts, where multiple markers were genotyped on individuals from four populations. Estimated haplotype frequencies, measures of pairwise LD, and genetic diversity were computed for 135 European-Americans, 57 Chinese-Singaporeans, 45 Malay-Singaporeans, and 46 Indian-Singaporeans. Patterns of pairwise LD were compared across these four populations and haplotype frequencies were used to assess genetic variation. Although these populations are fairly similar in allele frequencies and overall patterns of LD, both haplotype frequencies and genetic diversity varied significantly across populations. Such haplotype diversity has implications for designing studies of association involving samples from genetically distinct populations.

  7. RTEL1 tagging SNPs and haplotypes were associated with glioma development.

    PubMed

    Li, Gang; Jin, Tianbo; Liang, Hongjuan; Zhang, Zhiguo; He, Shiming; Tu, Yanyang; Yang, Haixia; Geng, Tingting; Cui, Guangbin; Chen, Chao; Gao, Guodong

    2013-05-17

    As glioma ranks as the first most prevalent solid tumors in primary central nervous system, certain single-nucleotide polymorphisms (SNPs) may be related to increased glioma risk, and have implications in carcinogenesis. The present case-control study was carried out to elucidate how common variants contribute to glioma susceptibility. Ten candidate tagging SNPs (tSNPs) were selected from seven genes whose polymorphisms have been proven by classical literatures and reliable databases to be tended to relate with gliomas, and with the minor allele frequency (MAF)>5% in the HapMap Asian population. The selected tSNPs were genotyped in 629 glioma patients and 645 controls from a Han Chinese population using the multiplexed SNP MassEXTEND assay calibrated. Two significant tSNPs in RTEL1 gene were observed to be associated with glioma risk (rs6010620, P=0.0016, OR: 1.32, 95% CI: 1.11-1.56; rs2297440, P=0.001, OR: 1.33, 95% CI: 1.12-1.58) by χ2 test. It was identified the genotype "GG" of rs6010620 acted as the protective genotype for glioma (OR, 0.46; 95% CI, 0.31-0.7; P=0.0002), while the genotype "CC" of rs2297440 as the protective genotype in glioma (OR, 0.47; 95% CI, 0.31-0.71; P=0.0003). Furthermore, haplotype "GCT" in RTEL1 gene was found to be associated with risk of glioma (OR, 0.7; 95% CI, 0.57-0.86; Fisher's P=0.0005; Pearson's P=0.0005), and haplotype "ATT" was detected to be associated with risk of glioma (OR, 1.32; 95% CI, 1.12-1.57; Fisher's P=0.0013; Pearson's P=0.0013). Two single variants, the genotypes of "GG" of rs6010620 and "CC" of rs2297440 (rs6010620 and rs2297440) in the RTEL1 gene, together with two haplotypes of GCT and ATT, were identified to be associated with glioma development. And it might be used to evaluate the glioma development risks to screen the above RTEL1 tagging SNPs and haplotypes. The virtual slides for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1993021136961998.

  8. Association of HLA haplotype with alopecia areata in Chinese Hans.

    PubMed

    Xiao, F-L; Ye, D-Q; Yang, S; Zhou, F-S; Zhou, S-M; Zhu, Y-G; Liang, Y-H; Ren, Y-Q; Zhang, X-J

    2006-11-01

    Some studies have shown discrepancies in human leucocyte antigen (HLA) associated with alopecia areata (AA) between different ethnic populations. To investigate whether HLA-I, -DQA1 and -DQB1 alleles and the HLA haplotype are associated with AA, and the correlation between the HLA haplotype profile, age of onset and severity of AA in Chinese Hans. The polymerase chain reaction-sequence specific primer (PCR-SSP) method was used to analyse the frequencies of HLA class I, -DQA1 and -DQB1 alleles in 192 patients with AA and 252 controls in Chinese Hans. The linkage disequilibrium was calculated using the 2 x 2 table. The 24 two-locus haplotypes [including A*02-B*18, A*02-B*27, A*02-B*52, A*02-Cw*0704, A*02-DQA1*0104, A*02-DQB1*0604, A*02-DQB1*0606, B*18-Cw*0704, B*18-DQA1*0104, B*18-DQA1*0302, B*18-DQB1*0606, B*27-Cw*0704, B*27-DQA1*0104, B*27-DQA1*0302, B*52-Cw*0704, B*52-DQA1*0104, B*52-DQA1*0302, B52-DQB1*0606, Cw*0704-DQA1*0104, Cw*0704-DQA1*0302, Cw*0704-DQB1*0606, DQA1*0104-DQB1*0604, DQA1*0104-DQB1*0606, DQA1*0302-DQB1*0606 (P<0.05)] were associated with AA, while eight extended haplotypes (A*02-B*18-DQA1*0104, A*02-B*27-DQA1*0104, A*02-B*52-DQA1*0104, A*02-B*52-DQA1*0302, A*02-B*52-DQB1*0606, B*52-Cw*0704-DQA1*0104, B*52-Cw*0704-DQA1*0302, A*02-B*52-DQA1*0302-DQB1*0606) were found to be related to AA in Chinese Hans. Through stratified analysis, we found that the extended haplotype B*52-Cw*0704-DQA1*0302 was related to early onset of AA, and no haplotype was only associated with severe AA. This is the first detailed report to elucidate HLA haplotypes associated with AA and that demonstrates the significant HLA haplotypes in Chinese Hans AA. The haplotype B*52-Cw*0704-DQA1*0302 was identified to be related to early onset of AA. Our results provide some information for future research on predisposing genes in HLA regions in Chinese Hans.

  9. Diploid/Polyploid Syntenic Shuttle Mapping and Haplotype-Specific Chromosome Walking Toward a Rust Resistance Gene (Bru1) in Highly Polyploid Sugarcane (2n ∼ 12x ∼ 115)

    PubMed Central

    Le Cunff, Loïc; Garsmeur, Olivier; Raboin, Louis Marie; Pauquet, Jérome; Telismart, Hugues; Selvi, Athiappan; Grivet, Laurent; Philippe, Romain; Begum, Dilara; Deu, Monique; Costet, Laurent; Wing, Rod; Glaszmann, Jean Christophe; D'Hont, Angélique

    2008-01-01

    The genome of modern sugarcane cultivars is highly polyploid (∼12x), aneuploid, of interspecific origin, and contains 10 Gb of DNA. Its size and complexity represent a major challenge for the isolation of agronomically important genes. Here we report on the first attempt to isolate a gene from sugarcane by map-based cloning, targeting a durable major rust resistance gene (Bru1). We describe the genomic strategies that we have developed to overcome constraints associated with high polyploidy in the successive steps of map-based cloning approaches, including diploid/polyploid syntenic shuttle mapping with two model diploid species (sorghum and rice) and haplotype-specific chromosome walking. Their applications allowed us (i) to develop a high-resolution map including markers at 0.28 and 0.14 cM on both sides and 13 markers cosegregating with Bru1 and (ii) to develop a physical map of the target haplotype that still includes two gaps at this stage due to the discovery of an insertion specific to this haplotype. These approaches will pave the way for the development of future map-based cloning approaches for sugarcane and other complex polyploid species. PMID:18757946

  10. HLA-A*02 allele frequencies and haplotypic associations in Koreans.

    PubMed

    Park, M H; Whang, D H; Kang, S J; Han, K S

    2000-03-01

    We have investigated the frequencies of HLA-A*02 alleles and their haplotypic associations with HLA-B and -DRB1 loci in 439 healthy unrelated Koreans, including 214 parents from 107 families. All of the 227 samples (51.7%) typed as A2 by serology were analyzed for A*02 alleles using polymerase chain reaction (PCR)-low ionic strength-single-strand conformation polymorphism (LIS-SSCP) method. A total of six different A*02 alleles were detected (A*02 allele frequency 29.6%): A*0201/9 (16.6%), *0203 (0.5%), *0206 (9.3%), *0207 (3.0%), and one each case of *0210 and *02 undetermined type. Two characteristic haplotypes showing the strongest linkage disequilibrium were A*0203-B38-DRB]*1502 and A*0207-B46-DRB1*0803. Besides these strong associations, significant two-locus associations (P<0.001) were observed for A*0201 with B61, DRB1*0901 and DRB1*1401, and for A*0206 with B48 and B61. HLA haplotypes carrying HLA-A2 showed a variable distribution of A*02 alleles, and all of the eight most common A2-B-DR haplotypes occurring at frequencies of > or =1% were variably associated with two different A*02 alleles. These results demonstrate that substantial heterogeneity is present in the distribution of HLA-A*02 alleles and related haplotypes in Koreans.

  11. Haplotype-based identification of a microsomal transfer protein marker associated with the human lifespan

    PubMed Central

    Geesaman, Bard J.; Benson, Erica; Brewster, Stephanie J.; Kunkel, Louis M.; Blanché, Hélène; Thomas, Gilles; Perls, Thomas T.; Daly, Mark J.; Puca, Annibale A.

    2003-01-01

    We previously reported a genomewide linkage study for human longevity using 308 long-lived individuals (LLI) (centenarians or near-centenarians) in 137 sibships and identified statistically significant linkage within chromosome 4 near microsatellite D4S1564. This interval spans 12 million bp and contains ≈50 putative genes. To identify the specific gene and gene variants impacting lifespan, we performed a haplotype-based fine-mapping study of the interval. The resulting genetic association study identified a haplotype marker within microsomal transfer protein as a modifier of human lifespan. This same variant was tested in a second cohort of LLI from France, and although the association was not replicated, there was evidence for statistical distortion in the form of Hardy–Weinberg disequilibrium. Microsomal transfer protein has been identified as the rate-limiting step in lipoprotein synthesis and may affect longevity by subtly modulating this pathway. This study provides proof of concept for the feasibility of using the genomes of LLI to identify genes impacting longevity. PMID:14615589

  12. Acute chest syndrome is associated with single nucleotide polymorphism-defined beta globin cluster haplotype in children with sickle cell anaemia

    PubMed Central

    Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.

    2013-01-01

    Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145

  13. RTEL1 tagging SNPs and haplotypes were associated with glioma development

    PubMed Central

    2013-01-01

    Abstract As glioma ranks as the first most prevalent solid tumors in primary central nervous system, certain single-nucleotide polymorphisms (SNPs) may be related to increased glioma risk, and have implications in carcinogenesis. The present case–control study was carried out to elucidate how common variants contribute to glioma susceptibility. Ten candidate tagging SNPs (tSNPs) were selected from seven genes whose polymorphisms have been proven by classical literatures and reliable databases to be tended to relate with gliomas, and with the minor allele frequency (MAF) > 5% in the HapMap Asian population. The selected tSNPs were genotyped in 629 glioma patients and 645 controls from a Han Chinese population using the multiplexed SNP MassEXTEND assay calibrated. Two significant tSNPs in RTEL1 gene were observed to be associated with glioma risk (rs6010620, P = 0.0016, OR: 1.32, 95% CI: 1.11-1.56; rs2297440, P = 0.001, OR: 1.33, 95% CI: 1.12-1.58) by χ2 test. It was identified the genotype “GG” of rs6010620 acted as the protective genotype for glioma (OR, 0.46; 95% CI, 0.31-0.7; P = 0.0002), while the genotype “CC” of rs2297440 as the protective genotype in glioma (OR, 0.47; 95% CI, 0.31-0.71; P = 0.0003). Furthermore, haplotype “GCT” in RTEL1 gene was found to be associated with risk of glioma (OR, 0.7; 95% CI, 0.57-0.86; Fisher’s P = 0.0005; Pearson’s P = 0.0005), and haplotype “ATT” was detected to be associated with risk of glioma (OR, 1.32; 95% CI, 1.12-1.57; Fisher’s P = 0.0013; Pearson’s P = 0.0013). Two single variants, the genotypes of “GG” of rs6010620 and “CC” of rs2297440 (rs6010620 and rs2297440) in the RTEL1 gene, together with two haplotypes of GCT and ATT, were identified to be associated with glioma development. And it might be used to evaluate the glioma development risks to screen the above RTEL1 tagging SNPs and haplotypes. Virtual slides The virtual slides for this article

  14. Mapping a New Spontaneous Preterm Birth Susceptibility Gene, IGF1R, Using Linkage, Haplotype Sharing, and Association Analysis

    PubMed Central

    Luukkonen, Aino; Teramo, Kari; Puttonen, Hilkka; Ojaniemi, Marja; Varilo, Teppo; Chaudhari, Bimal P.; Plunkett, Jevon; Murray, Jeffrey C.; McCarroll, Steven A.; Muglia, Louis J.; Palotie, Aarno; Hallman, Mikko

    2011-01-01

    Preterm birth is the major cause of neonatal death and serious morbidity. Most preterm births are due to spontaneous onset of labor without a known cause or effective prevention. Both maternal and fetal genomes influence the predisposition to spontaneous preterm birth (SPTB), but the susceptibility loci remain to be defined. We utilized a combination of unique population structures, family-based linkage analysis, and subsequent case-control association to identify a susceptibility haplotype for SPTB. Clinically well-characterized SPTB families from northern Finland, a subisolate founded by a relatively small founder population that has subsequently experienced a number of bottlenecks, were selected for the initial discovery sample. Genome-wide linkage analysis using a high-density single-nucleotide polymorphism (SNP) array in seven large northern Finnish non-consanginous families identified a locus on 15q26.3 (HLOD 4.68). This region contains the IGF1R gene, which encodes the type 1 insulin-like growth factor receptor IGF-1R. Haplotype segregation analysis revealed that a 55 kb 12-SNP core segment within the IGF1R gene was shared identical-by-state (IBS) in five families. A follow-up case-control study in an independent sample representing the more general Finnish population showed an association of a 6-SNP IGF1R haplotype with SPTB in the fetuses, providing further evidence for IGF1R as a SPTB predisposition gene (frequency in cases versus controls 0.11 versus 0.05, P = 0.001, odds ratio 2.3). This study demonstrates the identification of a predisposing, low-frequency haplotype in a multifactorial trait using a well-characterized population and a combination of family and case-control designs. Our findings support the identification of the novel susceptibility gene IGF1R for predisposition by the fetal genome to being born preterm. PMID:21304894

  15. Hypercontrols in genotype-phenotype analysis reveal ancestral haplotypes associated with essential hypertension.

    PubMed

    Balam-Ortiz, Eros; Esquivel-Villarreal, Adolfo; Huerta-Hernandez, David; Fernandez-Lopez, Juan Carlos; Alfaro-Ruiz, Luis; Muñoz-Monroy, Omar; Gutierrez, Ruth; Figueroa-Genis, Enrique; Carrillo, Karol; Elizalde, Adela; Hidalgo, Alfredo; Rodriguez, Mauricio; Urushihara, Maki; Kobori, Hiroyuki; Jimenez-Sanchez, Gerardo

    2012-04-01

    The angiotensinogen gene locus has been associated with essential hypertension in most populations analyzed to date. Increased plasma angiotensinogen levels have been proposed as an underlying cause of essential hypertension in whites; however, differences in the genetic regulation of plasma angiotensinogen levels have also been reported for other populations. The aim of this study was to analyze the relationship between angiotensinogen gene polymorphisms and haplotypes with plasma angiotensinogen levels and the risk of essential hypertension in the Mexican population. We genotyped 9 angiotensinogen gene polymorphisms in 706 individuals. Four polymorphisms, A-6, C4072, C6309, and G12775, were associated with increased risk, and the strongest association was found for the C6309 allele (χ(2)=23.9; P=0.0000009), which resulted in an odds ratio of 3.0 (95% CI: 1.8-4.9; P=0.000006) in the recessive model. Two polymorphisms, A-20C (P=0.003) and C3389T (P=0.0001), were associated with increased plasma angiotensinogen levels but did not show association with essential hypertension. The haplotypes H1 (χ(2)=8.1; P=0.004) and H5 (χ(2)=5.1; P=0.02) were associated with essential hypertension. Using phylogenetic analysis, we found that haplotypes 1 and 5 are the human ancestral haplotypes. Our results suggest that the positive association between angiotensinogen gene polymorphisms and haplotypes with essential hypertension is not simply explained by an increase in plasma angiotensinogen concentration. Complex interactions between risk alleles suggest that these haplotypes act as "superalleles."

  16. Hypercontrols in Genotype-Phenotype Analysis Reveal Ancestral Haplotypes Associated With Essential Hypertension

    PubMed Central

    Balam-Ortiz, Eros; Esquivel-Villarreal, Adolfo; Huerta-Hernandez, David; Fernandez-Lopez, Juan Carlos; Alfaro-Ruiz, Luis; Muñoz-Monroy, Omar; Gutierrez, Ruth; Figueroa-Genis, Enrique; Carrillo, Karol; Elizalde, Adela; Hidalgo, Alfredo; Rodriguez, Mauricio; Urushihara, Maki; Kobori, Hiroyuki; Jimenez-Sanchez, Gerardo

    2012-01-01

    The angiotensinogen gene locus has been associated with essential hypertension in most populations analyzed to date. Increased plasma angiotensinogen levels have been proposed as an underlying cause of essential hypertension in whites; however, differences in the genetic regulation of plasma angiotensinogen levels have also been reported for other populations. The aim of this study was to analyze the relationship between angiotensinogen gene polymorphisms and haplotypes with plasma angiotensinogen levels and the risk of essential hypertension in the Mexican population. We genotyped 9 angiotensinogen gene polymorphisms in 706 individuals. Four polymorphisms, A-6, C4072, C6309, and G12775, were associated with increased risk, and the strongest association was found for the C6309 allele (χ2 = 23.9; P = 0.0000009), which resulted in an odds ratio of 3.0 (95% CI: 1.8–4.9; P = 0.000006) in the recessive model. Two polymorphisms, A-20C (P = 0.003) and C3389T (P = 0.0001), were associated with increased plasma angiotensinogen levels but did not show association with essential hypertension. The haplotypes H1 (χ2 = 8.1; P = 0.004) and H5 (χ2 = 5.1; P = 0.02) were associated with essential hypertension. Using phylogenetic analysis, we found that haplotypes 1 and 5 are the human ancestral haplotypes. Our results suggest that the positive association between angiotensinogen gene polymorphisms and haplotypes with essential hypertension is not simply explained by an increase in plasma angiotensinogen concentration. Complex interactions between risk alleles suggest that these haplotypes act as “superalleles.” PMID:22371359

  17. Association between endothelin type A receptor haplotypes and mortality in coronary heart disease.

    PubMed

    Ellis, Katrina L; Pilbrow, Anna P; Potter, Howard C; Frampton, Chris M; Doughty, Rob N; Whalley, Gillian A; Ellis, Chris J; Palmer, Barry R; Skelton, Lorraine; Yandle, Tim G; Troughton, Richard W; Richards, A Mark; A Cameron, Vicky

    2012-05-01

    The endothelin type A receptor, encoded by EDNRA, mediates the effects of endothelin-1 to promote vasoconstriction, vascular cell growth, adhesion, fibrosis and thrombosis. We investigated the association between EDNRA haplotype and cardiovascular outcomes in patients with coronary artery disease. Coronary disease patients (n = 1007) were genotyped for the His323His (rs5333) variant and one tag SNP from each of the major EDNRA haplotype blocks (rs6537484, rs1568136, rs5335 and rs10003447). EDNRA haplotype associations with clinical history, natriuretic peptides cardiac function and cardiovascular outcomes were tested over a median 3.8 years. Univariate analysis identified a 'low-risk' EDNRA haplotype associated with later age of Type 2 diabetes onset (p = 0.004) smaller BMI (p = 0.021), and reduced mortality (log rank p = 0.001). Cox proportional hazards analysis including established cardiovascular risk factors revealed an independent association between haplotype and mortality (p < 0.0001). These data highlight the potential importance of the endothelin system, and in particular EDNRA in coronary disease.

  18. VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

    1994-09-01

    The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception ofmore » closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.« less

  19. Missing data imputation and haplotype phase inference for genome-wide association studies

    PubMed Central

    Browning, Sharon R.

    2009-01-01

    Imputation of missing data and the use of haplotype-based association tests can improve the power of genome-wide association studies (GWAS). In this article, I review methods for haplotype inference and missing data imputation, and discuss their application to GWAS. I discuss common features of the best algorithms for haplotype phase inference and missing data imputation in large-scale data sets, as well as some important differences between classes of methods, and highlight the methods that provide the highest accuracy and fastest computational performance. PMID:18850115

  20. Association Between Chloroplast DNA and Mitochondrial DNA Haplotypes in Prunus spinosa L. (Rosaceae) Populations across Europe

    PubMed Central

    MOHANTY, APARAJITA; MARTÍN, JUAN PEDRO; GONZÁLEZ, LUIS MIGUEL; AGUINAGALDE, ITZIAR

    2003-01-01

    Chloroplast DNA (cpDNA) and mitochondrial DNA (mtDNA) were studied in 24 populations of Prunus spinosa sampled across Europe. The cpDNA and mtDNA fragments were amplified using universal primers and subsequently digested with restriction enzymes to obtain the polymorphisms. Combinations of all the polymorphisms resulted in 33 cpDNA haplotypes and two mtDNA haplotypes. Strict association between the cpDNA haplotypes and the mtDNA haplotypes was detected in most cases, indicating conjoint inheritance of the two genomes. The most frequent and abundant cpDNA haplotype (C20; frequency, 51 %) is always associated with the more frequent and abundant mtDNA haplotype (M1; frequency, 84 %). All but two of the cpDNA haplotypes associated with the less frequent mtDNA haplotype (M2) are private haplotypes. These private haplotypes are phylogenetically related but geographically unrelated. They form a separate cluster on the minimum‐length spanning tree. PMID:14534199

  1. Association between β2-adrenoceptor (ADRB2) haplotypes and insulin resistance in PCOS.

    PubMed

    Tellechea, Mariana L; Muzzio, Damián O; Iglesias Molli, Andrea E; Belli, Susana H; Graffigna, Mabel N; Levalle, Oscar A; Frechtel, Gustavo D; Cerrone, Gloria E

    2013-04-01

    The aim of this study was to explore β2-adrenoceptor (ADRB2) haplotype associations with phenotypes and quantitative traits related to insulin resistance (IR) and the metabolic syndrome (MS) in a polycystic ovary syndrome (PCOS) population. A secondary purpose was to assess the association between ADRB2 haplotype and PCOS. Genetic polymorphism analysis. Cross-sectional case-control association study. Medical University Hospital and research laboratory. One hundred and sixty-five unrelated women with PCOS and 116 unrelated women without PCOS (control sample). Clinical and biochemical measurements, and ADRB2 genotyping in PCOS patients and control subjects. ADRB2 haplotypes (comprising rs1042711, rs1801704, rs1042713 and rs1042714 in that order), genotyping and statistical analysis to evaluate associations with continuous variables and traits related to IR and MS in a PCOS population. Associations between ADRB2 haplotypes and PCOS were also assessed. We observed an age-adjusted association between ADRB2 haplotype CCGG and lower insulin (P = 0·018) and HOMA (P = 0·008) in the PCOS sample. Interestingly, the expected differences in surrogate measures of IR between cases and controls were not significant in CCGG/CCGG carriers. In the case-control study, genotype CCGG/CCGG was associated with a 14% decrease in PCOS risk (P = 0·043), taking into account confounding variables. Haplotype I (CCGG) has a protective role for IR and MS in PCOS. © 2012 Blackwell Publishing Ltd.

  2. Multilocus association mapping using variable-length Markov chains.

    PubMed

    Browning, Sharon R

    2006-06-01

    I propose a new method for association-based gene mapping that makes powerful use of multilocus data, is computationally efficient, and is straightforward to apply over large genomic regions. The approach is based on the fitting of variable-length Markov chain models, which automatically adapt to the degree of linkage disequilibrium (LD) between markers to create a parsimonious model for the LD structure. Edges of the fitted graph are tested for association with trait status. This approach can be thought of as haplotype testing with sophisticated windowing that accounts for extent of LD to reduce degrees of freedom and number of tests while maximizing information. I present analyses of two published data sets that show that this approach can have better power than single-marker tests or sliding-window haplotypic tests.

  3. Multilocus Association Mapping Using Variable-Length Markov Chains

    PubMed Central

    Browning, Sharon R.

    2006-01-01

    I propose a new method for association-based gene mapping that makes powerful use of multilocus data, is computationally efficient, and is straightforward to apply over large genomic regions. The approach is based on the fitting of variable-length Markov chain models, which automatically adapt to the degree of linkage disequilibrium (LD) between markers to create a parsimonious model for the LD structure. Edges of the fitted graph are tested for association with trait status. This approach can be thought of as haplotype testing with sophisticated windowing that accounts for extent of LD to reduce degrees of freedom and number of tests while maximizing information. I present analyses of two published data sets that show that this approach can have better power than single-marker tests or sliding-window haplotypic tests. PMID:16685642

  4. Performance of Single Nucleotide Polymorphisms versus Haplotypes for Genome-Wide Association Analysis in Barley

    PubMed Central

    Jannink, Jean-Luc

    2010-01-01

    Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933

  5. HLA haplotype map of river valley populations with hemochromatosis traced through five centuries in Central Sweden.

    PubMed

    Olsson, K Sigvard; Ritter, Bernd; Hansson, Norbeth; Chowdhury, Ruma R

    2008-07-01

    The hemochromatosis mutation, C282Y of the HFE gene, seems to have originated from a single event which once occurred in a person living in the north west of Europe carrying human leukocyte antigen (HLA)-A3-B7. In descendants of this ancestor also other haplotypes appear probably caused by local recombinations and founder effects. The background of these associations is unknown. Isolated river valley populations may be fruitful for the mapping of genetic disorders such as hemochromatosis. In this study, we try to test this hypothesis in a study from central Sweden where the haplotyope A1-B8 was common. HLA haplotypes and HFE mutations were studied in hemochromatosis patients with present or past parental origin in a sparsely populated (1/km(2)) rural district (n = 8366 in the year of 2005), in central Sweden. Pedigrees were constructed from the Swedish church book registry. Extended haplotypes were studied to evaluate origin of recombinations. There were 87 original probands, 36 females and 51 males identified during 30 yr, of whom 86% carried C282Y/C282Y and 14% C282Y/H63D. Of 32 different HLA haplotypes A1-B8 was the most common (34%), followed by A3-B7 (16%), both in strong linkage disequilibrium with controls, (P < 0.001). Twenty-nine different families with A1-B8 had a common founder origin 15 generations ago in small bottleneck populations of the late 16th century. A second A1-B8 founder born 1655 was of Norwegian origin. Most of the A3 carriers (n = 26) had a common founder origin 16 generations ago in an even smaller nearby river valley. A fourth founder family carrying HLA-A2 seems to have originated from a recombination along the descendant lines from the A3 ancestor supported by extended haplotype studies. A1-haplotypes with alleles at the B locus different from B8 had a similar recombination origin as HLA-A2 alleles and a common founder origin 11 generations ago. The intergenerational time interval averaged 35.5 +/- 7.9 yr in men and 31.9 +/- 5.9 in

  6. Efficient algorithms for polyploid haplotype phasing.

    PubMed

    He, Dan; Saha, Subrata; Finkers, Richard; Parida, Laxmi

    2018-05-09

    Inference of haplotypes, or the sequence of alleles along the same chromosomes, is a fundamental problem in genetics and is a key component for many analyses including admixture mapping, identifying regions of identity by descent and imputation. Haplotype phasing based on sequencing reads has attracted lots of attentions. Diploid haplotype phasing where the two haplotypes are complimentary have been studied extensively. In this work, we focused on Polyploid haplotype phasing where we aim to phase more than two haplotypes at the same time from sequencing data. The problem is much more complicated as the search space becomes much larger and the haplotypes do not need to be complimentary any more. We proposed two algorithms, (1) Poly-Harsh, a Gibbs Sampling based algorithm which alternatively samples haplotypes and the read assignments to minimize the mismatches between the reads and the phased haplotypes, (2) An efficient algorithm to concatenate haplotype blocks into contiguous haplotypes. Our experiments showed that our method is able to improve the quality of the phased haplotypes over the state-of-the-art methods. To our knowledge, our algorithm for haplotype blocks concatenation is the first algorithm that leverages the shared information across multiple individuals to construct contiguous haplotypes. Our experiments showed that it is both efficient and effective.

  7. The JAK2 GGCC (46/1) Haplotype in Myeloproliferative Neoplasms: Causal or Random?

    PubMed

    Anelli, Luisa; Zagaria, Antonella; Specchia, Giorgina; Albano, Francesco

    2018-04-11

    The germline JAK2 haplotype known as "GGCC or 46/1 haplotype" (haplotype GGCC_46/1 ) consists of a combination of single nucleotide polymorphisms (SNPs) mapping in a region of about 250 kb, extending from the JAK2 intron 10 to the Insulin-like 4 ( INLS4 ) gene. Four main SNPs (rs3780367, rs10974944, rs12343867, and rs1159782) generating a "GGCC" combination are more frequently indicated to represent the JAK2 haplotype. These SNPs are inherited together and are frequently associated with the onset of myeloproliferative neoplasms (MPN) positive for both JAK2 V617 and exon 12 mutations. The association between the JAK2 haplotype GGCC_46/1 and mutations in other genes, such as thrombopoietin receptor ( MPL ) and calreticulin ( CALR ), or the association with triple negative MPN, is still controversial. This review provides an overview of the frequency and the role of the JAK2 haplotype GGCC_46/1 in the pathogenesis of different myeloid neoplasms and describes the hypothetical mechanisms at the basis of the association with JAK2 gene mutations. Moreover, possible clinical implications are discussed, as different papers reported contrasting data about the correlation between the JAK2 haplotype GGCC_46/1 and blood cell count, survival, or disease progression.

  8. COMT haplotypes modulate associations of antenatal maternal anxiety and neonatal cortical morphology.

    PubMed

    Qiu, Anqi; Tuan, Ta Anh; Ong, Mei Lyn; Li, Yue; Chen, Helen; Rifkin-Graboi, Anne; Broekman, Birit F P; Kwek, Kenneth; Saw, Seang-Mei; Chong, Yap-Seng; Gluckman, Peter D; Fortier, Marielle V; Holbrook, Joanna Dawn; Meaney, Michael J

    2015-02-01

    Exposure to antenatal maternal anxiety and complex genetic variations may shape fetal brain development. In particular, the catechol-O-methyltransferase (COMT) gene, located on chromosome 22q11.2, regulates catecholamine signaling in the prefrontal cortex and is implicated in anxiety, pain, and stress responsivity. This study examined whether individual single-nucleotide polymorphisms (SNPs) of the COMT gene and their haplotypes moderate the association between antenatal maternal anxiety and in utero cortical development. A total of 146 neonates were genotyped and underwent MRI shortly after birth. Neonatal cortical morphology was characterized using cortical thickness. Antenatal maternal anxiety was assessed using the State-Trait Anxiety Inventory at week 26 of pregnancy. Individual COMT SNPs (val158met, rs737865, and rs165599) modulated the association between antenatal maternal anxiety and the prefrontal and parietal cortical thickness in neonates. Based on haplotype trend regression analysis, findings also showed that among rs737865-val158met-rs165599 haplotypes, the A-val-G (AGG) haplotype probabilities modulated positive associations of antenatal maternal anxiety with cortical thickness in the right ventrolateral prefrontal cortex and the right superior parietal cortex and precuneus. In contrast, the G-met-A (GAA) haplotype probabilities modulated negative associations of antenatal maternal anxiety with cortical thickness in bilateral precentral gyrus and the dorsolateral prefrontal cortex. These results suggest that the association between maternal anxiety and in utero neurodevelopment is modified through complex genetic variation in COMT. Such genetic moderation may explain, in part, the variation in phenotypic outcomes in offspring associated with maternal emotional well-being.

  9. FamLBL: detecting rare haplotype disease association based on common SNPs using case-parent triads.

    PubMed

    Wang, Meng; Lin, Shili

    2014-09-15

    In recent years, there has been an increasing interest in using common single-nucleotide polymorphisms (SNPs) amassed in genome-wide association studies to investigate rare haplotype effects on complex diseases. Evidence has suggested that rare haplotypes may tag rare causal single-nucleotide variants, making SNP-based rare haplotype analysis not only cost effective, but also more valuable for detecting causal variants. Although a number of methods for detecting rare haplotype association have been proposed in recent years, they are population based and thus susceptible to population stratification. We propose family-triad-based logistic Bayesian Lasso (famLBL) for estimating effects of haplotypes on complex diseases using SNP data. By choosing appropriate prior distribution, effect sizes of unassociated haplotypes can be shrunk toward zero, allowing for more precise estimation of associated haplotypes, especially those that are rare, thereby achieving greater detection power. We evaluate famLBL using simulation to gauge its type I error and power. Compared with its population counterpart, LBL, highlights famLBL's robustness property in the presence of population substructure. Further investigation by comparing famLBL with Family-Based Association Test (FBAT) reveals its advantage for detecting rare haplotype association. famLBL is implemented as an R-package available at http://www.stat.osu.edu/∼statgen/SOFTWARE/LBL/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. A Primary Assembly of a Bovine Haplotype Block Map Based on a 15,036-Single-Nucleotide Polymorphism Panel Genotyped in Holstein–Friesian Cattle

    PubMed Central

    Khatkar, Mehar S.; Zenger, Kyall R.; Hobbs, Matthew; Hawken, Rachel J.; Cavanagh, Julie A. L.; Barris, Wes; McClintock, Alexander E.; McClintock, Sara; Thomson, Peter C.; Tier, Bruce; Nicholas, Frank W.; Raadsma, Herman W.

    2007-01-01

    Analysis of data on 1000 Holstein–Friesian bulls genotyped for 15,036 single-nucleotide polymorphisms (SNPs) has enabled genomewide identification of haplotype blocks and tag SNPs. A final subset of 9195 SNPs in Hardy–Weinberg equilibrium and mapped on autosomes on the bovine sequence assembly (release Btau 3.1) was used in this study. The average intermarker spacing was 251.8 kb. The average minor allele frequency (MAF) was 0.29 (0.05–0.5). Following recent precedents in human HapMap studies, a haplotype block was defined where 95% of combinations of SNPs within a region are in very high linkage disequilibrium. A total of 727 haplotype blocks consisting of ≥3 SNPs were identified. The average block length was 69.7 ± 7.7 kb, which is ∼5–10 times larger than in humans. These blocks comprised a total of 2964 SNPs and covered 50,638 kb of the sequence map, which constitutes 2.18% of the length of all autosomes. A set of tag SNPs, which will be useful for further fine-mapping studies, has been identified. Overall, the results suggest that as many as 75,000–100,000 tag SNPs would be needed to track all important haplotype blocks in the bovine genome. This would require ∼250,000 SNPs in the discovery phase. PMID:17435229

  11. The JAK2 GGCC (46/1) Haplotype in Myeloproliferative Neoplasms: Causal or Random?

    PubMed Central

    Anelli, Luisa; Zagaria, Antonella; Specchia, Giorgina

    2018-01-01

    The germline JAK2 haplotype known as “GGCC or 46/1 haplotype” (haplotypeGGCC_46/1) consists of a combination of single nucleotide polymorphisms (SNPs) mapping in a region of about 250 kb, extending from the JAK2 intron 10 to the Insulin-like 4 (INLS4) gene. Four main SNPs (rs3780367, rs10974944, rs12343867, and rs1159782) generating a “GGCC” combination are more frequently indicated to represent the JAK2 haplotype. These SNPs are inherited together and are frequently associated with the onset of myeloproliferative neoplasms (MPN) positive for both JAK2 V617 and exon 12 mutations. The association between the JAK2 haplotypeGGCC_46/1 and mutations in other genes, such as thrombopoietin receptor (MPL) and calreticulin (CALR), or the association with triple negative MPN, is still controversial. This review provides an overview of the frequency and the role of the JAK2 haplotypeGGCC_46/1 in the pathogenesis of different myeloid neoplasms and describes the hypothetical mechanisms at the basis of the association with JAK2 gene mutations. Moreover, possible clinical implications are discussed, as different papers reported contrasting data about the correlation between the JAK2 haplotypeGGCC_46/1 and blood cell count, survival, or disease progression. PMID:29641446

  12. HLA-DR2-associated DRB1 and DRB5 alleles and haplotypes in Koreans.

    PubMed

    Song, E Y; Kang, S J; Lee, Y J; Park, M H

    2000-09-01

    There are considerable racial differences in the distribution of HLA-DR2-associated DRB1 and DRB5 alleles and the characteristics of linkage disequilibrium between these alleles. In this study, the frequencies of DR2-associated DRB1 and DRB5 alleles and related haplotypes were analyzed in 186 DR2-positive individuals out of 800 normal Koreans registered for unrelated bone marrow donors. HLA class I antigen typing was performed by the serological method and DRB1 and DRB5 genotyping by the PCR-single strand conformational polymorphism method. Only 3 alleles were detected for DR2-associated DRB1 and DRB5 genes, respectively: DRB1(*)1501 (gene frequency 8.0%), (*)1502 (3.2%), (*)1602 (0.9%); DRB5(*)0101 (8.0%), (*)0102 (3.2%), and (*)0202 (0.9%). DRB1-DRB5 haplotype analysis showed an exclusive association between these alleles: DRB1*1501-DRB5*0101 (haplotype frequency 8.0%), DRB1(*)1502-DRB5(*)0102 (3.2%), and DRB1(*)1602-DRB5(*)0202 (0.9%). The 5 most common DR2-associated A-B-DRB1 haplotypes occurring at frequencies of > or = 0.5% were A24-B52-DRB1(*)1502 (1.8%), A2-B62-DRB1(*)1501, A2-B54-DRB1(*)1501, A26-B61-DRB1(*)1501, and A24-B51-DRB1(*)1501. The remarkable homogeneity in the haplotypic associations between DR2-associated DRB1 and DRB5 alleles in Koreans would be advantageous for organ transplantation compared with other ethnic groups showing considerable heterogeneity in the distribution of DRB1-DRB5 haplotypes.

  13. PAX6 Haplotypes Are Associated with High Myopia in Han Chinese

    PubMed Central

    Jiang, Bo; Yap, Maurice K. H.; Leung, Kim Hung; Ng, Po Wah; Fung, Wai Yan; Lam, Wai Wa; Gu, Yang-shun; Yip, Shea Ping

    2011-01-01

    Background The paired box 6 (PAX6) gene is considered as a master gene for eye development. Linkage of myopia to the PAX6 region on chromosome 11p13 was shown in several studies, but the results for association between myopia and PAX6 were inconsistent so far. Methodology/Principal Findings We genotyped 16 single nucleotide polymorphisms (SNPs) in the PAX6 gene and its regulatory regions in an initial study for 300 high myopia cases and 300 controls (Group 1), and successfully replicated the positive results with another independent group of 299 high myopia cases and 299 controls (Group 2). Five SNPs were genotyped in the replication study. The spherical equivalent of subjects with high myopia was ≤−8.0 dioptres. The PLINK package was used for genetic data analysis. No association was found between each of the SNPs and high myopia. However, exhaustive sliding-window haplotype analysis highlighted an important role for rs12421026 because haplotypes containing this SNP were found to be associated with high myopia. The most significant results were given by the 4-SNP haplotype window consisting of rs2071754, rs3026393, rs1506 and rs12421026 (P = 3.54×10−10, 4.06×10−11 and 1.56×10−18 for Group 1, Group 2 and Combined Group, respectively) and the 3-SNP haplotype window composed of rs3026393, rs1506 and rs12421026 (P = 5.48×10−10, 7.93×10−12 and 6.28×10−23 for the three respective groups). The results remained significant after correction for multiple comparisons by permutations. The associated haplotyes found in a previous study were also successfully replicated in this study. Conclusions/Significance PAX6 haplotypes are associated with susceptibility to the development of high myopia in Chinese. The PAX6 locus plays a role in high myopia. PMID:21589860

  14. Modeling haplotype block variation using Markov chains.

    PubMed

    Greenspan, G; Geiger, D

    2006-04-01

    Models of background variation in genomic regions form the basis of linkage disequilibrium mapping methods. In this work we analyze a background model that groups SNPs into haplotype blocks and represents the dependencies between blocks by a Markov chain. We develop an error measure to compare the performance of this model against the common model that assumes that blocks are independent. By examining data from the International Haplotype Mapping project, we show how the Markov model over haplotype blocks is most accurate when representing blocks in strong linkage disequilibrium. This contrasts with the independent model, which is rendered less accurate by linkage disequilibrium. We provide a theoretical explanation for this surprising property of the Markov model and relate its behavior to allele diversity.

  15. Modeling Haplotype Block Variation Using Markov Chains

    PubMed Central

    Greenspan, G.; Geiger, D.

    2006-01-01

    Models of background variation in genomic regions form the basis of linkage disequilibrium mapping methods. In this work we analyze a background model that groups SNPs into haplotype blocks and represents the dependencies between blocks by a Markov chain. We develop an error measure to compare the performance of this model against the common model that assumes that blocks are independent. By examining data from the International Haplotype Mapping project, we show how the Markov model over haplotype blocks is most accurate when representing blocks in strong linkage disequilibrium. This contrasts with the independent model, which is rendered less accurate by linkage disequilibrium. We provide a theoretical explanation for this surprising property of the Markov model and relate its behavior to allele diversity. PMID:16361244

  16. Single nucleotide polymorphisms and haplotypes associated with feed efficiency in beef cattle

    PubMed Central

    2013-01-01

    Background General, breed- and diet-dependent associations between feed efficiency in beef cattle and single nucleotide polymorphisms (SNPs) or haplotypes were identified on a population of 1321 steers using a 50 K SNP panel. Genomic associations with traditional two-step indicators of feed efficiency – residual feed intake (RFI), residual average daily gain (RADG), and residual intake gain (RIG) – were compared to associations with two complementary one-step indicators of feed efficiency: efficiency of intake (EI) and efficiency of gain (EG). Associations uncovered in a training data set were evaluated on independent validation data set. A multi-SNP model was developed to predict feed efficiency. Functional analysis of genes harboring SNPs significantly associated with feed efficiency and network visualization aided in the interpretation of the results. Results For the five feed efficiency indicators, the numbers of general, breed-dependent, and diet-dependent associations with SNPs (P-value < 0.0001) were 31, 40, and 25, and with haplotypes were six, ten, and nine, respectively. Of these, 20 SNP and six haplotype associations overlapped between RFI and EI, and five SNP and one haplotype associations overlapped between RADG and EG. This result confirms the complementary value of the one and two-step indicators. The multi-SNP models included 89 SNPs and offered a precise prediction of the five feed efficiency indicators. The associations of 17 SNPs and 7 haplotypes with feed efficiency were confirmed on the validation data set. Nine clusters of Gene Ontology and KEGG pathway categories (mean P-value < 0.001) including, 9nucleotide binding; ion transport, phosphorous metabolic process, and the MAPK signaling pathway were overrepresented among the genes harboring the SNPs associated with feed efficiency. Conclusions The general SNP associations suggest that a single panel of genomic variants can be used regardless of breed and diet. The breed- and diet

  17. Population Structure With Localized Haplotype Clusters

    PubMed Central

    Browning, Sharon R.; Weir, Bruce S.

    2010-01-01

    We propose a multilocus version of FST and a measure of haplotype diversity using localized haplotype clusters. Specifically, we use haplotype clusters identified with BEAGLE, which is a program implementing a hidden Markov model for localized haplotype clustering and performing several functions including inference of haplotype phase. We apply this methodology to HapMap phase 3 data. With this haplotype-cluster approach, African populations have highest diversity and lowest divergence from the ancestral population, East Asian populations have lowest diversity and highest divergence, and other populations (European, Indian, and Mexican) have intermediate levels of diversity and divergence. These relationships accord with expectation based on other studies and accepted models of human history. In contrast, the population-specific FST estimates obtained directly from single-nucleotide polymorphisms (SNPs) do not reflect such expected relationships. We show that ascertainment bias of SNPs has less impact on the proposed haplotype-cluster-based FST than on the SNP-based version, which provides a potential explanation for these results. Thus, these new measures of FST and haplotype-cluster diversity provide an important new tool for population genetic analysis of high-density SNP data. PMID:20457877

  18. Singapore Genome Variation Project: a haplotype map of three Southeast Asian populations.

    PubMed

    Teo, Yik-Ying; Sim, Xueling; Ong, Rick T H; Tan, Adrian K S; Chen, Jieming; Tantoso, Erwin; Small, Kerrin S; Ku, Chee-Seng; Lee, Edmund J D; Seielstad, Mark; Chia, Kee-Seng

    2009-11-01

    The Singapore Genome Variation Project (SGVP) provides a publicly available resource of 1.6 million single nucleotide polymorphisms (SNPs) genotyped in 268 individuals from the Chinese, Malay, and Indian population groups in Southeast Asia. This online database catalogs information and summaries on genotype and phased haplotype data, including allele frequencies, assessment of linkage disequilibrium (LD), and recombination rates in a format similar to the International HapMap Project. Here, we introduce this resource and describe the analysis of human genomic variation upon agglomerating data from the HapMap and the Human Genome Diversity Project, providing useful insights into the population structure of the three major population groups in Asia. In addition, this resource also surveyed across the genome for variation in regional patterns of LD between the HapMap and SGVP populations, and for signatures of positive natural selection using two well-established metrics: iHS and XP-EHH. The raw and processed genetic data, together with all population genetic summaries, are publicly available for download and browsing through a web browser modeled with the Generic Genome Browser.

  19. Singapore Genome Variation Project: A haplotype map of three Southeast Asian populations

    PubMed Central

    Teo, Yik-Ying; Sim, Xueling; Ong, Rick T.H.; Tan, Adrian K.S.; Chen, Jieming; Tantoso, Erwin; Small, Kerrin S.; Ku, Chee-Seng; Lee, Edmund J.D.; Seielstad, Mark; Chia, Kee-Seng

    2009-01-01

    The Singapore Genome Variation Project (SGVP) provides a publicly available resource of 1.6 million single nucleotide polymorphisms (SNPs) genotyped in 268 individuals from the Chinese, Malay, and Indian population groups in Southeast Asia. This online database catalogs information and summaries on genotype and phased haplotype data, including allele frequencies, assessment of linkage disequilibrium (LD), and recombination rates in a format similar to the International HapMap Project. Here, we introduce this resource and describe the analysis of human genomic variation upon agglomerating data from the HapMap and the Human Genome Diversity Project, providing useful insights into the population structure of the three major population groups in Asia. In addition, this resource also surveyed across the genome for variation in regional patterns of LD between the HapMap and SGVP populations, and for signatures of positive natural selection using two well-established metrics: iHS and XP-EHH. The raw and processed genetic data, together with all population genetic summaries, are publicly available for download and browsing through a web browser modeled with the Generic Genome Browser. PMID:19700652

  20. Variants and Haplotypes in Angiotensinogen Gene Are Associated With Plasmatic Angiotensinogen Level in Mexican Population

    PubMed Central

    Balam-Ortiz, Eros; Esquivel-Villarreal, Adolfo; Alfaro-Ruiz, Luis; Carrillo, Karol; Elizalde, Adela; Gil, Trinidad; Urushihara, Maki; Kobori, Hiroyuki; Jimenez-Sanchez, Gerardo

    2011-01-01

    Introduction The plasmatic angiotensinogen (AGT) level has been associated with essential hypertension. Linkage analysis has found a relationship between the AGT gene locus and hypertension in the Mexican-American population, but studies have failed to identify genetic variants associated with hypertension or plasma AGT levels. This study analyzes the relationship between polymorphisms in the AGT gene and plasmatic AGT levels in Mexican population. Methods Nine polymorphisms in AGT gene were genotyped, and plasma AGT level was determined by enzyme-linked immunosorbent assay. Results Differences in AGT plasma levels were associated with 2 polymorphisms: T-20G, TT = 25.3 ± 8.3 versus TG + GG = 21.6 ± 8.8 μg/mL; P = 0.008 and C3389T (T174M), CC = 25.8 ± 9.9 versus TC + TT = 20.5 ± 5.4 μg/mL; P = 0.0002. Haplotype 2 was associated with low plasma AGT (−5.1 μg/mL [95% confidence interval: −8.6 to −1.6], P = 0.004) and Haplotype 8 was associated with high plasma AGT (6.5 μg/mL [95% confidence interval: 2.5 to 10.6], P = 0.001). This association remained after adjustment for covariates. A Likelihood Ratio Test for haplotype-phenotype association adjusted for covariates resulted in χ2 = 38.9, P = 0.0005. The total effect of the haplotypes on plasma AGT level variance was 19.5%. No association was identified between haplotypes and quantitative traits of blood pressure. Conclusions Two polymorphisms (T-20G and C3389T) and 2 haplotypes (H2 and H8) showed an association with plasma AGT levels in Mexican population. PMID:21629041

  1. KCNQ1 Haplotypes Associate with Type 2 Diabetes in Malaysian Chinese Subjects

    PubMed Central

    Saif-Ali, Riyadh; Ismail, Ikram S.; Al-Hamodi, Zaid; Al-Mekhlafi, Hesham M.; Siang, Lee C.; Alabsi, Aied M.; Muniandy, Sekaran

    2011-01-01

    The aim of this study was to investigate the association of single nucleotide polymorphisms (SNPs) and haplotypes of potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1) with type 2 diabetes (T2D) in Malaysian Chinese subjects. The KCNQ1 SNPs rs2237892, rs2283228 and rs2237895 were genotyped in 300 T2D patients and 230 control subjects without diabetes and metabolic syndrome. Two logistic regression models of analysis were applied, the first adjusted for age and gender while the second adjusted for age, gender and body mass index. The additive genetic analysis showed that adjusting for body mass index (BMI) even strengthened association of rs2237892, rs2283228 and rs2237895 with T2D (OR = 2.0, P = 5.1 × 10−5; OR = 1.9, P = 5.2 × 10−5; OR = 1.9, P = 7.8 × 10−5, respectively). The haplotype TCA containing the allele of rs2237892 (T), rs2283228 (C) and rs2237895 (A) was highly protective against T2D (Second model; OR = 0.17, P = 3.7 × 10−11). The KCNQ1 rs2237892 (TT), and the protective haplotype (TCA) were associated with higher beta-cell function (HOMA-B) in normal subjects (P = 0.0002; 0.014, respectively). This study found that KCNQ1 SNPs was associated with T2D susceptibility in Malaysian Chinese subjects. In addition, certain KCNQ1 haplotypes were strongly associated with T2D. PMID:22016621

  2. Meta-analysis of haplotype-association studies: comparison of methods and empirical evaluation of the literature

    PubMed Central

    2011-01-01

    Background Meta-analysis is a popular methodology in several fields of medical research, including genetic association studies. However, the methods used for meta-analysis of association studies that report haplotypes have not been studied in detail. In this work, methods for performing meta-analysis of haplotype association studies are summarized, compared and presented in a unified framework along with an empirical evaluation of the literature. Results We present multivariate methods that use summary-based data as well as methods that use binary and count data in a generalized linear mixed model framework (logistic regression, multinomial regression and Poisson regression). The methods presented here avoid the inflation of the type I error rate that could be the result of the traditional approach of comparing a haplotype against the remaining ones, whereas, they can be fitted using standard software. Moreover, formal global tests are presented for assessing the statistical significance of the overall association. Although the methods presented here assume that the haplotypes are directly observed, they can be easily extended to allow for such an uncertainty by weighting the haplotypes by their probability. Conclusions An empirical evaluation of the published literature and a comparison against the meta-analyses that use single nucleotide polymorphisms, suggests that the studies reporting meta-analysis of haplotypes contain approximately half of the included studies and produce significant results twice more often. We show that this excess of statistically significant results, stems from the sub-optimal method of analysis used and, in approximately half of the cases, the statistical significance is refuted if the data are properly re-analyzed. Illustrative examples of code are given in Stata and it is anticipated that the methods developed in this work will be widely applied in the meta-analysis of haplotype association studies. PMID:21247440

  3. Patterns of haplotypes for 92 cystic fibrosis mutations: Variability, association and recurrence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morral, N.; Llevadot, R.; Estivill, X.

    1994-09-01

    Most CFTR mutations are very uncommon among the cystic fibrosis population, with frequencies of less than 1%, and many are found only in specific areas. We have analyzed 92 CF mutations for several markers (4 microsatellites and 3 other polymorphisms) scattered in the CFTR gene. Haplotypes associated with these mutations can be used as a framework in the screening of chromosomes carrying unknown mutations. The association between mutation and haplotype reduces the number of mutations it is necessary to search for to a maximum of 16 for the same haplotype. Only mutations {triangle}F508, G542X and N1303K are associated with moremore » than one haplotype as a result of slippage at more than one microsatellite loci, suggesting that these three are the most ancient CF mutations. Recurrence has been found for at least 7 mutations: H199Y, R347P, L558S, R553X, 2184insA, 3272-26A{r_arrow}G, 3849+10kbC{r_arrow}T and R1162X. Also microsatellite analysis of chromosomes of several ethnic origins (Czech, Italian, Russian, Slovac and Spanish) suggested that possibility of three or more independent origins for mutations R334W, R347P, R1162X, and 3849+10kbC{r_arrow}T, which was confirmed by analysis of markers flanking these mutations.« less

  4. Three potato centromeres are associated with distinct haplotypes with or without megabase-sized satellite repeat arrays.

    PubMed

    Wang, Linsheng; Zeng, Zixian; Zhang, Wenli; Jiang, Jiming

    2014-02-01

    We report discoveries of different haplotypes associated with the centromeres of three potato chromosomes, including haplotypes composed of long arrays of satellite repeats and haplotypes lacking the same repeats. These results are in favor of the hypothesis that satellite repeat-based centromeres may originate from neocentromeres that lack repeats.

  5. Common PCSK1 haplotypes are associated with obesity in the Chinese population.

    PubMed

    Chang, Yi-Cheng; Chiu, Yen-Feng; Shih, Kuang-Chung; Lin, Ming-Wei; Sheu, Wayne Huey-Herng; Donlon, Timothy; Curb, Jess David; Jou, Yuh-Shan; Chang, Tien-Jyun; Li, Hung-Yuan; Chuang, Lee-Ming

    2010-07-01

    Prohormone convertase subtilisin/kexin type 1 (PCSK1) genetic polymorphisms have recently been associated with obesity in European populations. This study aimed to examine whether common PCSK1 genetic variation is associated with obesity and related metabolic phenotypes in the Chinese population. We genotyped nine common tag single-nucleotide polymorphisms (tagSNP) of the PCSK1 gene in 1,094 subjects of Chinese origin from the Stanford Asia-Pacific Program for Hypertension and Insulin Resistance (SAPPHIRe) family study. One SNP in the PCSK1 gene (rs155971) were nominally associated with risk of obesity in the SAPPHIRe cohort (P = 0.01). A common protective haplotype was associated with reduced risk of obesity (23.79% vs. 32.89%, P = 0.01) and smaller waist circumference (81.71 +/- 10.22 vs. 84.75 +/- 10.48 cm, P = 0.02). Another common haplotype was significantly associated with increased risk of obesity (37.07% vs. 23.84%, P = 0.005). The global P value for haplotype association with obesity was 0.02. We also identified a suggestive association of another PCSK1 SNP (rs3811951) with fasting glucose, fasting insulin, homeostasis model assessment of insulin resistance (HOMA(IR)), triglycerides, and high-density lipoprotein cholesterol (P = 0.05, 0.003, 0.001, 0.04, and 0.04, respectively). These data indicate common PCSK1 genetic variants are associated with obesity in the Chinese population.

  6. Genetic variation in heat shock protein 70 is associated with septic shock: narrowing the association to a specific haplotype.

    PubMed

    Kee, C; Cheong, K Y; Pham, K; Waterer, G W; Temple, S E L

    2008-12-01

    Heat shock protein 70 (HSP70) plays a major role in immune responses. Polymorphisms within the gene have been associated with development of septic shock. This study refines the region of the HSP70 gene associated with development of septic shock and confirms its functionality. Subjects (n = 31) were grouped into one of three haplotypes based on their HSPA1B-179C>T and HSPA1B1267A>G genotypes. Mononuclear cells from these subjects were stimulated with heat-killed bacteria (10(7 )colony-forming units/mL Escherichia coli or Streptococcus pneumoniae) for 8 and 21 h. HSP70 and tumour necrosis factor (TNF) mRNA and protein levels were measured by reverse transcriptase-polymerase chain reaction and ELISA, respectively. The HSPA1B-179*C:1267*A haplotype was associated with significantly lower levels of HSPA1B mRNA and protein and higher production of TNF mRNA and protein compared to the other haplotypes. Induction of HSP70 was TNF independent. These results suggest that the HSPA1B-179C>T:1267A>G haplotype is functional and may explain the association of the HSP70 gene with development of septic shock.

  7. Variation analysis and gene annotation of eight MHC haplotypes: The MHC Haplotype Project

    PubMed Central

    Horton, Roger; Gibson, Richard; Coggill, Penny; Miretti, Marcos; Allcock, Richard J.; Almeida, Jeff; Forbes, Simon; Gilbert, James G. R.; Halls, Karen; Harrow, Jennifer L.; Hart, Elizabeth; Howe, Kevin; Jackson, David K.; Palmer, Sophie; Roberts, Anne N.; Sims, Sarah; Stewart, C. Andrew; Traherne, James A.; Trevanion, Steve; Wilming, Laurens; Rogers, Jane; de Jong, Pieter J.; Elliott, John F.; Sawcer, Stephen; Todd, John A.; Trowsdale, John

    2008-01-01

    The human major histocompatibility complex (MHC) is contained within about 4 Mb on the short arm of chromosome 6 and is recognised as the most variable region in the human genome. The primary aim of the MHC Haplotype Project was to provide a comprehensively annotated reference sequence of a single, human leukocyte antigen-homozygous MHC haplotype and to use it as a basis against which variations could be assessed from seven other similarly homozygous cell lines, representative of the most common MHC haplotypes in the European population. Comparison of the haplotype sequences, including four haplotypes not previously analysed, resulted in the identification of >44,000 variations, both substitutions and indels (insertions and deletions), which have been submitted to the dbSNP database. The gene annotation uncovered haplotype-specific differences and confirmed the presence of more than 300 loci, including over 160 protein-coding genes. Combined analysis of the variation and annotation datasets revealed 122 gene loci with coding substitutions of which 97 were non-synonymous. The haplotype (A3-B7-DR15; PGF cell line) designated as the new MHC reference sequence, has been incorporated into the human genome assembly (NCBI35 and subsequent builds), and constitutes the largest single-haplotype sequence of the human genome to date. The extensive variation and annotation data derived from the analysis of seven further haplotypes have been made publicly available and provide a framework and resource for future association studies of all MHC-associated diseases and transplant medicine. PMID:18193213

  8. Musical aptitude is associated with AVPR1A-haplotypes.

    PubMed

    Ukkola, Liisa T; Onkamo, Päivi; Raijas, Pirre; Karma, Kai; Järvelä, Irma

    2009-05-20

    Artistic creativity forms the basis of music culture and music industry. Composing, improvising and arranging music are complex creative functions of the human brain, which biological value remains unknown. We hypothesized that practicing music is social communication that needs musical aptitude and even creativity in music. In order to understand the neurobiological basis of music in human evolution and communication we analyzed polymorphisms of the arginine vasopressin receptor 1A (AVPR1A), serotonin transporter (SLC6A4), catecol-O-methyltranferase (COMT), dopamin receptor D2 (DRD2) and tyrosine hydroxylase 1 (TPH1), genes associated with social bonding and cognitive functions in 19 Finnish families (n = 343 members) with professional musicians and/or active amateurs. All family members were tested for musical aptitude using the auditory structuring ability test (Karma Music test; KMT) and Carl Seashores tests for pitch (SP) and for time (ST). Data on creativity in music (composing, improvising and/or arranging music) was surveyed using a web-based questionnaire. Here we show for the first time that creative functions in music have a strong genetic component (h(2) = .84; composing h(2) = .40; arranging h(2) = .46; improvising h(2) = .62) in Finnish multigenerational families. We also show that high music test scores are significantly associated with creative functions in music (p<.0001). We discovered an overall haplotype association with AVPR1A gene (markers RS1 and RS3) and KMT (p = 0.0008; corrected p = 0.00002), SP (p = 0.0261; corrected p = 0.0072) and combined music test scores (COMB) (p = 0.0056; corrected p = 0.0006). AVPR1A haplotype AVR+RS1 further suggested a positive association with ST (p = 0.0038; corrected p = 0.00184) and COMB (p = 0.0083; corrected p = 0.0040) using haplotype-based association test HBAT. The results suggest that the neurobiology of music perception and production is likely to be related to the pathways affecting intrinsic

  9. Association and haplotype analysis of the insulin-degrading enzyme (IDE) gene, a strong positional and biological candidate for type 2 diabetes susceptibility.

    PubMed

    Groves, Christopher J; Wiltshire, Steven; Smedley, Damian; Owen, Katherine R; Frayling, Timothy M; Walker, Mark; Hitman, Graham A; Levy, Jonathan C; O'Rahilly, Stephen; Menzel, Stephan; Hattersley, Andrew T; McCarthy, Mark I

    2003-05-01

    The gene for insulin-degrading enzyme (IDE) represents a strong positional and biological candidate for type 2 diabetes susceptibility. IDE maps to chromosome 10q23.3, a region linked to diabetes in several populations; the rat homolog has been directly implicated in diabetes susceptibility; and known functions of IDE support an important role in glucose homeostasis. We sought evidence for association between IDE variation and diabetes by mutation screening, defining local haplotype structure, and genotyping variants delineating common haplotypic diversity. An initial case-control analysis (628 diabetic probands from multiplex sibships and 604 control subjects) found no haplotypic associations, although one variant (IDE2, -179T-->C) showed modest association with diabetes (odds ratio [OR]1.25, P = 0.03). Linkage partitioning analyses failed to support this association, but provided borderline evidence for a different variant (IDE10, IVS20-405A-->G) (P = 0.06). Neither variant was associated with diabetes when replication was sought in 377 early onset diabetic subjects and 825 control subjects, though combined analysis of all typed cohorts indicated a nominally significant effect at IDE2 (OR 1.21 [1.04-1.40], P = 0.013). In the absence of convincing support for this association from linkage partitioning or analyses of continuous measures of glycemia, we conclude that analysis of over 2,400 samples provides no compelling evidence that variation in IDE contributes to diabetes susceptibility in humans.

  10. Sex differences in TTC12/ANKK1 haplotype associations with daily tobacco smoking in Black and White Americans.

    PubMed

    David, Sean P; Mezuk, Briana; Zandi, Peter P; Strong, David; Anthony, James C; Niaura, Raymond; Uhl, George R; Eaton, William W

    2010-03-01

    The 11q23.1 genomic region has been associated with nicotine dependence in Black and White Americans. By conducting linkage disequilibrium analyses of 7 informative single nucleotide polymorphisms (SNPs) within the tetratricopeptide repeat domain 12 (TTC12)/ankyrin repeat and kinase containing 1 (ANKK1)/dopamine (D2) receptor gene cluster, we identified haplotype block structures in 270 Black and 368 White (n = 638) participants, from the Baltimore Epidemiologic Catchment Area cohort study, spanning the TTC12 and ANKK1 genes consisting of three SNPs (rs2303380-rs4938015-rs11604671). Informative haplotypes were examined for sex-specific associations with daily tobacco smoking initiation and cessation using longitudinal data from 1993-1994 and 2004-2005 interviews. There was a Haplotype x Sex interaction such that Black men possessing the GTG haplotype who were smokers in 1993-2004 were more likely to have stopped smoking by 2004-2005 (55.6% GTG vs. 22.0% other haplotypes), while Black women were less likely to have quit smoking if they possessed the GTG (20.8%) versus other haplotypes (24.0%; p = .028). In Whites, the GTG haplotype (vs. other haplotypes) was associated with lifetime history of daily smoking (smoking initiation; odds ratio = 1.6; 95% CI = 1.1-2.4; p = .013). Moreover, there was a Haplotype x Sex interaction such that there was higher prevalence of smoking initiation with GTG (77.6%) versus other haplotypes (57.0%; p = .043). In 2 different ethnic American populations, we observed man-woman variation in the influence of the rs2303380-rs4938015-rs11604671 GTG haplotype on smoking initiation and cessation. These results should be replicated in larger cohorts to establish the relationship among the rs2303380-rs4938015-rs11604671 haplotype block, sex, and smoking behavior.

  11. Neuropsychiatric systemic lupus erythematosus is associated with imbalance in interleukin 10 promoter haplotypes

    PubMed Central

    Rood, M; Keijsers, V; van der Linden, M W; Tong, T; Borggreve, S; Verweij, C; Breedveld, F; Huizinga, T

    1999-01-01

    OBJECTIVE—To investigate the association of interleukin 10 (IL10) promoter polymorphisms and neuropsychiatric manifestations of systemic lupus erythematosus (SLE).
METHODS—IL10 haplotypes of 11 healthy volunteers were cloned to confirm that in the Dutch population, only the three common haplotypes (-1082/-819/-592) GCC, ACC and ATA exist. The IL10 promoter polymorphisms of 92 SLE patients and 162 healthy controls were determined. The medical records of the SLE patients were screened for the presence of neuropsychiatric involvement.
RESULTS—All cloned haplotypes were either GCC, ACC or ATA. Forty two SLE patients had suffered from neuropsychiatric manifestations (NP-SLE). In NP-SLE patients, the frequency of the ATA haplotype is 30% versus 18% in the controls and 17% in the non-NP-SLE group (odds ratios 1.9, p=0.02, and 2.1, p=0.04, respectively), whereas the GCC haplotype frequency is lower in the NP-SLE group compared with controls and non-NP-SLE patients (40% versus 55% and 61%, odds ratios 0.6, p=0.02 and 0.4 p=0.006). The odds ratio for the presence of NP-SLE is inversely proportional to the number of GCC haplotypes per genotype when the NP-SLE group is compared with non-NP-SLE patients.
CONCLUSIONS—The IL10 locus is associated with neuropsychiatric manifestations in SLE. This suggests that IL10 is implicated in the immunopathogenesis of neuropsychiatric manifestations in SLE.

 Keywords: systemic lupus erythematosus; neuropsychiatric manifestations; genetics; interleukin 10 promoter haplotypes PMID:10343522

  12. A new JAVA interface implementation of THESIAS: testing haplotype effects in association studies.

    PubMed

    Tregouet, D A; Garelle, V

    2007-04-15

    THESIAS (Testing Haplotype EffectS In Association Studies) is a popular software for carrying haplotype association analysis in unrelated individuals. In addition to the command line interface, a graphical JAVA interface is now proposed allowing one to run THESIAS in a user-friendly manner. Besides, new functionalities have been added to THESIAS including the possibility to analyze polychotomous phenotype and X-linked polymorphisms. The software package including documentation and example data files is freely available at http://genecanvas.ecgene.net. The source codes are also available upon request.

  13. Association studies of excision repair cross-complementation group 1 (ERCC1) haplotypes with lung and head and neck cancer risk in a Caucasian population.

    PubMed

    Jones, Nathan R; Spratt, Thomas E; Berg, Arthur S; Muscat, Joshua E; Lazarus, Philip; Gallagher, Carla J

    2011-04-01

    The formation of bulky DNA adducts caused by diol epoxide derivatives of polycyclic aromatic hydrocarbons has been associated with tobacco-induced cancers, and inefficient repair of such adducts by the nucleotide excision repair (NER) system has been linked to increased risk of tobacco-induced lung and head and neck (H&N) cancers. The human excision repair cross-complementation group 1 (ERCC1) protein is essential for a functional NER system and genetic variation in ERCC1 may contribute to impaired DNA repair capacity and increased lung and H&N cancer risk. In order to comprehensively capture common genetic variation in the ERCC1 gene, Caucasian data from the International HapMap project was used to assess linkage disequilibrium and choose four tagSNPs (rs1319052, rs3212955, rs3212948, and rs735482) in the ERCC1 gene to genotype 452 lung cancer cases, 175 H&N cancer cases, and 790 healthy controls. Haplotypes were estimated using expectation maximization (EM) algorithm, and haplotype association with cancer was investigated using Haplo.stats software adjusting for known covariates. The genotype and haplotype frequencies matched previous estimates from Caucasians. There was no significant difference in the prevalence of rs1319052, rs3212955, rs3212948, and rs735482 when comparing lung or H&N cancer cases with controls (p-values>0.05). Similarly, there was no association between ERCC1 haplotypes and lung or H&N cancer susceptibility in this Caucasian population (p-values>0.05). No associations were found when stratifying lung cancer cases by histology, sex, smoking status, or smoking intensity. This study suggests that ERCC1 polymorphisms and haplotypes do not play a role in lung and H&N cancer susceptibility in Caucasians. Copyright © 2010 Elsevier Ltd. All rights reserved.

  14. Association between platelet P2Y12 haplotype and risk of cardiovascular events in chronic coronary disease.

    PubMed

    Schettert, Isolmar T; Pereira, Alexandre C; Lopes, Neuza H; Hueb, Whady A; Krieger, Jose E

    2006-01-01

    A positive association was recently described between P2Y12 platelet receptor H1 and H2 haplotypes and peripheral artery disease. We tested the described P2Y12 receptor haplotypes in a group of patients with coronary artery disease. The P2Y12 platelet receptor H1 and H2 haplotypes was tested in a group of 540 patients enrolled in the Medical, Angioplasty, or Surgery Study II (MASS II), a randomized trial comparing treatments for patients with coronary artery disease (CAD) and preserved left ventricular function. After a 3-year follow-up period, the incidence of the composite end point of cardiac death, myocardial infarction, and refractory angina requiring revascularization was determined in the H1/H1, H1/H2 and H2/H2 haplotype groups. We used Student's t-test and the chi-square test to analyze the differences among groups and Kaplan-Meier method to calculate survival curves. Risk was assessed with the use of a Cox proportional-hazards model. The frequency of haplotypes among studied patients were 410 (75.9%) H1/H1, 119 (22.0%) H1/H2 and 11 (2.1%) H2/H2. The baseline clinical characteristics, mean clinical follow-up time and received treatment of each genotype group were similar. We did not disclose any association between haplotype groups regarding the incidence of any of the studied cardiovascular end-points. This is the first report studying the association of P2Y12 platelet receptor H1 and H2 haplotype and cardiovascular events. Our findings do not provide evidence for a strong association between H1/H1 and H1/H2 haplotypes and a increased risk of cardiovascular events in a population with CAD. Future works should address the role of the H2/H2 haplotype as a genetic marker for cardiovascular events.

  15. Haplotypic Analysis of Wellcome Trust Case Control Consortium Data

    PubMed Central

    Browning, Brian L.; Browning, Sharon R.

    2008-01-01

    We applied a recently developed multilocus association testing method (localized haplotype clustering) to Wellcome Trust Case Control Consortium data (14,000 cases of seven common diseases and 3,000 shared controls genotyped on the Affymetrix 500K array). After rigorous data quality filtering, we identified three disease-associated loci with strong statistical support from localized haplotype cluster tests but with only marginal significance in single marker tests. These loci are chromosomes 10p15.1 with type 1 diabetes (p = 5.1 × 10-9), 12q15 with type 2 diabetes (p = 1.9 × 10-7) and 15q26.2 with hypertension (p = 2.8 × 10-8). We also detected the association of chromosome 9p21.3 with type 2 diabetes (p = 2.8 × 10-8), although this locus did not pass our stringent genotype quality filters. The association of 10p15.1 with type 1 diabetes and 9p21.3 with type 2 diabetes have both been replicated in other studies using independent data sets. Overall, localized haplotype cluster analysis had better success detecting disease associated variants than a previous single-marker analysis of imputed HapMap SNPs. We found that stringent application of quality score thresholds to genotype data substantially reduced false-positive results arising from genotype error. In addition, we demonstrate that it is possible to simultaneously phase 16,000 individuals genotyped on genome-wide data (450K markers) using the Beagle software package. PMID:18224336

  16. Association of two independent functional risk haplotypes in TNIP1 with systemic lupus erythematosus.

    PubMed

    Adrianto, Indra; Wang, Shaofeng; Wiley, Graham B; Lessard, Christopher J; Kelly, Jennifer A; Adler, Adam J; Glenn, Stuart B; Williams, Adrienne H; Ziegler, Julie T; Comeau, Mary E; Marion, Miranda C; Wakeland, Benjamin E; Liang, Chaoying; Kaufman, Kenneth M; Guthridge, Joel M; Alarcón-Riquelme, Marta E; Alarcón, Graciela S; Anaya, Juan-Manuel; Bae, Sang-Cheol; Kim, Jae-Hoon; Joo, Young Bin; Boackle, Susan A; Brown, Elizabeth E; Petri, Michelle A; Ramsey-Goldman, Rosalind; Reveille, John D; Vilá, Luis M; Criswell, Lindsey A; Edberg, Jeffrey C; Freedman, Barry I; Gilkeson, Gary S; Jacob, Chaim O; James, Judith A; Kamen, Diane L; Kimberly, Robert P; Martín, Javier; Merrill, Joan T; Niewold, Timothy B; Pons-Estel, Bernardo A; Scofield, R Hal; Stevens, Anne M; Tsao, Betty P; Vyse, Timothy J; Langefeld, Carl D; Harley, John B; Wakeland, Edward K; Moser, Kathy L; Montgomery, Courtney G; Gaffney, Patrick M

    2012-11-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by autoantibody production and altered type I interferon expression. Genetic surveys and genome-wide association studies have identified >30 SLE susceptibility genes. One of these genes, TNIP1, encodes the ABIN1 protein. ABIN1 functions in the immune system by restricting NF-κB signaling. The present study was undertaken to investigate the genetic factors that influence association with SLE in genes that regulate the NF-κB pathway. We analyzed a dense set of genetic markers spanning TNIP1 and TAX1BP1, as well as the TNIP1 homolog TNIP2, in case-control populations of diverse ethnic origins. TNIP1, TNIP2, and TAX1BP1 were fine-mapped in a total of 8,372 SLE cases and 7,492 healthy controls from European-ancestry, African American, Hispanic, East Asian, and African American Gullah populations. Levels of TNIP1 messenger RNA (mRNA) and ABIN1 protein in Epstein-Barr virus-transformed human B cell lines were analyzed by quantitative reverse transcription-polymerase chain reaction and Western blotting, respectively. We found significant associations between SLE and genetic variants within TNIP1, but not in TNIP2 or TAX1BP1. After resequencing and imputation, we identified 2 independent risk haplotypes within TNIP1 in individuals of European ancestry that were also present in African American and Hispanic populations. Levels of TNIP1 mRNA and ABIN1 protein were reduced among subjects with these haplotypes, suggesting that they harbor hypomorphic functional variants that influence susceptibility to SLE by restricting ABIN1 expression. Our results confirm the association signals between SLE and TNIP1 variants in multiple populations and provide new insight into the mechanism by which TNIP1 variants may contribute to SLE pathogenesis. Copyright © 2012 by the American College of Rheumatology.

  17. Two Independent Functional Risk Haplotypes in TNIP1 are Associated with Systemic Lupus Erythematosus

    PubMed Central

    Adrianto, Indra; Wang, Shaofeng; Wiley, Graham B.; Lessard, Christopher J.; Kelly, Jennifer A.; Adler, Adam J.; Glenn, Stuart B.; Williams, Adrienne H.; Ziegler, Julie T.; Comeau, Mary E.; Marion, Miranda C.; Wakeland, Benjamin E.; Liang, Chaoying; Kaufman, Kenneth M.; Guthridge, Joel M.; Alarcón-Riquelme, Marta E.; Alarcón, Graciela S.; Anaya, Juan-Manuel; Bae, Sang-Cheol; Kim, Jae-Hoon; Joo, Young Bin; Boackle, Susan A.; Brown, Elizabeth E.; Petri, Michelle A.; Ramsey-Goldman, Rosalind; Reveille, John D.; Vilá, Luis M.; Criswell, Lindsey A.; Edberg, Jeffrey C.; Freedman, Barry I.; Gilkeson, Gary S.; Jacob, Chaim O.; James, Judith A.; Kamen, Diane L.; Kimberly, Robert P.; Martin, Javier; Merrill, Joan T.; Niewold, Timothy B.; Pons-Estel, Bernardo A.; Scofield, R. Hal; Stevens, Anne M.; Tsao, Betty P.; Vyse, Timothy J.; Langefeld, Carl D.; Harley, John B.; Wakeland, Edward K.; Moser, Kathy L.; Montgomery, Courtney G.; Gaffney, Patrick M.

    2012-01-01

    Objective Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by autoantibody production and altered type I interferon expression. Genetic surveys and genome-wide association studies have identified more than 30 SLE susceptibility genes. One of these genes, TNIP1, encodes the ABIN1 protein. ABIN1 functions in the immune system by restricting the NF-κB signaling. In order to better understand the genetic factors that influence association with SLE in genes that regulate the NF-κB pathway, we analyzed a dense set of genetic markers spanning TNIP1 and TAX1BP1, as well as the TNIP1 homolog, TNIP2, in case-control sets of diverse ethnic origins. Methods We fine-mapped TNIP1, TNIP2, and TAX1BP1 in a total of 8372 SLE cases and 7492 healthy controls from European-ancestry, African-American, Hispanic, East Asian, and African-American Gullah populations. Levels of TNIP1 mRNA and ABIN1 protein were analyzed using quantitative RT-PCR and Western blotting, respectively, in EBV-transformed human B cell lines. Results We found significant associations between genetic variants within TNIP1 and SLE but not in TNIP2 or TAX1BP1. After resequencing and imputation, we identified two independent risk haplotypes within TNIP1 in individuals of European-ancestry that were also present in African-American and Hispanic populations. These risk haplotypes produced lower levels of TNIP1 mRNA and ABIN1 protein suggesting they harbor hypomorphic functional variants that influence susceptibility to SLE by restricting ABIN1 expression. Conclusion Our results confirmed the association signals between SLE and TNIP1 variants in multiple populations and provide new insight into the mechanism by which TNIP1 variants may contribute to SLE pathogenesis. PMID:22833143

  18. Musical Aptitude Is Associated with AVPR1A-Haplotypes

    PubMed Central

    Ukkola, Liisa T.; Onkamo, Päivi; Raijas, Pirre; Karma, Kai; Järvelä, Irma

    2009-01-01

    Artistic creativity forms the basis of music culture and music industry. Composing, improvising and arranging music are complex creative functions of the human brain, which biological value remains unknown. We hypothesized that practicing music is social communication that needs musical aptitude and even creativity in music. In order to understand the neurobiological basis of music in human evolution and communication we analyzed polymorphisms of the arginine vasopressin receptor 1A (AVPR1A), serotonin transporter (SLC6A4), catecol-O-methyltranferase (COMT), dopamin receptor D2 (DRD2) and tyrosine hydroxylase 1 (TPH1), genes associated with social bonding and cognitive functions in 19 Finnish families (n = 343 members) with professional musicians and/or active amateurs. All family members were tested for musical aptitude using the auditory structuring ability test (Karma Music test; KMT) and Carl Seashores tests for pitch (SP) and for time (ST). Data on creativity in music (composing, improvising and/or arranging music) was surveyed using a web-based questionnaire. Here we show for the first time that creative functions in music have a strong genetic component (h2 = .84; composing h2 = .40; arranging h2 = .46; improvising h2 = .62) in Finnish multigenerational families. We also show that high music test scores are significantly associated with creative functions in music (p<.0001). We discovered an overall haplotype association with AVPR1A gene (markers RS1 and RS3) and KMT (p = 0.0008; corrected p = 0.00002), SP (p = 0.0261; corrected p = 0.0072) and combined music test scores (COMB) (p = 0.0056; corrected p = 0.0006). AVPR1A haplotype AVR+RS1 further suggested a positive association with ST (p = 0.0038; corrected p = 0.00184) and COMB (p = 0.0083; corrected p = 0.0040) using haplotype-based association test HBAT. The results suggest that the neurobiology of music perception and production is likely to be

  19. The putative oncogene Pim-1 in the mouse: its linkage and variation among t haplotypes.

    PubMed

    Nadeau, J H; Phillips, S J

    1987-11-01

    Pim-1, a putative oncogene involved in T-cell lymphomagenesis, was mapped between the pseudo-alpha globin gene Hba-4ps and the alpha-crystallin gene Crya-1 on mouse chromosome 17 and therefore within the t complex. Pim-1 restriction fragment variants were identified among t haplotypes. Analysis of restriction fragment sizes obtained with 12 endonucleases demonstrated that the Pim-1 genes in some t haplotypes were indistinguishable from the sizes for the Pim-1b allele in BALB/c inbred mice. There are now three genes, Pim-1, Crya-1 and H-2 I-E, that vary among independently derived t haplotypes and that have indistinguishable alleles in t haplotypes and inbred strains. These genes are closely linked within the distal inversion of the t complex. Because it is unlikely that these variants arose independently in t haplotypes and their wild-type homologues, we propose that an exchange of chromosomal segments, probably through double crossingover, was responsible for indistinguishable Pim-1 genes shared by certain t haplotypes and their wild-type homologues. There was, however, no apparent association between variant alleles of these three genes among t haplotypes as would be expected if a single exchange introduced these alleles into t haplotypes. If these variant alleles can be shown to be identical to the wild-type allele, then lack of association suggests that multiple exchanges have occurred during the evolution of the t complex.

  20. A spatial haplotype copying model with applications to genotype imputation.

    PubMed

    Yang, Wen-Yun; Hormozdiari, Farhad; Eskin, Eleazar; Pasaniuc, Bogdan

    2015-05-01

    Ever since its introduction, the haplotype copy model has proven to be one of the most successful approaches for modeling genetic variation in human populations, with applications ranging from ancestry inference to genotype phasing and imputation. Motivated by coalescent theory, this approach assumes that any chromosome (haplotype) can be modeled as a mosaic of segments copied from a set of chromosomes sampled from the same population. At the core of the model is the assumption that any chromosome from the sample is equally likely to contribute a priori to the copying process. Motivated by recent works that model genetic variation in a geographic continuum, we propose a new spatial-aware haplotype copy model that jointly models geography and the haplotype copying process. We extend hidden Markov models of haplotype diversity such that at any given location, haplotypes that are closest in the genetic-geographic continuum map are a priori more likely to contribute to the copying process than distant ones. Through simulations starting from the 1000 Genomes data, we show that our model achieves superior accuracy in genotype imputation over the standard spatial-unaware haplotype copy model. In addition, we show the utility of our model in selecting a small personalized reference panel for imputation that leads to both improved accuracy as well as to a lower computational runtime than the standard approach. Finally, we show our proposed model can be used to localize individuals on the genetic-geographical map on the basis of their genotype data.

  1. Specific haplotypes of the CALPAIN-5 gene are associated with polycystic ovary syndrome.

    PubMed

    González, A; Sáez, M E; Aragón, M J; Galán, J J; Vettori, P; Molina, L; Rubio, C; Real, L M; Ruiz, Agustín; Ramírez-Lorca, R

    2006-04-01

    Polycystic ovary syndrome (PCOS) is a common endocrine disorder in women of reproductive age. The aim of the present study was to investigate the role of CALPAIN-5 (CAPN5) gene in PCOS susceptibility. We analysed four intronic polymorphisms of the CAPN5 gene in 148 well-characterized women with PCOS and 606 unrelated controls. We performed a case-control study and an intracohort analysis of clinical characteristics associated with PCOS. Analysis of haplotypes distribution between PCOS population compared to controls showed a strong deviation (P = 0.00029). The haplotypes GGCA and GGTG were overrepresented in PCOS patients (P = 0.009 and P = 0.001, respectively). In addition, we identified several CAPN5 haplotypes associated with phenotypic differences observed between PCOS patients, such as the presence of obesity (P = 0.02), cardiovascular complications (P = 0.02), familial antecedents of obesity (P = 0.003) and of hypertension (P = 0.007) and type 2 diabetes mellitus aggregation (P = 0.04). These results suggest a role of CAPN5 gene in PCOS susceptibility in humans. Moreover, novel candidate risk alleles have been identified, within CAPN5 gene, which could be associated with important phenotypic and prognosis differences observed in PCOS patients.

  2. The Association of a Novel Haplotype in the Dopamine Transporter with Preschool Age Posttraumatic Stress Disorder

    PubMed Central

    Brett, Zoë H.; Henry, Caitlin; Scheeringa, Michael

    2013-01-01

    Abstract Objective Significant evidence supports a genetic contribution to the development of posttraumatic stress disorder (PTSD). Three previous studies have demonstrated an association between PTSD and the nine repeat allele of the 3′ untranslated region (3′UTR) variable number tandem repeat (VNTR) in the dopamine transporter (DAT, rs28363170). Recently a novel, functionally significant C/T single-nucleotide polymorphism (SNP) in the 3′UTR (rs27072) with putative interactions with the 3′VNTR, has been identified. To provide enhanced support for the role of DAT and striatal dopamine regulation in the development of PTSD, this study examined the impact of a haplotype defined by the C allele of rs27072 and the nine repeat allele of the 3′VNTR on PTSD diagnosis in young trauma-exposed children. Methods DAT haplotypes were determined in 150 trauma-exposed 3–6 year-old children. PTSD was assessed with a semistructured interview. After excluding double heterozygotes, analysis was performed on 143 total subjects. Haplotype was examined in relation to categorical and continuous measures of PTSD, controlling for trauma type and race. Additional analysis within the two largest race categories was performed, as other means of controlling for ethnic stratification were not available. Results The number of haplotypes (0, 1, or 2) defined by the presence of the nine repeat allele of rs28363170 (VNTR in the 3′UTR) and the C allele of rs27072 (SNP in the 3′UTR) was significantly associated with both the diagnosis of PTSD and total PTSD symptoms. Specifically, children with one or two copies of the haplotype had significantly more PTSD symptoms and were more likely to be diagnosed with PTSD than were children without this haplotype. Conclusions These findings extend previous findings associating genetic variation in the DAT with PTSD. The association of a haplotype in DAT with PTSD provides incremental traction for a model of genetic vulnerability to PTSD, a

  3. Serum Klotho (but not haplotypes) associate with the post-myocardial infarction status of older adults

    PubMed Central

    Paula, Roberta S; Souza, Vinícius C; Machado-Silva, Wilcelly; Almeida, Bruno Ratier S; Daros, Andersen C; Gomes, Lucy; Ferreira, Aparecido P; Brito, Ciro J; Córdova, Cláudio; Moraes, Clayton F; Nóbrega, Otávio T

    2016-01-01

    OBJECTIVES: The number of deaths from vascular diseases is incredibly high worldwide, and reliable markers for major events are still needed. The current cross-sectional study investigated the association of Klotho haplotypes and Klotho serum levels with classic risk factors and a clinical history of vascular events. METHODS: Clinical, anthropometric, biochemical and nutritional assessments were conducted with 168 older adults, complemented by genotyping (rs9536314 and rs9527025) and the detection of serum Klotho (ELISA). RESULTS: Klotho levels and haplotypes did not associate with most classic risk factors for vascular events, including markers such as C-reactive protein and homocysteine. A positive association was only found between Klotho levels and the previous occurrence of a myocardial infarction by both correlational (p=0.006) and variance analyses (p<0.001), and these associations were independent of the context. CONCLUSION: Our results suggest that serum Klotho is higher in individuals with a clinical history of myocardial infarction but not with a history of coronary artery disease or stroke. None of the Klotho haplotypes were associated with the variables investigated herein. PMID:28076518

  4. Association of galanin haplotypes with alcoholism and anxiety in two ethnically distinct populations

    PubMed Central

    Belfer, I; Hipp, H; McKnight, C; Evans, C; Buzas, B; Bollettino, A; Albaugh, B; Virkkunen, M; Yuan, Q; Max, MB; Goldman, D; Enoch, MA

    2009-01-01

    The neuropeptide galanin (GAL) is widely expressed in the central nervous system. Animal studies have implicated GAL in alcohol abuse and anxiety: chronic ethanol intake increases hypothalamic GAL mRNA; high levels of stress increase GAL release in the central amygdala. The coding sequence of the galanin gene, GAL, is highly conserved and a functional polymorphism has not yet been found. The aim of our study was, for the first time, to identify GAL haplotypes and investigate associations with alcoholism and anxiety. Seven single-nucleotide polymorphisms (SNPs) spanning GAL were genotyped in 65 controls from five populations: US and Finnish Caucasians, African Americans, Plains and Southwestern Indians. A single haplotype block with little evidence of historical recombination was observed for each population. Four tag SNPs were then genotyped in DSM-III-R lifetime alcoholics and nonalcoholics from two population isolates: 514 Finnish Caucasian men and 331 Plains Indian men and women. Tridimensional Personality Questionnaire harm avoidance (HA) scores, a dimensional measure of anxiety, were obtained. There was a haplotype association with alcoholism in both the Finnish (P=0.001) and Plains Indian (P=0.004) men. The SNPs were also significantly associated. Alcoholics were divided into high and low HA groups (≥ and < mean HA of population). In the Finns, haplotype (P < 0.0001) and diplotype (P < 0.0001) distributions differed between high HA alcoholics, low HA alcoholics and nonalcoholics. Our results from two independent populations suggest that GAL may contribute to vulnerability to alcoholism, perhaps mediated by dimensional anxiety. PMID:16314872

  5. Mechanisms and Disease Associations of Haplotype-Dependent Allele-Specific DNA Methylation

    PubMed Central

    Do, Catherine; Lang, Charles F.; Lin, John; Darbary, Huferesh; Krupska, Izabela; Gaba, Aulona; Petukhova, Lynn; Vonsattel, Jean-Paul; Gallagher, Mary P.; Goland, Robin S.; Clynes, Raphael A.; Dwork, Andrew; Kral, John G.; Monk, Catherine; Christiano, Angela M.; Tycko, Benjamin

    2016-01-01

    Haplotype-dependent allele-specific methylation (hap-ASM) can impact disease susceptibility, but maps of this phenomenon using stringent criteria in disease-relevant tissues remain sparse. Here we apply array-based and Methyl-Seq approaches to multiple human tissues and cell types, including brain, purified neurons and glia, T lymphocytes, and placenta, and identify 795 hap-ASM differentially methylated regions (DMRs) and 3,082 strong methylation quantitative trait loci (mQTLs), most not previously reported. More than half of these DMRs have cell type-restricted ASM, and among them are 188 hap-ASM DMRs and 933 mQTLs located near GWAS signals for immune and neurological disorders. Targeted bis-seq confirmed hap-ASM in 12/13 loci tested, including CCDC155, CD69, FRMD1, IRF1, KBTBD11, and S100A∗-ILF2, associated with immune phenotypes, MYT1L, PTPRN2, CMTM8 and CELF2, associated with neurological disorders, NGFR and HLA-DRB6, associated with both immunological and brain disorders, and ZFP57, a trans-acting regulator of genomic imprinting. Polymorphic CTCF and transcription factor (TF) binding sites were over-represented among hap-ASM DMRs and mQTLs, and analysis of the human data, supplemented by cross-species comparisons to macaques, indicated that CTCF and TF binding likelihood predicts the strength and direction of the allelic methylation asymmetry. These results show that hap-ASM is highly tissue specific; an important trans-acting regulator of genomic imprinting is regulated by this phenomenon; and variation in CTCF and TF binding sites is an underlying mechanism, and maps of hap-ASM and mQTLs reveal regulatory sequences underlying supra- and sub-threshold GWAS peaks in immunological and neurological disorders. PMID:27153397

  6. Mitochondrial haplotypes are not associated with mice selectively bred for high voluntary wheel running.

    PubMed

    Wone, Bernard W M; Yim, Won C; Schutz, Heidi; Meek, Thomas H; Garland, Theodore

    2018-04-04

    Mitochondrial haplotypes have been associated with human and rodent phenotypes, including nonshivering thermogenesis capacity, learning capability, and disease risk. Although the mammalian mitochondrial D-loop is highly polymorphic, D-loops in laboratory mice are identical, and variation occurs elsewhere mainly between nucleotides 9820 and 9830. Part of this region codes for the tRNA Arg gene and is associated with mitochondrial densities and number of mtDNA copies. We hypothesized that the capacity for high levels of voluntary wheel-running behavior would be associated with mitochondrial haplotype. Here, we analyzed the mtDNA polymorphic region in mice from each of four replicate lines selectively bred for 54 generations for high voluntary wheel running (HR) and from four control lines (Control) randomly bred for 54 generations. Sequencing the polymorphic region revealed a variable number of adenine repeats. Single nucleotide polymorphisms (SNPs) varied from 2 to 3 adenine insertions, resulting in three haplotypes. We found significant genetic differentiations between the HR and Control groups (F st  = 0.779, p ≤ 0.0001), as well as among the replicate lines of mice within groups (F sc  = 0.757, p ≤ 0.0001). Haplotypes, however, were not strongly associated with voluntary wheel running (revolutions run per day), nor with either body mass or litter size. This system provides a useful experimental model to dissect the physiological processes linking mitochondrial, genomic SNPs, epigenetics, or nuclear-mitochondrial cross-talk to exercise activity. Copyright © 2018. Published by Elsevier B.V.

  7. Genetic variants in a haplotype block spanning IDE are significantly associated with plasma Abeta42 levels and risk for Alzheimer disease.

    PubMed

    Ertekin-Taner, Nilüfer; Allen, Mariet; Fadale, Daniel; Scanlin, Leah; Younkin, Linda; Petersen, Ronald C; Graff-Radford, Neill; Younkin, Steven G

    2004-04-01

    Risk for late onset Alzheimer disease (LOAD) and plasma amyloid beta levels (Abeta42; encoded by APP), an intermediate phenotype for LOAD, show linkage to chromosome 10q. Several strong candidate genes (VR22, PLAU, IDE) lie within the 1-lod support interval for linkage. Others have independently identified haplotypes in the chromosome 10q region harboring IDE that show highly significant association with intermediate AD phenotypes and with risk for AD. To pursue these associations, we analyzed the same haplotypes for association with plasma Abeta42 in 24 extended LOAD families and for association with LOAD in two independent case-control series. One series (MCR, 188 age-matched case-control pairs) did not show association (p=0.64) with the six haplotypes in the 276-kb region spanning three genes (IDE, KNSL1, and HHEX) previously shown to associate with LOAD. The other series (MCJ, 109 age-matched case-control pairs) showed significant (p=0.003) association with these haplotypes. In the MCJ series, the H4 (odds ratio [OR]=5.1, p=0.003) and H2(H7) haplotypes (OR=0.60, p=0.04) had the same effects previously reported. In this series, the H8 haplotype (OR=2.7, p=0.098) also had an effect similar as in one previous case control series but not in others. In the extended families, the H8 haplotype was associated with significantly elevated plasma Abeta42 (p=0.02). In addition, the H5(H10) haplotype, which is associated with reduced risk for AD in the other study is associated with reduced plasma Abeta42 (p=0.007) in our family series. These results provide strong evidence for pathogenic variant(s) in the 276-kb region harboring IDE that influence intermediate AD phenotypes and risk for AD. Copyright 2004 Wiley-Liss, Inc.

  8. Identification of methylation haplotype blocks aids in deconvolution of heterogeneous tissue samples and tumor tissue-of-origin mapping from plasma DNA.

    PubMed

    Guo, Shicheng; Diep, Dinh; Plongthongkum, Nongluk; Fung, Ho-Lim; Zhang, Kang; Zhang, Kun

    2017-04-01

    Adjacent CpG sites in mammalian genomes can be co-methylated owing to the processivity of methyltransferases or demethylases, yet discordant methylation patterns have also been observed, which are related to stochastic or uncoordinated molecular processes. We focused on a systematic search and investigation of regions in the full human genome that show highly coordinated methylation. We defined 147,888 blocks of tightly coupled CpG sites, called methylation haplotype blocks, after analysis of 61 whole-genome bisulfite sequencing data sets and validation with 101 reduced-representation bisulfite sequencing data sets and 637 methylation array data sets. Using a metric called methylation haplotype load, we performed tissue-specific methylation analysis at the block level. Subsets of informative blocks were further identified for deconvolution of heterogeneous samples. Finally, using methylation haplotypes we demonstrated quantitative estimation of tumor load and tissue-of-origin mapping in the circulating cell-free DNA of 59 patients with lung or colorectal cancer.

  9. Association of pro-ghrelin and GHS-R1A gene polymorphisms and haplotypes with heavy alcohol use and body mass.

    PubMed

    Landgren, Sara; Jerlhag, Elisabet; Zetterberg, Henrik; Gonzalez-Quintela, Arturo; Campos, Joaquin; Olofsson, Ulrica; Nilsson, Staffan; Blennow, Kaj; Engel, Jörgen A

    2008-12-01

    Ghrelin, an orexigenic peptide, acts on growth hormone secretagogue receptors (GHS-R1A), expressed in the hypothalamus as well as in important reward nodes such as the ventral tegmental area. Interestingly, ghrelin has been found to activate an important part of the reward systems, i.e., the cholinergic-dopaminergic reward link. Additionally, the rewarding and neurochemical properties of alcohol are, at least in part, mediated via this reward link. There is comorbidity between alcohol dependence and eating disorders. Thus, plasma levels of ghrelin are altered in patients with addictive behaviors such as alcohol and nicotine dependence and in binge eating disorder. This overlap prompted as to investigate the pro-ghrelin and GHS-R1A genes in a haplotype analysis of heavy alcohol-using individuals. A total of 417 Spanish individuals (abstainers, moderate, and heavy alcohol drinkers) were investigated in a haplotype analysis of the pro-ghrelin and GHS-R1A genes. Tag SNPs were chosen using HapMap data and the Tagger and Haploview softwares. These SNPs were then genotyped using TaqMan Allelic Discrimination. SNP rs2232165 of the GHS-R1A gene was associated with heavy alcohol consumption and SNP rs2948694 of the same gene as well as haplotypes of both the pro-ghrelin and the GHS-R1A genes were associated with body mass in heavy alcohol consuming individuals. The present findings are the first to disclose an association between the pro-ghrelin and GHS-R1A genes and heavy alcohol use, further strengthening the role of the ghrelin system in addictive behaviors and brain reward.

  10. Human neuronal acetylcholine receptor A5-A3-B4 haplotypes are associated with multiple nicotine dependence phenotypes

    PubMed Central

    Weiss, Robert B.; Bolt, Daniel; von Niederhausern, Andrew; Fiore, Michael C.; Dunn, Diane M.; Piper, Megan E.; Matsunami, Nori; Smith, Stevens S.; Coon, Hilary; McMahon, William M.; Scholand, Mary B.; Singh, Nanda; Hoidal, John R.; Kim, Su-Young; Leppert, Mark F.; Cannon, Dale S.

    2009-01-01

    Introduction: Previous research revealed significant associations between haplotypes in the CHRNA5-A3-B4 subunit cluster and scores on the Fagerström Test for Nicotine Dependence among individuals reporting daily smoking by age 17. The present study used subsamples of participants from that study to investigate associations between the CHRNA5-A3-B4 haplotypes and an array of phenotypes not analyzed previously (i.e., withdrawal severity, ability to stop smoking, and specific scales on the Wisconsin Inventory of Smoking Dependence Motives (WISDM-68) that reflect loss of control, strong craving, and heavy smoking. Methods: Two cohorts of current or former smokers (N = 886) provided both self-report data and DNA samples. One sample (Wisconsin) comprised smokers making a quit smoking attempt, which permitted the assessment of withdrawal and relapse during the attempt. The other sample (Utah) comprised participants studied for risk factors for nicotine dependence and chronic obstructive pulmonary disease and included individuals originally recruited in the Lung Health Study. Results: The CHRNA5-A3-B4 haplotypes were significantly associated with the targeted WISDM-68 scales (Tolerance, Craving, Loss of Control) in both samples of participants but only among individuals who began smoking early in life. The haplotypes were significantly associated with relapse likelihood and withdrawal severity, but these associations showed no evidence of an interaction with age at daily smoking. Discussion: The CHRNA5-A3-B4 haplotypes are associated with a broad range of nicotine dependence phenotypes, but these associations are not consistently moderated by age at initial smoking. PMID:19436041

  11. A parsimonious tree-grow method for haplotype inference.

    PubMed

    Li, Zhenping; Zhou, Wenfeng; Zhang, Xiang-Sun; Chen, Luonan

    2005-09-01

    Haplotype information has become increasingly important in analyzing fine-scale molecular genetics data, such as disease genes mapping and drug design. Parsimony haplotyping is one of haplotyping problems belonging to NP-hard class. In this paper, we aim to develop a novel algorithm for the haplotype inference problem with the parsimony criterion, based on a parsimonious tree-grow method (PTG). PTG is a heuristic algorithm that can find the minimum number of distinct haplotypes based on the criterion of keeping all genotypes resolved during tree-grow process. In addition, a block-partitioning method is also proposed to improve the computational efficiency. We show that the proposed approach is not only effective with a high accuracy, but also very efficient with the computational complexity in the order of O(m2n) time for n single nucleotide polymorphism sites in m individual genotypes. The software is available upon request from the authors, or from http://zhangroup.aporc.org/bioinfo/ptg/ chen@elec.osaka-sandai.ac.jp Supporting materials is available from http://zhangroup.aporc.org/bioinfo/ptg/bti572supplementary.pdf

  12. IL1B-CGTC haplotype is associated with colorectal cancer in admixed individuals with increased African ancestry

    PubMed Central

    Sanabria-Salas, María Carolina; Hernández-Suárez, Gustavo; Umaña-Pérez, Adriana; Rawlik, Konrad; Tenesa, Albert; Serrano-López, Martha Lucía; Sánchez de Gómez, Myriam; Rojas, Martha Patricia; Bravo, Luis Eduardo; Albis, Rosario; Plata, José Luis; Green, Heather; Borgovan, Theodor; Li, Li; Majumdar, Sumana; Garai, Jone; Lee, Edward; Ashktorab, Hassan; Brim, Hassan; Li, Li; Margolin, David; Fejerman, Laura; Zabaleta, Jovanny

    2017-01-01

    Single-nucleotide polymorphisms (SNPs) in cytokine genes can affect gene expression and thereby modulate inflammation and carcinogenesis. However, the data on the association between SNPs in the interleukin 1 beta gene (IL1B) and colorectal cancer (CRC) are conflicting. We found an association between a 4-SNP haplotype block of the IL1B (-3737C/-1464G/-511T/-31C) and CRC risk, and this association was exclusively observed in individuals with a higher proportion of African ancestry, such as individuals from the Coastal Colombian region (odds ratio, OR 2.06; 95% CI 1.31–3.25; p < 0.01). Moreover, a significant interaction between this CRC risk haplotype and local African ancestry dosage was identified in locus 2q14 (p = 0.03). We conclude that Colombian individuals with high African ancestry proportions at locus 2q14 harbour more IL1B-CGTC copies and are consequently at an increased risk of CRC. This haplotype has been previously found to increase the IL1B promoter activity and is the most frequent haplotype in African Americans. Despite of limitations in the number of samples and the lack of functional analysis to examine the effect of these haplotypes on CRC cell lines, our results suggest that inflammation and ethnicity play a major role in the modulation of CRC risk. PMID:28157220

  13. A founder haplotype of APOE-Sendai mutation associated with lipoprotein glomerulopathy.

    PubMed

    Toyota, Kentaro; Hashimoto, Taeko; Ogino, Daisuke; Matsunaga, Akira; Ito, Minoru; Masakane, Ikuto; Degawa, Noriyuki; Sato, Hiroshi; Shirai, Sayuri; Umetsu, Kazuo; Tamiya, Gen; Saito, Takao; Hayasaka, Kiyoshi

    2013-05-01

    Lipoprotein glomerulopathy (LPG) is a hereditary disease characterized by lipoprotein thrombi in the glomerulus, hyperlipoproteinemia, and a marked increase in serum apolipoprotein E (APOE). More than 12 APOE mutations have been identified as causes of LPG, and APOE-Sendai (Arg145Pro) mutation was frequently detected in patients from the eastern part of Japan including Yamagata prefecture. Recently, effective therapy with intensive lipid-lowering agents was established, and epidemiologic data are required for early diagnosis. We determined the haplotype structure of APOE-Sendai in 13 patients from 9 unrelated families with LPG, and found that the haplotype of all APOE-Sendai mutations was identical, suggesting that APOE-Sendai mutation is common in Japanese patients probably through a founder effect. We also studied the gene frequency of APOE-Sendai in 2023 control subjects and 418 patients receiving hemodialysis in Yamagata prefecture using the TaqMan method, but did not identify any subjects carrying the mutation, indicating that it is very rare in the general population even in the eastern part of Japan. In addition to APOE mutation, other genetic and/or epigenetic factors are considered to be involved in the pathogenesis of LPG because of its low penetrance. The patients did not have a common haplotype of the counterpart APOE allele, and some patients had the same haplotype of the counterpart APOE allele as the asymptomatic carriers. These results suggest that the counterpart APOE allele is not likely associated with the onset of LPG. Further study is required to clarify the pathogenesis of LPG.

  14. A new mathematical modeling for pure parsimony haplotyping problem.

    PubMed

    Feizabadi, R; Bagherian, M; Vaziri, H R; Salahi, M

    2016-11-01

    Pure parsimony haplotyping (PPH) problem is important in bioinformatics because rational haplotyping inference plays important roles in analysis of genetic data, mapping complex genetic diseases such as Alzheimer's disease, heart disorders and etc. Haplotypes and genotypes are m-length sequences. Although several integer programing models have already been presented for PPH problem, its NP-hardness characteristic resulted in ineffectiveness of those models facing the real instances especially instances with many heterozygous sites. In this paper, we assign a corresponding number to each haplotype and genotype and based on those numbers, we set a mixed integer programing model. Using numbers, instead of sequences, would lead to less complexity of the new model in comparison with previous models in a way that there are neither constraints nor variables corresponding to heterozygous nucleotide sites in it. Experimental results approve the efficiency of the new model in producing better solution in comparison to two state-of-the art haplotyping approaches. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. PTCH1 gene haplotype association with basal cell carcinoma after transplantation.

    PubMed

    Begnini, A; Tessari, G; Turco, A; Malerba, G; Naldi, L; Gotti, E; Boschiero, L; Forni, A; Rugiu, C; Piaserico, S; Fortina, A B; Brunello, A; Cascone, C; Girolomoni, G; Gomez Lira, M

    2010-08-01

    Basal cell carcinoma (BCC) is 10 times more frequent in organ transplant recipients (OTRs) than in the general population. Factors in OTRs conferring increased susceptibility to BCC include ultraviolet radiation exposure, immunosuppression, viral infections such as human papillomavirus, phototype and genetic predisposition. The PTCH1 gene is a negative regulator of the hedgehog pathway, that provides mitogenic signals to basal cells in skin. PTCH1 gene mutations cause naevoid BCC syndrome, and contribute to the development of sporadic BCC and other types of cancers. Associations have been reported between PTCH1 polymorphisms and BCC susceptibility in nontransplanted individuals. To search for novel common polymorphisms in the proximal 5' regulatory region upstream of PTCH1 gene exon 1B, and to investigate the possible association of PTCH1 polymorphisms and haplotypes with BCC risk after organ transplantation. Three PTCH1 single nucleotide polymorphisms (rs2297086, rs2066836 and rs357564) were analysed by restriction fragment length polymorphism analysis in 161 northern Italian OTRs (56 BCC cases and 105 controls). Two regions of the PTCH1 gene promoter were screened by heteroduplex analysis in 30 cases and 30 controls. Single locus analysis showed no significant association. Haplotype T(1686)-T(3944) appeared to confer a significantly higher risk for BCC development (odds ratio 2.98, 95% confidence interval 2.55-3.48; P = 0.001). Two novel rare polymorphisms were identified at positions 176 and 179 of the 5'UTR. Two novel alleles of the -4 (CGG)(n) microsatellite were identified. No association of this microsatellite with BCC was observed. Haplotypes containing T(1686)-T(3944) alleles were shown to be associated with an increased BCC risk in our study population. These data appear to be of great interest for further investigations in a larger group of transplant individuals. Our results do not support the hypothesis that common polymorphisms in the proximal 5

  16. Mapping of the Pim-1 oncogene in mouse t-haplotypes and its use to define the relative map positions of the tcl loci t0(t6) and tw12 and the marker tf (tufted).

    PubMed

    Ark, B; Gummere, G; Bennett, D; Artzt, K

    1991-06-01

    Pim-1 is an oncogene activated in mouse T-cell lymphomas induced by Moloney and AKR mink cell focus (MCF) viruses. Pim-1 was previously mapped to chromosome 17 by somatic cell hybrids, and subsequently to the region between the hemoglobin alpha-chain pseudogene 4 (Hba-4ps) and the alpha-crystalline gene (Crya-1) by Southern blot analysis of DNA obtained from panels of recombinant inbred strains. We have now mapped Pim-1 more accurately in t-haplotypes by analysis of recombinant t-chromosomes. The recombinants were derived from Tts6tf/t12 parents backcrossed to + tf/ + tf, and scored for recombination between the loci of T and tf. For simplicity all t-complex lethal genes properly named tcl-tx are shortened to tx. The Pim-1 gene was localized 0.6 cM proximal to the tw12 lethal gene, thus placing the Pim-1 gene 5.2 cM distal to the H-2 region in t-haplotypes. Once mapped, the Pim-1 gene was used as a marker for further genetic analysis of t-haplotypes. tw12 is so close to tf that even with a large number of recombinants it was not possible to determine whether it is proximal or distal to tf. Southern blot analysis of DNA from T-tf recombinants with a separation of tw12 and tf indicated that tw12 is proximal to tf. The mapping of two allelic t-lethals, t0 and t6 with respect to tw12 and tf has also been a problem.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Association of ORAI1 Haplotypes with the Risk of HLA-B27 Positive Ankylosing Spondylitis

    PubMed Central

    Wei, James Cheng-Chung; Yen, Jeng-Hsien; Juo, Suh-Hang Hank; Chen, Wei-Chiao; Wang, Yu-Shiuan; Chiu, Yi-Ching; Hsieh, Tusty-Jiuan; Guo, Yuh-Cherng; Huang, Chun-Huang; Wong, Ruey-Hong; Wang, Hui-Po; Tsai, Ke-Li; Wu, Yang-Chang; Chang, Hsueh-Wei; Hsi, Edward; Chang, Wei-Pin; Chang, Wei-Chiao

    2011-01-01

    Ankylosing spondylitis (AS) is a chronic inflammation of the sacroiliac joints, spine and peripheral joints. The aetiology of ankylosing spondylitis is still unclear. Previous studies have indicated that genetics factors such as human leukocyte antigen HLA-B27 associates to AS susceptibility. We carried out a case-control study to determine whether the genetic polymorphisms of ORAI1 gene, a major component of store-operated calcium channels that involved the regulation of immune system, is a susceptibility factor to AS in a Taiwanese population. We enrolled 361 AS patients fulfilled the modified New York criteria and 379 controls from community. Five tagging single nucleotides polymorphisms (tSNPs) at ORAI1 were selected from the data of Han Chinese population in HapMap project. Clinical statuses of AS were assessed by the Bath Ankylosing Spondylitis Disease Activity Index (BASDAI), Bath Ankylosing Spondylitis Functional Index (BASFI), and Bath Ankylosing Spondylitis Global Index (BAS-G). Our results indicated that subjects carrying the minor allele homozygote (CC) of the promoter SNP rs12313273 or TT homozygote of the SNP rs7135617 had an increased risk of HLA-B27 positive AS. The minor allele C of 3′UTR SNP rs712853 exerted a protective effect to HLA-B27 positive AS. Furthermore, the rs12313273/rs7135617 pairwise allele analysis found that C-G (OR 1.69, 95% CI 1.27, 2.25; p = 0.0003) and T-T (OR 1.75, 95% CI 1.36, 2.27; p<0.0001) haplotypes had a significantly association with the risk of HLA-B27-positive AS in comparison with the T-G carriers. This is the first study that indicate haplotypes of ORAI1 (rs12313273 and rs7135617) are associated with the risk of HLA-B27 positive AS. PMID:21674042

  18. [Association between the methylenetetrahydrofolate reductase gene polymorphisms and haplotype with toxicity response of high dose methotrexate chemotherapy].

    PubMed

    Liao, Qing-Chuan; Li, Xiao-Lei; Liu, Si-Ting; Zhang, Yong; Li, Tian-Yuan; Qiu, Jin-Chun

    2012-07-01

    To investigate the association between single nucleotide polymorphisms (SNP) and its haplotypes of methylenetetrahydrofolate reductase (MTHFR) gene with high dose methotrexate (HDMTX)-induced toxicity in children with acute lymphoblastic leukemia (ALL). HDMTX-treated children with ALL (1.2 to 14-years old) were selected from inpatient and followed for a retrospective study. The toxicity response of HDMTX chemotherapy was evaluated using WHO common toxicity criteria. Sixty-one patients with therapy-related toxicity and 36 patients without therapy-related toxicity were genotyped for 2 SNP (677C > T and 1298A > C) of the MTHFR gene by polymerase chain reaction-restriction fragment length polymorphism. Frequency of haplotypes and linkage disequilibrium of MTHFR gene were analyzed by SHEsis program. The distribution of MTHFR gene 677C > T polymorphism did not appeare different between groups with or without toxicity response (χ(2) = 4.609, P = 0.100), but the 1298A > C polymorphism was significantly different (χ(2) = 10.192, P = 0.006). Individuals who carried C allele (AC + CC genotype) had a decreased risk of toxicity response compared to AA genotype (OR = 0.245, 95%CI: 0.099 - 0.607, P = 0.002). 677C > T and 1298A > C polymorphisms showed strong linkage disequilibrium (D' = 0.895). The CC haplotype was significantly associated with decreased risk of toxicity response (OR = 0.338, 95%CI: 0.155 - 0.738, P = 0.005), while the TA haplotype was significantly associated with the increased risk of toxicity response (OR = 1.907, 95%CI: 1.045 - 3.482, P = 0.035). MTHFR gene 1298C allele and CC haplotype might serve as protective factors while TA haplotype as a risk factor for the susceptibility to toxicity response of HDMTX chemotherapy in children with ALL.

  19. Genome-wide association mapping of partial resistance to Aphanomyces euteiches in pea.

    PubMed

    Desgroux, Aurore; L'Anthoëne, Virginie; Roux-Duparque, Martine; Rivière, Jean-Philippe; Aubert, Grégoire; Tayeh, Nadim; Moussart, Anne; Mangin, Pierre; Vetel, Pierrick; Piriou, Christophe; McGee, Rebecca J; Coyne, Clarice J; Burstin, Judith; Baranger, Alain; Manzanares-Dauleux, Maria; Bourion, Virginie; Pilet-Nayel, Marie-Laure

    2016-02-20

    Genome-wide association (GWA) mapping has recently emerged as a valuable approach for refining the genetic basis of polygenic resistance to plant diseases, which are increasingly used in integrated strategies for durable crop protection. Aphanomyces euteiches is a soil-borne pathogen of pea and other legumes worldwide, which causes yield-damaging root rot. Linkage mapping studies reported quantitative trait loci (QTL) controlling resistance to A. euteiches in pea. However the confidence intervals (CIs) of these QTL remained large and were often linked to undesirable alleles, which limited their application in breeding. The aim of this study was to use a GWA approach to validate and refine CIs of the previously reported Aphanomyces resistance QTL, as well as identify new resistance loci. A pea-Aphanomyces collection of 175 pea lines, enriched in germplasm derived from previously studied resistant sources, was evaluated for resistance to A. euteiches in field infested nurseries in nine environments and with two strains in climatic chambers. The collection was genotyped using 13,204 SNPs from the recently developed GenoPea Infinium® BeadChip. GWA analysis detected a total of 52 QTL of small size-intervals associated with resistance to A. euteiches, using the recently developed Multi-Locus Mixed Model. The analysis validated six of the seven previously reported main Aphanomyces resistance QTL and detected novel resistance loci. It also provided marker haplotypes at 14 consistent QTL regions associated with increased resistance and highlighted accumulation of favourable haplotypes in the most resistant lines. Previous linkages between resistance alleles and undesired late-flowering alleles for dry pea breeding were mostly confirmed, but the linkage between loci controlling resistance and coloured flowers was broken due to the high resolution of the analysis. A high proportion of the putative candidate genes underlying resistance loci encoded stress-related proteins and

  20. TUMOR HAPLOTYPE ASSEMBLY ALGORITHMS FOR CANCER GENOMICS

    PubMed Central

    AGUIAR, DEREK; WONG, WENDY S.W.; ISTRAIL, SORIN

    2014-01-01

    The growing availability of inexpensive high-throughput sequence data is enabling researchers to sequence tumor populations within a single individual at high coverage. But, cancer genome sequence evolution and mutational phenomena like driver mutations and gene fusions are difficult to investigate without first reconstructing tumor haplotype sequences. Haplotype assembly of single individual tumor populations is an exceedingly difficult task complicated by tumor haplotype heterogeneity, tumor or normal cell sequence contamination, polyploidy, and complex patterns of variation. While computational and experimental haplotype phasing of diploid genomes has seen much progress in recent years, haplotype assembly in cancer genomes remains uncharted territory. In this work, we describe HapCompass-Tumor a computational modeling and algorithmic framework for haplotype assembly of copy number variable cancer genomes containing haplotypes at different frequencies and complex variation. We extend our polyploid haplotype assembly model and present novel algorithms for (1) complex variations, including copy number changes, as varying numbers of disjoint paths in an associated graph, (2) variable haplotype frequencies and contamination, and (3) computation of tumor haplotypes using simple cycles of the compass graph which constrain the space of haplotype assembly solutions. The model and algorithm are implemented in the software package HapCompass-Tumor which is available for download from http://www.brown.edu/Research/Istrail_Lab/. PMID:24297529

  1. Simultaneous Genotype Calling and Haplotype Phasing Improves Genotype Accuracy and Reduces False-Positive Associations for Genome-wide Association Studies

    PubMed Central

    Browning, Brian L.; Yu, Zhaoxia

    2009-01-01

    We present a novel method for simultaneous genotype calling and haplotype-phase inference. Our method employs the computationally efficient BEAGLE haplotype-frequency model, which can be applied to large-scale studies with millions of markers and thousands of samples. We compare genotype calls made with our method to genotype calls made with the BIRDSEED, CHIAMO, GenCall, and ILLUMINUS genotype-calling methods, using genotype data from the Illumina 550K and Affymetrix 500K arrays. We show that our method has higher genotype-call accuracy and yields fewer uncalled genotypes than competing methods. We perform single-marker analysis of data from the Wellcome Trust Case Control Consortium bipolar disorder and type 2 diabetes studies. For bipolar disorder, the genotype calls in the original study yield 25 markers with apparent false-positive association with bipolar disorder at a p < 10−7 significance level, whereas genotype calls made with our method yield no associated markers at this significance threshold. Conversely, for markers with replicated association with type 2 diabetes, there is good concordance between genotype calls used in the original study and calls made by our method. Results from single-marker and haplotypic analysis of our method's genotype calls for the bipolar disorder study indicate that our method is highly effective at eliminating genotyping artifacts that cause false-positive associations in genome-wide association studies. Our new genotype-calling methods are implemented in the BEAGLE and BEAGLECALL software packages. PMID:19931040

  2. Tryptophan Hydroxylase 2 haplotype association with borderline personality disorder and aggression in a sample of patients with personality disorders and healthy controls

    PubMed Central

    Perez-Rodriguez, M. Mercedes; Weinstein, Shauna; New, Antonia S.; Bevilacqua, Laura; Yuan, Qiaoping; Zhou, Zhifeng; Hodgkinson, Colin; Goodman, Marianne; Koenigsberg, Harold W.; Goldman, David; Siever, Larry J.

    2010-01-01

    Background There is decreased serotonergic function in impulsive aggression and borderline personality disorder (BPD), and genetic association studies suggest a role of serotonergic genes in impulsive aggression and BPD. Only one study has analyzed the association between the tryptophan-hydroxylase 2 (TPH2) gene and BPD. A TPH2 “risk” haplotype has been described that is associated with anxiety, depression and suicidal behavior. Methods We assessed the relationship between the previously identified “risk” haplotype at the TPH2 locus and BPD diagnosis, impulsive aggression, affective lability, and suicidal/parasuicidal behaviors, in a well-characterized clinical sample of 103 healthy controls (HCs) and 251 patients with personality disorders (109 with BPD). A logistic regression including measures of depression, affective lability and aggression scores in predicting “risk” haplotype was conducted. Results The prevalence of the “risk” haplotype was significantly higher in patients with BPD compared to HCs. Those with the “risk” haplotype have higher aggression and affect lability scores and more suicidal/parasuicidal behaviors than those without it. In the logistic regression model, affect lability was the only significant predictor and it correctly classified 83.1% of the subjects as “risk” or “non-risk” haplotype carriers. Conclusions We found an association between the previously described TPH2 “risk” haplotype and BPD diagnosis, affective lability, suicidal/parasuicidal behavior, and aggression scores. PMID:20451217

  3. Functionally Relevant Microsatellite Markers From Chickpea Transcription Factor Genes for Efficient Genotyping Applications and Trait Association Mapping

    PubMed Central

    Kujur, Alice; Bajaj, Deepak; Saxena, Maneesha S.; Tripathi, Shailesh; Upadhyaya, Hari D.; Gowda, C.L.L.; Singh, Sube; Jain, Mukesh; Tyagi, Akhilesh K.; Parida, Swarup K.

    2013-01-01

    We developed 1108 transcription factor gene-derived microsatellite (TFGMS) and 161 transcription factor functional domain-associated microsatellite (TFFDMS) markers from 707 TFs of chickpea. The robust amplification efficiency (96.5%) and high intra-specific polymorphic potential (34%) detected by markers suggest their immense utilities in efficient large-scale genotyping applications, including construction of both physical and functional transcript maps and understanding population structure. Candidate gene-based association analysis revealed strong genetic association of TFFDMS markers with three major seed and pod traits. Further, TFGMS markers in the 5′ untranslated regions of TF genes showing differential expression during seed development had higher trait association potential. The significance of TFFDMS markers was demonstrated by correlating their allelic variation with amino acid sequence expansion/contraction in the functional domain and alteration of secondary protein structure encoded by genes. The seed weight-associated markers were validated through traditional bi-parental genetic mapping. The determination of gene-specific linkage disequilibrium (LD) patterns in desi and kabuli based on single nucleotide polymorphism-microsatellite marker haplotypes revealed extended LD decay, enhanced LD resolution and trait association potential of genes. The evolutionary history of a strong seed-size/weight-associated TF based on natural variation and haplotype sharing among desi, kabuli and wild unravelled useful information having implication for seed-size trait evolution during chickpea domestication. PMID:23633531

  4. A DRD1 haplotype is associated with risk for autism spectrum disorders in male-only affected sib-pair families.

    PubMed

    Hettinger, Joe A; Liu, Xudong; Schwartz, Charles E; Michaelis, Ron C; Holden, Jeanette J A

    2008-07-05

    Individuals with autism spectrum disorders (ASDs) have impairments in executive function and social cognition, with males generally being more severely affected in these areas than females. Because the dopamine D1 receptor (encoded by DRD1) is integral to the neural circuitry mediating these processes, we examined the DRD1 gene for its role in susceptibility to ASDs by performing single marker and haplotype case-control comparisons, family-based association tests, and genotype-phenotype assessments (quantitative transmission disequilibrium tests: QTDT) using three DRD1 polymorphisms, rs265981C/T, rs4532A/G, and rs686T/C. Our previous findings suggested that the dopaminergic system may be more integrally involved in families with affected males only than in other families. We therefore restricted our study to families with two or more affected males (N = 112). There was over-transmission of rs265981-C and rs4532-A in these families (P = 0.040, P = 0.038), with haplotype TDT analysis showing over-transmission of the C-A-T haplotype (P = 0.022) from mothers to affected sons (P = 0.013). In addition, haplotype case-control comparisons revealed an increase of this putative risk haplotype in affected individuals relative to a comparison group (P = 0.004). QTDT analyses showed associations of the rs265981-C, rs4532-A, rs686-T alleles, and the C-A-T haplotype with more severe problems in social interaction, greater difficulties with nonverbal communication and increased stereotypies compared to individuals with other haplotypes. Preferential haplotype transmission of markers at the DRD1 locus and an increased frequency of a specific haplotype support the DRD1 gene as a risk gene for core symptoms of ASD in families having only affected males. Copyright 2008 Wiley-Liss, Inc.

  5. Fine mapping of the celiac disease-associated LPP locus reveals a potential functional variant.

    PubMed

    Almeida, Rodrigo; Ricaño-Ponce, Isis; Kumar, Vinod; Deelen, Patrick; Szperl, Agata; Trynka, Gosia; Gutierrez-Achury, Javier; Kanterakis, Alexandros; Westra, Harm-Jan; Franke, Lude; Swertz, Morris A; Platteel, Mathieu; Bilbao, Jose Ramon; Barisani, Donatella; Greco, Luigi; Mearin, Luisa; Wolters, Victorien M; Mulder, Chris; Mazzilli, Maria Cristina; Sood, Ajit; Cukrowska, Bozena; Núñez, Concepción; Pratesi, Riccardo; Withoff, Sebo; Wijmenga, Cisca

    2014-05-01

    Using the Immunochip for genotyping, we identified 39 non-human leukocyte antigen (non-HLA) loci associated to celiac disease (CeD), an immune-mediated disease with a worldwide frequency of ∼1%. The most significant non-HLA signal mapped to the intronic region of 70 kb in the LPP gene. Our aim was to fine map and identify possible functional variants in the LPP locus. We performed a meta-analysis in a cohort of 25 169 individuals from six different populations previously genotyped using Immunochip. Imputation using data from the Genome of the Netherlands and 1000 Genomes projects, followed by meta-analysis, confirmed the strong association signal on the LPP locus (rs2030519, P = 1.79 × 10(-49)), without any novel associations. The conditional analysis on this top SNP-indicated association to a single common haplotype. By performing haplotype analyses in each population separately, as well as in a combined group of the four populations that reach the significant threshold after correction (P < 0.008), we narrowed down the CeD-associated region from 70 to 2.8 kb (P = 1.35 × 10(-44)). By intersecting regulatory data from the ENCODE project, we found a functional SNP, rs4686484 (P = 3.12 × 10(-49)), that maps to several B-cell enhancer elements and a highly conserved region. This SNP was also predicted to change the binding motif of the transcription factors IRF4, IRF11, Nkx2.7 and Nkx2.9, suggesting its role in transcriptional regulation. We later found significantly low levels of LPP mRNA in CeD biopsies compared with controls, thus our results suggest that rs4686484 is the functional variant in this locus, while LPP expression is decreased in CeD.

  6. No association between polymorphisms/haplotypes of the vascular endothelial growth factor gene and preeclampsia

    PubMed Central

    2011-01-01

    Background Preeclampsia (PE) is the first worldwide cause of death in pregnant women, intra-uterine growth retardation, and fetal prematurity. Some vascular endothelial grown factor gene (VEGF) polymorphisms have been associated to PE and other pregnancy disturbances. We evaluated the associations between VEGF genotypes/haplotypes and PE in Mexican women. Methods 164 pregnant women were enrolled in a case-control study (78 cases and 86 normotensive pregnant controls). The rs699947 (-2578C/A), rs1570360 (-1154G/A), rs2010963 (+405G/C), and rs25648 (-7C/T), VEGF variants were discriminated using Polymerase Chain Reaction - Restriction Fragment Length Polymorphism (PCR-RFLP) methods or Taqman single nucleotide polymorphism (SNP) assays. Results The proportions of the minor allele for rs699947, rs1570360, rs2010963, and rs25648 VEGF SNPs were 0.33, 0.2, 0.39, and 0.17 in controls, and 0.39, 0.23, 0.41, and 0.15 in cases, respectively (P values > 0.05). The most frequent haplotypes of rs699947, rs1570360, rs2010963, and rs25648 VEGF SNPs, were C-G-C-C and C-G-G-C with frequencies of 0.39, 0.21 in cases and 0.37, 0.25 in controls, respectively (P values > 0.05) Conclusion There was no evidence of an association between VEGF alleles, genotypes, or haplotypes frequencies and PE in our study. PMID:21575227

  7. A Cladistic Analysis of Phenotypic Associations with Haplotypes Inferred from Restriction Endonuclease Mapping. IV. Nested Analyses with Cladogram Uncertainty and Recombination

    PubMed Central

    Templeton, A. R.; Sing, C. F.

    1993-01-01

    We previously developed an analytical strategy based on cladistic theory to identify subsets of haplotypes that are associated with significant phenotypic deviations. Our initial approach was limited to segments of DNA in which little recombination occurs. In such cases, a cladogram can be constructed from the restriction site data to estimate the evolutionary steps that interrelate the observed haplotypes to one another. The cladogram is then used to define a nested statistical design for identifying mutational steps associated with significant phenotypic deviations. The central assumption behind this strategy is that a mutation responsible for a particular phenotypic effect is embedded within the evolutionary history that is represented by the cladogram. The power of this approach depends on the accuracy of the cladogram in portraying the evolutionary history of the DNA region. This accuracy can be diminished both by recombination and by uncertainty in the estimated cladogram topology. In a previous paper, we presented an algorithm for estimating the set of likely cladograms and recombination events. In this paper we present an algorithm for defining a nested statistical design under cladogram uncertainty and recombination. Given the nested design, phenotypic associations can be examined using either a nested analysis of variance (for haploids or homozygous strains) or permutation testing (for outcrossed, diploid gene regions). In this paper we also extend this analytical strategy to include categorical phenotypes in addition to quantitative phenotypes. Some worked examples are presented using Drosophila data sets. These examples illustrate that having some recombination may actually enhance the biological inferences that may derived from a cladistic analysis. In particular, recombination can be used to assign a physical localization to a given subregion for mutations responsible for significant phenotypic effects. PMID:8100789

  8. A genome-wide association study of production traits in a commercial population of Large White pigs: evidence of haplotypes affecting meat quality

    PubMed Central

    2014-01-01

    Background Numerous quantitative trait loci (QTL) have been detected in pigs over the past 20 years using microsatellite markers. However, due to the low density of these markers, the accuracy of QTL location has generally been poor. Since 2009, the dense genome coverage provided by the Illumina PorcineSNP60 BeadChip has made it possible to more accurately map QTL using genome-wide association studies (GWAS). Our objective was to perform high-density GWAS in order to identify genomic regions and corresponding haplotypes associated with production traits in a French Large White population of pigs. Methods Animals (385 Large White pigs from 106 sires) were genotyped using the PorcineSNP60 BeadChip and evaluated for 19 traits related to feed intake, growth, carcass composition and meat quality. Of the 64 432 SNPs on the chip, 44 412 were used for GWAS with an animal mixed model that included a regression coefficient for the tested SNPs and a genomic kinship matrix. SNP haplotype effects in QTL regions were then tested for association with phenotypes following phase reconstruction based on the Sscrofa10.2 pig genome assembly. Results Twenty-three QTL regions were identified on autosomes and their effects ranged from 0.25 to 0.75 phenotypic standard deviation units for feed intake and feed efficiency (four QTL), carcass (12 QTL) and meat quality traits (seven QTL). The 10 most significant QTL regions had effects on carcass (chromosomes 7, 10, 16, 17 and 18) and meat quality traits (two regions on chromosome 1 and one region on chromosomes 8, 9 and 13). Thirteen of the 23 QTL regions had not been previously described. A haplotype block of 183 kb on chromosome 1 (six SNPs) was identified and displayed three distinct haplotypes with significant (0.0001 < P < 0.03) associations with all evaluated meat quality traits. Conclusions GWAS analyses with the PorcineSNP60 BeadChip enabled the detection of 23 QTL regions that affect feed consumption, carcass and meat

  9. In Vivo Characterization of Human APOA5 Haplotypes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahituv, Nadav; Akiyama, Jennifer; Chapman-Helleboid, Audrey

    2006-10-01

    Increased plasma triglycerides concentrations are an independent risk factor for cardiovascular disease. Numerous studies support a reproducible genetic association between two minor haplotypes in the human apolipoprotein A5 gene (APOA5) and increased plasma triglyceride concentrations. We thus sought to investigate the effect of these minor haplotypes (APOA5*2 and APOA5*3) on ApoAV plasma levels through the precise insertion of single-copy intact APOA5 haplotypes at a targeted location in the mouse genome. While we found no difference in the amount of human plasma ApoAV in mice containing the common APOA5*1 and minor APOA5*2 haplotype, the introduction of the single APOA5*3 defining allelemore » (19W) resulted in 3-fold lower ApoAV plasma levels consistent with existing genetic association studies. These results indicate that S19W polymorphism is likely to be functional and explain the strong association of this variant with plasma triglycerides supporting the value of sensitive in vivo assays to define the functional nature of human haplotypes.« less

  10. Molecular characterization of a long range haplotype affecting protein yield and mastitis susceptibility in Norwegian Red cattle.

    PubMed

    Sodeland, Marte; Grove, Harald; Kent, Matthew; Taylor, Simon; Svendsen, Morten; Hayes, Ben J; Lien, Sigbjørn

    2011-08-11

    Previous fine mapping studies in Norwegian Red cattle (NRC) in the region 86-90.4 Mb on Bos taurus chromosome 6 (BTA6) has revealed a quantitative trait locus (QTL) for protein yield (PY) around 88 Mb and a QTL for clinical mastitis (CM) around 90 Mb. The close proximity of these QTLs may partly explain the unfavorable genetic correlation between these two traits in NRC. A long range haplotype covering this region was introduced into the NRC population through the importation of a Holstein-Friesian bull (1606 Frasse) from Sweden in the 1970s. It has been suggested that this haplotype has a favorable effect on milk protein content but an unfavorable effect on mastitis susceptibility. Selective breeding for milk production traits is likely to have increased the frequency of this haplotype in the NRC population. Association mapping for PY and CM in NRC was performed using genotypes from 556 SNPs throughout the region 86-97 Mb on BTA6 and daughter-yield-deviations (DYDs) from 2601 bulls made available from the Norwegian dairy herd recording system. Highest test scores for PY were found for single-nucleotide polymorphisms (SNPs) within and surrounding the genes CSN2 and CSN1S2, coding for the β-casein and α(S2)-casein proteins. High coverage re-sequencing by high throughput sequencing technology enabled molecular characterization of a long range haplotype from 1606 Frasse encompassing these two genes. Haplotype analysis of a large number of descendants from this bull indicated that the haplotype was not markedly disrupted by recombination in this region. The haplotype was associated with both increased milk protein content and increased susceptibility to mastitis, which might explain parts of the observed genetic correlation between PY and CM in NRC. Plausible causal polymorphisms affecting PY were detected in the promoter region and in the 5'-flanking UTR of CSN1S2. These polymorphisms could affect transcription or translation of CSN1S2 and thereby affect the amount

  11. Haplotype combination of the bovine CFL2 gene sequence variants and association with growth traits in Qinchuan cattle.

    PubMed

    Sun, Yujia; Lan, Xianyong; Lei, Chuzhao; Zhang, Chunlei; Chen, Hong

    2015-06-01

    The aim of this study was to examine the association of cofilin2 (CFL2) gene polymorphisms with growth traits in Chinese Qinchuan cattle. Three single nucleotide polymorphisms (SNPs) were identified in the bovine CFL2 gene using DNA sequencing and (forced) PCR-RFLP methods. These polymorphisms included a missense mutation (NC_007319.5: g. C 2213 G) in exon 4, one synonymous mutation (NC_007319.5: g. T 1694 A) in exon 4, and a mutation (NC_007319.5: g. G 1500 A) in intron 2, respectively. In addition, we evaluated the haplotype frequency and linkage disequilibrium coefficient of three sequence variants in 488 individuals in QC cattle. All the three SNPs in QC cattle belonged to an intermediate level of genetic diversity (0.25Haplotype analysis of three SNPs showed that 8 different haplotypes were identified in all, but only 5 haplotypes were listed except for those with a frequency of <0.03. Hap4 (-GTC-) had the highest haplotype frequencies (34.70%). However in the three SNPs there were no significant associations between the 13 combined genotypes of the CFL2 gene and growth traits. LD analysis showed that the SNP T 1694 A and C 2213 G loci had a strong linkage (r(2)>0.33). Association analysis indicated that SNP G 1500 A, T 1694 A and C 2213 G were significantly associated with growth traits in the QC population. The results of our study suggest that the CFL2 gene may be a strong candidate gene that affects growth traits in the QC cattle breeding program. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Congruence as a measurement of extended haplotype structure across the genome

    PubMed Central

    2012-01-01

    Background Historically, extended haplotypes have been defined using only a few data points, such as alleles for several HLA genes in the MHC. High-density SNP data, and the increasing affordability of whole genome SNP typing, creates the opportunity to define higher resolution extended haplotypes. This drives the need for new tools that support quantification and visualization of extended haplotypes as defined by as many as 2000 SNPs. Confronted with high-density SNP data across the major histocompatibility complex (MHC) for 2,300 complete families, compiled by the Type 1 Diabetes Genetics Consortium (T1DGC), we developed software for studying extended haplotypes. Methods The software, called ExHap (Extended Haplotype), uses a similarity measurement we term congruence to identify and quantify long-range allele identity. Using ExHap, we analyzed congruence in both the T1DGC data and family-phased data from the International HapMap Project. Results Congruent chromosomes from the T1DGC data have between 96.5% and 99.9% allele identity over 1,818 SNPs spanning 2.64 megabases of the MHC (HLA-DRB1 to HLA-A). Thirty-three of 132 DQ-DR-B-A defined haplotype groups have > 50% congruent chromosomes in this region. For example, 92% of chromosomes within the DR3-B8-A1 haplotype are congruent from HLA-DRB1 to HLA-A (99.8% allele identity). We also applied ExHap to all 22 autosomes for both CEU and YRI cohorts from the International HapMap Project, identifying multiple candidate extended haplotypes. Conclusions Long-range congruence is not unique to the MHC region. Patterns of allele identity on phased chromosomes provide a simple, straightforward approach to visually and quantitatively inspect complex long-range structural patterns in the genome. Such patterns aid the biologist in appreciating genetic similarities and differences across cohorts, and can lead to hypothesis generation for subsequent studies. PMID:22369243

  13. BCL11A Enhancer Haplotypes and Fetal Hemoglobin in Sickle Cell Anemia

    PubMed Central

    Sebastiani, P.; Farrell, J.J.; Alsultan, A.; Wang, S.; Edward, H. L.; Shappell, H.; Bae, H.; Milton, J. N.; Baldwin, C.T.; Al-Rubaish, A.M.; Naserullah, Z.; Al-Muhanna, F.; Alsuliman, A.; Patra, P. K.; Farrer, L.A.; Ngo, D.; Vathipadiekal, V.; Chui, D.H.K.; Al-Ali, A.K.; Steinberg, M.H.

    2015-01-01

    Background Fetal hemoglobin (HbF) levels in sickle cell anemia patients vary. We genotyped polymorphisms in the erythroid-specific enhancer of BCL11A to see if they might account for the very high HbF associated with the Arab-Indian (AI) haplotype and Benin haplotype of sickle cell anemia. Methods and Results Six BCL112A enhancer SNPs and their haplotypes were studied in Saudi Arabs from the Eastern Province and Indian patients with AI haplotype (HbF ~20%), African Americans (HbF ~7%), and Saudi Arabs from the Southwestern Province (HbF ~12%). Four SNPs (rs1427407, rs6706648, rs6738440, and rs7606173) and their haplotypes were consistently associated with HbF levels. The distributions of haplotypes differ in the 3 cohorts but not their genetic effects: the haplotype TCAG was associated with the lowest HbF level and the haplotype GTAC was associated with the highest HbF level and differences in HbF levels between carriers of these haplotypes in all cohorts was approximately 6%. Conclusions Common HbF BCL11A enhancer haplotypes in patients with African origin and AI sickle cell anemia have similar effects on HbF but they do not explain their differences in HbF. PMID:25703683

  14. Founder haplotype analysis of Fanconi anemia in the Korean population finds common ancestral haplotypes for a FANCG variant.

    PubMed

    Park, Joonhong; Kim, Myungshin; Jang, Woori; Chae, Hyojin; Kim, Yonggoo; Chung, Nack-Gyun; Lee, Jae-Wook; Cho, Bin; Jeong, Dae-Chul; Park, In Yang; Park, Mi Sun

    2015-05-01

    A common ancestral haplotype is strongly suggested in the Korean and Japanese patients with Fanconi anemia (FA), because common mutations have been frequently found: c.2546delC and c.3720_3724delAAACA of FANCA; c.307+1G>C, c.1066C>T, and c.1589_1591delATA of FANCG. Our aim in this study was to investigate the origin of these common mutations of FANCA and FANCG. We genotyped 13 FA patients consisting of five FA-A patients and eight FA-G patients from the Korean FA population. Microsatellite markers used for haplotype analysis included four CA repeat markers which are closely linked with FANCA and eight CA repeat markers which are contiguous with FANCG. As a result, Korean FA-A patients carrying c.2546delC or c.3720_3724delAAACA did not share the same haplotypes. However, three unique haplotypes carrying c.307+1G>C, c.1066C > T, or c.1589_1591delATA, that consisted of eight polymorphic loci covering a flanking region were strongly associated with Korean FA-G, consistent with founder haplotypes reported previously in the Japanese FA-G population. Our finding confirmed the common ancestral haplotypes on the origins of the East Asian FA-G patients, which will improve our understanding of the molecular population genetics of FA-G. To the best of our knowledge, this is the first report on the association between disease-linked mutations and common ancestral haplotypes in the Korean FA population. © 2015 John Wiley & Sons Ltd/University College London.

  15. Population-Specific Haplotype Association of the Postsynaptic Density Gene DLG4 with Schizophrenia, in Family-Based Association Studies

    PubMed Central

    Balan, Shabeesh; Yamada, Kazuo; Hattori, Eiji; Iwayama, Yoshimi; Toyota, Tomoko; Ohnishi, Tetsuo; Maekawa, Motoko; Toyoshima, Manabu; Iwata, Yasuhide; Suzuki, Katsuaki; Kikuchi, Mitsuru; Yoshikawa, Takeo

    2013-01-01

    The post-synaptic density (PSD) of glutamatergic synapses harbors a multitude of proteins critical for maintaining synaptic dynamics. Alteration of protein expression levels in this matrix is a marked phenomenon of neuropsychiatric disorders including schizophrenia, where cognitive functions are impaired. To investigate the genetic relationship of genes expressed in the PSD with schizophrenia, a family-based association analysis of genetic variants in PSD genes such as DLG4, DLG1, PICK1 and MDM2, was performed, using Japanese samples (124 pedigrees, n = 376 subjects). Results showed a significant association of the rs17203281 variant from the DLG4 gene, with preferential transmission of the C allele (p = 0.02), although significance disappeared after correction for multiple testing. Replication analysis of this variant, found no association in a Chinese schizophrenia cohort (293 pedigrees, n = 1163 subjects) or in a Japanese case-control sample (n = 4182 subjects). The DLG4 expression levels between postmortem brain samples from schizophrenia patients showed no significant changes from controls. Interestingly, a five marker haplotype in DLG4, involving rs2242449, rs17203281, rs390200, rs222853 and rs222837, was enriched in a population specific manner, where the sequences A-C-C-C-A and G-C-C-C-A accumulated in Japanese (p = 0.0009) and Chinese (p = 0.0007) schizophrenia pedigree samples, respectively. However, this could not be replicated in case-control samples. None of the variants in other examined candidate genes showed any significant association in these samples. The current study highlights a putative role for DLG4 in schizophrenia pathogenesis, evidenced by haplotype association, and warrants further dense screening for variants within these haplotypes. PMID:23936182

  16. Linkage mapping and molecular diversity at the flower sex locus in wild and cultivated grapevine reveal a prominent SSR haplotype in hermaphrodite plants.

    PubMed

    Battilana, Juri; Lorenzi, Silvia; Moreira, Flavia M; Moreno-Sanz, Paula; Failla, Osvaldo; Emanuelli, Francesco; Grando, M Stella

    2013-07-01

    Cultivars used for wine and table grape have self-fertile hermaphrodite flowers whereas wild European vines and American and Asian species are dioecious, having either male or female flowers. Consistent with previous studies, the flower sex trait was mapped as a single major locus on chromosome 2 based on a pure Vitis vinifera population segregating for hermaphrodite and female progeny, and a hybrid population producing all three flower sex types. The sex locus was placed between the same SSR and SNP markers on both genetic maps, although abnormal segregation hampered to fine map the genomic region. From a total of 55 possible haplotypes inferred for three SSR markers around the sex locus, in a population of 132 V. sylvestris accessions and 171 V. vinifera cultivars, one of them accounted for 66 % of the hermaphrodite individuals and may be the result of domestication. Specific size variants of the VVIB23 microsatellite sequence within the 3'-UTR of a putative YABBY1 gene were found to be statistically significantly associated with the sex alleles M, H and f; these markers can provide assistance in defining the status of wild grapevine germplasm.

  17. Global spread and genetic variants of the two CYP9M10 haplotype forms associated with insecticide resistance in Culex quinquefasciatus Say.

    PubMed

    Itokawa, K; Komagata, O; Kasai, S; Kawada, H; Mwatele, C; Dida, G O; Njenga, S M; Mwandawiro, C; Tomita, T

    2013-09-01

    Insecticide resistance develops as a genetic factor (allele) conferring lower susceptibility to insecticides proliferates within a target insect population under strong positive selection. Intriguingly, a resistance allele pre-existing in a population often bears a series of further adaptive allelic variants through new mutations. This phenomenon occasionally results in replacement of the predominating resistance allele by fitter new derivatives, and consequently, development of greater resistance at the population level. The overexpression of the cytochrome P450 gene CYP9M10 is associated with pyrethroid resistance in the southern house mosquito Culex quinquefasciatus. Previously, we have found two genealogically related overexpressing CYP9M10 haplotypes, which differ in gene copy number (duplicated and non-duplicated). The duplicated haplotype was derived from the non-duplicated overproducer probably recently. In the present study, we investigated allelic series of CYP9M10 involved in three C. quinquefasciatus laboratory colonies recently collected from three different localities. Duplicated and non-duplicated overproducing haplotypes coexisted in African and Asian colonies indicating a global distribution of both haplotype lineages. The duplicated haplotypes both in the Asian and African colonies were associated with higher expression levels and stronger resistance than non-duplicated overproducing haplotypes. There were slight variation in expression level among the non-duplicated overproducing haplotypes. The nucleotide sequences in coding and upstream regions among members of this group also showed a little diversity. Non-duplicated overproducing haplotypes with relatively higher expression were genealogically closer to the duplicated haplotypes than the other non-duplicated overproducing haplotypes, suggesting multiple cis-acting mutations before duplication.

  18. Haplotypes in the gene encoding protein kinase c-beta (PRKCB1) on chromosome 16 are associated with autism.

    PubMed

    Philippi, A; Roschmann, E; Tores, F; Lindenbaum, P; Benajou, A; Germain-Leclerc, L; Marcaillou, C; Fontaine, K; Vanpeene, M; Roy, S; Maillard, S; Decaulne, V; Saraiva, J P; Brooks, P; Rousseau, F; Hager, J

    2005-10-01

    Autism is a developmental disorder characterized by impairments in social interaction and communication associated with repetitive patterns of interest or behavior. Autism is highly influenced by genetic factors. Genome-wide linkage and candidate gene association approaches have been used to try and identify autism genes. A few loci have repeatedly been reported linked to autism. Several groups reported evidence for linkage to a region on chromosome 16p. We have applied a direct physical identity-by-descent (IBD) mapping approach to perform a high-density (0.85 megabases) genome-wide linkage scan in 116 families from the AGRE collection. Our results confirm linkage to a region on chromosome 16p with autism. High-resolution single-nucleotide polymorphism (SNP) genotyping and analysis of this region show that haplotypes in the protein kinase c-beta gene are strongly associated with autism. An independent replication of the association in a second set of 167 trio families with autism confirmed our initial findings. Overall, our data provide evidence that the PRKCB1 gene on chromosome 16p may be involved in the etiology of autism.

  19. Mapping the genetic diversity of HLA haplotypes in the Japanese populations

    PubMed Central

    Saw, Woei-Yuh; Liu, Xuanyao; Khor, Chiea-Chuen; Takeuchi, Fumihiko; Katsuya, Tomohiro; Kimura, Ryosuke; Nabika, Toru; Ohkubo, Takayoshi; Tabara, Yasuharu; Yamamoto, Ken; Yokota, Mitsuhiro; Akiyama, Koichi; Asano, Hiroyuki; Asayama, Kei; Haga, Toshikazu; Hara, Azusa; Hirose, Takuo; Hosaka, Miki; Ichihara, Sahoko; Imai, Yutaka; Inoue, Ryusuke; Ishiguro, Aya; Isomura, Minoru; Isono, Masato; Kamide, Kei; Kato, Norihiro; Katsuya, Tomohiro; Kikuya, Masahiro; Kohara, Katsuhiko; Matsubara, Tatsuaki; Matsuda, Ayako; Metoki, Hirohito; Miki, Tetsuro; Murakami, Keiko; Nabika, Toru; Nakatochi, Masahiro; Ogihara, Toshio; Ohnaka, Keizo; Ohkubo, Takayoshi; Rakugi, Hiromi; Satoh, Michihiro; Shiwaku, Kunihiro; Sugimoto, Ken; Tabara, Yasuharu; Takami, Yoichi; Takayanagi, Ryoichi; Takeuchi, Fumihiko; Tsubota-Utsugi, Megumi; Yamamoto, Ken; Yamamoto, Koichi; Yamasaki, Masayuki; Yasui, Daisaku; Yokota, Mitsuhiro; Teo, Yik-Ying; Kato, Norihiro

    2015-01-01

    Japan has often been viewed as an Asian country that possesses a genetically homogenous community. The basis for partitioning the country into prefectures has largely been geographical, although cultural and linguistic differences still exist between some of the districts/prefectures, especially between Okinawa and the mainland prefectures. The Major Histocompatibility Complex (MHC) region has consistently emerged as the most polymorphic region in the human genome, harbouring numerous biologically important variants; nevertheless the presence of population-specific long haplotypes hinders the imputation of SNPs and classical HLA alleles. Here, we examined the extent of genetic variation at the MHC between eight Japanese populations sampled from Okinawa, and six other prefectures located in or close to the mainland of Japan, specifically focusing at the haplotypes observed within each population, and what the impact of any variation has on imputation. Our results indicated that Okinawa was genetically farther to the mainland Japanese than were Gujarati Indians from Tamil Indians, while the mainland Japanese from six prefectures were more homogeneous than between northern and southern Han Chinese. The distribution of haplotypes across Japan was similar, although imputation was most accurate for Okinawa and several mainland prefectures when population-specific panels were used as reference. PMID:26648100

  20. Haplotype analysis indicates an association between the DOPA decarboxylase (DDC) gene and nicotine dependence.

    PubMed

    Ma, Jennie Z; Beuten, Joke; Payne, Thomas J; Dupont, Randolph T; Elston, Robert C; Li, Ming D

    2005-06-15

    DOPA decarboxylase (DDC; also known as L-amino acid decarboxylase; AADC) is involved in the synthesis of dopamine, norepinephrine and serotonin. Because the mesolimbic dopaminergic system is implicated in the reinforcing effects of many drugs, including nicotine, the DDC gene is considered a plausible candidate for involvement in the development of vulnerability to nicotine dependence (ND). Further, this gene is located within the 7p11 region that showed a 'suggestive linkage' to ND in our previous genome-wide scan in the Framingham Heart Study population. In the present study, we tested eight single nucleotide polymorphisms (SNPs) within DDC for association with ND, which was assessed by smoking quantity (SQ), the heaviness of smoking index (HSI) and the Fagerstrom test for ND (FTND) score, in a total of 2037 smokers and non-smokers from 602 nuclear families of African- or European-American (AA or EA, respectively) ancestry. Association analysis for individual SNPs using the PBAT-GEE program indicated that SNP rs921451 was significantly associated with two of the three adjusted ND measures in the EA sample (P=0.01-0.04). Haplotype-based association analysis revealed a protective T-G-T-G haplotype for rs921451-rs3735273-rs1451371-rs2060762 in the AA sample, which was significantly associated with all three adjusted ND measures after correction for multiple testing (min Z=-2.78, P=0.006 for HSI). In contrast, we found a high-risk T-G-T-G haplotype for a different SNP combination in the EA sample, rs921451-rs3735273-rs1451371-rs3757472, which showed a significant association after Bonferroni correction with the SQ and FTND score (max Z=2.73, P=0.005 for FTND). In summary, our findings provide the first evidence for the involvement of DDC in the susceptibility to ND and, further, reveal the racial specificity of its impact.

  1. HLA DPA1, DPB1 alleles and haplotypes contribute to the risk associated with type 1 diabetes: analysis of the type 1 diabetes genetics consortium families.

    PubMed

    Varney, Michael D; Valdes, Ana Maria; Carlson, Joyce A; Noble, Janelle A; Tait, Brian D; Bonella, Persia; Lavant, Eva; Fear, Anna Lisa; Louey, Anthony; Moonsamy, Priscilla; Mychaleckyj, Josyf C; Erlich, Henry

    2010-08-01

    To determine the relative risk associated with DPA1 and DPB1 alleles and haplotypes in type 1 diabetes. The frequency of DPA1 and DPB1 alleles and haplotypes in type 1 diabetic patients was compared to the family based control frequency in 1,771 families directly and conditional on HLA (B)-DRB1-DQA1-DQB1 linkage disequilibrium. A relative predispositional analysis (RPA) was performed in the presence or absence of the primary HLA DR-DQ associations and the contribution of DP haplotype to individual DR-DQ haplotype risks examined. Eight DPA1 and thirty-eight DPB1 alleles forming seventy-four DPA1-DPB1 haplotypes were observed; nineteen DPB1 alleles were associated with multiple DPA1 alleles. Following both analyses, type 1 diabetes susceptibility was significantly associated with DPB1*0301 (DPA1*0103-DPB1*0301) and protection with DPB1*0402 (DPA1*0103-DPB1*0402) and DPA1*0103-DPB1*0101 but not DPA1*0201-DPB1*0101. In addition, DPB1*0202 (DPA1*0103-DPB1*0202) and DPB1*0201 (DPA1*0103-DPB1*0201) were significantly associated with susceptibility in the presence of the high risk and protective DR-DQ haplotypes. Three associations (DPB1*0301, *0402, and *0202) remained statistically significant when only the extended HLA-A1-B8-DR3 haplotype was considered, suggesting that DPB1 alone may delineate the risk associated with this otherwise conserved haplotype. HLA DP allelic and haplotypic diversity contributes significantly to the risk for type 1 diabetes; DPB1*0301 (DPA1*0103-DPB1*0301) is associated with susceptibility and DPB1*0402 (DPA1*0103-DPB1*0402) and DPA1*0103-DPB1*0101 with protection. Additional evidence is presented for the susceptibility association of DPB1*0202 (DPA1*0103-DPB1*0202) and for a contributory role of individual amino acids and DPA1 or a gene in linkage disequilibrium in DR3-DPB1*0101 positive haplotypes.

  2. Association of interleukin-10 promoter haplotypes with disease susceptibility and IL-10 levels in Mexican patients with systemic lupus erythematosus.

    PubMed

    Palafox-Sánchez, Claudia Azucena; Oregon-Romero, Edith; Salazar-Camarena, Diana Celeste; Valle, Yeminia Maribel; Machado-Contreras, Jesús René; Cruz, Alvaro; Orozco-López, Mariana; Orozco-Barocio, Gerardo; Vázquez-Del Mercado, Mónica; Muñoz-Valle, José Francisco

    2015-11-01

    Systemic lupus erythematosus (SLE) is the prototype autoimmune rheumatic disease. The etiology of this disease is incompletely understood; however, environmental factors and genetic predisposition are involved. Cytokine-mediated immunity plays a crucial role in the pathogenesis of SLE. We investigate the association of interleukin-10 (IL-10) promoter polymorphisms and their haplotypes in SLE patients from the western Mexico. One hundred and twenty-five SLE patients fulfilling the 1997 ACR criteria and 260 unrelated healthy subjects (HS), both Mexican mestizos, were genotyped for IL-10 -1082A>G, -819C>T, and -592C>A polymorphisms. Haplotypes were inferred using the expectation-maximization algorithm, then allele and haplotype distributions were compared between patients and HS, as well as patients with different clinical variables. We identified at -1082, -819, and -592 four predominant haplotypes ACC (43.70 % in patients vs 46.55 % in HS), ATA (21.45 vs 22.97 %), GCC (16.28 vs 14.21 %), and GTA (14.12 vs 14.12 %). The ATC haplotype was more frequent in SLE respect to HS, suggesting a risk effect (3.23 vs 1.05 %; OR 3.55, CI 1.14-11.11; p = 0.0293). SLE patient carriers of -592 CC genotype as well as the dominant model of inheritance showed higher sIL-10 respect to AA genotype, suggesting that -592 C allele is associated with increased production of the cytokine (p < 0.05). The ACC haplotype had higher IL-10 serum levels and higher values of Mexican version of the Systemic Lupus Erythematosus Disease Activity Index compared with the other haplotype carriers; however, no association was found regarding autoantibodies. Our data suggest that the IL-10 promoter haplotypes play an important role in the risk of developing SLE and influence the production of IL-10 in Mexican population. Nevertheless, further studies are required to analyze the expression of mRNA as well as to investigate the interacting epigenetic factors that could help to define the true contribution of

  3. Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations.

    PubMed

    Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

    2007-08-10

    The sickle (betas) mutation in the beta-globin gene (HBB) occurs on five "classical" betas haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the betas allele - a consequence of protection from severe malarial infection afforded by heterozygotes - has been associated with a high degree of extended haplotype similarity. The relationship between classical betas haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical betas haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). The most common betas sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the betas mutation. Two different classical betas haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of betas haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle

  4. Brain white matter development is associated with a human-specific haplotype increasing the synthesis of long chain fatty acids.

    PubMed

    Peters, Bart D; Voineskos, Aristotle N; Szeszko, Philip R; Lett, Tristram A; DeRosse, Pamela; Guha, Saurav; Karlsgodt, Katherine H; Ikuta, Toshikazu; Felsky, Daniel; John, Majnu; Rotenberg, David J; Kennedy, James L; Lencz, Todd; Malhotra, Anil K

    2014-04-30

    The genetic and molecular pathways driving human brain white matter (WM) development are only beginning to be discovered. Long chain polyunsaturated fatty acids (LC-PUFAs) have been implicated in myelination in animal models and humans. The biosynthesis of LC-PUFAs is regulated by the fatty acid desaturase (FADS) genes, of which a human-specific haplotype is strongly associated with ω-3 and ω-6 LC-PUFA concentrations in blood. To investigate the relationship between LC-PUFA synthesis and human brain WM development, we examined whether this FADS haplotype is associated with age-related WM differences across the life span in healthy individuals 9-86 years of age (n = 207). Diffusion tensor imaging was performed to measure fractional anisotropy (FA), a putative measure of myelination, of the cerebral WM tracts. FADS haplotype status was determined with a single nucleotide polymorphism (rs174583) that tags this haplotype. Overall, normal age-related WM differences were observed, including higher FA values in early adulthood compared with childhood, followed by lower FA values across older age ranges. However, individuals homozygous for the minor allele (associated with lower LC-PUFA concentrations) did not display these normal age-related WM differences (significant age × genotype interactions, p(corrected) < 0.05). These findings suggest that LC-PUFAs are involved in human brain WM development from childhood into adulthood. This haplotype and LC-PUFAs may play a role in myelin-related disorders of neurodevelopmental origin.

  5. Genomic association for sexual precocity in beef heifers using pre-selection of genes and haplotype reconstruction

    PubMed Central

    Barbero, Marina M. D.; Oliveira, Henrique N.; de Camargo, Gregório M. F.; Fernandes Júnior, Gerardo A.; Aspilcueta-Borquis, Rusbel R.; Souza, Fabio R. P.; Boligon, Arione A.; Melo, Thaise P.; Regatieri, Inaê C.; Feitosa, Fabieli L. B.; Fonseca, Larissa F. S.; Magalhães, Ana F. B.; Costa, Raphael B.; Albuquerque, Lucia G.

    2018-01-01

    Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs. PMID:29293544

  6. Genomic association for sexual precocity in beef heifers using pre-selection of genes and haplotype reconstruction.

    PubMed

    Takada, Luciana; Barbero, Marina M D; Oliveira, Henrique N; de Camargo, Gregório M F; Fernandes Júnior, Gerardo A; Aspilcueta-Borquis, Rusbel R; Souza, Fabio R P; Boligon, Arione A; Melo, Thaise P; Regatieri, Inaê C; Feitosa, Fabieli L B; Fonseca, Larissa F S; Magalhães, Ana F B; Costa, Raphael B; Albuquerque, Lucia G

    2018-01-01

    Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs.

  7. ASSOCIATION BETWEEN GAB2 HAPLOTYPE AND HIGHER GLUCOSE METABOLISM IN ALZHEIMER'S DISEASE-AFFECTED BRAIN REGIONS IN COGNITIVELY NORMAL APOEε4 CARRIERS

    PubMed Central

    Liang, Winnie S.; Chen, Kewei; Lee, Wendy; Sidhar, Kunal; Corneveaux, Jason J.; Allen, April N.; Myers, Amanda; Villa, Stephen; Meechoovet, Bessie; Pruzin, Jeremy; Bandy, Daniel; Fleisher, Adam S.; Langbaum, Jessica B.S.; Huentelman, Matthew J.; Jensen, Kendall; Dunckley, Travis; Caselli, Richard J.; Kaib, Susan; Reiman, Eric M.

    2010-01-01

    In a genome-wide association study (GWAS) of late-onset Alzheimer's disease (AD), we found an association between common haplotypes of the GAB2 gene and AD risk in carriers of the apolipoprotein E (APOE) ε4 allele, the major late-onset AD susceptibility gene. We previously proposed the use of fluorodeoxyglucose positron emission tomography (FDG-PET) measurements as a quantitative presymptomatic endophenotype, more closely related to disease risk than the clinical syndrome itself, to help evaluate putative genetic and non-genetic modifiers of AD risk. In this study, we examined the relationship between the presence or absence of the relatively protective GAB2 haplotype and PET measurements of regional-to-whole brain FDG uptake in several AD-affected brain regions in 158 cognitively normal late-middle-aged APOEε4 homozygotes, heterozygotes, and non-carriers. GAB2 haplotypes were characterized using Affymetrix Genome-Wide Human SNP 6.0 Array data from each of these subjects. As predicted, the possibly protective GAB2 haplotype was associated with higher regional-to-whole brain FDG uptake in AD-affected brain regions in APOEε4 carriers. While additional studies are needed, this study supports the association between the possibly protective GAB2 haplotype and the risk of late-onset AD in APOEε4 carriers. It also supports the use of brain-imaging endophenotypes to help assess possible modifiers of AD risk. PMID:20888920

  8. eNOS gene haplotype is indirectly associated with the recovery of cardiovascular autonomic modulation from exercise.

    PubMed

    Silva, Bruno M; Barbosa, Thales C; Neves, Fabricia J; Sales, Allan K; Rocha, Natalia G; Medeiros, Renata F; Pereira, Felipe S; Garcia, Vinicius P; Cardoso, Fabiane T; Nobrega, Antonio C L

    2014-12-01

    Polymorphisms in the endothelial nitric oxide synthase (eNOS) gene decrease expression and activation of eNOS in vitro, which is associated with lower post-exercise increase in vasodilator reactivity in vivo. However, it is unknown whether such polymorphisms are associated with other eNOS-related phenotypes during recovery from exercise. Therefore, we investigated the impact of an eNOS haplotype containing polymorphic alleles at loci -786 and 894 on the recovery of cardiovascular autonomic function from exercise. Sedentary, non-obese, healthy subjects were enrolled [n = 107, age 32 ± 1 years (mean ± SEM)]. Resting autonomic modulation (heart rate variability, systolic blood pressure variability, and spontaneous baroreflex sensitivity) and vascular reactivity (forearm hyperemic response post-ischemia) were assessed at baseline, 10, 60, and 120 min after a maximal cardiopulmonary exercise test. Besides, autonomic function was assessed by heart rate recovery (HRR) immediately after peak exercise. Haplotype analysis showed that vagal modulation (i.e., HF n.u.) was significantly higher, combined sympathetic and vagal modulation (i.e., LF/HF) was significantly lower and total blood pressure variability was significantly lower post-exercise in a haplotype containing polymorphic alleles (H2) compared to a haplotype with wild type alleles (H1). HRR was similar between groups. Corroborating previous evidence, H2 had significantly lower post-exercise increase in vasodilator reactivity than H1. In conclusion, a haplotype containing polymorphic alleles at loci -786 and 894 had enhanced recovery of autonomic modulation from exercise, along with unchanged HRR, and attenuated vasodilator reactivity. Then, these results suggest an autonomic compensatory response of a direct deleterious effect of eNOS polymorphisms on the vascular function. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. OAS single-nucleotide polymorphisms and haplotypes are associated with variations in immune responses to rubella vaccine

    PubMed Central

    Haralambieva, Iana H.; Dhiman, Neelam; Ovsyannikova, Inna G.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

    2010-01-01

    Interferon (IFN)-induced antiviral genes are crucial players in innate antiviral defense and potential determinants of immune response heterogeneity. We selected 114 candidate SNPs from 12 antiviral genes using an LD tagSNP selection approach and genotyped them in a cohort of 738 schoolchildren immunized with two doses of rubella vaccine. Associations between SNPs/haplotypes and rubella virus-specific immune measures were assessed using linear regression methodologies. We identified 23 significant associations (p<0.05) between polymorphisms within the 2′-5′-oligoadenylate synthetase (OAS) gene cluster, and rubella virus-specific IL-2, IL-10, IL-6 secretion and antibody levels. The minor allele variants of three OAS1 SNPs (rs3741981/Ser162Gly, rs1051042/Thr361Arg, rs2660), located in a linkage disequilibrium block of functional importance, were significantly associated with an increase in rubella virus-specific IL-2/Th1 response (p≤0.024). Seven OAS1 and OAS3 promoter/regulatory SNPs were similarly associated with IL-2 secretion. Importantly, two SNPs (rs3741981 and rs10774670), independently cross-regulated rubella virus-specific IL-10 secretion levels (p≤0.031). Furthermore, both global tests and individual haplotype analyses revealed significant associations between OAS1 haplotypes and rubella virus-specific cytokine secretion. Our results suggest that innate immunity and OAS genetic variations are likely involved in modulating the magnitude and quality of the adaptive immune responses to live attenuated rubella vaccine. PMID:20079393

  10. X-chromosome as a marker for population history: linkage disequilibrium and haplotype study in Eurasian populations

    PubMed Central

    Laan, Maris; Wiebe, Victor; Khusnutdinova, Elza; Remm, Maido; Pääbo, Svante

    2005-01-01

    Linkage disequilibrium structure is still unpredictable because the interplay of regional recombination rate and demographic history is poorly understood. We have compared the distribution of LD across two genomic regions differing in crossing-over activity – Xq13 (0.166 cM/Mb) and Xp22 (1.3 cM/Mb) – in 15 Eurasian populations. Demographic events predicted to increase the LD level – genetic drift, bottleneck and admixture – had a very strong impact on extent and patterns of regional LD across Xq13 compared to Xp22. The haplotype distribution of the DXS1225-DXS8082 microsatellites from Xq13 exhibiting strong association in all populations was remarkably influenced by population history. European populations shared one common haplotype with a frequency of 25-40%. The Volga-Ural populations studied, living at the geographic borderline of Europe, showed elevated LD as well as harboring a significant fraction of haplotypes originating from East Asia, thus reflecting their past migrations and admixture. In the young Kuusamo isolate from Finland, a bottleneck has led to allelic associations between loci and shifted the haplotype distribution, but has much less affected single microsatellite allele frequencies compared to the main Finnish population. The data show that the footprint of a demographic event is longer preserved in haplotype distribution within a region of low crossing-over rate, than in the information content of a single marker, or between actively recombining markers. As the knowledge of LD patterns is often chosen to assist association mapping of common disease, our conclusions emphasise the importance of understanding the history, structure and variation of a study population. PMID:15657606

  11. Hereditary tyrosinemia type I: strong association with haplotype 6 in French Canadians permits simple carrier detection and prenatal diagnosis.

    PubMed Central

    Demers, S. I.; Phaneuf, D.; Tanguay, R. M.

    1994-01-01

    Hereditary tyrosinemia type 1 (HT1), a severe inborn error of tyrosine catabolism, is caused by deficiency of the terminal enzyme, fumarylacetoacetate hydrolase (FAH). The highest reported frequency of HT1 is in the French Canadian population, especially in the Saguenay-Lac-St-Jean region. Using human FAH cDNA probes, we have identified 10 haplotypes with TaqI, KpnI, RsaI, BglII, and MspI RFLPs in 118 normal chromosomes from the French Canadian population. Interestingly, in 29 HT1 children, a prevalent haplotype, haplotype 6, was found to be strongly associated with the disease, at a frequency of 90% of alleles, as compared with approximately 18% in 35 control individuals. This increased to 96% in the 24 patients originating from Saguenay-Lac-St-Jean. These results suggest that one or only a few prevailing mutations are responsible for most of the HT1 cases in Saguenay-Lac-St-Jean. Since most patients were found to be homozygous for a specific haplotype in this population, FAH RFLPs have permitted simple carrier detection in nine different informative HT1 families, with a confidence level of 99.9%. Heterozygosity rate values obtained from 52 carriers indicated that approximately 88% of families at risk from Saguenay-Lac-St-Jean are fully or partially informative. Prenatal diagnosis was also achieved in an American family. Analysis of 24 HT1 patients from nine countries gave a frequency of approximately 52% for haplotype 6, suggesting a relatively high association, worldwide, of HT1 with this haplotype. Images Figure 1 PMID:7913582

  12. Haplotype-based association analysis of general cognitive ability in Generation Scotland, the English Longitudinal Study of Ageing, and UK Biobank.

    PubMed

    Howard, David M; Adams, Mark J; Clarke, Toni-Kim; Wigmore, Eleanor M; Zeng, Yanni; Hagenaars, Saskia P; Lyall, Donald M; Thomson, Pippa A; Evans, Kathryn L; Porteous, David J; Nagy, Reka; Hayward, Caroline; Haley, Chris S; Smith, Blair H; Murray, Alison D; Batty, G David; Deary, Ian J; McIntosh, Andrew M

    2017-01-01

    Cognitive ability is a heritable trait with a polygenic architecture, for which several associated variants have been identified using genotype-based and candidate gene approaches. Haplotype-based analyses are a complementary technique that take phased genotype data into account, and potentially provide greater statistical power to detect lower frequency variants. In the present analysis, three cohort studies (n total = 48,002) were utilised: Generation Scotland: Scottish Family Health Study (GS:SFHS), the English Longitudinal Study of Ageing (ELSA), and the UK Biobank. A genome-wide haplotype-based meta-analysis of cognitive ability was performed, as well as a targeted meta-analysis of several gene coding regions. None of the assessed haplotypes provided evidence of a statistically significant association with cognitive ability in either the individual cohorts or the meta-analysis. Within the meta-analysis, the haplotype with the lowest observed P -value overlapped with the D-amino acid oxidase activator ( DAOA ) gene coding region. This coding region has previously been associated with bipolar disorder, schizophrenia and Alzheimer's disease, which have all been shown to impact upon cognitive ability. Another potentially interesting region highlighted within the current genome-wide association analysis (GS:SFHS: P = 4.09 x 10 -7 ), was the butyrylcholinesterase ( BCHE ) gene coding region. The protein encoded by BCHE has been shown to influence the progression of Alzheimer's disease and its role in cognitive ability merits further investigation. Although no evidence was found for any haplotypes with a statistically significant association with cognitive ability, our results did provide further evidence that the genetic variants contributing to the variance of cognitive ability are likely to be of small effect.

  13. Ultra-high density intra-specific genetic linkage maps accelerate identification of functionally relevant molecular tags governing important agronomic traits in chickpea

    PubMed Central

    Kujur, Alice; Upadhyaya, Hari D.; Shree, Tanima; Bajaj, Deepak; Das, Shouvik; Saxena, Maneesha S.; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. L.; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

    2015-01-01

    We discovered 26785 and 16573 high-quality SNPs differentiating two parental genotypes of a RIL mapping population using reference desi and kabuli genome-based GBS assay. Of these, 3625 and 2177 SNPs have been integrated into eight desi and kabuli chromosomes, respectively in order to construct ultra-high density (0.20–0.37 cM) intra-specific chickpea genetic linkage maps. One of these constructed high-resolution genetic map has potential to identify 33 major genomic regions harbouring 35 robust QTLs (PVE: 17.9–39.7%) associated with three agronomic traits, which were mapped within <1 cM mean marker intervals on desi chromosomes. The extended LD (linkage disequilibrium) decay (~15 cM) in chromosomes of genetic maps have encouraged us to use a rapid integrated approach (comparative QTL mapping, QTL-region specific haplotype/LD-based trait association analysis, expression profiling and gene haplotype-based association mapping) rather than a traditional QTL map-based cloning method to narrow-down one major seed weight (SW) robust QTL region. It delineated favourable natural allelic variants and superior haplotype-containing one seed-specific candidate embryo defective gene regulating SW in chickpea. The ultra-high-resolution genetic maps, QTLs/genes and alleles/haplotypes-related genomic information generated and integrated strategy for rapid QTL/gene identification developed have potential to expedite genomics-assisted breeding applications in crop plants, including chickpea for their genetic enhancement. PMID:25942004

  14. Estimating haplotype frequencies by combining data from large DNA pools with database information.

    PubMed

    Gasbarra, Dario; Kulathinal, Sangita; Pirinen, Matti; Sillanpää, Mikko J

    2011-01-01

    We assume that allele frequency data have been extracted from several large DNA pools, each containing genetic material of up to hundreds of sampled individuals. Our goal is to estimate the haplotype frequencies among the sampled individuals by combining the pooled allele frequency data with prior knowledge about the set of possible haplotypes. Such prior information can be obtained, for example, from a database such as HapMap. We present a Bayesian haplotyping method for pooled DNA based on a continuous approximation of the multinomial distribution. The proposed method is applicable when the sizes of the DNA pools and/or the number of considered loci exceed the limits of several earlier methods. In the example analyses, the proposed model clearly outperforms a deterministic greedy algorithm on real data from the HapMap database. With a small number of loci, the performance of the proposed method is similar to that of an EM-algorithm, which uses a multinormal approximation for the pooled allele frequencies, but which does not utilize prior information about the haplotypes. The method has been implemented using Matlab and the code is available upon request from the authors.

  15. COI haplotype groups in Mesocriconema (Nematoda: Criconematidae) and their morphospecies associations.

    PubMed

    Powers, T O; Bernard, E C; Harris, T; Higgins, R; Olson, M; Lodema, M; Mullin, P; Sutton, L; Powers, K S

    2014-07-03

    Without applying an a priori bias for species boundaries, specimen identities in the plant-parasitic nematode genus Mesocriconema were evaluated by examining mitochondrial COI nucleotide sequences, morphology, and biogeography. A total of 242 specimens that morphologically conformed to the genus were individually photographed, measured, and amplified by a PCR primer set to preserve the linkage between specimen morphology and a specific DNA barcode sequence. Specimens were extracted from soil samples representing 45 locations across 23 ecoregions in North America. Dendrograms constructed by neighbor-joining, maximum likelihood, and Bayesian Inference using a 721-bp COI barcode were used to group COI haplotypes. Each tree-building approach resulted in 24 major haplotype groups within the dataset. The distinctiveness of these groups was evaluated by node support, genetic distance, absence of intermediates, and several measures of distinctiveness included in software used for the exploration of species boundaries. Five of the 24 COI haplotype groups corresponded to morphologically characterized, Linnaean species. Morphospecies conforming to M. discus, Discocriconemella inarata, M. rusticum, M. onoense, and M. kirjanovae were represented by groups composed of multiple closely related or identical COI haplotypes. In other cases, morphospecies names could be equally applied to multiple haplotype groups that were genetically distant from each other. Identification based on morphology alone resulted in M. curvatum and M. ornatum species designations applied to seven and three groups, respectively. Morphological characters typically used for species level identification were demonstrably variable within haplotype groups, suggesting caution in assigning species names based on published compendia that solely consider morphological characters. Morphospecies classified as M. xenoplax formed a monophyletic group composed of seven genetically distinct COI subgroups. The species

  16. Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations

    PubMed Central

    Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

    2007-01-01

    Background The sickle (βs) mutation in the beta-globin gene (HBB) occurs on five "classical" βs haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the βs allele – a consequence of protection from severe malarial infection afforded by heterozygotes – has been associated with a high degree of extended haplotype similarity. The relationship between classical βs haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical βs haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). Results The most common βs sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the βs mutation. Conclusion Two different classical βs haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of βs haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence

  17. Factor IX gene haplotypes in Amerindians.

    PubMed

    Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S

    1997-02-01

    We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.

  18. Genotypes and Haplotypes of the Estrogen Receptor α Gene (ESR1) Are Associated With Female-to-Male Gender Dysphoria.

    PubMed

    Cortés-Cortés, Joselyn; Fernández, Rosa; Teijeiro, Nerea; Gómez-Gil, Esther; Esteva, Isabel; Almaraz, Mari Cruz; Guillamón, Antonio; Pásaro, Eduardo

    2017-03-01

    Gender dysphoria, a marked incongruence between one's experienced gender and biological sex, is commonly believed to arise from discrepant cerebral and genital sexual differentiation. With the discovery that estrogen receptor β is associated with female-to-male (FtM) but not with male-to-female (MtF) gender dysphoria, and given estrogen receptor α involvement in central nervous system masculinization, it was hypothesized that estrogen receptor α, encoded by the ESR1 gene, also might be implicated. To investigate whether ESR1 polymorphisms (TA)n-rs3138774, PvuII-rs2234693, and XbaI-rs9340799 and their haplotypes are associated with gender dysphoria in adults. Molecular analysis was performed in peripheral blood samples from 183 FtM subjects, 184 MtF subjects, and 394 sex- and ethnically-matched controls. Genotype and haplotype analyses of the (TA)n-rs3138774, PvuII-rs2234693, and XbaI-rs9340799 polymorphisms. Allele and genotype frequencies for the polymorphism XbaI were statistically significant only in FtM vs control XX subjects (P = .021 and P = .020). In XX individuals, the A/G genotype was associated with a low risk of gender dysphoria (odds ratio [OR] = 0.34; 95% CI = 0.16-0.74; P = .011); in XY individuals, the A/A genotype implied a low risk of gender dysphoria (OR = 0.39; 95% CI = 0.17-0.89; P = .008). Binary logistic regression showed partial effects for all three polymorphisms in FtM but not in MtF subjects. The three polymorphisms were in linkage disequilibrium: a small number of TA repeats was linked to the presence of PvuII and XbaI restriction sites (haplotype S-T-A), and a large number of TA repeats was linked to the absence of these restriction sites (haplotype L-C-G). In XX individuals, the presence of haplotype L-C-G carried a low risk of gender dysphoria (OR = 0.66; 95% CI = 0.44-0.99; P = .046), whereas the presence of haplotype L-C-A carried a high susceptibility to gender dysphoria (OR = 3.96; 95% CI = 1.04-15.02; P = .044

  19. 4G/5G Plasminogen Activator Inhibitor-1 Polymorphisms and Haplotypes Are Associated with Pneumonia

    PubMed Central

    Yende, Sachin; Angus, Derek C.; Ding, Jingzhong; Newman, Anne B.; Kellum, John A.; Li, Rongling; Ferrell, Robert E.; Zmuda, Joseph; Kritchevsky, Stephen B.; Harris, Tamara B.; Garcia, Melissa; Yaffe, Kristine; Wunderink, Richard G.

    2007-01-01

    Rationale: Plasminogen activator inhibitor (PAI)-1 inhibits urokinase and tissue plasminogen activator, required for host response to infection. Whether variation within the PAI-1 gene is associated with increased susceptibility to infection is unknown. Objectives: To ascertain the role of the 4G/5G polymorphism and other genetic variants within the PAI-1 gene. We hypothesized that variants associated with increased PAI-1 expression would be associated with an increased occurrence of community-acquired pneumonia (CAP). Methods: Longitudinal analysis (>12 yr) of the Health, Aging, and Body Composition cohort, aged 65–74 years at start of analysis. Measurements and Main Results: We genotyped the 4G/5G PAI-1 polymorphism and six additional single nucleotide polymorphisms. Of the 3,075 subjects, 272 (8.8%) had at least one hospitalization for CAP. Among whites, variants at the PAI4G,5G, PAI2846, and PAI7343 sites had higher risk of CAP (P = 0.018, 0.021, and 0.021, respectively). At these sites, variants associated with higher PAI-1 expression were associated with increased CAP susceptibility. Compared with the 5G/5G genotypes at PAI4G,5G site, the 4G/4G and 4G/5G genotypes were associated with a 1.98-fold increased risk of CAP (95% confidence interval, 1.2–3.2; P = 0.006). In whole blood stimulation assay, subjects with a 4G allele had 3.3- and 1.9-fold increased PAI-1 expression (P = 0.043 and 0.034, respectively). In haplotype analysis, the 4G/G/C/A haplotype at the PAI4G,5G, PAI2846, PAI4588, and PAI7343 single nucleotide polymorphisms was associated with higher CAP susceptibility, whereas the 5G/G/C/A haplotype was associated with lower CAP susceptibility. No associations were seen among blacks. Conclusions: Genotypes associated with increased expression of PAI-1 were associated with increased susceptibility to CAP in elderly whites. PMID:17761618

  20. [Fine mapping of complex disease susceptibility loci].

    PubMed

    Song, Qingfeng; Zhang, Hongxing; Ma, Yilong; Zhou, Gangqiao

    2014-01-01

    Genome-wide association studies (GWAS) using single nucleotide polymorphism (SNP) markers have identified more than 3800 susceptibility loci for more than 660 diseases or traits. However, the most significantly associated variants or causative variants in these loci and their biological functions have remained to be clarified. These causative variants can help to elucidate the pathogenesis and discover new biomarkers of complex diseases. One of the main goals in the post-GWAS era is to identify the causative variants and susceptibility genes, and clarify their functional aspects by fine mapping. For common variants, imputation or re-sequencing based strategies were implemented to increase the number of analyzed variants and help to identify the most significantly associated variants. In addition, functional element, expression quantitative trait locus (eQTL) and haplotype analyses were performed to identify functional common variants and susceptibility genes. For rare variants, fine mapping was carried out by re-sequencing, rare haplotype analysis, family-based analysis, burden test, etc.This review summarizes the strategies and problems for fine mapping.

  1. SNP and haplotype analysis of paired box 3 (PAX3) gene provide evidence for association with growth traits in Chinese cattle.

    PubMed

    Xu, Yao; Cai, Hanfang; Zhou, Yang; Shi, Tao; Lan, Xianyong; Zhang, Chunlei; Lei, Chuzhao; Jia, Yutang; Chen, Hong

    2014-07-01

    Paired box 3 (PAX3) belongs to the PAX superfamily of transcription factors and plays essential roles in the embryogenesis and postnatal formation of limb musculature through affecting the survival of muscle progenitor cells. By genetic mapping, PAX3 gene is assigned in the interval of quantitative trait loci for body weight on bovine BTA2. The objectives of this study were to detect polymorphisms of PAX3 gene in 1,241 cattle from five breeds and to investigate their effects on growth traits. Initially, three novel single nucleotide polymorphisms (SNPs) were identified by DNA pool sequencing and aCRS-RFLP methods (AC_000159: g.T-580G, g.A4617C and g.79018Ins/del G), which were located at 5'-UTR, exon 4 and intron 6, respectively. A total of eight haplotypes were constructed and the frequency of the three main haplotypes H1 (TAG), H2 (GCG) and H3 (GAG) accounted for over 81.7 % of the total individuals. Statistical analysis revealed that the three SNPs were associated with body height and body length of Nanyang and Chinese Caoyuan cattle at the age of 6 and/or 12 months old (P < 0.05), and consistently significant effects were also found in the haplotype combination analysis on these traits (P < 0.05). This study presented a complete scan of variations within bovine PAX3 gene, which could provide evidence for improving the economic traits of cattle by using these variations as potentially genetic markers in early marker-assisted selection programs.

  2. Gene genealogies for genetic association mapping, with application to Crohn's disease

    PubMed Central

    Burkett, Kelly M.; Greenwood, Celia M. T.; McNeney, Brad; Graham, Jinko

    2013-01-01

    A gene genealogy describes relationships among haplotypes sampled from a population. Knowledge of the gene genealogy for a set of haplotypes is useful for estimation of population genetic parameters and it also has potential application in finding disease-predisposing genetic variants. As the true gene genealogy is unknown, Markov chain Monte Carlo (MCMC) approaches have been used to sample genealogies conditional on data at multiple genetic markers. We previously implemented an MCMC algorithm to sample from an approximation to the distribution of the gene genealogy conditional on haplotype data. Our approach samples ancestral trees, recombination and mutation rates at a genomic focal point. In this work, we describe how our sampler can be used to find disease-predisposing genetic variants in samples of cases and controls. We use a tree-based association statistic that quantifies the degree to which case haplotypes are more closely related to each other around the focal point than control haplotypes, without relying on a disease model. As the ancestral tree is a latent variable, so is the tree-based association statistic. We show how the sampler can be used to estimate the posterior distribution of the latent test statistic and corresponding latent p-values, which together comprise a fuzzy p-value. We illustrate the approach on a publicly-available dataset from a study of Crohn's disease that consists of genotypes at multiple SNP markers in a small genomic region. We estimate the posterior distribution of the tree-based association statistic and the recombination rate at multiple focal points in the region. Reassuringly, the posterior mean recombination rates estimated at the different focal points are consistent with previously published estimates. The tree-based association approach finds multiple sub-regions where the case haplotypes are more genetically related than the control haplotypes, and that there may be one or multiple disease-predisposing loci. PMID

  3. Family-based association study of matrix metalloproteinase-3 and -9 haplotypes with susceptibility to ischemic white matter injury.

    PubMed

    Fornage, Myriam; Mosley, Thomas H; Jack, Clifford R; de Andrade, Mariza; Kardia, Sharon L R; Boerwinkle, Eric; Turner, Stephen T

    2007-01-01

    Susceptibility to ischemic damage to the subcortical white matter of the brain has a strong genetic basis. Dysregulation of matrix metalloproteinases (MMPs) contributes to loss of cerebrovascular integrity and white matter injury. We investigated whether sequence variation in the genes encoding MMP3 and MMP9 is associated with variation in leukoaraiosis volume, determined by magnetic resonance imaging, in non-Hispanic whites and African-Americans using family-based association tests. Seven hundred and fifty-six white and 671 African-American individuals from sibships ascertained through two or more siblings with hypertension were genotyped for 7 and 8 haplotype-tagging polymorphisms in the MMP3 and MMP9 genes, respectively. MMP3 sequence variation was significantly associated with variation in leukoaraiosis volume in Whites. Two common haplotypes with opposing relationships to leukoaraiosis volume were identified. MMP9 sequence variation was also significantly associated with variation in leukoaraiosis volume in both African-Americans and Whites. Different haplotypes contributed to these associations in the two racial groups. These findings add to the growing body of evidence from animal models and human clinical studies suggesting a role of MMPs in ischemic white matter injury. They provide the basis for further investigation of the role of these genes in susceptibility and/or progression to clinical disease.

  4. Dimensional Anxiety Mediates Linkage of GABRA2 Haplotypes With Alcoholism

    PubMed Central

    Enoch, Mary-Anne; Schwartz, Lori; Albaugh, Bernard; Virkkunen, Matti; Goldman, David

    2015-01-01

    The GABAAα2 receptor gene (GABRA2) modulates anxiety and stress response. Three recent association studies implicate GABRA2 in alcoholism, however in these papers both common, opposite-configuration haplotypes in the region distal to intron3 predict risk. We have now replicated the GABRA2 association with alcoholism in 331 Plains Indian men and women and 461 Finnish Caucasian men. Using a dimensional measure of anxiety, harm avoidance (HA), we also found that the association with alcoholism is mediated, or moderated, by anxiety. Nine SNPs were genotyped revealing two haplotype blocks. Within the previously implicated block 2 region, we identified the two common, opposite-configuration risk haplotypes, A and B. Their frequencies differed markedly in Finns and Plains Indians. In both populations, most block 2 SNPs were significantly associated with alcoholism. The associations were due to increased frequencies of both homozygotes in alcoholics, indicating the possibility of alcoholic subtypes with opposite genotypes. Congruently, there was no significant haplotype association. Using HA as an indicator variable for anxiety, we found haplotype linkage to alcoholism with high and low dimensional anxiety, and to HA itself, in both populations. High HA alcoholics had the highest frequency of the more abundant haplotype (A in Finns, B in Plains Indians); low HA alcoholics had the highest frequency of the less abundant haplotype (B in Finns, A in Plains Indians) (Finns: P α0.007, OR α2.1, Plains Indians: P α0.040, OR α1.9). Non-alcoholics had intermediate frequencies. Our results suggest that within the distal GABRA2 region is a functional locus or loci that may differ between populations but that alters risk for alcoholism via the mediating action of anxiety. PMID:16874763

  5. β3 Integrin Haplotype Influences Gene Regulation and Plasma von Willebrand Factor Activity

    PubMed Central

    Payne, Katie E; Bray, Paul F; Grant, Peter J; Carter, Angela M

    2008-01-01

    The Leu33Pro polymorphism of the gene encoding β3 integrin (ITGB3) is associated with acute coronary syndromes and influences platelet aggregation. Three common promoter polymorphisms have also been identified. The aims of this study were to (1) investigate the influence of the ITGB3 −400C/A, −425A/C and −468G/A promoter polymorphisms on reporter gene expression and nuclear protein binding and (2) determine genotype and haplotype associations with platelet αIIbβ3 receptor density. Promoter haplotypes were introduced into an ITGB3 promoter-pGL3 construct by site directed mutagenesis and luciferase reporter gene expression analysed in HEL and HMEC-1 cells. Binding of nuclear proteins was assessed by electrophoretic mobility shift assay. The association of ITGB3 haplotype with platelet αIIbβ3 receptor density was determined in 223 subjects. Species conserved motifs were identified in the ITGB3 promoter in the vicinity of the 3 polymorphisms. The GAA, GCC, AAC, AAA and ACC constructs induced ~50% increased luciferase expression relative to the GAC construct in both cell types. Haplotype analysis including Leu33Pro indicated 5 common haplotypes; no associations between ITGB3 haplotypes and receptor density were found. However, the GCC-Pro33 haplotype was associated with significantly higher vWF activity (128.6 [112.1–145.1]%) compared with all other haplotypes (107.1 [101.2–113.0]%, p=0.02). In conclusion, the GCC-Pro33 haplotype was associated with increased vWF activity but not with platelet αIIbβ3 receptor density, which may indicate ITGB3 haplotype influences endothelial function. PMID:18045606

  6. Prion gene haplotypes of U.S. cattle

    PubMed Central

    Clawson, Michael L; Heaton, Michael P; Keele, John W; Smith, Timothy PL; Harhay, Gregory P; Laegreid, William W

    2006-01-01

    Background Bovine spongiform encephalopathy (BSE) is a fatal neurological disorder characterized by abnormal deposits of a protease-resistant isoform of the prion protein. Characterizing linkage disequilibrium (LD) and haplotype networks within the bovine prion gene (PRNP) is important for 1) testing rare or common PRNP variation for an association with BSE and 2) interpreting any association of PRNP alleles with BSE susceptibility. The objective of this study was to identify polymorphisms and haplotypes within PRNP from the promoter region through the 3'UTR in a diverse sample of U.S. cattle genomes. Results A 25.2-kb genomic region containing PRNP was sequenced from 192 diverse U.S. beef and dairy cattle. Sequence analyses identified 388 total polymorphisms, of which 287 have not previously been reported. The polymorphism alleles define PRNP by regions of high and low LD. High LD is present between alleles in the promoter region through exon 2 (6.7 kb). PRNP alleles within the majority of intron 2, the entire coding sequence and the untranslated region of exon 3 are in low LD (18.0 kb). Two haplotype networks, one representing the region of high LD and the other the region of low LD yielded nineteen different combinations that represent haplotypes spanning PRNP. The haplotype combinations are tagged by 19 polymorphisms (htSNPS) which characterize variation within and across PRNP. Conclusion The number of polymorphisms in the prion gene region of U.S. cattle is nearly four times greater than previously described. These polymorphisms define PRNP haplotypes that may influence BSE susceptibility in cattle. PMID:17092337

  7. Haplotype Phasing and Inheritance of Copy Number Variants in Nuclear Families

    PubMed Central

    Palta, Priit; Kaplinski, Lauris; Nagirnaja, Liina; Veidenberg, Andres; Möls, Märt; Nelis, Mari; Esko, Tõnu; Metspalu, Andres; Laan, Maris; Remm, Maido

    2015-01-01

    DNA copy number variants (CNVs) that alter the copy number of a particular DNA segment in the genome play an important role in human phenotypic variability and disease susceptibility. A number of CNVs overlapping with genes have been shown to confer risk to a variety of human diseases thus highlighting the relevance of addressing the variability of CNVs at a higher resolution. So far, it has not been possible to deterministically infer the allelic composition of different haplotypes present within the CNV regions. We have developed a novel computational method, called PiCNV, which enables to resolve the haplotype sequence composition within CNV regions in nuclear families based on SNP genotyping microarray data. The algorithm allows to i) phase normal and CNV-carrying haplotypes in the copy number variable regions, ii) resolve the allelic copies of rearranged DNA sequence within the haplotypes and iii) infer the heritability of identified haplotypes in trios or larger nuclear families. To our knowledge this is the first program available that can deterministically phase null, mono-, di-, tri- and tetraploid genotypes in CNV loci. We applied our method to study the composition and inheritance of haplotypes in CNV regions of 30 HapMap Yoruban trios and 34 Estonian families. For 93.6% of the CNV loci, PiCNV enabled to unambiguously phase normal and CNV-carrying haplotypes and follow their transmission in the corresponding families. Furthermore, allelic composition analysis identified the co-occurrence of alternative allelic copies within 66.7% of haplotypes carrying copy number gains. We also observed less frequent transmission of CNV-carrying haplotypes from parents to children compared to normal haplotypes and identified an emergence of several de novo deletions and duplications in the offspring. PMID:25853576

  8. Haplotype phasing and inheritance of copy number variants in nuclear families.

    PubMed

    Palta, Priit; Kaplinski, Lauris; Nagirnaja, Liina; Veidenberg, Andres; Möls, Märt; Nelis, Mari; Esko, Tõnu; Metspalu, Andres; Laan, Maris; Remm, Maido

    2015-01-01

    DNA copy number variants (CNVs) that alter the copy number of a particular DNA segment in the genome play an important role in human phenotypic variability and disease susceptibility. A number of CNVs overlapping with genes have been shown to confer risk to a variety of human diseases thus highlighting the relevance of addressing the variability of CNVs at a higher resolution. So far, it has not been possible to deterministically infer the allelic composition of different haplotypes present within the CNV regions. We have developed a novel computational method, called PiCNV, which enables to resolve the haplotype sequence composition within CNV regions in nuclear families based on SNP genotyping microarray data. The algorithm allows to i) phase normal and CNV-carrying haplotypes in the copy number variable regions, ii) resolve the allelic copies of rearranged DNA sequence within the haplotypes and iii) infer the heritability of identified haplotypes in trios or larger nuclear families. To our knowledge this is the first program available that can deterministically phase null, mono-, di-, tri- and tetraploid genotypes in CNV loci. We applied our method to study the composition and inheritance of haplotypes in CNV regions of 30 HapMap Yoruban trios and 34 Estonian families. For 93.6% of the CNV loci, PiCNV enabled to unambiguously phase normal and CNV-carrying haplotypes and follow their transmission in the corresponding families. Furthermore, allelic composition analysis identified the co-occurrence of alternative allelic copies within 66.7% of haplotypes carrying copy number gains. We also observed less frequent transmission of CNV-carrying haplotypes from parents to children compared to normal haplotypes and identified an emergence of several de novo deletions and duplications in the offspring.

  9. Novel strategies to mine alcoholism-related haplotypes and genes by combining existing knowledge framework.

    PubMed

    Zhang, RuiJie; Li, Xia; Jiang, YongShuai; Liu, GuiYou; Li, ChuanXing; Zhang, Fan; Xiao, Yun; Gong, BinSheng

    2009-02-01

    High-throughout single nucleotide polymorphism detection technology and the existing knowledge provide strong support for mining the disease-related haplotypes and genes. In this study, first, we apply four kinds of haplotype identification methods (Confidence Intervals, Four Gamete Tests, Solid Spine of LD and fusing method of haplotype block) into high-throughout SNP genotype data to identify blocks, then use cluster analysis to verify the effectiveness of the four methods, and select the alcoholism-related SNP haplotypes through risk analysis. Second, we establish a mapping from haplotypes to alcoholism-related genes. Third, we inquire NCBI SNP and gene databases to locate the blocks and identify the candidate genes. In the end, we make gene function annotation by KEGG, Biocarta, and GO database. We find 159 haplotype blocks, which relate to the alcoholism most possibly on chromosome 1 approximately 22, including 227 haplotypes, of which 102 SNP haplotypes may increase the risk of alcoholism. We get 121 alcoholism-related genes and verify their reliability by the functional annotation of biology. In a word, we not only can handle the SNP data easily, but also can locate the disease-related genes precisely by combining our novel strategies of mining alcoholism-related haplotypes and genes with existing knowledge framework.

  10. Molecular definition of red cell Rh haplotypes by tightly linked SphI RFLPs.

    PubMed

    Huang, C H; Reid, M E; Chen, Y; Coghlan, G; Okubo, Y

    1996-01-01

    The Rh blood group system of human red cells contains five major antigens D, C/c, and E/e (the latter four designated "non-D") that are specified by eight gene complexes known as Rh haplotypes. In this paper, we report on the mapping of RH locus and identification of a set of SphI RFLPs that are tightly linked with the Rh structural genes. Using exon-specific probes, we have localized the SphI cleavage sites resulting in these DNA markers and derived a comprehensive map for the RH locus. It was found that the SphI fragments encompassing exons 4-7 of the Rh genes occur in four banding patterns or frameworks that correspond to the distribution and segregation of the common Rh haplotypes. This linkage disequilibrium allowed a genotype-phenotype correlation and direct determination of Rh zygosity related to the Rh-positive or Rh-negative status (D/D, D/d, and d/d). Studies on the occurrence of SphI RFLPs in a number of rare Rh variants indicated that Rh phenotypic diversity has taken place on different haplotype backgrounds and has arisen by diverse genetic mechanisms. The molecular definition of Rh haplotypes by SphI RFLP frameworks should provide a useful procedure for genetic counseling and prenatal assessment of Rh alloimmunization.

  11. Genome-Wide Association Mapping for Yield and Other Agronomic Traits in an Elite Breeding Population of Tropical Rice (Oryza sativa)

    PubMed Central

    Lalusin, Antonio; Borromeo, Teresita; Gregorio, Glenn; Hernandez, Jose; Virk, Parminder; Collard, Bertrand; McCouch, Susan R.

    2015-01-01

    Genome-wide association mapping studies (GWAS) are frequently used to detect QTL in diverse collections of crop germplasm, based on historic recombination events and linkage disequilibrium across the genome. Generally, diversity panels genotyped with high density SNP panels are utilized in order to assay a wide range of alleles and haplotypes and to monitor recombination breakpoints across the genome. By contrast, GWAS have not generally been performed in breeding populations. In this study we performed association mapping for 19 agronomic traits including yield and yield components in a breeding population of elite irrigated tropical rice breeding lines so that the results would be more directly applicable to breeding than those from a diversity panel. The population was genotyped with 71,710 SNPs using genotyping-by-sequencing (GBS), and GWAS performed with the explicit goal of expediting selection in the breeding program. Using this breeding panel we identified 52 QTL for 11 agronomic traits, including large effect QTLs for flowering time and grain length/grain width/grain-length-breadth ratio. We also identified haplotypes that can be used to select plants in our population for short stature (plant height), early flowering time, and high yield, and thus demonstrate the utility of association mapping in breeding populations for informing breeding decisions. We conclude by exploring how the newly identified significant SNPs and insights into the genetic architecture of these quantitative traits can be leveraged to build genomic-assisted selection models. PMID:25785447

  12. Genetic variation of 'Candidatus Liberibacter solanacearum' haplotype C and identification of a novel haplotype from Trioza urticae and stinging nettle.

    PubMed

    Haapalainen, Minna L; Wang, Jinhui; Latvala, Satu; Lehtonen, Mikko T; Pirhonen, Minna; Nissinen, Anne I

    2018-03-30

    'Candidatus Liberibacter solanacearum' (CLso) haplotype C is associated with disease in carrots and transmitted by the carrot psyllid Trioza apicalis. To identify possible other sources and vectors of this pathogen in Finland, samples were taken of wild plants within and near the carrot fields, the psyllids feeding on these plants, parsnips growing next to carrots, and carrot seeds. For analyzing the genotype of the CLso positive samples, a multi-locus sequence typing (MLST) scheme was developed. CLso haplotype C was detected in 11% of the Trioza anthrisci samples, in 35% of the Anthriscus sylvestris plants with discoloration, and in parsnips showing leaf discoloration. MLST revealed that the CLso in T. anthrisci and most A. sylvestris plants represent different strains than the bacteria found in T. apicalis and the cultivated plants. CLso haplotype D was detected in two of the 34 carrot seed lots tested, but was not detected in the plants grown from these seeds. Phylogenetic analysis by UPGMA clustering suggested that the haplotype D is more closely related to the haplotype A than to C. A novel, sixth haplotype of CLso, most closely related to A and D, was found in the psyllid Trioza urticae and stinging nettle (Urtica dioica, Urticaceae), and named as haplotype U.

  13. Haplotypes of heparin-binding epidermal-growth-factor-like growth factor gene are associated with pre-eclampsia.

    PubMed

    Harendra, Galhenagey Gayani; Jayasekara, Rohan W; Dissanayake, Vajira H W

    2012-01-01

    Heparin-binding epidermal-growth-factor-like growth factor (HBEGF) plays an important role in placentation, including impaired placentation, the primary defect seen in pre-eclampsia. We carried out a case-control disease-association study to examine the association of single nucleotide polymorphisms (SNP) in the HBEGF gene and haplotypes defined by them with pre-eclampsia in a Sinhalese population in Sri Lanka. A total of 175 women with pre-eclampsia and 171 matched normotensive controls were genotyped for six SNP selected in silico as having putative functional effects using mass array Sequenom iplex methodology and a newly designed polymerase chain reaction-restriction fragment length polymorphism assay. The individual SNP were not associated with pre-eclampsia. The haplotypes defined by them, however, showed both predisposing (rs13385T,rs2074613G,rs2237076G,rs2074611C,rs4150196A,rs1862176A; odds ratio,1.65; 95% confidence interval1.04-2.60; P=0.032) and protective (rs13385C,rs2074613G,rs2237076A,rs2074611C,rs4150196A,rs1862176A; odds ratio,0.20; 95% confidence interval, 0.04-0.89; P=0.034) effects. These results confirm that polymorphisms in the HGEGF gene are associated with pre-eclampsia. The haplotypes are likely to exert their effects through the numerous transcription regulation factors binding to the polymorphic sites, namely GATA-1, GATA-3, MZF-1 and AML-1a. © 2011 The Authors. Journal of Obstetrics and Gynaecology Research © 2011 Japan Society of Obstetrics and Gynecology.

  14. HapMap-based study on the association between MPO and GSTP1 gene polymorphisms and lung cancer susceptibility in Chinese Han population

    PubMed Central

    Gu, Jun-dong; Hua, Feng; Mei, Chao-rong; Zheng, De-jie; Wang, Guo-fan; Zhou, Qing-hua

    2014-01-01

    Aim: Myeloperoxidase (MPO) and glutathione S-transferase pi 1 (GSTP1) are important carcinogen-metabolizing enzymes. The aim of this study was to investigate the association between the common polymorphisms of MPO and GSTP1 genes and lung cancer risk in Chinese Han population. Methods: A total of 266 subjects with lung cancer and 307 controls without personal history of the disease were recruited in this case control study. The tagSNPs approach was used to assess the common polymorphisms of MOP and GSTP1 genes and lung cancer risk according to the disequilibrium information from the HapMap project. The tagSNP rs7208693 was selected as the polymorphism site for MPO, while the haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174 were selected as the polymorphism sites for GSTP1. The gene polymorphisms were confirmed using real-time PCR, cloning and sequencing. Results: The four GSTP1 haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174, but not the MPO tagSNP rs7208693, exhibited an association with lung cancer susceptibility in smokers in the overall population and in the studied subgroups. When Phase 2 software was used to reconstruct the haplotype for GSTP1, the haplotype CACA (rs749174+rs1695 + rs762803+rs4891) exhibited an increased risk of lung cancer among smokers (adjust odds ratio 1.53; 95%CI 1.04–2.25, P=0.033). Furthermore, diplotype analyses demonstrated that the significant association between the risk haplotype and lung cancer. The risk haplotypes co-segregated with one or more biologically functional polymorphisms and corresponded to a recessive inheritance model. Conclusion: The common polymorphisms of the GSTP1 gene may be the candidates for SNP markers for lung cancer susceptibility in Chinese Han population. PMID:24786234

  15. Eda haplotypes in three-spined stickleback are associated with variation in immune gene expression

    PubMed Central

    Robertson, Shaun; Bradley, Janette E.; MacColl, Andrew D. C.

    2017-01-01

    Haplotypes underlying local adaptation and speciation are predicted to have numerous phenotypic effects, but few genes involved have been identified, with much work to date concentrating on visible, morphological, phenotypes. The link between genes controlling these adaptive morphological phenotypes and the immune system has seldom been investigated, even though changes in the immune system could have profound adaptive consequences. The Eda gene in three-spined stickleback is one of the best studied major adaptation genes; it directly controls bony plate architecture and has been associated with additional aspects of adaptation to freshwater. Here, we exposed F2 hybrids, used to separate Eda genotype from genetic background, to contrasting conditions in semi-natural enclosures. We demonstrate an association between the Eda haplotype block and the expression pattern of key immune system genes. Furthermore, low plated fish grew less and experienced higher burdens of a common ectoparasite with fitness consequences. Little is currently known about the role of the immune system in facilitating adaptation to novel environments, but this study provides an indication of its potential importance. PMID:28195171

  16. HLA alleles and HLA-B27 haplotypes associated with susceptibility and severity of ankylosing spondylitis in a Portuguese population.

    PubMed

    Pimentel-Santos, F M; Matos, M; Ligeiro, D; Mourão, A F; Ribeiro, C; Costa, J; Santos, H; Barcelos, A; Pinto, P; Cruz, M; Sousa, E; Santos, R A; Fonseca, J E; Trindade, H; Guedes-Pinto, H; Branco, J C

    2013-12-01

    Human leukocyte antigen (HLA)-B27 is the mostly known major histocompatibility complex (MHC) gene associated with ankylosing spondylitis (AS). Nonetheless, there is substantial evidence that other MHC genes appear to be associated with the disease, although it has not yet been established whether these associations are driven by direct associations or by linkage disequilibrium (LD) mechanisms. We aimed to investigate the contributions of HLA class I and II alleles and B27-haplotypes for AS in a case-control study. A total of 188 HLA-B27 AS cases and 189 HLA-B27 healthy controls were selected and typed for HLA class I and II by the Luminex polymerase chain reaction-sequence specific oligonucleotide probe (PCR-SSOP) method. Allelic and haplotypic distributions were estimated by maximum likelihood method using Arlequin v3.11 and statistical analysis were performed by Stata10.1. No associations were found between non-HLA-B27 loci and AS susceptibility, but several associations were observed for phenotypic features of the disease. DRB1*08 was identified as a risk factor for uveitis and DQB1*04 seems to provide protection for AS severity (functional, metrological and radiological indexes). A*02/B27/C*02/DRB1*01/DQB1*05 [P<0.0001; odds ratio (OR) = 39.06; 95% confidence interval (CI) (2.34-651)] is the only haplotype that seems to confer susceptibility to AS. Moreover, the haplotype A*02/B27/C*01/DRB1*08/DQB1*04 seems to provide protection for disease functional and radiological repercussions. Our findings are compatible with the hypothesis that other genes within the HLA region besides HLA-B27 might play some role in AS susceptibility and severity. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Haplotype combination of the bovine INSIG1 gene sequence variants and association with growth traits in Nanyang cattle.

    PubMed

    Sun, Jiajie; Gao, Yuan; Liu, Dong; Ma, Wei; Xue, Jing; Zhang, Chunlei; Lan, Xianyong; Lei, Chuzhao; Chen, Hong

    2012-06-01

    The insulin-induced gene 1 (INSIG1) gene encodes a protein that blocks proteolytic activation of sterol regulatory element binding proteins, which are transcription factors that activate genes that regulate cholesterol, fatty acid, and glucose metabolism. However, similar research for the bovine INSIG1 gene is lacking. Therefore, in this study, polymorphisms of the bovine INSIG1 gene were detected in 643 individuals from four cattle breeds by DNA pooling, forced PCR-RFLP, PCR-SSCP, and DNA sequencing methods. Only 10 novel SNPs were identified, which included four mutations in the coding region and the others in the introns. In Nanyang individuals, seven common haplotypes were identified based on four coding region SNPs. The haplotype GACT, with a frequency of 75.4%, was the most prevalent haplotypes and SNPs formed two linkage disequilibrium blocks with strong multi-allelic D' (D' = 1). Additionally, association analysis between mutations of the bovine INSIG1 gene and growth traits in Nanyang cattle at 6, 12, 18, and 24 months old was performed, and the results indicated that the polymorphisms were not significantly associated with body mass.

  18. Absolute quantification of Aggregatibacter actinomycetemcomitans in patients carrying haplotypes associated with susceptibility to chronic periodontitis: multifaceted evaluation with periodontitis covariants.

    PubMed

    Cirelli, Thamiris; Finoti, Livia S; Corbi, Sâmia C T; Anovazzi, Giovana; Nepomuceno, Rafael; Orrico, Silvana R P; Cirelli, Joni A; Mayer, Márcia P A; Scarel-Caminaga, Raquel M

    2017-09-29

    This study aimed to evaluate the association between haplotypes in the interleukin 8 (IL8) and IL4 genes previously associated to chronic periodontitis (CP) and the levels of Aggregatibacter actinomycetemcomitans (A.a.) in subgingival sites of patients with and without CP. Moreover, multifaceted evaluations were made to search associations among patients' genetic background with the A.a. levels and previous clinical/immunological/microbiological findings. Subgingival sites (n = 596) of 104 patients were divided into susceptible to CP by the IL8 haplotype ATC/TTC (IL8+); non-susceptible to CP by the IL8 AGT/TTC (IL8-); susceptible to CP by the IL4 TCI/CCI (IL4+); protection against CP by the IL4 TTD/CTI (IL4-). Subgingival biofilm samples from diseased and healthy sites of CP patients and from control sites of health patients were obtained for absolute quantification of A.a. by quantitative real-time polymerase chain reaction. For diseased sites, samples were collected before and 45 days after periodontal treatment. The IL4 but not the IL8 haplotypes were associated with levels of A.a. (in both periods). After periodontal treatment, higher levels of A.a. were found in subgingival sites of (IL4-) patients, and higher levels of IL-4 were associated with deeper probing pockets in these same patients. Significant correlations were found among genetic (patients carrying IL8 or IL4 haplotypes), microbiological and immunological data showing the interrelationship of different factors in the CP. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. A TNF region haplotype offers protection from typhoid fever in Vietnamese patients

    PubMed Central

    2009-01-01

    The genomic region surrounding the TNF locus on human chromosome 6 has previously been associated with typhoid fever in Vietnam. We used a haplotypic approach to understand this association further. Eighty single nucleotide polymorphisms (SNPs) spanning a 150 kb region were genotyped in 95 Vietnamese individuals (typhoid case/mother/father trios). A subset of data from 33 SNPs with a minor allele frequency of >4.3% was used to construct haplotypes. Fifteen SNPs, which tagged the 42 constructed haplotypes were selected. The haplotype tagging SNPs (T1-T15) were genotyped in 380 confirmed typhoid cases and 380 Vietnamese ethnically matched controls. Allelic frequencies of seven SNPs (T1, T2, T3, T5, T6, T7, T8) were significantly different between typhoid cases and controls. Logistic regression results support the hypothesis that there is just one signal associated with disease at this locus. Haplotype-based analysis of the tag SNPs provided positive evidence of association with typhoid (posterior probability 0.821). The analysis highlighted a low-risk cluster of haplotypes that each carry the minor allele of T1 or T7, but not both, and otherwise carry the combination of alleles *12122*1111 at T1-T11, further supporting the one associated signal hypothesis. Finally, individuals that carry the typhoid fever protective haplotype *12122*1111 also produce a relatively low TNF-α response to LPS. PMID:17503085

  20. Deletion analysis of male sterility effects of t-haplotypes in the mouse.

    PubMed

    Bennett, D; Artzt, K

    1990-01-01

    We present data on the effects of three chromosome 17 deletions on transmission ratio distortion (TRD) and sterility of several t-haplotypes. All three deletions have similar effects on male TRD: that is, Tdel/tcomplete genotypes all transmit their t-haplotype in very high proportion. However, each deletion has different effects on sterility of heterozygous males, with TOr/t being fertile, Thp/t less fertile, and TOrl/t still less fertile. These data suggest that wild-type genes on chromosomes homologous to t-haplotypes can be important regulators of both TRD and fertility in males, and that the wild-type genes concerned with TRD and fertility are at least to some extent different. The data also provide a rough map of the positions of these genes.

  1. Significant association between ERCC2 and MTHR polymorphisms and breast cancer susceptibility in Moroccan population: genotype and haplotype analysis in a case-control study.

    PubMed

    Hardi, Hanaa; Melki, Rahma; Boughaleb, Zouhour; El Harroudi, Tijani; Aissaoui, Souria; Boukhatem, Noureddine

    2018-03-15

    Genetic determinants of breast cancer (BC) remained largely unknown in the majority of Moroccan patients. The purpose of this study was to explore the association of ERCC2 and MTHFR polymorphisms with genetic susceptibility to breast cancer in Moroccan population. We genotyped ERCC2 polymorphisms (rs1799793 (G934A) and rs13181 (A2251C)) and MTHFR polymorphisms (rs1801133 (C677T) and rs1801131 (A1298C)) using TaqMan SNP Genotyping Assays. Genotypes were compared in 151 BC cases and 156 population-matched controls. Allelic, genotypic and haplotype associations with the risk and clinicopathological features of BC were assessed using logistic regression analyses. ERCC2-rs1799793-AA genotype was associated with high risk of BC compared to wild type genotype (recessive model: OR: 2.90, 95% CI: 1.34-6.26, p = 0.0069) even after Bonferroni correction (p < 0,0125). MTHFR rs1801133-TT genotype was associated with increased risk of BC (recessive model, OR: 2.49, 95% CI: 1.17-5.29, p = 0.017) but the association turned insignificant after Bonferroni correction. For the rest of SNPs, no statistical associations to BC risk were detected. Significant association with clinical features was detected for MTHFR-rs1801133-TC genotype with early age at diagnosis and familial BC. Following Bonferroni correction, only association with familial BC remained significant. MTHFR-rs1801131-CC genotype was associated with sporadic BC. ERCC2-rs1799793-AA genotype correlated with ER+ and PR+ breast cancer. ERCC2-rs13181-CA genotype was significantly associated large tumors (T ≥ 3) in BC patients. None of these associations passed Bonferroni correction. Haplotype analysis showed that ERCC2 A-C haplotype was significantly associated with increased BC risk (OR: 3.71, 95% CI: 1.7-8.12, p = 0.0002 and p = 0.0008 before and after Bonferroni correction, respectively) and positive expression of ER and PR in BC patients. ERCC2 G-C haplotype was correlated with PR negative and

  2. Longitudinal analysis of haplotypes and polymorphisms of the APOA5 and APOC3 genes associated with variation in serum triglyceride levels: the Bogalusa Heart Study.

    PubMed

    Hallman, D Michael; Srinivasan, Sathanur R; Chen, Wei; Boerwinkle, Eric; Berenson, Gerald S

    2006-12-01

    Polymorphisms in the APOC3 and APOA5 genes, from the APOA1/APOC3/APOA4/APOA5 gene cluster on chromosome 11q23, have been associated with interindividual variation in plasma triglycerides. APOA5 polymorphisms implicated include 2 in the promoter region (-1131 T/C and -3 A/G) and 1 in exon 2 (+56 C/G). APOC3 polymorphisms implicated include 1 (SstI) in the 3' untranslated region and 1 (-2854 G/T) in the APOC3-APOA4 intergenic region. We analyzed the associations of haplotypes and multilocus genotypes of these polymorphisms on longitudinal serum triglyceride profiles in 360 African American and 823 white subjects from the Bogalusa Heart Study. Subjects were examined from 2 to 8 times (mean +/- SD, 5.4 +/- 1.3) between 1973 and 1996, at ages ranging from 4 to 38 years, with 1978 observations in African Americans and 4465 in whites. Serum triglycerides were significantly higher among whites across all ages. Allele frequencies differed significantly between African Americans and whites at all but the APOA5 +56 C/G locus. Linkage disequilibrium among the loci was higher in whites and haplotype diversity lower: 6 haplotypes had estimated frequencies of more than 1% in African Americans, 5 in whites. Individually, all polymorphisms except APOC3 -2854 G/T showed significant associations with triglyceride levels in the full sample. However, genotype models including all 5 loci showed significant triglyceride associations for only 3 (APOC3 SstI, APOA5 -1131 T/C, and APOA5 +56 C/G); significant interactions among them indicated their effects were not independent. Neither APOC3 -2854 G/T nor APOA5 -3 A/G had significant effects when the other 3 loci were in the models. The EM algorithm was used to estimate haplotype frequencies and assign haplotype probabilities to individuals, which is conditional on their genotypes; individuals' haplotype probability vectors were then used as predictors in multilevel mixed models of longitudinal triglyceride profiles. Of haplotypes comprising

  3. COMT haplotypes, catecholamine metabolites in plasma and clinical response in schizophrenic and bipolar patients.

    PubMed

    Zumárraga, Mercedes; Arrúe, Aurora; Basterreche, Nieves; Macías, Isabel; Catalán, Ana; Madrazo, Arantza; Bustamante, Sonia; Zamalloa, María I; Erkoreka, Leire; Gordo, Estibaliz; Arnaiz, Ainara; Olivas, Olga; Arroita, Ariane; Marín, Elena; González-Torres, Miguel A

    2016-06-01

    We examined the association of COMT haplotypes and plasma metabolites of catecholamines in relation to the clinical response to antipsychotics in schizophrenic and bipolar patients. We studied 165 patients before and after four weeks of treatment, and 163 healthy controls. We assessed four COMT haplotypes and the plasma concentrations of HVA, DOPAC and MHPG. Bipolar patients: haplotypes are associated with age at onset and clinical evolution. In schizophrenic patients, an haplotype previously associated with increased risk, is related to better response of negative symptoms. Haplotypes would be good indicators of the clinical status and the treatment response in bipolar and schizophrenic patients. Larger studies are required to elucidate the clinical usefulness of these findings.

  4. Molecular definition of red cell Rh haplotypes by tightly linked SphI RFLPs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, C.H.; Reid, M.E.; Chen, Y.

    The Rh blood group system of human red cells contains five major antigens D, C/c, and E/e (the latter four designated {open_quotes}non-D{close_quotes}) that are specified by eight gene complexes known as Rh haplotypes. In this paper, we report on the mapping of the RH locus and identification of a set of SphI RFLPs that are tightly linked with the Rh structural genes. Using exon-specific probes, we have localized the SphI cleavage sites resulting in these DNA markers and derived a comprehensive map for the RH locus. It was found that the SphI fragments encompassing exons 4-7 of the Rh genesmore » occur in four banding patterns or frameworks that correspond to the distribution and segregation of the common Rh haplotypes. This linkage disequilibrium allowed a genotype-phenotype correlation and direct determination of Rh zygosity related to the Rh-positive or Rh-negative status (D/D, D/d, and d/d). Studies on the occurrence of SphI RFLPs in a number of rare Rh variants indicated that Rh phenotypic diversity has taken place on different haplotype backgrounds and has arisen by diverse genetic mechanisms. The molecular definition of Rh haplotypes by SphI RFLP frameworks should provide a useful procedure for genetic counseling and prenatal assessment of Rh alloimmunization. 32 refs., 7 figs., 3 tabs.« less

  5. Analysis of extended human leukocyte antigen haplotype association with Addison's disease in three populations.

    PubMed

    Gombos, Z; Hermann, R; Kiviniemi, M; Nejentsev, S; Reimand, K; Fadeyev, V; Peterson, P; Uibo, R; Ilonen, J

    2007-12-01

    Addison's disease is an organ-specific autoimmune disorder with a polygenic background. The aim of the study was to identify non-class II human leukocyte antigen (HLA) susceptibility genes for Addison's disease. Addison's disease patients from three European populations were analysed for selected HLA-DR-DQ alleles and for 11 microsatellite markers covering approximately 4 Mb over the HLA region. Subjects were 69 patients with Addison's disease from Estonia (24), Finland (14) and Russia (31). Consecutively recruited healthy newborns from the same geographical regions were used as controls (269 Estonian, 1000 Finnish and 413 Russian). Association measures for HLA-DRB1, DQB1, DQA1 and 11 microsatellites between D6S273 and D6S2223 were taken. A low-resolution full-house typing was used for HLA class II genes, while microsatellite markers were studied using fluorescence-based DNA fragment sizing technology. We confirmed that the HLA-DR3-DQ2 and the DQB1*0302-DRB1*0404 haplotypes confer disease susceptibility. In Russian patients, we also found an increase of DRB1*0403 allele, combined with DQB1*0305 allele in three out of six cases (P<0.0001). Analysis of 11 microsatellite markers including STR MICA confirmed the strong linkage in DR3-DQ2 haplotypes but DRB1*0404-DQB1*0302 haplotypes were diverse. MICA5.1 allele was found in 22 out of 24 Estonian patients, but results from Finnish and Russian patients did not support its independent role in disease susceptibility. HLA-DRB1*0403 was identified as a novel susceptibility allele for Addison's disease. Additionally, we found no evidence of a non-class II HLA disease susceptibility locus; however, the HLA-DR3-DQ2 haplotype appeared more conserved in patient groups with high DR-DQ2 frequencies.

  6. Genetic Architecture of Aluminum Tolerance in Rice (Oryza sativa) Determined through Genome-Wide Association Analysis and QTL Mapping

    PubMed Central

    Famoso, Adam N.; Zhao, Keyan; Clark, Randy T.; Tung, Chih-Wei; Wright, Mark H.; Bustamante, Carlos; Kochian, Leon V.; McCouch, Susan R.

    2011-01-01

    Aluminum (Al) toxicity is a primary limitation to crop productivity on acid soils, and rice has been demonstrated to be significantly more Al tolerant than other cereal crops. However, the mechanisms of rice Al tolerance are largely unknown, and no genes underlying natural variation have been reported. We screened 383 diverse rice accessions, conducted a genome-wide association (GWA) study, and conducted QTL mapping in two bi-parental populations using three estimates of Al tolerance based on root growth. Subpopulation structure explained 57% of the phenotypic variation, and the mean Al tolerance in Japonica was twice that of Indica. Forty-eight regions associated with Al tolerance were identified by GWA analysis, most of which were subpopulation-specific. Four of these regions co-localized with a priori candidate genes, and two highly significant regions co-localized with previously identified QTLs. Three regions corresponding to induced Al-sensitive rice mutants (ART1, STAR2, Nrat1) were identified through bi-parental QTL mapping or GWA to be involved in natural variation for Al tolerance. Haplotype analysis around the Nrat1 gene identified susceptible and tolerant haplotypes explaining 40% of the Al tolerance variation within the aus subpopulation, and sequence analysis of Nrat1 identified a trio of non-synonymous mutations predictive of Al sensitivity in our diversity panel. GWA analysis discovered more phenotype–genotype associations and provided higher resolution, but QTL mapping identified critical rare and/or subpopulation-specific alleles not detected by GWA analysis. Mapping using Indica/Japonica populations identified QTLs associated with transgressive variation where alleles from a susceptible aus or indica parent enhanced Al tolerance in a tolerant Japonica background. This work supports the hypothesis that selectively introgressing alleles across subpopulations is an efficient approach for trait enhancement in plant breeding programs and

  7. Frequency and origin of haplotypes associated with the beta-globin gene cluster in individuals with trait and sickle cell anemia in the Atlantic and Pacific coastal regions of Colombia

    PubMed Central

    Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo

    2013-01-01

    Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events. PMID:24385850

  8. Genetic analysis of autoimmune regulator haplotypes in alopecia areata.

    PubMed

    Wengraf, D A; McDonagh, A J G; Lovewell, T R J; Vasilopoulos, Y; Macdonald-Hull, S P; Cork, M J; Messenger, A G; Tazi-Ahnini, R

    2008-03-01

    Alopecia areata is an immune-mediated disorder, occurring with the highest observed frequency in the rare recessive autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) syndrome caused by mutations of the autoimmune regulator (AIRE) gene on chromosome 21q22.3. We have previously detected association between alopecia areata and a single nucleotide polymorphism (SNP) in the AIRE gene in patients without APECED, and we now report the findings of an extended examination of the association of alopecia areata with haplotype analysis including six SNPs in the AIRE gene: C-103T, C4144G, T5238C, G6528A, T7215C and T11787C. In Caucasian groups of 295 patients and 363 controls, we found strong association between the AIRE 7215C allele and AA [P = 3.8 x 10(-8), OR (95% CI): 2.69 (1.8-4.0)]. The previously reported association between AA and the AIRE 4144G allele was no longer significant on correction for multiple testing. The AIRE haplotypes CCTGCT and CGTGCC showed a highly significant association with AA [P = 6.05 x 10(-6), 9.47 (2.91-30.8) and P = 0.001, 3.51 (1.55-7.95), respectively]. To select the haplotypes most informative for analysis, we tagged the polymorphisms using SNPTag software. Employing AIRE C-103T, G6528A, T7215C and T11787C as tag SNPs, two haplotypes were associated with AA; AIRE CGCT and AIRE CGCC [P = 3.84 x 10(-7), 11.40 (3.53-36.9) and P = 3.94 x 10(-4), 2.13 (1.39-3.24) respectively]. The AIRE risk haplotypes identified in this study potentially account for a major component of the genetic risk of developing alopecia areata.

  9. Association between Psoriasis and haplotypes of the IgH 3' Regulatory Region 1.

    PubMed

    D'Addabbo, Pietro; Serone, Eliseo; Esposito, Maria; Vaccari, Gabriele; Gargioli, Cesare; Frezza, Domenico; Bianchi, Luca

    2018-08-30

    The association studies of several immune-diseases with the 3' Regulatory Region 1 (3'RR1) increased interest on the role that the region plays in the immune-regulation. The 3'RR1 is a polymorphic region on human chromosome 14q32, acting as a cis-regulative element on the Immunoglobulin constant-gene locus recently considered as super-enhancer. The human 3'RR1 share large sequences with its paralogous 3'RR2, at high level of similarity. Thus, a focused investigation was necessary to discriminate each one of the duplicated components of the two regions and its specific contribution to the immunologic phenotype. One of the duplicated elements is the hs1.2 enhancer. The 3'RR1 alleles of this enhancer were demonstrated to play a role in autoimmune diseases, including Psoriasis. We sequenced a specific region internal to the 3'RR1 in hs1.2 homozygous subjects, to detect SNPs associated to the main alleles of the enhancer. We identified two alternative nine-SNPs haplotypes strictly linked to the allele *1 and *2 of hs1.2, that could be used as markers to further investigate the region and associations to pathology. Finally, we identified two haplotypes, namely E2A1 and E2A2, that strongly support the hypothesis of a relevant effect of the rs35216181 in the onset of Psoriasis when the *2 allele is present. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Identification and genetic effect of haplotype in the bovine BMP7 gene.

    PubMed

    Huang, Yong-Zhen; Wang, Xin-Lei; He, Hua; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong

    2013-12-15

    Bone morphogenetic proteins (BMPs) are peptide growth factors belonging to the transforming growth factor-beta (TGF-β) superfamily, and some members of the BMP family support white adipocyte differentiation. In this study, we focused on the BMP7 which singularly promotes the differentiation of brown preadipocytes. Haplotypes involving 5 single nucleotide polymorphism (SNP) sites in the bovine BMP7 gene were identified and their effect on body weight was analyzed. 16 haplotypes and 18 combined haplotypes were revealed and the linkage disequilibrium was assessed in the cattle population with 602 individuals representing three main cattle breeds from China. The results showed that haplotypes 3, 10 and 14 were predominant and accounted for 75.64%, 69.85%, and 83.36% in Nanyang, Qinchuan and Jiaxian cattle breeds, respectively. The statistical analyses indicated that the SNP 1, 4, and 5 are associated with the body weight, body length, and heart girth at 12 and 24 months in Nanyang cattle population (P<0.05), whereas there is no significant association between their 16 haplotypes and 18 combined haplotypes. Our results provide evidence that some SNPs and haplotypes in BMP7 are associated with growth traits, and may be utilized as a genetic marker in marker-assisted selection for beef cattle breeding programs. Copyright © 2013. Published by Elsevier B.V.

  11. H2 haplotype at chromosome 17q21.31 protects against childhood sexual abuse-associated risk for alcohol consumption and dependence

    PubMed Central

    Nelson, Elliot C.; Agrawal, Arpana; Pergadia, Michele L.; Wang, Jen C.; Whitfield, John B.; Saccone, F. Scott; Kern, Jason; Grant, Julia D.; Schrage, Andrew J.; Rice, John P.; Montgomery, Grant W.; Heath, Andrew C.; Goate, Alison M.; Martin, Nicholas G.; Madden, Pamela A.F.

    2011-01-01

    Animal research supports a central role for corticotropin releasing factor (CRF) in actions of ethanol on brain function. An examination of alcohol consumption in adolescents reported a significant genotype × environment (G × E) interaction involving rs1876831, a CRHR1 polymorphism, and negative events. CRHR1 and at least 4 other genes are located at 17q21.31 in an extremely large block of high linkage disequilibrium resulting from a local chromosomal inversion; the minor allele of rs1876831 is contained within the H2 haplotype. Here we examine whether G × E interactions involving this haplotype and childhood sexual abuse (CSA) are associated with risk for alcohol consumption and dependence in Australian participants (N=1128 respondents from 476 families) of the Nicotine Addiction Genetics project. Telephone interviews provided data on DSM-IV alcohol dependence diagnosis and CSA and enabled calculation of lifetime alcohol consumption factor score (ACFS) from 4 indices of alcohol consumption. Individuals reporting a history of CSA had significantly higher ACFS and increased risk for alcohol dependence. A significant G × E interaction was found for ACFS involving the H2 haplotype and CSA (p<0.017). A similar G × E interaction was associated with protective effects against alcohol dependence risk (odds ratio 0.42; 95%CI 0.20 – 0.89). For each outcome, no significant CSA-associated risk was observed in H2 haplotype carriers. These findings support conducting further investigation of the H2 haplotype to determine the gene(s) responsible. Our results also suggest that severe early trauma may prove to be an important clinical covariate in the treatment of alcohol dependence. PMID:19878140

  12. Genotype-Based Association Mapping of Complex Diseases: Gene-Environment Interactions with Multiple Genetic Markers and Measurement Error in Environmental Exposures

    PubMed Central

    Lobach, Irvna; Fan, Ruzone; Carroll, Raymond T.

    2011-01-01

    With the advent of dense single nucleotide polymorphism genotyping, population-based association studies have become the major tools for identifying human disease genes and for fine gene mapping of complex traits. We develop a genotype-based approach for association analysis of case-control studies of gene-environment interactions in the case when environmental factors are measured with error and genotype data are available on multiple genetic markers. To directly use the observed genotype data, we propose two genotype-based models: genotype effect and additive effect models. Our approach offers several advantages. First, the proposed risk functions can directly incorporate the observed genotype data while modeling the linkage disequihbrium information in the regression coefficients, thus eliminating the need to infer haplotype phase. Compared with the haplotype-based approach, an estimating procedure based on the proposed methods can be much simpler and significantly faster. In addition, there is no potential risk due to haplotype phase estimation. Further, by fitting the proposed models, it is possible to analyze the risk alleles/variants of complex diseases, including their dominant or additive effects. To model measurement error, we adopt the pseudo-likelihood method by Lobach et al. [2008]. Performance of the proposed method is examined using simulation experiments. An application of our method is illustrated using a population-based case-control study of association between calcium intake with the risk of colorectal adenoma development. PMID:21031455

  13. Serpin peptidase inhibitor (SERPINB5) haplotypes are associated with susceptibility to hepatocellular carcinoma

    NASA Astrophysics Data System (ADS)

    Yang, Shun-Fa; Yeh, Chao-Bin; Chou, Ying-Erh; Lee, Hsiang-Lin; Liu, Yu-Fan

    2016-05-01

    Hepatocellular carcinoma (HCC) represents the second leading cause of cancer-related death worldwide. The serpin peptidase inhibitor SERPINB5 is a tumour-suppressor gene that promotes the development of various cancers in humans. However, whether SERPINB5 gene variants play a role in HCC susceptibility remains unknown. In this study, we genotyped 6 SNPs of the SERPINB5 gene in an independent cohort from a replicate population comprising 302 cases and 590 controls. Additionally, patients who had at least one rs2289520 C allele in SERPINB5 tended to exhibit better liver function than patients with genotype GG (Child-Pugh grade A vs. B or C; P = 0.047). Next, haplotype blocks were reconstructed according to the linkage disequilibrium structure of the SERPINB5 gene. A haplotype “C-C-C” (rs17071138 + rs3744941 + rs8089204) in SERPINB5-correlated promoter showed a significant association with an increased HCC risk (AOR = 1.450 P = 0.031). Haplotypes “T-C-A” and “C-C-C” (rs2289519 + rs2289520 + rs1455555) located in the SERPINB5 coding region had a decreased (AOR = 0.744 P = 0.031) and increased (AOR = 1.981 P = 0.001) HCC risk, respectively. Finally, an additional integrated in silico analysis confirmed that these SNPs affected SERPINB5 expression and protein stability, which significantly correlated with tumour expression and subsequently with tumour development and aggressiveness. Taken together, our findings regarding these biomarkers provide a prediction model for risk assessment.

  14. Association of HLA-DRB1 Haplotypes With Rheumatoid Arthritis Severity, Mortality, and Treatment Response

    PubMed Central

    Viatte, Sebastien; Plant, Darren; Han, Buhm; Fu, Bo; Yarwood, Annie; Thomson, Wendy; Symmons, Deborah P. M.; Worthington, Jane; Young, Adam; Hyrich, Kimme L.; Morgan, Ann W.; Wilson, Anthony G.; Isaacs, John D.; Raychaudhuri, Soumya; Barton, Anne

    2016-01-01

    IMPORTANCE Advances have been made in identifying genetic susceptibility loci for autoimmune diseases, but evidence is needed regarding their association with prognosis and treatment response. OBJECTIVE To assess whether specific HLA-DRB1 haplotypes associated with rheumatoid arthritis (RA) susceptibility are also associated with radiological severity, mortality, and response to tumor necrosis factor (TNF) inhibitor drugs. DESIGN, SETTING, AND PARTICIPANTS The Norfolk Arthritis Register (NOAR; 1691 patients and 2811 radiographs; recruitment: 1989–2008; 2008 as final follow-up) was used as a discovery cohort and the Early Rheumatoid Arthritis Study (421 patients and 3758 radiographs; recruitment: 1986–1999; 2005 as final follow-up) as an independent replication cohort for studies of radiographic outcome. Mortality studies were performed in the NOAR cohort (2432 patients; recruitment: 1990–2007; 2011 as final follow-up) and studies of treatment response in the Biologics in Rheumatoid Arthritis Genetics and Genomics Study Syndicate cohort (1846 patients enrolled at initiation of TNF inhibitor; recruitment: 2006–2010; 2011 as final follow-up). Longitudinal statistical modeling was performed to integrate multiple radiograph records per patient over time. All patients were from the United Kingdom and had self-reported white ancestry. EXPOSURES Sixteen HLA-DRB1 haplotypes defined by amino acids at positions 11, 71, and 74. MAIN OUTCOMES AND MEASURES Radiological outcome using the Larsen score (range: 0 [none] to 200 [severe joint damage]) and erosions of the hands and feet on radiographs, all-cause mortality, and treatment response measured by change in Disease Activity Score based on 28 joint counts and European League Against Rheumatism (EULAR) response. RESULTS Patients with RA and valine at position 11 of HLA-DRB1 had the strongest association with radiological damage (OR, 1.75 [95% CI, 1.51–2.05], P = 4.6E-13). By year 5, the percentages of patients with

  15. Haplotype-Based Genotyping in Polyploids.

    PubMed

    Clevenger, Josh P; Korani, Walid; Ozias-Akins, Peggy; Jackson, Scott

    2018-01-01

    Accurate identification of polymorphisms from sequence data is crucial to unlocking the potential of high throughput sequencing for genomics. Single nucleotide polymorphisms (SNPs) are difficult to accurately identify in polyploid crops due to the duplicative nature of polyploid genomes leading to low confidence in the true alignment of short reads. Implementing a haplotype-based method in contrasting subgenome-specific sequences leads to higher accuracy of SNP identification in polyploids. To test this method, a large-scale 48K SNP array (Axiom Arachis2) was developed for Arachis hypogaea (peanut), an allotetraploid, in which 1,674 haplotype-based SNPs were included. Results of the array show that 74% of the haplotype-based SNP markers could be validated, which is considerably higher than previous methods used for peanut. The haplotype method has been implemented in a standalone program, HAPLOSWEEP, which takes as input bam files and a vcf file and identifies haplotype-based markers. Haplotype discovery can be made within single reads or span paired reads, and can leverage long read technology by targeting any length of haplotype. Haplotype-based genotyping is applicable in all allopolyploid genomes and provides confidence in marker identification and in silico-based genotyping for polyploid genomics.

  16. Association of an MHC Class II Haplotype with Increased Risk of Polymyositis in Hungarian Vizsla Dogs

    PubMed Central

    Massey, Jonathan; Rothwell, Simon; Rusbridge, Clare; Tauro, Anna; Addicott, Diane; Chinoy, Hector; Cooper, Robert G.; Ollier, William E. R.; Kennedy, Lorna J.

    2013-01-01

    A breed-specific polymyositis is frequently observed in the Hungarian Vizsla. Beneficial clinical response to immunosuppressive therapies has been demonstrated which points to an immune-mediated aetiology. Canine inflammatory myopathies share clinical and histological similarities with the human immune-mediated myopathies. As MHC class II associations have been reported in the human conditions we investigated whether an MHC class II association was present in the canine myopathy seen in this breed. 212 Hungarian Vizsla pedigree dogs were stratified both on disease status and degree of relatedness to an affected dog. This generated a group of 29 cases and 183 “graded” controls: 93 unaffected dogs with a first degree affected relative, 44 unaffected dogs with a second degree affected relative, and 46 unaffected dogs with no known affected relatives. Eleven DLA class II haplotypes were identified, of which, DLA-DRB1*02001/DQA1*00401/DQB1*01303, was at significantly raised frequency in cases compared to controls (OR = 1.92, p = 0.032). When only control dogs with no family history of the disease were compared to cases, the association was further strengthened (OR = 4.08, p = 0.00011). Additionally, a single copy of the risk haplotype was sufficient to increase disease risk, with the risk substantially increasing for homozygotes. There was a trend of increasing frequency of this haplotype with degree of relatedness, indicating low disease penetrance. These findings support the hypothesis of an immune-mediated aetiology for this canine myopathy and give credibility to potentially using the Hungarian Vizsla as a genetic model for comparative studies with human myositis. PMID:23457575

  17. Association of HLA alleles and haplotypes with CYP21A2 gene p. V282L mutation in the Croatian population.

    PubMed

    Grubic, Z; Maskalan, M; Stingl Jankovic, K; Zvecic, S; Dumic Kubat, K; Krnic, N; Zunec, R; Ille, J; Kusec, V; Dumic, M

    2016-11-01

    The CYP21A2 mutations that are in linkage disequilibrium with particular HLA-A, -B, -DRB1 alleles/haplotypes, cause deficiency of the 21-hydroxylase enzyme (21-OHD) and account for the majority of congenital adrenal hyperplasia (CAH) cases. The aim of this study was to investigate those associations with the p.V282L mutation linked to the non-classical (NC) form of CAH among Croatians. The study included parents of patients with the NC form of CAH, positive for the p.V282L mutation (N = 55) and cadaveric donor samples (N = 231). All subjects were HLA-A, -B, and -DRB1 typed and tested for the presence of the p.V282L mutation. Among parents of patients, 92.73% of subjects were positive for the B*14:02 allele and almost half of them carried the HLA-A*33:01-B*14:02-DRB1*01:02 haplotype. Among cadaveric samples 77 out of 96 subjects positive for the B*14:02 allele had the p.V282L mutation. Among them, 37 were positive for the HLA-A*33:01-B*14:02-DRB1*01:02 haplotype, 23 had the HLA-A*33:01-B*14:02-DRB1*03:01 haplotype, 8 had the B*14:02-DRB1*01:02 combination and 5 were carrying the HLA-A*68:02-B*14:02-DRB1*13:03 haplotype. Only 4 of these subjects were positive for the B*14:02 allele. HLA-B*14:02 was the only single allele with association that reached statistically significant P value (RR = 12.00; P = 0.0024). Haplotypes B*14:02-DRB1*01:02 (P < 0.001) and HLA-A*68:02-B*14:02-DRB1*13:03 (P < 0.001) as well as HLA-A*33:01-B*14:02-DRB1*01:02 and HLA-A*33:01-B*14:02-DRB1*03:01 showed high relative risks (RR = 45.00, RR = 41.63 and RR = 36.96, respectively). Our data support the previously documented association of the HLA-A*33:01-B*14:02-DRB1*01:02 haplotype with the p.V282L mutation, but also point out a high frequency of the p.V282L mutation among Croatians with HLA-A*33:01-B*14:02-DRB1*03:01 and HLA-A*68:02-B*14:02-DRB1*13:03 haplotypes. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Genomic dissection of a ‘Fuji’ apple cultivar: re-sequencing, SNP marker development, definition of haplotypes, and QTL detection

    PubMed Central

    Kunihisa, Miyuki; Moriya, Shigeki; Abe, Kazuyuki; Okada, Kazuma; Haji, Takashi; Hayashi, Takeshi; Kawahara, Yoshihiro; Itoh, Ryutaro; Itoh, Takeshi; Katayose, Yuichi; Kanamori, Hiroyuki; Matsumoto, Toshimi; Mori, Satomi; Sasaki, Harumi; Matsumoto, Takashi; Nishitani, Chikako; Terakami, Shingo; Yamamoto, Toshiya

    2016-01-01

    ‘Fuji’ is one of the most popular and highly-produced apple cultivars worldwide, and has been frequently used in breeding programs. The development of genotypic markers for the preferable phenotypes of ‘Fuji’ is required. Here, we aimed to define the haplotypes of ‘Fuji’ and find associations between haplotypes and phenotypes of five traits (harvest day, fruit weight, acidity, degree of watercore, and flesh mealiness) by using 115 accessions related to ‘Fuji’. Through the re-sequencing of ‘Fuji’ genome, total of 2,820,759 variants, including single nucleotide polymorphisms (SNPs) and insertions or deletions (indels) were detected between ‘Fuji’ and ‘Golden Delicious’ reference genome. We selected mapping-validated 1,014 SNPs, most of which were heterozygous in ‘Fuji’ and capable of distinguishing alleles inherited from the parents of ‘Fuji’ (i.e., ‘Ralls Janet’ and ‘Delicious’). We used these SNPs to define the haplotypes of ‘Fuji’ and trace their inheritance in relatives, which were shown to have an average of 27% of ‘Fuji’ genome. Analysis of variance (ANOVA) based on ‘Fuji’ haplotypes identified one quantitative trait loci (QTL) each for harvest time, acidity, degree of watercore, and mealiness. A haplotype from ‘Delicious’ chr14 was considered to dominantly cause watercore, and one from ‘Ralls Janet’ chr1 was related to low-mealiness. PMID:27795675

  19. Practical interpretation of CYP2D6 haplotypes: Comparison and integration of automated and expert calling.

    PubMed

    Ruaño, Gualberto; Kocherla, Mohan; Graydon, James S; Holford, Theodore R; Makowski, Gregory S; Goethe, John W

    2016-05-01

    We describe a population genetic approach to compare samples interpreted with expert calling (EC) versus automated calling (AC) for CYP2D6 haplotyping. The analysis represents 4812 haplotype calls based on signal data generated by the Luminex xMap analyzers from 2406 patients referred to a high-complexity molecular diagnostics laboratory for CYP450 testing. DNA was extracted from buccal swabs. We compared the results of expert calls (EC) and automated calls (AC) with regard to haplotype number and frequency. The ratio of EC to AC was 1:3. Haplotype frequencies from EC and AC samples were convergent across haplotypes, and their distribution was not statistically different between the groups. Most duplications required EC, as only expansions with homozygous or hemizygous haplotypes could be automatedly called. High-complexity laboratories can offer equivalent interpretation to automated calling for non-expanded CYP2D6 loci, and superior interpretation for duplications. We have validated scientific expert calling specified by scoring rules as standard operating procedure integrated with an automated calling algorithm. The integration of EC with AC is a practical strategy for CYP2D6 clinical haplotyping. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Haplotype analysis of the apolipoprotein gene cluster on human chromosome 11

    PubMed Central

    Olivier, Michael; Wang, Xujing; Cole, Regina; Gau, Brian; Kim, Jessica; Rubin, Edward M.; Pennacchio, Len A.

    2009-01-01

    Members of the apolipoprotein gene cluster (APOA1/C3/A4/A5) on human chromosome 11q23 play an important role in lipid metabolism. Polymorphisms in both APOA5 and APOC3 are strongly associated with plasma triglyceride concentrations. The close genomic locations of these two genes as well as their functional similarity have hindered efforts to define whether each gene independently influences human triglyceride concentrations. In this study, we examined the linkage disequilibrium and haplotype structure of 49 SNPs in a 150-kb region spanning the gene cluster. We identified a total of five common APOA5 haplotypes with a frequency of greater than 8% in samples of northern European origin. The APOA5 haplotype block did not extend past the 7 SNPs in the gene and was separated from the other apolipoprotein gene in the cluster by a region of significantly increased recombination. Furthermore, one previously identified triglyceride risk haplotype of APOA5 (APOA5*3) showed no association with three APOC3 SNPs previously associated with triglyceride concentrations, in contrast to the other risk haplotype (APOA5*2), which was associated with all three minor APOC3 SNP alleles. These results highlight the complex genetic relationship between APOA5 and APOC3 and support the notion that APOA5 represents an independent risk gene affecting plasma triglyceride concentrations in humans. PMID:15081120

  1. Haplotype Analysis Discriminates Genetic Risk for DR3-Associated Endocrine Autoimmunity and Helps Define Extreme Risk for Addison’s Disease

    PubMed Central

    Baker, Peter R.; Baschal, Erin E.; Fain, Pam R.; Triolo, Taylor M.; Nanduri, Priyaanka; Siebert, Janet C.; Armstrong, Taylor K.; Babu, Sunanda R.; Rewers, Marian J.; Gottlieb, Peter A.; Barker, Jennifer M.; Eisenbarth, George S.

    2010-01-01

    Context: Multiple autoimmune disorders (e.g. Addison’s disease, type 1 diabetes, celiac disease) are associated with HLA-DR3, but it is likely that alleles of additional genes in linkage disequilibrium with HLA-DRB1 contribute to disease. Objective: The objective of the study was to characterize major histocompatability complex (MHC) haplotypes conferring extreme risk for autoimmune Addison’s disease (AD). Design, Setting, and Participants: Eighty-six 21-hydroxylase autoantibody-positive, nonautoimmune polyendocrine syndrome type 1, Caucasian individuals collected from 1992 to 2009 with clinical AD from 68 families (12 multiplex and 56 simplex) were genotyped for HLA-DRB1, HLA-DQB1, MICA, HLA-B, and HLA-A as well as high density MHC single-nucleotide polymorphism (SNP) analysis for 34. Main Outcome Measures: AD and genotype were measured. Result: Ninety-seven percent of the multiplex individuals had both HLA-DR3 and HLA-B8 vs. 60% of simplex AD patients (P = 9.72 × 10−4) and 13% of general population controls (P = 3.00 × 10−19). The genotype DR3/DR4 with B8 was present in 85% of AD multiplex patients, 24% of simplex patients, and 1.5% of control individuals (P = 4.92 × 10−191). The DR3-B8 haplotype of AD patients had HLA-A1 less often (47%) than controls (81%, P = 7.00 × 10−5) and type 1 diabetes patients (73%, P = 1.93 × 10−3). Analysis of 1228 SNPs across the MHC for individuals with AD revealed a shorter conserved haplotype (3.8) with the loss of the extended conserved 3.8.1 haplotype approximately halfway between HLA-B and HLA-A. Conclusion: Extreme risk for AD, especially in multiplex families, is associated with haplotypic DR3 variants, in particular a portion (3.8) but not all of the conserved 3.8.1 haplotype. PMID:20631027

  2. Distribution of MICA alleles and haplotypes associated with HLA in the Korean population.

    PubMed

    Pyo, Chul-Woo; Hur, Seong-Suk; Kim, Yang-Kyum; Choi, Hee-Baeg; Kim, Tae-Yoon; Kim, Tai-Gyu

    2003-03-01

    The MICA (MHC class I chain-related gene A) is a polymorphic gene located 46 kb centromeric of the HLA-B gene, and is preferentially expressed in epithelial cells and intestinal mucosa. The MICA gene, similar to human leukocyte antigen (HLA) class I, displays a high degree of genetic polymorphism in exons 2, 3, 4, and 5, amounting to 54 alleles. In this study, we investigated the polymorphisms at exons coding for extracellular domains (exons 2, 3, and 4), and the GCT repeat polymorphism at the transmembrane (exon 5) of MICA in 199 unrelated healthy Koreans. Eight alleles were observed in the Korean population, with allele frequencies for MICA*010, MICA*00201, MICA*027, MICA*004, MICA*012, MICA*00801, MICA*00901, and MICA*00701 being 18.3%, 17.8%, 13.6%, 12.3%, 11.1%, 10.8%, 10.6%, and 3.3%, respectively. Strong linkage disequilibria were also observed between the MICA and HLA-B gene-MICA*00201-B58, MICA*004-B44, MICA*00701-B27, MICA*00801-B60, MICA*00901-B51, MICA*010-B62, MICA*012-B54, and MICA*027-B61. In the analysis of the haplotypes of HLA class I genes (HLA-A, B, and C) and the MICA, the most common haplotype was MICA*004-A33-B44-Cw*07, followed by MICA*00201-A2-B58-Cw*0302 and MICA*012-A2-B54-Cw*0102. The MICA null haplotype might be identified in the HLA-B48 homozygous individual. These results will provide an understanding of the role of MICA in transplantation, disease association, and population analyses in Koreans.

  3. Alpha-globin gene haplotypes in South American Indians.

    PubMed

    Zago, M A; Melo Santos, E J; Clegg, J B; Guerreiro, J F; Martinson, J J; Norwich, J; Figueiredo, M S

    1995-08-01

    The haplotypes of the alpha-globin gene cluster were determined for 99 Indians from the Brazilian Amazon region who belong to 5 tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Three predominant haplotypes were identified: Ia (present in 38.9% of chromosomes), IIIa (25.8%), and IIe (22.1%). The only alpha-globin gene rearrangement detected was alpha alpha alpha 3.7 I gene triplication associated with haplotype IIIa, found in high frequencies (5.6% and 10.6%) in two tribes and absent in the others. alpha-Globin gene deletions that cause alpha-thalassemia were not seen, supporting the argument that malaria was absent in these populations until recently. The heterogeneous distribution of alpha-globin gene haplotypes and rearrangements among the different tribes differs markedly from the homogeneous distribution of beta-globin gene cluster haplotypes and reflects the action of various genetic mechanisms (genetic drift, founder effect, consanguinity) on small isolated population groups with a complicated history of divergence-fusion events. The alpha-globin gene haplotype distribution has some similarities to distributions observed in Southeast Asian and Pacific Island populations, indicating that these populations have considerable genetic affinities. However, the absence of several features of the alpha-globin gene cluster that are consistently present among the Pacific Islanders suggests that the similarity of haplotypes between Brazilian Indians and people from Polynesia, Micronesia, and Melanesia is more likely to result of ancient common ancestry rather than the consequence of recent direct genetic contribution through immigration.

  4. An unusual haplotype structure on human chromosome 8p23 derived from the inversion polymorphism.

    PubMed

    Deng, Libin; Zhang, Yuezheng; Kang, Jian; Liu, Tao; Zhao, Hongbin; Gao, Yang; Li, Chaohua; Pan, Hao; Tang, Xiaoli; Wang, Dunmei; Niu, Tianhua; Yang, Huanming; Zeng, Changqing

    2008-10-01

    Chromosomal inversion is an important type of genomic variations involved in both evolution and disease pathogenesis. Here, we describe the refined genetic structure of a 3.8-Mb inversion polymorphism at chromosome 8p23. Using HapMap data of 1,073 SNPs generated from 209 unrelated samples from CEPH-Utah residents with ancestry from northern and western Europe (CEU); Yoruba in Ibadan, Nigeria (YRI); and Asian (ASN) samples, which were comprised of Han Chinese from Beijing, China (CHB) and Japanese from Tokyo, Japan (JPT)-we successfully deduced the inversion orientations of all their 418 haplotypes. In particular, distinct haplotype subgroups were identified based on principal component analysis (PCA). Such genetic substructures were consistent with clustering patterns based on neighbor-joining tree reconstruction, which revealed a total of four haplotype clades across all samples. Metaphase fluorescence in situ hybridization (FISH) in a subset of 10 HapMap samples verified their inversion orientations predicted by PCA or phylogenetic tree reconstruction. Positioning of the outgroup haplotype within one of YRI clades suggested that Human NCBI Build 36-inverted order is most likely the ancestral orientation. Furthermore, the population differentiation test and the relative extended haplotype homozygosity (REHH) analysis in this region discovered multiple selection signals, also in a population-specific manner. A positive selection signal was detected at XKR6 in the ASN population. These results revealed the correlation of inversion polymorphisms to population-specific genetic structures, and various selection patterns as possible mechanisms for the maintenance of a large chromosomal rearrangement at 8p23 region during evolution. In addition, our study also showed that haplotype-based clustering methods, such as PCA, can be applied in scanning for cryptic inversion polymorphisms at a genome-wide scale.

  5. Haplotypes in the CRP Gene Associated with Increased BMI and Levels of CRP in Subjects with Type 2 Diabetes or Obesity from Southwestern Mexico

    PubMed Central

    Martínez-Calleja, América; Quiróz-Vargas, Irma; Parra-Rojas, Isela; Muñoz-Valle, José Francisco; Leyva-Vázquez, Marco A.; Fernández-Tilapa, Gloria; Vences-Velázquez, Amalia; Cruz, Miguel; Salazar-Martínez, Eduardo; Flores-Alfaro, Eugenia

    2012-01-01

    Objective. We evaluated the association between four polymorphisms in the CRP gene with circulating levels of C-reactive protein (CRP), type 2 diabetes (T2D), obesity, and risk score of coronary heart disease. Methods. We studied 402 individuals and classified them into four groups: healthy, obese, T2D obese, and T2D without obesity, from Guerrero, Southwestern Mexico. Blood levels of CRP, glucose, cholesterol, triglycerides, and leukocytes were measured. Genotyping was performed by PCR/RFLP, and the risk score for coronary heart disease was determined by the Framingham's methodology. Results. The TT genotype of SNP rs1130864 was associated with increased body mass index and T2D patients with obesity. We found that the haplotype 2 (TGAG) was associated with increased levels of CRP (β = 0.3; 95%CI: 0.1, 0.5; P = 0.005) and haplotype 7 (TGGG) with higher body mass index (BMI) (β = 0.2; 95%CI: 0.1, 0.3; P < 0.001). The risk score for coronary heart disease was associated with increased levels of CRP, but not with any polymorphism or haplotype. Conclusions. The association between the TT genotype of SNP rs1130864 with obesity and the haplotype 7 with BMI may explain how obesity and genetic predisposition increase the risk of diseases such as T2D in the population of Southwestern Mexico. PMID:23049543

  6. Haplotypes in the CRP gene associated with increased BMI and levels of CRP in subjects with type 2 diabetes or obesity from Southwestern Mexico.

    PubMed

    Martínez-Calleja, América; Quiróz-Vargas, Irma; Parra-Rojas, Isela; Muñoz-Valle, José Francisco; Leyva-Vázquez, Marco A; Fernández-Tilapa, Gloria; Vences-Velázquez, Amalia; Cruz, Miguel; Salazar-Martínez, Eduardo; Flores-Alfaro, Eugenia

    2012-01-01

    We evaluated the association between four polymorphisms in the CRP gene with circulating levels of C-reactive protein (CRP), type 2 diabetes (T2D), obesity, and risk score of coronary heart disease. We studied 402 individuals and classified them into four groups: healthy, obese, T2D obese, and T2D without obesity, from Guerrero, Southwestern Mexico. Blood levels of CRP, glucose, cholesterol, triglycerides, and leukocytes were measured. Genotyping was performed by PCR/RFLP, and the risk score for coronary heart disease was determined by the Framingham's methodology. The TT genotype of SNP rs1130864 was associated with increased body mass index and T2D patients with obesity. We found that the haplotype 2 (TGAG) was associated with increased levels of CRP (β = 0.3; 95%CI: 0.1, 0.5; P = 0.005) and haplotype 7 (TGGG) with higher body mass index (BMI) (β = 0.2; 95%CI: 0.1, 0.3; P < 0.001). The risk score for coronary heart disease was associated with increased levels of CRP, but not with any polymorphism or haplotype. The association between the TT genotype of SNP rs1130864 with obesity and the haplotype 7 with BMI may explain how obesity and genetic predisposition increase the risk of diseases such as T2D in the population of Southwestern Mexico.

  7. IRF5 haplotypes demonstrate diverse serological associations which predict serum interferon alpha activity and explain the majority of the genetic association with systemic lupus erythematosus

    PubMed Central

    Niewold, Timothy B; Kelly, Jennifer A; Kariuki, Silvia N; Franek, Beverly S; Kumar, Akaash A; Kaufman, Kenneth M; Thomas, Kenaz; Walker, Daniel; Kamp, Stan; Frost, Jacqueline M; Wong, Andrew K; Merrill, Joan T; Alarcón-Riquelme, Marta E; Tikly, Mohammed; Ramsey-Goldman, Rosalind; Reveille, John D; Petri, Michelle A; Edberg, Jeffrey C; Kimberly, Robert P; Alarcón, Graciela S; Kamen, Diane L; Gilkeson, Gary S; Vyse, Timothy J; James, Judith A; Gaffney, Patrick M; Moser, Kathy L; Crow, Mary K; Harley, John B

    2012-01-01

    Objective High serum interferon α (IFNα) activity is a heritable risk factor for systemic lupus erythematosus (SLE). Auto-antibodies found in SLE form immune complexes which can stimulate IFNα production by activating endosomal Toll-like receptors and interferon regulatory factors (IRFs), including IRF5. Genetic variation in IRF5 is associated with SLE susceptibility; however, it is unclear how IRF5 functional genetic elements contribute to human disease. Methods 1034 patients with SLE and 989 controls of European ancestry, 555 patients with SLE and 679 controls of African–American ancestry, and 73 patients with SLE of South African ancestry were genotyped at IRF5 polymorphisms, which define major haplotypes. Serum IFNα activity was measured using a functional assay. Results In European ancestry subjects, anti-double-stranded DNA (dsDNA) and anti-Ro antibodies were each associated with different haplotypes characterised by a different combination of functional genetic elements (OR > 2.56, p >003C; 1.9×10−14 for both). These IRF5 haplotype-auto-antibody associations strongly predicted higher serum IFNα in patients with SLE and explained > 70% of the genetic risk of SLE due to IRF5. In African–American patients with SLE a similar relationship between serology and IFNα was observed, although the previously described European ancestry-risk haplotype was present at admixture proportions in African–American subjects and absent in African patients with SLE. Conclusions The authors define a novel risk haplotype of IRF5 that is associated with anti-dsDNA antibodies and show that risk of SLE due to IRF5 genotype is largely dependent upon particular auto-antibodies. This suggests that auto-antibodies are directly pathogenic in human SLE, resulting in increased IFNα in cooperation with particular combinations of IRF5 functional genetic elements. SLE is a systemic autoimmune disorder affecting multiple organ systems including the skin, musculoskeletal, renal and

  8. Genome sequence, comparative analysis and haplotype structure of the domestic dog.

    PubMed

    Lindblad-Toh, Kerstin; Wade, Claire M; Mikkelsen, Tarjei S; Karlsson, Elinor K; Jaffe, David B; Kamal, Michael; Clamp, Michele; Chang, Jean L; Kulbokas, Edward J; Zody, Michael C; Mauceli, Evan; Xie, Xiaohui; Breen, Matthew; Wayne, Robert K; Ostrander, Elaine A; Ponting, Chris P; Galibert, Francis; Smith, Douglas R; DeJong, Pieter J; Kirkness, Ewen; Alvarez, Pablo; Biagi, Tara; Brockman, William; Butler, Jonathan; Chin, Chee-Wye; Cook, April; Cuff, James; Daly, Mark J; DeCaprio, David; Gnerre, Sante; Grabherr, Manfred; Kellis, Manolis; Kleber, Michael; Bardeleben, Carolyne; Goodstadt, Leo; Heger, Andreas; Hitte, Christophe; Kim, Lisa; Koepfli, Klaus-Peter; Parker, Heidi G; Pollinger, John P; Searle, Stephen M J; Sutter, Nathan B; Thomas, Rachael; Webber, Caleb; Baldwin, Jennifer; Abebe, Adal; Abouelleil, Amr; Aftuck, Lynne; Ait-Zahra, Mostafa; Aldredge, Tyler; Allen, Nicole; An, Peter; Anderson, Scott; Antoine, Claudel; Arachchi, Harindra; Aslam, Ali; Ayotte, Laura; Bachantsang, Pasang; Barry, Andrew; Bayul, Tashi; Benamara, Mostafa; Berlin, Aaron; Bessette, Daniel; Blitshteyn, Berta; Bloom, Toby; Blye, Jason; Boguslavskiy, Leonid; Bonnet, Claude; Boukhgalter, Boris; Brown, Adam; Cahill, Patrick; Calixte, Nadia; Camarata, Jody; Cheshatsang, Yama; Chu, Jeffrey; Citroen, Mieke; Collymore, Alville; Cooke, Patrick; Dawoe, Tenzin; Daza, Riza; Decktor, Karin; DeGray, Stuart; Dhargay, Norbu; Dooley, Kimberly; Dooley, Kathleen; Dorje, Passang; Dorjee, Kunsang; Dorris, Lester; Duffey, Noah; Dupes, Alan; Egbiremolen, Osebhajajeme; Elong, Richard; Falk, Jill; Farina, Abderrahim; Faro, Susan; Ferguson, Diallo; Ferreira, Patricia; Fisher, Sheila; FitzGerald, Mike; Foley, Karen; Foley, Chelsea; Franke, Alicia; Friedrich, Dennis; Gage, Diane; Garber, Manuel; Gearin, Gary; Giannoukos, Georgia; Goode, Tina; Goyette, Audra; Graham, Joseph; Grandbois, Edward; Gyaltsen, Kunsang; Hafez, Nabil; Hagopian, Daniel; Hagos, Birhane; Hall, Jennifer; Healy, Claire; Hegarty, Ryan; Honan, Tracey; Horn, Andrea; Houde, Nathan; Hughes, Leanne; Hunnicutt, Leigh; Husby, M; Jester, Benjamin; Jones, Charlien; Kamat, Asha; Kanga, Ben; Kells, Cristyn; Khazanovich, Dmitry; Kieu, Alix Chinh; Kisner, Peter; Kumar, Mayank; Lance, Krista; Landers, Thomas; Lara, Marcia; Lee, William; Leger, Jean-Pierre; Lennon, Niall; Leuper, Lisa; LeVine, Sarah; Liu, Jinlei; Liu, Xiaohong; Lokyitsang, Yeshi; Lokyitsang, Tashi; Lui, Annie; Macdonald, Jan; Major, John; Marabella, Richard; Maru, Kebede; Matthews, Charles; McDonough, Susan; Mehta, Teena; Meldrim, James; Melnikov, Alexandre; Meneus, Louis; Mihalev, Atanas; Mihova, Tanya; Miller, Karen; Mittelman, Rachel; Mlenga, Valentine; Mulrain, Leonidas; Munson, Glen; Navidi, Adam; Naylor, Jerome; Nguyen, Tuyen; Nguyen, Nga; Nguyen, Cindy; Nguyen, Thu; Nicol, Robert; Norbu, Nyima; Norbu, Choe; Novod, Nathaniel; Nyima, Tenchoe; Olandt, Peter; O'Neill, Barry; O'Neill, Keith; Osman, Sahal; Oyono, Lucien; Patti, Christopher; Perrin, Danielle; Phunkhang, Pema; Pierre, Fritz; Priest, Margaret; Rachupka, Anthony; Raghuraman, Sujaa; Rameau, Rayale; Ray, Verneda; Raymond, Christina; Rege, Filip; Rise, Cecil; Rogers, Julie; Rogov, Peter; Sahalie, Julie; Settipalli, Sampath; Sharpe, Theodore; Shea, Terrance; Sheehan, Mechele; Sherpa, Ngawang; Shi, Jianying; Shih, Diana; Sloan, Jessie; Smith, Cherylyn; Sparrow, Todd; Stalker, John; Stange-Thomann, Nicole; Stavropoulos, Sharon; Stone, Catherine; Stone, Sabrina; Sykes, Sean; Tchuinga, Pierre; Tenzing, Pema; Tesfaye, Senait; Thoulutsang, Dawa; Thoulutsang, Yama; Topham, Kerri; Topping, Ira; Tsamla, Tsamla; Vassiliev, Helen; Venkataraman, Vijay; Vo, Andy; Wangchuk, Tsering; Wangdi, Tsering; Weiand, Michael; Wilkinson, Jane; Wilson, Adam; Yadav, Shailendra; Yang, Shuli; Yang, Xiaoping; Young, Geneva; Yu, Qing; Zainoun, Joanne; Zembek, Lisa; Zimmer, Andrew; Lander, Eric S

    2005-12-08

    Here we report a high-quality draft genome sequence of the domestic dog (Canis familiaris), together with a dense map of single nucleotide polymorphisms (SNPs) across breeds. The dog is of particular interest because it provides important evolutionary information and because existing breeds show great phenotypic diversity for morphological, physiological and behavioural traits. We use sequence comparison with the primate and rodent lineages to shed light on the structure and evolution of genomes and genes. Notably, the majority of the most highly conserved non-coding sequences in mammalian genomes are clustered near a small subset of genes with important roles in development. Analysis of SNPs reveals long-range haplotypes across the entire dog genome, and defines the nature of genetic diversity within and across breeds. The current SNP map now makes it possible for genome-wide association studies to identify genes responsible for diseases and traits, with important consequences for human and companion animal health.

  9. Suggestive evidence for association between L-type voltage-gated calcium channel (CACNA1C) gene haplotypes and bipolar disorder in Latinos: a family-based association study

    PubMed Central

    Gonzalez, Suzanne; Xu, Chun; Ramirez, Mercedes; Zavala, Juan; Armas, Regina; Contreras, Salvador A; Contreras, Javier; Dassori, Albana; Leach, Robin J; Flores, Deborah; Jerez, Alvaro; Raventós, Henriette; Ontiveros, Alfonso; Nicolini, Humberto; Escamilla, Michael

    2013-01-01

    Objectives Through recent genome-wide association studies (GWAS), several groups have reported significant association between variants in the alpha 1C subunit of the L-type voltage-gated calcium channel (CACNA1C) and bipolar disorder (BP) in European and European-American cohorts. We performed a family-based association study to determine whether CACNA1C is associated with BP in the Latino population. Methods This study consisted of 913 individuals from 215 Latino pedigrees recruited from the United States, Mexico, Guatemala, and Costa Rica. The Illumina GoldenGate Genotyping Assay was used to genotype 58 single-nucleotide polymorphisms (SNPs) that spanned a 602.9 kb region encompassing the CACNA1C gene including two SNPs (rs7297582 and rs1006737) previously shown to associate with BP. Individual SNP and haplotype association analyses were performed using Family-Based Association Test (version 2.0.3) and Haploview (version 4.2) software. Results An eight-locus haplotype block that included these two markers showed significant association with BP (global marker permuted p = 0.0018) in the Latino population. For individual SNPs, this sample had insufficient power (10%) to detect associations with SNPs with minor effect (odds ratio = 1.15). Conclusions Although we were not able to replicate findings of association between individual CACNA1C SNPs rs7297582 and rs1006737 and BP, we were able to replicate the GWAS signal reported for CACNA1C through a haplotype analysis that encompassed these previously reported significant SNPs. These results provide additional evidence that CACNA1C is associated with BP and provides the first evidence that variations in this gene might play a role in the pathogenesis of this disorder in the Latino population. PMID:23437964

  10. Detecting disease-predisposing variants: the haplotype method.

    PubMed Central

    Valdes, A M; Thomson, G

    1997-01-01

    For many HLA-associated diseases, multiple alleles-- and, in some cases, multiple loci--have been suggested as the causative agents. The haplotype method for identifying disease-predisposing amino acids in a genetic region is a stratification analysis. We show that, for each haplotype combination containing all the amino acid sites involved in the disease process, the relative frequencies of amino acid variants at sites not involved in disease but in linkage disequilibrium with the disease-predisposing sites are expected to be the same in patients and controls. The haplotype method is robust to mode of inheritance and penetrance of the disease and can be used to determine unequivocally whether all amino acid sites involved in the disease have not been identified. Using a resampling technique, we developed a statistical test that takes account of the nonindependence of the sites sampled. Further, when multiple sites in the genetic region are involved in disease, the test statistic gives a closer fit to the null expectation when some--compared with none--of the true predisposing factors are included in the haplotype analysis. Although the haplotype method cannot distinguish between very highly correlated sites in one population, ethnic comparisons may help identify the true predisposing factors. The haplotype method was applied to insulin-dependent diabetes mellitus (IDDM) HLA class II DQA1-DQB1 data from Caucasian, African, and Japanese populations. Our results indicate that the combination DQA1#52 (Arg predisposing) DQB1#57 (Asp protective), which has been proposed as an important IDDM agent, does not include all the predisposing elements. With rheumatoid arthritis HLA class II DRB1 data, the results were consistent with the shared-epitope hypothesis. PMID:9042931

  11. Inferring the annual migration patterns of fall armyworm (Lepidoptera: Noctuidae) in the United States from mitochondrial haplotypes

    PubMed Central

    Nagoshi, Rodney N; Meagher, Robert L; Hay-Roe, Mirian

    2012-01-01

    Spodoptera frugiperda (J. E. Smith) or fall armyworm is an important agricultural pest of a number of crops in the western hemisphere. In the United States, infestations in corn acreages extend from the Mexican to the Canadian border. Because fall armyworm does not survive prolonged freezing, the infestations annually affecting most of North America are migrants from southern Texas and Florida, where winter temperatures are mild and host plants are available. A haplotype method was developed that can distinguish between these two geographically distant overwintering populations, with the potential to delineate the associated migratory pathways. Several years of collections from major corn-producing areas in the southern, central, and eastern United States were used to map the geographical distribution of the fall armyworm haplotypes. From these haplotype profiles, it was possible to develop the most detailed description yet of the annual northward movements of fall armyworm. The consistency of these results with past studies and the implications on our understanding of fall armyworm biology are discussed. A better understanding of fall armyworm populations and their movement is critical for the development of strategies to predict infestation levels and eventually control this pest in the United States. PMID:22957154

  12. Mineralocorticoid receptor haplotype, estradiol, progesterone and emotional information processing.

    PubMed

    Hamstra, Danielle A; de Kloet, E Ronald; Quataert, Ina; Jansen, Myrthe; Van der Does, Willem

    2017-02-01

    Carriers of MR-haplotype 1 and 3 (GA/CG; rs5522 and rs2070951) are more sensitive to the influence of oral contraceptives (OC) and menstrual cycle phase on emotional information processing than MR-haplotype 2 (CA) carriers. We investigated whether this effect is associated with estradiol (E2) and/or progesterone (P4) levels. Healthy MR-genotyped premenopausal women were tested twice in a counterbalanced design. Naturally cycling (NC) women were tested in the early-follicular and mid-luteal phase and OC-users during OC-intake and in the pill-free week. At both sessions E2 and P4 were assessed in saliva. Tests included implicit and explicit positive and negative affect, attentional blink accuracy, emotional memory, emotion recognition, and risky decision-making (gambling). MR-haplotype 2 homozygotes had higher implicit happiness scores than MR-haplotype 2 heterozygotes (p=0.031) and MR-haplotype 1/3 carriers (p<0.001). MR-haplotype 2 homozygotes also had longer reaction times to happy faces in an emotion recognition test than MR-haplotype 1/3 (p=0.001). Practice effects were observed for most measures. The pattern of correlations between information processing and P4 or E2 differed between sessions, as well as the moderating effects of the MR genotype. In the first session the MR-genotype moderated the influence of P4 on implicit anxiety (sr=-0.30; p=0.005): higher P4 was associated with reduction in implicit anxiety, but only in MR-haplotype 2 homozygotes (sr=-0.61; p=0.012). In the second session the MR-genotype moderated the influence of E2 on the recognition of facial expressions of happiness (sr=-0.21; p=0.035): only in MR-haplotype 1/3 higher E2 was correlated with happiness recognition (sr=0.29; p=0.005). In the second session higher E2 and P4 were negatively correlated with accuracy in lag2 trials of the attentional blink task (p<0.001). Thus NC women, compared to OC-users, performed worse on lag 2 trials (p=0.041). The higher implicit happiness scores of MR-haplotype

  13. Association of chemokine receptor gene (CCR2-CCR5) haplotypes with acquisition and control of HIV-1 infection in Zambians

    PubMed Central

    2011-01-01

    Background Polymorphisms in chemokine (C-C motif) receptors 2 and 5 genes (CCR2 and CCR5) have been associated with HIV-1 infection and disease progression. We investigated the impact of CCR2-CCR5 haplotypes on HIV-1 viral load (VL) and heterosexual transmission in an African cohort. Between 1995 and 2006, cohabiting Zambian couples discordant for HIV-1 (index seropositive and HIV-1 exposed seronegative {HESN}) were monitored prospectively to determine the role of host genetic factors in HIV-1 control and heterosexual transmission. Genotyping for eight CCR2 and CCR5 variants resolved nine previously recognized haplotypes. By regression and survival analytic techniques, controlling for non-genetic factors, we estimated the effects of these haplotypic variants on a) index partner VL, b) seroconverter VL, c) HIV-1 transmission by index partners, d) HIV-1 acquisition by HESN partners. Results Among 567 couples, 240 virologically linked transmission events had occurred through 2006. HHF*2 homozygosity was associated with significantly lower VL in seroconverters (mean beta = -0.58, log10 P = 0.027) and the HHD/HHE diplotype was associated with significantly higher VL in the seroconverters (mean beta = 0.54, log10 P = 0.014) adjusted for age and gender in multivariable model. HHD/HHE was associated with more rapid acquisition of infection by the HESNs (HR = 2.0, 95% CI = 1.20-3.43, P = 0.008), after adjustments for index partner VL and the presence of genital ulcer or inflammation in either partner in Cox multivariable models. The HHD/HHE effect was stronger in exposed females (HR = 2.1, 95% CI = 1.14-3.95, P = 0.018). Conclusions Among Zambian discordant couples, HIV-1 coreceptor gene haplotypes and diplotypes appear to modulate HIV-1 VL in seroconverters and alter the rate of HIV-1 acquisition by HESNs. These associations replicate or resemble findings reported in other African and European populations. PMID:21429204

  14. Two independent apolipoprotein A5 haplotypes influence human plasma triglyceride levels.

    PubMed

    Pennacchio, Len A; Olivier, Michael; Hubacek, Jaroslav A; Krauss, Ronald M; Rubin, Edward M; Cohen, Jonathan C

    2002-11-15

    The recently identified apolipoprotein A5 gene (APOA5) has been shown to play an important role in determining plasma triglyceride concentrations in humans and mice. We previously identified an APOA5 haplotype (designated APOA5*2) that is present in approximately 16% of Caucasians and is associated with increased plasma triglyceride concentrations. In this report we describe another APOA5 haplotype (APOA5*3) containing the rare allele of the single nucleotide polymorphism c.56C>G that changes serine to tryptophan at codon 19 and is independently associated with high plasma triglyceride levels in three different populations. In a sample of 264 Caucasian men and women with plasma triglyceride concentrations above the 90th percentile or below the 10th percentile, the APOA5*3 haplotype was more than three-fold more common in the group with high plasma triglyceride levels. In a second independently ascertained sample of Caucasian men and women (n=419) who were studied while consuming their self-selected diets as well as after high-carbohydrate diets and high-fat diets, the APOA5*3 haplotype was associated with increased plasma triglyceride levels on all three dietary regimens. In a third population comprising 2660 randomly selected individuals, the APOA5*3 haplotype was found in 12% of Caucasians, 14% of African-Americans and 28% of Hispanics and was associated with increased plasma triglyceride levels in both men and women in each ethnic group. These findings establish that the APOA5 locus contributes significantly to inter-individual variation in plasma triglyceride levels in humans. Together, the APOA5*2 and APOA5*3 haplotypes are found in 25-50% of African-Americans, Hispanics and Caucasians and support the contribution of common human variation to quantitative phenotypes in the general population.

  15. Two independent apolipoprotein a5 Haplotypes influence human plasma triglyceride levels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pennacchio, Len A.; Olivier, Michael; Hubacek, Jaroslav A.

    2002-09-16

    The recently identified apolipoprotein A5 gene (APOA5) has been shown to play an important role in determining plasma triglyceride concentrations in humans and mice. We previously identified an APOA5 haplotype (designated APOA5*2) that is present in {approx}16 percent of Caucasians and is associated with increased plasma triglyceride concentrations. In this report we describe another APOA5 haplotype (APOA5*3) containing the rare allele of the single nucleotide polymorphism c.56C>G that changes serine to tryptophan at codon 19 and is independently associated with high plasma triglyceride levels in three different populations. In a sample of 264 Caucasian men and women with plasma triglyceridemore » concentrations above the 90th percentile or below the 10th percentile, the APOA5*3 haplotype was more than three-fold more common in the group with high plasma triglyceride levels. In a second independently ascertained sample of Caucasian men and women (n 1/4 419) who were studied while consuming their self-selected diets as well as after high-carbohydrate diets and high-fat diets, the APOA5*3 haplotype was associated with increased plasma triglyceride levels on all three dietary regimens. In a third population comprising 2660 randomly selected individuals, the APOA5*3 haplotype was found in 12 percent of Caucasians, 14 percent of African-Americans and 28 percent of Hispanics and was associated with increased plasma triglyceride levels in both men and women in each ethnic group. These findings establish that the APOA5 locus contributes significantly to inter-individual variation in plasma triglyceride levels in humans. Together, the APOA5*2 and APOA5*3 haplotypes are found in 25 50 percent of African-Americans, Hispanics and Caucasians and support the contribution of common human variation to quantitative phenotypes in the general population.« less

  16. A Genome-Wide Scan for Breast Cancer Risk Haplotypes among African American Women

    PubMed Central

    Song, Chi; Chen, Gary K.; Millikan, Robert C.; Ambrosone, Christine B.; John, Esther M.; Bernstein, Leslie; Zheng, Wei; Hu, Jennifer J.; Ziegler, Regina G.; Nyante, Sarah; Bandera, Elisa V.; Ingles, Sue A.; Press, Michael F.; Deming, Sandra L.; Rodriguez-Gil, Jorge L.; Chanock, Stephen J.; Wan, Peggy; Sheng, Xin; Pooler, Loreall C.; Van Den Berg, David J.; Le Marchand, Loic; Kolonel, Laurence N.; Henderson, Brian E.; Haiman, Chris A.; Stram, Daniel O.

    2013-01-01

    Genome-wide association studies (GWAS) simultaneously investigating hundreds of thousands of single nucleotide polymorphisms (SNP) have become a powerful tool in the investigation of new disease susceptibility loci. Haplotypes are sometimes thought to be superior to SNPs and are promising in genetic association analyses. The application of genome-wide haplotype analysis, however, is hindered by the complexity of haplotypes themselves and sophistication in computation. We systematically analyzed the haplotype effects for breast cancer risk among 5,761 African American women (3,016 cases and 2,745 controls) using a sliding window approach on the genome-wide scale. Three regions on chromosomes 1, 4 and 18 exhibited moderate haplotype effects. Furthermore, among 21 breast cancer susceptibility loci previously established in European populations, 10p15 and 14q24 are likely to harbor novel haplotype effects. We also proposed a heuristic of determining the significance level and the effective number of independent tests by the permutation analysis on chromosome 22 data. It suggests that the effective number was approximately half of the total (7,794 out of 15,645), thus the half number could serve as a quick reference to evaluating genome-wide significance if a similar sliding window approach of haplotype analysis is adopted in similar populations using similar genotype density. PMID:23468962

  17. Autosomal dominant hereditary spastic paraplegia with axonal sensory motor polyneuropathy maps to chromosome 21q 22.3.

    PubMed

    Peddareddygari, Leema Reddy; Hanna, Philip A; Igo, Robert P; Luo, Yuqun A; Won, Sungho; Hirano, Michio; Grewal, Raji P

    2016-01-01

    Hereditary spastic paraplegia (HSP) are a genetically and clinically heterogeneous group of disorders. At present, 19 autosomal dominant loci for HSP have been mapped. We ascertained an American family of European descent segregating an autosomal dominant HSP associated with peripheral neuropathy. A genome wide scan was performed with 410 microsatellite repeat marker (Weber lab screening set 16) and following linkage and haplotype analysis, fine mapping was performed. Established genes or loci for HSP were excluded by direct sequencing or haplotype analysis. All established loci for HSP were excluded. Fine mapping suggested a locus on chromosome 21q22.3 flanked by markers D21S1411 and D21S1446 with a maximum logarithm of odds score of 2.05 and was supported by haplotype analysis. A number of candidate genes in this region were analyzed and no disease-producing mutations were detected. We present the clinical and genetic analysis of an American family with autosomal dominant HSP with axonal sensory motor polyneuropathy mapping to a novel locus on chromosome 21q22.3 designated SPG56.

  18. A phased SNP-based classification of sickle cell anemia HBB haplotypes.

    PubMed

    Shaikho, Elmutaz M; Farrell, John J; Alsultan, Abdulrahman; Qutub, Hatem; Al-Ali, Amein K; Figueiredo, Maria Stella; Chui, David H K; Farrer, Lindsay A; Murphy, George J; Mostoslavsky, Gustavo; Sebastiani, Paola; Steinberg, Martin H

    2017-08-11

    Sickle cell anemia causes severe complications and premature death. Five common β-globin gene cluster haplotypes are each associated with characteristic fetal hemoglobin (HbF) levels. As HbF is the major modulator of disease severity, classifying patients according to haplotype is useful. The first method of haplotype classification used restriction fragment length polymorphisms (RFLPs) to detect single nucleotide polymorphisms (SNPs) in the β-globin gene cluster. This is labor intensive, and error prone. We used genome-wide SNP data imputed to the 1000 Genomes reference panel to obtain phased data distinguishing parental alleles. We successfully haplotyped 813 sickle cell anemia patients previously classified by RFLPs with a concordance >98%. Four SNPs (rs3834466, rs28440105, rs10128556, and rs968857) marking four different restriction enzyme sites unequivocally defined most haplotypes. We were able to assign a haplotype to 86% of samples that were either partially or misclassified using RFLPs. Phased data using only four SNPs allowed unequivocal assignment of a haplotype that was not always possible using a larger number of RFLPs. Given the availability of genome-wide SNP data, our method is rapid and does not require high computational resources.

  19. High-Density SNP Genotyping to Define β-Globin Locus Haplotypes

    PubMed Central

    Liu, Li; Muralidhar, Shalini; Singh, Manisha; Sylvan, Caprice; Kalra, Inderdeep S.; Quinn, Charles T.; Onyekwere, Onyinye C.; Pace, Betty S.

    2014-01-01

    Five major β-globin locus haplotypes have been established in individuals with sickle cell disease (SCD) from the Benin, Bantu, Senegal, Cameroon, and Arab-Indian populations. Historically, β-haplotypes were established using restriction fragment length polymorphism (RFLP) analysis across the β-locus, which consists of five functional β-like globin genes located on chromosome 11. Previous attempts to correlate these haplotypes as robust predictors of clinical phenotypes observed in SCD have not been successful. We speculate that the coverage and distribution of the RFLP sites located proximal to or within the globin genes are not sufficiently dense to accurately reflect the complexity of this region. To test our hypothesis, we performed RFLP analysis and high-density single nucleotide polymorphism (SNP) genotyping across the β-locus using DNA samples from either healthy African Americans with normal hemoglobin A (HbAA) or individuals with homozygous SS (HbSS) disease. Using the genotyping data from 88 SNPs and Haploview analysis, we generated a greater number of haplotypes than that observed with RFLP analysis alone. Furthermore, a unique pattern of long-range linkage disequilibrium between the locus control region and the β-like globin genes was observed in the HbSS group. Interestingly, we observed multiple SNPs within the HindIII restriction site located in the Gγ-globin intervening sequence II which produced the same RFLP pattern. These findings illustrated the inability of RFLP analysis to decipher the complexity of sequence variations that impacts genomic structure in this region. Our data suggest that high density SNP mapping may be required to accurately define β-haplotypes that correlate with the different clinical phenotypes observed in SCD. PMID:18829352

  20. Association between VEGF polymorphisms (936c/t, -460t/c and -634g/c) with haplotypes and coronary heart disease susceptibility.

    PubMed

    Han, Xia; Liu, Lili; Niu, Jiamin; Yang, Jun; Zhang, Zengtang; Zhang, Zhiqiang

    2015-01-01

    Our aim was to investigate the association between single nucleotide polymorphisms (SNPs) of vascular endothelial growth factor (VEGF) and coronary heart disease (CHD) susceptibility in Chinese Han population. 144 CHD patients and 150 healthy individuals were enrolled in the study. Three SNPs (936C/T, -460T/C and -634G/C) of VEGF were chose and then were genotyped with Sequenom time-of-flight mass spectrometry (TOFMS). Odds ratio (OR) with 95% confidence interval (CI) were used to evaluate the association of genotypes and haplotypes and CHD susceptibility. The frequencies of -460T/C CC genotype (13.6%) was found higher in the case group than that of control group (6.7%), which indicated that CC genotype was a risk factor for CHD (OR=2.50, 95% CI=1.10-5.68). Correspondently, the C allele appeared to increase the risk of CHD (OR=1.54, 95% CI=1.07-2.22). For -634G/C polymorphism, the risk of the CC genotype carrier for CHD increased 2.24 fold compared to the wild genotype. Moreover, -634G/CC allele was significantly associated with CHD susceptibility (OR=1.65, 95% CI=1.15-2.36). In addition, +936C/T CT genotype and C allele appeared to be a genetic-susceptibility factors for CHD (OR=2.43, 95% CI=1.44-4.10; OR=1.95, 95% CI=1.26-3.02). The haplotype analysis showed that T-C-T, C-C-C and C-G-C haplotypes all could increase the risk for CHD (OR: 2.43, 2.77 and 2.33). we concluded VEGF polymorphisms were associated with CHD susceptibility. Moreover, the haplotypes of T-C-T, C-C-C and C-G-C all could increase the risk for CHD.

  1. Application of the Linux cluster for exhaustive window haplotype analysis using the FBAT and Unphased programs.

    PubMed

    Mishima, Hiroyuki; Lidral, Andrew C; Ni, Jun

    2008-05-28

    Genetic association studies have been used to map disease-causing genes. A newly introduced statistical method, called exhaustive haplotype association study, analyzes genetic information consisting of different numbers and combinations of DNA sequence variations along a chromosome. Such studies involve a large number of statistical calculations and subsequently high computing power. It is possible to develop parallel algorithms and codes to perform the calculations on a high performance computing (HPC) system. However, most existing commonly-used statistic packages for genetic studies are non-parallel versions. Alternatively, one may use the cutting-edge technology of grid computing and its packages to conduct non-parallel genetic statistical packages on a centralized HPC system or distributed computing systems. In this paper, we report the utilization of a queuing scheduler built on the Grid Engine and run on a Rocks Linux cluster for our genetic statistical studies. Analysis of both consecutive and combinational window haplotypes was conducted by the FBAT (Laird et al., 2000) and Unphased (Dudbridge, 2003) programs. The dataset consisted of 26 loci from 277 extended families (1484 persons). Using the Rocks Linux cluster with 22 compute-nodes, FBAT jobs performed about 14.4-15.9 times faster, while Unphased jobs performed 1.1-18.6 times faster compared to the accumulated computation duration. Execution of exhaustive haplotype analysis using non-parallel software packages on a Linux-based system is an effective and efficient approach in terms of cost and performance.

  2. Application of the Linux cluster for exhaustive window haplotype analysis using the FBAT and Unphased programs

    PubMed Central

    Mishima, Hiroyuki; Lidral, Andrew C; Ni, Jun

    2008-01-01

    Background Genetic association studies have been used to map disease-causing genes. A newly introduced statistical method, called exhaustive haplotype association study, analyzes genetic information consisting of different numbers and combinations of DNA sequence variations along a chromosome. Such studies involve a large number of statistical calculations and subsequently high computing power. It is possible to develop parallel algorithms and codes to perform the calculations on a high performance computing (HPC) system. However, most existing commonly-used statistic packages for genetic studies are non-parallel versions. Alternatively, one may use the cutting-edge technology of grid computing and its packages to conduct non-parallel genetic statistical packages on a centralized HPC system or distributed computing systems. In this paper, we report the utilization of a queuing scheduler built on the Grid Engine and run on a Rocks Linux cluster for our genetic statistical studies. Results Analysis of both consecutive and combinational window haplotypes was conducted by the FBAT (Laird et al., 2000) and Unphased (Dudbridge, 2003) programs. The dataset consisted of 26 loci from 277 extended families (1484 persons). Using the Rocks Linux cluster with 22 compute-nodes, FBAT jobs performed about 14.4–15.9 times faster, while Unphased jobs performed 1.1–18.6 times faster compared to the accumulated computation duration. Conclusion Execution of exhaustive haplotype analysis using non-parallel software packages on a Linux-based system is an effective and efficient approach in terms of cost and performance. PMID:18541045

  3. Fetal hemoglobin in sickle cell anemia: The Arab-Indian haplotype and new therapeutic agents.

    PubMed

    Habara, Alawi H; Shaikho, Elmutaz M; Steinberg, Martin H

    2017-11-01

    Fetal hemoglobin (HbF) has well-known tempering effects on the symptoms of sickle cell disease and its levels vary among patients with different haplotypes of the sickle hemoglobin gene. Compared with sickle cell anemia haplotypes found in patients of African descent, HbF levels in Saudi and Indian patients with the Arab-Indian (AI) haplotype exceed that in any other haplotype by nearly twofold. Genetic association studies have identified some loci associated with high HbF in the AI haplotype but these observations require functional confirmation. Saudi patients with the Benin haplotype have HbF levels almost twice as high as African patients with this haplotype but this difference is unexplained. Hydroxyurea is still the only FDA approved drug for HbF induction in sickle cell disease. While most patients treated with hydroxyurea have an increase in HbF and some clinical improvement, 10 to 20% of adults show little response to this agent. We review the genetic basis of HbF regulation focusing on sickle cell anemia in Saudi Arabia and discuss new drugs that can induce increased levels of HbF. © 2017 Wiley Periodicals, Inc.

  4. Association between mitochondrial DNA haplotype compatibility and increased efficiency of bovine intersubspecies cloning.

    PubMed

    Yan, Hao; Yan, Zhonghai; Ma, Qingwen; Jiao, Fei; Huang, Shuzhen; Zeng, Fanyi; Zeng, Yitao

    2011-01-01

    Reconstructed embryos derived from intersubspecies somatic cell nuclear transfer (SCNT) have poorer developmental potential than those from intrasubspecies SCNT. Based on our previous study that Holstein dairy bovine (HD) mitochondrial DNA (mtDNA) haplotype compatibility between donor karyoplast and recipient cytoplast is crucial for SCNT embryo development, we performed intersubspecies SCNT using HD as donor karyoplast and Luxi yellow heifer (LY) as recipient cytoplast according to mtDNA haplotypes determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. The results demonstrated that intersubspecies mtDNA homotype SCNT embryos had higher pre- and post-implantation developmental competence than intrasubspecies mtDNA heterotype embryos as well as improved blastocyst reprogramming status, including normal H3K9 dimethylation pattern and promoter hypomethylation of pluripotent genes such as Oct4 and Sox2, suggesting that intersubspecies SCNT using LY oocytes maintains HD cloning efficiency and may reprogram HD nuclei to develop into a normal cloned animal ultimately. Our results indicated that karyoplast-cytoplast interactions and mtDNA haplotype compatibility may affect bovine intersubspecies SCNT efficiency. This study on bovine intersubspecies SCNT is valuable for understanding the mechanisms of mtDNA haplotype compatibility between karyoplast and cytoplast impacting the bovine SCNT efficiency, and provides an alternative and economic resource for HD cloning. Copyright © 2011. Published by Elsevier Ltd.

  5. Specific CAPN10 gene haplotypes influence the clinical profile of polycystic ovary patients.

    PubMed

    Gonzalez, Alejandro; Abril, Eduardo; Roca, Alfredo; Aragón, Maria José; Figueroa, Maria José; Velarde, Pilar; Ruiz, Rocío; Fayez, Omar; Galán, José Jorge; Herreros, José Antonio; Real, Luis Miguel; Ruiz, Agustín

    2003-11-01

    Recently, several research groups have evaluated CAPN10 gene in polycystic ovarian syndrome (PCOS) patients and other phenotypes, including hirsutism or intermediate phenotypes of PCOS. Molecular genetic analysis of CAPN10 gene indicates that different alleles may play a role in PCOS susceptibility and could be associated with idiopathic hirsutism. However, these observations are not exempt from controversy, because independent studies cannot replicate these preliminary findings. We present a haplotype-phenotype correlation study of CAPN10 haplotypes in 148 women showing ecographically detected polycystic ovaries (PCO) combined with one or more of these clinical symptoms: amenorrhea or severe oligomenorrhea, hyperandrogenism, and anovulatory infertility, as well as 93 unrelated controls. We have reconstructed and analyzed 482 CAPN10 haplotypes in patients and controls. We detected the association of UCSNP-44 allele with PCO phenotype in the Spanish population (P = 0.02). In addition, we identified several CAPN10 alleles associated to phenotypic differences observed between PCO patients, such as the presence of hypercholesterolemia (haplotype 1121, P = 0.005), presence of hyperandrogenic features (P = 0.05), and familial cancer incidence (haplotype 1111, P = 0.0005). Our results confirm the association of UCSNP-44 allele with PCO phenotype in the Spanish population. Moreover, we have identified novel candidate risk alleles and genotypes, within CAPN10 gene, that could be associated with important phenotypic and prognosis differences observed in PCOS patients.

  6. Honey bee-inspired algorithms for SNP haplotype reconstruction problem

    NASA Astrophysics Data System (ADS)

    PourkamaliAnaraki, Maryam; Sadeghi, Mehdi

    2016-03-01

    Reconstructing haplotypes from SNP fragments is an important problem in computational biology. There have been a lot of interests in this field because haplotypes have been shown to contain promising data for disease association research. It is proved that haplotype reconstruction in Minimum Error Correction model is an NP-hard problem. Therefore, several methods such as clustering techniques, evolutionary algorithms, neural networks and swarm intelligence approaches have been proposed in order to solve this problem in appropriate time. In this paper, we have focused on various evolutionary clustering techniques and try to find an efficient technique for solving haplotype reconstruction problem. It can be referred from our experiments that the clustering methods relying on the behaviour of honey bee colony in nature, specifically bees algorithm and artificial bee colony methods, are expected to result in more efficient solutions. An application program of the methods is available at the following link. http://www.bioinf.cs.ipm.ir/software/haprs/

  7. Visualizing disease associations: graphic analysis of frequency distributions as a function of age using moving average plots (MAP) with application to Alzheimer's and Parkinson's disease.

    PubMed

    Payami, Haydeh; Kay, Denise M; Zabetian, Cyrus P; Schellenberg, Gerard D; Factor, Stewart A; McCulloch, Colin C

    2010-01-01

    Age-related variation in marker frequency can be a confounder in association studies, leading to both false-positive and false-negative findings and subsequently to inconsistent reproducibility. We have developed a simple method, based on a novel extension of moving average plots (MAP), which allows investigators to inspect the frequency data for hidden age-related variations. MAP uses the standard case-control association data and generates a birds-eye view of the frequency distributions across the age spectrum; a picture in which one can see if, how, and when the marker frequencies in cases differ from that in controls. The marker can be specified as an allele, genotype, haplotype, or environmental factor; and age can be age-at-onset, age when subject was last known to be unaffected, or duration of exposure. Signature patterns that emerge can help distinguish true disease associations from spurious associations due to age effects, age-varying associations from associations that are uniform across all ages, and associations with risk from associations with age-at-onset. Utility of MAP is illustrated by application to genetic and epidemiological association data for Alzheimer's and Parkinson's disease. MAP is intended as a descriptive method, to complement standard statistical techniques. Although originally developed for age patterns, MAP is equally useful for visualizing any quantitative trait.

  8. Patterns of linkage disequilibrium and haplotype distribution in disease candidate genes.

    PubMed

    Long, Ji-Rong; Zhao, Lan-Juan; Liu, Peng-Yuan; Lu, Yan; Dvornyk, Volodymyr; Shen, Hui; Liu, Yong-Jun; Zhang, Yuan-Yuan; Xiong, Dong-Hai; Xiao, Peng; Deng, Hong-Wen

    2004-05-24

    The adequacy of association studies for complex diseases depends critically on the existence of linkage disequilibrium (LD) between functional alleles and surrounding SNP markers. We examined the patterns of LD and haplotype distribution in eight candidate genes for osteoporosis and/or obesity using 31 SNPs in 1,873 subjects. These eight genes are apolipoprotein E (APOE), type I collagen alpha1 (COL1A1), estrogen receptor-alpha (ER-alpha), leptin receptor (LEPR), parathyroid hormone (PTH)/PTH-related peptide receptor type 1 (PTHR1), transforming growth factor-beta1 (TGF-beta1), uncoupling protein 3 (UCP3), and vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR). Yin yang haplotypes, two high-frequency haplotypes composed of completely mismatching SNP alleles, were examined. To quantify LD patterns, two common measures of LD, D' and r2, were calculated for the SNPs within the genes. The haplotype distribution varied in the different genes. Yin yang haplotypes were observed only in PTHR1 and UCP3. D' ranged from 0.020 to 1.000 with the average of 0.475, whereas the average r2 was 0.158 (ranging from 0.000 to 0.883). A decay of LD was observed as the intermarker distance increased, however, there was a great difference in LD characteristics of different genes or even in different regions within gene. The differences in haplotype distributions and LD patterns among the genes underscore the importance of characterizing genomic regions of interest prior to association studies.

  9. Association of swine leukocyte antigen class II haplotypes and immune-related traits in a swine line selected for resistance to mycoplasmal pneumonia.

    PubMed

    Ando, Asako; Shigenari, Atsuko; Kojima-Shibata, Chihiro; Nakajoh, Mitsuru; Suzuki, Keiichi; Kitagawa, Hitoshi; Shiina, Takashi; Inoko, Hidetoshi; Uenishi, Hirohide

    2016-10-01

    By selective breeding for five generations, a Landrace line has been recently established to improve resistance to mycoplasmal pneumonia of swine (MPS), daily gain (DG), back fat thickness (BF), and plasma cortisol concentrations (COR). To clarify the involvement of swine leukocyte antigen (SLA) polymorphisms in the selection process, we investigated possible associations of 11 SLA-class II haplotypes with selected traits or immune parameters. Pigs with the low-resolution SLA haplotype Lr-0.23 or Lr-0.13, which increased in frequency with the passage of generations, had less severe pathological lesions of MPS, increased leukocyte phagocytic activity, and higher white blood cell counts. In contrast, Lr-0.12 and Lr-0.2, which decreased in subsequent generations, were weakly associated with more severe pathological lesions of MPS. Therefore, in the studied Landrace line, the Lr-0.23 and Lr-0.13 haplotypes are potentially useful genetic markers for selecting and breeding animals with less severe pathological lesions of MPS. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Evaluation of the association between the JAK2 46/1 haplotype and chronic myeloproliferative neoplasms in a Brazilian population

    PubMed Central

    Silva, Sarah Pagliarini- e-; Santos, Bruna Cunha; de Figueiredo Pereira, Elizangela Mendes; Ferreira, Mari Ellen; Baraldi, Elaine Cristina; Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

    2013-01-01

    OBJECTIVE: The JAK2 46/1 haplotype has recently been described as a major contributing factor to the development of myeloproliferative neoplasm, whether positive or negative for the JAK2 V617F mutation. The G allele, identified by a single-nucleotide polymorphism known as JAK2 rs10974944, is part of the JAK2 46/1 haplotype. The aim of this study was to verify the association between the presence of the G allele and the development of BCR-ABL-negative chronic myeloproliferative neoplasms in our population. METHODS: Blood and oral mucosa swab samples were obtained from 56 patients of two local Brazilian hospitals who had previously been diagnosed with BCR-ABL-negative chronic myeloproliferative neoplasms. Blood samples from 90 local blood donors were used as controls. The presence of the G allele was assessed using a PCR-RFLP assay after extracting DNA from the samples. RESULTS: The presence of the G allele was strongly associated with the presence of BCR-ABL-negative chronic myeloproliferative neoplasms (p = 0.0001; OR = 2.674; 95% CI = 1.630−4.385) in the studied population. CONCLUSION: In agreement with previous reports, the JAK2 46/1 haplotype, represented in this study by the presence of the G allele, is an important predisposing factor in the oncogenetic development of these neoplasms in our population. PMID:23420150

  11. Catechol-O-methyltransferase gene haplotypes in Mexican and Spanish patients with fibromyalgia

    PubMed Central

    Vargas-Alarcón, Gilberto; Fragoso, José-Manuel; Cruz-Robles, David; Vargas, Angélica; Vargas, Alfonso; Lao-Villadóniga, José-Ignacio; García-Fructuoso, Ferrán; Ramos-Kuri, Manuel; Hernández, Fernando; Springall, Rashidi; Bojalil, Rafael; Vallejo, Maite; Martínez-Lavín, Manuel

    2007-01-01

    Autonomic dysfunction is frequent in patients with fibromyalgia (FM). Heart rate variability analyses have demonstrated signs of ongoing sympathetic hyperactivity. Catecholamines are sympathetic neurotransmitters. Catechol-O-methyltransferase (COMT), an enzyme, is the major catecholamine-clearing pathway. There are several single-nucleotide polymorphisms (SNPs) in the COMT gene associated with the different catecholamine-clearing abilities of the COMT enzyme. These SNPs are in linkage disequilibrium and segregate as 'haplotypes'. Healthy females with a particular COMT gene haplotype (ACCG) producing a defective enzyme are more sensitive to painful stimuli. The objective of our study was to define whether women with FM, from two different countries (Mexico and Spain), have the COMT gene haplotypes that have been previously associated with greater sensitivity to pain. All the individuals in the study were female. Fifty-seven Mexican patients and 78 Spanish patients were compared with their respective healthy control groups. All participants filled out the Fibromyalgia Impact Questionnaire (FIQ). Six COMT SNPs (rs2097903, rs6269, rs4633, rs4818, rs4680, and rs165599) were genotyped from peripheral blood DNA. In Spanish patients, there was a significant association between three SNPs (rs6269, rs4818, and rs4680) and the presence of FM when compared with healthy controls. Moreover, in Spanish patients with the 'high pain sensitivity' haplotype (ACCG), the disease, as assessed by the FIQ, was more severe. By contrast, Mexican patients displayed only a weak association between rs6269 and rs165599, and some FIQ subscales. In our group of Spanish patients, there was an association between FM and the COMT haplotype previously associated with high pain sensitivity. This association was not observed in Mexican patients. Studies with a larger sample size are needed in order to verify or amend these preliminary results. PMID:17961261

  12. A powerful approach reveals numerous expression quantitative trait haplotypes in multiple tissues.

    PubMed

    Ying, Dingge; Li, Mulin Jun; Sham, Pak Chung; Li, Miaoxin

    2018-04-26

    Recently many studies showed single nucleotide polymorphisms (SNPs) affect gene expression and contribute to development of complex traits/diseases in a tissue context-dependent manner. However, little is known about haplotype's influence on gene expression and complex traits, which reflects the interaction effect between SNPs. In the present study, we firstly proposed a regulatory region guided eQTL haplotype association analysis approach, and then systematically investigate the expression quantitative trait loci (eQTL) haplotypes in 20 different tissues by the approach. The approach has a powerful design of reducing computational burden by the utilization of regulatory predictions for candidate SNP selection and multiple testing corrections on non-independent haplotypes. The application results in multiple tissues showed that haplotype-based eQTLs not only increased the number of eQTL genes in a tissue specific manner, but were also enriched in loci that associated with complex traits in a tissue-matched manner. In addition, we found that tag SNPs of eQTL haplotypes from whole blood were selectively enriched in certain combination of regulatory elements (e.g. promoters and enhancers) according to predicted chromatin states. In summary, this eQTL haplotype detection approach, together with the application results, shed insights into synergistic effect of sequence variants on gene expression and their susceptibility to complex diseases. The executable application "eHaplo" is implemented in Java and is publicly available at http://grass.cgs.hku.hk/limx/ehaplo/. jonsonfox@gmail.com, limiaoxin@mail.sysu.edu.cn. Supplementary data are available at Bioinformatics online.

  13. VKORC1 haplotypes are associated with arterial vascular diseases (stroke, coronary heart disease, and aortic dissection).

    PubMed

    Wang, Yibo; Zhang, Weili; Zhang, Yuhui; Yang, Yuejin; Sun, Lizhong; Hu, Shengshou; Chen, Jilin; Zhang, Channa; Zheng, Yi; Zhen, Yisong; Sun, Kai; Fu, Chunyan; Yang, Tao; Wang, Jianwei; Sun, Jing; Wu, Haiying; Glasgow, Wayne C; Hui, Rutai

    2006-03-28

    The haplotypes in the gene vitamin K epoxide reductase complex subunit 1 (VKORC1) have been found to affect warfarin dose response through effects on the formation of reduced-form vitamin K, a cofactor for gamma-carboxylation of vitamin K-dependent proteins, which is involved in the coagulation cascade and has a potential impact on atherosclerosis. We hypothesized that VKORC1-dependent effects on the coagulation cascade and atherosclerosis would contribute to susceptibility for vascular diseases. To test the hypothesis, we studied the association of polymorphisms of VKORC1 with stroke (1811 patients), coronary heart disease (740 patients), and aortic dissection (253 patients) compared with matched controls (n=1811, 740, and 416, respectively). Five common noncoding single-nucleotide polymorphisms of VKORC1 were identified in a natural haplotype block with strong linkage disequilibrium (D'>0.9, r2>0.9), then single-nucleotide polymorphism (SNP) +2255 in the block was selected for the association study. We found that the presence of the C allele of the +2255 locus conferred almost twice the risk of vascular disease (odds ratio [OR] 1.95, 95% confidence interval [CI] .58 to 2.41, P<0.001 for stroke; OR 1.72, 95% CI 1.24 to 2.38, P<0.01 for coronary heart disease; and OR 1.90, 95% CI 1.04 to 3.48, P<0.05 for aortic dissection). We also observed that subjects with the CC and CT genotypes had lower levels of undercarboxylated osteocalcin (a regulator for the bone), probably vascular calcification, and lower levels of protein induced in vitamin K absence or antagonism II (PIVKA-II, a des-gamma-carboxy prothrombin) than those with TT genotypes. The haplotype of VKORC1 may serve as a novel genetic marker for the risk of stroke, coronary heart disease, and aortic dissection.

  14. How Have Self-Incompatibility Haplotypes Diversified? Generation of New Haplotypes during the Evolution of Self-Incompatibility from Self-Compatibility.

    PubMed

    Sakai, Satoki

    2016-08-01

    I developed a gametophytic self-incompatibility (SI) model to study the conditions leading to diversification in SI haplotypes. In the model, the SI system is assumed to be incomplete, and the pollen expressing a given specificity is not fully rejected by the pistils expressing the same specificity. I also assumed that mutations can occur that enhance the rejection of pollen by pistils with the same haplotype variant and reduce rejection by pistils with other variants in the same haplotype. I found that if such mutations occur, the new haplotypes (mutant variants) can stably coexist with the ancestral haplotype in which the mutant arose. This is because pollen bearing the new haplotype is most strongly rejected by pistils bearing the same new haplotype among the pistils in the population; hence, negative frequency-dependent selection prevents their fixation. I also performed simulations and found that the nearly complete SI system evolves from completely self-compatible populations and that SI haplotypes can increase to about 40-50 within a few thousand generations. On the basis of my findings, I propose that diversification of SI haplotypes occurred during the evolution of SI from self-compatibility.

  15. JAK2 46/1 haplotype is associated with JAK2 V617F--positive myeloproliferative neoplasms in Brazilian patients.

    PubMed

    Macedo, L C; Santos, B C; Pagliarini-e-Silva, S; Pagnano, K B B; Rodrigues, C; Quintero, F C; Ferreira, M E; Baraldi, E C; Ambrosio-Albuquerque, E P; Sell, A M; Visentainer, J E L

    2015-10-01

    This study aimed to verify the association between the JAK2 46/1 haplotype (V617F positive) and some hematological parameters in BCR-ABL-negative chronic myeloproliferative neoplasms (cMPNs) in our population. The blood samples obtained from the patients with cMPN were genotyped for the JAK2 V617F mutation and JAK2 rs10974944 SNP screening using a PCR-RFLP assay. The JAK2 V617F mutation was detected in 80.15% of patients. The G variant of rs10974944 was more frequent in all MPNs, especially those that were JAK2 V617F positive, than in the control population. We also compared the 46/1 haplotype status in each MPN disease entity, polycythemia vera (PV), essential thrombocythemia (ET), primary myelofibrosis (PMF), and MPNu with controls. The G allele frequency relative to controls was significantly enriched in patients with PV and ET, but not in those with PMF and MPNu. PV and ET patients especially, all of whom had the JAK2 V617F mutation, showed significant excess of the G allele. The frequency of JAK2 V617F mutation was associated with elevated hematological parameters, but when we analyze the occurrence of the mutation and the presence of the G allele, just the high hemoglobin was significantly. In agreement with previous reports, JAK2 46/1 haplotype for JAK2 V617F was associated with cMPN positive in Brazilian patients. © 2015 John Wiley & Sons Ltd.

  16. A haplotype of three SNPs in FTO had a strong association with body composition and BMI in Iranian male adolescents.

    PubMed

    Kalantari, Naser; Keshavarz Mohammadi, Nastaran; Izadi, Pantea; Doaei, Saeid; Gholamalizadeh, Maryam; Eini-Zinab, Hassan; Salonurmi, Tuire; Rafieifar, Shahram; Janipoor, Reza; Azizi Tabesh, Ghasem

    2018-01-01

    Single-nucleotide polymorphisms (SNPs), which are located in the first intron of the FTO gene, are reported to be associated with body weight and the body mass index (BMI). However, their effects on anthropometric measurements in adolescents are poorly understood. This study aimed to investigate the association of three adjacent polymorphisms (rs9930506, rs9930501, & rs9932754) in the FTO gene with anthropometric indices in Iranian adolescent males. The participants comprised a total of 237 adolescent males who were recruited randomly from two high schools in Tehran, Iran. The DNA samples were genotyped for the FTO gene polymorphisms by DNA sequencing. BMI, body fat percentage (BF%), and body muscle percentage (BM%) were determined using a validated bioelectrical impedance analysis scale. The association of the FTO polymorphisms with weight, height, BMI, BF%, and BM% was investigated. A haplotype of rs9930506, rs9930501, and rs9932754 (GGT) in the first intron of the FTO with complete linkage disequilibrium (LD) was found to be significantly associated with higher weight (OR = 1.32), BMI (OR = 5.36) and BF% (OR = 1.46), and lower BM% (OR = 3.59) (all P<0.001). None of the students with GGC genotypes were underweight, while all of the students with AAT genotypes had high muscle mass. A haplotype in the first intron of the FTO gene had a strong association with obesity indices in Iranian adolescent males. The FTO gene polymorphisms might have greater effects on anthropometric indices than what was previously imagined. Moreover, we suggested that the FTO gene exerted their effects on anthropometric measurements through haplotypes (and not single SNPs).

  17. Association of KIR genotypes and haplotypes with susceptibility to chronic hepatitis B virus infection in Chinese Han population.

    PubMed

    Lu, Zhiming; Zhang, Bingchang; Chen, Shijun; Gai, Zhongtao; Feng, Zhaolei; Liu, Xiangdong; Liu, Yiqing; Wen, Xin; Li, Li; Jiao, Yulian; Ma, Chunyan; Shao, Song; Cui, Xiangfa; Chen, Guojian; Li, Jianfeng; Zhao, Yueran

    2008-12-01

    Killer immunoglobulin-like receptor (KIR) genes can regulate the activation of NK and T cells upon interaction with HLA class I molecules. Hepatitis B virus (HBV) infection has been regarded as a multi-factorial disorder disease. Previous studies revealed that KIRs were involved in HCV and HIV infection or clearance. The aim of this study was to explore the possibility of the inheritance of KIR genotypes and haplotypes as a candidate for susceptibility to persistent HBV infection or HBV clearance. The sequence specific primer polymerase chain reaction (SSP-PCR) was employed to identify the KIR genes and pseudogenes in 150 chronic hepatitis B (CHB) patients, 251 spontaneously recovered (SR) controls, and 412 healthy controls. The frequencies of genotype G, M, FZ1 increased in CHB patients compared with healthy control subjects. The frequency of genotype AH was higher in SR controls than that in both CHB patients and healthy controls. The carriage frequencies of genotype G and AH were higher; while, the frequencies of AF and AJ were lower in SR controls than those in healthy control subjects. The frequency of A haplotype was lower, whereas, the frequency of B haplotype was higher in CHB patients and SR controls than those in healthy controls. In healthy controls, haplotype 4 was found lower compared with that in CHB patients and SR controls and the frequency of haplotype 5 was higher in SR controls than that in other two groups. Based on these findings, it seems that the genotypes M and FZ1 are HBV susceptive genotypes; AH, on the other hand, may be protective genotypes that facilitate the clearance of HBV. It appears that the haplotype 4 is HBV susceptive haplotype, whereas, haplotype 5 may be the protective haplotype that facilitates the clearance of HBV.

  18. MAPT H1 Haplotype is Associated with Late-Onset Alzheimer's Disease Risk in APOEɛ4 Noncarriers: Results from the Dementia Genetics Spanish Consortium.

    PubMed

    Pastor, Pau; Moreno, Fermín; Clarimón, Jordi; Ruiz, Agustín; Combarros, Onofre; Calero, Miguel; López de Munain, Adolfo; Bullido, Maria J; de Pancorbo, Marian M; Carro, Eva; Antonell, Anna; Coto, Eliecer; Ortega-Cubero, Sara; Hernandez, Isabel; Tárraga, Lluís; Boada, Mercè; Lleó, Alberto; Dols-Icardo, Oriol; Kulisevsky, Jaime; Vázquez-Higuera, José Luis; Infante, Jon; Rábano, Alberto; Fernández-Blázquez, Miguel Ángel; Valentí, Meritxell; Indakoetxea, Begoña; Barandiarán, Myriam; Gorostidi, Ana; Frank-García, Ana; Sastre, Isabel; Lorenzo, Elena; Pastor, María A; Elcoroaristizabal, Xabier; Lennarz, Martina; Maier, Wolfang; Rámirez, Alfredo; Serrano-Ríos, Manuel; Lee, Suzee E; Sánchez-Juan, Pascual

    2016-01-01

    The MAPT H1 haplotype has been linked to several disorders, but its relationship with Alzheimer's disease (AD) remains controversial. A rare variant in MAPT (p.A152T) has been linked with frontotemporal dementia (FTD) and AD. We genotyped H1/H2 and p.A152T MAPT in 11,572 subjects from Spain (4,327 AD, 563 FTD, 648 Parkinson's disease (PD), 84 progressive supranuclear palsy (PSP), and 5,950 healthy controls). Additionally, we included 101 individuals from 21 families with genetic FTD. MAPT p.A152T was borderline significantly associated with FTD [odds ratio (OR) = 2.03; p = 0.063], but not with AD. MAPT H1 haplotype was associated with AD risk (OR = 1.12; p = 0.0005). Stratification analysis showed that this association was mainly driven by APOE ɛ4 noncarriers (OR = 1.14; p = 0.0025). MAPT H1 was also associated with risk for PD (OR = 1.30; p = 0.0003) and PSP (OR = 3.18; p = 8.59 × 10-8) but not FTD. Our results suggest that the MAPT H1 haplotype increases the risk of PD, PSP, and non-APOE ɛ4 AD.

  19. A comprehensive literature review of haplotyping software and methods for use with unrelated individuals.

    PubMed

    Salem, Rany M; Wessel, Jennifer; Schork, Nicholas J

    2005-03-01

    Interest in the assignment and frequency analysis of haplotypes in samples of unrelated individuals has increased immeasurably as a result of the emphasis placed on haplotype analyses by, for example, the International HapMap Project and related initiatives. Although there are many available computer programs for haplotype analysis applicable to samples of unrelated individuals, many of these programs have limitations and/or very specific uses. In this paper, the key features of available haplotype analysis software for use with unrelated individuals, as well as pooled DNA samples from unrelated individuals, are summarised. Programs for haplotype analysis were identified through keyword searches on PUBMED and various internet search engines, a review of citations from retrieved papers and personal communications, up to June 2004. Priority was given to functioning computer programs, rather than theoretical models and methods. The available software was considered in light of a number of factors: the algorithm(s) used, algorithm accuracy, assumptions, the accommodation of genotyping error, implementation of hypothesis testing, handling of missing data, software characteristics and web-based implementations. Review papers comparing specific methods and programs are also summarised. Forty-six haplotyping programs were identified and reviewed. The programs were divided into two groups: those designed for individual genotype data (a total of 43 programs) and those designed for use with pooled DNA samples (a total of three programs). The accuracy of programs using various criteria are assessed and the programs are categorised and discussed in light of: algorithm and method, accuracy, assumptions, genotyping error, hypothesis testing, missing data, software characteristics and web implementation. Many available programs have limitations (eg some cannot accommodate missing data) and/or are designed with specific tasks in mind (eg estimating haplotype frequencies rather than

  20. Haplotypes in CCR5-CCR2, CCL3 and CCL5 are associated with natural resistance to HIV-1 infection in a Colombian cohort.

    PubMed

    Vega, Jorge A; Villegas-Ospina, Simón; Aguilar-Jiménez, Wbeimar; Rugeles, María T; Bedoya, Gabriel; Zapata, Wildeman

    2017-06-01

    Variants in genes encoding for HIV-1 co-receptors and their natural ligands have been individually associated to natural resistance to HIV-1 infection. However, the simultaneous presence of these variants has been poorly studied. To evaluate the association of single and multilocus haplotypes in genes coding for the viral co-receptors CCR5 and CCR2, and their ligands CCL3 and CCL5, with resistance or susceptibility to HIV-1 infection. Nine variants in CCR5-CCR2, two SNPs in CCL3 and two in CCL5 were genotyped by PCR-RFLP in 35 seropositive (cases) and 49 HIV-1-exposed seronegative Colombian individuals (controls). Haplotypes were inferred using the Arlequin software, and their frequency in individual or combined loci was compared between cases and controls by the chi-square test. A p' value ;0.05 after Bonferroni correction was considered significant. Homozygosis of the human haplogroup (HH) E was absent in controls and frequent in cases, showing a tendency to susceptibility. The haplotypes C-C and T-T in CCL3 were associated with susceptibility (p'=0.016) and resistance (p';0.0001) to HIV-1 infection, respectively. Finally, in multilocus analysis, the haplotype combinations formed by HHC in CCR5-CCR2, T-T in CCL3 and G-C in CCL5 were associated with resistance (p'=0.006). Our results suggest that specific combinations of variants in genes from the same signaling pathway can define an HIV-1 resistant phenotype. Despite our small sample size, our statistically significant associations suggest strong effects; however, these results should be further validated in larger cohorts.

  1. Association of polymorphisms and haplotypes in the cytochrome P450 1B1 gene with uterine leiomyoma: A case control study

    PubMed Central

    SALIMI, SAEEDEH; KHODAMIAN, MARYAM; NAROOIE-NEJAD, MEHRNAZ; HAJIZADEH, AZAM; FAZELI, KIMIA; NAMAZI, LIDA; YAGHMAEI, MINOO

    2015-01-01

    Uterine leiomyoma (UL) is an estrogen-dependent neoplasm of the uterus and estrogen metabolizing enzymes affect its promotion and progression. The aim of the present study was to evaluate the association between four single-nucleotide polymorphisms (SNPs) of the cytochrome P450 1B1 (CYP1B1) gene and UL risk. Four SNPs of the CYP1B1 gene in 105 UL patients and 112 unrelated healthy controls were genotyped using a direct sequencing method. Haplotype analyses were performed with UNPHASED software and linkage disequilibrium (LD) was assessed by Haploview software. There were no associations between Leu432Val (rs1056836), Asp449Asp (rs1056837) and Asn453Ser (rs1800440) polymorphisms of the CYP1B1 gene and UL. Although the genotypic frequencies of the Arg368His (rs79204362) polymorphism did not differ between the two groups, the frequency of A (His) allele was significantly higher in UL females (P=0.02). In addition, the frequency of GTAA haplotype was significantly higher in the controls and played a protective role in UL susceptibility. A strong LD between the three common SNPs (rs1056836, rs1056837 and rs1800440) in the CYP1B1 gene was observed in the population. In conclusion, a higher frequency of the CYP1B1 368His (A) allele was observed in UL females. The frequency of the GTAA haplotype was significantly higher in healthy females and this haplotype played a protective role in UL susceptibility. PMID:26075073

  2. TNF-alpha SNP haplotype frequencies in equidae.

    PubMed

    Brown, J J; Ollier, W E R; Thomson, W; Matthews, J B; Carter, S D; Binns, M; Pinchbeck, G; Clegg, P D

    2006-05-01

    Tumour necrosis factor alpha (TNF-alpha) is a pro-inflammatory cytokine that plays a crucial role in the regulation of inflammatory and immune responses. In all vertebrate species the genes encoding TNF-alpha are located within the major histocompatability complex. In the horse TNF-alpha has been ascribed a role in a variety of important disease processes. Previously two single nucleotide polymorphisms (SNPs) have been reported within the 5' un-translated region of the equine TNF-alpha gene. We have examined the equine TNF-alpha promoter region further for additional SNPs by analysing DNA from 131 horses (Equus caballus), 19 donkeys (E. asinus), 2 Grant's zebras (E. burchellii boehmi) and one onager (E. hemionus). Two further SNPs were identified at nucleotide positions 24 (T/G) and 452 (T/C) relative to the first nucleotide of the 522 bp polymerase chain reaction product. A sequence variant at position 51 was observed between equidae. SNaPSHOT genotyping assays for these and the two previously reported SNPs were performed on 457 horses comprising seven different breeds and 23 donkeys to determine the gene frequencies. SNP frequencies varied considerably between different horse breeds and also between the equine species. In total, nine different TNF-alpha promoter SNP haplotypes and their frequencies were established amongst the various equidae examined, with some haplotypes being found only in horses and others only in donkeys or zebras. The haplotype frequencies observed varied greatly between different horse breeds. Such haplotypes may relate to levels of TNF-alpha production and disease susceptibility and further investigation is required to identify associations between particular haplotypes and altered risk of disease.

  3. Association analysis of calpain 10 gene variants/haplotypes with gestational diabetes mellitus among Mexican women.

    PubMed

    Castro-Martínez, Anna Gabriela; Sánchez-Corona, José; Vázquez-Vargas, Adriana Patricia; García-Zapién, Alejandra Guadalupe; López-Quintero, Andres; Villalpando-Velazco, Héctor Javier; Flores-Martínez, Silvia Esperanza

    2018-02-28

    Gestational diabetes mellitus (GDM) is a metabolically complex disease with major genetic determinants. GDM has been associated with insulin resistance and dysfunction of pancreatic beta cells, so the GDM candidate genes are those that encode proteins modulating the function and secretion of insulin, such as that for calpain 10 (CAPN10). This study aimed to assess whether single nucleotide polymorphism (SNP)-43, SNP-44, SNP-63, and the indel-19 variant, and specific haplotypes of the CAPN10 gene were associated with gestational diabetes mellitus. We studied 116 patients with gestational diabetes mellitus and 83 women with normal glucose tolerance. Measurements of anthropometric and biochemical parameters were performed. SNP-43, SNP-44, and SNP-63 were identified by polymerase chain reaction (PCR)-restriction fragment length polymorphisms, while the indel-19 variant was detected by TaqMan qPCR assays.  The allele, genotype, and haplotype frequencies of the four variants did not differ significantly between women with gestational diabetes mellitus and controls. However, in women with gestational diabetes mellitus, glucose levels were significantly higher bearing the 3R/3R genotype than in carriers of the 3R/2R genotype of the indel-19 variant (p = 0.006). In conclusion, the 3R/3R genotype of the indel-19 variant of the CAPN-10 gene influenced increased glucose levels in these Mexican women with gestational diabetes mellitus.

  4. Association of serotonin receptor 2a haplotypes with obsessive-compulsive disorder and its treatment response in Iranian patients: a genetic and pharmacogenetic study.

    PubMed

    Sina, Marzie; Ahmadiani, Abolhassan; Asadi, Sareh; Shams, Jamal

    2018-01-01

    Obsessive-compulsive disorder (OCD) is a debilitating psychiatric disorder causing intrusive thoughts or repetitive behaviors. Serotonin reuptake inhibitors are used for OCD treatment, but 40%-60% of patients do not respond to them adequately. In this study, the associations of serotonin receptor 2a polymorphisms rs6311 and rs6313 with OCD, its familial form and fluvoxamine treatment response in Iranian population were investigated. Association analyses were conducted in 293 OCD cases fulfilling the Diagnostic and Statistical Manual of Mental Disorders (DSM)-IV-TR and 245 controls. Pharmacotherapy was defined as 12 weeks of treatment with fluvoxamine (150-300 mg). Treatment response was considered as >25% reduction in Yale-Brown Obsessive Compulsive Scale score. Genotyping was performed by means of PCR-RFLP. The results showed no association of rs6311 or rs6313 with OCD, but their haplotypes had different distribution patterns in cases and controls. Moreover, rs6313 was associated with the familial form of OCD in females significantly ( P =0.005) under the recessive genetic model. Moreover, rs6311-rs6313 haplotypes were associated with fluvoxamine treatment response in OCD patients with more AC and less AT in responders. HTR2A haplotypes are associated with OCD and its treatment response with a fluvoxamine in Iranian patients. Furthermore, the observed association of rs6313 with the familial form of OCD in females suggests different genetic background of OCD familial and non-familial forms, which needs further investigation.

  5. Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.

    PubMed

    Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R

    2001-11-23

    Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.

  6. Impacts of TNF-LTA SNPs/Haplotypes and Lifestyle Factors on Oral Carcinoma in an Indian Population.

    PubMed

    Bandil, Kapil; Singhal, Pallavi; Sharma, Upma; Hussain, Showket; Basu, Surojit; Parashari, Aditya; Singh, Veena; Sehgal, Ashok; Shivam, Animesh; Ahuja, Puneet; Bharadwaj, Mausumi; Banerjee, Basu Dev; Mehrotra, Ravi

    2016-10-01

    To investigate a potential association between single-nucleotide polymorphisms (SNPs) and  haplotypes at the TNFA-LTA locus and the development of oral cancer in an Indian population. In this study, 150 oral precancer/cancer samples (50 precancer and 100 cancer), along with an equal number of control samples, were genotyped. Six SNPs at the TNF-LTA locus (i.e., -238G/A, -308G/A, -857C/T, -863C/A, -1031T/C, and +252A/G) were analyzed by use of a polymerase chain reaction-restriction fragment length polymorphism method, the assay was validated by sequencing 10 % of samples. The allelic frequencies of TNFA and LTA SNPs were found to be significantly associated with the risk of oral cancer and precancerous lesions in comparison with controls (P < 0.0003). Further haplotypic analysis showed that two haplotypes (ATCTGG and ACACGG) served as risk haplotypes for oral cancer. These haplotypes were also found to be significantly and positively associated with lifestyle habits (tobacco chewing P = 0.04, odds ratio [OR] 3.4) and socioeconomic status (P = 0.01, OR 3.4). We noticed an increased percentage of risk haplotypes correlating with the aggressiveness of oral cancer. The percentages of risk haplotypes were found to be threefold higher in precancer and fourfold higher in advanced stages of oral cancer in comparison with controls. Five SNPs at the TNF-LTA locus (i.e., -308G>A, -857C>T, -863C>A, -1031T>C, and +252A>G) were found to be associated with the development of oral cancer. Two haplotypes (ATCTGG and ACACGG) emerged as major risk haplotypes for oral carcinoma progression and were also found to be associated with lifestyle factors and clinical aggressiveness. These findings make the TNF-LTA locus a suitable candidate for a future biomarker, which may be used either for early detection or for helping to improve treatment efficacy and effectiveness.

  7. SNP analyses of growth factor genes EGF, TGF{beta}-1, and HGF reveal haplotypic association of EGF with autism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Toyoda, Takao; Thanseem, Ismail; Kawai, Masayoshi

    Autism is a pervasive neurodevelopmental disorder diagnosed in early childhood. Growth factors have been found to play a key role in the cellular differentiation and proliferation of the central and peripheral nervous systems. Epidermal growth factor (EGF) is detected in several regions of the developing and adult brain, where, it enhances the differentiation, maturation, and survival of a variety of neurons. Transforming growth factor-{beta} (TGF{beta}) isoforms play an important role in neuronal survival, and the hepatocyte growth factor (HGF) has been shown to exhibit neurotrophic activity. We examined the association of EGF, TGF{beta}1, and HGF genes with autism, in amore » trio association study, using DNA samples from families recruited to the Autism Genetic Resource Exchange; 252 trios with a male offspring scored for autism were selected for the study. Transmission disequilibrium test revealed significant haplotypic association of EGF with autism. No significant SNP or haplotypic associations were observed for TGF{beta}1 or HGF. Given the role of EGF in brain and neuronal development, we suggest a possible role of EGF in the pathogenesis of autism.« less

  8. Haplotype analysis of the apolipoprotein A5 gene in obese pediatric patients.

    PubMed

    Horvatovich, Katalin; Bokor, Szilvia; Baráth, Akos; Maász, Anita; Kisfali, Péter; Járomi, Luca; Polgár, Noémi; Tóth, Dénes; Répásy, Judit; Endreffy, Emoke; Molnár, Dénes; Melegh, Béla

    2011-06-01

    Apolipoprotein A5 (APOA5) gene variants have been shown to be associated with elevated TG levels; the T-1131C (rs662799) variant has been reported to confer risk for the metabolic syndrome in adult populations. Little is known about the APOA5 variants in pediatric population, no such information is available for pediatric obesity at all. Here we examined four haplotype-tagging polymorphisms (T-1131C, IVS3 + G476A [rs2072560], T1259C [rs2266788] and C56G [rs3135506]) and studied also the frequency of major naturally occurring haplotypes of APOA5 in obese children. The polymorphisms were analyzed in 232 obese children, and in 137 healthy, normal weight controls, using PCR-RFLP methods. In the pediatric patients we could confirm the already known adult subjects based association of -1131C, IVS3 + 476A and 1259C variants with elevated triglyceride concentrations, both in obese patients and in the controls. The prevalence of the APOA5*2 haplotype (containing the minor allele of T-1131C, IVS3 + G476A and T1259C SNPs together) was 15.5% in obese children, and 5.80% in the controls (p<0.001); multiple logistic regression analysis revealed that this haplotype confers susceptibility for development of obesity (OR=2.87; 95% CI: 1.29-6.37; p≤0.01). By contrast, the APOA5*4 haplotype (with -1131C alone) did not show similar associations. Our findings also suggest that the APOA5*5 haplotype (1259C alone) can be protective against obesity (OR=0.25; 95% CI: 0.07-0.80; p<0.05). While previous studies in adults demonstrated, that the APOA5 -1131C minor allele confers risk for adult metabolic syndrome, here we show, that the susceptibility nature of this SNP restricted to the APOA5*2 haplotype in pediatric obese subjects.

  9. Porcine NAMPT gene: search for polymorphism, mapping and association studies.

    PubMed

    Cepica, S; Bartenschlager, H; Ovilo, C; Zrůstová, J; Masopust, M; Fernández, A; López, A; Knoll, A; Rohrer, G A; Snelling, W M; Geldermann, H

    2010-12-01

    NAMPT encodes an enzyme catalysing the rate-limiting step in NAD biosynthesis. The extracellular form of the enzyme is known as adipokine visfatin. We detected SNP AM999341:g.669T>C (referred to as 669T>C) in intron 9 and SNP FN392209:g.358A>G (referred to as 358A>G) in the promoter of the gene. RH mapping linked the gene to microsatellite SW944. Linkage analysis placed the gene on the current USDA – USMARC linkage map at position 92 cM on SSC9. Association analyses were performed in a wild boar × Meishan F2 family (W × M), with 45 traits recorded (growth and fattening, fat deposition, muscling, meat quality, stress resistance and other traits), and in a commercial Landrace × Chinese-European (LCE) synthetic population with records for 15 traits (growth, fat deposition, muscling, intramuscular fat, meat colour and backfat fatty acid content). In the W × M, SNP 669T>C was associated with muscling, fat deposition, growth and fattening, meat quality and other traits and in the LCE with muscling, meat quality and backfat fatty acid composition. In the W × M, SNP 358A>G was associated with muscling, fat deposition, growth and other traits. After correction for multiple testing, the NAMPT haplotypes were associated in the W × M with, in descending order, muscling (q = 0.0056), growth (q = 0.0056), fat deposition (q = 0.0109), fat-to-meat ratio (q = 0.0135), cooling losses (q = 0.0568) and longissimus pHU (q = 0.0695). The SNPs are hypothesized to be in linkage disequilibrium with a causative mutation affecting energy metabolism as a whole rather than fat metabolism alone.

  10. Huntington disease in the South African population occurs on diverse and ethnically distinct genetic haplotypes

    PubMed Central

    Baine, Fiona K; Kay, Chris; Ketelaar, Maria E; Collins, Jennifer A; Semaka, Alicia; Doty, Crystal N; Krause, Amanda; Jacquie Greenberg, L; Hayden, Michael R

    2013-01-01

    Huntington disease (HD) is a neurodegenerative disorder resulting from the expansion of a CAG trinucleotide repeat in the huntingtin (HTT) gene. Worldwide prevalence varies geographically with the highest figures reported in populations of European ancestry. HD in South Africa has been reported in Caucasian, black and mixed subpopulations, with similar estimated prevalence in the Caucasian and mixed groups and a lower estimate in the black subpopulation. Recent studies have associated specific HTT haplotypes with HD in distinct populations. Expanded HD alleles in Europe occur predominantly on haplogroup A (specifically high-risk variants A1/A2), whereas in East Asian populations, HD alleles are associated with haplogroup C. Whether specific HTT haplotypes associate with HD in black Africans and how these compare with haplotypes found in European and East Asian populations remains unknown. The current study genotyped the HTT region in unaffected individuals and HD patients from each of the South African subpopulations, and haplotypes were constructed. CAG repeat sizes were determined and phased to haplotype. Results indicate that HD alleles from Caucasian and mixed patients are predominantly associated with haplogroup A, signifying a similar European origin for HD. However, in black patients, HD occurs predominantly on haplogroup B, suggesting several distinct origins of the mutation in South Africa. The absence of high-risk variants (A1/A2) in the black subpopulation may also explain the reported low prevalence of HD. Identification of haplotypes associated with HD-expanded alleles is particularly relevant to the development of population-specific therapeutic targets for selective suppression of the expanded HTT transcript. PMID:23463025

  11. Evidence of triple mutant Pfdhps ISGNGA haplotype in Plasmodium falciparum isolates from North-east India: An analysis of sulfadoxine resistant haplotype selection.

    PubMed

    Das, Manuj K; Chetry, Sumi; Kalita, Mohan C; Dutta, Prafulla

    2016-12-01

    North-east region of India has consistent role in the spread of multi drug resistant Plasmodium (P.) falciparum to other parts of Southeast Asia. After rapid clinical treatment failure of Artemisinin based combination therapy-Sulphadoxine/Pyrimethamine (ACT-SP) chemoprophylaxis, Artemether-Lumefantrine (ACT-AL) combination therapy was introduced in the year 2012 in this region for the treatment of uncomplicated P. falciparum malaria. In a DNA sequencing based polymorphism analysis, seven codons of P. falciparum dihydropteroate synthetase ( Pf dhps) gene were screened in a total of 127 P. falciparum isolates collected from Assam, Arunachal Pradesh and Tripura of North-east India during the year 2014 and 2015 to document current sulfadoxine resistant haplotypes. Sequences were analyzed to rearrange both nucleotide and protein haplotypes. Molecular diversity indices were analyzed in DNA Sequence Polymorphism software (DnaSP) on the basis of Pf dhps gene sequences. Disappearance from selective neutrality was assessed based on the ratio of non-synonomous to synonomous nucleotide substitutions [dN/dS ratio]. Moreover, two-tailed Z test was performed in search of the significance for probability of rejecting null hypothesis of strict neutrality [dN = dS]. Presence of mutant P. falciparum multidrug resistance protein1 ( Pf mdr1) was also checked in those isolates that were present with new Pf dhps haplotypes. Phylogenetic relationship based on Pf dhps gene was reconstructed in Molecular Evolutionary Genetics Analysis (MEGA). Among eight different sulfadoxine resistant haplotypes found, IS GNG A haplotype was documented in a total of five isolates from Tripura with association of a new mutant M538 R allele. Sequence analysis of Pf mdr1 gene in these five isolates came to notice that not all but only one isolate was mutant at codon 86 (N86 Y ; Y YSND) in the multidrug resistance protein. Molecular diversity based on Pf dhps haplotypes revealed that P. falciparum

  12. PWHATSHAP: efficient haplotyping for future generation sequencing.

    PubMed

    Bracciali, Andrea; Aldinucci, Marco; Patterson, Murray; Marschall, Tobias; Pisanti, Nadia; Merelli, Ivan; Torquati, Massimo

    2016-09-22

    Haplotype phasing is an important problem in the analysis of genomics information. Given a set of DNA fragments of an individual, it consists of determining which one of the possible alleles (alternative forms of a gene) each fragment comes from. Haplotype information is relevant to gene regulation, epigenetics, genome-wide association studies, evolutionary and population studies, and the study of mutations. Haplotyping is currently addressed as an optimisation problem aiming at solutions that minimise, for instance, error correction costs, where costs are a measure of the confidence in the accuracy of the information acquired from DNA sequencing. Solutions have typically an exponential computational complexity. WHATSHAP is a recent optimal approach which moves computational complexity from DNA fragment length to fragment overlap, i.e., coverage, and is hence of particular interest when considering sequencing technology's current trends that are producing longer fragments. Given the potential relevance of efficient haplotyping in several analysis pipelines, we have designed and engineered PWHATSHAP, a parallel, high-performance version of WHATSHAP. PWHATSHAP is embedded in a toolkit developed in Python and supports genomics datasets in standard file formats. Building on WHATSHAP, PWHATSHAP exhibits the same complexity exploring a number of possible solutions which is exponential in the coverage of the dataset. The parallel implementation on multi-core architectures allows for a relevant reduction of the execution time for haplotyping, while the provided results enjoy the same high accuracy as that provided by WHATSHAP, which increases with coverage. Due to its structure and management of the large datasets, the parallelisation of WHATSHAP posed demanding technical challenges, which have been addressed exploiting a high-level parallel programming framework. The result, PWHATSHAP, is a freely available toolkit that improves the efficiency of the analysis of genomics

  13. C-reactive protein haplotype is associated with high PSA as a marker of metastatic prostate cancer but not with overall cancer risk

    PubMed Central

    Eklund, C M; Tammela, T L J; Schleutker, J; Hurme, M

    2009-01-01

    Growing evidence points to a role for inflammation in prostate carcinogenesis. The significance of C-reactive protein (CRP), an inflammatory and innate immunity molecule, has not been evaluated thoroughly in prostate cancer (PC). In this study of 739 Finnish patients with PC and 760 healthy men, we evaluated the associations of CRP genotypes and haplotypes with total PC risk and PC progression, using prostate-specific antigen (PSA) as a marker of metastatic disease. Although the haplotype frequencies were similar in patients and controls, an association between haplotype ACCCA and patients' PSA levels was found. The carriers more often had a high PSA than non-carriers (P=0.0002) and the SNP rs2794521 A-allele and rs1800947 C-allele carriers had a higher PSA than non-carriers (P=0.009 and P=0.0004, respectively). A trend for a younger age at diagnosis was found among the carriers of ACCCA (P=0.07) and the rs1800947 C-allele (P=0.06), as well as a trend for the latter to have more likely metastases (P=0.06), but not after Bonferroni correction (α=0.00208). This is the first study to suggest association between PSA and CRP variants in PC and, therefore, further studies are warranted. CRP alleles previously found to protect against increased CRP levels are now suggested to be associated with metastatic PC, indicated by elevated PSA. PMID:19436291

  14. A functional haplotype of UBE2L3 confers risk for Systemic Lupus Erythematosus

    PubMed Central

    Wang, Shaofeng; Adrianto, Indra; Wiley, Graham B.; Lessard, Christopher J.; Kelly, Jennifer A.; Adler, Adam J.; Glenn, Stuart B.; Williams, Adrienne H.; Ziegler, Julie T.; Comeau, Mary E.; Marion, Miranda C.; Wakeland, Benjamin E.; Liang, Chaoying; Kaufman, Kenneth M.; Guthridge, Joel M.; Alarcón-Riquelme, Marta E.; Alarcón, Graciela S.; Anaya, Juan-Manuel; Bae, Sang-Cheol; Kim, Jae-Hoon; Joo, Young Bin; Boackle, Susan A.; Brown, Elizabeth E.; Petri, Michelle A.; Ramsey-Goldman, Rosalind; Reveille, John D.; Vilá, Luis M.; Criswell, Lindsey A.; Edberg, Jeffrey C.; Freedman, Barry I.; Gilkeson, Gary S.; Jacob, Chaim O.; James, Judith A.; Kamen, Diane L.; Kimberly, Robert P.; Martin, Javier; Merrill, Joan T.; Niewold, Timothy B.; Pons-Estel, Bernardo A.; Scofield, R. Hal; Stevens, Anne M.; Tsao, Betty P.; Vyse, Timothy J.; Langefeld, Carl D.; Harley, John B.; Wakeland, Edward K.; Moser, Kathy L.; Montgomery, Courtney G.; Gaffney, Patrick M.

    2012-01-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical manifestations characterized by the development of pathogenic autoantibodies manifesting in inflammation of target organs such as the kidneys, skin and joints. Genome-wide association studies have identified genetic variants in the UBE2L3 region that are associated with SLE in subjects of European and Asian ancestry. UBE2L3 encodes an ubiquitin-conjugating enzyme, UBCH7, involved in cell proliferation and immune function. In this study, we sought to further characterize the genetic association in the region of UBE2L3 and use molecular methods to determine the functional effect of the risk haplotype. We identified significant associations between variants in the region of UBE2L3 and SLE in individuals of European and Asian ancestry that exceeded a Bonferroni corrected threshold (P < 1 × 10−4). A single risk haplotype was observed in all associated populations. Individuals harboring the risk haplotype display a significant increase in both UBE2L3 mRNA expression (P = 0.0004) and UBCH7 protein expression (P = 0.0068). The results suggest that variants carried on the SLE associated UBE2L3 risk haplotype influence autoimmunity by modulating UBCH7 expression. PMID:22476155

  15. Association of serotonin receptor 2a haplotypes with obsessive–compulsive disorder and its treatment response in Iranian patients: a genetic and pharmacogenetic study

    PubMed Central

    Sina, Marzie; Ahmadiani, Abolhassan; Asadi, Sareh; Shams, Jamal

    2018-01-01

    Introduction Obsessive–compulsive disorder (OCD) is a debilitating psychiatric disorder causing intrusive thoughts or repetitive behaviors. Serotonin reuptake inhibitors are used for OCD treatment, but 40%–60% of patients do not respond to them adequately. In this study, the associations of serotonin receptor 2a polymorphisms rs6311 and rs6313 with OCD, its familial form and fluvoxamine treatment response in Iranian population were investigated. Patients and methods Association analyses were conducted in 293 OCD cases fulfilling the Diagnostic and Statistical Manual of Mental Disorders (DSM)-IV-TR and 245 controls. Pharmacotherapy was defined as 12 weeks of treatment with fluvoxamine (150–300 mg). Treatment response was considered as >25% reduction in Yale–Brown Obsessive Compulsive Scale score. Genotyping was performed by means of PCR-RFLP. Results The results showed no association of rs6311 or rs6313 with OCD, but their haplotypes had different distribution patterns in cases and controls. Moreover, rs6313 was associated with the familial form of OCD in females significantly (P=0.005) under the recessive genetic model. Moreover, rs6311–rs6313 haplotypes were associated with fluvoxamine treatment response in OCD patients with more AC and less AT in responders. Conclusion HTR2A haplotypes are associated with OCD and its treatment response with a fluvoxamine in Iranian patients. Furthermore, the observed association of rs6313 with the familial form of OCD in females suggests different genetic background of OCD familial and non-familial forms, which needs further investigation. PMID:29785111

  16. Detection of haplotypes associated with prenatal death in dairy cattle and identification of deleterious mutations in GART, SHBG and SLC37A2.

    PubMed

    Fritz, Sébastien; Capitan, Aurelien; Djari, Anis; Rodriguez, Sabrina C; Barbat, Anne; Baur, Aurélia; Grohs, Cécile; Weiss, Bernard; Boussaha, Mekki; Esquerré, Diane; Klopp, Christophe; Rocha, Dominique; Boichard, Didier

    2013-01-01

    The regular decrease of female fertility over time is a major concern in modern dairy cattle industry. Only half of this decrease is explained by indirect response to selection on milk production, suggesting the existence of other factors such as embryonic lethal genetic defects. Genomic regions harboring recessive deleterious mutations were detected in three dairy cattle breeds by identifying frequent haplotypes (>1%) showing a deficit in homozygotes among Illumina Bovine 50k Beadchip haplotyping data from the French genomic selection database (47,878 Holstein, 16,833 Montbéliarde, and 11,466 Normande animals). Thirty-four candidate haplotypes (p<10(-4)) including previously reported regions associated with Brachyspina, CVM, HH1, and HH3 in Holstein breed were identified. Haplotype length varied from 1 to 4.8 Mb and frequencies from 1.7 up to 9%. A significant negative effect on calving rate, consistent in heifers and in lactating cows, was observed for 9 of these haplotypes in matings between carrier bulls and daughters of carrier sires, confirming their association with embryonic lethal mutations. Eight regions were further investigated using whole genome sequencing data from heterozygous bull carriers and control animals (45 animals in total). Six strong candidate causative mutations including polymorphisms previously reported in FANCI (Brachyspina), SLC35A3 (CVM), APAF1 (HH1) and three novel mutations with very damaging effect on the protein structure, according to SIFT and Polyphen-2, were detected in GART, SHBG and SLC37A2 genes. In conclusion, this study reveals a yet hidden consequence of the important inbreeding rate observed in intensively selected and specialized cattle breeds. Counter-selection of these mutations and management of matings will have positive consequences on female fertility in dairy cattle.

  17. Detection of Haplotypes Associated with Prenatal Death in Dairy Cattle and Identification of Deleterious Mutations in GART, SHBG and SLC37A2

    PubMed Central

    Fritz, Sébastien; Capitan, Aurelien; Djari, Anis; Rodriguez, Sabrina C.; Barbat, Anne; Baur, Aurélia; Grohs, Cécile; Weiss, Bernard; Boussaha, Mekki; Esquerré, Diane; Klopp, Christophe; Rocha, Dominique; Boichard, Didier

    2013-01-01

    The regular decrease of female fertility over time is a major concern in modern dairy cattle industry. Only half of this decrease is explained by indirect response to selection on milk production, suggesting the existence of other factors such as embryonic lethal genetic defects. Genomic regions harboring recessive deleterious mutations were detected in three dairy cattle breeds by identifying frequent haplotypes (>1%) showing a deficit in homozygotes among Illumina Bovine 50k Beadchip haplotyping data from the French genomic selection database (47,878 Holstein, 16,833 Montbéliarde, and 11,466 Normande animals). Thirty-four candidate haplotypes (p<10−4) including previously reported regions associated with Brachyspina, CVM, HH1, and HH3 in Holstein breed were identified. Haplotype length varied from 1 to 4.8 Mb and frequencies from 1.7 up to 9%. A significant negative effect on calving rate, consistent in heifers and in lactating cows, was observed for 9 of these haplotypes in matings between carrier bulls and daughters of carrier sires, confirming their association with embryonic lethal mutations. Eight regions were further investigated using whole genome sequencing data from heterozygous bull carriers and control animals (45 animals in total). Six strong candidate causative mutations including polymorphisms previously reported in FANCI (Brachyspina), SLC35A3 (CVM), APAF1 (HH1) and three novel mutations with very damaging effect on the protein structure, according to SIFT and Polyphen-2, were detected in GART, SHBG and SLC37A2 genes. In conclusion, this study reveals a yet hidden consequence of the important inbreeding rate observed in intensively selected and specialized cattle breeds. Counter-selection of these mutations and management of matings will have positive consequences on female fertility in dairy cattle. PMID:23762392

  18. LDlink: a web-based application for exploring population-specific haplotype structure and linking correlated alleles of possible functional variants.

    PubMed

    Machiela, Mitchell J; Chanock, Stephen J

    2015-11-01

    Assessing linkage disequilibrium (LD) across ancestral populations is a powerful approach for investigating population-specific genetic structure as well as functionally mapping regions of disease susceptibility. Here, we present LDlink, a web-based collection of bioinformatic modules that query single nucleotide polymorphisms (SNPs) in population groups of interest to generate haplotype tables and interactive plots. Modules are designed with an emphasis on ease of use, query flexibility, and interactive visualization of results. Phase 3 haplotype data from the 1000 Genomes Project are referenced for calculating pairwise metrics of LD, searching for proxies in high LD, and enumerating all observed haplotypes. LDlink is tailored for investigators interested in mapping common and uncommon disease susceptibility loci by focusing on output linking correlated alleles and highlighting putative functional variants. LDlink is a free and publically available web tool which can be accessed at http://analysistools.nci.nih.gov/LDlink/. mitchell.machiela@nih.gov. Published by Oxford University Press 2015. This work is written by US Government employees and is in the public domain in the US.

  19. Polymorphism at Expressed DQ and DR Loci in Five Common Equine MHC Haplotypes

    PubMed Central

    Miller, Donald; Tallmadge, Rebecca L.; Binns, Matthew; Zhu, Baoli; Mohamoud, Yasmin Ali; Ahmed, Ayeda; Brooks, Samantha A.; Antczak, Douglas F.

    2016-01-01

    The polymorphism of Major Histocompatibility Complex (MHC) class II DQ and DR genes in five common Equine Leukocyte Antigen (ELA) haplotypes was determined through sequencing of mRNA transcripts isolated from lymphocytes of eight ELA homozygous horses. Ten expressed MHC class II genes were detected in horses of the ELA-A3 haplotype carried by the donor horses of the equine Bacterial Artificial Chromosome (BAC) library and the reference genome sequence: four DR genes and six DQ genes. The other four ELA haplotypes contained at least eight expressed polymorphic MHC class II loci. Next Generation Sequencing (NGS) of genomic DNA of these four MHC haplotypes revealed stop codons in the DQA3 gene in the ELA-A2, ELA-A5, and ELA-A9 haplotypes. Few NGS reads were obtained for the other MHC class II genes that were not amplified in these horses. The amino acid sequences across haplotypes contained locus-specific residues, and the locus clusters produced by phylogenetic analysis were well supported. The MHC class II alleles within the five tested haplotypes were largely non-overlapping between haplotypes. The complement of equine MHC class II DQ and DR genes appears to be well conserved between haplotypes, in contrast to the recently described variation in class I gene loci between equine MHC haplotypes. The identification of allelic series of equine MHC class II loci will aid comparative studies of mammalian MHC conservation and evolution and may also help to interpret associations between the equine MHC class II region and diseases of the horse. PMID:27889800

  20. Geographic distribution of haplotype diversity at the bovine casein locus

    PubMed Central

    Jann, Oliver C; Ibeagha-Awemu, Eveline M; Özbeyaz, Ceyhan; Zaragoza, Pilar; Williams, John L; Ajmone-Marsan, Paolo; Lenstra, Johannes A; Moazami-Goudarzi, Katy; Erhardt, Georg

    2004-01-01

    The genetic diversity of the casein locus in cattle was studied on the basis of haplotype analysis. Consideration of recently described genetic variants of the casein genes which to date have not been the subject of diversity studies, allowed the identification of new haplotypes. Genotyping of 30 cattle breeds from four continents revealed a geographically associated distribution of haplotypes, mainly defined by frequencies of alleles at CSN1S1 and CSN3. The genetic diversity within taurine breeds in Europe was found to decrease significantly from the south to the north and from the east to the west. Such geographic patterns of cattle genetic variation at the casein locus may be a result of the domestication process of modern cattle as well as geographically differentiated natural or artificial selection. The comparison of African Bos taurus and Bos indicus breeds allowed the identification of several Bos indicus specific haplotypes (CSN1S1*C-CSN2*A2-CSN3*AI/CSN3*H) that are not found in pure taurine breeds. The occurrence of such haplotypes in southern European breeds also suggests that an introgression of indicine genes into taurine breeds could have contributed to the distribution of the genetic variation observed. PMID:15040901

  1. Effects of IL-10 haplotype and atomic bomb radiation exposure on gastric cancer risk.

    PubMed

    Hayashi, Tomonori; Ito, Reiko; Cologne, John; Maki, Mayumi; Morishita, Yukari; Nagamura, Hiroko; Sasaki, Keiko; Hayashi, Ikue; Imai, Kazue; Yoshida, Kengo; Kajimura, Junko; Kyoizumi, Seishi; Kusunoki, Yoichiro; Ohishi, Waka; Fujiwara, Saeko; Akahoshi, Masazumi; Nakachi, Kei

    2013-07-01

    Gastric cancer (GC) is one of the cancers that reveal increased risk of mortality and incidence in atomic bomb survivors. The incidence of gastric cancer in the Life Span Study cohort of the Radiation Effects Research Foundation (RERF) increased with radiation dose (gender-averaged excess relative risk per Gy = 0.28) and remains high more than 65 years after exposure. To assess a possible role of gene-environment interaction, we examined the dose response for gastric cancer incidence based on immunosuppression-related IL-10 genotype, in a cohort study with 200 cancer cases (93 intestinal, 96 diffuse and 11 other types) among 4,690 atomic bomb survivors participating in an immunological substudy. Using a single haplotype block composed of four haplotype-tagging SNPs (comprising the major haplotype allele IL-10-ATTA and the minor haplotype allele IL-10-GGCG, which are categorized by IL-10 polymorphisms at -819A>G and -592T>G, +1177T>C and +1589A>G), multiplicative and additive models for joint effects of radiation and this IL-10 haplotyping were examined. The IL-10 minor haplotype allele(s) was a risk factor for intestinal type gastric cancer but not for diffuse type gastric cancer. Radiation was not associated with intestinal type gastric cancer. In diffuse type gastric cancer, the haplotype-specific excess relative risk (ERR) for radiation was statistically significant only in the major homozygote category of IL-10 (ERR = 0.46/Gy, P = 0.037), whereas estimated ERR for radiation with the minor IL-10 homozygotes was close to 0 and nonsignificant. Thus, the minor IL-10 haplotype might act to reduce the radiation related risk of diffuse-type gastric cancer. The results suggest that this IL-10 haplotyping might be involved in development of radiation-associated gastric cancer of the diffuse type, and that IL-10 haplotypes may explain individual differences in the radiation-related risk of gastric cancer. © 2013 by Radiation Research Society

  2. Ancient mitochondrial haplotypes and evidence for intragenic recombination in a gynodioecious plant.

    PubMed

    Städler, Thomas; Delph, Lynda F

    2002-09-03

    Because of their extremely low nucleotide mutation rates, plant mitochondrial genes are generally not expected to show variation within species. Remarkably, we found nine distinct cytochrome b sequence haplotypes in the gynodioecious alpine plant Silene acaulis, with two or more haplotypes coexisting locally in each of three sampled regions. Moreover, there is evidence for intragenic recombination in the history of the haplotype sample, implying at least transient heteroplasmy of mitochondrial DNA (mtDNA). Heteroplasmy might be achieved by one of two potential mechanisms, either continuous coexistence of subgenomic fragments in low stoichiometry, or occasional paternal leakage of mtDNA. On the basis of levels of synonymous nucleotide substitutions, the average divergence time between haplotypes is estimated to be at least 15 million years. Ancient coalescence of extant haplotypes is further indicated by the paucity of fixed differences in haplotypes obtained from related species, a pattern expected under trans-specific evolution. Our data are consistent with models of frequency-dependent selection on linked cytoplasmic male-sterility factors, the putative molecular basis of females in gynodioecious populations. However, associations between marker loci and the inferred male-sterility genes can be maintained only with very low rates of recombination. Heteroplasmy and recombination between divergent haplotypes imply unexplored consequences for the evolutionary dynamics of gynodioecy, a widespread plant breeding system.

  3. Single nucleotide polymorphism and haplotype effects associated with somatic cell score in German Holstein cattle

    PubMed Central

    2014-01-01

    Background To better understand the genetic determination of udder health, we performed a genome-wide association study (GWAS) on a population of 2354 German Holstein bulls for which daughter yield deviations (DYD) for somatic cell score (SCS) were available. For this study, we used genetic information of 44 576 informative single nucleotide polymorphisms (SNPs) and 11 725 inferred haplotype blocks. Results When accounting for the sub-structure of the analyzed population, 16 SNPs and 10 haplotypes in six genomic regions were significant at the Bonferroni threshold of P ≤ 1.14 × 10-6. The size of the identified regions ranged from 0.05 to 5.62 Mb. Genomic regions on chromosomes 5, 6, 18 and 19 coincided with known QTL affecting SCS, while additional genomic regions were found on chromosomes 13 and X. Of particular interest is the region on chromosome 6 between 85 and 88 Mb, where QTL for mastitis traits and significant SNPs for SCS in different Holstein populations coincide with our results. In all identified regions, except for the region on chromosome X, significant SNPs were present in significant haplotypes. The minor alleles of identified SNPs on chromosomes 18 and 19, and the major alleles of SNPs on chromosomes 6 and X were favorable for a lower SCS. Differences in somatic cell count (SCC) between alternative SNP alleles reached 14 000 cells/mL. Conclusions The results support the polygenic nature of the genetic determination of SCS, confirm the importance of previously reported QTL, and provide evidence for the segregation of additional QTL for SCS in Holstein cattle. The small size of the regions identified here will facilitate the search for causal genetic variations that affect gene functions. PMID:24898131

  4. Conserved extended haplotypes discriminate HLA-DR3-homozygous Basque patients with type 1 diabetes mellitus and celiac disease.

    PubMed

    Bilbao, J R; Calvo, B; Aransay, A M; Martin-Pagola, A; Perez de Nanclares, G; Aly, T A; Rica, I; Vitoria, J C; Gaztambide, S; Noble, J; Fain, P R; Awdeh, Z L; Alper, C A; Castaño, L

    2006-10-01

    The major susceptibility locus for type 1 diabetes mellitus (T1D) maps to the human lymphocyte antigen (HLA) class II region in the major histocompatibility complex on chromosome 6p21. In southern European populations, like the Basques, the greatest risk to T1D is associated with DR3 homo- and heterozygosity and is comparable to that of DR3/DR4, the highest risk genotype in northern European populations. Celiac disease (CD) is another DR3-associated autoimmune disorder showing certain overlap with T1D that has been explained by the involvement of common genetic determinants, a situation more frequent in DR3-rich populations, like the Basques. As both T1D- and CD-associated HLA alleles are part of conserved extended haplotypes (CEH), we compared DR3-homozygous T1D and CD patients to determine whether CEHs were equally distributed between both disorders or there was a differential contribution of different haplotypes. We observed a very pronounced distribution bias (P<10(-5)) of the two major DR3 CEHs, with DR3-B18 predominating in T1D and DR3-B8 in CD. Additionally, high-density single nucleotide polymorphism (SNP) analysis of the complete CEH [A*30-B*18-MICA*4-F1C30-DRB1*0301-DQB1*0201-DPB1*0202] revealed extraordinary conservation throughout the 4.9 Mbp analyzed supporting the existence of additional diabetogenic variants (other than HLA-DRB1*0301-DQB1*0201), conserved within the DR3-B18 CEH (but not in other DR3 haplotypes) that could explain its enhanced diabetogenicity.

  5. Strong association between a splice mutation (IVS12+5G{r_arrow}A) and haplotype 6 in hereditary tyrosinemia type I

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanguay, R.M.; St-Louis, M.; Gibson, K.

    1994-09-01

    Hereditary tyrosinemia type I (HT I; McKusick 276700) is a severe inborn error of tyrosine catabolism pathway caused by a deficiency of fumarylacetoacetate hydrolase (FAH). The highest frequency reported is the one in Saguenay-Lac St-Jean (Quebec, Canada) where 1:1,846 births are affected. The FAH gene has been cloned and several mutations have been described. Allele specific oligonucleotide (ASO) hybridization was used to examine the frequency of a splice (IVS12-5G{r_arrow}A) mutation recently reported and RFLP analysis was done to identify haplotypes related to HT I. The splice mutation was found on 45/50 alleles (90%) in patients from SLSJ and 12/66 (18%)more » alleles from patients world-wide. All 25 patients from the SLSJ region were positive with 20 being homozygous, indicating that this mutation is the major cause of HT I in French Canada. Of these 25 patients, 96% were positive for one haplotype called no 6 which is these 25 patients, 96% were positive for one haplotype called no 6 which is identified by TaqI, RsaI, BglII, MspI and KpnI digestions. These data show a really strong association between the mutation (IVS12+5G{r_arrow}A) and haplotype 6. Among our patients from around the world, {approximately}52% were positive for haplotype 6 indicating its strong relation with HT I. These results provide the rationale for DNA-based carrier testing for HT I in the F-C population at risk as well as in HT I patients in general.« less

  6. Detecting structure of haplotypes and local ancestry

    USDA-ARS?s Scientific Manuscript database

    We present a two-layer hidden Markov model to detect the structure of haplotypes for unrelated individuals. This allows us to model two scales of linkage disequilibrium (one within a group of haplotypes and one between groups), thereby taking advantage of rich haplotype information to infer local an...

  7. Extended Islands of Tractability for Parsimony Haplotyping

    NASA Astrophysics Data System (ADS)

    Fleischer, Rudolf; Guo, Jiong; Niedermeier, Rolf; Uhlmann, Johannes; Wang, Yihui; Weller, Mathias; Wu, Xi

    Parsimony haplotyping is the problem of finding a smallest size set of haplotypes that can explain a given set of genotypes. The problem is NP-hard, and many heuristic and approximation algorithms as well as polynomial-time solvable special cases have been discovered. We propose improved fixed-parameter tractability results with respect to the parameter "size of the target haplotype set" k by presenting an O *(k 4k )-time algorithm. This also applies to the practically important constrained case, where we can only use haplotypes from a given set. Furthermore, we show that the problem becomes polynomial-time solvable if the given set of genotypes is complete, i.e., contains all possible genotypes that can be explained by the set of haplotypes.

  8. Comparative sequence analysis of the potato cyst nematode resistance locus H1 reveals a major lack of co-linearity between three haplotypes in potato (Solanum tuberosum ssp.).

    PubMed

    Finkers-Tomczak, Anna; Bakker, Erin; de Boer, Jan; van der Vossen, Edwin; Achenbach, Ute; Golas, Tomasz; Suryaningrat, Suwardi; Smant, Geert; Bakker, Jaap; Goverse, Aska

    2011-02-01

    The H1 locus confers resistance to the potato cyst nematode Globodera rostochiensis pathotypes 1 and 4. It is positioned at the distal end of chromosome V of the diploid Solanum tuberosum genotype SH83-92-488 (SH) on an introgression segment derived from S. tuberosum ssp. andigena. Markers from a high-resolution genetic map of the H1 locus (Bakker et al. in Theor Appl Genet 109:146-152, 2004) were used to screen a BAC library to construct a physical map covering a 341-kb region of the resistant haplotype coming from SH. For comparison, physical maps were also generated of the two haplotypes from the diploid susceptible genotype RH89-039-16 (S. tuberosum ssp. tuberosum/S. phureja), spanning syntenic regions of 700 and 319 kb. Gene predictions on the genomic segments resulted in the identification of a large cluster consisting of variable numbers of the CC-NB-LRR type of R genes for each haplotype. Furthermore, the regions were interspersed with numerous transposable elements and genes coding for an extensin-like protein and an amino acid transporter. Comparative analysis revealed a major lack of gene order conservation in the sequences of the three closely related haplotypes. Our data provide insight in the evolutionary mechanisms shaping the H1 locus and will facilitate the map-based cloning of the H1 resistance gene.

  9. Differential distribution of Y-chromosome haplotypes in Swiss and Southern European goat breeds.

    PubMed

    Vidal, Oriol; Drögemüller, Cord; Obexer-Ruff, Gabriela; Reber, Irene; Jordana, Jordi; Martínez, Amparo; Bâlteanu, Valentin Adrian; Delgado, Juan Vicente; Eghbalsaied, Shahin; Landi, Vincenzo; Goyache, Felix; Traoré, Amadou; Pazzola, Michele; Vacca, Giuseppe Massimo; Badaoui, Bouabid; Pilla, Fabio; D'Andrea, Mariasilvia; Álvarez, Isabel; Capote, Juan; Sharaf, Abdoallah; Pons, Àgueda; Amills, Marcel

    2017-11-23

    The analysis of Y-chromosome variation has provided valuable clues about the paternal history of domestic animal populations. The main goal of the current work was to characterize Y-chromosome diversity in 31 goat populations from Central Eastern (Switzerland and Romania) and Southern Europe (Spain and Italy) as well as in reference populations from Africa and the Near East. Towards this end, we have genotyped seven single nucleotide polymorphisms (SNPs), mapping to the SRY, ZFY, AMELY and DDX3Y Y-linked loci, in 275 bucks from 31 populations. We have observed a low level of variability in the goat Y-chromosome, with just five haplotypes segregating in the whole set of populations. We have also found that Swiss bucks carry exclusively Y1 haplotypes (Y1A: 24%, Y1B1: 15%, Y1B2: 43% and Y1C: 18%), while in Italian and Spanish bucks Y2A is the most abundant haplotype (77%). Interestingly, in Carpathian goats from Romania the Y2A haplotype is also frequent (42%). The high Y-chromosome differentiation between Swiss and Italian/Spanish breeds might be due to the post-domestication spread of two different Near Eastern genetic stocks through the Danubian and Mediterranean corridors. Historical gene flow between Southern European and Northern African goats might have also contributed to generate such pattern of genetic differentiation.

  10. Association of human leukocyte antigen class II allele and haplotypes in chikungunya viral infection in a western Indian population.

    PubMed

    Thanapati, Subrat; Hande, Aparna; Das, Rumki; Gurav, Yogesh; Tripathy, Anuradha S

    2014-05-01

    Genes coding for human leukocyte antigen (HLA) class II molecules are polymorphic and have been shown to influence susceptibility to viral diseases. One hundred patients with acute chikungunya with and without viral load and 250 chikungunya negative controls from western India were studied for the distribution of HLA class II alleles by PCR with sequence-specific primer (SSP) method. Frequency of DRB1*11 allele group (patients vs controls: p=0.002, Pc=0.036, OR=0.21) and haplotype DRB1*11/DQB1*03 (patients vs controls: p=0.007, OR=0.15) were significantly low, while haplotype DRB1*04/DQB1*03 (patients vs controls: p=0.042, OR=1.94) was significantly high in the patient population. HLA DQB1*04 allele was found only in the patient group with viral load (n=17), suggesting possible involvement of the same with chikungunya virus (CHIKV) replication. Association of HLA-DRB1*11 and the emergence of DRB1*11/DQB1*03 & DRB1*04/DQB1*03 as resistant and susceptible haplotypes towards CHIKV infection is being reported for the first time. Our results suggest that genetic susceptibility and/or resistance to chikungunya infection may be modulated by HLA class II alleles.

  11. SLC22A1-ABCB1 haplotype profiles predict imatinib pharmacokinetics in Asian patients with chronic myeloid leukemia.

    PubMed

    Singh, Onkar; Chan, Jason Yongsheng; Lin, Keegan; Heng, Charles Chuah Thuan; Chowbay, Balram

    2012-01-01

    This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM) pharmacokinetics in Asian patients with chronic myeloid leukemia (CML). Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each) and CML patients (n = 38) were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h)) and clearance (CL) were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM) to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T), to be significantly associated with IM clearance (p = 0.013). Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2) L/hr/mg): CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h) than patients carrying 0 or 1 copy [CL (10(-2) L/hr/mg): 2.19 vs 3.29, p = 0.026; C(0h) (10(-6) 1/ml): 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h) (p = 0.002 and 0.009, respectively). This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.

  12. Modeling coverage gaps in haplotype frequencies via Bayesian inference to improve stem cell donor selection.

    PubMed

    Louzoun, Yoram; Alter, Idan; Gragert, Loren; Albrecht, Mark; Maiers, Martin

    2018-05-01

    Regardless of sampling depth, accurate genotype imputation is limited in regions of high polymorphism which often have a heavy-tailed haplotype frequency distribution. Many rare haplotypes are thus unobserved. Statistical methods to improve imputation by extending reference haplotype distributions using linkage disequilibrium patterns that relate allele and haplotype frequencies have not yet been explored. In the field of unrelated stem cell transplantation, imputation of highly polymorphic human leukocyte antigen (HLA) genes has an important application in identifying the best-matched stem cell donor when searching large registries totaling over 28,000,000 donors worldwide. Despite these large registry sizes, a significant proportion of searched patients present novel HLA haplotypes. Supporting this observation, HLA population genetic models have indicated that many extant HLA haplotypes remain unobserved. The absent haplotypes are a significant cause of error in haplotype matching. We have applied a Bayesian inference methodology for extending haplotype frequency distributions, using a model where new haplotypes are created by recombination of observed alleles. Applications of this joint probability model offer significant improvement in frequency distribution estimates over the best existing alternative methods, as we illustrate using five-locus HLA frequency data from the National Marrow Donor Program registry. Transplant matching algorithms and disease association studies involving phasing and imputation of rare variants may benefit from this statistical inference framework.

  13. Haplotype diversity in the equine myostatin gene with focus on variants associated with race distance propensity and muscle fiber type proportions

    PubMed Central

    Petersen, Jessica L; Valberg, Stephanie J; Mickelson, James R; McCue, Molly E

    2014-01-01

    Summary Two variants in the equine myostatin gene (MSTN), including a T/C SNP substitution in the first intron and a 227-bp SINE insertion in the promoter, are associated with muscle fiber type proportions in the Quarter Horse (QH) and with the prediction of race distance propensity in the Thoroughbred (TB). Genotypes from these loci, along with 18 additional variants surrounding MSTN, were examined in 301 horses of 14 breeds to evaluate haplotype relationships and diversity. The C allele of intron 1 was found in 12 of 14 breeds at a frequency of 0.27; the SINE was observed in five breeds, but common in only the TB and QH (0.73 and 0.48 respectively). Haplotype data suggest the SINE insertion is contemporary to and arose upon a haplotype containing the intron 1 C allele. Gluteal muscle biopsies of TBs showed a significant association of the intron 1 C allele and SINE with a higher proportion of Type 2B and lower proportion of Type 1 fibers. However, in the Belgian horse, in which the SINE is not present, the intron 1 SNP was not associated with fiber type proportions, and evaluation of fiber type proportions across the Belgian, TB and QH breeds shows the significant effect of breed on fiber type proportions is negated when evaluating horses without the SINE variant. These data suggest the SINE, rather than the intron 1 SNP, is driving the observed muscle fiber type characteristics and is the variant targeted by selection for short-distance racing. PMID:25160752

  14. F8 haplotype and inhibitor risk: results from the Hemophilia Inhibitor Genetics Study (HIGS) Combined Cohort

    PubMed Central

    Schwarz, John; Astermark, Jan; Menius, Erika D.; Carrington, Mary; Donfield, Sharyne M.; Gomperts, Edward D.; Nelson, George W.; Oldenburg, Johannes; Pavlova, Anna; Shapiro, Amy D.; Winkler, Cheryl A.; Berntorp, Erik

    2012-01-01

    Background Ancestral background, specifically African descent, confers higher risk for development of inhibitory antibodies to factor VIII (FVIII) in hemophilia A. It has been suggested that differences in the distribution of factor VIII gene (F8) haplotypes, and mismatch between endogenous F8 haplotypes and those comprising products used for treatment could contribute to risk. Design and Methods Data from the HIGS Combined Cohort were used to determine the association between F8 haplotype 3 (H3) vs. haplotypes 1 and 2 (H1+H2) and inhibitor risk among individuals of genetically-determined African descent. Other variables known to affect inhibitor risk including type of F8 mutation and HLA were included in the analysis. A second research question regarding risk related to mismatch in endogenous F8 haplotype and recombinant FVIII products used for treatment was addressed. Results H3 was associated with higher inhibitor risk among those genetically-identified (N=49) as of African ancestry, but the association did not remain significant after adjustment for F8 mutation type and the HLA variables. Among subjects of all racial ancestries enrolled in HIGS who reported early use of recombinant products (N=223), mismatch in endogenous haplotype and the FVIII proteins constituting the products used did not confer greater risk for inhibitor development. Conclusion H3 was not an independent predictor of inhibitor risk. Further, our findings did not support a higher risk of inhibitors in the presence of a haplotype mismatch between the FVIII molecule infused and that of the individual. PMID:22958194

  15. Haplotype Analysis of the Melanopsin Gene in Seasonal Affective Disorder and Controls

    DTIC Science & Technology

    2007-06-19

    Cole, P. A. (2002). Serotonin n-acetyltransferase: Mechanism and inhibition. Current Medicinal Chemistry , 9(12), 1187-1199. 152 APPENDIX A STRUCTURED ...such that low light levels fall below this threshold during winter in individuals with SAD. The present study investigated the haplotype structure of...Association Studies 51 Advantages of Population-Based Case-Control Samples 52 Haplotype Structure 53 Linkage Disequilibrium: A Measure of Correlation Between

  16. Elucidation of the ‘Honeycrisp’ pedigree through haplotype analysis with a multi-family integrated SNP linkage map and a large apple (Malus×domestica) pedigree-connected SNP data set

    PubMed Central

    Howard, Nicholas P; van de Weg, Eric; Bedford, David S; Peace, Cameron P; Vanderzande, Stijn; Clark, Matthew D; Teh, Soon Li; Cai, Lichun; Luby, James J

    2017-01-01

    The apple (Malus×domestica) cultivar Honeycrisp has become important economically and as a breeding parent. An earlier study with SSR markers indicated the original recorded pedigree of ‘Honeycrisp’ was incorrect and ‘Keepsake’ was identified as one putative parent, the other being unknown. The objective of this study was to verify ‘Keepsake’ as a parent and identify and genetically describe the unknown parent and its grandparents. A multi-family based dense and high-quality integrated SNP map was created using the apple 8 K Illumina Infinium SNP array. This map was used alongside a large pedigree-connected data set from the RosBREED project to build extended SNP haplotypes and to identify pedigree relationships. ‘Keepsake’ was verified as one parent of ‘Honeycrisp’ and ‘Duchess of Oldenburg’ and ‘Golden Delicious’ were identified as grandparents through the unknown parent. Following this finding, siblings of ‘Honeycrisp’ were identified using the SNP data. Breeding records from several of these siblings suggested that the previously unreported parent is a University of Minnesota selection, MN1627. This selection is no longer available, but now is genetically described through imputed SNP haplotypes. We also present the mosaic grandparental composition of ‘Honeycrisp’ for each of its 17 chromosome pairs. This new pedigree and genetic information will be useful in future pedigree-based genetic studies to connect ‘Honeycrisp’ with other cultivars used widely in apple breeding programs. The created SNP linkage map will benefit future research using the data from the Illumina apple 8 and 20 K and Affymetrix 480 K SNP arrays. PMID:28243452

  17. A Candidate Trans-acting Modulator of Fetal Hemoglobin Gene Expression in the Arab-Indian Haplotype of Sickle Cell Anemia

    PubMed Central

    Vathipadiekal, Vinod; Farrell, John J.; Wang, Shuai; Edward, Heather L.; Shappell, Heather; Al-Rubaish, A.M.; Al-Muhanna, Fahad; Naserullah, Z.; Alsuliman, A.; Qutub, Hatem Othman; Simkin, Irene; Farrer, Lindsay A.; Jiang, Zhihua; Luo, Hong-Yuan; Huang, Shengwen; Mostoslavsky, Gustavo; Murphy, George J.; Patra, Pradeep.K.; Chui, David H.K.; Alsultan, Abdulrahman; Al-Ali, Amein K.; Sebastiani, Paola.; Steinberg, Martin. H.

    2016-01-01

    Fetal hemoglobin (HbF) levels are higher in the Arab-Indian (AI) β-globin gene haplotype of sickle cell anemia compared with African-origin haplotypes. To study genetic elements that effect HbF expression in the AI haplotype we completed whole genome sequencing in 14 Saudi AI haplotype sickle hemoglobin homozygotes—seven selected for low HbF (8.2±1.3%) and seven selected for high HbF (23.5±.2.6%). An intronic single nucleotide polymorphism (SNP) in ANTXR1, an anthrax toxin receptor (chromosome 2p13), was associated with HbF. These results were replicated in two independent Saudi AI haplotype cohorts of 120 and 139 patients, but not in 76 Saudi Benin haplotype, 894 African origin haplotype and 44 Arab Indian haplotype patients of Indian descent, suggesting that this association is effective only in the Saudi AI haplotype background. ANTXR1 variants explained 10% of the HbF variability compared with 8% for BCL11A. These two genes had independent, additive effects on HbF and together explained about 15% of HbF variability in Saudi AI sickle cell anemia patients. ANTXR1 was expressed at mRNA and protein levels in erythroid progenitors derived from induced pluripotent stem cells (iPSCs) and CD34+ cells. As CD34+ cells matured and their HbF decreased ANTXR1 expression increased; as iPSCs differentiated and their HbF increased, ANTXR1 expression decreased. Along with elements in cis to the HbF genes, ANTXR1 contributes to the variation in HbF in Saudi AI haplotype sickle cell anemia and is the first gene in trans to HBB that is associated with HbF only in carriers of the Saudi AI haplotype. PMID:27501013

  18. Molecular and immunogenetic analysis of major histocompatibility haplotypes in Northern Bobwhite enable direct identification of corresponding haplotypes in an endangered subspecies, the Masked Bobwhite

    USGS Publications Warehouse

    Drake, B.M.; Goto, R.M.; Miller, M.M.; Gee, G.F.; Briles, W.E.

    1999-01-01

    The major histocompatibility complex (MHC) is a group of genetic loci coding for haplotypes that have been associated with fitness traits in mammals and birds. Such associations suggest that MHC diversity may be an indicator of overall genetic fitness of endangered or threatened species. The MHC haplotypes of a captive population of 12 families of northern bobwhites (Colinus virginianus) were identified using a combination of immunogenetic and molecular techniques. Alloantisera were produced within families of northern bobwhites and were then tested for differential agglutination of erythrocytes of all members of each family. The pattern of reactions determined from testing these alloantisera identified a single genetic system of alloantigens in the northern bobwhites, resulting in the assignment of a tentative genotype to each individual within the quail families. Restriction fragment patterns of the DNA of each bird were determined using the chicken MHC B-G cDNA probe bg11. The concordance between the restriction fragment patterns and the alloantisera reactions showed that the alloantisera had identified the MHC of the northern bobwhite and supported the tentative genotype assignments, identifying at least 12 northern bobwhite MHC haplotypes.

  19. Addiction Genetics and Pleiotropic Effects of Common Haplotypes that Make Polygenic Contributions to Vulnerability to Substance Dependence

    PubMed Central

    Uhl, George R.; Drgon, Tomas; Johnson, Catherine; Liu, Qing-Rong

    2016-01-01

    Abundant evidence from family, adoption, and twin studies point to large genetic contributions to individual differences in vulnerability to develop dependence on one or more addictive substances. Twin data suggest that most of this genetic vulnerability is shared by individuals who are dependent on a variety of addictive substances. Molecular genetic studies, especially genomewide and candidate gene association studies, have elucidated common haplotypes in dozens of genes that appear to make polygenic contributions to vulnerability to developing dependence. Most genes that harbor currently identified addiction-associated haplotypes are expressed in the brain. Haplotypes in many of the same genes are identified in genomewide association studies that compare allele frequencies in substance dependent vs. control individuals from European, African, and Asian racial/ethnic backgrounds. Many of these addiction-associated haplotypes display pleiotropic influences on a variety of related brain-based phenotypes that display 1) substantial heritability and 2) clinical cooccurence with substance dependence. PMID:19152208

  20. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  1. Reconstruction of Haplotype-Blocks Selected during Experimental Evolution.

    PubMed

    Franssen, Susanne U; Barton, Nicholas H; Schlötterer, Christian

    2017-01-01

    The genetic analysis of experimentally evolving populations typically relies on short reads from pooled individuals (Pool-Seq). While this method provides reliable allele frequency estimates, the underlying haplotype structure remains poorly characterized. With small population sizes and adaptive variants that start from low frequencies, the interpretation of selection signatures in most Evolve and Resequencing studies remains challenging. To facilitate the characterization of selection targets, we propose a new approach that reconstructs selected haplotypes from replicated time series, using Pool-Seq data. We identify selected haplotypes through the correlated frequencies of alleles carried by them. Computer simulations indicate that selected haplotype-blocks of several Mb can be reconstructed with high confidence and low error rates, even when allele frequencies change only by 20% across three replicates. Applying this method to real data from D. melanogaster populations adapting to a hot environment, we identify a selected haplotype-block of 6.93 Mb. We confirm the presence of this haplotype-block in evolved populations by experimental haplotyping, demonstrating the power and accuracy of our haplotype reconstruction from Pool-Seq data. We propose that the combination of allele frequency estimates with haplotype information will provide the key to understanding the dynamics of adaptive alleles. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Genome-wide Association Study Identifies HLA 8.1 Ancestral Haplotype Alleles as Major Genetic Risk Factors for Myositis Phenotypes

    PubMed Central

    Miller, Frederick W.; Chen, Wei; O’Hanlon, Terrance P.; Cooper, Robert G.; Vencovsky, Jiri; Rider, Lisa G.; Danko, Katalin; Wedderburn, Lucy R.; Lundberg, Ingrid E.; Pachman, Lauren M.; Reed, Ann M.; Ytterberg, Steven R.; Padyukov, Leonid; Selva-O’Callaghan, Albert; Radstake, Timothy R.; Isenberg, David A.; Chinoy, Hector; Ollier, William E.R.; Scheet, Paul; Peng, Bo; Lee, Annette; Byun, Jinyoung; Lamb, Janine A.; Gregersen, Peter K.; Amos, Christopher I.

    2016-01-01

    Autoimmune muscle diseases (myositis) comprise a group of complex phenotypes influenced by genetic and environmental factors. To identify genetic risk factors in patients of European ancestry, we conducted a genome-wide association study (GWAS) of the major myositis phenotypes in a total of 1710 cases, which included 705 adult dermatomyositis; 473 juvenile dermatomyositis; 532 polymyositis; and 202 adult dermatomyositis, juvenile dermatomyositis or polymyositis patients with anti-histidyl tRNA synthetase (anti-Jo-1) autoantibodies, and compared them with 4724 controls. Single-nucleotide polymorphisms showing strong associations (P < 5 × 10−8) in GWAS were identified in the major histocompatibility complex (MHC) region for all myositis phenotypes together, as well as for the four clinical and autoantibody phenotypes studied separately. Imputation and regression analyses found that alleles comprising the human leukocyte antigen (HLA) 8.1 ancestral haplotype (AH8.1) defined essentially all the genetic risk in the phenotypes studied. Although the HLA DRB1*03:01 allele showed slightly stronger associations with adult and juvenile dermatomyositis, and HLA B*08:01 with polymyositis and anti-Jo-1 autoantibody-positive myositis, multiple alleles of AH8.1 were required for the full risk effects. Our findings establish that alleles of the AH8.1haplotype comprise the primary genetic risk factors associated with the major myositis phenotypes in geographically diverse Caucasian populations. PMID:26291516

  3. Native and European haplotypes of Phragmites Australis (common reed) in the central Platte River, Nebraska

    USGS Publications Warehouse

    Larson, D.L.; Galatowitsch, S.M.; Larson, J.L.

    2011-01-01

    Phragmites australis (common reed) is known to have occurred along the Platte River historically, but recent rapid increases in both distribution and density have begun to impact habitat for migrating sandhill cranes and nesting piping plovers and least terns. Invasiveness in Phragmites has been associated with the incursion of a European genotype (haplotype M) in other areas; determining the genotype of Phragmites along the central Platte River has implications for proper management of the river system. In 2008 we sampled Phragmites patches along the central Platte River from Lexington to Chapman, NE, stratified by bridge segments, to determine the current distribution of haplotype E (native) and haplotype M genotypes. In addition, we did a retrospective analysis of historical Phragmites collections from the central Platte watershed (1902-2006) at the Bessey Herbarium. Fresh tissue from the 2008 survey and dried tissue from the herbarium specimens were classified as haplotype M or E using the restriction fragment length polymorphism procedure. The European haplotype was predominant in the 2008 samples: only 14 Phragmites shoots were identified as native haplotype E; 224 were non-native haplotype M. The retrospective analysis revealed primarily native haplotype individuals. Only collections made in Lancaster County, near Lincoln, NE, were haplotype M, and the earliest of these was collected in 1973. ?? 2011 Copyright by the Center for Great Plains Studies, University of Nebraska-Lincoln.

  4. Human leucocyte antigens class II allele and haplotype association with Type 1 Diabetes in Madeira Island (Portugal).

    PubMed

    Spínola, H; Lemos, A; Couto, A R; Parreira, B; Soares, M; Dutra, I; Bruges-Armas, J; Brehm, A; Abreu, S

    2017-12-01

    This study confirms for Madeira Island (Portugal) population the Type 1 Diabetes (T1D) susceptible and protective Human leucocyte antigens (HLA) markers previously reported in other populations and adds some local specificities. Among the strongest T1D HLA associations, stands out, as susceptible, the alleles DRB1*04:05 (OR = 7.3), DQB1*03:02 (OR = 6.1) and DQA1*03:03 (OR = 4.5), as well as the haplotypes DRB1*04:05-DQA1*03:03-DQB1*03:02 (OR = 100.9) and DRB1*04:04-DQA1*03:01-DQB1*03:02 (OR = 22.1), and DQB1*06:02 (OR = 0.07) and DRB1*15:01-DQA1*01:02-DQB1*06:02 (OR = 0.04) as protective. HLA-DQA1 positive for Arginine at position 52 (Arg52) (OR = 15.2) and HLA-DQB1 negative for Aspartic acid at the position 57 (Asp57) (OR = 9.0) alleles appear to be important genetic markers for T1D susceptibility, with higher odds ratio values than any single allele and than most of the haplotypes. Genotypes generated by the association of markers Arg52 DQA1 positive and Asp57 DQB1 negative increase T1D susceptibility much more than one would expected by a simple additive effect of those markers separately (OR = 26.9). This study also confirms an increased risk for DRB1*04/DRB1*03 heterozygote genotypes (OR = 16.8) and also a DRB1*04-DQA1*03:01-DQB1*03:02 haplotype susceptibility dependent on the DRB1*04 allele (DRB1*04:01, OR = 7.9; DRB1*04:02, OR = 3.2; DRB1*04:04, OR = 22.1). © 2017 John Wiley & Sons Ltd.

  5. Genetic dissection of powdery mildew resistance in interspecific half-sib grapevine families using SNP-based maps.

    PubMed

    Teh, Soon Li; Fresnedo-Ramírez, Jonathan; Clark, Matthew D; Gadoury, David M; Sun, Qi; Cadle-Davidson, Lance; Luby, James J

    2017-01-01

    Quantitative trait locus (QTL) identification in perennial fruit crops is impeded largely by their lengthy generation time, resulting in costly and labor-intensive maintenance of breeding programs. In a grapevine (genus Vitis ) breeding program, although experimental families are typically unreplicated, the genetic backgrounds may contain similar progenitors previously selected due to their contribution of favorable alleles. In this study, we investigated the utility of joint QTL identification provided by analyzing half-sib families. The genetic control of powdery mildew was studied using two half-sib F 1 families, namely GE0711/1009 (MN1264 × MN1214; N  = 147) and GE1025 (MN1264 × MN1246; N  = 125) with multiple species in their ancestry. Maternal genetic maps consisting of 1077 and 1641 single nucleotide polymorphism (SNP) markers, respectively, were constructed using a pseudo-testcross strategy. Ratings of field resistance to powdery mildew were obtained based on whole-plant evaluation of disease severity. This 2-year analysis uncovered two QTLs that were validated on a consensus map in these half-sib families with improved precision relative to the parental maps. Examination of haplotype combinations based on the two QTL regions identified strong association of haplotypes inherited from 'Seyval blanc', through MN1264, with powdery mildew resistance. This investigation also encompassed the use of microsatellite markers to establish a correlation between 206-bp (UDV-015b) and 357-bp (VViv67) fragment sizes with resistance-carrying haplotypes. Our work is one of the first reports in grapevine demonstrating the use of SNP-based maps and haplotypes for QTL identification and tagging of powdery mildew resistance in half-sib families.

  6. Genome-Wide Association Mapping of Barley Yellow Dwarf Virus Tolerance in Spring Oat (Avena sativa L.)

    PubMed Central

    Foresman, Bradley J.; Oliver, Rebekah E.; Jackson, Eric W.; Chao, Shiaoman; Arruda, Marcio P.; Kolb, Frederic L.

    2016-01-01

    Barley yellow dwarf viruses (BYDVs) are responsible for the disease barley yellow dwarf (BYD) and affect many cereals including oat (Avena sativa L.). Until recently, the molecular marker technology in oat has not allowed for many marker-trait association studies to determine the genetic mechanisms for tolerance. A genome-wide association study (GWAS) was performed on 428 spring oat lines using a recently developed high-density oat single nucleotide polymorphism (SNP) array as well as a SNP-based consensus map. Marker-trait associations were performed using a Q-K mixed model approach to control for population structure and relatedness. Six significant SNP-trait associations representing two QTL were found on chromosomes 3C (Mrg17) and 18D (Mrg04). This is the first report of BYDV tolerance QTL on chromosome 3C (Mrg17) and 18D (Mrg04). Haplotypes using the two QTL were evaluated and distinct classes for tolerance were identified based on the number of favorable alleles. A large number of lines carrying both favorable alleles were observed in the panel. PMID:27175781

  7. Imputation of variants from the 1000 Genomes Project modestly improves known associations and can identify low-frequency variant-phenotype associations undetected by HapMap based imputation.

    PubMed

    Wood, Andrew R; Perry, John R B; Tanaka, Toshiko; Hernandez, Dena G; Zheng, Hou-Feng; Melzer, David; Gibbs, J Raphael; Nalls, Michael A; Weedon, Michael N; Spector, Tim D; Richards, J Brent; Bandinelli, Stefania; Ferrucci, Luigi; Singleton, Andrew B; Frayling, Timothy M

    2013-01-01

    Genome-wide association (GWA) studies have been limited by the reliance on common variants present on microarrays or imputable from the HapMap Project data. More recently, the completion of the 1000 Genomes Project has provided variant and haplotype information for several million variants derived from sequencing over 1,000 individuals. To help understand the extent to which more variants (including low frequency (1% ≤ MAF <5%) and rare variants (<1%)) can enhance previously identified associations and identify novel loci, we selected 93 quantitative circulating factors where data was available from the InCHIANTI population study. These phenotypes included cytokines, binding proteins, hormones, vitamins and ions. We selected these phenotypes because many have known strong genetic associations and are potentially important to help understand disease processes. We performed a genome-wide scan for these 93 phenotypes in InCHIANTI. We identified 21 signals and 33 signals that reached P<5×10(-8) based on HapMap and 1000 Genomes imputation, respectively, and 9 and 11 that reached a stricter, likely conservative, threshold of P<5×10(-11) respectively. Imputation of 1000 Genomes genotype data modestly improved the strength of known associations. Of 20 associations detected at P<5×10(-8) in both analyses (17 of which represent well replicated signals in the NHGRI catalogue), six were captured by the same index SNP, five were nominally more strongly associated in 1000 Genomes imputed data and one was nominally more strongly associated in HapMap imputed data. We also detected an association between a low frequency variant and phenotype that was previously missed by HapMap based imputation approaches. An association between rs112635299 and alpha-1 globulin near the SERPINA gene represented the known association between rs28929474 (MAF = 0.007) and alpha1-antitrypsin that predisposes to emphysema (P = 2.5×10(-12)). Our data provide important proof of principle

  8. Imputation of Variants from the 1000 Genomes Project Modestly Improves Known Associations and Can Identify Low-frequency Variant - Phenotype Associations Undetected by HapMap Based Imputation

    PubMed Central

    Wood, Andrew R.; Perry, John R. B.; Tanaka, Toshiko; Hernandez, Dena G.; Zheng, Hou-Feng; Melzer, David; Gibbs, J. Raphael; Nalls, Michael A.; Weedon, Michael N.; Spector, Tim D.; Richards, J. Brent; Bandinelli, Stefania; Ferrucci, Luigi; Singleton, Andrew B.; Frayling, Timothy M.

    2013-01-01

    Genome-wide association (GWA) studies have been limited by the reliance on common variants present on microarrays or imputable from the HapMap Project data. More recently, the completion of the 1000 Genomes Project has provided variant and haplotype information for several million variants derived from sequencing over 1,000 individuals. To help understand the extent to which more variants (including low frequency (1% ≤ MAF <5%) and rare variants (<1%)) can enhance previously identified associations and identify novel loci, we selected 93 quantitative circulating factors where data was available from the InCHIANTI population study. These phenotypes included cytokines, binding proteins, hormones, vitamins and ions. We selected these phenotypes because many have known strong genetic associations and are potentially important to help understand disease processes. We performed a genome-wide scan for these 93 phenotypes in InCHIANTI. We identified 21 signals and 33 signals that reached P<5×10−8 based on HapMap and 1000 Genomes imputation, respectively, and 9 and 11 that reached a stricter, likely conservative, threshold of P<5×10−11 respectively. Imputation of 1000 Genomes genotype data modestly improved the strength of known associations. Of 20 associations detected at P<5×10−8 in both analyses (17 of which represent well replicated signals in the NHGRI catalogue), six were captured by the same index SNP, five were nominally more strongly associated in 1000 Genomes imputed data and one was nominally more strongly associated in HapMap imputed data. We also detected an association between a low frequency variant and phenotype that was previously missed by HapMap based imputation approaches. An association between rs112635299 and alpha-1 globulin near the SERPINA gene represented the known association between rs28929474 (MAF = 0.007) and alpha1-antitrypsin that predisposes to emphysema (P = 2.5×10−12). Our data provide important proof of principle

  9. In vitro and ex vivo analysis of CHRNA3 and CHRNA5 haplotype expression.

    PubMed

    Doyle, Glenn A; Wang, Min-Jung; Chou, Andrew D; Oleynick, John U; Arnold, Steven E; Buono, Russell J; Ferraro, Thomas N; Berrettini, Wade H

    2011-01-01

    Genome-wide association studies implicate variations in CHRNA5 and CHRNA3 as being associated with nicotine addiction (NA). Multiple common haplotypes ("risk", "mixed" and "protective") exist in Europeans; however, high linkage disequilibrium between variations in CHRNA5 and CHRNA3 makes assigning causative allele(s) for NA difficult through genotyping experiments alone. We investigated whether CHRNA5 or CHRNA3 promoter haplotypes, associated previously with NA, might influence allelic expression levels. For in vitro analyses, promoter haplotypes were sub-cloned into a luciferase reporter vector. When assessed in BE(2)-C cells, luciferase expression was equivalent among CHRNA3 haplotypes, but the combination of deletion at rs3841324 and variation at rs503464 decreased CHRNA5 promoter-derived luciferase activity, possibly due to loss of an SP-1 and other site(s). Variation within the CHRNA5 5'UTR at rs55853698 and rs55781567 also altered luciferase expression in BE(2)-C cells. Allelic expression imbalance (AEI) from the "risk" or "protective" haplotypes was assessed in post-mortem brain tissue from individuals heterozygous at coding polymorphisms in CHRNA3 (rs1051730) or CHRNA5 (rs16969968). In most cases, equivalent allelic expression was observed; however, one individual showed CHRNA5 AEI that favored the "protective" allele and that was concordant with heterozygosity at polymorphisms ∼13.5 kb upstream of the CHRNA5 transcription start site. Putative enhancer activity from these distal promoter elements was assessed using heterologous promoter constructs. We observed no differences in promoter activity from the two distal promoter haplotypes examined, but found that the distal promoter region strongly repressed transcription. We conclude that CHRNA5 promoter variants may affect relative risk for NA in some heterozygous individuals.

  10. No association between polymorphisms and haplotypes of COL1A1 and COL1A2 genes and osteoporotic fracture in postmenopausal Chinese women

    PubMed Central

    Hu, Wei-wei; He, Jin-wei; Zhang, Hao; Wang, Chun; Gu, Jie-mei; Yue, Hua; Ke, Yao-hua; Hu, Yun-qiu; Fu, Wen-zhen; Li, Miao; Liu, Yu-juan; Zhang, Zhen-lin

    2011-01-01

    Aim: To study whether genetic polymorphisms of COL1A1 and COL1A2 genes affected the onset of fracture in postmenopausal Chinese women. Methods: SNPs in COL1A1 and COL1A2 genes were identified via direct sequencing in 32 unrelated postmenopausal Chinese women. Ten SNPs were genotyped in 1252 postmenopausal Chinese women. The associations were examined using both single-SNP and haplotype tests using logistic regression. Results: Twenty four (4 novel) and 28 (7 novel) SNPs were identified in COL1A1 and COL1A2 gene, respectively. The distribution frequencies of 2 SNPs in COL1A1 (rs2075554 and rs2586494) and 3 SNPs in COL1A2 (rs42517, rs1801182, and rs42524) were significantly different from those documented for the European Caucasian population. No significant difference was observed between fracture and control groups with respect to allele frequency or genotype distribution in 9 selected SNPs and haplotype. No significant association was found between fragility fracture and each SNP or haplotype. The results remained the same after additional corrections for other risk factors such as weight, height, and bone mineral density. Conclusion: Our results show no association between common genetic variations of COL1A1 and COL1A2 genes and fracture, suggesting the complex genetic background of osteoporotic fractures. PMID:21602843

  11. [Association between CETP polymorphisms and haplotypes with dyslipidemia in Xinjiang Uygur and Kazak residents].

    PubMed

    Hu, Y H; Liu, J M; Zhang, M; He, J; Yan, Y Z; Ma, J L; Ma, R L; Guo, H; Rui, D S; Sun, F; Mu, L L; Niu, Q; Ding, Y S; Zhang, J Y; Li, S G; Guo, S X

    2016-08-24

    To explore the relationship between the polymorphisms and haplotypes in the CETP gene and dyslipidemia among Xinjiang Kazak and Uygur residents. A population status survey was performed from 2010 to 2011 in Kashgar Xinjiang Uygur and Kazak residents, stratified cluster sampling method was used to select Uygur, Kazak residents with abnormal blood lipid values (n=367 and 345, respectively) as the dyslipidemia groups, and to select residents with normal lipid values as control group from the same area (n=374 and 390, respectively). SNaPshot technology was applied to detect the DNA of CETP gene rs3764261, rs1800775, rs708272 and rs5882 loci in all selected residents, and linkage disequilibrium analysis and haplotype construction were performed. (1) In Uygur residents, the dyslipidemia risk of rs708272 CT (OR=0.64, 95%CI 0.46-0.91, P=0.01) and TT genotype (OR=0.60, 95%CI 0.40-0.91, P=0.02) was significantly lower than CC genotype. Dyslipidemia risk of rs3764261 GT (OR=0.55, 95%CI 0.40-0.74, P=0.00) and TT genotype (OR=0.47, 95%CI 0.28-0.78, P<0.01) was significantly lower than GG genetype. Dyslipidemia risk of the rs1800775 CC genotype was higher than AA genotype (OR=1.79, 95%CI 1.17-2.74, P=0.01). There was no statistical significance in CETP gene of the 4 genotype and allele frequency between the dyslipidemia and normal lipid groups in Kazak residents (all P>0.05). (2) In Uighur residents with dyslipidemia, HDL-C level was significantly higher in rs708272 TT genotype carriers than in CC and CT genotypes (all P<0.05) and in rs3764261 TT genotype carriers than in GG genotype carriers (P=0.008), while was significantly lower in rs1800775 CC genotype carriers with AA genotype carriers (P=0.008). (3) Linkage disequilibrium analysis showed that there was strong linkage disequilibrium between rs3764261 and rs708272 (D'=0.869, r(2)=0.869), rs1800775 and rs708272 (D'=0.845, r(2)=0.446) in Uighur residents, and there was strong linkage disequilibrium between rs3764261 and rs

  12. Haplotypes identified by 10 DNA restriction fragment length polymorphisms at the human low density lipoprotein receptor gene locus.

    PubMed Central

    Kotze, M J; Langenhoven, E; Retief, A E; Seftel, H C; Henderson, H E; Weich, H F

    1989-01-01

    Ten useful two allele restriction fragment length polymorphisms of the low density lipoprotein receptor gene were used for haplotype analysis in 45 unrelated familial hypercholesterolaemic (FH) patients, 60 normal controls, and 32 FH homozygotes, all of whom were white Afrikaners. Pedigree analysis in 27 informative heterozygous FH and 23 normal families has shown the segregation of at least 17 haplotypes in the normal population (111 chromosomes) compared to a predominant association of two of these haplotypes with the disease in the FH subjects. This association was further confirmed in 32 FH homozygotes, indicating at least two 'founder' members for the disease in the Afrikaner population. Recombination events were not detected in any of the families studied and we thus conclude that the haplotypes associated with FH function as specific markers for the disease and will allow presymptomatic diagnosis in affected families. PMID:2565980

  13. HLA Type Inference via Haplotypes Identical by Descent

    NASA Astrophysics Data System (ADS)

    Setty, Manu N.; Gusev, Alexander; Pe'Er, Itsik

    The Human Leukocyte Antigen (HLA) genes play a major role in adaptive immune response and are used to differentiate self antigens from non self ones. HLA genes are hyper variable with nearly every locus harboring over a dozen alleles. This variation plays an important role in susceptibility to multiple autoimmune diseases and needs to be matched on for organ transplantation. Unfortunately, HLA typing by serological methods is time consuming and expensive compared to high throughput Single Nucleotide Polymorphism (SNP) data. We present a new computational method to infer per-locus HLA types using shared segments Identical By Descent (IBD), inferred from SNP genotype data. IBD information is modeled as graph where shared haplotypes are explored among clusters of individuals with known and unknown HLA types to identify the latter. We analyze performance of the method in a previously typed subset of the HapMap population, achieving accuracy of 96% in HLA-A, 94% in HLA-B, 95% in HLA-C, 77% in HLA-DR1, 93% in HLA-DQA1 and 90% in HLA-DQB1 genes. We compare our method to a tag SNP based approach and demonstrate higher sensitivity and specificity. Our method demonstrates the power of using shared haplotype segments for large-scale imputation at the HLA locus.

  14. [Frequency distribution of HLA antigens and haplotypes in newly arrived inhabitants of Magadan].

    PubMed

    Solovenchuk, L L; Pereverzeva, V V; Nevretdinova, Z G

    1994-09-01

    Peculiarities of the frequency distribution of antigens and haplotypes of A, B, and Cw subloci of the HLA system in 924 Slavic inhabitants of Magadan are described. Significant differences in gene and haplotype frequencies between inhabitants of Magadan and those of Moscow, Odessa, Poles'e, Latvia, and England were revealed, which could not be attributed solely to the specificity of migration processes. On the basis of an analysis of gamete associations of the A and B subloci, an attempt was made to explain the specificity of the frequency distribution of HLA system alleles and haplotypes in the investigated sample from an ecological point of view.

  15. The haplotype-resolved genome and epigenome of the aneuploid HeLa cancer cell line.

    PubMed

    Adey, Andrew; Burton, Joshua N; Kitzman, Jacob O; Hiatt, Joseph B; Lewis, Alexandra P; Martin, Beth K; Qiu, Ruolan; Lee, Choli; Shendure, Jay

    2013-08-08

    The HeLa cell line was established in 1951 from cervical cancer cells taken from a patient, Henrietta Lacks. This was the first successful attempt to immortalize human-derived cells in vitro. The robust growth and unrestricted distribution of HeLa cells resulted in its broad adoption--both intentionally and through widespread cross-contamination--and for the past 60 years it has served a role analogous to that of a model organism. The cumulative impact of the HeLa cell line on research is demonstrated by its occurrence in more than 74,000 PubMed abstracts (approximately 0.3%). The genomic architecture of HeLa remains largely unexplored beyond its karyotype, partly because like many cancers, its extensive aneuploidy renders such analyses challenging. We carried out haplotype-resolved whole-genome sequencing of the HeLa CCL-2 strain, examined point- and indel-mutation variations, mapped copy-number variations and loss of heterozygosity regions, and phased variants across full chromosome arms. We also investigated variation and copy-number profiles for HeLa S3 and eight additional strains. We find that HeLa is relatively stable in terms of point variation, with few new mutations accumulating after early passaging. Haplotype resolution facilitated reconstruction of an amplified, highly rearranged region of chromosome 8q24.21 at which integration of the human papilloma virus type 18 (HPV-18) genome occurred and that is likely to be the event that initiated tumorigenesis. We combined these maps with RNA-seq and ENCODE Project data sets to phase the HeLa epigenome. This revealed strong, haplotype-specific activation of the proto-oncogene MYC by the integrated HPV-18 genome approximately 500 kilobases upstream, and enabled global analyses of the relationship between gene dosage and expression. These data provide an extensively phased, high-quality reference genome for past and future experiments relying on HeLa, and demonstrate the value of haplotype resolution for

  16. New HLA haplotype frequency reference standards: high-resolution and large sample typing of HLA DR-DQ haplotypes in a sample of European Americans.

    PubMed

    Klitz, W; Maiers, M; Spellman, S; Baxter-Lowe, L A; Schmeckpeper, B; Williams, T M; Fernandez-Viña, M

    2003-10-01

    A collaborative study involving a large sample of European Americans was typed for the histocompatibility loci of the HLA DR-DQ region and subjected to intensive typing validation measures in order to accurately determine haplotype composition and frequency. The resulting tables have immediate application to HLA typing and allogeneic transplantation. The loci within the DR-DQ region are especially valuable for such an undertaking because of their tight linkage and high linkage disequilibrium. The 3798 haplotypes, derived from 1899 unrelated individuals, had a total of 75 distinct DRB1-DQA1-DQB1 haplotypes. The frequency distribution of the haplotypes was right skewed with haplotypes occurring at a frequency of less than 1% numbering 59 and yet constituting less than 12% of the total sample. Given DRB1 typing, it was possible to infer the exact DQA1 and DQB1 composition of a haplotype with high confidence (>90% likelihood) in 21 of the 35 high-resolution DRB1 alleles present in the sample. Of the DRB1 alleles without high reliability for DQ haplotype inference, only *0401, *0701 and *1302 were common, the remaining 11 DRB1 alleles constituting less than 5% of the total sample. This approach failed for the 13 serologically equivalent DR alleles in which only 33% of DQ haplotypes could be reliably inferred. The 36 DQA1-DQB1 haplotypes present in the total sample conformed to the known pattern of permissible heterodimers. Four DQA1-DQB1 haplotypes, all rare, are reported here for the first time. The haplotype frequency tables are suitable as a reference standard for HLA typing of the DR and DQ loci in European Americans.

  17. Two extended haplotype blocks are associated with adaptation to high altitude habitats in East African honey bees

    PubMed Central

    Schöning, Caspar

    2017-01-01

    Understanding the genetic basis of adaption is a central task in biology. Populations of the honey bee Apis mellifera that inhabit the mountain forests of East Africa differ in behavior and morphology from those inhabiting the surrounding lowland savannahs, which likely reflects adaptation to these habitats. We performed whole genome sequencing on 39 samples of highland and lowland bees from two pairs of populations to determine their evolutionary affinities and identify the genetic basis of these putative adaptations. We find that in general, levels of genetic differentiation between highland and lowland populations are very low, consistent with them being a single panmictic population. However, we identify two loci on chromosomes 7 and 9, each several hundred kilobases in length, which exhibit near fixation for different haplotypes between highland and lowland populations. The highland haplotypes at these loci are extremely rare in samples from the rest of the world. Patterns of segregation of genetic variants suggest that recombination between haplotypes at each locus is suppressed, indicating that they comprise independent structural variants. The haplotype on chromosome 7 harbors nearly all octopamine receptor genes in the honey bee genome. These have a role in learning and foraging behavior in honey bees and are strong candidates for adaptation to highland habitats. Molecular analysis of a putative breakpoint indicates that it may disrupt the coding sequence of one of these genes. Divergence between the highland and lowland haplotypes at both loci is extremely high suggesting that they are ancient balanced polymorphisms that greatly predate divergence between the extant honey bee subspecies. PMID:28542163

  18. Linkage disequilibrium with HLA-DRB1-DQB1 haplotypes explains the association of TNF-308G>A variant with type 1 diabetes in a Brazilian cohort.

    PubMed

    Patente, Thiago A; Monteiro, Maria B; Vieira, Suzana M; Rossi da Silva, Maria E; Nery, Márcia; Queiroz, Márcia; Azevedo, Mirela J; Canani, Luis H; Parisi, Maria C; Pavin, Elizabeth J; Mainardi, Débora; Javor, Juraj; Velho, Gilberto; Coimbra, Cássio N; Corrêa-Giannella, Maria Lúcia

    2015-08-15

    A functional variant in the promoter region of the gene encoding tumor necrosis factor (TNF; rs1800629, -308G>A) showed to confer susceptibility to T1D. However, TNF rs1800629 was found, in several populations, to be in linkage disequilibrium with HLA susceptibility haplotypes to T1D. We evaluated the association of TNF rs1800629 with T1D in a cohort of Brazilian subjects, and assessed the impact of HLA susceptibility haplotypes in this association. 659 subjects with T1D and 539 control subjects were genotyped for TNF-308G>A variant. HLA-DRB1 and HLA-DQB1 genes were genotyped in a subset of 313 subjects with T1D and 139 control subjects. Associations with T1D were observed for the A-allele of rs1800629 (OR 1.69, 95% CI 1.33-2.15, p<0.0001, in a codominant model) and for 3 HLA haplotypes: DRB1*03:01-DQB1*02:01 (OR 5.37, 95% CI 3.23-8.59, p<0.0001), DRB1*04:01-DQB1*03:02 (OR 2.95, 95% CI 1.21-7.21, p=0.01) and DRB1*04:02-DQB1*03:02 (OR 2.14, 95% CI 1.02-4.50, p=0.04). Linkage disequilibrium was observed between TNF rs1800629 and HLA-DRB1 and HLA-DQB1 alleles. In a stepwise regression analysis HLA haplotypes, but not TNF rs1800629, remained independently associated with T1D. Our results do not support an independent effect of allelic variations of TNF in the genetic susceptibility to T1D. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. The effect of using genealogy-based haplotypes for genomic prediction.

    PubMed

    Edriss, Vahid; Fernando, Rohan L; Su, Guosheng; Lund, Mogens S; Guldbrandtsen, Bernt

    2013-03-06

    Genomic prediction uses two sources of information: linkage disequilibrium between markers and quantitative trait loci, and additive genetic relationships between individuals. One way to increase the accuracy of genomic prediction is to capture more linkage disequilibrium by regression on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (π) of the haplotype covariates had zero effect, i.e. a Bayesian mixture method. About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some cases, decreased the bias of prediction. With the Bayesian method, accuracy of prediction was less sensitive to parameter π when fitting haplotypes compared to fitting markers. Use of haplotypes based on genealogy can slightly increase the accuracy of genomic prediction. Improved methods to cluster the haplotypes constructed from local genealogy could lead to additional gains in accuracy.

  20. Integrating sequence and array data to create an improved 1000 Genomes Project haplotype reference panel.

    PubMed

    Delaneau, Olivier; Marchini, Jonathan

    2014-06-13

    A major use of the 1000 Genomes Project (1000 GP) data is genotype imputation in genome-wide association studies (GWAS). Here we develop a method to estimate haplotypes from low-coverage sequencing data that can take advantage of single-nucleotide polymorphism (SNP) microarray genotypes on the same samples. First the SNP array data are phased to build a backbone (or 'scaffold') of haplotypes across each chromosome. We then phase the sequence data 'onto' this haplotype scaffold. This approach can take advantage of relatedness between sequenced and non-sequenced samples to improve accuracy. We use this method to create a new 1000 GP haplotype reference set for use by the human genetic community. Using a set of validation genotypes at SNP and bi-allelic indels we show that these haplotypes have lower genotype discordance and improved imputation performance into downstream GWAS samples, especially at low-frequency variants.

  1. Comparative sequence analysis of the potato cyst nematode resistance locus H1 reveals a major lack of co-linearity between three haplotypes in potato (Solanum tuberosum ssp.)

    PubMed Central

    Bakker, Erin; de Boer, Jan; van der Vossen, Edwin; Achenbach, Ute; Golas, Tomasz; Suryaningrat, Suwardi; Smant, Geert; Bakker, Jaap; Goverse, Aska

    2010-01-01

    The H1 locus confers resistance to the potato cyst nematode Globodera rostochiensis pathotypes 1 and 4. It is positioned at the distal end of chromosome V of the diploid Solanum tuberosum genotype SH83-92-488 (SH) on an introgression segment derived from S. tuberosum ssp. andigena. Markers from a high-resolution genetic map of the H1 locus (Bakker et al. in Theor Appl Genet 109:146–152, 2004) were used to screen a BAC library to construct a physical map covering a 341-kb region of the resistant haplotype coming from SH. For comparison, physical maps were also generated of the two haplotypes from the diploid susceptible genotype RH89-039-16 (S. tuberosum ssp. tuberosum/S. phureja), spanning syntenic regions of 700 and 319 kb. Gene predictions on the genomic segments resulted in the identification of a large cluster consisting of variable numbers of the CC-NB-LRR type of R genes for each haplotype. Furthermore, the regions were interspersed with numerous transposable elements and genes coding for an extensin-like protein and an amino acid transporter. Comparative analysis revealed a major lack of gene order conservation in the sequences of the three closely related haplotypes. Our data provide insight in the evolutionary mechanisms shaping the H1 locus and will facilitate the map-based cloning of the H1 resistance gene. Electronic supplementary material The online version of this article (doi:10.1007/s00122-010-1472-9) contains supplementary material, which is available to authorized users. PMID:21049265

  2. Ancestral Asian source(s) of new world Y-chromosome founder haplotypes.

    PubMed Central

    Karafet, T M; Zegura, S L; Posukh, O; Osipova, L; Bergen, A; Long, J; Goldman, D; Klitz, W; Harihara, S; de Knijff, P; Wiebe, V; Griffiths, R C; Templeton, A R; Hammer, M F

    1999-01-01

    Haplotypes constructed from Y-chromosome markers were used to trace the origins of Native Americans. Our sample consisted of 2,198 males from 60 global populations, including 19 Native American and 15 indigenous North Asian groups. A set of 12 biallelic polymorphisms gave rise to 14 unique Y-chromosome haplotypes that were unevenly distributed among the populations. Combining multiallelic variation at two Y-linked microsatellites (DYS19 and DXYS156Y) with the unique haplotypes results in a total of 95 combination haplotypes. Contra previous findings based on Y- chromosome data, our new results suggest the possibility of more than one Native American paternal founder haplotype. We postulate that, of the nine unique haplotypes found in Native Americans, haplotypes 1C and 1F are the best candidates for major New World founder haplotypes, whereas haplotypes 1B, 1I, and 1U may either be founder haplotypes and/or have arrived in the New World via recent admixture. Two of the other four haplotypes (YAP+ haplotypes 4 and 5) are probably present because of post-Columbian admixture, whereas haplotype 1G may have originated in the New World, and the Old World source of the final New World haplotype (1D) remains unresolved. The contrasting distribution patterns of the two major candidate founder haplotypes in Asia and the New World, as well as the results of a nested cladistic analysis, suggest the possibility of more than one paternal migration from the general region of Lake Baikal to the Americas. PMID:10053017

  3. Mitochondrial haplotype variation and phylogeography of Iberian brown trout populations.

    PubMed

    MacHordom, A; Suárez, J; Almodóvar, A; Bautista, J M

    2000-09-01

    The biogeographical distribution of brown trout mitochondrial DNA haplotypes throughout the Iberian Peninsula was established by polymerase chain reaction-restriction fragment polymorphism analysis. The study of 507 specimens from 58 localities representing eight widely separated Atlantic-slope (north and west Iberian coasts) and six Mediterranean drainage systems served to identify five main groups of mitochondrial haplotypes: (i) haplotypes corresponding to non-native, hatchery-reared brown trout that were widely distributed but also found in wild populations of northern Spain (Cantabrian slope); (ii) a widespread Atlantic haplotype group; (iii) a haplotype restricted to the Duero Basin; (iv) a haplotype shown by southern Iberian populations; and (v) a Mediterranean haplotype. The Iberian distribution of these haplotypes reflects both the current fishery management policy of introducing non-native brown trout, and Messinian palaeobiogeography. Our findings complement and extend previous allozyme studies on Iberian brown trout and improve present knowledge of glacial refugia and postglacial movement of brown trout lineages.

  4. The effect of using genealogy-based haplotypes for genomic prediction

    PubMed Central

    2013-01-01

    Background Genomic prediction uses two sources of information: linkage disequilibrium between markers and quantitative trait loci, and additive genetic relationships between individuals. One way to increase the accuracy of genomic prediction is to capture more linkage disequilibrium by regression on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. Methods A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (π) of the haplotype covariates had zero effect, i.e. a Bayesian mixture method. Results About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some cases, decreased the bias of prediction. With the Bayesian method, accuracy of prediction was less sensitive to parameter π when fitting haplotypes compared to fitting markers. Conclusions Use of haplotypes based on genealogy can slightly increase the accuracy of genomic prediction. Improved methods to cluster the haplotypes constructed from local genealogy could lead to additional gains in accuracy. PMID:23496971

  5. Characterization of swine leukocyte antigen alleles and haplotypes on a novel miniature pig line, Microminipig.

    PubMed

    Ando, A; Imaeda, N; Ohshima, S; Miyamoto, A; Kaneko, N; Takasu, M; Shiina, T; Kulski, J K; Inoko, H; Kitagawa, H

    2014-12-01

    Microminipigs are extremely small-sized, novel miniature pigs that were recently developed for medical research. The inbred Microminipigs with defined swine leukocyte antigen (SLA) haplotypes are expected to be useful for allo- and xenotransplantation studies and also for association analyses between SLA haplotypes and immunological traits. To establish SLA-defined Microminipig lines, we characterized the polymorphic SLA alleles for three class I (SLA-1, SLA-2 and SLA-3) and two class II (SLA-DRB1 and SLA-DQB1) genes of 14 parental Microminipigs using a high-resolution nucleotide sequence-based typing method. Eleven class I and II haplotypes, including three recombinant haplotypes, were found in the offspring of the parental Microminipigs. Two class I and class II haplotypes, Hp-31.0 (SLA-1*1502-SLA-3*070102-SLA-2*1601) and Hp-0.37 (SLA-DRB1*0701-SLA-DQB1*0502), are novel and have not so far been reported in other pig breeds. Crossover regions were defined by the analysis of 22 microsatellite markers within the SLA class III region of three recombinant haplotypes. The SLA allele and haplotype information of Microminipigs in this study will be useful to establish SLA homozygous lines including three recombinants for transplantation and immunological studies. © 2014 Stichting International Foundation for Animal Genetics.

  6. Evaluation of a SNP map of 6q24-27 confirms diabetic nephropathy loci and identifies novel associations type 2 diabetes patients enriched with nephropathy from an African American population

    PubMed Central

    Leak, Tennille S.; Mychaleckyj, Josyf C.; Smith, Shelly G.; Keene, Keith L.; Gordon, Candace J.; Hicks, Pamela J.; Freedman, Barry I.; Bowden, Donald W.; Sale, Michèle M.

    2009-01-01

    Previously we performed a genome scan for type 2 diabetes (T2DM) using 638 African-American (AA) affected sibling pairs from 247 families; non-parametric linkage analysis suggested evidence of linkage at 6q24-27 (LOD 2.26). To comprehensively evaluate this region we performed a 2-stage association study by first constructing a SNP map of 754 SNPs selected from HapMap on the basis of linkage disequilibrium (LD) in 300 AAT2DM-ESRD subjects, 311 AA controls, 43 European American controls and 45 Yoruba Nigerian samples (Set 1). Replication analyses were conducted in an independent population of 283 AA T2DM-ESRD subjects and 282 AA controls (Set 2). In addition, we adjusted for the impact of admixture on association results by using ancestry informative markers (AIMs). In Stage 1, 137 (18.2%) SNPs showed nominal evidence of association (P<0.05) in one or more of tests of association: allelic (n=33), dominant (n=36), additive (n=29), or recessive (n=34) genotypic models, and 2- (n=47) and 3-SNP (n=43) haplotypic analyses. These SNPs were selected for follow-up genotyping. Stage 2 analyses confirmed association with a predicted 2-SNP “risk” haplotype in the PARK2 gene. Also, two intergenic SNPs showed consistent genotypic association with T2DM-ESRD: rs12197043 and rs4897081. Combined analysis of all subjects from both stages revealed nominal associations with 17 SNPs within genes; including suggestive associations in ESR1 and PARK2. This study confirms known diabetic nephropathy loci and identifies potentially novel susceptibility variants located within 6q24-27 in AA. PMID:18560894

  7. The IGF1 small dog haplotype is derived from Middle Eastern grey wolves.

    PubMed

    Gray, Melissa M; Sutter, Nathan B; Ostrander, Elaine A; Wayne, Robert K

    2010-02-24

    A selective sweep containing the insulin-like growth factor 1 (IGF1) gene is associated with size variation in domestic dogs. Intron 2 of IGF1 contains a SINE element and single nucleotide polymorphism (SNP) found in all small dog breeds that is almost entirely absent from large breeds. In this study, we surveyed a large sample of grey wolf populations to better understand the ancestral pattern of variation at IGF1 with a particular focus on the distribution of the small dog haplotype and its relationship to the origin of the dog. We present DNA sequence data that confirms the absence of the derived small SNP allele in the intron 2 region of IGF1 in a large sample of grey wolves and further establishes the absence of a small dog associated SINE element in all wild canids and most large dog breeds. Grey wolf haplotypes from the Middle East have higher nucleotide diversity suggesting an origin there. Additionally, PCA and phylogenetic analyses suggests a closer kinship of the small domestic dog IGF1 haplotype with those from Middle Eastern grey wolves. The absence of both the SINE element and SNP allele in grey wolves suggests that the mutation for small body size post-dates the domestication of dogs. However, because all small dogs possess these diagnostic mutations, the mutations likely arose early in the history of domestic dogs. Our results show that the small dog haplotype is closely related to those in Middle Eastern wolves and is consistent with an ancient origin of the small dog haplotype there. Thus, in concordance with past archeological studies, our molecular analysis is consistent with the early evolution of small size in dogs from the Middle East.See associated opinion by Driscoll and Macdonald: http://jbiol.com/content/9/2/10.

  8. Interrelationships between Amerindian tribes of lower Amazonia as manifest by HLA haplotype disequilibria.

    PubMed

    Black, F L

    1984-11-01

    HLA B-C haplotypes exhibit common disequilibria in populations drawn from four continents, indicating that they are subject to broadly active selective forces. However, the A-B and A-C associations we have examined show no consistent disequilibrium pattern, leaving open the possibility that these disequilibria are due to descent from common progenitors. By examining HLA haplotype distributions, I have explored the implications that would follow from the hypothesis that biological selection played no role in determining A-C disequilibria in 10 diverse tribes of the lower Amazon Basin. Certain haplotypes are in strong positive disequilibria across a broad geographic area, suggesting that members of diverse tribes descend from common ancestors. On the basis of the extent of diffusion of the components of these haplotypes, one can estimate that the progenitors lived less than 6,000 years ago. One widely encountered lineage entered the area within the last 1,200 years. When haplotype frequencies are used in genetic distance measurements, they give a pattern of relationships very similar to that obtained by conventional chord measurements based on several genetic markers; but more than that, when individual haplotype disequilibria in the several tribes are compared, multiple origins of a single tribe are discernible and relationships are revealed that correlate more closely to geographic and linguistic patterns than do the genetic distance measurements.

  9. Very long haplotype tracts characterized at high resolution from HLA homozygous cell lines

    PubMed Central

    Norman, Paul J.; Norberg, Steve; Nemat-Gorgani, Neda; Royce, Thomas; Hollenbach, Jill A.; Won, Melissa Shults; Guethlein, Lisbeth A.; Gunderson, Kevin L.; Ronaghi, Mostafa; Parham, Peter

    2015-01-01

    The HLA region of chromosome 6 contains the most polymorphic genes in humans. Spanning ~5Mbp the densely packed region encompasses approximately 175 expressed genes including the highly polymorphic HLA class I and II loci. Most of the other genes and functional elements are also polymorphic, and many of them are directly implicated in immune function or immune-related disease. For these reasons this complex genomic region is subject to intense scrutiny by researchers with the common goal of aiding further understanding and diagnoses of multiple immune-related diseases and syndromes. To aid assay development and characterization of the classical loci, a panel of cell lines partially or fully homozygous for HLA class I and II was assembled over time by the International Histocompatibility Working Group (IHWG). Containing a minimum of 88 unique HLA haplotypes, we show this panel represents a significant proportion of European HLA allelic and haplotype diversity (60–95%). Using a high-density whole genome array that includes 13,331 HLA region SNPs, we analyzed 99 IHWG cells to map the coordinates of the homozygous tracts at a fine scale. The mean homozygous tract length within chromosome 6 from these individuals is 21Mbp. Within HLA the mean haplotype length is 4.3Mbp, and 65% of the cell lines were shown to be homozygous throughout the entire region. In addition, four cell lines are homozygous throughout the complex KIR region of chromosome 19 (~250kbp). The data we describe will provide a valuable resource for characterizing haplotypes, designing and refining imputation algorithms and developing assay controls. PMID:26198775

  10. Lower frequency of the HLA-G UTR-4 haplotype in women with unexplained recurrent miscarriage.

    PubMed

    Meuleman, T; Drabbels, J; van Lith, J M M; Dekkers, O M; Rozemuller, E; Cretu-Stancu, M; Claas, F H J; Bloemenkamp, K W M; Eikmans, M

    2018-04-01

    HLA-G expressed by trophoblasts at the fetal-maternal interface and its soluble form have immunomodulatory effects. HLA-G expression depends on the combination of DNA polymorphisms. We hypothesized that combinations of specific single nucleotide polymorphisms (SNPs) in the 3'untranslated region (3'UTR) of HLA-G play a role in unexplained recurrent miscarriage. In a case control design, 100 cases with at least three unexplained consecutive miscarriages prior to the 20th week of gestation were included. Cases were at time of the third miscarriage younger than 36 years, and they conceived all their pregnancies from the same partner. The control group included 89 women with an uneventful pregnancy. The association of HLA-G 3'UTR SNPs and specific HLA-G haplotype with recurrent miscarriage was studied with logistic regression. Odds ratios (OR) and 95% confidence intervals (95% CI) were reported. Individual SNPs were not significantly associated with recurrent miscarriage after correction for multiple comparisons. However, the presence of the UTR-4 haplotype, which included +3003C, was significantly lower in women with recurrent miscarriage (OR 0.4, 95% CI 0.2-0.8, p = 0.015). In conclusion, this is the first study to perform a comprehensive analysis of HLA-G SNPs and HLA-G haplotypes in a well-defined group of women with recurrent miscarriage and women with uneventful pregnancy. The UTR-4 haplotype was less frequently observed in women with recurrent miscarriage, suggesting an immunoregulatory role of this haplotype for continuation of the pregnancy without complications. Thus, association of HLA-G with recurrent miscarriage is not related to single polymorphisms in the 3'UTR, but is rather dependent on haplotypes. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Occurrence of 15 Haplotypes of Linepithema micans (Hymenoptera: Formicidae) in Southern Brazil.

    PubMed

    Ramalho, Manuela Oliveira; Martins, C; Campos, T; Nondillo, A; Botton, M; Bueno, O C

    2017-08-01

    The ant genus Linepithema is widely known, thanks to the pest species Linepithema humile (Mayr), which is easily mistaken for Linepithema micans (Forel) due to their morphological similarity. Like L. humile, L. micans is associated to the main grapevine pest in Brazil, Eurhizococcus brasiliensis (Wille), also known as ground pearl. Therefore, the present study uses mtDNA fragments to expand the knowledge of haplotype diversity and distribution of L. micans in the state of Rio Grande do Sul (Brazil), to understand the genetic differences of the populations identified in this study. We identified 15 haplotypes of L. micans spread across different localities. Twelve of these haplotypes were new for the species. The high haplotype diversity uncovered in Rio Grande do Sul (Brazil) for this species was predictable, as L. micans is in its native environment. Additional studies that take gene flow into account may reveal interesting aspects of diversity in these populations. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Genome-wide association mapping of frost tolerance in barley (Hordeum vulgare L.)

    PubMed Central

    2013-01-01

    Background Frost tolerance is a key trait with economic and agronomic importance in barley because it is a major component of winter hardiness, and therefore limits the geographical distribution of the crop and the effective transfer of quality traits between spring and winter crop types. Three main frost tolerance QTL (Fr-H1, Fr-H2 and Fr-H3) have been identified from bi-parental genetic mapping but it can be argued that those mapping populations only capture a portion of the genetic diversity of the species. A genetically broad dataset consisting of 184 genotypes, representative of the barley gene pool cultivated in the Mediterranean basin over an extended time period, was genotyped with 1536 SNP markers. Frost tolerance phenotype scores were collected from two trial sites, Foradada (Spain) and Fiorenzuola (Italy) and combined with the genotypic data in genome wide association analyses (GWAS) using Eigenstrat and kinship approaches to account for population structure. Results GWAS analyses identified twelve and seven positive SNP associations at Foradada and Fiorenzuola, respectively, using Eigenstrat and six and four, respectively, using kinship. Linkage disequilibrium analyses of the significant SNP associations showed they are genetically independent. In the kinship analysis, two of the significant SNP associations were tightly linked to the Fr-H2 and HvBmy loci on chromosomes 5H and 4HL, respectively. The other significant kinship associations were located in genomic regions that have not previously been associated with cold stress. Conclusions Haplotype analysis revealed that most of the significant SNP loci are fixed in the winter or facultative types, while they are freely segregating within the un-adapted spring barley genepool. Although there is a major interest in detecting new variation to improve frost tolerance of available winter and facultative types, from a GWAS perspective, working within the un-adapted spring germplasm pool is an attractive

  13. Genetic Mapping and Exome Sequencing Identify Variants Associated with Five Novel Diseases

    PubMed Central

    Puffenberger, Erik G.; Jinks, Robert N.; Sougnez, Carrie; Cibulskis, Kristian; Willert, Rebecca A.; Achilly, Nathan P.; Cassidy, Ryan P.; Fiorentini, Christopher J.; Heiken, Kory F.; Lawrence, Johnny J.; Mahoney, Molly H.; Miller, Christopher J.; Nair, Devika T.; Politi, Kristin A.; Worcester, Kimberly N.; Setton, Roni A.; DiPiazza, Rosa; Sherman, Eric A.; Eastman, James T.; Francklyn, Christopher; Robey-Bond, Susan; Rider, Nicholas L.; Gabriel, Stacey; Morton, D. Holmes; Strauss, Kevin A.

    2012-01-01

    The Clinic for Special Children (CSC) has integrated biochemical and molecular methods into a rural pediatric practice serving Old Order Amish and Mennonite (Plain) children. Among the Plain people, we have used single nucleotide polymorphism (SNP) microarrays to genetically map recessive disorders to large autozygous haplotype blocks (mean = 4.4 Mb) that contain many genes (mean = 79). For some, uninformative mapping or large gene lists preclude disease-gene identification by Sanger sequencing. Seven such conditions were selected for exome sequencing at the Broad Institute; all had been previously mapped at the CSC using low density SNP microarrays coupled with autozygosity and linkage analyses. Using between 1 and 5 patient samples per disorder, we identified sequence variants in the known disease-causing genes SLC6A3 and FLVCR1, and present evidence to strongly support the pathogenicity of variants identified in TUBGCP6, BRAT1, SNIP1, CRADD, and HARS. Our results reveal the power of coupling new genotyping technologies to population-specific genetic knowledge and robust clinical data. PMID:22279524

  14. Analysis of Shared Haplotypes amongst Palauans Maps Loci for Psychotic Disorders to 4q28 and 5q23-q31.

    PubMed

    Bodea, Corneliu A; Middleton, Frank A; Melhem, Nadine M; Klei, Lambertus; Song, Youeun; Tiobech, Josepha; Marumoto, Pearl; Yano, Victor; Faraone, Stephen V; Roeder, Kathryn; Myles-Worsley, Marina; Devlin, Bernie; Byerley, William

    2017-02-01

    To localize genetic variation affecting risk for psychotic disorders in the population of Palau, we genotyped DNA samples from 203 Palauan individuals diagnosed with psychotic disorders, broadly defined, and 125 control subjects using a genome-wide single nucleotide polymorphism array. Palau has unique features advantageous for this study: due to its population history, Palauans are substantially interrelated; affected individuals often, but not always, cluster in families; and we have essentially complete ascertainment of affected individuals. To localize risk variants to genomic regions, we evaluated long-shared haplotypes, ≥10 Mb, identifying clusters of affected individuals who share such haplotypes. This extensive sharing, typically identical by descent, was significantly greater in cases than population controls, even after controlling for relatedness. Several regions of the genome exhibited substantial excess of shared haplotypes for affected individuals, including 3p21, 3p12, 4q28, and 5q23-q31. Two of these regions, 4q28 and 5q23-q31, showed significant linkage by traditional LOD score analysis and could harbor variants of more sizeable risk for psychosis or a multiplicity of risk variants. The pattern of haplotype sharing in 4q28 highlights PCDH10 , encoding a cadherin-related neuronal receptor, as possibly involved in risk.

  15. MHC Class II haplotypes of Colombian Amerindian tribes

    PubMed Central

    Yunis, Juan J.; Yunis, Edmond J.; Yunis, Emilio

    2013-01-01

    We analyzed 1041 individuals belonging to 17 Amerindian tribes of Colombia, Chimila, Bari and Tunebo (Chibcha linguistic family), Embera, Waunana (Choco linguistic family), Puinave and Nukak (Maku-Puinave linguistic families), Cubeo, Guanano, Tucano, Desano and Piratapuyo (Tukano linguistic family), Guahibo and Guayabero (Guayabero Linguistic Family), Curripaco and Piapoco (Arawak linguistic family) and Yucpa (Karib linguistic family). for MHC class II haplotypes (HLA-DRB1, DQA1, DQB1). Approximately 90% of the MHC class II haplotypes found among these tribes are haplotypes frequently encountered in other Amerindian tribes. Nonetheless, striking differences were observed among Chibcha and non-Chibcha speaking tribes. The DRB1*04:04, DRB1*04:11, DRB1*09:01 carrying haplotypes were frequently found among non-Chibcha speaking tribes, while the DRB1*04:07 haplotype showed significant frequencies among Chibcha speaking tribes, and only marginal frequencies among non-Chibcha speaking tribes. Our results suggest that the differences in MHC class II haplotype frequency found among Chibcha and non-Chibcha speaking tribes could be due to genetic differentiation in Mesoamerica of the ancestral Amerindian population into Chibcha and non-Chibcha speaking populations before they entered into South America. PMID:23885196

  16. Y-SNPs haplotype diversity in four Chinese cattle breeds.

    PubMed

    Zhang, Runfeng; Cheng, Ming; Li, Xiaofeng; Chen, Fuying; Zheng, Jing; Wang, Xiaofei; Meng, Quanke

    2013-01-01

    To investigate the genetic diversity of Chinese cattle, 96 male samples of 4 Chinese native cattle breeds were investigated using 5 single nucleotide polymorphisms specific to the bovine Y chromosome. Two previously described haplotypes (taurine Y2 and indicine Y3) were detected in 74 and 22 animals, respectively. The haplotype frequencies varied amongst the four native breeds. The taurine Y2 haplotype dominated in the Qinchuan, Dabieshan, and Yunba breeds. However, the indicine Y3 haplotype occurred in high frequency in the Enshi breed. Among the four native breeds, Yunba had the highest haplotype diversity (0.4330 ± 0.0750), followed by Qinchuan (0.2899 ± 0.1028) and Enshi (0.2222 ± 0.1662), Dabieshan was the least differentiated (0.1079 ± 0.0680). Compared with some foreign cattle breeds, the low level of haplotype diversity was detected in our breeds (0.2633 ± 0.1030).

  17. Converging evidence that sequence variations in the novel candidate gene MAP2K7 (MKK7) are functionally associated with schizophrenia.

    PubMed

    Winchester, Catherine L; Ohzeki, Hiromitsu; Vouyiouklis, Demetrius A; Thompson, Rhiannon; Penninger, Josef M; Yamagami, Keiji; Norrie, John D; Hunter, Robert; Pratt, Judith A; Morris, Brian J

    2012-11-15

    Schizophrenia is a debilitating psychiatric disease with a strong genetic contribution, potentially linked to altered glutamatergic function in brain regions such as the prefrontal cortex (PFC). Here, we report converging evidence to support a functional candidate gene for schizophrenia. In post-mortem PFC from patients with schizophrenia, we detected decreased expression of MKK7/MAP2K7-a kinase activated by glutamatergic activity. While mice lacking one copy of the Map2k7 gene were overtly normal in a variety of behavioural tests, these mice showed a schizophrenia-like cognitive phenotype of impaired working memory. Additional support for MAP2K7 as a candidate gene came from a genetic association study. A substantial effect size (odds ratios: ~1.9) was observed for a common variant in a cohort of case and control samples collected in the Glasgow area and also in a replication cohort of samples of Northern European descent (most significant P-value: 3 × 10(-4)). While some caution is warranted until these association data are further replicated, these results are the first to implicate the candidate gene MAP2K7 in genetic risk for schizophrenia. Complete sequencing of all MAP2K7 exons did not reveal any non-synonymous mutations. However, the MAP2K7 haplotype appeared to have functional effects, in that it influenced the level of expression of MAP2K7 mRNA in human PFC. Taken together, the results imply that reduced function of the MAP2K7-c-Jun N-terminal kinase (JNK) signalling cascade may underlie some of the neurochemical changes and core symptoms in schizophrenia.

  18. Sparse Tensor Decomposition for Haplotype Assembly of Diploids and Polyploids.

    PubMed

    Hashemi, Abolfazl; Zhu, Banghua; Vikalo, Haris

    2018-03-21

    Haplotype assembly is the task of reconstructing haplotypes of an individual from a mixture of sequenced chromosome fragments. Haplotype information enables studies of the effects of genetic variations on an organism's phenotype. Most of the mathematical formulations of haplotype assembly are known to be NP-hard and haplotype assembly becomes even more challenging as the sequencing technology advances and the length of the paired-end reads and inserts increases. Assembly of haplotypes polyploid organisms is considerably more difficult than in the case of diploids. Hence, scalable and accurate schemes with provable performance are desired for haplotype assembly of both diploid and polyploid organisms. We propose a framework that formulates haplotype assembly from sequencing data as a sparse tensor decomposition. We cast the problem as that of decomposing a tensor having special structural constraints and missing a large fraction of its entries into a product of two factors, U and [Formula: see text]; tensor [Formula: see text] reveals haplotype information while U is a sparse matrix encoding the origin of erroneous sequencing reads. An algorithm, AltHap, which reconstructs haplotypes of either diploid or polyploid organisms by iteratively solving this decomposition problem is proposed. The performance and convergence properties of AltHap are theoretically analyzed and, in doing so, guarantees on the achievable minimum error correction scores and correct phasing rate are established. The developed framework is applicable to diploid, biallelic and polyallelic polyploid species. The code for AltHap is freely available from https://github.com/realabolfazl/AltHap . AltHap was tested in a number of different scenarios and was shown to compare favorably to state-of-the-art methods in applications to haplotype assembly of diploids, and significantly outperforms existing techniques when applied to haplotype assembly of polyploids.

  19. IL7Rα Expression and Upregulation by IFNβ in Dendritic Cell Subsets Is Haplotype-Dependent

    PubMed Central

    McKay, Fiona C.; Hoe, Edwin; Parnell, Grant; Gatt, Prudence; Schibeci, Stephen D.; Stewart, Graeme J.; Booth, David R.

    2013-01-01

    The IL7Rα gene is unequivocally associated with susceptibility to multiple sclerosis (MS). Haplotype 2 (Hap 2) confers protection from MS, and T cells and dendritic cells (DCs) of Hap 2 exhibit reduced splicing of exon 6, resulting in production of relatively less soluble receptor, and potentially more response to ligand. We have previously shown in CD4 T cells that IL7Rα haplotypes 1 and 2, but not 4, respond to interferon beta (IFNβ), the most commonly used immunomodulatory drug in MS, and that haplotype 4 (Hap 4) homozygotes have the highest risk of developing MS. We now show that IL7R expression increases in myeloid cells in response to IFNβ, but that the response is haplotype-dependent, with cells from homozygotes for Hap 4 again showing no response. This was shown using freshly derived monocytes, in vitro cultured immature and mature monocyte-derived dendritic cells, and by comparing homozygotes for the common haplotypes, and relative expression of alleles in heterozygotes (Hap 4 vs not Hap 4). As for T cells, in all myeloid cell subsets examined, Hap 2 homozygotes showed a trend for reduced splicing of exon 6 compared to the other haplotypes, significantly so in most conditions. These data are consistent with increased signaling being protective from MS, constitutively and in response to IFNβ. We also demonstrate significant regulation of immune response, chemokine activity and cytokine biosynthesis pathways by IL7Rα signaling in IFNβ -treated myeloid subsets. IFNβ-responsive genes are over-represented amongst genes associated with MS susceptibility. IL7Rα haplotype may contribute to MS susceptibility through reduced capacity for IL7Rα signalling in myeloid cells, especially in the presence of IFNβ, and is currently under investigation as a predictor of therapeutic response. PMID:24147013

  20. Vitamin K epoxide reductase complex subunit 1 (Vkorc1) haplotype diversity in mouse priority strains

    PubMed Central

    Song, Ying; Vera, Nicole; Kohn, Michael H

    2008-01-01

    Background Polymorphisms in the vitamin K-epoxide reductase complex subunit 1 gene, Vkorc1, could affect blood coagulation and other vitamin K-dependent proteins, such as osteocalcin (bone Gla protein, BGP). Here we sequenced the Vkorc1 gene in 40 mouse priority strains. We analyzed Vkorc1 haplotypes with respect to prothrombin time (PT) and bone mineral density and composition (BMD and BMC); phenotypes expected to be vitamin K-dependent and represented by data in the Mouse Phenome Database (MPD). Findings In the commonly used laboratory strains of Mus musculus domesticus we identified only four haplotypes differing in the intron or 5' region sequence of the Vkorc1. Six haplotypes differing by coding and non-coding polymorphisms were identified in the other subspecies of Mus. We detected no significant association of Vkorc1 haplotypes with PT, BMD and BMC within each subspecies of Mus. Vkorc1 haplotype sequences divergence between subspecies was associated with PT, BMD and BMC. Conclusion Phenotypic variation in PT, BMD and BMC within subspecies of Mus, while substantial, appears to be dominated by genetic variation in genes other than the Vkorc1. This was particularly evident for M. m. domesticus, where a single haplotype was observed in conjunction with virtually the entire range of PT, BMD and BMC values of all 5 subspecies of Mus included in this study. Differences in these phenotypes between subspecies also should not be attributed to Vkorc1 variants, but should be viewed as a result of genome wide genetic divergence. PMID:19046458

  1. High density genotyping of STAT4 gene reveals multiple haplotypic associations with Systemic Lupus Erythematosus in different racial groups

    PubMed Central

    Namjou, Bahram; Sestak, Andrea L.; Armstrong, Don L.; Zidovetzki, Raphael; Kelly, Jennifer A.; Jacob, Noam; Ciobanu, Voicu; Kaufman, Kenneth M.; Ojwang, Joshua O.; Ziegler, Julie; Quismorio, Francesco; Reiff, Andreas; Myones, Barry L.; Guthridge, Joel M.; Nath, Swapan K.; Bruner, Gail R.; Mehrian-Shai, Ruth; Silverman, Earl; Klein-Gitelman, Marisa; McCurdy, Deborah; Wagner-Weiner, Linda; Nocton, James J.; Putterman, Chaim; Bae, Sang-Cheol; Kim, Yun Jung; Petri, Michelle; Reveille, John D.; Vyse, Timothy J.; Gilkeson, Gary S.; Kamen, Diane L.; Alarcón-Riquelme, Marta E.; Gaffney, Patrick M.; Moser, Kathy L; Merrill, Joan T.; Scofield, R. Hal; James, Judith A.; Langefeld, Carl D.; Harley, John B.; Jacob, Chaim O.

    2009-01-01

    Objective Systemic lupus erythematosus (SLE) is the prototypic systemic autoimmune disorder with complex etiology and a strong genetic component. Recently, gene products involved in the interferon pathway have been under intense investigation in SLE pathogenesis. STAT1 and STAT4 are transcription factors that play key roles in the interferon and Th1 signaling pathways, making them attractive candidates for SLE susceptibility. Methods Fifty-six single-nucleotide polymorphisms (SNPs) across STAT1 and STAT4 genes on chromosome 2 were genotyped using Illumina platform as a part of extensive association study in a large collection of 9923 lupus cases and controls from different racial groups. DNA from patients and controls was obtained from peripheral blood. Principal component analyses and population based case-control association analyses were performed and the p values, FDR q values and Odds ratios with 95% confidence intervals (95% CIs) were calculated. Results We observed strong genetic associations with SLE and multiple SNPs located within the STAT4 gene in different ethnicities (Fisher combined p= 7.02×10−25). In addition to strong confirmation of the association in the 3rd intronic region of this gene reported previously, we identified additional haplotypic association across STAT4 gene and in particular a common risk haplotype that is found in multiple racial groups. In contrast, only a relatively weak suggestive association was observed with STAT1, probably due to the proximity to STAT4. Conclusion Our findings indicate that the STAT4 gene is likely to be a crucial component in SLE pathogenesis among multiple racial groups. The functional effects of this association, when revealed, might improve our understanding of the disease and provide new therapeutic targets. PMID:19333953

  2. The effects of NAMPT haplotypes and metabolic risk factors on circulating visfatin/NAMPT levels in childhood obesity.

    PubMed

    Belo, V A; Luizon, M R; Lacchini, R; Miranda, J A; Lanna, C M M; Souza-Costa, D C; Tanus-Santos, J E

    2015-01-01

    Polymorphisms in the NAMPT gene, which encodes the adipocytokine visfatin/nicotinamide phosphorybosil transferase (NAMPT), affect the circulating visfatin/NAMPT levels and are associated with obesity and cardiovascular diseases. However, no study has tested the hypothesis that NAMPT haplotypes could affect visfatin/NAMPT levels in case of childhood obesity. We investigated the effects of traditional metabolic risk factors (MRFs) and NAMPT polymorphisms T/C (rs1319501) and A/G (rs3801266) or haplotypes on visfatin/NAMPT levels in obese children and adolescents, and whether NAMPT polymorphisms and/or haplotypes are associated with susceptibility to childhood obesity. We studied 175 control, 99 obese and 82 obese with ⩾ 3 MRFs children and adolescents. Genotypes were determined by a Taqman allele discrimination assay and real-time PCR. The plasma visfatin/NAMPT level was measured using an enzyme immunoassay. Obese children and adolescents with ⩾ 3 MRFs had higher plasma visfatin/NAMPT levels in comparison with control children and adolescents (P<0.05). Although positive associations were observed between visfatin/NAMPT and body mass index (rs = 0.157; P = 0.034) as well as visfatin/NAMPT and waist circumference (rs = 0.192; P = 0.011), visfatin/NAMPT and high-density lipoprotein cholesterol were inversely associated (rs = -0.162; P = 0.031). No significant differences in genotype, allele or haplotype frequency distributions for the studied polymorphisms were found when the three groups were compared. However, higher plasma visfatin/NAMPT levels were found in control and obese subjects carrying the GG genotype for the A/G (rs3801266) polymorphism (P<0.05) but not in obese children with ⩾ 3 MRFs. Moreover, control subjects carrying the 'T-G' haplotype showed higher plasma visfatin/NAMPT levels. NAMPT genotypes or haplotypes were not associated with childhood obesity. Obesity in children with ⩾ 3 MRFs increases plasma visfatin/NAMPT levels, and this marker was

  3. Different DRB1*03:01-DQB1*02:01 haplotypes confer different risk for celiac disease.

    PubMed

    Alshiekh, S; Zhao, L P; Lernmark, Å; Geraghty, D E; Naluai, Å T; Agardh, D

    2017-08-01

    Celiac disease is associated with the HLA-DR3-DQA1*05:01-DQB1*02:01 and DR4-DQA1*03:01-DQB1*03:02 haplotypes. In addition, there are currently over 40 non-HLA loci associated with celiac disease. This study extends previous analyses on different HLA haplotypes in celiac disease using next generation targeted sequencing. Included were 143 patients with celiac disease and 135 non-celiac disease controls investigated at median 9.8 years (1.4-18.3 years). PCR-based amplification of HLA and sequencing with Illumina MiSeq technology were used for extended sequencing of the HLA class II haplotypes HLA-DRB1, DRB3, DRB4, DRB5, DQA1 and DQB1, respectively. Odds ratios were computed marginally for every allele and haplotype as the ratio of allelic frequency in patients and controls as ratio of exposure rates (RR), when comparing a null reference with equal exposure rates in cases and controls. Among the extended HLA haplotypes, the strongest risk haplotype for celiac disease was shown for DRB3*01:01:02 in linkage with DQA1*05:01-DQB1*02:01 (RR = 6.34; P-value < .0001). In a subpopulation analysis, DRB3*01:01:02-DQA1*05:01-DQB1*02:01 remained the most significant in patients with Scandinavian ethnicity (RR = 4.63; P < .0001) whereas DRB1*07:01:01-DRB4*01:03:01-DQA1*02:01-DQB1*02:02:01 presented the highest risk of celiac disease among non-Scandinavians (RR = 7.94; P = .011). The data also revealed 2 distinct celiac disease risk DR3-DQA1*05:01-DQB*02:01 haplotypes distinguished by either the DRB3*01:01:02 or DRB3*02:02:01 alleles, indicating that different DRB1*03:01-DQB1*02:01 haplotypes confer different risk for celiac disease. The associated risk of celiac disease for DR3-DRB3*01:01:02-DQA1*05:01-DQB1*02:01 is predominant among patients of Scandinavian ethnicity. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Haplotypes and gene expression implicate the MAPT region for Parkinson disease

    PubMed Central

    Tobin, J.E.; Latourelle, J.C.; Lew, M.F.; Klein, C.; Suchowersky, O.; Shill, H.A.; Golbe, L.I.; Mark, M.H.; Growdon, J.H.; Wooten, G.F.; Racette, B.A.; Perlmutter, J.S.; Watts, R.; Guttman, M.; Baker, K.B.; Goldwurm, S.; Pezzoli, G.; Singer, C.; Saint-Hilaire, M.H.; Hendricks, A.E.; Williamson, S.; Nagle, M.W.; Wilk, J.B.; Massood, T.; Laramie, J.M.; DeStefano, A.L.; Litvan, I.; Nicholson, G.; Corbett, A.; Isaacson, S.; Burn, D.J.; Chinnery, P.F.; Pramstaller, P.P.; Sherman, S.; Al-hinti, J.; Drasby, E.; Nance, M.; Moller, A.T.; Ostergaard, K.; Roxburgh, R.; Snow, B.; Slevin, J.T.; Cambi, F.; Gusella, J.F.; Myers, R.H.

    2009-01-01

    Background Microtubule-associated protein tau (MAPT) has been associated with several neurodegenerative disorders including forms of parkinsonism and Parkinson disease (PD). We evaluated the association of the MAPT region with PD in a large cohort of familial PD cases recruited by the GenePD Study. In addition, postmortem brain samples from patients with PD and neurologically normal controls were used to evaluate whether the expression of the 3-repeat and 4-repeat isoforms of MAPT, and neighboring genes Saitohin (STH) and KIAA1267, are altered in PD cerebellum. Methods Twenty-one single-nucleotide polymorphisms (SNPs) in the region of MAPT on chromosome 17q21 were genotyped in the GenePD Study. Single SNPs and haplotypes, including the H1 haplotype, were evaluated for association to PD. Relative quantification of gene expression was performed using real-time RT-PCR. Results After adjusting for multiple comparisons, SNP rs1800547 was significantly associated with PD affection. While the H1 haplotype was associated with a significantly increased risk for PD, a novel H1 subhaplotype was identified that predicted a greater increased risk for PD. The expression of 4-repeat MAPT, STH, and KIAA1267 was significantly increased in PD brains relative to controls. No difference in expression was observed for 3-repeat MAPT. Conclusions This study supports a role for MAPT in the pathogenesis of familial and idiopathic Parkinson disease (PD). Interestingly, the results of the gene expression studies suggest that other genes in the vicinity of MAPT, specifically STH and KIAA1267, may also have a role in PD and suggest complex effects for the genes in this region on PD risk. PMID:18509094

  5. Linkage Disequilibrium and Haplotype Diversity in the Genes of the Renin–Angiotensin System: Findings From the Family Blood Pressure Program

    PubMed Central

    Zhu, Xiaofeng; Yan, Denise; Cooper, Richard S.; Luke, Amy; Ikeda, Morna A.; Chang, Yen-Pei C.; Weder, Alan; Chakravarti, Aravinda

    2003-01-01

    Association studies of candidate genes with complex traits have generally used one or a few single nucleotide polymorphisms (SNPs), although variation in the extent of linkage disequilibrium (LD) within genes markedly influences the sensitivity and precision of association studies. The extent of LD and the underlying haplotype structure for most candidate genes are still unavailable. We sampled 193 blacks (African-Americans) and 160 whites (European-Americans) and estimated the intragenic LD and the haplotype structure in four genes of the renin–angiotensin system. We genotyped 25 SNPs, with all but one of the pairs spaced between 1 and 20 kb, thus providing resolution at small scale. The pattern of LD within a gene was very heterogeneous. Using a robust method to define haplotype blocks, blocks of limited haplotype diversity were identified at each locus; between these blocks, LD was lost owing to the history of recombination events. As anticipated, there was less LD among blacks, the number of haplotypes was substantially larger, and shorter haplotype segments were found, compared with whites. These findings have implications for candidate-gene association studies and indicate that variation between populations of European and African origin in haplotype diversity is characteristic of most genes. [The sequence data described in this paper are available in GenBank under the following accession nos: AGT, MIM 106150; Renin, MIM 179820; ACE, MIM 106180; Angiotensin receptor I, MIM 106165. Supplementary material is available online at http://www.genome.org.] PMID:12566395

  6. Intrahaplotypic Variants Differentiate Complex Linkage Disequilibrium within Human MHC Haplotypes

    PubMed Central

    Lam, Tze Hau; Tay, Matthew Zirui; Wang, Bei; Xiao, Ziwei; Ren, Ee Chee

    2015-01-01

    Distinct regions of long-range genetic fixation in the human MHC region, known as conserved extended haplotypes (CEHs), possess unique genomic characteristics and are strongly associated with numerous diseases. While CEHs appear to be homogeneous by SNP analysis, the nature of fine variations within their genomic structure is unknown. Using multiple, MHC-homozygous cell lines, we demonstrate extensive sequence conservation in two common Asian MHC haplotypes: A33-B58-DR3 and A2-B46-DR9. However, characterization of phase-resolved MHC haplotypes revealed unique intra-CEH patterns of variation and uncovered 127 single nucleotide variants (SNVs) which are missing from public databases. We further show that the strong linkage disequilibrium structure within the human MHC that typically confounds precise identification of genetic features can be resolved using intra-CEH variants, as evidenced by rs3129063 and rs448489, which affect expression of ZFP57, a gene important in methylation and epigenetic regulation. This study demonstrates an improved strategy that can be used towards genetic dissection of diseases. PMID:26593880

  7. [A total of 362 HLA different haplotypes and HLA recombination haplotypes based on analysis of their family pedigree in Chinese partial Han populations].

    PubMed

    Gao, Su-Qing; Cheng, Xi; Li, Qian; Li, Yu-Zhu; Deng, Zhi-Hui

    2009-06-01

    This study was aimed to discover the novel HLA recombination haplotypes and investigate the distribution of haplotypes in Chinese Han population. Based on the HLA-A, B, DRB1 typing results of 179 family members, 791 haplotypes were assigned by the mode of inheritance. The results showed that a total of 4 novel recombinant haplotypes in HLA-DRB1 locus region were observed in 4 families, which ratio of paternal to maternal chromosomes was 3:1. The recombination ratio between HLA-DRB1 and HLA-A or B loci was 0.92% (4/433). There were a total of 362 kinds of HLA-A, -B, -DRB1 haplotypes to be confirmed in Chinese Han partial population. A33-B58-DR17, A2-B46-DR9, A30-B13-DR7, A11-B13-DR15, A11-B75-DR12 and A2-B46-DR14 were the most common haplotypes that was consistent with the distribution of HLA alleles in unrelated donors. There were A1-B63-DR12, A29-B46-DR15, A1-B61-DR10, A34-B35-DR9, A29-B54-DR4, A23-B13-DR16 and A34-B62-DR15 haplotypes and so on, which were rare haplotypes not yet reported in Chinese. It is concluded that the HLA-A-B-DRB1 haplotypes would be confirmed by analysis of their family pedigree. The results obtained in this study are basic data for study of Chinese anthropology, organ transplantation and disease correlation analysis.

  8. Better ILP models for haplotype assembly.

    PubMed

    Etemadi, Maryam; Bagherian, Mehri; Chen, Zhi-Zhong; Wang, Lusheng

    2018-02-19

    The haplotype assembly problem for diploid is to find a pair of haplotypes from a given set of aligned Single Nucleotide Polymorphism (SNP) fragments (reads). It has many applications in association studies, drug design, and genetic research. Since this problem is computationally hard, both heuristic and exact algorithms have been designed for it. Although exact algorithms are much slower, they are still of great interest because they usually output significantly better solutions than heuristic algorithms in terms of popular measures such as the Minimum Error Correction (MEC) score, the number of switch errors, and the QAN50 score. Exact algorithms are also valuable because they can be used to witness how good a heuristic algorithm is. The best known exact algorithm is based on integer linear programming (ILP) and it is known that ILP can also be used to improve the output quality of every heuristic algorithm with a little decline in speed. Therefore, faster ILP models for the problem are highly demanded. As in previous studies, we consider not only the general case of the problem but also its all-heterozygous case where we assume that if a column of the input read matrix contains at least one 0 and one 1, then it corresponds to a heterozygous SNP site. For both cases, we design new ILP models for the haplotype assembly problem which aim at minimizing the MEC score. The new models are theoretically better because they contain significantly fewer constraints. More importantly, our experimental results show that for both simulated and real datasets, the new model for the all-heterozygous (respectively, general) case can usually be solved via CPLEX (an ILP solver) at least 5 times (respectively, twice) faster than the previous bests. Indeed, the running time can sometimes be 41 times better. This paper proposes a new ILP model for the haplotype assembly problem and its all-heterozygous case, respectively. Experiments with both real and simulated datasets show that the

  9. Haplotype Reconstruction in Large Pedigrees with Many Untyped Individuals

    NASA Astrophysics Data System (ADS)

    Li, Xin; Li, Jing

    Haplotypes, as they specify the linkage patterns between dispersed genetic variations, provide important information for understanding the genetics of human traits. However haplotypes are not directly available from current genotyping platforms, and hence there are extensive investigations of computational methods to recover such information. Two major computational challenges arising in current family-based disease studies are large family sizes and many ungenotyped family members. Traditional haplotyping methods can neither handle large families nor families with missing members. In this paper, we propose a method which addresses these issues by integrating multiple novel techniques. The method consists of three major components: pairwise identical-bydescent (IBD) inference, global IBD reconstruction and haplotype restoring. By reconstructing the global IBD of a family from pairwise IBD and then restoring the haplotypes based on the inferred IBD, this method can scale to large pedigrees, and more importantly it can handle families with missing members. Compared with existing methods, this method demonstrates much higher power to recover haplotype information, especially in families with many untyped individuals.

  10. Significant association between IL10-1082/-819 and TNF-308 haplotypes and the susceptibility to cervical carcinogenesis in women infected by Human papillomavirus.

    PubMed

    Chagas, Bárbara Simas; Lima, Rita de Cássia Pereira de; Paiva Júnior, Sérgio de Sá Leitão; Silva, Ruany Cristyne de Oliveira; Cordeiro, Marcelo Nazário; Silva Neto, Jacinto da Costa; Batista, Marcus Vinicius de Aragão; Silva, Anna Jéssica Duarte; Gurgel, Ana Pavla Almeida Diniz; Freitas, Antonio Carlos de

    2018-06-20

    Human papillomavirus (HPV) is responsible for high-grade cervical lesions and cervical cancer. The inflammation plays a key role in cervical cancer progression. In this context, studies propose an association between TNFα and IL10 SNPs and susceptibility to HPV infection. The present work aimed to investigate the possible association between IL10 and TNFα promoter polymorphisms and HPV infection in the cervical carcinogenesis risk in women from Brazil. A total of 654 samples was evaluated in this study. HPV detection was performed by PCR and HPV genotyping was performed by PCR and sequencing of positive MY09/11 PCR product. Genotyping of IL10 SNPs (rs1800871 and rs1800896) was performed by High Resolution Melt analysis. Genotyping of TNFα SNP (rs1800629) was performed by fluorogenic allele-specific probes. The distribution of TNF-308 (rs1800629) allelic (p = 0.03) and genotype (p = 0.03) frequencies and HPV-58 infection has showed a statistically significant difference between case and control groups for the assessed TNFα polymorphism. When it comes to TNFα (rs1800629) allelic and genotypic distribution and HPVs 18 and 31 infections, no statistically significant differences between case and control groups were observed for the studied TNFα polymorphism. The allelic and genotypic distribution of IL10-819 (rs1800871) and IL10-1082 (rs1800896) and HPV infection (HPVs 58, 18 and 31) has showed no statistically significant differences between case and control groups for the assessed IL10 polymorphisms. Furthermore, it was observed that haplotypes were associated with an increased cervical cancer risk in HPVs 16, 18 and 58-positive women. It was observed that women carrying the GTA and ATG haplotypes had 3.85 and 17.99-fold, respectively, increased cervical cancer susceptibility when infected by HPV-58. In women infected with HPV-16 and HPV-18, statistically significant results in women carrying the GTA and ATA haplotypes was observed. They had a 2.32 and 3

  11. Global variation in CYP2C8–CYP2C9 functional haplotypes

    PubMed Central

    Speed, William C; Kang, Soonmo Peter; Tuck, David P; Harris, Lyndsay N; Kidd, Kenneth K

    2009-01-01

    We have studied the global frequency distributions of 10 single nucleotide polymorphisms (SNPs) across 132 kb of CYP2C8 and CYP2C9 in ∼2500 individuals representing 45 populations. Five of the SNPs were in noncoding sequences; the other five involved the more common missense variants (four in CYP2C8, one in CYP2C9) that change amino acids in the gene products. One haplotype containing two CYP2C8 coding variants and one CYP2C9 coding variant reaches an average frequency of 10% in Europe; a set of haplotypes with a different CYP2C8 coding variant reaches 17% in Africa. In both cases these haplotypes are found in other regions of the world at <1%. This considerable geographic variation in haplotype frequencies impacts the interpretation of CYP2C8/CYP2C9 association studies, and has pharmacogenomic implications for drug interactions. PMID:19381162

  12. Linkage disequilibrium, SNP frequency change due to selection, and association mapping in popcorn chromosome regions containing QTLs for quality traits

    PubMed Central

    Paes, Geísa Pinheiro; Viana, José Marcelo Soriano; Silva, Fabyano Fonseca e; Mundim, Gabriel Borges

    2016-01-01

    Abstract The objectives of this study were to assess linkage disequilibrium (LD) and selection-induced changes in single nucleotide polymorphism (SNP) frequency, and to perform association mapping in popcorn chromosome regions containing quantitative trait loci (QTLs) for quality traits. Seven tropical and two temperate popcorn populations were genotyped for 96 SNPs chosen in chromosome regions containing QTLs for quality traits. The populations were phenotyped for expansion volume, 100-kernel weight, kernel sphericity, and kernel density. The LD statistics were the difference between the observed and expected haplotype frequencies (D), the proportion of D relative to the expected maximum value in the population, and the square of the correlation between the values of alleles at two loci. Association mapping was based on least squares and Bayesian approaches. In the tropical populations, D-values greater than 0.10 were observed for SNPs separated by 100-150 Mb, while most of the D-values in the temperate populations were less than 0.05. Selection for expansion volume indirectly led to increase in LD values, population differentiation, and significant changes in SNP frequency. Some associations were observed for expansion volume and the other quality traits. The candidate genes are involved with starch, storage protein, lipid, and cell wall polysaccharides synthesis. PMID:27007903

  13. Linkage disequilibrium, SNP frequency change due to selection, and association mapping in popcorn chromosome regions containing QTLs for quality traits.

    PubMed

    Paes, Geísa Pinheiro; Viana, José Marcelo Soriano; Silva, Fabyano Fonseca E; Mundim, Gabriel Borges

    2016-03-01

    The objectives of this study were to assess linkage disequilibrium (LD) and selection-induced changes in single nucleotide polymorphism (SNP) frequency, and to perform association mapping in popcorn chromosome regions containing quantitative trait loci (QTLs) for quality traits. Seven tropical and two temperate popcorn populations were genotyped for 96 SNPs chosen in chromosome regions containing QTLs for quality traits. The populations were phenotyped for expansion volume, 100-kernel weight, kernel sphericity, and kernel density. The LD statistics were the difference between the observed and expected haplotype frequencies (D), the proportion of D relative to the expected maximum value in the population, and the square of the correlation between the values of alleles at two loci. Association mapping was based on least squares and Bayesian approaches. In the tropical populations, D-values greater than 0.10 were observed for SNPs separated by 100-150 Mb, while most of the D-values in the temperate populations were less than 0.05. Selection for expansion volume indirectly led to increase in LD values, population differentiation, and significant changes in SNP frequency. Some associations were observed for expansion volume and the other quality traits. The candidate genes are involved with starch, storage protein, lipid, and cell wall polysaccharides synthesis.

  14. Structural forms of the human amylase locus and their relationships to SNPs, haplotypes, and obesity

    PubMed Central

    Usher, Christina L; Handsaker, Robert E; Esko, Tõnu; Tuke, Marcus A; Weedon, Michael N; Hastie, Alex R; Cao, Han; Moon, Jennifer E; Kashin, Seva; Fuchsberger, Christian; Metspalu, Andres; Pato, Carlos N; Pato, Michele T; McCarthy, Mark I; Boehnke, Michael; Altshuler, David M; Frayling, Timothy M; Hirschhorn, Joel N; McCarroll, Steven A

    2016-01-01

    Hundreds of genes reside in structurally complex, poorly understood regions of the human genome1-3. One such region contains the three amylase genes (AMY2B, AMY2A, and AMY1) responsible for digesting starch into sugar. The copy number of AMY1 is reported to be the genome’s largest influence on obesity4, though genome-wide association studies for obesity have found this locus unremarkable. Using whole genome sequence analysis3,5, droplet digital PCR6, and genome mapping7, we identified eight common structural haplotypes of the amylase locus that suggest its mutational history. We found that AMY1 copy number in individuals’ genomes is generally even (rather than odd) and partially correlates to nearby SNPs, which do not associate with BMI. We measured amylase gene copy number in 1,000 obese or lean Estonians and in two other cohorts totaling ~3,500 individuals. We had 99% power to detect the lower bound of the reported effects on BMI4, yet found no association. PMID:26098870

  15. Genetic Dissection of the Human Leukocyte Antigen Region by Use of Haplotypes of Tasmanians with Multiple Sclerosis

    PubMed Central

    Rubio, Justin P.; Bahlo, Melanie; Butzkueven, Helmut; van der Mei, Ingrid A. F.; Sale, Michèle M.; Dickinson, Joanne L.; Groom, Patricia; Johnson, Laura J.; Simmons, Rex D.; Tait, Brian; Varney, Mike; Taylor, Bruce; Dwyer, Terence; Williamson, Robert; Gough, Nicholas M.; Kilpatrick, Trevor J.; Speed, Terence P.; Foote, Simon J.

    2002-01-01

    Association of multiple sclerosis (MS) with the human leukocyte antigen (HLA) class II haplotype DRB1*1501-DQB1*0602 is the most consistently replicated finding of genetic studies of the disease. However, the high level of linkage disequilibrium (LD) in the HLA region has hindered the identification of other loci that single-marker tests for association are unlikely to resolve. In order to address this issue, we generated haplotypes spanning 14.754 Mb (5 cM) across the entire HLA region. The haplotypes, which were inferred by genotyping relatives of 152 patients with MS and 105 unaffected control subjects of Tasmanian ancestry, define a genomic segment from D6S276 to D6S291, including 13 microsatellite markers integrated with allele-typing data for DRB1 and DQB1. Association to the DRB1*1501-DQB1*0602 haplotype was replicated. In addition, we found that the class I/extended class I region, defined by a genomic segment of ∼400 kb between MOGCA and D6S265, harbors genes that independently increase risk of, or provide protection from, MS. Log-linear modeling analysis of constituent haplotypes that represent genomic regions containing class I (MOGCA-D6S265), class III (TNFa-TNFd-D6S273), and class II (DRB1-DQB1) genes indicated that having class I and class II susceptibility variants on the same haplotype provides an additive effect on risk. Moreover, we found no evidence for a disease locus in the class III region defined by a 150-kb genomic segment containing the TNF locus and 14 other genes. A global overview of LD performed using GOLD identified two discrete blocks of LD in the HLA region that correspond well with previous findings. We propose that the analysis of haplotypes, by use of the types of approaches outlined in the present article, should make it possible to more accurately define the contribution of the HLA to MS. PMID:11923913

  16. Hapl-o-Mat: open-source software for HLA haplotype frequency estimation from ambiguous and heterogeneous data.

    PubMed

    Schäfer, Christian; Schmidt, Alexander H; Sauter, Jürgen

    2017-05-30

    Knowledge of HLA haplotypes is helpful in many settings as disease association studies, population genetics, or hematopoietic stem cell transplantation. Regarding the recruitment of unrelated hematopoietic stem cell donors, HLA haplotype frequencies of specific populations are used to optimize both donor searches for individual patients and strategic donor registry planning. However, the estimation of haplotype frequencies from HLA genotyping data is challenged by the large amount of genotype data, the complex HLA nomenclature, and the heterogeneous and ambiguous nature of typing records. To meet these challenges, we have developed the open-source software Hapl-o-Mat. It estimates haplotype frequencies from population data including an arbitrary number of loci using an expectation-maximization algorithm. Its key features are the processing of different HLA typing resolutions within a given population sample and the handling of ambiguities recorded via multiple allele codes or genotype list strings. Implemented in C++, Hapl-o-Mat facilitates efficient haplotype frequency estimation from large amounts of genotype data. We demonstrate its accuracy and performance on the basis of artificial and real genotype data. Hapl-o-Mat is a versatile and efficient software for HLA haplotype frequency estimation. Its capability of processing various forms of HLA genotype data allows for a straightforward haplotype frequency estimation from typing records usually found in stem cell donor registries.

  17. The JAK2 46/1 haplotype predisposes to MPL-mutated myeloproliferative neoplasms

    PubMed Central

    Jones, Amy V.; Campbell, Peter J.; Beer, Philip A.; Schnittger, Susanne; Vannucchi, Alessandro M.; Zoi, Katerina; Percy, Melanie J.; McMullin, Mary Frances; Scott, Linda M.; Tapper, William; Silver, Richard T.; Oscier, David; Harrison, Claire N.; Grallert, Harald; Kisialiou, Aliaksei; Strike, Paul; Chase, Andrew J.; Green, Anthony R.

    2010-01-01

    The 46/1 JAK2 haplotype predisposes to V617F-positive myeloproliferative neoplasms, but the underlying mechanism is obscure. We analyzed essential thrombocythemia patients entered into the PT-1 studies and, as expected, found that 46/1 was overrepresented in V617F-positive cases (n = 404) versus controls (n = 1492, P = 3.9 × 10−11). The 46/1 haplotype was also overrepresented in cases without V617F (n = 347, P = .009), with an excess seen for both MPL exon 10 mutated and V617F, MPL exon 10 nonmutated cases. Analysis of further MPL-positive, V617F-negative cases confirmed an excess of 46/1 (n = 176, P = .002), but no association between MPL mutations and MPL haplotype was seen. An excess of 46/1 was also seen in JAK2 exon 12 mutated cases (n = 69, P = .002), and these mutations preferentially arose on the 46/1 chromosome (P = .029). No association between 46/1 and clinical or laboratory features was seen in the PT-1 cohort either with or without V617F. The excess of 46/1 in JAK2 exon 12 cases is compatible with both the “hypermutability” and “fertile ground” hypotheses, but the excess in MPL-mutated cases argues against the former. No difference in sequence, splicing, or expression of JAK2 was found on 46/1 compared with other haplotypes, suggesting that any functional difference of JAK2 on 46/1, if it exists, must be relatively subtle. PMID:20304805

  18. BMP4 and FGF3 haplotypes increase the risk of tendinopathy in volleyball athletes.

    PubMed

    Salles, José Inácio; Amaral, Marcus Vinícius; Aguiar, Diego Pinheiro; Lira, Daisy Anne; Quinelato, Valquiria; Bonato, Letícia Ladeira; Duarte, Maria Eugenia Leite; Vieira, Alexandre Rezende; Casado, Priscila Ladeira

    2015-03-01

    To investigate whether genetic variants can be correlated with tendinopathy in elite male volleyball athletes. Case-control study. Fifteen single nucleotide polymorphisms within BMP4, FGF3, FGF10, FGFR1 genes were investigated in 138 elite volleyball athletes, aged between 18 and 35 years, who undergo 4-5h of training per day: 52 with tendinopathy and 86 with no history of pain suggestive of tendinopathy in patellar, Achilles, shoulder, and hip abductors tendons. The clinical diagnostic criterion was progressive pain during training, confirmed by magnetic resonance image. Genomic DNA was obtained from saliva samples. Genetic markers were genotyped using TaqMan real-time PCR. Chi-square test compared genotypes and haplotype differences between groups. Multivariate logistic regression analyzed the significance of covariates and incidence of tendinopathy. Statistical analysis revealed participant age (p=0.005) and years of practice (p=0.004) were risk factors for tendinopathy. A significant association between BMP4 rs2761884 (p=0.03) and tendinopathy was observed. Athletes with a polymorphic genotype have 2.4 times more susceptibility to tendinopathy (OR=2.39; 95%CI=1.10-5.19). Also, association between disease and haplotype TTGGA in BMP4 (p=0.01) was observed. The FGF3 TGGTA haplotype showed a tendency of association with tendinopathy (p=0.05), and so did FGF10 rs900379. FGFR1 showed no association with disease. These findings indicate that haplotypes in BMP4 and FGF3 genes may contribute to the tendon disease process in elite volleyball athletes. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  19. Transancestral mapping of the MHC region in systemic lupus erythematosus identifies new independent and interacting loci at MSH5, HLA-DPB1 and HLA-G

    PubMed Central

    Fernando, Michelle M A; Freudenberg, Jan; Lee, Annette; Morris, David Lester; Boteva, Lora; Rhodes, Benjamin; Gonzalez-Escribano, María Francisca; Lopez-Nevot, Miguel Angel; Navarra, Sandra V; Gregersen, Peter K; Martin, Javier; Vyse, Timothy J

    2012-01-01

    Objectives Systemic lupus erythematosus (SLE) is a chronic multisystem genetically complex autoimmune disease characterised by the production of autoantibodies to nuclear and cellular antigens, tissue inflammation and organ damage. Genome-wide association studies have shown that variants within the major histocompatibility complex (MHC) region on chromosome 6 confer the greatest genetic risk for SLE in European and Chinese populations. However, the causal variants remain elusive due to tight linkage disequilibrium across disease-associated MHC haplotypes, the highly polymorphic nature of many MHC genes and the heterogeneity of the SLE phenotype. Methods A high-density case-control single nucleotide polymorphism (SNP) study of the MHC region was undertaken in SLE cohorts of Spanish and Filipino ancestry using a custom Illumina chip in order to fine-map association signals in these haplotypically diverse populations. In addition, comparative analyses were performed between these two datasets and a northern European UK SLE cohort. A total of 1433 cases and 1458 matched controls were examined. Results Using this transancestral SNP mapping approach, novel independent loci were identified within the MHC region in UK, Spanish and Filipino patients with SLE with some evidence of interaction. These loci include HLA-DPB1, HLA-G and MSH5 which are independent of each other and HLA-DRB1 alleles. Furthermore, the established SLE-associated HLA-DRB1*15 signal was refined to an interval encompassing HLA-DRB1 and HLA-DQA1. Increased frequencies of MHC region risk alleles and haplotypes were found in the Filipino population compared with Europeans, suggesting that the greater disease burden in non-European SLE may be due in part to this phenomenon. Conclusion These data highlight the usefulness of mapping disease susceptibility loci using a transancestral approach, particularly in a region as complex as the MHC, and offer a springboard for further fine-mapping, resequencing and

  20. ABCB1 haplotype and OPRM1 118A > G genotype interaction in methadone maintenance treatment pharmacogenetics

    PubMed Central

    Barratt, Daniel T; Coller, Janet K; Hallinan, Richard; Byrne, Andrew; White, Jason M; Foster, David JR; Somogyi, Andrew A

    2012-01-01

    Background: Genetic variability in ABCB1, encoding the P-glycoprotein efflux transporter, has been linked to altered methadone maintenance treatment dose requirements. However, subsequent studies have indicated that additional environmental or genetic factors may confound ABCB1 pharmacogenetics in different methadone maintenance treatment settings. There is evidence that genetic variability in OPRM1, encoding the mu opioid receptor, and ABCB1 may interact to affect morphine response in opposite ways. This study aimed to examine whether a similar gene-gene interaction occurs for methadone in methadone maintenance treatment. Methods: Opioid-dependent subjects (n = 119) maintained on methadone (15–300 mg/day) were genotyped for five single nucleotide polymorphisms of ABCB1 (61A > G; 1199G > A; 1236C > T; 2677G > T; 3435C > T), as well as for the OPRM1 118A > G single nucleotide polymorphism. Subjects’ methadone doses and trough plasma (R)-methadone concentrations (Ctrough) were compared between ABCB1 haplotypes (with and without controlling for OPRM1 genotype), and between OPRM1 genotypes (with and without controlling for ABCB1 haplotype). Results: Among wild-type OPRM1 subjects, an ABCB1 variant haplotype group (subjects with a wild-type and 61A:1199G:1236C:2677T:3435T haplotype combination, or homozygous for the 61A:1199G:1236C:2677T:3435T haplotype) had significantly lower doses (median ± standard deviation 35 ± 5 versus 180 ± 65 mg/day, P < 0.01) and Ctrough (78 ± 22 versus 177 ± 97 ng/mL, P < 0.05) than ABCB1 wild-type subjects. Among subjects with the most common ABCB1 haplotype combination (wild-type with 61A:1199G:1236T:2677T:3435T), the OPRM1 118 A/G genotype was associated with a significantly higher Ctrough than 118 A/A (250 ± 126 versus 108 ± 36 ng/mL, P = 0.016). No ABCB1 haplotype group or OPRM1 genotype was associated with dose or Ctrough without taking into account confounding genetic variability at the other locus. Therefore, two

  1. HaploForge: a comprehensive pedigree drawing and haplotype visualization web application.

    PubMed

    Tekman, Mehmet; Medlar, Alan; Mozere, Monika; Kleta, Robert; Stanescu, Horia

    2017-12-15

    Haplotype reconstruction is an important tool for understanding the aetiology of human disease. Haplotyping infers the most likely phase of observed genotypes conditional on constraints imposed by the genotypes of other pedigree members. The results of haplotype reconstruction, when visualized appropriately, show which alleles are identical by descent despite the presence of untyped individuals. When used in concert with linkage analysis, haplotyping can help delineate a locus of interest and provide a succinct explanation for the transmission of the trait locus. Unfortunately, the design choices made by existing haplotype visualization programs do not scale to large numbers of markers. Indeed, following haplotypes from generation to generation requires excessive scrolling back and forth. In addition, the most widely used program for haplotype visualization produces inconsistent recombination artefacts for the X chromosome. To resolve these issues, we developed HaploForge, a novel web application for haplotype visualization and pedigree drawing. HaploForge takes advantage of HTML5 to be fast, portable and avoid the need for local installation. It can accurately visualize autosomal and X-linked haplotypes from both outbred and consanguineous pedigrees. Haplotypes are coloured based on identity by descent using a novel A* search algorithm and we provide a flexible viewing mode to aid visual inspection. HaploForge can currently process haplotype reconstruction output from Allegro, GeneHunter, Merlin and Simwalk. HaploForge is licensed under GPLv3 and is hosted and maintained via GitHub. https://github.com/mtekman/haploforge. r.kleta@ucl.ac.uk. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  2. Trans-ancestral studies fine map the SLE-susceptibility locus TNFSF4.

    PubMed

    Manku, Harinder; Langefeld, Carl D; Guerra, Sandra G; Malik, Talat H; Alarcon-Riquelme, Marta; Anaya, Juan-Manuel; Bae, Sang-Cheol; Boackle, Susan A; Brown, Elizabeth E; Criswell, Lindsey A; Freedman, Barry I; Gaffney, Patrick M; Gregersen, Peter A; Guthridge, Joel M; Han, Sang-Hoon; Harley, John B; Jacob, Chaim O; James, Judith A; Kamen, Diane L; Kaufman, Kenneth M; Kelly, Jennifer A; Martin, Javier; Merrill, Joan T; Moser, Kathy L; Niewold, Timothy B; Park, So-Yeon; Pons-Estel, Bernardo A; Sawalha, Amr H; Scofield, R Hal; Shen, Nan; Stevens, Anne M; Sun, Celi; Gilkeson, Gary S; Edberg, Jeff C; Kimberly, Robert P; Nath, Swapan K; Tsao, Betty P; Vyse, Tim J

    2013-01-01

    We previously established an 80 kb haplotype upstream of TNFSF4 as a susceptibility locus in the autoimmune disease SLE. SLE-associated alleles at this locus are associated with inflammatory disorders, including atherosclerosis and ischaemic stroke. In Europeans, the TNFSF4 causal variants have remained elusive due to strong linkage disequilibrium exhibited by alleles spanning the region. Using a trans-ancestral approach to fine-map the locus, utilising 17,900 SLE and control subjects including Amerindian/Hispanics (1348 cases, 717 controls), African-Americans (AA) (1529, 2048) and better powered cohorts of Europeans and East Asians, we find strong association of risk alleles in all ethnicities; the AA association replicates in African-American Gullah (152,122). The best evidence of association comes from two adjacent markers: rs2205960-T (P=1.71 × 10(-34) , OR=1.43[1.26-1.60]) and rs1234317-T (P=1.16 × 10(-28) , OR=1.38[1.24-1.54]). Inference of fine-scale recombination rates for all populations tested finds the 80 kb risk and non-risk haplotypes in all except African-Americans. In this population the decay of recombination equates to an 11 kb risk haplotype, anchored in the 5' region proximal to TNFSF4 and tagged by rs2205960-T after 1000 Genomes phase 1 (v3) imputation. Conditional regression analyses delineate the 5' risk signal to rs2205960-T and the independent non-risk signal to rs1234314-C. Our case-only and SLE-control cohorts demonstrate robust association of rs2205960-T with autoantibody production. The rs2205960-T is predicted to form part of a decameric motif which binds NF-κBp65 with increased affinity compared to rs2205960-G. ChIP-seq data also indicate NF-κB interaction with the DNA sequence at this position in LCL cells. Our research suggests association of rs2205960-T with SLE across multiple groups and an independent non-risk signal at rs1234314-C. rs2205960-T is associated with autoantibody production and lymphopenia. Our data confirm a

  3. Identification of specific angiotensin-converting enzyme variants and haplotypes that confer risk and protection against type 2 diabetic nephropathy.

    PubMed

    Ezzidi, Intissar; Mtiraoui, Nabil; Kacem, Maha; Chaieb, Molka; Mahjoub, Touhami; Almawi, Wassim Y

    2009-11-01

    Cross-sectional and family studies identified angiotensin-converting enzyme (ACE) gene as a risk factor for diabetic nephropathy (DN). The contribution of ACE gene variants to DN development and progression is controversial and varies among different ethnic/racial groups. We investigated the association of three ACE gene variants with DN, rs1799752 insertion/deletion (I/D), rs1800764T/C and rs12449782A/G in 917 Tunisian type 2 diabetic (T2DM) patients: 515 with (DN) and 402 without (DWN) nephropathy. ACE genotyping was done by PCR-based assays; haplotype estimation was performed using H-Plus software (chi(2)-test based). Genotype frequency distributions of the three studied variants were in Hardy-Weinberg equilibrium. Minor allele frequency of rs1800764 was higher in DN patients than DWN patients or healthy controls, and minor allele frequency of rs1799752 was higher in DN than DWN patients. Higher frequency of rs1799752 and rs1800764 homozygous mutant genotypes was seen in DN compared to DWN patients. Of the three variants, only rs1799752 deletion/deletion (D/D) genotype was associated with a significant increase in albumin to creatinine ratios levels, and D/D carriers had elevated low-density lipoprotein, total cholesterol and urea. Three locus haplotype [rs1799752(I/D)/rs1800764(T/C)/rs12449782(A/G)] analysis revealed that the frequency of DCG haplotype was higher, while that of ITG and ICA haplotypes were lower among unselected type 2 diabetic patients. Taking ITA haplotype as reference, multivariate regression analysis confirmed the negative (ITG), and positive (DCG, DTG, DCA and DTA) association of specific ACE haplotypes with DN, after adjusting for potential nephropathy-linked covariates. Our results support the involvement of specific ACE variants in DN pathogenesis and demonstrate the presence of DN-specific haplotypes at the ACE locus.

  4. Myopia and Late-Onset Progressive Cone Dystrophy Associate to LVAVA/MVAVA Exon 3 Interchange Haplotypes of Opsin Genes on Chromosome X.

    PubMed

    Orosz, Orsolya; Rajta, István; Vajas, Attila; Takács, Lili; Csutak, Adrienne; Fodor, Mariann; Kolozsvári, Bence; Resch, Miklós; Sényi, Katalin; Lesch, Balázs; Szabó, Viktória; Berta, András; Balogh, István; Losonczy, Gergely

    2017-03-01

    Rare interchange haplotypes in exon 3 of the OPN1LW and OPN1MW opsin genes cause X-linked myopia, color vision defect, and cone dysfunction. The severity of the disease varies on a broad scale from nonsyndromic high myopia to blue cone monochromatism. Here, we describe a new genotype-phenotype correlation attributed to rare exon 3 interchange haplotypes simultaneously present in the long- and middle-wavelength sensitive opsin genes (L- and M-opsin genes). A multigenerational family with X-linked high myopia and cone dystrophy was investigated. Affected male patients had infantile onset myopia with normal visual acuity and color vision until their forties. Visual acuity decreased thereafter, along with the development of severe protan and deutan color vision defects. A mild decrease in electroretinography response of cone photoreceptors was detected in childhood, which further deteriorated in middle-aged patients. Rods were also affected, however, to a lesser extent than cones. Clinical exome sequencing identified the LVAVA and MVAVA toxic haplotypes in the OPN1LW and OPN1MW opsin genes, respectively. Here, we show that LVAVA haplotype of the OPN1LW gene and MVAVA haplotype of the OPN1MW gene cause apparently nonsyndromic high myopia in young patients but lead to progressive cone-rod dystrophy with deuteranopia and protanopia in middle-aged patients corresponding to a previously unknown disease course. To the best of our knowledge, this is the first report on the joint effect of these toxic haplotypes in the two opsin genes on chromosome X.

  5. Haplotype assembly in polyploid genomes and identical by descent shared tracts.

    PubMed

    Aguiar, Derek; Istrail, Sorin

    2013-07-01

    Genome-wide haplotype reconstruction from sequence data, or haplotype assembly, is at the center of major challenges in molecular biology and life sciences. For complex eukaryotic organisms like humans, the genome is vast and the population samples are growing so rapidly that algorithms processing high-throughput sequencing data must scale favorably in terms of both accuracy and computational efficiency. Furthermore, current models and methodologies for haplotype assembly (i) do not consider individuals sharing haplotypes jointly, which reduces the size and accuracy of assembled haplotypes, and (ii) are unable to model genomes having more than two sets of homologous chromosomes (polyploidy). Polyploid organisms are increasingly becoming the target of many research groups interested in the genomics of disease, phylogenetics, botany and evolution but there is an absence of theory and methods for polyploid haplotype reconstruction. In this work, we present a number of results, extensions and generalizations of compass graphs and our HapCompass framework. We prove the theoretical complexity of two haplotype assembly optimizations, thereby motivating the use of heuristics. Furthermore, we present graph theory-based algorithms for the problem of haplotype assembly using our previously developed HapCompass framework for (i) novel implementations of haplotype assembly optimizations (minimum error correction), (ii) assembly of a pair of individuals sharing a haplotype tract identical by descent and (iii) assembly of polyploid genomes. We evaluate our methods on 1000 Genomes Project, Pacific Biosciences and simulated sequence data. HapCompass is available for download at http://www.brown.edu/Research/Istrail_Lab/. Supplementary data are available at Bioinformatics online.

  6. Unique Variants in OPN1LW Cause Both Syndromic and Nonsyndromic X-Linked High Myopia Mapped to MYP1.

    PubMed

    Li, Jiali; Gao, Bei; Guan, Liping; Xiao, Xueshan; Zhang, Jianguo; Li, Shiqiang; Jiang, Hui; Jia, Xiaoyun; Yang, Jianhua; Guo, Xiangming; Yin, Ye; Wang, Jun; Zhang, Qingjiong

    2015-06-01

    MYP1 is a locus for X-linked syndromic and nonsyndromic high myopia. Recently, unique haplotypes in OPN1LW were found to be responsible for X-linked syndromic high myopia mapped to MYP1. The current study is to test if such variants in OPN1LW are also responsible for X-linked nonsyndromic high myopia mapped to MYP1. The proband of the family previously mapped to MYP1 was initially analyzed using whole-exome sequencing and whole-genome sequencing. Additional probands with early-onset high myopia were analyzed using whole-exome sequencing. Variants in OPN1LW were selected and confirmed by Sanger sequencing. Long-range and second PCR were used to determine the haplotype and the first gene of the red-green gene array. Candidate variants were further validated in family members and controls. The unique LVAVA haplotype in OPN1LW was detected in the family with X-linked nonsyndromic high myopia mapped to MYP1. In addition, this haplotype and a novel frameshift mutation (c.617_620dup, p.Phe208Argfs*51) in OPN1LW were detected in two other families with X-linked high myopia. The unique haplotype cosegregated with high myopia in the two families, with a maximum LOD score of 3.34 and 2.31 at θ = 0. OPN1LW with the variants in these families was the first gene in the red-green gene array and was not present in 247 male controls. Reevaluation of the clinical data in both families with the unique haplotype suggested nonsyndromic high myopia. Our study confirms the findings that unique variants in OPN1LW are responsible for both syndromic and nonsyndromic X-linked high myopia mapped to MYP1.

  7. Mapping of a Major QTL for Ceratocystis Wilt Disease in an F1 Population of Theobroma cacao.

    PubMed

    Fernandes, Luciel Dos Santos; Royaert, Stefan; Corrêa, Fábio M; Mustiga, Guiliana M; Marelli, Jean-Philippe; Corrêa, Ronan X; Motamayor, Juan C

    2018-01-01

    Cacao is an important crop, its beans are key raw materials for the chocolate and cosmetic industries. Ceratocystis wilt of cacao (CWC) caused by Ceratocystis cacaofunesta is a lethal disease for the crop. Therefore, the selection of resistant cacao varieties is one of the viable ways to minimize losses in cacao production. In this paper, we described the identification of a major QTL associated with CWC in an F1 mapping population from a cross between a resistant, "TSH 1188," and a susceptible genotype, "CCN 51." A set of 266 trees were genotyped using 3,526 single nucleotide polymorphic markers and then multiple QTL mapping analyses were performed. Two QTLs were identified on chromosomes IV and VI. The major QTL was located at 20 cM from the top position of chromosome VI, accounting for more than 60% of the phenotypic variation. The favorable allele T1, with haplotype GTT, came from the "TSH 1188" parent. It was evident that the haplotype combination T1C2 on chromosome VI was the most significant for resistance, since 93% of resistant trees had this haplotype. The major QTL converged to a genomic region of 739.4 kb that harbored nine candidate genes, including two major classes of resistance genes, which would make them the primary candidates involved in the resistance to CWC. The haplotypes detected are now used to improve the efficiency and precision of the selection of resistant trees in cacao breeding.

  8. Functional and genetic analysis of haplotypic sequence variation at the nicastrin genomic locus

    PubMed Central

    Hamilton, Gillian; Killick, Richard; Lambert, Jean-Charles; Amouyel, Philippe; Carrasquillo, Minerva M.; Pankratz, V. Shane; Graff-Radford, Neill R.; Dickson, Dennis W.; Petersen, Ronald C.; Younkin, Steven G.; Powell, John F.; Wade-Martins, Richard

    2013-01-01

    Nicastrin (NCSTN) is a component of the γ-secretase complex and therefore potentially a candidate risk gene for Alzheimer's disease. Here, we have developed a novel functional genomics methodology to express common locus haplotypes to assess functional differences. DNA recombination was used to engineer 5 bacterial artificial chromosomes (BACs) to each express a different haplotype of the NCSTN locus. Each NCSTN-BAC was delivered to knockout nicastrin (Ncstn−/−) cells and clonal NCSTN-BAC+/Ncstn−/− cell lines were created for functional analyses. We showed that all NCSTN-BAC haplotypes expressed nicastrin protein and rescued γ-secretase activity and amyloid beta (Aβ) production in NCSTN-BAC+/Ncstn−/− lines. We then showed that genetic variation at the NCSTN locus affected alternative splicing in human postmortem brain tissue. However, there was no robust functional difference between clonal cell lines rescued by each of the 5 different haplotypes. Finally, there was no statistically significant association of NCSTN with disease risk in the 4 cohorts. We therefore conclude that it is unlikely that common variation at the NCSTN locus is a risk factor for Alzheimer's disease. PMID:22405046

  9. Cloud computing-based TagSNP selection algorithm for human genome data.

    PubMed

    Hung, Che-Lun; Chen, Wen-Pei; Hua, Guan-Jie; Zheng, Huiru; Tsai, Suh-Jen Jane; Lin, Yaw-Ling

    2015-01-05

    Single nucleotide polymorphisms (SNPs) play a fundamental role in human genetic variation and are used in medical diagnostics, phylogeny construction, and drug design. They provide the highest-resolution genetic fingerprint for identifying disease associations and human features. Haplotypes are regions of linked genetic variants that are closely spaced on the genome and tend to be inherited together. Genetics research has revealed SNPs within certain haplotype blocks that introduce few distinct common haplotypes into most of the population. Haplotype block structures are used in association-based methods to map disease genes. In this paper, we propose an efficient algorithm for identifying haplotype blocks in the genome. In chromosomal haplotype data retrieved from the HapMap project website, the proposed algorithm identified longer haplotype blocks than an existing algorithm. To enhance its performance, we extended the proposed algorithm into a parallel algorithm that copies data in parallel via the Hadoop MapReduce framework. The proposed MapReduce-paralleled combinatorial algorithm performed well on real-world data obtained from the HapMap dataset; the improvement in computational efficiency was proportional to the number of processors used.

  10. Sequences associated with human iris pigmentation.

    PubMed Central

    Frudakis, Tony; Thomas, Matthew; Gaskin, Zach; Venkateswarlu, K; Chandra, K Suresh; Ginjupalli, Siva; Gunturi, Sitaram; Natrajan, Sivamani; Ponnuswamy, Viswanathan K; Ponnuswamy, K N

    2003-01-01

    To determine whether and how common polymorphisms are associated with natural distributions of iris colors, we surveyed 851 individuals of mainly European descent at 335 SNP loci in 13 pigmentation genes and 419 other SNPs distributed throughout the genome and known or thought to be informative for certain elements of population structure. We identified numerous SNPs, haplotypes, and diplotypes (diploid pairs of haplotypes) within the OCA2, MYO5A, TYRP1, AIM, DCT, and TYR genes and the CYP1A2-15q22-ter, CYP1B1-2p21, CYP2C8-10q23, CYP2C9-10q24, and MAOA-Xp11.4 regions as significantly associated with iris colors. Half of the associated SNPs were located on chromosome 15, which corresponds with results that others have previously obtained from linkage analysis. We identified 5 additional genes (ASIP, MC1R, POMC, and SILV) and one additional region (GSTT2-22q11.23) with haplotype and/or diplotypes, but not individual SNP alleles associated with iris colors. For most of the genes, multilocus gene-wise genotype sequences were more strongly associated with iris colors than were haplotypes or SNP alleles. Diplotypes for these genes explain 15% of iris color variation. Apart from representing the first comprehensive candidate gene study for variable iris pigmentation and constituting a first step toward developing a classification model for the inference of iris color from DNA, our results suggest that cryptic population structure might serve as a leverage tool for complex trait gene mapping if genomes are screened with the appropriate ancestry informative markers. PMID:14704187

  11. FcγRIIIa SNPs and haplotypes affect human IgG binding and association with lupus nephritis in African Americans

    PubMed Central

    Dong, Chaoling; Ptacek, Travis S; Redden, David T; Zhang, Kui; Brown, Elizabeth E.; Edberg, Jeffrey C.; McGwin, Gerald; Alarcón, Graciela S.; Ramsey-Goldman, Rosalind; Reveille, John D.; Vilá, Luis M.; Petri, Michelle; Qin, Aijian; Wu, Jianming; Kimberly, Robert P.

    2014-01-01

    Objective To investigate whether the FcγRIIIa-66R/H/L polymorphism influences net effective receptor function and to assess if the FCGR3A combined genotypes formed by FcγRIIIa-66R/H/L and FcγRIIIa-176F/V as well as copy number variation (CNV) confer risk for development of SLE and lupus nephritis. Methods FcγRIIIa variants, expressed on A20 IIA1.6 cells, were used in flow cytometry-based human IgG binding assays. FCGR3A SNP and CNV genotypes were determined by Pyrosequencing methodology in a cohort of 1728 SLE patients and 2404 healthy controls. Results The FcγRIIIa-66L/H/R (rs10127939) polymorphism influences ligand binding capacity in the context of the FcγRIIIa-176V (rs396991) allele. The low binding FcγRIIIa-176F allele was associated with SLE nephritis (p = 0.0609) in African Americans but not in European Americans (p > 0.10). Nephritis among African American SLE subjects was associated with FcγRIIIa low binding haplotypes containing the 66R/H/L and 176F variants (p = 0.03) and with low binding genotype combinations (p = 0.002). No association was observed in European American SLE patients. The distribution of FCGR3A CNV was not significantly different between controls and SLE patients with or without nephritis. Conclusion FcγRIIIa-66R/H/L influences ligand binding. The low binding haplotypes formed by 66R/H/L and 176F confer enhanced risk for lupus nephritis in African Americans. FCGR3A CNVs are not associated with SLE or SLE nephritis in either African Americans or European Americans. PMID:24782186

  12. Toll-like receptor 4 polymorphisms and their haplotypes modulate the risk of developing diabetic retinopathy in type 2 diabetes patients

    PubMed Central

    Singh, Kanhaiya; Kant, Shri; Singh, Vivek Kumar; Agrawal, Neeraj K.; Gupta, Sanjeev K.

    2014-01-01

    Purpose Persistent inflammation and impaired neovascularization in type 2 diabetes mellitus (T2DM) patients may lead to development of macro- and microvascular complications. Diabetic retinopathy (DR) is one of the secondary microvascular complications of T2DM. Improper activation of the innate immune system may be an important contributor in the pathophysiology of DR. Toll-like receptor 4 (TLR4) is an important mediator of innate immunity, and genetic alterations in TLR4 support inflammation in the hyperglycemic condition. The present work was designed to investigate whether the TLR4 single nucleotide polymorphisms (SNPs) rs4986790, rs4986791, rs10759931, rs1927911, and rs1927914 are associated with DR in a north Indian population. Methods The study group of 698 individuals (128 DR, 250 T2DM, 320 controls) was genotyped by PCR-RFLP. Haplotype and linkage disequilibrium between SNPs were determined using Haploview software. Results Combined risk genotypes of TLR4 SNPs rs10759931 (odds ratio [OR] 1.50, p = 0.05) and rs1927914 (OR 1.48, p = 0.05) were found to be significantly associated with pathogenesis of DR. A total of 14 haplotypes with frequency >1% were obtained using Haploview software. Haplotypes ACATC (37.5%) and ACATT (14.8%) were the two most common haplotypes obtained. Conclusions Results of the present case-control study that included 698 north Indian subjects suggested that TLR4 SNPs rs10759931 and rs1927914 modulate the risk of DR in T2DM cases. Association analysis using haplotypes showed none of the haplotypes were associated with either susceptibility or resistance to DR in a north Indian population. PMID:24883015

  13. Phylogeny and Haplotype Analysis of Fungi Within the Fusarium incarnatum-equiseti Species Complex.

    PubMed

    Ramdial, H; Latchoo, R K; Hosein, F N; Rampersad, S N

    2017-01-01

    Fusarium spp. are ranked among the top 10 most economically and scientifically important plant-pathogenic fungi in the world and are associated with plant diseases that include fruit decay of a number of crops. Fusarium isolates infecting bell pepper in Trinidad were identified based on sequence comparisons of the translation elongation factor gene (EF-1a) with sequences of Fusarium incarnatum-equiseti species complex (FIESC) verified in the FUSARIUM-ID database. Eighty-two isolates were identified as belonging to one of four phylogenetic species within the subclades FIESC-1, FIESC-15, FIESC-16, and FIESC-26, with the majority of isolates belonging to FIESC-15. A comparison of the level of DNA polymorphism and phylogenetic inference for sequences of the internal transcribed spacer region (ITS1-5.8S-ITS2) and EF-1a sequences for Trinidad and FUSARIUM-ID type species was carried out. The ITS sequences were less informative, had lower haplotype diversity and restricted haplotype distribution, and resulted in poor resolution and taxa placement in the consensus maximum-likelihood tree. EF-1a sequences enabled strongly supported phylogenetic inference with highly resolved branching patterns of the 30 phylogenetic species within the FIESC and placement of representative Trinidad isolates. Therefore, global phylogeny was inferred from EF-1a sequences representing 11 countries, and separation into distinct Incarnatum and Equiseti clades was again evident. In total, 42 haplotypes were identified: 12 were shared and the remaining were unique haplotypes. The most diverse haplotype was represented by sequences from China, Indonesia, Malaysia, and Trinidad and consisted exclusively of F. incarnatum isolates. Spain had the highest haplotype diversity, perhaps because both F. equiseti and F. incarnatum sequences were represented; followed by the United States, which contributed both F. equiseti and F. incarnatum sequences to the data set; then by countries representing Southeast

  14. Genetic differences in the two main groups of the Japanese population based on autosomal SNPs and haplotypes.

    PubMed

    Yamaguchi-Kabata, Yumi; Tsunoda, Tatsuhiko; Kumasaka, Natsuhiko; Takahashi, Atsushi; Hosono, Naoya; Kubo, Michiaki; Nakamura, Yusuke; Kamatani, Naoyuki

    2012-05-01

    Although the Japanese population has a rather low genetic diversity, we recently confirmed the presence of two main clusters (the Hondo and Ryukyu clusters) through principal component analysis of genome-wide single-nucleotide polymorphism (SNP) genotypes. Understanding the genetic differences between the two main clusters requires further genome-wide analyses based on a dense SNP set and comparison of haplotype frequencies. In the present study, we determined haplotypes for the Hondo cluster of the Japanese population by detecting SNP homozygotes with 388,591 autosomal SNPs from 18,379 individuals and estimated the haplotype frequencies. Haplotypes for the Ryukyu cluster were inferred by a statistical approach using the genotype data from 504 individuals. We then compared the haplotype frequencies between the Hondo and Ryukyu clusters. In most genomic regions, the haplotype frequencies in the Hondo and Ryukyu clusters were very similar. However, in addition to the human leukocyte antigen region on chromosome 6, other genomic regions (chromosomes 3, 4, 5, 7, 10 and 12) showed dissimilarities in haplotype frequency. These regions were enriched for genes involved in the immune system, cell-cell adhesion and the intracellular signaling cascade. These differentiated genomic regions between the Hondo and Ryukyu clusters are of interest because they (1) should be examined carefully in association studies and (2) likely contain genes responsible for morphological or physiological differences between the two groups.

  15. Mineralocorticoid receptor haplotype, oral contraceptives and emotional information processing.

    PubMed

    Hamstra, D A; de Kloet, E R; van Hemert, A M; de Rijk, R H; Van der Does, A J W

    2015-02-12

    Oral contraceptives (OCs) affect mood in some women and may have more subtle effects on emotional information processing in many more users. Female carriers of mineralocorticoid receptor (MR) haplotype 2 have been shown to be more optimistic and less vulnerable to depression. To investigate the effects of oral contraceptives on emotional information processing and a possible moderating effect of MR haplotype. Cross-sectional study in 85 healthy premenopausal women of West-European descent. We found significant main effects of oral contraceptives on facial expression recognition, emotional memory and decision-making. Furthermore, carriers of MR haplotype 1 or 3 were sensitive to the impact of OCs on the recognition of sad and fearful faces and on emotional memory, whereas MR haplotype 2 carriers were not. Different compounds of OCs were included. No hormonal measures were taken. Most naturally cycling participants were assessed in the luteal phase of their menstrual cycle. Carriers of MR haplotype 2 may be less sensitive to depressogenic side-effects of OCs. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  16. Relationship of polymorphisms and haplotype in interleukin-16 and adiponectin gene with late-onset Alzheimer’s disease risk

    PubMed Central

    Yin, Honglei; Zhang, Yuzhen; Hua, Linlin; Li, Jinfeng; Zeng, Zhilei; Yang, Xiaopeng; Gong, Bin; Geng, Shuang; Liu, Yajun; Zhang, Hui; Liu, Yanqiu; Zhao, Jing; Wang, Yunliang

    2017-01-01

    Aims To investigate the impact of Interleukin-16 (IL- 16) and Adiponectin (ANP) gene single nucleotide polymorphisms (SNPs), gene- gene interactions and haplotype on late-onset Alzheimer’s disease (LOAD) risk. Methods Hardy-Weinberg equilibrium (HWE), haplotype and pairwise linkage disequilibrium (LD) analysis were investigated by using SNPstats (available online at http://bioinfo.iconcologia.net/SNPstats). Generalized multifactor dimensionality reduction (GMDR) was used to examine interaction among 4 SNPs, odds ratio (OR) and 95% confident interval (95%CI) were calculated by logistic regression model. Results LOAD risk was significantly higher in carriers of rs266729- G allele than those with CC genotype (CG+ GG versus CC), OR (95%CI) =1.61 (1.26-1.96), and higher in carriers of rs1501299- T allele, OR (95%CI) = 1.62 (1.32-2.12), lower in carriers of rs4072111- T allele, adjusted OR (95%CI) =0.65 (0.44-0.93). We also found a significant gene- gene interaction between rs266729 and rs4072111. Participants with CG or GG of rs266729 and CC of rs4072111 genotype have the highest LOAD risk, OR (95%CI) = 2.62 (1.64 -3.58). Haplotype containing the rs266729- G and rs1501299- T alleles were associated with increased LOAD risk, OR (95%CI)= 1.83 (1.32- 2.43), and haplotype containing the rs1131445- C and rs4072111- T alleles were associated with decreased LOAD risk, OR (95%CI)= 0.53 (0.18- 0.95). Conclusions We concluded that rs266729 and rs1501299 minor alleles were associated with increased LOAD risk, but rs4072111 minor allele was associated with decreased LOAD risk. We also found that interaction involving rs266729 and rs4072111, and haplotype combinations were associated with LOAD risk. PMID:29108295

  17. A Haplotype Information Theory Method Reveals Genes of Evolutionary Interest in European vs. Asian Pigs.

    PubMed

    Hudson, Nicholas J; Naval-Sánchez, Marina; Porto-Neto, Laercio; Pérez-Enciso, Miguel; Reverter, Antonio

    2018-06-05

    Asian and European wild boars were independently domesticated ca. 10,000 years ago. Since the 17th century, Chinese breeds have been imported to Europe to improve the genetics of European animals by introgression of favourable alleles, resulting in a complex mosaic of haplotypes. To interrogate the structure of these haplotypes further, we have run a new haplotype segregation analysis based on information theory, namely compression efficiency (CE). We applied the approach to sequence data from individuals from each phylogeographic region (n = 23 from Asia and Europe) including a number of major pig breeds. Our genome-wide CE is able to discriminate the breeds in a manner reflecting phylogeography. Furthermore, 24,956 non-overlapping sliding windows (each comprising 1,000 consecutive SNP) were quantified for extent of haplotype sharing within and between Asia and Europe. The genome-wide distribution of extent of haplotype sharing was quite different between groups. Unlike European pigs, Asian pigs haplotype sharing approximates a normal distribution. In line with this, we found the European breeds possessed a number of genomic windows of dramatically higher haplotype sharing than the Asian breeds. Our CE analysis of sliding windows capture some of the genomic regions reported to contain signatures of selection in domestic pigs. Prominent among these regions, we highlight the role of a gene encoding the mitochondrial enzyme LACTB which has been associated with obesity, and the gene encoding MYOG a fundamental transcriptional regulator of myogenesis. The origin of these regions likely reflects either a population bottleneck in European animals, or selective targets on commercial phenotypes reducing allelic diversity in particular genes and/or regulatory regions.

  18. VNTR internal structure mapping at the {alpha}-globin 3{prime}HVR locus reveals a hierachy of related lineages in oceania

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

    1994-09-01

    Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. Wemore » have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.« less

  19. Ultraaccurate genome sequencing and haplotyping of single human cells.

    PubMed

    Chu, Wai Keung; Edge, Peter; Lee, Ho Suk; Bansal, Vikas; Bafna, Vineet; Huang, Xiaohua; Zhang, Kun

    2017-11-21

    Accurate detection of variants and long-range haplotypes in genomes of single human cells remains very challenging. Common approaches require extensive in vitro amplification of genomes of individual cells using DNA polymerases and high-throughput short-read DNA sequencing. These approaches have two notable drawbacks. First, polymerase replication errors could generate tens of thousands of false-positive calls per genome. Second, relatively short sequence reads contain little to no haplotype information. Here we report a method, which is dubbed SISSOR (single-stranded sequencing using microfluidic reactors), for accurate single-cell genome sequencing and haplotyping. A microfluidic processor is used to separate the Watson and Crick strands of the double-stranded chromosomal DNA in a single cell and to randomly partition megabase-size DNA strands into multiple nanoliter compartments for amplification and construction of barcoded libraries for sequencing. The separation and partitioning of large single-stranded DNA fragments of the homologous chromosome pairs allows for the independent sequencing of each of the complementary and homologous strands. This enables the assembly of long haplotypes and reduction of sequence errors by using the redundant sequence information and haplotype-based error removal. We demonstrated the ability to sequence single-cell genomes with error rates as low as 10 -8 and average 500-kb-long DNA fragments that can be assembled into haplotype contigs with N50 greater than 7 Mb. The performance could be further improved with more uniform amplification and more accurate sequence alignment. The ability to obtain accurate genome sequences and haplotype information from single cells will enable applications of genome sequencing for diverse clinical needs. Copyright © 2017 the Author(s). Published by PNAS.

  20. Mitochondrial DNA haplotype distribution patterns in Pinus ponderosa (Pinaceae): range-wide evolutionary history and implications for conservation.

    PubMed

    Potter, Kevin M; Hipkins, Valerie D; Mahalovich, Mary F; Means, Robert E

    2013-08-01

    Ponderosa pine (Pinus ponderosa Douglas ex P. Lawson & C. Lawson) exhibits complicated patterns of morphological and genetic variation across its range in western North America. This study aims to clarify P. ponderosa evolutionary history and phylogeography using a highly polymorphic mitochondrial DNA marker, with results offering insights into how geographical and climatological processes drove the modern evolutionary structure of tree species in the region. We amplified the mtDNA nad1 second intron minisatellite region for 3,100 trees representing 104 populations, and sequenced all length variants. We estimated population-level haplotypic diversity and determined diversity partitioning among varieties, races and populations. After aligning sequences of minisatellite repeat motifs, we evaluated evolutionary relationships among haplotypes. The geographical structuring of the 10 haplotypes corresponded with division between Pacific and Rocky Mountain varieties. Pacific haplotypes clustered with high bootstrap support, and appear to have descended from Rocky Mountain haplotypes. A greater proportion of diversity was partitioned between Rocky Mountain races than between Pacific races. Areas of highest haplotypic diversity were the southern Sierra Nevada mountain range in California, northwestern California, and southern Nevada. Pinus ponderosa haplotype distribution patterns suggest a complex phylogeographic history not revealed by other genetic and morphological data, or by the sparse paleoecological record. The results appear consistent with long-term divergence between the Pacific and Rocky Mountain varieties, along with more recent divergences not well-associated with race. Pleistocene refugia may have existed in areas of high haplotypic diversity, as well as the Great Basin, Southwestern United States/northern Mexico, and the High Plains.

  1. An Association Study of the SLC19A1 Gene Polymorphisms/Haplotypes with Idiopathic Recurrent Pregnancy Loss in an Iranian Population.

    PubMed

    Mohtaram, Shirin; Sheikhha, Mohammad Hasan; Honarvar, Negar; Sazegari, Ali; Maraghechi, Neda; Feizollahi, Zahra; Ghasemi, Nasrin

    2016-05-01

    The genetics of folate metabolism is one of the most significant mechanisms influencing fetal growth and may underlie some cases of unexplained recurrent miscarriage. Reduced folate carrier 1, encoded by the SLC19A1 gene, is a transporter of folate. Folate deficiency and elevated levels of homocysteine could be disadvantageous for the female reproductive system health. Thus, the balance between homocysteine and folate status can be used to measure the risk of recurrent pregnancy loss. The purpose of this study was to determine the association between -43T>C, 80G>A, and 696C>T polymorphisms of the SLC19A1 gene in 147 women who had unexplained recurrent miscarriage in comparison with 150 healthy women. Amplification refractory mutation system-polymerase chain reaction was used to genotype the molecular polymorphisms of this gene. The results indicated that the -43T>C single nucleotide of the SLC19A1 gene was significantly associated with a risk of recurrent miscarriage in Iranian women (p < 0.05). No significant association was observed for the other two polymorphisms. The haplotype frequency distribution of -43C/80G/696C, -;43C/80G/696T, -43C/80G, and 80G/696T was significantly different in patients than controls, which may represent a novel risk factor for idiopathic recurrent pregnancy loss. Polymorphisms and haplotypes of the SLC19A1 gene can be considered risk factors for idiopathic recurrent pregnancy loss.

  2. Different effects of apolipoprotein A5 SNPs and haplotypes on triglyceride concentration in three ethnic origins.

    PubMed

    Ken-Dror, Gie; Goldbourt, Uri; Dankner, Rachel

    2010-05-01

    Several polymorphisms in the ApoA5 gene emerged as important candidate genes in triglyceride metabolism. The aim of this study was to determine the associations between ApoA5 polymorphisms, plasma triglyceride concentrations and the presence of cardiovascular disease (CVD) in three ethnic origins. Genotypes for 15 single nucleotide polymorphisms (SNPs) were determined in 659 older adults (mean age 71+/-7 years) who immigrated to Israel or whose ancestors originated from East Europe (Ashkenazi), North Africa, Asia (Sephardic) or Yemen (Yemenite). The minor alleles of the four common SNPs (rs662799, rs651821, rs2072560 and rs2266788) are associated with an increase of 27-38% in triglyceride concentration among Ashkenazi and Yemenite Jews compared with the major alleles, but not among those of Sephardic origin. Conversely, among the Sephardic group, the presence of the minor allele in SNP rs3135506 compared with the major allele was associated with an increase of 34% in triglyceride concentration. The four SNPs were in significant linkage disequilibrium (D'=0.96-0.99), resulting in three haplotypes H1, H2 and H3, representing 98-99% of the population. Haplotype H2 was significantly associated with triglyceride concentration among Ashkenazi and Yemenite but not among Sephardic Jews. Conversely, haplotype H3 was associated with triglyceride concentration in Sephardic but not in Ashkenazi and Yemenite Jews. Ashkenazi carriers of H2 haplotype had a CVD odds ratio of 2.19 (95% CI: 1.05-4.58) compared with H1 (the most frequent), after adjustment for all other risk factors. These results suggest that different SNPs in ApoA5 polymorphisms may be associated with triglyceride concentration and CVD in each of these ethnic origins.

  3. Haplotypes in the APOA1-C3-A4-A5 gene cluster affect plasma lipids in both humans and baboons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Qian-fei; Liu, Xin; O'Connell, Jeff

    2003-09-15

    Genetic studies in non-human primates serve as a potential strategy for identifying genomic intervals where polymorphisms impact upon human disease-related phenotypes. It remains unclear, however, whether independently arising polymorphisms in orthologous regions of non-human primates leads to similar variation in a quantitative trait found in both species. To explore this paradigm, we studied a baboon apolipoprotein gene cluster (APOA1/C3/A4/A5) for which the human gene orthologs have well established roles in influencing plasma HDL-cholesterol and triglyceride concentrations. Our extensive polymorphism analysis of this 68 kb gene cluster in 96 pedigreed baboons identified several haplotype blocks each with limited diversity, consistent withmore » haplotype findings in humans. To determine whether baboons, like humans, also have particular haplotypes associated with lipid phenotypes, we genotyped 634 well characterized baboons using 16 haplotype tagging SNPs. Genetic analysis of single SNPs, as well as haplotypes, revealed an association of APOA5 and APOC3 variants with HDL cholesterol and triglyceride concentrations, respectively. Thus, independent variation in orthologous genomic intervals does associate with similar quantitative lipid traits in both species, supporting the possibility of uncovering human QTL genes in a highly controlled non-human primate model.« less

  4. The influence of casein haplotype on morphometric characteristics of fat globules and fatty acid composition of milk in Italian Holstein cows.

    PubMed

    Perna, Annamaria; Intaglietta, Immacolata; Simonetti, Amalia; Gambacorta, Emilio

    2016-04-01

    The aim of this work was to investigate the effect of casein haplotypes (αS1-, β-, and κ-caseins) on morphometric characteristics of fat globules and fatty acid composition of Italian Holstein milk. Casein haplotypes were determined by isoelectric focusing; milk fat globule size was measured by using a fluorescence microscope; and fatty acid profile was determined by gas chromatography. Casein haplotype significantly affected the fat globule size, the percentage incidence of each globule size class on total measured milk fat globules, and fatty acid composition. A higher incidence of smaller milk fat globules was associated with the BB-A(2)A(2)-BB genotype (αS1-, β-, and κ-casein haplotypes, respectively), whereas small globules were not detected in BB-A(2)A(1)-AA milk, but that milk had the highest percentage of large globules. A higher content of monounsaturated fatty acids was associated with the BB-A(2)A(2)-AB genotype, whereas higher contents of conjugated linoleic acid and docosahexaenoic acid were detected in BB-A(1)A(1)-AA milk. Our results indicate that casein haplotype could affect fat characteristics and, therefore, the nutritional and technological quality of milk. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  5. Genomic evolution in domestic cattle: ancestral haplotypes and healthy beef.

    PubMed

    Williamson, Joseph F; Steele, Edward J; Lester, Susan; Kalai, Oscar; Millman, John A; Wolrige, Lindsay; Bayard, Dominic; McLure, Craig; Dawkins, Roger L

    2011-05-01

    We have identified numerous Ancestral Haplotypes encoding a 14-Mb region of Bota C19. Three are frequent in Simmental, Angus and Wagyu and have been conserved since common progenitor populations. Others are more relevant to the differences between these 3 breeds including fat content and distribution in muscle. SREBF1 and Growth Hormone, which have been implicated in the production of healthy beef, are included within these haplotypes. However, we conclude that alleles at these 2 loci are less important than other sequences within the haplotypes. Identification of breeds and hybrids is improved by using haplotypes rather than individual alleles. Copyright © 2010 Elsevier Inc. All rights reserved.

  6. DLA Class II Alleles and Haplotypes Are Associated with Risk for and Protection from Chronic Hepatitis in the English Springer Spaniel

    PubMed Central

    Bexfield, Nicholas H.; Watson, Penny J.; Aguirre-Hernandez, Jesús; Sargan, David R.; Tiley, Laurence; Heeney, Jonathan L.; Kennedy, Lorna J.

    2012-01-01

    Chronic hepatitis (CH) is common in dogs in the United Kingdom. An increased prevalence of the disease is seen in the English Springer spaniel (ESS), and this breed suffer from a severe form with young to middle aged female dogs being predisposed. The disease shares histological features with those of human viral hepatitis, although the specific aetiological agent has not yet been identified. The aim of the current study was to investigate whether dog leucocyte antigen (DLA) class II alleles and haplotypes are associated with susceptibility/resistance to CH in the ESS. Sequence-based genotyping of the polymorphic exon 2 from DLA-DRB1, -DQA1 and -DQB1 class II loci were performed in 66 ESSs with CH and 84 healthy controls. There was a significant difference in the distribution of the protective alleles DRB1*00501 (3.0% vs. 12.0%, odds ratio [OR] = 0.23, 95% confidence interval [CI] = 0.06–0.74) and DQB1*00501 (3.8% vs. 12.0%, OR = 0.29, 95% CI = 0.09–0.85) between cases and controls. The haplotype DLA-DRB1*00501/DQA1*00301/DQB1*00501 was present in 11.9% of controls and 3.0% of cases and was significantly associated with protection against disease development (OR = 0.26, 95% CI = 0.08–0.80). There was a significant difference in the distribution of the risk alleles DRB1*00601 (14.4% vs. 6.5%, OR = 2.40, 95% CI = 1.10–5.63) and DQB1*00701 (14.4% vs. 6.5%, OR = 2.40, 95% CI = 1.10–5.63) between cases and controls. A risk haplotype (DLA-DRB1*00601/DQA1*005011/DQB1*00701) was present in 14.4% of cases and 6.5% of controls and conferred an elevated risk of developing CH with an OR of 3.13 (95% CI = 1.20–8.26). These results demonstrate that DLA class II is significantly associated with risk and protection from developing CH in ESSs. PMID:22870335

  7. Genome-Wide Association Study among Four Horse Breeds Identifies a Common Haplotype Associated with In Vitro CD3+ T Cell Susceptibility/Resistance to Equine Arteritis Virus Infection ▿

    PubMed Central

    Go, Yun Young; Bailey, Ernest; Cook, Deborah G.; Coleman, Stephen J.; MacLeod, James N.; Chen, Kuey-Chu; Timoney, Peter J.; Balasuriya, Udeni B. R.

    2011-01-01

    Previously, we have shown that horses could be divided into susceptible and resistant groups based on an in vitro assay using dual-color flow cytometric analysis of CD3+ T cells infected with equine arteritis virus (EAV). Here, we demonstrate that the differences in in vitro susceptibility of equine CD3+ T lymphocytes to EAV infection have a genetic basis. To investigate the possible hereditary basis for this trait, we conducted a genome-wide association study (GWAS) to compare susceptible and resistant phenotypes. Testing of 267 DNA samples from four horse breeds that had a susceptible or a resistant CD3+ T lymphocyte phenotype using both Illumina Equine SNP50 BeadChip and Sequenom's MassARRAY system identified a common, genetically dominant haplotype associated with the susceptible phenotype in a region of equine chromosome 11 (ECA11), positions 49572804 to 49643932. The presence of a common haplotype indicates that the trait occurred in a common ancestor of all four breeds, suggesting that it may be segregated among other modern horse breeds. Biological pathway analysis revealed several cellular genes within this region of ECA11 encoding proteins associated with virus attachment and entry, cytoskeletal organization, and NF-κB pathways that may be associated with the trait responsible for the in vitro susceptibility/resistance of CD3+ T lymphocytes to EAV infection. The data presented in this study demonstrated a strong association of genetic markers with the trait, representing de facto proof that the trait is under genetic control. To our knowledge, this is the first GWAS of an equine infectious disease and the first GWAS of equine viral arteritis. PMID:21994447

  8. Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.

    PubMed

    Guerreiro, J F; Figueiredo, M S; Zago, M A

    1994-01-01

    We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.

  9. Association of CDH13 Genotypes/Haplotypes with Circulating Adiponectin Levels, Metabolic Syndrome, and Related Metabolic Phenotypes: The Role of the Suppression Effect

    PubMed Central

    Teng, Ming-Sheng; Hsu, Lung-An; Wu, Semon; Sun, Yu-Chen; Juan, Shu-Hui; Ko, Yu-Lin

    2015-01-01

    Objective Previous genome-wide association studies have indicated an association between CDH13 genotypes and adiponectin levels. In this study, we used mediation analysis to assess the statistical association between CDH13 locus variants and adiponectin levels, metabolic syndrome, and related metabolic phenotypes. Methods and results A sample population of 530 Taiwanese participants was enrolled. Four CDH13 gene variants in the promoter and intron 1 regions were genotyped. After adjustment for clinical covariates, the CDH13 genotypes/haplotypes exhibited an association with the adiponectin levels (lowest P = 1.95 × 10−11 for rs4783244 and lowest P = 3.78 × 10−13 for haplotype ATTT). Significant correlations were observed between the adiponectin levels and the various metabolic syndrome-related phenotypes (all P ≤ 0.005). After further adjustment for the adiponectin levels, participants with a minor allele of rs12051272 revealed a considerable association with a more favorable metabolic profile, including higher insulin sensitivity, high-density lipoprotein cholesterol levels, lower diastolic blood pressure, circulating levels of fasting plasma glucose, and triglycerides, and as a lower risk of metabolic syndrome (all P < 0.05). The mediation analysis further revealed a suppression effect of the adiponectin levels on the association between CDH13 genotypes and metabolic syndrome and its related phenotypes (Sobel test; all P < 0.001). Conclusion The genetic polymorphisms at the CDH13 locus independently affect the adiponectin levels, whereas the adiponectin levels exhibit a suppressive effect on the association between CDH13 locus variants and various metabolic phenotypes and metabolic syndrome. In addition, these results provide further evidence of the association between the CDH13 gene variants and the risks of metabolic syndrome and atherosclerotic cardiovascular disease. PMID:25875811

  10. Risk of pediatric celiac disease according to HLA haplotype and country.

    PubMed

    Liu, Edwin; Lee, Hye-Seung; Aronsson, Carin A; Hagopian, William A; Koletzko, Sibylle; Rewers, Marian J; Eisenbarth, George S; Bingley, Polly J; Bonifacio, Ezio; Simell, Ville; Agardh, Daniel

    2014-07-03

    The presence of HLA haplotype DR3-DQ2 or DR4-DQ8 is associated with an increased risk of celiac disease. In addition, nearly all children with celiac disease have serum antibodies against tissue transglutaminase (tTG). We studied 6403 children with HLA haplotype DR3-DQ2 or DR4-DQ8 prospectively from birth in the United States, Finland, Germany, and Sweden. The primary end point was the development of celiac disease autoimmunity, which was defined as the presence of tTG antibodies on two consecutive tests at least 3 months apart. The secondary end point was the development of celiac disease, which was defined for the purpose of this study as either a diagnosis on biopsy or persistently high levels of tTG antibodies. The median follow-up was 60 months (interquartile range, 46 to 77). Celiac disease autoimmunity developed in 786 children (12%). Of the 350 children who underwent biopsy, 291 had confirmed celiac disease; an additional 21 children who did not undergo biopsy had persistently high levels of tTG antibodies. The risks of celiac disease autoimmunity and celiac disease by the age of 5 years were 11% and 3%, respectively, among children with a single DR3-DQ2 haplotype, and 26% and 11%, respectively, among those with two copies (DR3-DQ2 homozygosity). In the adjusted model, the hazard ratios for celiac disease autoimmunity were 2.09 (95% confidence interval [CI], 1.70 to 2.56) among heterozygotes and 5.70 (95% CI, 4.66 to 6.97) among homozygotes, as compared with children who had the lowest-risk genotypes (DR4-DQ8 heterozygotes or homozygotes). Residence in Sweden was also independently associated with an increased risk of celiac disease autoimmunity (hazard ratio, 1.90; 95% CI, 1.61 to 2.25). Children with the HLA haplotype DR3-DQ2, especially homozygotes, were found to be at high risk for celiac disease autoimmunity and celiac disease early in childhood. The higher risk in Sweden than in other countries highlights the importance of studying environmental

  11. The Role of MAPT Haplotype H2 and Isoform 1N/4R in Parkinsonism of Older Adults.

    PubMed

    Valenca, Guilherme T; Srivastava, Gyan P; Oliveira-Filho, Jamary; White, Charles C; Yu, Lei; Schneider, Julie A; Buchman, Aron S; Shulman, Joshua M; Bennett, David A; De Jager, Philip L

    2016-01-01

    Recently, we have shown that the Parkinson's disease (PD) susceptibility locus MAPT (microtubule associated protein tau) is associated with parkinsonism in older adults without a clinical diagnosis of PD. In this study, we investigated the relationship between parkinsonian signs and MAPT transcripts by assessing the effect of MAPT haplotypes on alternative splicing and expression levels of the most common isoforms in two prospective clinicopathologic studies of aging. using regression analysis, controlling for age, sex, study and neuropathology, we evaluated 976 subjects with clinical, genotyping and brain pathology data for haplotype analysis. For transcript analysis, we obtained MAPT gene and isoform-level expression from the dorsolateral prefrontal cortex for 505 of these subjects. The MAPT H2 haplotype was associated with lower total MAPT expression (p = 1.2x10-14) and global parkinsonism at both study entry (p = 0.001) and proximate to death (p = 0.050). Specifically, haplotype H2 was primarily associated with bradykinesia in both assessments (p<0.001 and p = 0.008). MAPT total expression was associated with age and decreases linearly with advancing age (p<0.001). Analysing MAPT alternative splicing, the expression of 1N/4R isoform was inversely associated with global parkinsonism (p = 0.008) and bradykinesia (p = 0.008). Diminished 1N/4R isoform expression was also associated with H2 (p = 0.001). Overall, our results suggest that age and H2 are associated with higher parkinsonism score and decreased total MAPT RNA expression. Additionally, we found that H2 and parkinsonism are associated with altered expression levels of specific isoforms. These findings may contribute to the understanding of the association between MAPT locus and parkinsonism in elderly subjects and in some extent to age-related neurodegenerative diseases.

  12. Mathematical properties and bounds on haplotyping populations by pure parsimony.

    PubMed

    Wang, I-Lin; Chang, Chia-Yuan

    2011-06-01

    Although the haplotype data can be used to analyze the function of DNA, due to the significant efforts required in collecting the haplotype data, usually the genotype data is collected and then the population haplotype inference (PHI) problem is solved to infer haplotype data from genotype data for a population. This paper investigates the PHI problem based on the pure parsimony criterion (HIPP), which seeks the minimum number of distinct haplotypes to infer a given genotype data. We analyze the mathematical structure and properties for the HIPP problem, propose techniques to reduce the given genotype data into an equivalent one of much smaller size, and analyze the relations of genotype data using a compatible graph. Based on the mathematical properties in the compatible graph, we propose a maximal clique heuristic to obtain an upper bound, and a new polynomial-sized integer linear programming formulation to obtain a lower bound for the HIPP problem. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Cloud Computing-Based TagSNP Selection Algorithm for Human Genome Data

    PubMed Central

    Hung, Che-Lun; Chen, Wen-Pei; Hua, Guan-Jie; Zheng, Huiru; Tsai, Suh-Jen Jane; Lin, Yaw-Ling

    2015-01-01

    Single nucleotide polymorphisms (SNPs) play a fundamental role in human genetic variation and are used in medical diagnostics, phylogeny construction, and drug design. They provide the highest-resolution genetic fingerprint for identifying disease associations and human features. Haplotypes are regions of linked genetic variants that are closely spaced on the genome and tend to be inherited together. Genetics research has revealed SNPs within certain haplotype blocks that introduce few distinct common haplotypes into most of the population. Haplotype block structures are used in association-based methods to map disease genes. In this paper, we propose an efficient algorithm for identifying haplotype blocks in the genome. In chromosomal haplotype data retrieved from the HapMap project website, the proposed algorithm identified longer haplotype blocks than an existing algorithm. To enhance its performance, we extended the proposed algorithm into a parallel algorithm that copies data in parallel via the Hadoop MapReduce framework. The proposed MapReduce-paralleled combinatorial algorithm performed well on real-world data obtained from the HapMap dataset; the improvement in computational efficiency was proportional to the number of processors used. PMID:25569088

  14. Association of methylenetetrahydrofolate reductase gene-gene interaction and haplotype with susceptibility to acute lymphoblastic leukemia in Chinese children.

    PubMed

    Xia, Xiaojun; Duan, Yun; Cui, Jie; Jiang, Junfeng; Lin, Li; Peng, Xiaojuan; Wang, YuHong; Guo, Bingtao; Liu, Shouhai; Lei, Xudong

    2017-08-01

    The aim of this study was to investigate the association of methylenetetrahydrofolate reductase (MTHFR) gene polymorphism and additional gene-gene interaction with acute lymphoblastic leukemia (ALL) risk. Logistic regression was performed to investigate the association between two single nucleotide polymorphisms (SNPs) within MTHFR gene and ALL risk and additional gene-gene interaction between rs1801133 and rs1801131. The minor allele of rs1801133 and rs1801131 is associated with decreased ALL risk, OR (95% CI) were 0.61 (0.38-0.89), and 0.68 (0.50-0.96), respectively. We also found a significantly interaction between the two SNPs, participants with rs1801133 - CT or TT and rs1801131 - AC or CC genotype have the lowest ALL risk, compared with participants with rs1801133 - CC and rs1801131 - AA genotype, OR (95% CI) was 0.32 (0.12-0.63). We did not find any haplotype between the rs1801133 and rs1801131 associated with ALL risk. rs1801133 and rs1801131 within MTHFR gene and their interaction were both associated with ALL risk in Chinese children.

  15. Mapping of a Major QTL for Ceratocystis Wilt Disease in an F1 Population of Theobroma cacao

    PubMed Central

    Fernandes, Luciel dos Santos; Royaert, Stefan; Corrêa, Fábio M.; Mustiga, Guiliana M.; Marelli, Jean-Philippe; Corrêa, Ronan X.; Motamayor, Juan C.

    2018-01-01

    Cacao is an important crop, its beans are key raw materials for the chocolate and cosmetic industries. Ceratocystis wilt of cacao (CWC) caused by Ceratocystis cacaofunesta is a lethal disease for the crop. Therefore, the selection of resistant cacao varieties is one of the viable ways to minimize losses in cacao production. In this paper, we described the identification of a major QTL associated with CWC in an F1 mapping population from a cross between a resistant, “TSH 1188,” and a susceptible genotype, “CCN 51.” A set of 266 trees were genotyped using 3,526 single nucleotide polymorphic markers and then multiple QTL mapping analyses were performed. Two QTLs were identified on chromosomes IV and VI. The major QTL was located at 20 cM from the top position of chromosome VI, accounting for more than 60% of the phenotypic variation. The favorable allele T1, with haplotype GTT, came from the “TSH 1188” parent. It was evident that the haplotype combination T1C2 on chromosome VI was the most significant for resistance, since 93% of resistant trees had this haplotype. The major QTL converged to a genomic region of 739.4 kb that harbored nine candidate genes, including two major classes of resistance genes, which would make them the primary candidates involved in the resistance to CWC. The haplotypes detected are now used to improve the efficiency and precision of the selection of resistant trees in cacao breeding. PMID:29491879

  16. An EPAS1 haplotype is associated with high altitude polycythemia in male Han Chinese at the Qinghai-Tibetan plateau.

    PubMed

    Chen, Yu; Jiang, Chunhua; Luo, Yongjun; Liu, Fuyu; Gao, Yuqi

    2014-12-01

    Hemoglobin concentration at high altitude is considered an important marker of high altitude adaptation, and native Tibetans in the Qinghai-Tibetan plateau show lower hemoglobin concentrations than Han people who have emigrated from plains areas. Genetic studies revealed that EPAS1 plays a key role in high altitude adaptation and is associated with the low hemoglobin concentration in Tibetans. Three single nucleotide polymorphisms (rs13419896, rs4953354, rs1868092) of noncoding regions in EPAS1 exhibited significantly different allele frequencies in the Tibetan and Han populations and were associated with low hemoglobin concentrations in Tibetans. To explore the hereditary basis of high altitude polycythemia (HAPC) and investigate the association between EPAS1 and HAPC in the Han population, these 3 single nucleotide polymorphisms were assessed in 318 male Han Chinese HAPC patients and 316 control subjects. Genotyping was performed by high resolution melting curve analysis. The G-G-G haplotype of rs13419896, rs4953354, and rs1868092 was significantly more frequent in HAPC patients than in control subjects, whereas no differences in the allele or genotype frequencies of the 3 single nucleotide polymorphisms were found between HAPC patients and control subjects. Moreover, genotypes of rs1868092 (AA) and rs4953354 (GG) that were not observed in the Chinese Han in the Beijing population were found at frequencies of 1.6% and 0.9%, respectively, in our study population of HAPC patients and control subjects. Carriers of this EPAS1 haplotype (G-G-G, rs13419896, rs4953354, and rs1868092) may have a higher risk for HAPC. These results may contribute to a better understanding of the pathogenesis of HAPC in the Han population. Copyright © 2014 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  17. Origin and Diversification Dynamics of Self-Incompatibility Haplotypes

    PubMed Central

    Gervais, Camille E.; Castric, Vincent; Ressayre, Adrienne; Billiard, Sylvain

    2011-01-01

    Self-incompatibility (SI) is a genetic system found in some hermaphrodite plants. Recognition of pollen by pistils expressing cognate specificities at two linked genes leads to rejection of self pollen and pollen from close relatives, i.e., to avoidance of self-fertilization and inbred matings, and thus increased outcrossing. These genes generally have many alleles, yet the conditions allowing the evolution of new alleles remain mysterious. Evolutionary changes are clearly necessary in both genes, since any mutation affecting only one of them would result in a nonfunctional self-compatible haplotype. Here, we study diversification at the S-locus (i.e., a stable increase in the total number of SI haplotypes in the population, through the incorporation of new SI haplotypes), both deterministically (by investigating analytically the fate of mutations in an infinite population) and by simulations of finite populations. We show that the conditions allowing diversification are far less stringent in finite populations with recurrent mutations of the pollen and pistil genes, suggesting that diversification is possible in a panmictic population. We find that new SI haplotypes emerge fastest in populations with few SI haplotypes, and we discuss some implications for empirical data on S-alleles. However, allele numbers in our simulations never reach values as high as observed in plants whose SI systems have been studied, and we suggest extensions of our models that may reconcile the theory and data. PMID:21515570

  18. Novel Tenascin-C Haplotype Modifies the Risk for a Failure to Heal After Rotator Cuff Repair.

    PubMed

    Kluger, Rainer; Huber, Klaus R; Seely, Philipp G; Berger, Christian E; Frommlet, Florian

    2017-11-01

    Several single-nucleotide polymorphisms (SNPs) in the TNC gene have recently been found to be associated with degenerative rotator cuff tears. Exonic SNPs in the TNC gene are related to the risk for a failure to heal after rotator cuff repair. Case-control study; Level of evidence, 3. A total of 302 patients from the Vienna area and European Caucasian ancestry underwent mini-open rotator cuff repair for a full-thickness superior or posterosuperior tear and were assessed for the integrity of the repair 1 year postoperatively with a real-time 7.5- to 10-MHz ultrasound linear array transducer. Outcomes were classified as intact (complete footprint coverage), small (<200 mm 2 ), or large (≥200 mm 2 ) recurrent defect. Patients were genotyped for 15 previously identified risk SNPs within a 49-kbp segment of the TNC gene with the KASP genotyping technology or the Ion-Torrent Personal Genome Machine System. All recurrent defects were atraumatic failures, and the overall failure rate was 39.7%. Of the traditional risk factors, only the initial tear size was significantly associated with a failure to heal. In a multinomial logistic regression model, the T allele at rs1138545 [C>T] was protective for a large recurrent defect (odds ratio = 0.16; 95% CI, 0.09-0.31). The role of rs1138545 was further backed by haplotype analysis, which showed that the combination of the C allele at rs1138545 [C>T], the A allele at rs2104772 [A>T], and the G allele at rs10759752 [A>G] formed the risk-related haplotype [CAG]. The CAG haplotype was associated with large recurrent defects ( P < .0001; haplotype frequency, 0.394; haplotype score, 4.518). Exonic marker rs1138545 transcribed into all isoforms of the TNC protein, whereas exonic marker rs2104772, which has been associated with Achilles tendinopathy before, transcribed only into large isoforms of the TNC protein. Recurrent defects after rotator cuff repairs are clinically relevant, and a heritable component of the disorder is plausible

  19. Ancestral inference from haplotypes and mutations.

    PubMed

    Griffiths, Robert C; Tavaré, Simon

    2018-04-25

    We consider inference about the history of a sample of DNA sequences, conditional upon the haplotype counts and the number of segregating sites observed at the present time. After deriving some theoretical results in the coalescent setting, we implement rejection sampling and importance sampling schemes to perform the inference. The importance sampling scheme addresses an extension of the Ewens Sampling Formula for a configuration of haplotypes and the number of segregating sites in the sample. The implementations include both constant and variable population size models. The methods are illustrated by two human Y chromosome datasets. Copyright © 2018. Published by Elsevier Inc.

  20. Revealing phenotype-associated functional differences by genome-wide scan of ancient haplotype blocks

    PubMed Central

    Onuki, Ritsuko; Yamaguchi, Rui; Shibuya, Tetsuo; Kanehisa, Minoru; Goto, Susumu

    2017-01-01

    Genome-wide scans for positive selection have become important for genomic medicine, and many studies aim to find genomic regions affected by positive selection that are associated with risk allele variations among populations. Most such studies are designed to detect recent positive selection. However, we hypothesize that ancient positive selection is also important for adaptation to pathogens, and has affected current immune-mediated common diseases. Based on this hypothesis, we developed a novel linkage disequilibrium-based pipeline, which aims to detect regions associated with ancient positive selection across populations from single nucleotide polymorphism (SNP) data. By applying this pipeline to the genotypes in the International HapMap project database, we show that genes in the detected regions are enriched in pathways related to the immune system and infectious diseases. The detected regions also contain SNPs reported to be associated with cancers and metabolic diseases, obesity-related traits, type 2 diabetes, and allergic sensitization. These SNPs were further mapped to biological pathways to determine the associations between phenotypes and molecular functions. Assessments of candidate regions to identify functions associated with variations in incidence rates of these diseases are needed in the future. PMID:28445522

  1. A second generation human haplotype map of over 3.1 million SNPs.

    PubMed

    Frazer, Kelly A; Ballinger, Dennis G; Cox, David R; Hinds, David A; Stuve, Laura L; Gibbs, Richard A; Belmont, John W; Boudreau, Andrew; Hardenbol, Paul; Leal, Suzanne M; Pasternak, Shiran; Wheeler, David A; Willis, Thomas D; Yu, Fuli; Yang, Huanming; Zeng, Changqing; Gao, Yang; Hu, Haoran; Hu, Weitao; Li, Chaohua; Lin, Wei; Liu, Siqi; Pan, Hao; Tang, Xiaoli; Wang, Jian; Wang, Wei; Yu, Jun; Zhang, Bo; Zhang, Qingrun; Zhao, Hongbin; Zhao, Hui; Zhou, Jun; Gabriel, Stacey B; Barry, Rachel; Blumenstiel, Brendan; Camargo, Amy; Defelice, Matthew; Faggart, Maura; Goyette, Mary; Gupta, Supriya; Moore, Jamie; Nguyen, Huy; Onofrio, Robert C; Parkin, Melissa; Roy, Jessica; Stahl, Erich; Winchester, Ellen; Ziaugra, Liuda; Altshuler, David; Shen, Yan; Yao, Zhijian; Huang, Wei; Chu, Xun; He, Yungang; Jin, Li; Liu, Yangfan; Shen, Yayun; Sun, Weiwei; Wang, Haifeng; Wang, Yi; Wang, Ying; Xiong, Xiaoyan; Xu, Liang; Waye, Mary M Y; Tsui, Stephen K W; Xue, Hong; Wong, J Tze-Fei; Galver, Luana M; Fan, Jian-Bing; Gunderson, Kevin; Murray, Sarah S; Oliphant, Arnold R; Chee, Mark S; Montpetit, Alexandre; Chagnon, Fanny; Ferretti, Vincent; Leboeuf, Martin; Olivier, Jean-François; Phillips, Michael S; Roumy, Stéphanie; Sallée, Clémentine; Verner, Andrei; Hudson, Thomas J; Kwok, Pui-Yan; Cai, Dongmei; Koboldt, Daniel C; Miller, Raymond D; Pawlikowska, Ludmila; Taillon-Miller, Patricia; Xiao, Ming; Tsui, Lap-Chee; Mak, William; Song, You Qiang; Tam, Paul K H; Nakamura, Yusuke; Kawaguchi, Takahisa; Kitamoto, Takuya; Morizono, Takashi; Nagashima, Atsushi; Ohnishi, Yozo; Sekine, Akihiro; Tanaka, Toshihiro; Tsunoda, Tatsuhiko; Deloukas, Panos; Bird, Christine P; Delgado, Marcos; Dermitzakis, Emmanouil T; Gwilliam, Rhian; Hunt, Sarah; Morrison, Jonathan; Powell, Don; Stranger, Barbara E; Whittaker, Pamela; Bentley, David R; Daly, Mark J; de Bakker, Paul I W; Barrett, Jeff; Chretien, Yves R; Maller, Julian; McCarroll, Steve; Patterson, Nick; Pe'er, Itsik; Price, Alkes; Purcell, Shaun; Richter, Daniel J; Sabeti, Pardis; Saxena, Richa; Schaffner, Stephen F; Sham, Pak C; Varilly, Patrick; Altshuler, David; Stein, Lincoln D; Krishnan, Lalitha; Smith, Albert Vernon; Tello-Ruiz, Marcela K; Thorisson, Gudmundur A; Chakravarti, Aravinda; Chen, Peter E; Cutler, David J; Kashuk, Carl S; Lin, Shin; Abecasis, Gonçalo R; Guan, Weihua; Li, Yun; Munro, Heather M; Qin, Zhaohui Steve; Thomas, Daryl J; McVean, Gilean; Auton, Adam; Bottolo, Leonardo; Cardin, Niall; Eyheramendy, Susana; Freeman, Colin; Marchini, Jonathan; Myers, Simon; Spencer, Chris; Stephens, Matthew; Donnelly, Peter; Cardon, Lon R; Clarke, Geraldine; Evans, David M; Morris, Andrew P; Weir, Bruce S; Tsunoda, Tatsuhiko; Mullikin, James C; Sherry, Stephen T; Feolo, Michael; Skol, Andrew; Zhang, Houcan; Zeng, Changqing; Zhao, Hui; Matsuda, Ichiro; Fukushima, Yoshimitsu; Macer, Darryl R; Suda, Eiko; Rotimi, Charles N; Adebamowo, Clement A; Ajayi, Ike; Aniagwu, Toyin; Marshall, Patricia A; Nkwodimmah, Chibuzor; Royal, Charmaine D M; Leppert, Mark F; Dixon, Missy; Peiffer, Andy; Qiu, Renzong; Kent, Alastair; Kato, Kazuto; Niikawa, Norio; Adewole, Isaac F; Knoppers, Bartha M; Foster, Morris W; Clayton, Ellen Wright; Watkin, Jessica; Gibbs, Richard A; Belmont, John W; Muzny, Donna; Nazareth, Lynne; Sodergren, Erica; Weinstock, George M; Wheeler, David A; Yakub, Imtaz; Gabriel, Stacey B; Onofrio, Robert C; Richter, Daniel J; Ziaugra, Liuda; Birren, Bruce W; Daly, Mark J; Altshuler, David; Wilson, Richard K; Fulton, Lucinda L; Rogers, Jane; Burton, John; Carter, Nigel P; Clee, Christopher M; Griffiths, Mark; Jones, Matthew C; McLay, Kirsten; Plumb, Robert W; Ross, Mark T; Sims, Sarah K; Willey, David L; Chen, Zhu; Han, Hua; Kang, Le; Godbout, Martin; Wallenburg, John C; L'Archevêque, Paul; Bellemare, Guy; Saeki, Koji; Wang, Hongguang; An, Daochang; Fu, Hongbo; Li, Qing; Wang, Zhen; Wang, Renwu; Holden, Arthur L; Brooks, Lisa D; McEwen, Jean E; Guyer, Mark S; Wang, Vivian Ota; Peterson, Jane L; Shi, Michael; Spiegel, Jack; Sung, Lawrence M; Zacharia, Lynn F; Collins, Francis S; Kennedy, Karen; Jamieson, Ruth; Stewart, John

    2007-10-18

    We describe the Phase II HapMap, which characterizes over 3.1 million human single nucleotide polymorphisms (SNPs) genotyped in 270 individuals from four geographically diverse populations and includes 25-35% of common SNP variation in the populations surveyed. The map is estimated to capture untyped common variation with an average maximum r2 of between 0.9 and 0.96 depending on population. We demonstrate that the current generation of commercial genome-wide genotyping products captures common Phase II SNPs with an average maximum r2 of up to 0.8 in African and up to 0.95 in non-African populations, and that potential gains in power in association studies can be obtained through imputation. These data also reveal novel aspects of the structure of linkage disequilibrium. We show that 10-30% of pairs of individuals within a population share at least one region of extended genetic identity arising from recent ancestry and that up to 1% of all common variants are untaggable, primarily because they lie within recombination hotspots. We show that recombination rates vary systematically around genes and between genes of different function. Finally, we demonstrate increased differentiation at non-synonymous, compared to synonymous, SNPs, resulting from systematic differences in the strength or efficacy of natural selection between populations.

  2. A CT-rich haplotype in intron 4 of SNCA confers risk for Lewy body pathology in Alzheimer’s disease and affects SNCA expression

    PubMed Central

    Lutz, Michael W.; Saul, Robert; Linnertz, Colton; Glenn, Omolara-Chinue; Roses, Allen D.; Chiba-Falek, Ornit

    2015-01-01

    INTRODUCTION We recently showed that tagging-SNPs across the SNCA locus were significantly associated with increased risk for LB pathology in AD cases. However, the actual genetic variant(s) that underlie the observed associations remain elusive. METHODS We used a bioinformatics algorithm to catalogue Structural-Variants in a region of SNCA-intron4, followed by phased-sequencing. We performed a genetic-association analysis in autopsy series of LBV/AD cases compared with AD-only controls. We investigated the biological functions by expression analysis using temporal-cortex samples. RESULTS We identified four distinct haplotypes within a highly-polymorphic-low-complexity CT-rich region. We showed that a specific haplotype conferred risk to develop LBV/AD. We demonstrated that the CT-rich site acts as an enhancer element, where the risk haplotype was significantly associated with elevated levels of SNCA-mRNA. DISCUSSION We have discovered a novel haplotype in a CT-rich region in SNCA that contributes to LB pathology in AD patients, possibly via cis-regulation of the gene expression. PMID:26079410

  3. Recent Advances in Experimental Whole Genome Haplotyping Methods

    PubMed Central

    Huang, Mengting; Lu, Zuhong

    2017-01-01

    Haplotype plays a vital role in diverse fields; however, the sequencing technologies cannot resolve haplotype directly. Pioneers demonstrated several approaches to resolve haplotype in the early years, which was extensively reviewed. Since then, numerous methods have been developed recently that have significantly improved phasing performance. Here, we review experimental methods that have emerged mainly over the past five years, and categorize them into five classes according to their maximum scale of contiguity: (i) encapsulation, (ii) 3D structure capture and construction, (iii) compartmentalization, (iv) fluorography, (v) long-read sequencing. Several subsections of certain methods are attached to each class as instances. We also discuss the relative advantages and disadvantages of different classes and make comparisons among representative methods of each class. PMID:28891974

  4. Trans-Ancestral Studies Fine Map the SLE-Susceptibility Locus TNFSF4

    PubMed Central

    Manku, Harinder; Langefeld, Carl D.; Guerra, Sandra G.; Malik, Talat H.; Alarcon-Riquelme, Marta; Anaya, Juan-Manuel; Bae, Sang-Cheol; Boackle, Susan A.; Brown, Elizabeth E.; Criswell, Lindsey A.; Freedman, Barry I.; Gaffney, Patrick M.; Gregersen, Peter A.; Guthridge, Joel M.; Han, Sang-Hoon; Harley, John B.; Jacob, Chaim O.; James, Judith A.; Kamen, Diane L.; Kaufman, Kenneth M.; Kelly, Jennifer A.; Martin, Javier; Merrill, Joan T.; Moser, Kathy L.; Niewold, Timothy B.; Park, So-Yeon; Pons-Estel, Bernardo A.; Sawalha, Amr H.; Scofield, R. Hal; Shen, Nan; Stevens, Anne M.; Sun, Celi; Gilkeson, Gary S.; Edberg, Jeff C.; Kimberly, Robert P.; Nath, Swapan K.; Tsao, Betty P.; Vyse, Tim J.

    2013-01-01

    We previously established an 80 kb haplotype upstream of TNFSF4 as a susceptibility locus in the autoimmune disease SLE. SLE-associated alleles at this locus are associated with inflammatory disorders, including atherosclerosis and ischaemic stroke. In Europeans, the TNFSF4 causal variants have remained elusive due to strong linkage disequilibrium exhibited by alleles spanning the region. Using a trans-ancestral approach to fine-map the locus, utilising 17,900 SLE and control subjects including Amerindian/Hispanics (1348 cases, 717 controls), African-Americans (AA) (1529, 2048) and better powered cohorts of Europeans and East Asians, we find strong association of risk alleles in all ethnicities; the AA association replicates in African-American Gullah (152,122). The best evidence of association comes from two adjacent markers: rs2205960-T (P = 1.71×10−34, OR = 1.43[1.26–1.60]) and rs1234317-T (P = 1.16×10−28, OR = 1.38[1.24–1.54]). Inference of fine-scale recombination rates for all populations tested finds the 80 kb risk and non-risk haplotypes in all except African-Americans. In this population the decay of recombination equates to an 11 kb risk haplotype, anchored in the 5′ region proximal to TNFSF4 and tagged by rs2205960-T after 1000 Genomes phase 1 (v3) imputation. Conditional regression analyses delineate the 5′ risk signal to rs2205960-T and the independent non-risk signal to rs1234314-C. Our case-only and SLE-control cohorts demonstrate robust association of rs2205960-T with autoantibody production. The rs2205960-T is predicted to form part of a decameric motif which binds NF-κBp65 with increased affinity compared to rs2205960-G. ChIP-seq data also indicate NF-κB interaction with the DNA sequence at this position in LCL cells. Our research suggests association of rs2205960-T with SLE across multiple groups and an independent non-risk signal at rs1234314-C. rs2205960-T is associated with autoantibody production and

  5. APOC3/A5 haplotypes, lipid levels, and risk of myocardial infarction in the Central Valley of Costa Rica.

    PubMed

    Ruiz-Narváez, Edward A; Yang, Yadong; Nakanishi, Yukiko; Kirchdorfer, Jill; Campos, Hannia

    2005-12-01

    Genetic variation in the APOC3 and APOA5 genes has been associated with plasma triglyceride concentrations and may affect the risk of myocardial infarction (MI). To assess whether APOC3/A5 haplotypes are associated with risk of MI, we examined three single-nucleotide polymorphisms (SNPs) in APOC3 (3238C>G, -455T>C, and -482C>T) and six SNPs in the APOA5 gene (-1131T>C, c.-3A>G, c.56C>G, IVS3+476G>A, c.553G>T, and c.1259T>C) in incident cases (n = 1,703) of a first nonfatal MI matched for gender, age, and area of residence with population-based controls (n = 1,703). Conditional logistic regression models, adjusted for potential environmental confounders, were used for analysis. The common APOC3*222 haplotype was more frequent in cases than in controls (17.4% and 13.7%, respectively, P < 0.001) and was associated with increased risk of MI [odds ratio (OR) = 1.27; 95% confidence interval (95% CI), 1.09, 1.48] compared with APOC3*111 wild-type haplotype. This association was independent of the APOA5 SNPs. Although the APOC3 3238G, APOA5 -1131C, APOA5 c.-3G, and APOA5 c.1259C alleles were associated with higher triglyceride plasma concentrations, these effects could not explain the associations with MI in this population. In summary, this study supports the hypothesis that haplotypes in the APOC3 gene but not in the APOA5 gene increase susceptibility to MI.

  6. Fine mapping of chromosome 15q25.1 lung cancer susceptibility in African-Americans.

    PubMed

    Hansen, Helen M; Xiao, Yuanyuan; Rice, Terri; Bracci, Paige M; Wrensch, Margaret R; Sison, Jennette D; Chang, Jeffery S; Smirnov, Ivan V; Patoka, Joseph; Seldin, Michael F; Quesenberry, Charles P; Kelsey, Karl T; Wiencke, John K

    2010-09-15

    Several genome-wide association studies identified the chr15q25.1 region, which includes three nicotinic cholinergic receptor genes (CHRNA5-B4) and the cell proliferation gene (PSMA4), for its association with lung cancer risk in Caucasians. A haplotype and its tagging single nucleotide polymorphisms (SNPs) encompassing six genes from IREB2 to CHRNB4 were most strongly associated with lung cancer risk (OR = 1.3; P < 10(-20)). In order to narrow the region of association and identify potential causal variations, we performed a fine-mapping study using 77 SNPs in a 194 kb segment of the 15q25.1 region in a sample of 448 African-American lung cancer cases and 611 controls. Four regions, two SNPs and two distinct haplotypes from sliding window analyses, were associated with lung cancer. CHRNA5 rs17486278 G had OR = 1.28, 95% CI 1.07-1.54 and P = 0.008, whereas CHRNB4 rs7178270 G had OR = 0.78, 95% CI 0.66-0.94 and P = 0.008 for lung cancer risk. Lung cancer associations remained significant after pack-year adjustment. Rs7178270 decreased lung cancer risk in women but not in men; gender interaction P = 0.009. For two SNPs (rs7168796 A/G and rs7164594 A/G) upstream of PSMA4, lung cancer risks for people with haplotypes GG and AA were reduced compared with those with AG (OR = 0.56, 95% CI 0.38-0.82; P = 0.003 and OR = 0.73, 95% CI 0.59-0.90, P = 0.004, respectively). A four-SNP haplotype spanning CHRNA5 (rs11637635 C, rs17408276 T, rs16969968 G) and CHRNA3 (rs578776 G) was associated with increased lung cancer risk (P = 0.002). The identified regions contain SNPs predicted to affect gene regulation. There are multiple lung cancer risk loci in the 15q25.1 region in African-Americans.

  7. De novo assembly of a haplotype-resolved human genome.

    PubMed

    Cao, Hongzhi; Wu, Honglong; Luo, Ruibang; Huang, Shujia; Sun, Yuhui; Tong, Xin; Xie, Yinlong; Liu, Binghang; Yang, Hailong; Zheng, Hancheng; Li, Jian; Li, Bo; Wang, Yu; Yang, Fang; Sun, Peng; Liu, Siyang; Gao, Peng; Huang, Haodong; Sun, Jing; Chen, Dan; He, Guangzhu; Huang, Weihua; Huang, Zheng; Li, Yue; Tellier, Laurent C A M; Liu, Xiao; Feng, Qiang; Xu, Xun; Zhang, Xiuqing; Bolund, Lars; Krogh, Anders; Kristiansen, Karsten; Drmanac, Radoje; Drmanac, Snezana; Nielsen, Rasmus; Li, Songgang; Wang, Jian; Yang, Huanming; Li, Yingrui; Wong, Gane Ka-Shu; Wang, Jun

    2015-06-01

    The human genome is diploid, and knowledge of the variants on each chromosome is important for the interpretation of genomic information. Here we report the assembly of a haplotype-resolved diploid genome without using a reference genome. Our pipeline relies on fosmid pooling together with whole-genome shotgun strategies, based solely on next-generation sequencing and hierarchical assembly methods. We applied our sequencing method to the genome of an Asian individual and generated a 5.15-Gb assembled genome with a haplotype N50 of 484 kb. Our analysis identified previously undetected indels and 7.49 Mb of novel coding sequences that could not be aligned to the human reference genome, which include at least six predicted genes. This haplotype-resolved genome represents the most complete de novo human genome assembly to date. Application of our approach to identify individual haplotype differences should aid in translating genotypes to phenotypes for the development of personalized medicine.

  8. HERC1 polymorphisms: population-specific variations in haplotype composition.

    PubMed

    Yuasa, Isao; Umetsu, Kazuo; Nishimukai, Hiroaki; Fukumori, Yasuo; Harihara, Shinji; Saitou, Naruya; Jin, Feng; Chattopadhyay, Prasanta K; Henke, Lotte; Henke, Jürgen

    2009-08-01

    Human HERC1 is one of six HERC proteins and may play an important role in intracellular membrane trafficking. The human HERC1 gene is suggested to have been affected by local positive selection. To assess the global frequency distributions of coding and non-coding single nucleotide polymorphisms (SNPs) in the HERC1 gene, we developed a new simultaneous genotyping method for four SNPs, and applied this method to investigate 1213 individuals from 12 global populations. The results confirmed remarked differences in the allele and haplotype frequencies between East Asian and non-East Asian populations. One of the three common haplotypes observed was found to be characteristic of East Asians, who showed a relatively uniform distribution of haplotypes. Information on haplotypes would be useful for testing the function of polymorphisms in the HERC1 gene. This is the first study to investigate the distribution of HERC1 polymorphisms in various populations. (c) 2009 John Wiley & Sons, Ltd.

  9. Short communication: casein haplotype variability in sicilian dairy goat breeds.

    PubMed

    Gigli, I; Maizon, D O; Riggio, V; Sardina, M T; Portolano, B

    2008-09-01

    In the Mediterranean region, goat milk production is an important economic activity. In the present study, 4 casein genes were genotyped in 5 Sicilian goat breeds to 1) identify casein haplotypes present in the Argentata dell'Etna, Girgentana, Messinese, Derivata di Siria, and Maltese goat breeds; and 2) describe the structure of the Sicilian goat breeds based on casein haplotypes and allele frequencies. In a sample of 540 dairy goats, 67 different haplotypes with frequency >or=0.01 and 27 with frequency >or=0.03 were observed. The most common CSN1S1-CSN2-CSN1S2-CSN3 haplotype for Derivata di Siria and Maltese was FCFB (0.17 and 0.22, respectively), whereas for Argentata dell'Etna, Girgentana and Messinese was ACAB (0.06, 0.23, and 0.10, respectively). According to the haplotype reconstruction, Argentata dell'Etna, Girgentana, and Messinese breeds presented the most favorable haplotype for cheese production, because the casein concentration in milk of these breeds might be greater than that in Derivata di Siria and Maltese breeds. Based on a cluster analysis, the breeds formed 2 main groups: Derivata di Siria, and Maltese in one group, and Argentata dell'Etna and Messinese in the other; the Girgentana breed was between these groups but closer to the latter.

  10. Association Mapping and Haplotype Analysis of a 3.1-Mb Genomic Region Involved in Fusarium Head Blight Resistance on Wheat Chromosome 3BS

    PubMed Central

    Hao, Chenyang; Wang, Yuquan; Hou, Jian; Feuillet, Catherine; Balfourier, Francois; Zhang, Xueyong

    2012-01-01

    A previous study provided an in-depth understanding of molecular population genetics of European and Asian wheat gene pools using a sequenced 3.1-Mb contig (ctg954) on chromosome 3BS. This region is believed to carry the Fhb1 gene for response to Fusarium head blight. In this study, 266 wheat accessions were evaluated in three environments for Type II FHB response based on the single floret inoculation method. Hierarchical clustering (UPGMA) based on a Manhattan dissimilarity matrix divided the accessions into eight groups according to five FHB-related traits which have a high correlation between them; Group VIII comprised six accessions with FHB response levels similar to variety Sumai 3. Based on the compressed mixed linear model (MLM), association analysis between five FHB-related traits and 42 molecular markers along the 3.1-Mb region revealed 12 significant association signals at a threshold of P<0.05. The highest proportion of phenotypic variation (6.2%) in number of diseased spikelets (NDS) occurred at locus cfb6059, and the physical distance was about 2.9 Kb between umn10 and this marker. Haplotype block (HapB) analysis using a sliding window LD of 5 markers, detected six HapBs in the 3.1-Mb region at r2>0.1 and P<0.001 between random closely linked markers. F-tests among Haps with frequencies >0.05 within each HapB at r2>0.1 and P<0.001 showed significant differences between the Hap carried by FHB resistant resources, such as Sumai 3 and Wangshuibai, and susceptible genotypes in HapB3 and HapB6. These results suggest that Fhb1 is located within HapB6, with the possibility that another gene is located at or near HapB3. SSR markers and Haps detected in this study will be helpful in further understanding the genetic basis of FHB resistance, and provide useful information for marker-assisted selection of Fhb1 in wheat breeding. PMID:23071572

  11. Mineralocorticoid receptor haplotypes sex-dependently moderate depression susceptibility following childhood maltreatment.

    PubMed

    Vinkers, Christiaan H; Joëls, Marian; Milaneschi, Yuri; Gerritsen, Lotte; Kahn, René S; Penninx, Brenda W J H; Boks, Marco P M

    2015-04-01

    The MR is an important regulator of the hypothalamic-pituitary-adrenal (HPA) axis and a prime target for corticosteroids. There is increasing evidence from both clinical and preclinical studies that the MR has different effects on behavior and mood in males and females. To investigate the hypothesis that the MR sex-dependently influences the relation between childhood maltreatment and depression, we investigated three common and functional MR haplotypes (GA, CA, and CG haplotype, based on rs5522 and rs2070951) in a population-based cohort (N = 665) and an independent clinical cohort from the Netherlands Study of Depression and Anxiety (NESDA) (N = 1639). The CA haplotype sex-dependently moderated the relation between childhood maltreatment and depressive symptoms both in the population-based sample (sex × maltreatment × haplotype: β = -4.07, P = 0.029) and in the clinical sample (sex × maltreatment × haplotype, β = -2.40, P = 0.011). Specifically, female individuals in the population-based sample were protected (β = -4.58, P = 2.0 e(-5)), whereas males in the clinical sample were at increased risk (β = 2.54, P = 0.0022). In line with these results, female GA haplotype carriers displayed increased vulnerability in the population-based sample (β = 4.58, P = 7.5 e(-5)) whereas male CG-carriers showed increased resilience in the clinical sample (β = -2.71, P = 0.016). Consistently, we found a decreased lifetime MDD risk for male GA haplotype carriers following childhood maltreatment but an increased risk for male CA haplotype carriers in the clinical sample. In both samples, sex-dependent effects were observed for GA-GA diplotype carriers. In summary, sex plays an important role in determining whether functional genetic variation in MR is beneficial or detrimental, with an apparent female advantage for the CA haplotype but male advantage for the GA and CG haplotype. These sex-dependent effects of MR on depression susceptibility following childhood

  12. Levels of human platelet-derived soluble CD40 ligand depend on haplotypes of CD40LG-CD40-ITGA2

    PubMed Central

    Aloui, Chaker; Prigent, Antoine; Tariket, Sofiane; Sut, Caroline; Fagan, Jocelyne; Cognasse, Fabrice; Chakroun, Tahar; Garraud, Olivier; Laradi, Sandrine

    2016-01-01

    Increased circulating soluble CD40 ligand (sCD40L) is commonly associated with inflammatory disorders. We aimed to investigate whether gene polymorphisms in CD40LG, CD40 and ITGA2 are associated with a propensity to secrete sCD40L; thus, we examined this issue at the level of human platelets, the principal source of sCD40L. We performed single polymorphism and haplotype analyses to test for the effect of twelve polymorphisms across the CD40LG, CD40 and ITGA2 genes in blood donors. ITGA2 presented a positive association with rs1126643, with a significant modification in sCD40L secretion (carriers of C allele, P = 0.02), unlike the investigated CD40LG and CD40 polymorphisms. One CD40LG haplotype (TGGC) showing rs975379 (C/T), rs3092952 (A/G), rs3092933 (A/G) and rs3092929 (A/C) was associated with increased sCD40L levels (1.906 μg/L (95% CI: 1.060 to 2.751); P = 0.000009). The sCD40L level was associated with the inter-chromosomal CD40LG/CD40/ITGA2 haplotype (ATC), displaying rs3092952 (A/G), rs1883832 (C/T) and rs1126643 (C/T), with increased sCD40L levels (P = 0.0135). Our results help to decipher the genetic role of CD40LG, CD40 and ITGA2 with regard to sCD40L levels found in platelet components. Given the crucial role of sCD40L, this haplotype study in a transfusion model may be helpful to further determine the role of haplotypes in inflammatory clinical settings. PMID:27094978

  13. Effect of genetic type and casein haplotype on antioxidant activity of yogurts during storage.

    PubMed

    Perna, A; Intaglietta, I; Simonetti, A; Gambacorta, E

    2013-06-01

    The aim of this work was to investigate the antioxidant activity of yogurt made from the milk of 2 breeds-Italian Brown and Italian Holstein-characterized by different casein haplotypes (αS1-, β-, and κ-caseins) during storage up to 15 d. The casein haplotype was determined by isoelectric focusing; antioxidant activity of yogurt was measured using 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid). The statistical analysis showed a significant effect of the studied factors. Antioxidant activity increased during storage of both yogurt types, but yogurt produced with Italian Brown milk showed higher antioxidant activity than those produced with Italian Holstein milk. A high scavenging activity was present in yogurts with the allelic combination of BB-A(2)A(2)-BB. The results of this study suggest that the genetic type and the haplotype make a significant contribution in the production of yogurts with high nutraceutical value. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  14. Comparative analysis of the IGF2 and ZBED6 gene variants and haplotypes reveals significant effect of growth traits in cattle.

    PubMed

    Huang, Yong-Zhen; Zhan, Zhao-Yang; Sun, Yu-Jia; Wang, Jing; Li, Ming-Xun; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong

    2013-06-01

    Muscle growth is a complex phenomenon regulated by many factors, whereby net growth results from the combined action of synthesis and turnover. Insulin-like growth factor 2 (IGF2) is a fetal growth and differentiation factor that plays an important role in muscle growth and in myoblast proliferation and differentiation; Zinc finger, BED-type containing 6 (ZBED6) is a novel transcription factor that was identified and shown to act as a repressor of IGF2 transcription in skeletal muscle. In this study, a total of seven single nucleotide polymorphisms (SNPs) were identified, four SNPs in intron 8 of IGF2 and one promoter SNP and two missense mutations in the coding region of ZBED6, two of which were in complete linkage disequilibrium (LD) in the bovine IGF2. The 58 haplotypes were inferred in 1522 individuals representing four purebred cattle breeds from China. The seven SNPs, 79 and 66 combined diplotypes were revealed for association with body mass in Nanyang and Jiaxian cattle populations at five different ages (P < 0.05 or 0.01). The mutant-type variants and haplotype 58 (likely in LD with the beneficial quantitative trait nucleotide allele) was superior for body mass; the heterozygote diplotype of the most common haplotypes 58 was associated with higher body mass compared to either heterozygote or homozygote. The statistical analyses indicated that the mutant-type variants and haplotypes are significantly associated with body mass in study cattle populations at different ages. These data demonstrate that variants and haplotypes are associated with growth traits, and these results may provide important biological insights into the phenotypic differentiation that is associated with adaptation and specialization of cattle breeds.

  15. Predictive value of interleukin-10 promoter genotypes and haplotypes in determining the susceptibility to nephropathy in type 2 diabetes patients.

    PubMed

    Mtiraoui, Nabil; Ezzidi, Intissar; Kacem, Maha; Ben Hadj Mohamed, Manel; Chaieb, Molka; Haj Jilani, Aoutef Bel; Mahjoub, Touhami; Almawi, Wassim Y

    2009-01-01

    The IL-10 promoter polymorphisms -1082G/A, -819C/T, and -592C/A have been consistently associated with type 2 diabetes (T2DM). We examined whether these polymorphisms variants are also associated with progression of diabetic nephropathy (DN). These promoter variants were genotyped in 917 T2DM patients comprising 515 DN patients and 402 control patients without nephropathy (DWN), together with 748 non-diabetic control subjects. Haplotype analysis and multivariate regression analysis were employed in assessing the contribution of IL-10 haplotypes to DN risk, using genotype, clinical and biochemical profile, and their interactions as predictors of DN. Carriers of mutant -592A and -819T alleles, and -819T/T, -592A/A, and -819C/T genotypes were more frequent in T2DM. However, the -819C/T genotype appeared to be protective of DN, since lower frequency -819T allele and -819C/T genotype were seen in DN patients. Regression analysis identified -1082G/-819T/-592A (GTA) and -1082G/-819T/-592C (GTC) haplotypes as DN-protective haplotypes. Relative to the -1082G/-819C/-592C haplotype, GTA [P = 0.044; odds ratio (OR) = 0.54, 95% confidence interval (CI): 0.30-0.98] and GTC (P = 0.045; OR = 0.56, 95% CI: 0.31-0.99) haplotypes were associated with decreased odds ratio (OR) for DN, after controlling for a number of covariates (age, sex, body mass index (BMI), hypertension, glucose, HbA(1c), DN duration, total cholesterol). Our results indicate that genetic variations at the IL-10 promoter influence the risk of nephropathy in T2DM patients and thus represent a potential DN genetic-susceptibility locus worthy of replication. Copyright 2009 John Wiley & Sons, Ltd.

  16. Cytochrome P450 2E1 gene polymorphisms/haplotypes and anti-tuberculosis drug-induced hepatitis in a Chinese cohort.

    PubMed

    Tang, Shaowen; Lv, Xiaozhen; Zhang, Yuan; Wu, Shanshan; Yang, Zhirong; Xia, Yinyin; Tu, Dehua; Deng, Peiyuan; Ma, Yu; Chen, Dafang; Zhan, Siyan

    2013-01-01

    The pathogenic mechanism of anti-tuberculosis (anti-TB) drug-induced hepatitis is associated with drug metabolizing enzymes. No tagging single-nucleotide polymorphisms (tSNPs) of cytochrome P450 2E1(CYP2E1) in the risk of anti-TB drug-induced hepatitis have been reported. The present study was aimed at exploring the role of tSNPs in CYP2E1 gene in a population-based anti-TB treatment cohort. A nested case-control study was designed. Each hepatitis case was 14 matched with controls by age, gender, treatment history, disease severity and drug dosage. The tSNPs were selected by using Haploview 4.2 based on the HapMap database of Han Chinese in Beijing, and detected by using TaqMan allelic discrimination technology. Eighty-nine anti-TB drug-induced hepatitis cases and 356 controls were included in this study. 6 tSNPs (rs2031920, rs2070672, rs915908, rs8192775, rs2515641, rs2515644) were genotyped and minor allele frequencies of these tSNPs were 21.9%, 23.0%, 19.1%, 23.6%, 20.8% and 44.4% in the cases and 20.9%, 22.7%, 18.9%, 23.2%, 18.2% and 43.2% in the controls, respectively. No significant difference was observed in genotypes or allele frequencies of the 6 tSNPs between case group and control group, and neither of haplotypes in block 1 nor in block 2 was significantly associated with the development of hepatitis. Based on the Chinese anti-TB treatment cohort, we did not find a statistically significant association between genetic polymorphisms of CYP2E1 and the risk of anti-TB drug-induced hepatitis. None of the haplotypes showed a significant association with the development of hepatitis in Chinese TB population.

  17. Fitchi: haplotype genealogy graphs based on the Fitch algorithm.

    PubMed

    Matschiner, Michael

    2016-04-15

    : In population genetics and phylogeography, haplotype genealogy graphs are important tools for the visualization of population structure based on sequence data. In this type of graph, node sizes are often drawn in proportion to haplotype frequencies and edge lengths represent the minimum number of mutations separating adjacent nodes. I here present Fitchi, a new program that produces publication-ready haplotype genealogy graphs based on the Fitch algorithm. http://www.evoinformatics.eu/fitchi.htm : michaelmatschiner@mac.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Rapid growth of a Eurasian haplotype of Phragmites australis in a restored brackish marsh in Louisiana, USA

    USGS Publications Warehouse

    Howard, R.J.; Travis, S.E.; Sikes, B.A.

    2008-01-01

    While numerous studies have documented patterns of invasion by non-indigenous plant species, few have considered the invasive properties of non-native genotypes of native species. Characteristics associated with specific genotypes, such as tolerance to disturbance, may mistakenly be applied to an entire species in the absence of genetic information, which consequently may affect management decisions. We report here on the incidence and growth of an introduced lineage of Phragmites australis in the Gulf of Mexico coastal zone of Louisiana. P. australis was collected from nine separate locations for inclusion in a series of growth experiments. Chloroplast DNA analysis indicated that specimens collected from four locations in the Mississippi River Delta represented the introduced Eurasian haplotype; the remainder represented the gulf coast haplotype. Three distinct genotypes, or clones, were identified within each haplotype via analysis using amplified fragment length polymorphisms, which also revealed reduced genetic diversity of the gulf coast clones compared to the Eurasian clones. Clones of each haplotype were planted along with three other native macrophytes at similar densities in a restored brackish marsh and monitored for growth. After 14 months, the Eurasian haplotype had spread vegetatively to cover about 82% of the experimental plots, more than four times the coverage (18%) of the gulf coast haplotype. Thus, the use of P. australis plantings for wetland restoration should consider the genetic lineage of plants used since our results indicate the potential of the Eurasian haplotype to grow rapidly at newly restored sites. This rapid growth may limit the establishment of more slowly growing native species. ?? 2007 Springer Science+Business Media B.V.

  19. Wingless-type MMTV integration site family member 2 (WNT2) gene is associated with resistance to MAP in faecal culture and antibody response in Holstein cattle.

    PubMed

    Pauciullo, A; Küpper, J; Brandt, H; Donat, K; Iannuzzi, L; Erhardt, G

    2015-04-01

    Mycobacterium avium subspecies paratuberculosis (MAP) is a pathogenic bacterium responsible for the lethal Johne's disease in cattle. So far, several genome-wide association studies (GWAS) have been carried out to identify chromosomal regions highly associated with Johne's disease. The aim of this study was to investigate the genetic variability within a pool of seven genes (LAMB1, DLD, WNT2, PRDM1, SOCS5, PTGER4 and IL10) indicated by former GWAS/RNA-Seq studies as putatively associated with MAP infections and to achieve a confirmation study of association with paratuberculosis susceptibility in a population of 324 German Holstein cattle (162 cases MAP positive and 162 controls MAP negative) using ELISA and fecal cultural tests. SNP validation and genotyping information are provided, quick methods for allelic discrimination were set up and transcription factor binding analyses were performed. The rs43390642:G>TSNP in the WNT2 promoter region is associated with paratuberculosis susceptibility (P = 0.013), suggesting a protective role of the T allele (P = 0.043; odds ratio 0.50 [0.25-0.97]). The linkage disequilibrium with the DLD rs134692583:A>T might suggest a combined mechanism of action of these neighboring genes in resistance to MAP infection, which is also supported by a significant effect shown by the haplotype DLD(T) /WNT2(T) (P = 0.047). In silico analysis predicted rs43390642:G>T and rs134692583:A>T as essential parts of binding sites for the transcription factors GR, C/EBPβ and GATA-1, hence suggesting a potential influence on WNT2 and DLD gene expression. This study confirmed the region on BTA 4 (UMD 3.1: 50639460-51397892) as involved in tolerance/resistance to Johne's disease. In addition, this study clarifies the involvement of the investigated genes in MAP infection and contributes to the understanding of genetic variability involved in Johne's disease susceptibility. © 2015 Stichting International Foundation for Animal Genetics.

  20. Frequency distribution of interleukin-10 haplotypes (-1082 A>G, -819 C>T, and -592 C>A) in a Mexican population.

    PubMed

    Vázquez-Villamar, M; Palafox-Sánchez, C A; Hernández-Bello, J; Muñoz-Valle, J F; Valle, Y; Cruz, A; Alatorre-Meza, A I; Oregon-Romero, E

    2016-11-03

    Interleukin 10 (IL-10) is an immunoregulatory cytokine with multiple roles in the immune system. Three single nucleotide polymorphisms at positions -1082 (A>G), -819 (C>T), and -592 (C>A) in the promoter region of the IL10 gene are believed to be associated with different inflammatory, infectious, and autoimmune diseases. These polymorphisms exhibit a strong linkage disequilibrium (LD) and form three principal haplotypes (GCC, ACC, and ATA). The GCC and ATA haplotypes have been associated with high and low levels of IL-10 production, respectively. The aim of this study was to establish the allele and haplotype frequencies of the IL10 polymorphisms in Mestizos from western Mexico. SNPs were analyzed in 340 healthy unrelated Mestizos from western Mexico by polymerase chain reaction-restriction fragment length polymorphism. The studied population presented significant differences, in the distribution of IL10 polymorphisms, from the Asian, African, and European populations. We also observed a strong LD within -1082 A>G, -819 C>T, and -592 C>A (100% pc = 7.735 x 10 -18 ). The haplotypes ACC (45.4%), ATA (22.0%), GTA (14.9%), and GCC (13.9%) were most frequently observed in this population. The haplotype frequencies, however, differed from those reported previously in Mestizos from central Mexico, Asians, Africans, and European Caucasians, suggesting a differential gene flow in the Mexican Mestizo population. This could account for the genetic variability between Mexicans and populations of other ethnicities. The study of these polymorphisms and their haplotypes could help in expanding our knowledge to design future disease-risk studies on the western Mexican population.

  1. Genome-Wide Association Studies Identify Heavy Metal ATPase3 as the Primary Determinant of Natural Variation in Leaf Cadmium in Arabidopsis thaliana

    PubMed Central

    Chao, Dai-Yin; Silva, Adriano; Baxter, Ivan; Huang, Yu S.; Nordborg, Magnus; Danku, John; Lahner, Brett; Yakubova, Elena; Salt, David E.

    2012-01-01

    Understanding the mechanism of cadmium (Cd) accumulation in plants is important to help reduce its potential toxicity to both plants and humans through dietary and environmental exposure. Here, we report on a study to uncover the genetic basis underlying natural variation in Cd accumulation in a world-wide collection of 349 wild collected Arabidopsis thaliana accessions. We identified a 4-fold variation (0.5–2 µg Cd g−1 dry weight) in leaf Cd accumulation when these accessions were grown in a controlled common garden. By combining genome-wide association mapping, linkage mapping in an experimental F2 population, and transgenic complementation, we reveal that HMA3 is the sole major locus responsible for the variation in leaf Cd accumulation we observe in this diverse population of A. thaliana accessions. Analysis of the predicted amino acid sequence of HMA3 from 149 A. thaliana accessions reveals the existence of 10 major natural protein haplotypes. Association of these haplotypes with leaf Cd accumulation and genetics complementation experiments indicate that 5 of these haplotypes are active and 5 are inactive, and that elevated leaf Cd accumulation is associated with the reduced function of HMA3 caused by a nonsense mutation and polymorphisms that change two specific amino acids. PMID:22969436

  2. Risk of Pediatric Celiac Disease According to HLA Haplotype and Country

    PubMed Central

    Liu, Edwin; Lee, Hye-Seung; Aronsson, Carin A.; Hagopian, William A.; Koletzko, Sibylle; Rewers, Marian J.; Eisenbarth, George S.; Bingley, Polly J.; Bonifacio, Ezio; Simell, Ville; Agardh, Daniel

    2014-01-01

    BACKGROUND The presence of HLA haplotype DR3–DQ2 or DR4–DQ8 is associated with an increased risk of celiac disease. In addition, nearly all children with celiac disease have serum antibodies against tissue transglutaminase (tTG). METHODS We studied 6403 children with HLA haplotype DR3–DQ2 or DR4–DQ8 prospectively from birth in the United States, Finland, Germany, and Sweden. The primary end point was the development of celiac disease autoimmunity, which was defined as the presence of tTG antibodies on two consecutive tests at least 3 months apart. The secondary end point was the development of celiac disease, which was defined for the purpose of this study as either a diagnosis on biopsy or persistently high levels of tTG antibodies. RESULTS The median follow-up was 60 months (interquartile range, 46 to 77). Celiac disease autoimmunity developed in 786 children (12%). Of the 350 children who underwent biopsy, 291 had confirmed celiac disease; an additional 21 children who did not undergo biopsy had persistently high levels of tTG antibodies. The risks of celiac disease autoimmunity and celiac disease by the age of 5 years were 11% and 3%, respectively, among children with a single DR3–DQ2 haplotype, and 26% and 11%, respectively, among those with two copies (DR3–DQ2 homozygosity). In the adjusted model, the hazard ratios for celiac disease autoimmunity were 2.09 (95% confidence interval [CI], 1.70 to 2.56) among heterozygotes and 5.70 (95% CI, 4.66 to 6.97) among homozygotes, as compared with children who had the lowest-risk genotypes (DR4–DQ8 heterozygotes or homozygotes). Residence in Sweden was also independently associated with an increased risk of celiac disease autoimmunity (hazard ratio, 1.90; 95% CI, 1.61 to 2.25). CONCLUSIONS Children with the HLA haplotype DR3–DQ2, especially homozygotes, were found to be at high risk for celiac disease autoimmunity and celiac disease early in childhood. The higher risk in Sweden than in other countries

  3. HLA-E regulatory and coding region variability and haplotypes in a Brazilian population sample.

    PubMed

    Ramalho, Jaqueline; Veiga-Castelli, Luciana C; Donadi, Eduardo A; Mendes-Junior, Celso T; Castelli, Erick C

    2017-11-01

    The HLA-E gene is characterized by low but wide expression on different tissues. HLA-E is considered a conserved gene, being one of the least polymorphic class I HLA genes. The HLA-E molecule interacts with Natural Killer cell receptors and T lymphocytes receptors, and might activate or inhibit immune responses depending on the peptide associated with HLA-E and with which receptors HLA-E interacts to. Variable sites within the HLA-E regulatory and coding segments may influence the gene function by modifying its expression pattern or encoded molecule, thus, influencing its interaction with receptors and the peptide. Here we propose an approach to evaluate the gene structure, haplotype pattern and the complete HLA-E variability, including regulatory (promoter and 3'UTR) and coding segments (with introns), by using massively parallel sequencing. We investigated the variability of 420 samples from a very admixed population such as Brazilians by using this approach. Considering a segment of about 7kb, 63 variable sites were detected, arranged into 75 extended haplotypes. We detected 37 different promoter sequences (but few frequent ones), 27 different coding sequences (15 representing new HLA-E alleles) and 12 haplotypes at the 3'UTR segment, two of them presenting a summed frequency of 90%. Despite the number of coding alleles, they encode mainly two different full-length molecules, known as E*01:01 and E*01:03, which corresponds to about 90% of all. In addition, differently from what has been previously observed for other non classical HLA genes, the relationship among the HLA-E promoter, coding and 3'UTR haplotypes is not straightforward because the same promoter and 3'UTR haplotypes were many times associated with different HLA-E coding haplotypes. This data reinforces the presence of only two main full-length HLA-E molecules encoded by the many HLA-E alleles detected in our population sample. In addition, this data does indicate that the distal HLA-E promoter is by

  4. Haplotypes composed of minor frequency single nucleotide polymorphisms of the TNF gene protect from progression into sepsis: A study using the new sepsis classification.

    PubMed

    Retsas, Theodoros; Huse, Klaus; Lazaridis, Lazaros-Dimitrios; Karampela, Niki; Bauer, Michael; Platzer, Matthias; Kolonia, Virginia; Papageorgiou, Eirini; Giamarellos-Bourboulis, Evangelos J; Dimopoulos, George

    2018-02-01

    Several articles have provided conflicting results regarding the role of single nucleotide polymorphisms (SNPs) in the promoter region of the TNF gene in susceptibility to sepsis. Former articles have been based on previous definitions of sepsis. This study investigated the influence of TNF haplotypes on the development of sepsis using the new Sepsis-3 definitions. DNA was isolated from patients suffering from infection and systemic inflammatory response syndrome. Haplotyping was performed for six SNPs of TNF. The serum levels of tumour necrosis factor alpha (TNF-α) of these patients were measured using an enzyme immunosorbent assay. Patients were classified into infection and sepsis categories using the Sepsis-3 definitions. Associations between the TNF haplotypes and the clinical characteristics and serum TNF-α levels of the patients were examined. The most common TNF haplotype h1 was composed of major alleles of the studied SNPs. Carriage of haplotypes composed of minor frequency alleles was associated with a lower risk of developing sepsis (odds ratio 0.41, 95% confidence interval 0.19-0.88, p=0.022), but this did not affect the 28-day outcome. Serum TNF-α levels were significantly higher among patients homozygous for h1 haplotypes who developed sepsis compared to infection (p=0.032); a similar result was not observed for patients carrying other haplotypes. Haplotypes containing minor frequency SNP alleles of TNF protect against the development of sepsis without affecting the outcome. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  5. A risk PRODH haplotype affects sensorimotor gating, memory, schizotypy, and anxiety in healthy male subjects.

    PubMed

    Roussos, Panos; Giakoumaki, Stella G; Bitsios, Panos

    2009-06-15

    Significant associations have been shown for haplotypes comprising three PRODH single nucleotide polymorphisms (SNPs; 1945T/C, 1766A/G, 1852G/A) located in the 3' region of the gene, suggesting a role of these variants in the etiopathogenesis of schizophrenia. We assessed the relationship between these high-risk PRODH polymorphisms and schizophrenia-related endophenotypes in a large and highly homogeneous cohort of healthy males. Participants (n = 217) were tested in prepulse inhibition (PPI), verbal and working memory, trait anxiety and schizotypy. The QTPHASE from the UNPHASED package was used for the association analysis of each SNP or haplotype data. This procedure revealed significant phenotypic impact of the risk CGA haplotype. Subjects were then divided in two groups; levels of PPI, anxiety, and schizotypy, verbal and working memory were compared with analysis of variance. CGA carriers (n = 32) exhibited attenuated PPI (p < .001) and verbal memory (p < .001) and higher anxiety (p < .004) and schizotypy (p < .008) compared with the noncarriers (n = 185). There were no differences in baseline startle, demographics, and working memory. The main significant correlations were schizotypy x PPI [85-dB, 120-msec trials] in the carriers and schizotypy x anxiety in the entire group and the noncarriers but not the carriers group. Our results strongly support PPI as a valid schizophrenia endophenotype and highlight the importance of examining the role of risk haplotypes on multiple endophenotypes and have implications for understanding the continuum from normality to psychosis, transitional states, and the genetics of schizophrenia-related traits.

  6. β2-Adrenergic receptor promoter haplotype influences the severity of acute viral respiratory tract infection during infancy: a prospective cohort study.

    PubMed

    Wu, Pingsheng; Larkin, Emma K; Reiss, Sara S; Carroll, Kecia N; Summar, Marshall L; Minton, Patricia A; Woodward, Kimberly B; Liu, Zhouwen; Islam, Jessica Y; Hartert, Tina V; Moore, Paul E

    2015-09-14

    Despite the significant interest in β2-Adrenergic receptor (ADRB2) polymorphisms related to asthma, whether ADRB2 genetic variants are similarly associated with acute respiratory tract infections have not been studied. We hypothesized that genetic variants in ADRB2 associated with a response to asthma therapy during an asthma exacerbation were also associated with severity of acute respiratory tract infections. To test this hypothesis, we genotyped 5 common polymorphisms in the promoter region and coding block of the ADRB2 gene (loci -2387, -2274, -1343, +46, and +79) from 374 Caucasian and African American term infants who were enrolled at the time of acute respiratory illness over four respiratory viral seasons. Severity of respiratory tract infections was measured using a bronchiolitis severity score (BSS; range = 0-12, clinically significant difference = 0.5) with a higher score indicating more severe disease. We assigned the promoter, coding and combined promoter and coding haplotypes to the unphased genotype data. The associations between each of these five single-nucleotide polymorphisms (SNPs) as well as the haplotypes and infant BSS were analyzed using nonparametric univariate analysis and multivariable proportional odds model separately in Caucasians and African Americans. There was no significant association between infant BSS and each of the SNPs in both Caucasians and African Americans. However, promoter haplotype CCA was associated with a decreased BSS in African Americans in a dose dependent manner. The median (interquartile range) BSS of infants with no copies of the CCA haplotype, one copy, and two copies of the CCA haplotype were 5.5 (2.0, 8.0), 4.0 (1.0, 7.5), and 3.0 (1.0, 4.0), respectively. This dose dependent relationship persisted after adjusting for infant age, gender, daycare exposure, secondhand smoke exposure, prior history of breastfeeding, siblings at home, and enrollment season (adjusted odds ratio: 0.59, 95% confidence

  7. Polymorphism and haplotype analyses of swine leukocyte antigen DQA exons 2, 3, 4, and their associations with piglet diarrhea in Chinese native pig.

    PubMed

    Huang, X Y; Yang, Q L; Yuan, J H; Gun, S B

    2015-09-08

    In this study, 290 Chinese native Yantai black pig piglets were investigated to identify gene polymorphisms, for haplotype reconstruction, and to determine the association between piglet diarrhea and swine leukocyte antigen (SLA) class II DQA exons 2, 3, and 4 by polymerase chain reaction-single stranded conformational polymorphism and cloning sequencing. The results showed that the 5, 8, and 7 genotypes were identified from SLA-DQA exon 2, 3, and 4, respectively, based on the single-stranded conformational polymorphism banding patterns and found a novel allele D in exon 2 and 2 novel mutational sites of allele C (c.4828T>C) and allele F (c.4617T>C) in exon 3. Polymorphism information content testing showed that exon 2 was moderately polymorphic and that exons-3 and -4 loci were highly polymorphic. The piglet diarrhea scores for genotypes AB (1.40 ± 0.14) and AC (1.54 ± 0.17) in exon 2, AA (1.22 ± 0.32), BC (1.72 ± 0.13), DD (1.67 ± 0.35), and CF (1.22 ± 0.45) in exon 3, and AD (2.35 ± 0.25) in exon 4 were significantly higher than those for the other genotypes (P ≤ 0.05) in DQA exons. There were 14 reconstructed haplotypes in the 3 exons from 290 individuals and Hap12 may be the diarrhea-resistant gene. Haplotype distribution was extremely uneven, and the SLA-DQA gene showed genetic linkage. In this study, we identified molecular genetic markers and provided a theoretical foundation for future pig anti-disease resistance breeding.

  8. Prevalence of genetic thrombophilic polymorphisms in the Sri Lankan population--implications for association study design and clinical genetic testing services.

    PubMed

    Dissanayake, Vajira H W; Weerasekera, Lakshini Y; Gammulla, C Gayani; Jayasekara, Rohan W

    2009-10-01

    We investigated the prevalence of genotypes/alleles of single nucleotide polymorphisms (SNP) and haplotypes defined by them in three genes in which variations are associated with venous thromboembolism in 80 Sinhalese, 80 Sri Lankan Tamils and 80 Moors in the Sri Lankan population and compared the SNP data with that of other populations in Southern India and haplotype data with that of HapMap populations. The genes and polymorphisms investigated were Methylenetetrahydrofolate reductase (MTHFR) - 677C>T (rs1801133), 1298A>C (rs1801131), 1317T>C, 1793G>A (rs2274976); Factor V (F5) - 1691G>A (rs6025) and 4070A>G (rs1800595); and prothrombin (F2) - 20210G>A (rs1799963). The polymorphisms were genotyped using PCR/RFLP methods. The prevalence of the variant alleles of each polymorphism in the Sinhalese, Tamils, and Moors was MTHFR 677T: Sinhalese - 13%, Tamils - 9%, Moors - 9%. 1317T>C: Sinhalese - 0%; Tamils - 0%; Moors - 0%. 1793A: Sinhalese - 19%, Tamils - 19%, Moors - 19%. F5 1691A: Sinhalese - 2%, Tamils - 3%, Moors - 2%. 4070G: Sinhalese - 6%, Tamils - 5%, Moors - 8%. F2 20210A: Sinhalese - 0%, Tamils - 0%, Moors - 0%. The frequencies observed were similar to data from other South Indian populations; the haplotype data showed haplotypes unique to the Sri Lankan population when compared to HapMap populations. rs9651118 was identified as a SNP that splits the haplotypes harbouring the functionally significant 677T allele in the MTHFR gene. This data would be useful in planning genetic association studies in the Sri Lankan population and in deciding on which genetic variants should be tested in a clinical genetic testing service.

  9. Genome-Wide Association Mapping and Genomic Prediction Elucidate the Genetic Architecture of Morphological Traits in Arabidopsis.

    PubMed

    Kooke, Rik; Kruijer, Willem; Bours, Ralph; Becker, Frank; Kuhn, André; van de Geest, Henri; Buntjer, Jaap; Doeswijk, Timo; Guerra, José; Bouwmeester, Harro; Vreugdenhil, Dick; Keurentjes, Joost J B

    2016-04-01

    Quantitative traits in plants are controlled by a large number of genes and their interaction with the environment. To disentangle the genetic architecture of such traits, natural variation within species can be explored by studying genotype-phenotype relationships. Genome-wide association studies that link phenotypes to thousands of single nucleotide polymorphism markers are nowadays common practice for such analyses. In many cases, however, the identified individual loci cannot fully explain the heritability estimates, suggesting missing heritability. We analyzed 349 Arabidopsis accessions and found extensive variation and high heritabilities for different morphological traits. The number of significant genome-wide associations was, however, very low. The application of genomic prediction models that take into account the effects of all individual loci may greatly enhance the elucidation of the genetic architecture of quantitative traits in plants. Here, genomic prediction models revealed different genetic architectures for the morphological traits. Integrating genomic prediction and association mapping enabled the assignment of many plausible candidate genes explaining the observed variation. These genes were analyzed for functional and sequence diversity, and good indications that natural allelic variation in many of these genes contributes to phenotypic variation were obtained. For ACS11, an ethylene biosynthesis gene, haplotype differences explaining variation in the ratio of petiole and leaf length could be identified. © 2016 American Society of Plant Biologists. All Rights Reserved.

  10. Pregnancy after azathioprine therapy for ulcerative colitis in a woman with autoimmune premature ovarian failure and Addison's disease: HLA haplotype characterization.

    PubMed

    Ferraù, Francesco; Gangemi, Sebastiano; Vita, Giuseppe; Trimarchi, Francesco; Cannavò, Salvatore

    2011-06-01

    To present a case of fertility restored by azathioprine treatment in a woman with autoimmune premature ovarian failure, Addison's disease, and ulcerative colitis, and to study the genetic background of the three autoimmune diseases. Case report. Endocrinology and Immunology Units of an university hospital. A 30-year-old woman with autoimmune premature ovarian failure, Addison's disease, and ulcerative colitis. Azathioprine has been administered as immunosuppressive treatment. We performed analysis of human leukocyte antigens expression on lymphocytes and genomic haplotype of the patient. The human leukocyte antigen haplotype of the patient was consistent with the haplotypes predisposing for the three autoimmune diseases, as reported in the literature. The administration of azathioprine restored regular menses and allowed uneventful pregnancy. This is the first clinical evidence of association of immunosuppressive azathioprine treatment and restored ovarian function and fertility in a woman with autoimmune premature ovarian failure. In this patient, the haplotype was associated with susceptibility to autoimmune premature ovarian failure, Addison's disease, and ulcerative colitis. Copyright © 2011 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  11. Methylenetetrahydrofolate reductase gene haplotypes affect toxicity during maintenance therapy for childhood acute lymphoblastic leukemia in Japanese patients.

    PubMed

    Tanaka, Yoichi; Manabe, Atsushi; Nakadate, Hisaya; Kondoh, Kensuke; Nakamura, Kozue; Koh, Katsuyoshi; Kikuchi, Akira; Komiyama, Takako

    2014-05-01

    Abstract The aim of this study was to investigate the influence of daily 6-mercaptopurine (6-MP) and low-dose weekly methotrexate (MTX) combination treatment and methylenetetrahydrofolate reductase (MTHFR) haplotypes on toxicity during maintenance therapy in Japanese childhood acute lymphoblastic leukemia (ALL). We retrospectively analyzed the MTHFR C677T and A1298C polymorphisms and influence of haplotypes on toxicity in 73 patients. Patients with the MTHFR 677TT and 677CT + 1298AC were associated with severe liver toxicity (p = 0.014, odds ratio [OR] = 3.82, 95% confidence interval [CI] = 1.27-11.46) and more rapid onset of liver toxicity (p = 0.010). Patients with MTHFR 677TT and 677CT + 1298AC were associated with lower frequency of 6-MP and MTX dose reduction due to leukopenia (p < 0.05). No difference was observed in average drug doses in the MTHFR genotypes. In conclusion, the MTHFR C677T and A1298C haplotypes might be useful for monitoring adverse effects in childhood ALL maintenance therapy in Japanese patients.

  12. β-globin gene cluster haplotypes in ethnic minority populations of southwest China

    PubMed Central

    Sun, Hao; Liu, Hongxian; Huang, Kai; Lin, Keqin; Huang, Xiaoqin; Chu, Jiayou; Ma, Shaohui; Yang, Zhaoqing

    2017-01-01

    The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5′ sites and 3′ sites of the β-globin gene cluster. 5′ haplotypes 2 (+−−−), 6 (−++−+), 9 (−++++) and 3′ haplotype FW3 (−+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China. PMID:28205625

  13. Association between the oxytocin receptor (OXTR) gene and autism: relationship to Vineland Adaptive Behavior Scales and cognition.

    PubMed

    Lerer, E; Levi, S; Salomon, S; Darvasi, A; Yirmiya, N; Ebstein, R P

    2008-10-01

    Evidence both from animal and human studies suggests that common polymorphisms in the oxytocin receptor (OXTR) gene are likely candidates to confer risk for autism spectrum disorders (ASD). In lower mammals, oxytocin is important in a wide range of social behaviors, and recent human studies have shown that administration of oxytocin modulates behavior in both clinical and non-clinical groups. Additionally, two linkage studies and two recent association investigations also underscore a possible role for the OXTR gene in predisposing to ASD. We undertook a comprehensive study of all 18 tagged SNPs across the entire OXTR gene region identified using HapMap data and the Haploview algorithm. Altogether 152 subjects diagnosed with ASDs (that is, DSM IV autistic disorder or pervasive developmental disorder--NOS) from 133 families were genotyped (parents and affected siblings). Both individual SNPs and haplotypes were tested for association using family-based association tests as provided in the UNPHASED set of programs. Significant association with single SNPs and haplotypes (global P-values <0.05, following permutation test adjustment) were observed with ASD. Association was also observed with IQ and the Vineland Adaptive Behavior Scales (VABS). In particular, a five-locus haplotype block (rs237897-rs13316193-rs237889-rs2254298-rs2268494) was significantly associated with ASD (nominal global P=0.000019; adjusted global P=0.009) and a single haplotype (carried by 7% of the population) within that block showed highly significant association (P=0.00005). This is the third association study, in a third ethnic group, showing that SNPs and haplotypes in the OXTR gene confer risk for ASD. The current investigation also shows association with IQ and total VABS scores (as well as the communication, daily living skills and socialization subdomains), suggesting that this gene shapes both cognition and daily living skills that may cross diagnostic boundaries.

  14. Mapping-by-sequencing in complex polyploid genomes using genic sequence capture: a case study to map yellow rust resistance in hexaploid wheat.

    PubMed

    Gardiner, Laura-Jayne; Bansept-Basler, Pauline; Olohan, Lisa; Joynson, Ryan; Brenchley, Rachel; Hall, Neil; O'Sullivan, Donal M; Hall, Anthony

    2016-08-01

    Previously we extended the utility of mapping-by-sequencing by combining it with sequence capture and mapping sequence data to pseudo-chromosomes that were organized using wheat-Brachypodium synteny. This, with a bespoke haplotyping algorithm, enabled us to map the flowering time locus in the diploid wheat Triticum monococcum L. identifying a set of deleted genes (Gardiner et al., 2014). Here, we develop this combination of gene enrichment and sliding window mapping-by-synteny analysis to map the Yr6 locus for yellow stripe rust resistance in hexaploid wheat. A 110 MB NimbleGen capture probe set was used to enrich and sequence a doubled haploid mapping population of hexaploid wheat derived from an Avalon and Cadenza cross. The Yr6 locus was identified by mapping to the POPSEQ chromosomal pseudomolecules using a bespoke pipeline and algorithm (Chapman et al., 2015). Furthermore the same locus was identified using newly developed pseudo-chromosome sequences as a mapping reference that are based on the genic sequence used for sequence enrichment. The pseudo-chromosomes allow us to demonstrate the application of mapping-by-sequencing to even poorly defined polyploidy genomes where chromosomes are incomplete and sub-genome assemblies are collapsed. This analysis uniquely enabled us to: compare wheat genome annotations; identify the Yr6 locus - defining a smaller genic region than was previously possible; associate the interval with one wheat sub-genome and increase the density of SNP markers associated. Finally, we built the pipeline in iPlant, making it a user-friendly community resource for phenotype mapping. © 2016 The Authors. The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.

  15. Inferring mechanisms of copy number change from haplotype structures at the human DEFA1A3 locus.

    PubMed

    Black, Holly A; Khan, Fayeza F; Tyson, Jess; Al Armour, John

    2014-07-21

    The determination of structural haplotypes at copy number variable regions can indicate the mechanisms responsible for changes in copy number, as well as explain the relationship between gene copy number and expression. However, obtaining spatial information at regions displaying extensive copy number variation, such as the DEFA1A3 locus, is complex, because of the difficulty in the phasing and assembly of these regions. The DEFA1A3 locus is intriguing in that it falls within a region of high linkage disequilibrium, despite its high variability in copy number (n = 3-16); hence, the mechanisms responsible for changes in copy number at this locus are unclear. In this study, a region flanking the DEFA1A3 locus was sequenced across 120 independent haplotypes with European ancestry, identifying five common classes of DEFA1A3 haplotype. Assigning DEFA1A3 class to haplotypes within the 1000 Genomes project highlights a significant difference in DEFA1A3 class frequencies between populations with different ancestry. The features of each DEFA1A3 class, for example, the associated DEFA1A3 copy numbers, were initially assessed in a European cohort (n = 599) and replicated in the 1000 Genomes samples, showing within-class similarity, but between-class and between-population differences in the features of the DEFA1A3 locus. Emulsion haplotype fusion-PCR was used to generate 61 structural haplotypes at the DEFA1A3 locus, showing a high within-class similarity in structure. Structural haplotypes across the DEFA1A3 locus indicate that intra-allelic rearrangement is the predominant mechanism responsible for changes in DEFA1A3 copy number, explaining the conservation of linkage disequilibrium across the locus. The identification of common structural haplotypes at the DEFA1A3 locus could aid studies into how DEFA1A3 copy number influences expression, which is currently unclear.

  16. Discovery, evaluation and distribution of haplotypes of the wheat Ppd-D1 gene.

    PubMed

    Guo, Zhiai; Song, Yanxia; Zhou, Ronghua; Ren, Zhenglong; Jia, Jizeng

    2010-02-01

    Ppd-D1 is one of the most potent genes affecting the photoperiod response of wheat (Triticum aestivum). Only two alleles, insensitive Ppd-D1a and sensitive Ppd-D1b, were known previously, and these did not adequately explain the broad adaptation of wheat to photoperiod variation. In this study, five diagnostic molecular markers were employed to identify Ppd-D1 haplotypes in 492 wheat varieties from diverse geographic locations and 55 accessions of Aegilops tauschii, the D genome donor species of wheat. Six Ppd-D1 haplotypes, designated I-VI, were identified. Types II, V and VI were considered to be more ancient and types I, III and IV were considered to be derived from type II. The transcript abundances of the Ppd-D1 haplotypes showed continuous variation, being highest for haplotype I, lowest for haplotype III, and correlating negatively with varietal differences in heading time. These haplotypes also significantly affected other agronomic traits. The distribution frequency of Ppd-D1 haplotypes showed partial correlations with both latitudes and altitudes of wheat cultivation regions. The evolution, expression and distribution of Ppd-D1 haplotypes were consistent evidentially with each other. What was regarded as a pair of alleles in the past can now be considered a series of alleles leading to continuous variation.

  17. Inheritance of the 8.1 ancestral haplotype in recurrent pregnancy loss

    PubMed Central

    Kolte, Astrid M.; Nielsen, Henriette S.; Steffensen, Rudi; Crespi, Bernard; Christiansen, Ole B.

    2015-01-01

    Background and objectives: The 8.1 ancestral haplotype (AH) (HLA-A1, C7, B8, C4AQ0, C4B1, DR3, DQ2) is a remarkably long and conserved haplotype in the human major histocompatibility complex. It has been associated with both beneficial and detrimental effects, consistent with antagonistic pleiotropy. It has also been proposed that the survival of long, conserved haplotypes may be due to gestational drive, i.e. selective miscarriage of fetuses who have not inherited the haplotype from a heterozygous mother. Recurrent pregnancy loss (RPL) is defined as three or more consecutive pregnancy losses. The objective was to test the gestational drive theory for the 8.1AH in women with RPL and their live born children. Methodology: We investigated the inheritance of the 8.1AH from 82 heterozygous RPL women to 110 live born children. All participants were genotyped for HLA-A, -B and -DRB1 in DNA from EDTA-treated blood or buccal swaps. Inheritance was compared with a Mendelian inheritance of 50% using a two-sided exact binomial test. Results: We found that 55% of the live born children had inherited the 8.1AH, which was not significantly higher than the expected 50% (P = 0.29). Interestingly, we found a non-significant trend toward a higher inheritance of the 8.1AH in girls, 63%, P = 0.11 as opposed to boys, 50%, P = 1.00. Conclusions and implications: We did not find that the 8.1AH was significantly more often inherited by live born children of 8.1AH heterozygous RPL women. However our data suggest that there may be a sex-specific effect which would be interesting to explore further, both in RPL and in a background population. PMID:26675299

  18. Best's vitelliform dystrophy (VMD2) maps between D11S903 and PYGM: No evidence for locus heterogeneity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weber, B.H.F.; Walker, D.; Mar, L.

    1994-03-15

    Vitelliform macular dystrophy, also known as Best's disease (BD), is an autosomal dominant disorder typically characterized by an accumulation of yellowish material in the macular area. The disease is slowly progressive and eventually results in atrophy of the retinal pigment epithelium and photoreceptor cells, thus severely impairing central vision. The biochemical defect underlying this condition is unknown. More recently, the BD locus (VMD2) was mapped to chromosome 11 by genetic analysis in three multigeneration Best's disease families using eight microsatellite markers spanning approximately 26 cM around the putative BD locus. The authors demonstrate linkage between Best's disease and the markersmore » used. Furthermore, haplotype analysis in unrelated Best's disease families identified three distinct haplotypes associated with the disease, strongly suggesting independent origins of the BD mutation. Finally, they characterized two recombinant BD chromosomes that significantly refine the location of the disease gene to a 3.7-cM interval between markers at D11S903 and PYGM. PCR-hybrid mapping sublocalized this interval to the pericentromeric region of chromosome 11. 47 refs., 4 figs., 1 tab.« less

  19. Haplotype analysis of the HFE gene among populations of Northern Eurasia, in patients with metabolic disorders or stomach cancer, and in long-lived people.

    PubMed

    Mikhailova, S V; Babenko, V N; Ivanoshchuk, D E; Gubina, M A; Maksimov, V N; Solovjova, I G; Voevoda, M I

    2016-06-17

    Previously, it was shown that the HFE gene (associated with human hereditary hemochromatosis) has several haplotypes of intronic polymorphisms. Some haplotype frequencies are race specific and hence can be used in phylogenetic analysis. We assumed that analysis of Caucasoid patients-living now in Western Siberia and having diseases associated with dietary habits and metabolic rate-will allow us to understand the processes of possible selection during settling of the northern part of Asia. Haplotype analysis of Northern Eurasian native and recently settled ethnic groups was performed on polymorphisms rs1799945, rs1800730, rs1800562, rs2071303, rs1800708, rs1572982, rs2794719, rs807209, and rs2032451 of this gene. The CCA haplotype of the rs2071303, rs1800708, and rs1572982 was found to be associated with HLA-A2 (39 %) in Asian populations. Haplotype analysis for the rs1799945, rs1800730, rs1800562, rs2071303, rs1800708, and rs1572982 was performed on Russian patients with some metabolic disorders or stomach cancer and among long-lived people. Decreased frequencies of the TTA haplotype (T in rs2071303, T in rs1800708, and A in rs1572982) were observed in the groups of patients with diseases associated with overweight (fatty liver disease, type 2 diabetes mellitus, or metabolic syndrome + arterial hypertension) as compared with the control sample. We detected significant differences in this haplotype's frequency between the patients with type 2 diabetes mellitus and Russian adolescents, elderly citizens, and long-lived people (χ(2) P value = 0.003, 0.010, and 0.015, respectively). No significant differences in frequencies of the alleles with mutations in coding regions of the HFE gene (C282Y, H63D, and S65C) were detected between the analyzed patients (with stomach cancer, metabolic syndrome, fatty liver disease, or type 2 diabetes mellitus) and the control Caucasoid sample. Monophyletic origin of H63D (rs1799945) was confirmed in Caucasoids and Northern

  20. Haplotype estimation using sequencing reads.

    PubMed

    Delaneau, Olivier; Howie, Bryan; Cox, Anthony J; Zagury, Jean-François; Marchini, Jonathan

    2013-10-03

    High-throughput sequencing technologies produce short sequence reads that can contain phase information if they span two or more heterozygote genotypes. This information is not routinely used by current methods that infer haplotypes from genotype data. We have extended the SHAPEIT2 method to use phase-informative sequencing reads to improve phasing accuracy. Our model incorporates the read information in a probabilistic model through base quality scores within each read. The method is primarily designed for high-coverage sequence data or data sets that already have genotypes called. One important application is phasing of single samples sequenced at high coverage for use in medical sequencing and studies of rare diseases. Our method can also use existing panels of reference haplotypes. We tested the method by using a mother-father-child trio sequenced at high-coverage by Illumina together with the low-coverage sequence data from the 1000 Genomes Project (1000GP). We found that use of phase-informative reads increases the mean distance between switch errors by 22% from 274.4 kb to 328.6 kb. We also used male chromosome X haplotypes from the 1000GP samples to simulate sequencing reads with varying insert size, read length, and base error rate. When using short 100 bp paired-end reads, we found that using mixtures of insert sizes produced the best results. When using longer reads with high error rates (5-20 kb read with 4%-15% error per base), phasing performance was substantially improved. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  1. MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

    PubMed

    Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

    2016-10-01

    The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

  2. Y-STR haplotypes of Native American populations from the Brazilian Amazon region.

    PubMed

    Palha, Teresinha Jesus Brabo Ferreira; Rodrigues, Elzemar Martins Ribeiro; dos Santos, Sidney Emanuel Batista

    2010-10-01

    The allele and haplotype frequencies of nine Y-STRs (DYS19, DYS389 I, DYS389 II, DYS390, DYS391, DYS392, DYS393, DYS385 I/II) were determined in a sample of six native tribes from the Brazilian Amazon (Tiriyó, Awa-Guajá, Waiãpi, Urubu-Kaapor, Zoé and Parakanã). Forty-eight different haplotypes were identified, 28 of which unique. Five haplotypes are very frequent and were shared by over 10 individuals. The estimated haplotype diversity (0.9114) was very low compared to other geographic groups, including Africans, Europeans and Asians. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  3. In Southern Africa, Brown Oculocutaneous Albinism (BOCA) Maps to the OCA2 Locus on Chromosome 15q: P-Gene Mutations Identified

    PubMed Central

    Manga, Prashiela; Kromberg, Jennifer G. R.; Turner, Angela; Jenkins, Trefor; Ramsay, Michele

    2001-01-01

    In southern Africa, brown oculocutaneous albinism (BOCA) is a distinct pigmentation phenotype. In at least two cases, it has occurred in the same families as tyrosinase-positive oculocutaneous albinism (OCA2), suggesting that it may be allelic, despite the fact that this phenotype was attributed to mutations in the TYRP1 gene in an American individual of mixed ancestry. Linkage analysis in five families mapped the BOCA locus to the same region as the OCA2 locus (maximum LOD 3.07; θ=0 using a six-marker haplotype). Mutation analysis of the human homologue of the mouse pink-eyed dilution gene (P), in 10 unrelated individuals with BOCA revealed that 9 had one copy of the 2.7-kb deletion. No other mutations were identified. Additional haplotype studies, based on closely linked markers (telomere to centromere: D15S1048, D15S1019, D15S1533, P-gene 2.7-kb deletion, D15S219, and D15S156) revealed several BOCA-associated P haplotypes. These could be divided into two core haplotypes, suggesting that a limited number of P-gene mutations give rise to this phenotype. PMID:11179026

  4. Cystic fibrosis transmembrane regulator haplotypes in households of patients with cystic fibrosis.

    PubMed

    Furgeri, Daniela Tenório; Marson, Fernando Augusto Lima; Correia, Cyntia Arivabeni Araújo; Ribeiro, José Dirceu; Bertuzzo, Carmen Sílvia

    2018-01-30

    Nearly 2000 mutations in the cystic fibrosis transmembrane regulator (CFTR) gene have been reported. The F508del mutation occurs in approximately 50-65% of patients with cystic fibrosis (CF). However, molecular diagnosis is not always possible. Therefore, silent polymorphisms can be used to label the mutant allele in households of patients with CF. To verify the haplotypes of four polymorphisms at the CFTR locus in households of patients with CF for pre-fertilization, pre-implantation, and prenatal indirect mutation diagnosis to provide better genetic counseling for families and patients with CF and to associate the genotypes/haplotypes with the F508del mutation screening. GATT polymorphism analysis was performed using direct polymerase chain reaction amplification, and the MP6-D9, TUB09 and TUB18 polymorphism analyses were performed using restriction fragment length polymorphism. Nine haplotypes were found in 37 CFTR alleles, and of those, 24 were linked with the F508del mutation and 13 with other CFTR mutations. The 6 (GATT), C (MP6-D9), G (TUB09), and C (TUB18) haplotypes showed the highest prevalence (48%) of the mutant CFTR allele and were linked to the F508del mutation (64%). In 43% of households analyzed, at least one informative polymorphism can be used for the indirect diagnostic test. CFTR polymorphisms are genetic markers that are useful for identifying the mutant CFTR alleles in households of patients with CF when it is not possible to establish the complete CFTR genotype. Moreover, the polymorphisms can be used for indirect CFTR mutation identification in cases of pre-fertilization, pre-implantation and prenatal analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Epistatic interaction between haplotypes of the ghrelin ligand and receptor genes influence susceptibility to myocardial infarction and coronary artery disease.

    PubMed

    Baessler, Andrea; Fischer, Marcus; Mayer, Bjoern; Koehler, Martina; Wiedmann, Silke; Stark, Klaus; Doering, Angela; Erdmann, Jeanette; Riegger, Guenter; Schunkert, Heribert; Kwitek, Anne E; Hengstenberg, Christian

    2007-04-15

    Data from both experimental models and humans provide evidence that ghrelin and its receptor, the growth hormone secretagogue receptor (ghrelin receptor, GHSR), possess a variety of cardiovascular effects. Thus, we hypothesized that genetic variants within the ghrelin system (ligand ghrelin and its receptor GHSR) are associated with susceptibility to myocardial infarction (MI) and coronary artery disease (CAD). Seven single nucleotide polymorphisms (SNPs) covering the GHSR region as well as eight SNPs across the ghrelin gene (GHRL) region were genotyped in index MI patients (864 Caucasians, 'index MI cases') from the German MI family study and in matched controls without evidence of CAD (864 Caucasians, 'controls', MONICA Augsburg). In addition, siblings of these MI patients with documented severe CAD (826 'affected sibs') were matched likewise with controls (n = 826 Caucasian 'controls') and used for verification. The effect of interactions between genetic variants of both genes of the ghrelin system was explored by conditional classification tree models. We found association of several GHSR SNPs with MI [best SNP odds ratio (OR) 1.7 (1.2-2.5); P = 0.002] using a recessive model. Moreover, we identified a common GHSR haplotype which significantly increases the risk for MI [multivariate adjusted OR for homozygous carriers 1.6 (1.1-2.5) and CAD OR 1.6 (1.1-2.5)]. In contrast, no relationship between genetic variants and the disease could be revealed for GHRL. However, the increase in MI/CAD frequency related to the susceptible GHSR haplotype was abolished when it coincided with a common GHRL haplotype. Multivariate adjustments as well as permutation-based methods conveyed the same results. These data are the first to demonstrate an association of SNPs and haplotypes within important genes of the ghrelin system and the susceptibility to MI, whereas association with MI/CAD could be identified for genetic variants across GHSR, no relationship could be revealed for GHRL

  6. A haplotypic variant at the IRGM locus and rs11747270 are related to the susceptibility for chronic periodontitis.

    PubMed

    Folwaczny, Matthias; Tsekeri, Eleni; Glas, Jürgen

    2018-02-01

    Immunity-regulated GTPase M (IRGM) plays a critical role in the defense against intracellular bacteria by regulating autophagy formation. This direct genetic association study aimed to determine whether variants at the IRGM genetic locus are associated with chronic periodontitis. Using PCR and melting curve analysis 390 periodontitis patients and 770 healthy controls have been genotyped regarding six polymorphisms in the IRGM gene (rs13361189, rs10065172, rs4958847, rs1000113, rs11747270, rs931058). Frequency distribution of alleles and genotypes for the six polymorphisms were not significantly different between the periodontitis and the control group. Also following stratification according to gender and smoking no significant linkage was found for any of the IRGM variants with periodontitis. Analysis of a subsample of patients revealed a significant association for rs11747270 with severe periodontitis (p = 0.003). Pairwise linkage analysis revealed one block composed of rs13361189, rs10065172, rs4958847, rs1000113 and 11747270 with strong or even complete linkage disequilibrium (r 2  > 0.9). Four haplotypes showed a frequency of > 1%, among which the haplotype C-T-A-T-G was significantly associated with chronic periodontitis (p = 0.0051; OR 4.66, 95% CI 1.41-15.42). One rare haplotype of the IRGM locus is significantly associated with chronic periodontitis in a German cohort.

  7. The Influence of the Autoimmunity-Associated Ancestral HLA Haplotype AH8.1 on the Human Gut Microbiota: A Cross-Sectional Study

    PubMed Central

    Qin, Bingcai; Anmarkrud, Jarl Andreas; Holm, Kristian; Franke, Andre; Lie, Benedicte A.; Karlsen, Tom H.

    2015-01-01

    Multiple immune-related genes are encoded in the HLA complex on chromosome 6p21. The 8.1 ancestral haplotype (AH8.1) include the classical HLA alleles HLA-B*08:01 and HLA-DRB1*03:01, and has been associated with a large number of autoimmune diseases, but the underlying mechanisms for this association are largely unknown. Given the recently established links between the gut microbiota and inflammatory diseases, we hypothesized that the AH8.1 influences the host gut microbial community composition. To study this further, healthy individuals were selected from the Norwegian Bone Marrow Donor Registry and categorized as either I. AH8.1 homozygote (n=34), II. AH8.1 heterozygote (n=38), III. Non AH8.1 heterozygote or IV. HLA-DRB1 homozygote but non AH8.1 (n=15). Bacterial DNA from stool samples were subjected to sequencing of the V3–V5 region of the 16S rRNA gene on the 454 Life Sciences platform and data analyzed using Mothur and QIIME. The results showed that the abundances of different taxa were highly variable within all pre-defined AH8.1 genotype groups. Using univariate non-parametric statistics, there were no differences regarding alpha or beta diversity between AH8.1 carriers (categories I and II) and non-carriers (categories III and IV), however four different taxa (Prevotellaceae, Clostridium XVIII, Coprococcus, Enterorhabdus) had nominally significant lower abundances in AH8.1 carriers than non-carriers. After including possible confounders in a multivariate linear regression, only the two latter genera remained significantly associated. In conclusion, the overall contribution of the AH8.1 haplotype to the variation in gut microbiota profile of stool in the present study was small. PMID:26207384

  8. Biological Effects of COMT Haplotypes and Psychosis Risk in 22q11.2 Deletion Syndrome

    PubMed Central

    Gothelf, Doron; Law, Amanda J.; Frisch, Amos; Chen, Jingshan; Zarchi, Omer; Michaelovsky, Elena; Ren-Patterson, Renee; Lipska, Barbara K.; Carmel, Miri; Kolachana, Bhaskar; Weizman, Abraham; Weinberger, Daniel R.

    2013-01-01

    Background 22q11.2 deletion syndrome (22q11.2DS) is the most common genetic syndrome associated with schizophrenia. The catechol-o-methyltransferase (COMT) gene is located in the obligatory deletion region, and possible associations between COMT variants and neuropsychiatric manifestations in 22q11.2DS have been reported. The purpose of the current study was to evaluate the effect of COMT hemizygosity and molecular haplotypes on gene expression and enzyme activity and its association with psychotic symptoms in 22q11.2DS. Methods Lymphoblast samples were drawn from 53 individuals with 22q11.2DS and 16 typically developing controls. We measured COMT mRNA and protein expression and enzyme activity using standard procedures. The presence of a psychotic disorder and cognitive deficits were also evaluated using structured testing. Results There was a ~50% reduction in COMT mRNA, protein and enzyme activity levels in 22q11.2DS samples. Haplotype analysis revealed clear phenotypic differences between various Val-containing haplotypes on COMT-3′UTR extended mRNA, S-COMT and MB proteins and enzyme activity. The G variant of rs165599, a 3′UTR SNP, was associated with low levels of COMT expression and with the presence of psychosis and lower performance IQ scores in our 22q11.2DS sample. Finally, we demonstrate that the COMT rs74745580 ‘T’ mutation is associated with absent S-COMT expression and very low COMT activity in two 22q11.2DS individuals. Conclusions Our findings confirm a robust effect of COMT hemizygosity on COMT activity and show complex interactions of variants within the COMT gene that influence COMT biology and confound conclusions based on associations with the Val158Met genotype alone. PMID:23992923

  9. Human leukocyte antigen alleles, genotypes and haplotypes frequencies in renal transplant donors and recipients from West Central India.

    PubMed

    Patel, Jaina S; Patel, Manisha M; Koringa, Prakash G; Shah, Tejas M; Patel, Amrutlal K; Tripathi, Ajai K; Mathew, Anila; Rajapurkar, Mohan M; Joshi, Chaitanya G

    2013-04-01

    Human leukocyte antigen (HLA) is comprised of a highly polymorphic set of genes which determines the histocompatibility of organ transplantation. The present study was undertaken to identify HLA class I and class II allele, genotype and haplotype frequencies in renal transplant recipients and donors from West Central India. HLA typing was carried out using Polymerase Chain Reaction-Sequence Specific Primer in 552 live related and unrelated renal transplant recipients and donors. The most frequent HLA class I and class II alleles and their frequencies in recipients were HLA-AFNx0101 (0.1685) and AFNx0102 (0.1649), HLA-BFNx0135 (0.1322), and HLA-DR beta 1 (DRB 1)FNx0115 (0.2192), whereas in donors, these were HLA-AFNx0102 (0.1848) and AFNx0101 (0.1667), HLA-BFNx0135 (0.1359), and HLA-DRB1FNx0115 (0.2409). The two-locus haplotype statistical analysis revealed HLA-AFNx0102-B61 as the most common haplotype with the frequency of 0.0487 and 0.0510 in recipients and donors, respectively. Further, among the three locus haplotypes HLA-AFNx0133-BFNx0144-DRB1FNx0107 and HLA-AFNx0102-BFNx0161-DRB1FNx0115 were the most common haplotypes with frequencies 0.0362 and 0.0326, respectively in recipients and 0.0236 and 0.0323, respectively in donors. Genotype frequency revealed a high prevalence of genotype HLA-AFNx0102/AFNx0124 in recipients (0.058) compared to donors (0.0109) whereas low prevalence of HLA-AFNx0101/AFNx0102 in recipients (0.0435) than in donors (0.0797). The phylogenetic and principal component analysis of HLA allele and haplotype frequency distribution revealed genetic similarities of various ethnic groups. Further, case control analysis provides preliminary evidence of association of HLA-A genotype (P < 0.05) with renal failure. This study will be helpful in suitable donor search besides providing valuable information for population genetics and HLA disease association analysis.

  10. Mice, humans and haplotypes--the hunt for disease genes in SLE.

    PubMed

    Rigby, R J; Fernando, M M A; Vyse, T J

    2006-09-01

    Defining the polymorphisms that contribute to the development of complex genetic disease traits is a challenging, although increasingly tractable problem. Historically, the technical difficulties in conducting association studies across the entire human genome are such that murine models have been used to generate candidate genes for analysis in human complex diseases, such as SLE. In this article we discuss the advantages and disadvantages of this approach and specifically address some assumptions made in the transition from studying one species to another, using lupus as an example. These issues include differences in genetic structure and genetic organisation which are a reflection on the population history. Clearly there are major differences in the histories of the human population and inbred laboratory strains of mice. Both human and murine genomes do exhibit structure at the genetic level. That is to say, they comprise haplotypes which are genomic regions that carry runs of polymorphisms that are not independently inherited. Haplotypes therefore reduce the number of combinations of the polymorphisms in the DNA in that region and facilitate the identification of disease susceptibility genes in both mice and humans. There are now novel means of generating candidate genes in SLE using mutagenesis (with ENU) in mice and identifying mice that generate antinuclear autoimmunity. In addition, murine models still provide a valuable means of exploring the functional consequences of genetic variation. However, advances in technology are such that human geneticists can now screen large fractions of the human genome for disease associations using microchip technologies that provide information on upwards of 100,000 different polymorphisms. These approaches are aimed at identifying haplotypes that carry disease susceptibility mutations and rely less on the generation of candidate genes.

  11. A Locus for Autosomal Dominant Hereditary Spastic Ataxia, SAX1, Maps to Chromosome 12p13

    PubMed Central

    Meijer, I. A.; Hand, C. K.; Grewal, K. K.; Stefanelli, M. G.; Ives, E. J.; Rouleau, G. A.

    2002-01-01

    The hereditary spastic ataxias (HSA) are a group of clinically heterogeneous neurodegenerative disorders characterized by lower-limb spasticity and generalized ataxia. HSA was diagnosed in three unrelated autosomal dominant families from Newfoundland, who presented mainly with severe leg spasticity, dysarthria, dysphagia, and ocular-movement abnormalities. A genomewide scan was performed on one family, and linkage to a novel locus for HSA on chromosome 12p13, which contains the as-yet-unidentified gene locus SAX1, was identified. Fine mapping confirmed linkage in the two large families, and the third, smaller family showed LOD scores suggestive of linkage. Haplotype construction by use of 13 polymorphic markers revealed that all three families share a disease haplotype, which key recombinants and overlapping haplotypes refine to ∼5 cM, flanked by markers D12S93 and GATA151H05. SAX1 is the first locus mapped for autosomal dominant HSA. PMID:11774073

  12. Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population.

    PubMed

    Saeki, Mayumi; Saito, Yoshiro; Nakamura, Takahiro; Murayama, Norie; Kim, Su-Ryang; Ozawa, Shogo; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Nakajima, Toshiharu; Saito, Hirohisa; Kitamura, Yutaka; Kamatani, Naoyuki; Sawada, Jun-ichi

    2003-06-01

    In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese. Copyright 2003 Wiley-Liss, Inc.

  13. Enhancing the mathematical properties of new haplotype homozygosity statistics for the detection of selective sweeps.

    PubMed

    Garud, Nandita R; Rosenberg, Noah A

    2015-06-01

    Soft selective sweeps represent an important form of adaptation in which multiple haplotypes bearing adaptive alleles rise to high frequency. Most statistical methods for detecting selective sweeps from genetic polymorphism data, however, have focused on identifying hard selective sweeps in which a favored allele appears on a single haplotypic background; these methods might be underpowered to detect soft sweeps. Among exceptions is the set of haplotype homozygosity statistics introduced for the detection of soft sweeps by Garud et al. (2015). These statistics, examining frequencies of multiple haplotypes in relation to each other, include H12, a statistic designed to identify both hard and soft selective sweeps, and H2/H1, a statistic that conditional on high H12 values seeks to distinguish between hard and soft sweeps. A challenge in the use of H2/H1 is that its range depends on the associated value of H12, so that equal H2/H1 values might provide different levels of support for a soft sweep model at different values of H12. Here, we enhance the H12 and H2/H1 haplotype homozygosity statistics for selective sweep detection by deriving the upper bound on H2/H1 as a function of H12, thereby generating a statistic that normalizes H2/H1 to lie between 0 and 1. Through a reanalysis of resequencing data from inbred lines of Drosophila, we show that the enhanced statistic both strengthens interpretations obtained with the unnormalized statistic and leads to empirical insights that are less readily apparent without the normalization. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Phenotypic assessments of peanut nested association mapping (NAM) populations

    USDA-ARS?s Scientific Manuscript database

    Nested association mapping (NAM) is a valuable innovation and multi-parental mapping population strategy in peanut genetics which increases the power to map quantitative trait loci and assists in extending the gene pool of elite peanut lines. In the peanut research community, two structured mapping ...

  15. Assessing transmission of ‘Candidatus Liberibacter solanacearum’ haplotypes through seed potato

    USDA-ARS?s Scientific Manuscript database

    Conflicting data has previously been reported concerning the impact of zebra chip disease transmission through seed tubers. These discrepancies may be due to the experimental design of each study, whereby different pathogen haplotypes, insect vector haplotypes, and potato plant varieties were used....

  16. Two families from New England with usher syndrome type IC with distinct haplotypes.

    PubMed

    DeAngelis, M M; McGee, T L; Keats, B J; Slim, R; Berson, E L; Dryja, T P

    2001-03-01

    To search for patients with Usher syndrome type IC among those with Usher syndrome type I who reside in New England. Genotype analysis of microsatellite markers closely linked to the USH1C locus was done using the polymerase chain reaction. We compared the haplotype of our patients who were homozygous in the USH1C region with the haplotypes found in previously reported USH1C Acadian families who reside in southwestern Louisiana and from a single family residing in Lebanon. Of 46 unrelated cases of Usher syndrome type I residing in New England, two were homozygous at genetic markers in the USH1C region. Of these, one carried the Acadian USH1C haplotype and had Acadian ancestors (that is, from Nova Scotia) who did not participate in the 1755 migration of Acadians to Louisiana. The second family had a haplotype that proved to be the same as that of a family with USH1C residing in Lebanon. Each of the two families had haplotypes distinct from the other. This is the first report that some patients residing in New England have Usher syndrome type IC. Patients with Usher syndrome type IC can have the Acadian haplotype or the Lebanese haplotype compatible with the idea that at least two independently arising pathogenic mutations have occurred in the yet-to-be identified USH1C gene.

  17. More powerful haplotype sharing by accounting for the mode of inheritance.

    PubMed

    Ziegler, Andreas; Ewhida, Adel; Brendel, Michael; Kleensang, André

    2009-04-01

    The concept of haplotype sharing (HS) has received considerable attention recently, and several haplotype association methods have been proposed. Here, we extend the work of Beckmann and colleagues [2005 Hum. Hered. 59:67-78] who derived an HS statistic (BHS) as special case of Mantel's space-time clustering approach. The Mantel-type HS statistic correlates genetic similarity with phenotypic similarity across pairs of individuals. While phenotypic similarity is measured as the mean-corrected cross product of phenotypes, we propose to incorporate information of the underlying genetic model in the measurement of the genetic similarity. Specifically, for the recessive and dominant modes of inheritance we suggest the use of the minimum and maximum of shared length of haplotypes around a marker locus for pairs of individuals. If the underlying genetic model is unknown, we propose a model-free HS Mantel statistic using the max-test approach. We compare our novel HS statistics to BHS using simulated case-control data and illustrate its use by re-analyzing data from a candidate region of chromosome 18q from the Rheumatoid Arthritis (RA) Consortium. We demonstrate that our approach is point-wise valid and superior to BHS. In the re-analysis of the RA data, we identified three regions with point-wise P-values<0.005 containing six known genes (PMIP1, MC4R, PIGN, KIAA1468, TNFRSF11A and ZCCHC2) which might be worth follow-up.

  18. Two Orangutan Species Have Evolved Different KIR Alleles and Haplotypes1

    PubMed Central

    Guethlein, Lisbeth A.; Norman, Paul J.; Heijmans, Corinne M. C.; de Groot, Natasja G.; Hilton, Hugo G.; Babrzadeh, Farbod; Abi-Rached, Laurent; Bontrop, Ronald E.; Parham, Peter

    2017-01-01

    The immune and reproductive functions of human Natural Killer (NK) cells are regulated by interactions of the C1 and C2 epitopes of HLA-C with C1-specific and C2-specific lineage III killer cell immunoglobulin-like receptors (KIR). This rapidly evolving and diverse system of ligands and receptors is restricted to humans and great apes. In this context, the orangutan has particular relevance because it represents an evolutionary intermediate, one having the C1 epitope and corresponding KIR, but lacking the C2 epitope. Through a combination of direct sequencing, KIR genotyping and data mining from the Great Ape Genome Project (GAGP) we characterized the KIR alleles and haplotypes for panels of ten Bornean orangutans and 19 Sumatran orangutans. The orangutan KIR haplotypes have between five and ten KIR genes. The seven orangutan lineage III KIR genes all locate to the centromeric region of the KIR locus, whereas their human counterparts also populate the telomeric region. One lineage III KIR gene is Bornean-specific, one is Sumatran-specific and five are shared. Of twelve KIR gene-content haplotypes five are Bornean-specific, five are Sumatran-specific and two are shared. The haplotypes have different combinations of genes encoding activating and inhibitory C1 receptors that can be of higher or lower affinity. All haplotypes encode an inhibitory C1 receptor, but only some haplotypes encode an activating C1 receptor. Of 130 KIR alleles, 55 are Bornean-specific, 65 are Sumatran specific and ten are shared. PMID:28264973

  19. Batrachochytrium dendrobatidis Shows High Genetic Diversity and Ecological Niche Specificity among Haplotypes in the Maya Mountains of Belize

    PubMed Central

    Kaiser, Kristine; Pollinger, John

    2012-01-01

    The amphibian pathogen Batrachochytrium dendrobatidis (Bd) has been implicated in amphibian declines around the globe. Although it has been found in most countries in Central America, its presence has never been assessed in Belize. We set out to determine the range, prevalence, and diversity of Bd using quantitative PCR (qPCR) and sequencing of a portion of the 5.8 s and ITS1-2 regions. Swabs were collected from 524 amphibians of at least 26 species in the protected areas of the Maya Mountains of Belize. We sequenced a subset of 72 samples that had tested positive for Bd by qPCR at least once; 30 samples were verified as Bd. Eight unique Bd haplotypes were identified in the Maya Mountains, five of which were previously undescribed. We identified unique ecological niches for the two most broadly distributed haplotypes. Combined with data showing differing virulence shown in different strains in other studies, the 5.8 s - ITS1-2 region diversity found in this study suggests that there may be substantial differences among populations or haplotypes. Future work should focus on whether specific haplotypes for other genomic regions and possibly pathogenicity can be associated with haplotypes at this locus, as well as the integration of molecular tools with other ecological tools to elucidate the ecology and pathogenicity of Bd. PMID:22389681

  20. A haplotype of polymorphisms in ASE-1, RAI and ERCC1 and the effects of tobacco smoking and alcohol consumption on risk of colorectal cancer: a Danish prospective case-cohort study.

    PubMed

    Hansen, Rikke D; Sørensen, Mette; Tjønneland, Anne; Overvad, Kim; Wallin, Håkan; Raaschou-Nielsen, Ole; Vogel, Ulla

    2008-02-20

    Single nucleotide polymorphisms (SNPs) are the most frequent type of genetic variation in the human genome, and are of interest for the study of susceptibility to and protection from diseases. The haplotype at chromosome 19q13.2-3 encompassing the three SNPs ASE-1 G-21A, RAI IVS1 A4364G and ERCC1 Asn118Asn have been associated with risk of breast cancer and lung cancer. Haplotype carriers are defined as the homozygous carriers of RAI IVS1 A4364GA, ERCC1 Asn118AsnT and ASE-1 G-21AG. We aimed to evaluate whether the three polymorphisms and the haplotype are associated to risk of colorectal cancer, and investigated gene-environment associations between the polymorphisms and the haplotype and smoking status at enrolment, smoking duration, average smoking intensity and alcohol consumption, respectively, in relation to risk of colorectal cancer. Associations between the three individual polymorphisms, the haplotype and risk of colorectal cancer were examined, as well as gene-environment interaction, in a Danish case-cohort study including 405 cases and a comparison group of 810 persons. Incidence rate ratio (IRR) were estimated by the Cox proportional hazards model stratified according to gender, and two-sided 95% confidence intervals (CI) and p-values were calculated based on robust estimates of the variance-covariance matrix and Wald's test of the Cox regression parameter. No consistent associations between the three individual polymorphisms, the haplotype and risk of colorectal cancer were found. No statistically significant interactions between the genotypes and the lifestyle exposures smoking or alcohol consumption were observed. Our results suggest that the ASE-1 G-21A, RAI IVS1 A4364G and ERCC1 Asn118Asn polymorphisms and the previously identified haplotype are not associated with risk of colorectal cancer. We found no evidence of gene-environment interaction between the three polymorphisms and the haplotype and smoking intensity and alcohol consumption

  1. Limb-girdle muscular dystrophy and Miyoshi myopathy in an aboriginal Canadian kindred map to LGMD2B and segregate with the same haplotype

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weiler, T.; Nylen, E.; Wrogemann, K.

    1996-10-01

    We report the results of our investigations of a large, inbred, aboriginal Canadian kindred with nine muscular dystrophy patients. The ancestry of all but two of the carrier parents could be traced to a founder couple, seven generations back. Seven patients presented with proximal myopathy consistent with limb girdle-type muscular dystrophy (LGMD), whereas two patients manifested predominantly distal wasting and weakness consistent with Miyoshi myopathy (distal autosomal recessive muscular dystrophy) (MM). Age at onset of symptoms, degree of creatine kinase elevation, and muscle histology were similar in both phenotypes. Segregation of LGMD/MM is consistent with autosomal recessive inheritance, and themore » putative locus is significantly linked (LOD scores >3.0) to six marker loci that span the region of the LGMD2B locus on chromosome 2p. Our initial hypothesis that the affected patients would all be homozygous by descent for microsatellite markers surrounding the disease locus was rejected. Rather, two different core haplotypes, encompassing a 4-cM region spanned by D2S291-D2S145-D2S286, segregated with the disease, indicating that there are two mutant alleles of independent origin in this kindred. There was no association, however, between the two different haplotypes and clinical variability; they do not distinguish between the LGMD and MM phenotypes. Thus, we conclude that LGMD and MM in our population are caused by the same mutation in LGMD2B and that additional factors, both genetic and nongenetic, must contribute to the clinical phenotype. 37 refs., 2 figs., 2 tabs.« less

  2. The evolutionary history of the DMRT3 'Gait keeper' haplotype.

    PubMed

    Staiger, E A; Almén, M S; Promerová, M; Brooks, S; Cothran, E G; Imsland, F; Jäderkvist Fegraeus, K; Lindgren, G; Mehrabani Yeganeh, H; Mikko, S; Vega-Pla, J L; Tozaki, T; Rubin, C J; Andersson, L

    2017-10-01

    A previous study revealed a strong association between the DMRT3:Ser301STOP mutation in horses and alternate gaits as well as performance in harness racing. Several follow-up studies have confirmed a high frequency of the mutation in gaited horse breeds and an effect on gait quality. The aim of this study was to determine when and where the mutation arose, to identify additional potential causal mutations and to determine the coalescence time for contemporary haplotypes carrying the stop mutation. We utilized sequences from 89 horses representing 26 breeds to identify 102 SNPs encompassing the DMRT3 gene that are in strong linkage disequilibrium with the stop mutation. These 102 SNPs were genotyped in an additional 382 horses representing 72 breeds, and we identified 14 unique haplotypes. The results provided conclusive evidence that DMRT3:Ser301STOP is causal, as no other sequence polymorphisms showed an equally strong association to locomotion traits. The low sequence diversity among mutant chromosomes demonstrated that they must have diverged from a common ancestral sequence within the last 10 000 years. Thus, the mutation occurred either just before domestication or more likely some time after domestication and then spread across the world as a result of selection on locomotion traits. © 2017 Stichting International Foundation for Animal Genetics.

  3. Fcγ receptor IIIa single-nucleotide polymorphisms and haplotypes affect human IgG binding and are associated with lupus nephritis in African Americans.

    PubMed

    Dong, Chaoling; Ptacek, Travis S; Redden, David T; Zhang, Kui; Brown, Elizabeth E; Edberg, Jeffrey C; McGwin, Gerald; Alarcón, Graciela S; Ramsey-Goldman, Rosalind; Reveille, John D; Vilá, Luis M; Petri, Michelle; Qin, Aijian; Wu, Jianming; Kimberly, Robert P

    2014-05-01

    To investigate whether the Fcγ receptor IIIa-66L/R/H (FcγRIIIa-66L/R/H) polymorphism influences net effective receptor function and to assess if the FCGR3A combined genotypes formed by FcγRIIIa-66L/R/H and FcγRIIIa-176F/V, as well as copy number variation (CNV), confer risk of developing systemic lupus erythematosus (SLE) and lupus nephritis. FcγRIIIa variants, expressed on A20 IIA1.6 cells, were used in flow cytometry-based human IgG-binding assays. Using Pyrosequencing methodology, FCGR3A single-nucleotide polymorphism and CNV genotypes were determined in a cohort of 1,728 SLE patients and 2,404 healthy controls. The FcγRIIIa-66L/R/H (rs10127939) polymorphism influenced ligand binding capacity in the presence of the FcγRIIIa-176V (rs396991) allele. There was a trend toward an association of the low-binding FcγRIIIa-176F allele with lupus nephritis among African Americans (P = 0.0609) but not among European Americans (P > 0.10). Nephritis among African American patients with SLE was associated with FcγRIIIa low-binding haplotypes containing the 66L/R/H and 176F variants (P = 0.03) and with low-binding genotype combinations (P = 0.002). No association was observed among European American patients with SLE. The distribution of FCGR3A CNV was not significantly different among controls and SLE patients with or without nephritis. FcγRIIIa-66L/R/H influences ligand binding. The low-binding haplotypes formed by 66L/R/H and 176F confer enhanced risk of lupus nephritis in African Americans. FCGR3A CNVs are not associated with SLE or lupus nephritis in either African Americans or European Americans. Copyright © 2014 by the American College of Rheumatology.

  4. Exact algorithms for haplotype assembly from whole-genome sequence data.

    PubMed

    Chen, Zhi-Zhong; Deng, Fei; Wang, Lusheng

    2013-08-15

    Haplotypes play a crucial role in genetic analysis and have many applications such as gene disease diagnoses, association studies, ancestry inference and so forth. The development of DNA sequencing technologies makes it possible to obtain haplotypes from a set of aligned reads originated from both copies of a chromosome of a single individual. This approach is often known as haplotype assembly. Exact algorithms that can give optimal solutions to the haplotype assembly problem are highly demanded. Unfortunately, previous algorithms for this problem either fail to output optimal solutions or take too long time even executed on a PC cluster. We develop an approach to finding optimal solutions for the haplotype assembly problem under the minimum-error-correction (MEC) model. Most of the previous approaches assume that the columns in the input matrix correspond to (putative) heterozygous sites. This all-heterozygous assumption is correct for most columns, but it may be incorrect for a small number of columns. In this article, we consider the MEC model with or without the all-heterozygous assumption. In our approach, we first use new methods to decompose the input read matrix into small independent blocks and then model the problem for each block as an integer linear programming problem, which is then solved by an integer linear programming solver. We have tested our program on a single PC [a Linux (x64) desktop PC with i7-3960X CPU], using the filtered HuRef and the NA 12878 datasets (after applying some variant calling methods). With the all-heterozygous assumption, our approach can optimally solve the whole HuRef data set within a total time of 31 h (26 h for the most difficult block of the 15th chromosome and only 5 h for the other blocks). To our knowledge, this is the first time that MEC optimal solutions are completely obtained for the filtered HuRef dataset. Moreover, in the general case (without the all-heterozygous assumption), for the HuRef dataset our

  5. Protection From Varicella Zoster in Solid Organ Transplant Recipients Carrying Killer Cell Immunoglobulin-Like Receptor B Haplotypes.

    PubMed

    Schmied, Laurent; Terszowski, Grzegorz; Gonzalez, Asensio; Schmitter, Karin; Hirsch, Hans H; Garzoni, Christian; van Delden, Christian; Boggian, Katia; Mueller, Nicolas J; Berger, Christoph; Villard, Jean; Manuel, Oriol; Meylan, Pascal; Hess, Christoph; Stern, Martin

    2015-12-01

    Natural killer cell function is regulated by inhibitory and activating killer cell immunoglobulin-like receptors (KIR). Previous studies have documented associations of KIR genotype with the risk of cytomegalovirus (CMV) replication after solid organ transplantation. In this study of 649 solid organ transplant recipients, followed prospectively for infectious disease events within the Swiss Transplant Cohort Study, we were interested to see if KIR genotype associated with virus infections other than CMV. We found that KIR B haplotypes (which have previously been linked to protection from CMV replication) were associated with protection from varicella zoster virus infection (hazard ratio, 0.43; 95% confidence interval, 0.21-0.91; P = 0.03). No significant associations were detected regarding the risk of herpes simplex, Epstein-Barr virus or BK polyomavirus infections. In conclusion, these data provide evidence that the relative protection of KIR haplotype B from viral replication after solid organ transplantation may extend beyond CMV to other herpes viruses, such as varicella zoster virus and possibly Epstein-Barr virus.

  6. A Monomorphic Haplotype of Chromosome Ia Is Associated with Widespread Success in Clonal and Nonclonal Populations of Toxoplasma gondii

    PubMed Central

    Khan, Asis; Miller, Natalie; Roos, David S.; Dubey, J. P.; Ajzenberg, Daniel; Dardé, Marie Laure; Ajioka, James W.; Rosenthal, Benjamin; Sibley, L. David

    2011-01-01

    ABSTRACT Toxoplasma gondii is a common parasite of animals that also causes a zoonotic infection in humans. Previous studies have revealed a strongly clonal population structure that is shared between North America and Europe, while South American strains show greater genetic diversity and evidence of sexual recombination. The common inheritance of a monomorphic version of chromosome Ia (referred to as ChrIa*) among three clonal lineages from North America and Europe suggests that inheritance of this chromosome might underlie their recent clonal expansion. To further examine the diversity and distribution of ChrIa, we have analyzed additional strains with greater geographic diversity. Our findings reveal that the same haplotype of ChrIa* is found in the clonal lineages from North America and Europe and in older lineages in South America, where sexual recombination is more common. Although lineages from all three continents harbor the same conserved ChrIa* haplotype, strains from North America and Europe are genetically separate from those in South America, and these respective geographic regions show limited evidence of recent mixing. Genome-wide, array-based profiling of polymorphisms provided evidence for an ancestral flow from particular older southern lineages that gave rise to the clonal lineages now dominant in the north. Collectively, these data indicate that ChrIa* is widespread among nonclonal strains in South America and has more recently been associated with clonal expansion of specific lineages in North America and Europe. These findings have significant implications for the spread of genetic loci influencing transmission and virulence in pathogen populations. PMID:22068979

  7. Haplotype-Based Genome-Wide Prediction Models Exploit Local Epistatic Interactions Among Markers

    PubMed Central

    Jiang, Yong; Schmidt, Renate H.; Reif, Jochen C.

    2018-01-01

    Genome-wide prediction approaches represent versatile tools for the analysis and prediction of complex traits. Mostly they rely on marker-based information, but scenarios have been reported in which models capitalizing on closely-linked markers that were combined into haplotypes outperformed marker-based models. Detailed comparisons were undertaken to reveal under which circumstances haplotype-based genome-wide prediction models are superior to marker-based models. Specifically, it was of interest to analyze whether and how haplotype-based models may take local epistatic effects between markers into account. Assuming that populations consisted of fully homozygous individuals, a marker-based model in which local epistatic effects inside haplotype blocks were exploited (LEGBLUP) was linearly transformable into a haplotype-based model (HGBLUP). This theoretical derivation formally revealed that haplotype-based genome-wide prediction models capitalize on local epistatic effects among markers. Simulation studies corroborated this finding. Due to its computational efficiency the HGBLUP model promises to be an interesting tool for studies in which ultra-high-density SNP data sets are studied. Applying the HGBLUP model to empirical data sets revealed higher prediction accuracies than for marker-based models for both traits studied using a mouse panel. In contrast, only a small subset of the traits analyzed in crop populations showed such a benefit. Cases in which higher prediction accuracies are observed for HGBLUP than for marker-based models are expected to be of immediate relevance for breeders, due to the tight linkage a beneficial haplotype will be preserved for many generations. In this respect the inheritance of local epistatic effects very much resembles the one of additive effects. PMID:29549092

  8. Haplotype-Based Genome-Wide Prediction Models Exploit Local Epistatic Interactions Among Markers.

    PubMed

    Jiang, Yong; Schmidt, Renate H; Reif, Jochen C

    2018-05-04

    Genome-wide prediction approaches represent versatile tools for the analysis and prediction of complex traits. Mostly they rely on marker-based information, but scenarios have been reported in which models capitalizing on closely-linked markers that were combined into haplotypes outperformed marker-based models. Detailed comparisons were undertaken to reveal under which circumstances haplotype-based genome-wide prediction models are superior to marker-based models. Specifically, it was of interest to analyze whether and how haplotype-based models may take local epistatic effects between markers into account. Assuming that populations consisted of fully homozygous individuals, a marker-based model in which local epistatic effects inside haplotype blocks were exploited (LEGBLUP) was linearly transformable into a haplotype-based model (HGBLUP). This theoretical derivation formally revealed that haplotype-based genome-wide prediction models capitalize on local epistatic effects among markers. Simulation studies corroborated this finding. Due to its computational efficiency the HGBLUP model promises to be an interesting tool for studies in which ultra-high-density SNP data sets are studied. Applying the HGBLUP model to empirical data sets revealed higher prediction accuracies than for marker-based models for both traits studied using a mouse panel. In contrast, only a small subset of the traits analyzed in crop populations showed such a benefit. Cases in which higher prediction accuracies are observed for HGBLUP than for marker-based models are expected to be of immediate relevance for breeders, due to the tight linkage a beneficial haplotype will be preserved for many generations. In this respect the inheritance of local epistatic effects very much resembles the one of additive effects. Copyright © 2018 Jiang et al.

  9. Effects of apolipoprotein A5 haplotypes on the ratio of triglyceride to high-density lipoprotein cholesterol and the risk for metabolic syndrome in Koreans.

    PubMed

    Cha, Seongwon; Yu, Hyunjoo; Park, Ah Yeon; Song, Kwang Hoon

    2014-03-12

    Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C-G-A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS.

  10. MDR1 haplotypes derived from exons 21 and 26 do not affect the steady-state pharmacokinetics of tacrolimus in renal transplant patients.

    PubMed

    Mai, Ingrid; Perloff, Elke S; Bauer, Steffen; Goldammer, Mark; Johne, Andreas; Filler, Guido; Budde, Klemens; Roots, Ivar

    2004-11-01

    This retrospective study investigated the influence of MDR1 haplotypes derived from the polymorphisms 2677G > T (exon 21) and 3435C > T (exon 26) on the pharmacokinetics of the immunosuppressant drug tacrolimus in 73 renal transplant patients. Based on both variants of SNPs 2677 and 3435, four different haplotypes and eight different genotypes were identified in the study sample. Tacrolimus trough concentrations (C(0)) were compared between different SNP variants and genotypes, as well as between carriers and noncarriers of each haplotype. Additionally, CYP3A5 genotype (6956G > A) was determined. No significant differences were observed between groups. Differences in mean tacrolimus C(0) values between carriers and noncarriers of each haplotype ranged from -0.04 microg/litre (95% confidence interval: -0.53 to 0.60) to -23 microg/litre (-1.07 to 1.53). No association was found between CYP3A5*1/*3 genotype and tacrolimus Co concentractions. MDR1 haplotypes derived from the SNPs 2677G > T (exon 21) and 3435C > T (exon 26) do not influence the pharmacokinetics of tacrolimus in renal transplant patients.

  11. HLA class I and class II haplotypes in admixed families from several regions of Mexico.

    PubMed

    Barquera, Rodrigo; Zúñiga, Joaquín; Hernández-Díaz, Raquel; Acuña-Alonzo, Victor; Montoya-Gama, Karla; Moscoso, Juan; Torres-García, Diana; García-Salas, Claudia; Silva, Beatriz; Cruz-Robles, David; Arnaiz-Villena, Antonio; Vargas-Alarcón, Gilberto; Granados, Julio

    2008-02-01

    We studied HLA class I and class II alleles in 191 Mexican families (381 non-related individuals) to directly obtain the HLA-A/B/DRB1/DQB1 haplotypes and their linkage disequilibrium (LD). The most frequent HLA haplotypes observed were: A*02-B*39-DRB1*04-DQB1*0302, A*02-B*35-DRB1*04-DQB1*0302, A*68-B*39-DRB1*04-DQB1*0302, A*02-B*35-DRB1*08-DQB1*04, A*33-B*1402-DRB1*01-DQB1*05, and A*24-B*35-DRB1*04-DQB1*0302. The four most common haplotypes found by our study involve those previously reported in Amerindian populations. LD analysis of HLA-A-B and HLA-B-DRB1 loci showed significant associations between A29(19)-B44(12), A33(19)-B65(14), A1-B8, A26(19)-B44(12), A24(9)-B61(40), B65(14)-DR1, B8-DR17(3), B44(12)-DR7, B7-DR15(2), and B39(16)-DR4. Also, all DRB1-DQB1 associations showed significant LD values. Admixture estimations using a trihybrid model showed that Mexicans from the State of Sinaloa (Northern Mexico) have a greater proportion of European genetic component compared with Mexicans from the Central area of Mexico, who have a greater percentage of Amerindian genes. Our results are important for future comparative genetic studies of different Mexican ethnic groups with special relevance to disease association and transplantation studies.

  12. Diet and Colorectal Cancer: Analysis of a Candidate Pathway Using SNPS, Haplotypes, and Multi-Gene Assessment

    PubMed Central

    Slattery, Martha L.; Lundgreen, Abbie; Herrick, Jennifer S.; Caan, Bette J.; Potter, John D.; Wolff, Roger K.

    2012-01-01

    There is considerable biologic plausibility to the hypothesis that genetic variability in pathways involved in insulin signaling and energy homeostasis may modulate dietary risk associated with colorectal cancer. We utilized data from 2 population-based case-control studies of colon (n = 1,574 cases, 1,970 controls) and rectal (n = 791 cases, 999 controls) cancer to evaluate genetic variation in candidate SNPs identified from 9 genes in a candidate pathway: PDK1, RP6KA1, RPS6KA2, RPS6KB1, RPS6KB2, PTEN, FRAP1 (mTOR), TSC1, TSC2, Akt1, PIK3CA, and PRKAG2 with dietary intake of total energy, carbohydrates, fat, and fiber. We employed SNP, haplotype, and multiple-gene analysis to evaluate associations. PDK1 interacted with dietary fat for both colon and rectal cancer and with dietary carbohydrates for colon cancer. Statistically significant interaction with dietary carbohydrates and rectal cancer was detected by haplotype analysis of PDK1. Evaluation of dietary interactions with multiple genes in this candidate pathway showed several interactions with pairs of genes: Akt1 and PDK1, PDK1 and PTEN, PDK1 and TSC1, and PRKAG2 and PTEN. Analyses show that genetic variation influences risk of colorectal cancer associated with diet and illustrate the importance of evaluating dietary interactions beyond the level of single SNPs or haplotypes when a biologically relevant candidate pathway is examined. PMID:21999454

  13. The "Sardinian" HLA-A30,B18,DR3,DQw2 haplotype constantly lacks the 21-OHA and C4B genes. Is it an ancestral haplotype without duplication?

    PubMed

    Contu, L; Carcassi, C; Dausset, J

    1989-01-01

    The C4 and 21-OH loci of the class III HLA have been studied by specific DNA probes and the restriction enzyme Taq 1 in 24 unrelated Sardinian individuals selected from completely HLA-typed families. All 24 individuals had the HLA extended haplotype A30,Cw5,B18, BfF1,DR3,DRw52,DQw2, named "Sardinian" in the present paper because of its frequency of 15% in the Sardinian population. Eighteen of these were homozygous for the entire haplotype, and six were heterozygous at the A locus and blank (or homozygous) at all the other loci. In all completely homozygous cells and in four heterozygous cells at the A locus, the restriction fragments of the 21-OHA (3.2 kb) and C4B (5.8 kb or 5.4 kb) genes were absent, and the fragments of the C4A (7.0 kb) and 21-OHB (3.7 kb) genes were present. It is suggested that the "Sardinian" haplotype is an ancestral haplotype without duplication of the C4 and 21-OH genes, practically always identical in its structure, also in unrelated individuals. The diversity of this haplotype in the class III region (about 30 kb less) may be at least partially responsible for its misalignment with most haplotypes, which have duplicated C4 and 21-OH genes, and therefore also for its decreased probability to recombine. This can help explain its high stability and frequency in the Sardinian population. The same conclusion can be suggested for the Caucasian extended haplotype A1,B8,DR3 that always seems to lack the C4A and 21-OHA genes.

  14. Haplotypes of CYP3A4 and their close linkage with CYP3A5 haplotypes in a Japanese population.

    PubMed

    Fukushima-Uesaka, Hiromi; Saito, Yoshiro; Watanabe, Hidemi; Shiseki, Kisho; Saeki, Mayumi; Nakamura, Takahiro; Kurose, Kouichi; Sai, Kimie; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Kitakaze, Masafumi; Hanai, Sotaro; Nakajima, Toshiharu; Matsumoto, Kenji; Saito, Hirohisa; Goto, Yu-ichi; Kimura, Hideo; Katoh, Masaaki; Sugai, Kenji; Minami, Narihiro; Shirao, Kuniaki; Tamura, Tomohide; Yamamoto, Noboru; Minami, Hironobu; Ohtsu, Atsushi; Yoshida, Teruhiko; Saijo, Nagahiro; Kitamura, Yutaka; Kamatani, Naoyuki; Ozawa, Shogo; Sawada, Jun-ichi

    2004-01-01

    In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A4 in a Japanese population, the distal enhancer and proximal promoter regions, all exons, and the surrounding introns were sequenced from genomic DNA of 416 Japanese subjects. We found 24 SNPs, including 17 novel ones: two in the distal enhancer, four in the proximal promoter, one in the 5'-untranslated region (UTR), seven in the introns, and three in the 3'-UTR. The most common SNP was c.1026+12G>A (IVS10+12G>A), with a 0.249 frequency. Four non-synonymous SNPs, c.554C>G (p.T185S, CYP3A4(*)16), c.830_831insA (p.E277fsX8, (*)6), c.878T>C (p.L293P, (*)18), and c.1088 C>T (p.T363M, (*)11) were found with frequencies of 0.014, 0.001, 0.028, and 0.002, respectively. No SNP was found in the known nuclear transcriptional factor-binding sites in the enhancer and promoter regions. Using these 24 SNPs, 16 haplotypes were unambiguously identified, and nine haplotypes were inferred by aid of an expectation-maximization-based program. In addition, using data from 186 subjects enabled a close linkage to be found between CYP3A4 and CYP3A5 SNPs, especially among the SNPs at c.1026+12 in CYP3A4 and c.219-237 (IVS3-237, a key SNP site for CYP3A5(*)3), c.865+77 (IVS9+77) and c.1523 in CYP3A5. This result suggested that CYP3A4 and CYP3A5 are within the same gene block. Haplotype analysis between CYP3A4 and CYP3A5 revealed several major haplotype combinations in the CYP3A4-CYP3A5 block. Our findings provide fundamental and useful information for genotyping CYP3A4 (and CYP3A5) in the Japanese, and probably Asian populations. Copyright 2003 Wiley-Liss, Inc.

  15. Pre-harvest sprouting resistance and haplotype variation of ThVp-1 gene in the collection of wheat-wheatgrass hybrids

    PubMed Central

    Kocheshkova, A. A.; Kroupin, P. Yu.; Bazhenov, M. S.; Karlov, G. I.; Pochtovyy, A. A.; Upelniek, V. P.; Belov, V. I.

    2017-01-01

    The germplasm collection of 87 wheat-wheatgrass hybrids developed in Tsitisin Main Botanical Garden (Russia, Moscow) was evaluated for resistance to pre-harvest sprouting (PHS) by spike sprouting (SS) and germination index (GI) assays as well as for spike and grain features. The PHS resistance variation and haplotype polymorphism of the wheatgrass ThVp-1 and wheat TaVp-1B genes orthologues of Vp-1 was revealed in the studied collection. Four haplotypes of ThVp-1 were revealed: ThVp-1a (41% of the entries), ThVp-1b (13%), ThVp-1c (29%), and ThVp-1d (15%). The association between the allelic state of ThVp-1 and PHS resistance in the wheat-wheatgrass hybrids was shown: haplotype ThVp-1d of the wheatgrass Vp-1 gene is significantly associated with reduced PHS in the wheat-wheatgrass hybrids (mean SS 0.33, mean GI 0.64). The resistant entries may be perspective as a source of PHS resistance in the development of commercial cultivars of perennial wheat. PMID:29131854

  16. RNA sequencing demonstrates large-scale temporal dysregulation of gene expression in stimulated macrophages derived from MHC-defined chicken haplotypes.

    PubMed

    Irizarry, Kristopher J L; Downs, Eileen; Bryden, Randall; Clark, Jory; Griggs, Lisa; Kopulos, Renee; Boettger, Cynthia M; Carr, Thomas J; Keeler, Calvin L; Collisson, Ellen; Drechsler, Yvonne

    2017-01-01

    Discovering genetic biomarkers associated with disease resistance and enhanced immunity is critical to developing advanced strategies for controlling viral and bacterial infections in different species. Macrophages, important cells of innate immunity, are directly involved in cellular interactions with pathogens, the release of cytokines activating other immune cells and antigen presentation to cells of the adaptive immune response. IFNγ is a potent activator of macrophages and increased production has been associated with disease resistance in several species. This study characterizes the molecular basis for dramatically different nitric oxide production and immune function between the B2 and the B19 haplotype chicken macrophages.A large-scale RNA sequencing approach was employed to sequence the RNA of purified macrophages from each haplotype group (B2 vs. B19) during differentiation and after stimulation. Our results demonstrate that a large number of genes exhibit divergent expression between B2 and B19 haplotype cells both prior and after stimulation. These differences in gene expression appear to be regulated by complex epigenetic mechanisms that need further investigation.

  17. Contribution of HLA-A/B/C/DRB1/DQB1 common haplotypes to donor search outcome in unrelated hematopoietic stem cell transplantation.

    PubMed

    Pédron, Béatrice; Guérin-El Khourouj, Valérie; Dalle, Jean-Hugues; Ouachée-Chardin, Marie; Yakouben, Karima; Corroyez, France; Auvrignon, Anne; Petit, Arnaud; Landman-Parker, Judith; Leverger, Guy; Baruchel, André; Sterkers, Ghislaine

    2011-11-01

    In unrelated hematopoietic stem cell transplantation (HSCT), the prediction of donor search outcome at the time of search initiation is of great value for the physicians to delineate the strategy of patient care. The probability of finding an unrelated donor is high for patients who carry at least 1 of the 10 most common HLA haplotypes in Caucasians. As only 10% to 20% patients respond to this criterion, here we aimed at finding additional common haplotypes to improve the prediction of a successful search. HLA broad HLA-A/B/DRB1 haplotypes that were observed with frequencies ≥0.19% in patient families of European origin and that split into ≤2 predominant 4-digit HLA-A/B/C/DRB1/DQB1 haplotypes were considered as common. Carriage of at least 1 of those in 168 patients of various geographic areas with no family donor was confronted to the chance of finding ≥9/10 HLA-matched unrelated donors. Fifty common 4-digit haplotypes were identified. A higher (P < 5 × 10(-6)) chance of finding a suitable donor was found for 55 of 170 (32%) recipients that carried at least 1 of these common haplotypes. Up to now, estimates classified patients into ≥3 groups of probability with ≥1 intermediate group of poor utility for the clinicians. Considering carriage of these common haplotypes together with the frequencies of alleles and of B/C and DRB1/DQB1 associations, which are carried by patient HLA haplotypes, we could classify the patients into 2 groups of probability with a 98% and 26% chance of finding a donor, respectively. Prediction of search outcome could be improved by including the 50 most common HLA haplotypes in the current approaches. Copyright © 2011 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.

  18. Conflation and integration of archived geologic maps and associated uncertainties

    USGS Publications Warehouse

    Shoberg, Thomas G.

    2016-01-01

    Old, archived geologic maps are often available with little or no associated metadata. This creates special problems in terms of extracting their data to use with a modern database. This research focuses on some problems and uncertainties associated with conflating older geologic maps in regions where modern geologic maps are, as yet, non-existent as well as vertically integrating the conflated maps with layers of modern GIS data (in this case, The National Map of the U.S. Geological Survey). Ste. Genevieve County, Missouri was chosen as the test area. It is covered by six archived geologic maps constructed in the years between 1928 and 1994. Conflating these maps results in a map that is internally consistent with these six maps, is digitally integrated with hydrography, elevation and orthoimagery data, and has a 95% confidence interval useful for further data set integration.

  19. Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms

    PubMed Central

    Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

    2016-01-01

    Abstract Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited. We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms. In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D’ and r2 values were 0.883 and 0.143, respectively. In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs. PMID:27902594

  20. Analysis of MHC class I genes across horse MHC haplotypes

    PubMed Central

    Tallmadge, Rebecca L.; Campbell, Julie A.; Miller, Donald C.; Antczak, Douglas F.

    2010-01-01

    The genomic sequences of 15 horse Major Histocompatibility Complex (MHC) class I genes and a collection of MHC class I homozygous horses of five different haplotypes were used to investigate the genomic structure and polymorphism of the equine MHC. A combination of conserved and locus-specific primers was used to amplify horse MHC class I genes with classical and non-classical characteristics. Multiple clones from each haplotype identified three to five classical sequences per homozygous animal, and two to three non-classical sequences. Phylogenetic analysis was applied to these sequences and groups were identified which appear to be allelic series, but some sequences were left ungrouped. Sequences determined from MHC class I heterozygous horses and previously described MHC class I sequences were then added, representing a total of ten horse MHC haplotypes. These results were consistent with those obtained from the MHC homozygous horses alone, and 30 classical sequences were assigned to four previously confirmed loci and three new provisional loci. The non-classical genes had few alleles and the classical genes had higher levels of allelic polymorphism. Alleles for two classical loci with the expected pattern of polymorphism were found in the majority of haplotypes tested, but alleles at two other commonly detected loci had more variation outside of the hypervariable region than within. Our data indicate that the equine Major Histocompatibility Complex is characterized by variation in the complement of class I genes expressed in different haplotypes in addition to the expected allelic polymorphism within loci. PMID:20099063

  1. Bootstrap study of genome-enabled prediction reliabilities using haplotype blocks across Nordic Red cattle breeds.

    PubMed

    Cuyabano, B C D; Su, G; Rosa, G J M; Lund, M S; Gianola, D

    2015-10-01

    This study compared the accuracy of genome-enabled prediction models using individual single nucleotide polymorphisms (SNP) or haplotype blocks as covariates when using either a single breed or a combined population of Nordic Red cattle. The main objective was to compare predictions of breeding values of complex traits using a combined training population with haplotype blocks, with predictions using a single breed as training population and individual SNP as predictors. To compare the prediction reliabilities, bootstrap samples were taken from the test data set. With the bootstrapped samples of prediction reliabilities, we built and graphed confidence ellipses to allow comparisons. Finally, measures of statistical distances were used to calculate the gain in predictive ability. Our analyses are innovative in the context of assessment of predictive models, allowing a better understanding of prediction reliabilities and providing a statistical basis to effectively calibrate whether one prediction scenario is indeed more accurate than another. An ANOVA indicated that use of haplotype blocks produced significant gains mainly when Bayesian mixture models were used but not when Bayesian BLUP was fitted to the data. Furthermore, when haplotype blocks were used to train prediction models in a combined Nordic Red cattle population, we obtained up to a statistically significant 5.5% average gain in prediction accuracy, over predictions using individual SNP and training the model with a single breed. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Molecular pathology and haplotype analysis of Wilson disease in Mediterranean populations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Figus, A.; Farcia, A.M.G.; Nurchi, A.

    1995-12-01

    We analyzed mutations and defined the chromosomal haplotype in 127 patients of Mediterranean descent who were affected in Wilson disease (WD): 39 Sardinians, 49 Italians, 33 Turks, and 6 Albanians. Haplotypes were derived by use of the microsatellite markers D13S301, D13S296, D13S297, and D13S298, which are linked to the WD locus. There were five common haplotypes in Sardinians, three in Italians, and two in Turks, which accounted for 85%, 32%, and 30% of the WD chromosomes, respectively. We identified 16 novel mutations: 8 frameshifts, 7 missense mutations, and 1 splicing defect. In addition, we detected the previously described mutations: 2302insC,more » 3404delC, Arg1320ter, Gly944Ser, and His1070Gin. Of the new mutations detected, two, the 1515insT on haplotype I and 2464delC on haplotype XVI, accounted for 6% and 13%, respectively, of the mutations in WD chromsomes in the Sardinian populations. Mutations H1070Q, 2302insC, and 2533delA represented 13%, 8%, and 8%, respectively, of the mutations in WD chromsomes in other Mediterranean populations. The remaining mutations were rare and limited to one or two patients from different populations. Thus, WD results from some frequent mutations and many rare defects. 28 refs., 1 fig., 3 tabs.« less

  3. Genetic variation in CXCR1 haplotypes linked to severity of Streptococcus uberis infection in an experimental challenge model.

    PubMed

    Siebert, Lydia; Headrick, Susan; Lewis, Mark; Gillespie, Barbara; Young, Charlie; Wojakiewicz, Leszek; Kerro-Dego, Oudessa; Prado, Maria E; Almeida, Raul; Oliver, Stephen P; Pighetti, Gina M

    2017-08-01

    Mastitis, an inflammation of the mammary gland, costs the dairy industry billions of dollars in lost revenues annually. The prevalence and costs associated with mastitis has made genetic selection methods a target for research. Previous research has identified amino acid changes at positions 122, 207, 245, 327, and 332 in the IL8 receptor, CXCR1, that result in three dominant amino acid haplotypes: VWHKH, VWHRR, and AWQRR. We hypothesize different haplotype combinations influence a cow's resistance, strength, and duration of response to mastitis. To test this, Holstein dairy cows (n=40) were intramammarily challenged with Streptococcus uberis within 3 d post-calving. All cows developed mastitis based on isolation of S. uberis from the challenged quarter at least twice. All cows with the VWHRR x VWHRR (n=5) and AWQRR x VWHRR (n=6) haplotype combinations required antibiotic therapy due to clinical signs of mastitis and tended (P=0.08) to be different from cows with a VWHRR x VWHKH (n=6) haplotype combination where only 33.3% required antibiotic therapy. Cows with a VWHRR homozygous haplotype combination displayed significantly higher responses to challenge indicated by elevated S. uberis counts (4340±5,521.9CFU/mL; P=0.01), mammary scores (1.1±0.18; P=0.03), milk scores (0.9±0.17; P=0.002), and SCC (1,010,832±489,993cells/mL; P=0.03). Contrastingly, AWQRR x VWHRR cows had significantly lower S. uberis counts (15.3±16.46CFU/mL; P=0.01), mammary scores (0.3±0.16; P=0.03), milk scores (0±0.15; P=0.002), and SCC (239,261±92,264.3cells/mL; P=0.03). Cows of the VWHKH x VWHRR haplotype combination displayed responses to challenge statistically comparable to other haplotype combinations, but appeared to have an earlier peak in SCC in comparison to all other haplotype combinations. Haplotype combination did not influence milk yield (P=0.6). Our results suggest using combinations of the SNPs within the CXCR1 gene gives a better indication of a cow's ability to combat S

  4. Mendel-GPU: haplotyping and genotype imputation on graphics processing units

    PubMed Central

    Chen, Gary K.; Wang, Kai; Stram, Alex H.; Sobel, Eric M.; Lange, Kenneth

    2012-01-01

    Motivation: In modern sequencing studies, one can improve the confidence of genotype calls by phasing haplotypes using information from an external reference panel of fully typed unrelated individuals. However, the computational demands are so high that they prohibit researchers with limited computational resources from haplotyping large-scale sequence data. Results: Our graphics processing unit based software delivers haplotyping and imputation accuracies comparable to competing programs at a fraction of the computational cost and peak memory demand. Availability: Mendel-GPU, our OpenCL software, runs on Linux platforms and is portable across AMD and nVidia GPUs. Users can download both code and documentation at http://code.google.com/p/mendel-gpu/. Contact: gary.k.chen@usc.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22954633

  5. The prognostic impact of germline 46/1 haplotype of Janus kinase 2 in cytogenetically normal acute myeloid leukemia

    PubMed Central

    Nahajevszky, Sarolta; Andrikovics, Hajnalka; Batai, Arpad; Adam, Emma; Bors, Andras; Csomor, Judit; Gopcsa, Laszlo; Koszarska, Magdalena; Kozma, Andras; Lovas, Nora; Lueff, Sandor; Matrai, Zoltan; Meggyesi, Nora; Sinko, Janos; Sipos, Andrea; Varkonyi, Andrea; Fekete, Sandor; Tordai, Attila; Masszi, Tamas

    2011-01-01

    Background Prognostic risk stratification according to acquired or inherited genetic alterations has received increasing attention in acute myeloid leukemia in recent years. A germline Janus kinase 2 haplotype designated as the 46/1 haplotype has been reported to be associated with an inherited predisposition to myeloproliferative neoplasms, and also to acute myeloid leukemia with normal karyotype. The aim of this study was to assess the prognostic impact of the 46/1 haplotype on disease characteristics and treatment outcome in acute myeloid leukemia. Design and Methods Janus kinase 2 rs12343867 single nucleotide polymorphism tagging the 46/1 haplotype was genotyped by LightCycler technology applying melting curve analysis with the hybridization probe detection format in 176 patients with acute myeloid leukemia under 60 years diagnosed consecutively and treated with curative intent. Results The morphological subtype of acute myeloid leukemia with maturation was less frequent among 46/1 carriers than among non-carriers (5.6% versus 17.2%, P=0.018, cytogenetically normal subgroup: 4.3% versus 20.6%, P=0.031), while the morphological distribution shifted towards the myelomonocytoid form in 46/1 haplotype carriers (28.1% versus 14.9%, P=0.044, cytogenetically normal subgroup: 34.0% versus 11.8%, P=0.035). In cytogenetically normal cases of acute myeloid leukemia, the 46/1 carriers had a considerably lower remission rate (78.7% versus 94.1%, P=0.064) and more deaths in remission or in aplasia caused by infections (46.8% versus 23.5%, P=0.038), resulting in the 46/1 carriers having shorter disease-free survival and overall survival compared to the 46/1 non-carriers. In multivariate analysis, the 46/1 haplotype was an independent adverse prognostic factor for disease-free survival (P=0.024) and overall survival (P=0.024) in patients with a normal karyotype. Janus kinase 2 46/1 haplotype had no impact on prognosis in the subgroup with abnormal karyotype. Conclusions Janus

  6. JAK2 haplotype is a major risk factor for the development of myeloproliferative neoplasms

    PubMed Central

    Jones, Amy V; Chase, Andrew; Silver, Richard T; Oscier, David; Zoi, Katerina; Wang, Y Lynn; Cario, Holger; Pahl, Heike L; Collins, Andrew; Reiter, Andreas; Grand, Francis; Cross, Nicholas C P

    2014-01-01

    Chronic myeloproliferative neoplasms (MPNs) are a group of related conditions characterized by the overproduction of cells from one or more myeloid lineages. More than 95% of cases of polycythemia vera, and roughly half of essential thrombocythemia and primary myelofibrosis acquire a unique somatic 1849G>T JAK2 mutation (encoding V617F) that is believed to be a critical driver of excess proliferation1–4. We report here that JAK2V617F-associated disease is strongly associated with a specific constitutional JAK2 haplotype, designated 46/1, in all three disease entities compared to healthy controls (polycythemia vera, n = 192, P = 2.9 × 10−16; essential thrombocythemia, n = 78, P = 8.2 × 10−9 and myelofibrosis, n = 41, P = 8.0 × 10−5). Furthermore, JAK2V617F specifically arises on the 46/1 allele in most cases. The 46/1 JAK2 haplotype thus predisposes to the development of JAK2V617F-associated MPNs (OR = 3.7; 95% CI = 3.1–4.3) and provides a model whereby a constitutional genetic factor is associated with an increased risk of acquiring a specific somatic mutation. PMID:19287382

  7. Complement factor H gene (CFH) polymorphisms C-257T, G257A and haplotypes are associated with protection against severe dengue phenotype, possible related with high CFH expression

    PubMed Central

    Pastor, André F.; Moura, Laís Rodrigues; Neto, José W.D.; Nascimento, Eduardo J.M.; Calzavara-Silva, Carlos E.; Gomes, Ana Lisa V.; da Silva, Ana Maria; Cordeiro, Marli T.; Braga-Neto, Ulisses; Crovella, Sergio; Gil, Laura H.V.G.; Marques, Ernesto T.A.; Acioli-Santos, Bartolomeu

    2013-01-01

    Four genetic polymorphisms located at the promoter (C-257T) and coding regions of CFH gene (exon 2 G257A, exon 14 A2089G and exon 19 G2881T) were investigated in 121 dengue patients (DENV-3) in order to assess the relationship between allele/haplotypes variants and clinical outcomes. A statistical value was found between the CFH-257T allele (TT/TC genotypes) and reduced susceptibility to severe dengue (SD). Statistical associations indicate that individuals bearing a T allele presented significantly higher protein levels in plasma. The –257T variant is located within a NF-κB binding site, suggesting that this variant might have effect on the ability of the CFH gene to respond to signals via the NF-κB pathway. The G257A allelic variant showed significant protection against severe dengue. When CFH haplotypes effect was considered, the ancestral CG/CG promoter-exon 2 SNP genotype showed significant risk to SD either in a general comparison (ancestral × all variant genotypes), as well as in individual genotypes comparison (ancestral × each variant genotype), where the most prevalent effect was observed in the CG/CG × CA/TG comparison. These findings support the involvement of –257T, 257A allele variants and haplotypes on severe dengue phenotype protection, related with high basal CFH expression. PMID:23747994

  8. Abdominal obesity and hyperglycemia mask the effect of a common APOC3 haplotype on the risk of myocardial infarction123

    PubMed Central

    Ruiz-Narváez, Edward A; Sacks, Frank M; Campos, Hannia

    2013-01-01

    Background Plasma apolipoprotein (apo) C-III strongly predicts myocardial infarction (MI) and directly activates atherogenic processes invascularcells.Geneticvariationintheinsulinresponseelementofthe APOC3 promoter is associated with an increased risk of MI. Objective The objective was to determine whether the APOC3 promoter variation affects plasma apo C-III concentrations and MI only when insulin sensitivity is normal. Design TheAPOC3*222haplotype,definedbytheminorallelesofthe single nucleotide polymorphisms 3238C→G, –455T→C, and –482C→T, was studied in 1703 matched nonfatal case-control pairs with MI in the Central Valley of Costa Rica. We used fasting hyper-glycemia and abdominal obesity as surrogates for insulin sensitivity. Results The APOC3*222 haplotype was associated with higher apo C-III concentrations only in those with the lowest waist circumference or fasting glucose concentration. The association between the APOC3*222 haplotype and nonfatal MI, previously reported in this population, was strongly influenced by fasting hyperglycemia and abdominal obesity. The odds ratios for MI for the APOC3*222 haplotype were 1.72 (95% CI: 1.16, 2.54) and 1.84 (1.31, 2.59) in subjects in the lowest quintiles of abdominal obesity and fasting hyperglycemia, respectively, and were 0.75 (0.54, 1.05) and 1.16 (0.85, 1.59) in subjects in the highest quintiles, respectively (P for interaction <0.05). Conclusion The results support the concept that mutations in the APOC3 promoter inhibit the down-regulation of APOC3 expression by insulin. This cardioprotective system becomes dysfunctional in abdominal obesity and hyperglycemia. PMID:18541587

  9. Abdominal obesity and hyperglycemia mask the effect of a common APOC3 haplotype on the risk of myocardial infarction.

    PubMed

    Ruiz-Narváez, Edward A; Sacks, Frank M; Campos, Hannia

    2008-06-01

    Plasma apolipoprotein (apo) C-III strongly predicts myocardial infarction (MI) and directly activates atherogenic processes in vascular cells. Genetic variation in the insulin response element of the APOC3 promoter is associated with an increased risk of MI. The objective was to determine whether the APOC3 promoter variation affects plasma apo C-III concentrations and MI only when insulin sensitivity is normal. The APOC3*222 haplotype, defined by the minor alleles of the single nucleotide polymorphisms 3238C-->G, -455T-->C, and -482C-->T, was studied in 1703 matched nonfatal case-control pairs with MI in the Central Valley of Costa Rica. We used fasting hyperglycemia and abdominal obesity as surrogates for insulin sensitivity. The APOC3*222 haplotype was associated with higher apo C-III concentrations only in those with the lowest waist circumference or fasting glucose concentration. The association between the APOC3*222 haplotype and nonfatal MI, previously reported in this population, was strongly influenced by fasting hyperglycemia and abdominal obesity. The odds ratios for MI for the APOC3*222 haplotype were 1.72 (95% CI: 1.16, 2.54) and 1.84 (1.31, 2.59) in subjects in the lowest quintiles of abdominal obesity and fasting hyperglycemia, respectively, and were 0.75 (0.54, 1.05) and 1.16 (0.85, 1.59) in subjects in the highest quintiles, respectively (P for interaction <0.05). The results support the concept that mutations in the APOC3 promoter inhibit the down-regulation of APOC3 expression by insulin. This cardioprotective system becomes dysfunctional in abdominal obesity and hyperglycemia.

  10. Effects of apolipoprotein A5 haplotypes on the ratio of triglyceride to high-density lipoprotein cholesterol and the risk for metabolic syndrome in Koreans

    PubMed Central

    2014-01-01

    Background Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. Methods The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). Results The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C–G–A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. Conclusions We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS. PMID:24618354

  11. "HOOF-Print" Genotyping and Haplotype Inference Discriminates among Brucella spp Isolates From a Small Spatial Scale

    USDA-ARS?s Scientific Manuscript database

    We demonstrate that the “HOOF-Print” assay provides high power to discriminate among Brucella isolates collected on a small spatial scale (within Portugal). Additionally, we illustrate how haplotype identification using non-random association among markers allows resolution of B. melitensis biovars ...

  12. Lack of haplotype structuring for two candidate genes for trypanotolerance in cattle.

    PubMed

    Álvarez, I; Pérez-Pardal, L; Traoré, A; Fernández, I; Goyache, F

    2016-04-01

    Bovine trypanotolerance is a heritable trait associated to the ability of the individuals to control parasitaemia and anaemia. The INHBA (BTA4) and TICAM1 (BTA7) genes are strong candidates for trypanotolerance-related traits. The coding sequence of both genes (3951 bp in total) were analysed in a panel including 79 Asian, African and European cattle (Bos taurus and B. indicus) to identify naturally occurring polymorphisms on both genes. In general, the genetic diversity was low. Nineteen of the 33 mutations identified were found just one time. Seventeen different haplotypes were defined for the TICAM1 gene, and 9 and 12 were defined for the exon 1 and the exon 2 of the INHBA gene, respectively. There was no clear separation between cattle groups. The most frequent haplotypes identified in West African taurine samples were also identified in other cattle groups including Asian zebu and European cattle. Phylogenetic trees and principal component analysis confirmed that divergence among the cattle groups analysed was poor, particularly for the INHBA sequences. The European cattle subset had the lowest values of haplotype diversity for both the exon1 (monomorphic) and the exon2 (0.077 ± 0.066) of the INHBA gene. Neutrality tests, in general, did not suggest that the analysed genes were under positive selection. The assessed scenario would be consistent with the identification of recent mutations in evolutionary terms. © 2015 Blackwell Verlag GmbH.

  13. The analysis of APOL1 genetic variation and haplotype diversity provided by 1000 Genomes project.

    PubMed

    Peng, Ting; Wang, Li; Li, Guisen

    2017-08-11

    The APOL1 gene variants has been shown to be associated with an increased risk of multiple kinds of diseases, particularly in African Americans, but not in Caucasians and Asians. In this study, we explored the single nucleotide polymorphism (SNP) and haplotype diversity of APOL1 gene in different races provided by 1000 Genomes project. Variants of APOL1 gene in 1000 Genome Project were obtained and SNPs located in the regulatory region or coding region were selected for genetic variation analysis. Total 2504 individuals from 26 populations were classified as four groups that included Africa, Europe, Asia and Admixed populations. Tag SNPs were selected to evaluate the haplotype diversities in the four populations by HaploStats software. APOL1 gene was surrounded by some of the most polymorphic genes in the human genome, variation of APOL1 gene was common, with up to 613 SNP (1000 Genome Project reported) and 99 of them (16.2%) with MAF ≥ 1%. There were 79 SNPs in the URR and 92 SNPs in 3'UTR. Total 12 SNPs in URR and 24 SNPs in 3'UTR were considered as common variants with MAF ≥ 1%. It is worth noting that URR-1 was presents lower frequencies in European populations, while other three haplotypes taken an opposite pattern; 3'UTR presents several high-frequency variation sites in a short segment, and the differences of its haplotypes among different population were significant (P < 0.01), UTR-1 and UTR-5 presented much higher frequency in African population, while UTR-2, UTR-3 and UTR-4 were much lower. APOL1 coding region showed that two SNP of G1 with higher frequency are actually pull down the haplotype H-1 frequency when considering all populations pooled together, and the diversity among the four populations be widen by the G1 two mutation (P 1  = 3.33E-4 vs P 2  = 3.61E-30). The distributions of APOL1 gene variants and haplotypes were significantly different among the different populations, in either regulatory or coding regions. It could provide

  14. Endurance exercise training effects on body fatness, VO2max, HDL-C subfractions, and glucose tolerance are influenced by a PLIN haplotype in older Caucasians.

    PubMed

    Jenkins, Nathan T; McKenzie, Jennifer A; Damcott, Coleen M; Witkowski, Sarah; Hagberg, James M

    2010-03-01

    Perilipins are lipid droplet-coating proteins that regulate intracellular lipolysis in adipocytes. A haplotype of two perilipin gene (PLIN) single nucleotide polymorphisms, 13041A>G and 14995A>T, has been previously associated with obesity risk. Furthermore, the available data indicate that this association may be modified by sex. We hypothesized that this haplotype would associate with body fatness, aerobic fitness, and a number of cardiovascular (CV) risk factor phenotypes before and after a 6-mo endurance exercise training program in sedentary older Caucasians. The major haplotype group (13041A/14995A; n = 57) had significantly lower body mass index (BMI) and body fatness compared with noncarriers of the AA haplotype (n = 44) before the training intervention. Training improved body composition in both groups, but fatness remained higher in noncarriers than AA carriers after training. This fat retention in noncarriers blunted their maximal oxygen uptake (Vo(2 max)) adaptation to training. Female noncarriers had substantially higher concentrations of several conventionally and NMR-measured HDL-C subfractions than male noncarriers before and after training, but only minimal differences were found between the sexes in the AA haplotype group. Haplotype group differences in baseline and after-training responses to an oral glucose tolerance test (OGTT) also differed by sex, as noncarrier men had the highest baseline area under the insulin curve (insulin AUC), but were the only group to significantly improve insulin AUC with training. The insulin sensitivity index and plasma glucose responses to the OGTT were more favorable in AA carriers than noncarriers before and after training. Overall, our findings suggest that PLIN variation explains some of the interindividual differences in the response of obesity and CV phenotypes to exercise training. Furthermore, these data contribute to the growing understanding of PLIN as a candidate gene for human obesity and the

  15. The HLA-DRB9 gene and the origin of HLA-DR haplotypes.

    PubMed

    Gongora, R; Figueroa, F; Klein, J

    1996-11-01

    HLA-DRB9 is a gene fragment consisting of exon 2 and flanking intron sequences. It is located at the extreme end of the DRB subregion, whose other end is demarcated by the DRB1 locus. We sequenced approximately 1400 base pairs of the segment encompassing the DRB9 locus from eight human haplotypes (DR1, DR10, DR2, DR3, DR5, DR6, DR8, and DR9, the DR4 and DR7 having been sequenced by others earlier), as well as two chimpanzee, five gorillas, one orangutan and one macaque haplotype. The analysis of these sequences indicates that the DRB9 locus, which we estimate to be more than 58 million years (my) old, has been coevolving with the DRB1 locus for the last 4.2 my. As a consequence of this coevolution, the human DRB9 alleles fall into groups that correlate with the DRB1 allelic groups and with the gene organization of the human haplotypes. This observation implies that the present-day HLA-DR haplotype groups (DR1, DR51, DR52, DR8, and DR53) were founded more than 4 my ago and have remained intact (barring minor internal rearrangements that did not recombine the DRB1 and DRB9 genes) for this period of time. The haplotypes have been transmitted during speciations from ancestral to emerging species just like allelic lineages at the DRB1 locus. Thus not only allelic but also haplotype polymorphism evolves trans-specifically.

  16. Genomic rearrangements and signatures of breeding in the allo-octoploid strawberry as revealed through an allele dose based SSR linkage map

    PubMed Central

    2014-01-01

    Background Breeders in the allo-octoploid strawberry currently make little use of molecular marker tools. As a first step of a QTL discovery project on fruit quality traits and resistance to soil-borne pathogens such as Phytophthora cactorum and Verticillium we built a genome-wide SSR linkage map for the cross Holiday x Korona. We used the previously published MADCE method to obtain full haplotype information for both of the parental cultivars, facilitating in-depth studies on their genomic organisation. Results The linkage map incorporates 508 segregating loci and represents each of the 28 chromosome pairs of octoploid strawberry, spanning an estimated length of 2050 cM. The sub-genomes are denoted according to their sequence divergence from F. vesca as revealed by marker performance. The map revealed high overall synteny between the sub-genomes, but also revealed two large inversions on LG2C and LG2D, of which the latter was confirmed using a separate mapping population. We discovered interesting breeding features within the parental cultivars by in-depth analysis of our haplotype data. The linkage map-derived homozygosity level of Holiday was similar to the pedigree-derived inbreeding level (33% and 29%, respectively). For Korona we found that the observed homozygosity level was over three times higher than expected from the pedigree (13% versus 3.6%). This could indicate selection pressure on genes that have favourable effects in homozygous states. The level of kinship between Holiday and Korona derived from our linkage map was 2.5 times higher than the pedigree-derived value. This large difference could be evidence of selection pressure enacted by strawberry breeders towards specific haplotypes. Conclusion The obtained SSR linkage map provides a good base for QTL discovery. It also provides the first biologically relevant basis for the discernment and notation of sub-genomes. For the first time, we revealed genomic rearrangements that were verified in a

  17. Genomic rearrangements and signatures of breeding in the allo-octoploid strawberry as revealed through an allele dose based SSR linkage map.

    PubMed

    van Dijk, Thijs; Pagliarani, Giulia; Pikunova, Anna; Noordijk, Yolanda; Yilmaz-Temel, Hulya; Meulenbroek, Bert; Visser, Richard G F; van de Weg, Eric

    2014-03-01

    Breeders in the allo-octoploid strawberry currently make little use of molecular marker tools. As a first step of a QTL discovery project on fruit quality traits and resistance to soil-borne pathogens such as Phytophthora cactorum and Verticillium we built a genome-wide SSR linkage map for the cross Holiday x Korona. We used the previously published MADCE method to obtain full haplotype information for both of the parental cultivars, facilitating in-depth studies on their genomic organisation. The linkage map incorporates 508 segregating loci and represents each of the 28 chromosome pairs of octoploid strawberry, spanning an estimated length of 2050 cM. The sub-genomes are denoted according to their sequence divergence from F. vesca as revealed by marker performance. The map revealed high overall synteny between the sub-genomes, but also revealed two large inversions on LG2C and LG2D, of which the latter was confirmed using a separate mapping population. We discovered interesting breeding features within the parental cultivars by in-depth analysis of our haplotype data. The linkage map-derived homozygosity level of Holiday was similar to the pedigree-derived inbreeding level (33% and 29%, respectively). For Korona we found that the observed homozygosity level was over three times higher than expected from the pedigree (13% versus 3.6%). This could indicate selection pressure on genes that have favourable effects in homozygous states. The level of kinship between Holiday and Korona derived from our linkage map was 2.5 times higher than the pedigree-derived value. This large difference could be evidence of selection pressure enacted by strawberry breeders towards specific haplotypes. The obtained SSR linkage map provides a good base for QTL discovery. It also provides the first biologically relevant basis for the discernment and notation of sub-genomes. For the first time, we revealed genomic rearrangements that were verified in a separate mapping population. We

  18. Mapping asthma-associated variants in admixed populations

    PubMed Central

    Mersha, Tesfaye B.

    2015-01-01

    Admixed populations arise when two or more previously isolated populations interbreed. Mapping asthma susceptibility loci in an admixed population using admixture mapping (AM) involves screening the genome of individuals of mixed ancestry for chromosomal regions that have a higher frequency of alleles from a parental population with higher asthma risk as compared with parental population with lower asthma risk. AM takes advantage of the admixture created in populations of mixed ancestry to identify genomic regions where an association exists between genetic ancestry and asthma (in contrast to between the genotype of the marker and asthma). The theory behind AM is that chromosomal segments of affected individuals contain a significantly higher-than-average proportion of alleles from the high-risk parental population and thus are more likely to harbor disease–associated loci. Criteria to evaluate the applicability of AM as a gene mapping approach include: (1) the prevalence of the disease differences in ancestral populations from which the admixed population was formed; (2) a measurable difference in disease-causing alleles between the parental populations; (3) reduced linkage disequilibrium (LD) between unlinked loci across chromosomes and strong LD between neighboring loci; (4) a set of markers with noticeable allele-frequency differences between parental populations that contributes to the admixed population (single nucleotide polymorphisms (SNPs) are the markers of choice because they are abundant, stable, relatively cheap to genotype, and informative with regard to the LD structure of chromosomal segments); and (5) there is an understanding of the extent of segmental chromosomal admixtures and their interactions with environmental factors. Although genome-wide association studies have contributed greatly to our understanding of the genetic components of asthma, the large and increasing degree of admixture in populations across the world create many challenges

  19. H1 tau haplotype-related genomic variation at 17q21.3 as an Asian heritage of the European Gypsy population.

    PubMed

    Almos, P Z; Horváth, S; Czibula, A; Raskó, I; Sipos, B; Bihari, P; Béres, J; Juhász, A; Janka, Z; Kálmán, J

    2008-11-01

    In this study, we examine the frequency of a 900 kb inversion at 17q21.3 in the Gypsy and Caucasian populations of Hungary, which may reflect the Asian origin of Gypsy populations. Of the two haplotypes (H1 and H2), H2 is thought to be exclusively of Caucasian origin, and its occurrence in other racial groups is likely to reflect admixture. In our sample, the H1 haplotype was significantly more frequent in the Gypsy population (89.8 vs 75.5%, P<0.001) and was in Hardy-Weinberg disequilibrium (P=0.017). The 17q21.3 region includes the gene of microtubule-associated protein tau, and this result might imply higher sensitivity to H1 haplotype-related multifactorial tauopathies among Gypsies.

  20. β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil.

    PubMed

    Dos Santos Silva, Wellington; de Nazaré Klautau-Guimarães, Maria; Grisolia, Cesar Koppe

    2010-07-01

    Five restriction site polymorphisms in the β-globin gene cluster (HincII-5' ε, HindIII-(G) γ, HindIII-(A) γ, HincII- ψβ1 and HincII-3' ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the β(A) chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.

  1. β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil

    PubMed Central

    2010-01-01

    Five restriction site polymorphisms in the β-globin gene cluster (HincII-5‘ ε, HindIII-G γ, HindIII-A γ, HincII- ψβ1 and HincII-3‘ ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the “quilombo community”, from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the βA chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil. PMID:21637405

  2. Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana).

    PubMed

    Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila

    2010-07-16

    Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A

  3. Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana)

    PubMed Central

    2010-01-01

    Background Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Results Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M

  4. Association of the oxytocin receptor gene (OXTR) in Caucasian children and adolescents with autism.

    PubMed

    Jacob, Suma; Brune, Camille W; Carter, C S; Leventhal, Bennett L; Lord, Catherine; Cook, Edwin H

    2007-04-24

    The oxytocin receptor gene (OXTR) has been studied in autism because of the role of oxytocin (OT) in social cognition. Linkage has also been demonstrated to the region of OXTR in a large sample. Two single nucleotide polymorphisms (SNPs) and a haplotype constructed from them in OXTR have been associated with autism in the Chinese Han population. We tested whether these associations replicated in a Caucasian sample with strictly defined autistic disorder. We genotyped the two previously associated SNPs (rs2254298, rs53576) in 57 Caucasian autism trios. Probands met clinical, ADI-R, and ADOS criteria for autistic disorder. Significant association was detected at rs2254298 (p=0.03) but not rs53576. For rs2254298, overtransmission of the G allele to probands with autistic disorder was found which contrasts with the overtransmission of A previously reported in the Chinese Han sample. In both samples, G was more frequent than A. However, in our Caucasian autism trios and the CEU Caucasian HapMap samples the frequency of A was less than that reported in the Chinese Han and Chinese in Bejing HapMap samples. The haplotype test of association did not reveal excess transmission from parents to affected offspring. These findings provide support for association of OXTR with autism in a Caucasian population. Overtransmission of different alleles in different populations may be due to a different pattern of linkage disequilibrium between the marker rs2254298 and an as yet undetermined susceptibility variant in OXTR.

  5. Cluster analysis of European Y-chromosomal STR haplotypes using the discrete Laplace method.

    PubMed

    Andersen, Mikkel Meyer; Eriksen, Poul Svante; Morling, Niels

    2014-07-01

    The European Y-chromosomal short tandem repeat (STR) haplotype distribution has previously been analysed in various ways. Here, we introduce a new way of analysing population substructure using a new method based on clustering within the discrete Laplace exponential family that models the probability distribution of the Y-STR haplotypes. Creating a consistent statistical model of the haplotypes enables us to perform a wide range of analyses. Previously, haplotype frequency estimation using the discrete Laplace method has been validated. In this paper we investigate how the discrete Laplace method can be used for cluster analysis to further validate the discrete Laplace method. A very important practical fact is that the calculations can be performed on a normal computer. We identified two sub-clusters of the Eastern and Western European Y-STR haplotypes similar to results of previous studies. We also compared pairwise distances (between geographically separated samples) with those obtained using the AMOVA method and found good agreement. Further analyses that are impossible with AMOVA were made using the discrete Laplace method: analysis of the homogeneity in two different ways and calculating marginal STR distributions. We found that the Y-STR haplotypes from e.g. Finland were relatively homogeneous as opposed to the relatively heterogeneous Y-STR haplotypes from e.g. Lublin, Eastern Poland and Berlin, Germany. We demonstrated that the observed distributions of alleles at each locus were similar to the expected ones. We also compared pairwise distances between geographically separated samples from Africa with those obtained using the AMOVA method and found good agreement. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  6. Three Novel Haplotypes of Theileria bicornis in Black and White Rhinoceros in Kenya.

    PubMed

    Otiende, M Y; Kivata, M W; Jowers, M J; Makumi, J N; Runo, S; Obanda, V; Gakuya, F; Mutinda, M; Kariuki, L; Alasaad, S

    2016-02-01

    Piroplasms, especially those in the genera Babesia and Theileria, have been found to naturally infect rhinoceros. Due to natural or human-induced stress factors such as capture and translocations, animals often develop fatal clinical piroplasmosis, which causes death if not treated. This study examines the genetic diversity and occurrence of novel Theileria species infecting both black and white rhinoceros in Kenya. Samples collected opportunistically during routine translocations and clinical interventions from 15 rhinoceros were analysed by polymerase chain reaction (PCR) using a nested amplification of the small subunit ribosomal RNA (18S rRNA) gene fragments of Babesia and Theileria. Our study revealed for the first time in Kenya the presence of Theileria bicornis in white (Ceratotherium simum simum) and black (Diceros bicornis michaeli) rhinoceros and the existence of three new haplotypes: haplotypes H1 and H3 were present in white rhinoceros, while H2 was present in black rhinoceros. No specific haplotype was correlated to any specific geographical location. The Bayesian inference 50% consensus phylogram recovered the three haplotypes monophyleticly, and Theileria bicornis had very high support (BPP: 0.98). Furthermore, the genetic p-uncorrected distances and substitutions between T. bicornis and the three haplotypes were the same in all three haplotypes, indicating a very close genetic affinity. This is the first report of the occurrence of Theileria species in white and black rhinoceros from Kenya. The three new haplotypes reported here for the first time have important ecological and conservational implications, especially for population management and translocation programs and as a means of avoiding the transport of infected animals into non-affected areas. © 2014 Blackwell Verlag GmbH.

  7. Intricacies in arrangement of SNP haplotypes suggest "Great Admixture" that created modern humans.

    PubMed

    Dutta, Rajib; Mainsah, Joseph; Yatskiv, Yuriy; Chakrabortty, Sharmistha; Brennan, Patrick; Khuder, Basil; Qiu, Shuhao; Fedorova, Larisa; Fedorov, Alexei

    2017-06-05

    Inferring history from genomic sequences is challenging and problematic because chromosomes are mosaics of thousands of small Identicalby-descent (IBD) fragments, each of them having their own unique story. However, the main events in recent evolution might be deciphered from comparative analysis of numerous loci. A paradox of why humans, whose effective population size is only 10 4 , have nearly three million frequent SNPs is formulated and examined. We studied 5398 loci evenly covering all human autosomes. Common haplotypes built from frequent SNPs that are present in people from various populations have been examined. We demonstrated highly non-random arrangement of alleles in common haplotypes. Abundance of mutually exclusive pairs of common haplotypes that have different alleles at every polymorphic position (so-called Yin/Yang haplotypes) was found in 56% of loci. A novel widely spread category of common haplotypes named Mosaic has been described. Mosaic consists of numerous pieces of Yin/Yang haplotypes and represents an ancestral stage of one of them. Scenarios of possible appearance of large number of frequent human SNPs and their habitual arrangement in Yin/Yang common haplotypes have been evaluated with an advanced genomic simulation algorithm. Computer modeling demonstrated that the observed arrangement of 2.9 million frequent SNPs could not originate from a sole stand-alone population. A "Great Admixture" event has been proposed that can explain peculiarities with frequent SNP distributions. This Great Admixture presumably occurred 100-300 thousand years ago between two ancestral populations that had been separated from each other about a million years ago. Our programs and algorithms can be applied to other species to perform evolutionary and comparative genomics.

  8. Polymorphisms and haplotypes of the interleukin 2 gene are associated with an increased risk of gastric cancer. The possible involvement of Helicobacter pylori.

    PubMed

    Melchiades, Jessica L; Zabaglia, Luanna M; Sallas, Mayara L; Orcini, Wilson A; Chen, Elizabeth; Smith, Marilia A C; Payão, Spencer L M; Rasmussen, Lucas T

    2017-08-01

    , a high risk was found in subjects carrying the +114 TT genotype (OR=6.36, 95% CI: 2.66-15.21, p<0.0001). The haplotype was also analyzed. The -330G/+114T haplotype was found to be significantly associated with gastric cancer. Therefore, our results show that, among patients with H. pylori infection, the -330 GG and +114 TT genotypes are significantly associated with a high risk of developing gastric cancer, as is the -330G/+114T haplotype. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Massively parallel haplotyping on microscopic beads for the high-throughput phase analysis of single molecules.

    PubMed

    Boulanger, Jérôme; Muresan, Leila; Tiemann-Boege, Irene

    2012-01-01

    In spite of the many advances in haplotyping methods, it is still very difficult to characterize rare haplotypes in tissues and different environmental samples or to accurately assess the haplotype diversity in large mixtures. This would require a haplotyping method capable of analyzing the phase of single molecules with an unprecedented throughput. Here we describe such a haplotyping method capable of analyzing in parallel hundreds of thousands single molecules in one experiment. In this method, multiple PCR reactions amplify different polymorphic regions of a single DNA molecule on a magnetic bead compartmentalized in an emulsion drop. The allelic states of the amplified polymorphisms are identified with fluorescently labeled probes that are then decoded from images taken of the arrayed beads by a microscope. This method can evaluate the phase of up to 3 polymorphisms separated by up to 5 kilobases in hundreds of thousands single molecules. We tested the sensitivity of the method by measuring the number of mutant haplotypes synthesized by four different commercially available enzymes: Phusion, Platinum Taq, Titanium Taq, and Phire. The digital nature of the method makes it highly sensitive to detecting haplotype ratios of less than 1:10,000. We also accurately quantified chimera formation during the exponential phase of PCR by different DNA polymerases.

  10. MICA and MICB microsatellite alleles in HLA extended haplotypes.

    PubMed

    Bolognesi, E; Dalfonso, S; Rolando, V; Fasano, M E; Praticò, L; Momigliano-Richiardi, P

    2001-10-01

    The present study is a contribution to the definition of the linkage disequilibrium relationship of MICA and MICB with adjacent loci and to the characterization of extended HLA haplotypes. These issues are of importance for the identification of disease associations and for a better definition of donor-recipient compatibility in bone-marrow grafts through the typing of haplospecific markers. The distribution of the five alleles of MICA and the 13 alleles of MICB microsatellites, located, respectively, in MICA transmembrane exon 5 and in MICB intron 1, was examined in 133 healthy Italian individuals previously typed for HLA class I, class II and complement loci and for the TNFa microsatellite. The MICB microsatellite was also analysed in 49 HTCLs for which MICA typing was already available. Very strong linkage disequilibria with HLA-B and TNFa were detected in the Italian population for both MICA and MICB microsatellite alleles, in spite of the high mutability rate of the larger MICB alleles. Some strong associations were also detected between MICB and DRB1. The strongest associations (P < 0.001, D' > 0.7) were those of MICA-A4 with HLA-B18, B27 and TNFa1, MICA-A5 with HLA-B35, B61 and B62, MICA-A5.1 with HLA-B7, B8, B13, B63 and MICB-CA24, MICA-A6 with HLA-B51, MICA-A9 with HLA-B39, B57 and TNFa2, MICB-CA14 with HLA-B14, B27 and TNFa1, MICB-CA15 with HLA-B52, TNFa4 and TNFa13, MICB-CA17 with HLA-B7 and TNFa11, MICB-CA18 with HLA-B13 and TNFa7, MICB-CA22 with HLA-B57, and MICB-CA24 with HLA-B8 and TNFa2. From pairwise associations in the random panel and results for the homozygous cell lines it was possible to deduce the MICA and MICB microsatellite alleles present in many of the well-known Caucasoid extended haplotypes.

  11. Identification of a functional enhancer variant within the chronic pancreatitis-associated SPINK1 c.101A>G (p.Asn34Ser)-containing haplotype.

    PubMed

    Boulling, Arnaud; Masson, Emmanuelle; Zou, Wen-Bin; Paliwal, Sumit; Wu, Hao; Issarapu, Prachand; Bhaskar, Seema; Génin, Emmanuelle; Cooper, David N; Li, Zhao-Shen; Chandak, Giriraj R; Liao, Zhuan; Chen, Jian-Min; Férec, Claude

    2017-08-01

    The haplotype harboring the SPINK1 c.101A>G (p.Asn34Ser) variant (also known as rs17107315:T>C) represents the most important heritable risk factor for idiopathic chronic pancreatitis identified to date. The causal variant contained within this risk haplotype has however remained stubbornly elusive. Herein, we set out to resolve this enigma by employing a hypothesis-driven approach. First, we searched for variants in strong linkage disequilibrium (LD) with rs17107315:T>C using HaploReg v4.1. Second, we identified two candidate SNPs by visual inspection of sequences spanning all 25 SNPs found to be in LD with rs17107315:T>C, guided by prior knowledge of pancreas-specific transcription factors and their cognate binding sites. Third, employing a novel cis-regulatory module (CRM)-guided approach to further filter the two candidate SNPs yielded a solitary candidate causal variant. Finally, combining data from phylogenetic conservation and chromatin accessibility, cotransfection transactivation experiments, and population genetic studies, we suggest that rs142703147:C>A, which disrupts a PTF1L-binding site within an evolutionarily conserved HNF1A-PTF1L CRM located ∼4 kb upstream of the SPINK1 promoter, contributes to the aforementioned chronic pancreatitis risk haplotype. Further studies are required not only to improve the characterization of this functional SNP but also to identify other functional components that might contribute to this high-risk haplotype. © 2017 Wiley Periodicals, Inc.

  12. Antioxidant activity of yogurt made from milk characterized by different casein haplotypes and fortified with chestnut and sulla honeys.

    PubMed

    Perna, Annamaria; Intaglietta, Immacolata; Simonetti, Amalia; Gambacorta, Emilio

    2014-11-01

    The aim of this work was to evaluate the antioxidant activity of yogurt made from milk characterized by different casein (CN) haplotypes (αs1-, β-, κ-CN) and fortified with chestnut and sulla honeys. The CN haplotype was determined by isoelectric focusing, whereas antioxidant activity of yogurt was measured using 2,2'-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid and ferric-reducing antioxidant power. The statistical analysis showed a significant effect of the studied factors. The results showed that chestnut honey presented the highest phenolic acid and flavonoid contents, which are closely associated with its high antioxidant activity. The antioxidant activity of fortified yogurt samples was affected both by different CN haplotypes and by type of honey added. Yogurts fortified with chestnut honey showed higher antioxidant activity than those fortified with sulla honey. The different behavior observed among the fortified yogurts led us to hypothesize that the effects of protein-polyphenol complex on antioxidant activity are interactive. The results suggest that milk proteins polymorphism and polyphenols play different roles in affecting the bioavailability and the antioxidant activity of yogurt. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Compound Heterozygosity for Null Mutations and a Common Hypomorphic Risk Haplotype in TBX6 Causes Congenital Scoliosis.

    PubMed

    Takeda, Kazuki; Kou, Ikuyo; Kawakami, Noriaki; Iida, Aritoshi; Nakajima, Masahiro; Ogura, Yoji; Imagawa, Eri; Miyake, Noriko; Matsumoto, Naomichi; Yasuhiko, Yukuto; Sudo, Hideki; Kotani, Toshiaki; Nakamura, Masaya; Matsumoto, Morio; Watanabe, Kota; Ikegawa, Shiro

    2017-03-01

    Congenital scoliosis (CS) occurs as a result of vertebral malformations and has an incidence of 0.5-1/1,000 births. Recently, TBX6 on chromosome 16p11.2 was reported as a disease gene for CS; about 10% of Chinese CS patients were compound heterozygotes for rare null mutations and a common haplotype defined by three SNPs in TBX6. All patients had hemivertebrae. We recruited 94 Japanese CS patients, investigated the TBX6 locus for both mutations and the risk haplotype, examined transcriptional activities of mutant TBX6 in vitro, and evaluated clinical and radiographic features. We identified TBX6 null mutations in nine patients, including a missense mutation that had a loss of function in vitro. All had the risk haplotype in the opposite allele. One of the mutations showed dominant negative effect. Although all Chinese patients had one or more hemivertebrae, two Japanese patients did not have hemivertebra. The compound heterozygosity of null mutations and the common risk haplotype in TBX6 also causes CS in Japanese patients with similar incidence. Hemivertebra was not a specific type of spinal malformation in TBX6-associated CS (TACS). A heterozygous TBX6 loss-of-function mutation has been reported in a family with autosomal-dominant spondylocostal dysostosis, but it may represent a spectrum of the same disease with TACS. © 2017 WILEY PERIODICALS, INC.

  14. No evidence for MHC class II-based non-random mating at the gametic haplotype in Atlantic salmon.

    PubMed

    Promerová, M; Alavioon, G; Tusso, S; Burri, R; Immler, S

    2017-06-01

    Genes of the major histocompatibility complex (MHC) are a likely target of mate choice because of their role in inbreeding avoidance and potential benefits for offspring immunocompetence. Evidence for female choice for complementary MHC alleles among competing males exists both for the pre- and the postmating stages. However, it remains unclear whether the latter may involve non-random fusion of gametes depending on gametic haplotypes resulting in transmission ratio distortion or non-random sequence divergence among fused gametes. We tested whether non-random gametic fusion of MHC-II haplotypes occurs in Atlantic salmon Salmo salar. We performed in vitro fertilizations that excluded interindividual sperm competition using a split family design with large clutch sample sizes to test for a possible role of the gametic haplotype in mate choice. We sequenced two MHC-II loci in 50 embryos per clutch to assess allelic frequencies and sequence divergence. We found no evidence for transmission ratio distortion at two linked MHC-II loci, nor for non-random gamete fusion with respect to MHC-II alleles. Our findings suggest that the gametic MHC-II haplotypes play no role in gamete association in Atlantic salmon and that earlier findings of MHC-based mate choice most likely reflect choice among diploid genotypes. We discuss possible explanations for these findings and how they differ from findings in mammals.

  15. A prospective study of XRCC1 haplotypes and their interaction with plasma carotenoids on breast cancer risk

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mohrenweiser, H W; Han, J; Hankinson, S E

    2004-01-15

    The XRCC1 protein is involved in the base excision repair pathway through interactions with other proteins. Polymorphisms in the XRCC1 gene may lead to variation in repair proficiency and confer inherited predisposition to cancer. We prospectively assessed the associations between polymorphisms and haplotypes in XRCC1 and breast cancer risk in a nested case-control study within the Nurses' Health Study (incident cases, n 1004; controls, n 1385). We further investigated gene-environment interactions between the XRCC1 variations and plasma carotenoids on breast cancer risk. We genotyped four haplotype-tagging single nucleotide polymorphisms Arg {sup 194}Trp, C26602T, Arg{sup 399}Gln, and Gln{sup 632}Gln in themore » XRCC1 gene. Five common haplotypes accounted for 99% of the chromosomes in the present study population of mostly Caucasian women. We observed a marginally significant reduction in the risk of breast cancer among {sup 194}Trp carriers. As compared with no-carriers, women with at least one {sup 194}Trp allele had a multivariate odds ratio of 0.79 (95% of the confidence interval, 0.60 -1.04). The inferred haplotype harboring the {sup 194}Trp allele was more common in controls than in cases (6.6 versus 5.3%, P 0.07). We observed that the Arg {sup 194}Trp modified the inverse associations of plasma -carotene level (P, ordinal test for interaction 0.02) and plasma -carotene level (P, ordinal test for interaction 0.003) with breast cancer risk. No suggestion of an interaction was observed between the Arg {sup 194}Trp and cigarette smoking. Our results suggest an inverse association between XRCC1 {sup 194}Trp allele and breast cancer risk. The findings of the effect modification of the Arg {sup 194}Trp on the relations of plasma -and -carotene levels with breast cancer risk suggest a potential protective effect of carotenoids in breast carcinogenesis by preventing oxidative DNA damage.« less

  16. Global selection on sucrose synthase haplotypes during a century of wheat breeding.

    PubMed

    Hou, Jian; Jiang, Qiyan; Hao, Chenyang; Wang, Yuquan; Zhang, Hongna; Zhang, Xueyong

    2014-04-01

    Spike number per unit area, number of grains per spike, and thousand kernel weight (TKW) are important yield components. In China, increases in wheat (Triticum aestivum) yields are mainly due to increases in grain number per spike and TKW. TKW mainly depends on starch content, as starch accounts for about 70% of the grain endosperm. Sucrose synthase catalysis is the first step in the conversion of sucrose to starch, that is, the conversion of sucrose to fructose and UDP-glucose by the wheat sucrose synthase genes (TaSus1 and TaSus2) that are located on chromosomes 7A/7B/7D and 2A/2B/2D, respectively. A total of 1,520 wheat accessions were genotyped at the six loci. Two, two, five, and two haplotypes were identified at the TaSus2-2A, TaSus2-2B, TaSus1-7A, and TaSus1-7B loci, respectively. Their main variations were detected within the introns. Significant differences between the haplotypes correlated with TKW differences among 348 modern Chinese cultivars from the core collection. Frequency changes for favored haplotypes showed gradual increases in cultivars released since beginning of the last century in China, Europe, and North America. Geographic distributions and time changes of favored haplotypes were characterized in six major wheat production regions worldwide. Strong selection bottlenecks to haplotype variations occurred at polyploidization and domestication and during breeding of wheat. Genetic-effect differences between haplotypes at the same locus influence the selection time and intensity. This work shows that the endosperm starch synthesis pathway is a major target of indirect selection in global wheat breeding for higher yield.

  17. Endurance exercise training effects on body fatness, V̇o2max, HDL-C subfractions, and glucose tolerance are influenced by a PLIN haplotype in older Caucasians

    PubMed Central

    Jenkins, Nathan T.; McKenzie, Jennifer A.; Damcott, Coleen M.; Witkowski, Sarah

    2010-01-01

    Perilipins are lipid droplet-coating proteins that regulate intracellular lipolysis in adipocytes. A haplotype of two perilipin gene (PLIN) single nucleotide polymorphisms, 13041A>G and 14995A>T, has been previously associated with obesity risk. Furthermore, the available data indicate that this association may be modified by sex. We hypothesized that this haplotype would associate with body fatness, aerobic fitness, and a number of cardiovascular (CV) risk factor phenotypes before and after a 6-mo endurance exercise training program in sedentary older Caucasians. The major haplotype group (13041A/14995A; n = 57) had significantly lower body mass index (BMI) and body fatness compared with noncarriers of the AA haplotype (n = 44) before the training intervention. Training improved body composition in both groups, but fatness remained higher in noncarriers than AA carriers after training. This fat retention in noncarriers blunted their maximal oxygen uptake (V̇o2max) adaptation to training. Female noncarriers had substantially higher concentrations of several conventionally and NMR-measured HDL-C subfractions than male noncarriers before and after training, but only minimal differences were found between the sexes in the AA haplotype group. Haplotype group differences in baseline and after-training responses to an oral glucose tolerance test (OGTT) also differed by sex, as noncarrier men had the highest baseline area under the insulin curve (insulin AUC), but were the only group to significantly improve insulin AUC with training. The insulin sensitivity index and plasma glucose responses to the OGTT were more favorable in AA carriers than noncarriers before and after training. Overall, our findings suggest that PLIN variation explains some of the interindividual differences in the response of obesity and CV phenotypes to exercise training. Furthermore, these data contribute to the growing understanding of PLIN as a candidate gene for human obesity and the

  18. A susceptible haplotype within APOE gene influences BMD and intensifies the osteoporosis risk in postmenopausal women of Northwest India.

    PubMed

    Singh, Monica; Singh, Puneetpal; Singh, Surinder; Juneja, Pawan Kumar; Kaur, Taranpal

    2010-11-01

    The association of apolipoprotein E (APOE) genotypes with bone mineral density (BMD) and risk of osteoporosis have remained unclear. The influence of APOE gene polymorphisms on BMD as genetic mediators of osteoporosis risk needs to be explored in Indian postmenopausal females where this disease is rising rampantly. The present study investigated the role and relevance of four pertinent APOE single nucleotide polymorphisms: 5'UTR G/C (rs440446), Int2 G/A (rs769450), Exon4 T/C (rs429358), Exon4C/T (rs7412) in DEXA verified 133 osteoporotic, 57 osteopenic and 83 normal postmenopausal females of India, who were not taking hormone replacement therapy. Minor allele frequencies of rs440446 and rs429358 were higher in osteoporotic females (0.31, 0.18) than osteopenic (0.29, 0.15) and females having normal bone mass (0.16, 0.07). Disease association analysis revealed a susceptibility haplotype CGTC (in order of rs440446, rs769450, rs429358, rs7412) and the carriers of this haplotype has higher risk of osteopenia (OR 3.53, 95% CI 1.21-11.0, P=0.017) and osteoporosis (OR 3.61, 95% CI 1.53-9.48, P=0.002) after adjusting the confounding effect of age, BMI and years since menopause. Females who possess either one copy or two copies of the haplotype have lesser BMD values of lumbar spine (0.88 and 0.85 g/cm(2)) and femoral neck (0.84 and 0.82 g/cm(2)) than those females who possess zero copy (0.9 and 0.87 g/cm(2), respectively). The present study exposed a susceptibility haplotype CGTC, within APOE gene, which was found to be associated with BMD and risk of osteopenia and osteoporosis in postmenopausal females of India. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  19. Aldehyde dehydrogenase-2 genotypes and HLA haplotypes in Japanese patients with esophageal cancer.

    PubMed

    Watanabe, Seishiro; Sasahara, Katsuyuki; Kinekawa, Fumihiko; Uchida, Naohito; Masaki, Tsutomu; Kurokohchi, Kazutaka; Murota, Masayuki; Touge, Tetsuo; Kawauchi, Kazuyoshi; Oda, Syuji; Kuriyama, Shigeki

    2002-01-01

    The aim of this study was to examine how aldehyde dehydrogenase-2 (ALDH2) genotypes and human leukocyte antigen (HLA) haplotypes contribute to the risk for esophageal cancer. We examined ALDH2 genotypes and HLA haplotypes in 29 Japanese patients with esophageal cancer. The ratio of patients who experienced current or former intense vasodilatation upon consuming alcohol (flushing type) was much higher in individuals with the inactive form of ALDH2 encoded by the ALDH2(2)/2(2) or ALDH2(1)/2(2) genotype than in those with the active form of ALDH2 encoded by the ALDH2(1)/2(1) genotype. The ratio of inactive ALDH2 was significantly higher in patients with esophageal cancer than in control normal subjects, suggesting that alcoholics with inactive ALDH2 were susceptible to esophageal cancer. HLA haplotypes A24, A26, B54, B61 and DR9 were prevalent in patients with esophageal cancer (82.8, 24.1, 34.5, 37.9 and 44.8%, respectively). HLA haplotype of A24 and inactive ALDH2 were simultaneously found in 58.6% of patients with esophageal cancer. Furthermore, we found other primary malignancies in 6 of 29 (20.7%) patients with esophageal cancer, and 4 of these 6 patients had both the inactive form of ALDH2 and the HLA A24 haplotype. The present study showed the high prevalence of the inactive form of ALDH2 and HLA haplotypes A24, A26, B54, B61 and DR9 in Japanese patients with esophageal cancer. Therefore, the examination of genotypes of ALDH2 loci and HLA haplotypes may allow the early detection of esophageal cancer in the Japanese population.

  20. Single-nucleotide polymorphisms and haplotypes of non-coding area in the CP gene are correlated with Parkinson's disease.

    PubMed

    Zhao, Na; Xiao, Jianqiu; Zheng, Zhiyong; Fei, Guoqiang; Zhang, Feng; Jin, Lirong; Zhong, Chunjiu

    2015-04-01

    Our previous studies have demonstrated that ceruloplasmin (CP) dysmetabolism is correlated with Parkinson's disease (PD). However, the causes of decreased serum CP levels in PD patients remain to be clarified. This study aimed to explore the potential association between genetic variants of the CP gene and PD. Clinical features, serum CP levels, and the CP gene (both promoter and coding regions) were analyzed in 60 PD patients and 50 controls. A luciferase reporter system was used to investigate the function of promoter single-nucleotide polymorphisms (SNPs). High-density comparative genomic hybridization microarrays were also used to detect large-scale copy-number variations in CP and an additional 47 genes involved in PD and/or copper/iron metabolism. The frequencies of eight SNPs (one intronic SNP and seven promoter SNPs of the CP gene) and their haplotypes were significantly different between PD patients, especially those with lowered serum CP levels, and controls. However, the luciferase reporter system revealed no significant effect of the risk haplotype on promoter activity of the CP gene. Neither these SNPs nor their haplotypes were correlated with the Hoehn and Yahr staging of PD. The results of this study suggest that common genetic variants of CP are associated with PD and further investigation is needed to explore their functions in PD.

  1. RENT+: an improved method for inferring local genealogical trees from haplotypes with recombination

    PubMed Central

    Mirzaei, Sajad; Wu, Yufeng

    2017-01-01

    Abstract Motivation: Haplotypes from one or multiple related populations share a common genealogical history. If this shared genealogy can be inferred from haplotypes, it can be very useful for many population genetics problems. However, with the presence of recombination, the genealogical history of haplotypes is complex and cannot be represented by a single genealogical tree. Therefore, inference of genealogical history with recombination is much more challenging than the case of no recombination. Results: In this paper, we present a new approach called RENT+ for the inference of local genealogical trees from haplotypes with the presence of recombination. RENT+ builds on a previous genealogy inference approach called RENT, which infers a set of related genealogical trees at different genomic positions. RENT+ represents a significant improvement over RENT in the sense that it is more effective in extracting information contained in the haplotype data about the underlying genealogy than RENT. The key components of RENT+ are several greatly enhanced genealogy inference rules. Through simulation, we show that RENT+ is more efficient and accurate than several existing genealogy inference methods. As an application, we apply RENT+ in the inference of population demographic history from haplotypes, which outperforms several existing methods. Availability and Implementation: RENT+ is implemented in Java, and is freely available for download from: https://github.com/SajadMirzaei/RentPlus. Contacts: sajad@engr.uconn.edu or ywu@engr.uconn.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:28065901

  2. Molecular identification and first report of mitochondrial COI gene haplotypes in the hawksbill turtle Eretmochelys imbricata (Testudines: Cheloniidae) in the Colombian Caribbean nesting colonies.

    PubMed

    Daza-Criado, L; Hernández-Fernández, J

    2014-02-21

    Hawksbill sea turtles Eretmochelys imbricata are found extensively around the world, including the Atlantic, Pacific, and Indian Oceans; the Persian Gulf, and the Red and Mediterranean Seas. Populations of this species are affected by international trafficking of their shields, meat, and eggs, making it a critically endangered animal. We determined the haplotypes of 17 hawksbill foraging turtles of Islas del Rosario (Bolivar) and of the nesting beach Don Diego (Magdalena) in the Colombian Caribbean based on amplification and sequencing of the mitochondrial gene cytochrome oxidase c subunit I (COI). We identified 5 haplotypes, including EI-A1 previously reported in Puerto Rico, which was similar to 10 of the study samples. To our knowledge, the remaining 4 haplotypes have not been described. Samples EICOI11 and EICOI3 showed 0.2% divergence from EI-A1, by a single nucleotide change, and were classified as the EI-A2 haplotype. EICOI6, EICOI14, and EICOI12 samples showed 0.2% divergence from EI-A1 and 0.3% divergence from EI-A2 and were classified as EI-A3 haplotype. Samples EICOI16 and EICOI15 presented 5 nucleotide changes each and were classified as 2 different haplotypes, EI-A4 and EI-A5, respectively. The last 2 haplotypes had higher nucleotide diversity (K2P=1.7%) than that by the first 3 haplotypes. EI-A1 and EI-A2 occurred in nesting individuals, and EI-A2, EI-A3, EI-A4, and EI-A5 occurred in foraging individuals. The description of the haplotypes may be associated with reproductive migrations or foraging and could support the hypothesis of natal homing. Furthermore, they can be used in phylogeographic studies.

  3. Inheritance of Hetero-Diploid Pollen S-Haplotype in Self-Compatible Tetraploid Chinese Cherry (Prunus pseudocerasus Lindl)

    PubMed Central

    Gu, Chao; Liu, Qing-Zhong; Yang, Ya-Nan; Zhang, Shu-Jun; Khan, Muhammad Awais; Wu, Jun; Zhang, Shao-Ling

    2013-01-01

    The breakdown of self-incompatibility, which could result from the accumulation of non-functional S-haplotypes or competitive interaction between two different functional S-haplotypes, has been studied extensively at the molecular level in tetraploid Rosaceae species. In this study, two tetraploid Chinese cherry (Prunus pseudocerasus) cultivars and one diploid sweet cherry (Prunus avium) cultivar were used to investigate the ploidy of pollen grains and inheritance of pollen-S alleles. Genetic analysis of the S-genotypes of two intercross-pollinated progenies showed that the pollen grains derived from Chinese cherry cultivars were hetero-diploid, and that the two S-haplotypes were made up of every combination of two of the four possible S-haplotypes. Moreover, the distributions of single S-haplotypes expressed in self- and intercross-pollinated progenies were in disequilibrium. The number of individuals of the two different S-haplotypes was unequal in two self-pollinated and two intercross-pollinated progenies. Notably, the number of individuals containing two different S-haplotypes (S1- and S5-, S5- and S8-, S1- and S4-haplotype) was larger than that of other individuals in the two self-pollinated progenies, indicating that some of these hetero-diploid pollen grains may have the capability to inactivate stylar S-RNase inside the pollen tube and grow better into the ovaries. PMID:23596519

  4. Complement factor H gene (CFH) polymorphisms C-257T, G257A and haplotypes are associated with protection against severe dengue phenotype, possible related with high CFH expression.

    PubMed

    Pastor, André F; Rodrigues Moura, Laís; Neto, José W D; Nascimento, Eduardo J M; Calzavara-Silva, Carlos E; Gomes, Ana Lisa V; Silva, Ana Maria da; Cordeiro, Marli T; Braga-Neto, Ulisses; Crovella, Sergio; Gil, Laura H V G; Marques, Ernesto T A; Acioli-Santos, Bartolomeu

    2013-09-01

    Four genetic polymorphisms located at the promoter (C-257T) and coding regions of CFH gene (exon 2 G257A, exon 14 A2089G and exon 19 G2881T) were investigated in 121 dengue patients (DENV-3) in order to assess the relationship between allele/haplotypes variants and clinical outcomes. A statistical value was found between the CFH-257T allele (TT/TC genotypes) and reduced susceptibility to severe dengue (SD). Statistical associations indicate that individuals bearing a T allele presented significantly higher protein levels in plasma. The -257T variant is located within a NF-κB binding site, suggesting that this variant might have effect on the ability of the CFH gene to respond to signals via the NF-κB pathway. The G257A allelic variant showed significant protection against severe dengue. When CFH haplotypes effect was considered, the ancestral CG/CG promoter-exon 2 SNP genotype showed significant risk to SD either in a general comparison (ancestral × all variant genotypes), as well as in individual genotypes comparison (ancestral × each variant genotype), where the most prevalent effect was observed in the CG/CG × CA/TG comparison. These findings support the involvement of -257T, 257A allele variants and haplotypes on severe dengue phenotype protection, related with high basal CFH expression. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  5. African gene flow to north Brazil as revealed by HBB*S gene haplotype analysis.

    PubMed

    Lemos Cardoso, Greice; Farias Guerreiro, João

    2006-01-01

    Haplotypes linked to the HBB*S gene were analyzed in a sample of 260 chromosomes of Brazilian sickle cell anemia patients from the population of Belém, state of Pará, to evaluate if the present-day haplotype frequencies correlate as well as expected with historical information on the geographic origin of African slaves sent directly to Northern Brazil. The HBB*S gene haplotype distribution (66% Bantu, 21.8% Benin, 10.9% Senegal, and 1.3% Cameroon) is in agreement with those observed for other Brazilian populations regarding the highest proportion of the Bantu type, followed by the Benin type, but it differs significantly concerning the Senegal type as this haplotype is rare or absent in samples from other Brazilian regions already studied. In addition, our results are in accordance with historical records that establish that about 90% of the slaves sent to Northern Brazil were from Angola, Congo, and Mozambique, where the Bantu haplotype predominates, in contrast to 10% of slaves from Senegambia, Guine-Bissau, and Cape Verde, where the Senegal haplotype is the most common. On the other hand, the observed frequency of the Benin haplotype in Belém was much higher than that expected by historical data. This fact corroborates the suggestion that the high prevalence of the Benin type in Belém is due to domestic slave trade and later internal migrations, mainly from the Northeast, since there are no historical records of direct slave trade from Central West Africa to North Brazil. Am. J. Hum. Biol. 18:93-98, 2006. (c) 2005 Wiley-Liss, Inc.

  6. A tool for selecting SNPs for association studies based on observed linkage disequilibrium patterns.

    PubMed

    De La Vega, Francisco M; Isaac, Hadar I; Scafe, Charles R

    2006-01-01

    The design of genetic association studies using single-nucleotide polymorphisms (SNPs) requires the selection of subsets of the variants providing high statistical power at a reasonable cost. SNPs must be selected to maximize the probability that a causative mutation is in linkage disequilibrium (LD) with at least one marker genotyped in the study. The HapMap project performed a genome-wide survey of genetic variation with about a million SNPs typed in four populations, providing a rich resource to inform the design of association studies. A number of strategies have been proposed for the selection of SNPs based on observed LD, including construction of metric LD maps and the selection of haplotype tagging SNPs. Power calculations are important at the study design stage to ensure successful results. Integrating these methods and annotations can be challenging: the algorithms required to implement these methods are complex to deploy, and all the necessary data and annotations are deposited in disparate databases. Here, we present the SNPbrowser Software, a freely available tool to assist in the LD-based selection of markers for association studies. This stand-alone application provides fast query capabilities and swift visualization of SNPs, gene annotations, power, haplotype blocks, and LD map coordinates. Wizards implement several common SNP selection workflows including the selection of optimal subsets of SNPs (e.g. tagging SNPs). Selected SNPs are screened for their conversion potential to either TaqMan SNP Genotyping Assays or the SNPlex Genotyping System, two commercially available genotyping platforms, expediting the set-up of genetic studies with an increased probability of success.

  7. The role of the JAK2 GGCC haplotype and the TET2 gene in familial myeloproliferative neoplasms

    PubMed Central

    Olcaydu, Damla; Rumi, Elisa; Harutyunyan, Ashot; Passamonti, Francesco; Pietra, Daniela; Pascutto, Cristiana; Berg, Tiina; Jäger, Roland; Hammond, Emma; Cazzola, Mario; Kralovics, Robert

    2011-01-01

    Background Myeloproliferative neoplasms constitute a group of diverse chronic myeloid malignancies that share pathogenic features such as acquired mutations in the JAK2, TET2, CBL and MPL genes. There are recent reports that a JAK2 gene haplotype (GGCC or 46/1) confers susceptibility to JAK2 mutation-positive myeloproliferative neoplasms. The aim of this study was to examine the role of the JAK2 GGCC haplotype and germline mutations of TET2, CBL and MPL in familial myeloproliferative neoplasms. Design and Methods We investigated patients with familial (n=88) or sporadic (n=684) myeloproliferative neoplasms, and a control population (n=203) from the same demographic area in Italy. Association analysis was performed using tagged single nucleotide polymorphisms (rs10974944 and rs12343867) of the JAK2 haplotype. Sequence analysis of TET2, CBL and MPL was conducted in the 88 patients with familial myeloproliferative neoplasms. Results Association analysis revealed no difference in haplotype frequency between familial and sporadic cases of myeloproliferative neoplasms (P=0.6529). No germline mutations in TET2, CBL or MPL that segregate with the disease phenotype were identified. As we observed variability in somatic mutations in the affected members of a pedigree with myeloproliferative neoplasms, we postulated that somatic mutagenesis is increased in familial myeloproliferative neoplasms. Accordingly, we compared the incidence of malignant disorders between sporadic and familial patients. Although the overall incidence of malignant disorders did not differ significantly between cases of familial and sporadic myeloproliferative neoplasms, malignancies were more frequent in patients with familial disease aged between 50 to 70 years (P=0.0198) than in patients in the same age range with sporadic myeloproliferative neoplasms. Conclusions We conclude that the JAK2 GGCC haplotype and germline mutations of TET2, CBL or MPL do not explain familial clustering of

  8. Association of HLA-A, B, DRB1 alleles and haplotypes with HIV-1 infection in Chongqing, China

    PubMed Central

    2009-01-01

    Background The human immunodeficiency virus type 1(HIV-1) epidemic in Chongqing, China, is increasing rapidly with the dominant subtype of CRF07_BC over the past 3 years. Since human leukocyte antigen (HLA) polymorphisms have shown strong association with susceptibility/resistance to HIV-1 infection from individuals with different ethnic backgrounds, a recent investigation on frequencies of HLA class I and class II alleles in a Chinese cohort also indicated that similar correlation existed in HIV infected individuals from several provinces in China, however, such information is unavailable in Chongqing, southwest China. Methods In this population-based study, we performed polymerase chain reaction analysis with sequence-specific oligonucleotide probes (PCR-SSOP) for intermediate-low-resolution HLA typing in a cohort of 549 HIV-1 infected individuals, another 2475 healthy subjects from the Han nationality in Chongqing, China, were selected as population control. We compared frequencies of HLA-A, B, DRB1 alleles, haplotypes and genotypes between the two groups, and analyzed their association with HIV-1 susceptibility or resistance. Results The genetic profile of HLA (A, B, DRB1) alleles of HIV-1 infected individuals from Chongqing Han of China was obtained. Several alleles of HLA-B such as B*46 (P = 0.001, OR = 1.38, 95%CI = 1.13-1.68), B*1501G(B62) (P = 0.013, OR = 1.42, 95%CI = 1.08-1.88), B*67 (P = 0.022, OR = 2.76, 95%CI = 1.16-6.57), B*37 (P = 0.014, OR = 1.93, 95%CI = 1.14-3.28) and B*52 (P = 0.038, OR = 1.64, 95%CI = 1.03-2.61) were observed to have association with susceptibility to HIV-1 infection in this population. In addition, the haplotype analysis revealed that A*11-B*46, A*24-B*54 and A*01-B*37 for 2-locus, and A*11-B*46-DRB1*09, A*02-B*46-DRB1*08, A*11-B*4001G-DRB1*15, A*02-B*4001G-DRB1*04, A*11-B*46-DRB1*08 and A*02-B*4001G-DRB1*12 for 3-locus had significantly overrepresented in HIV-1 infected individuals, whereas A*11-B*1502G, A*11-B*1502G-DRB1

  9. Association of HLA-A, B, DRB1 alleles and haplotypes with HIV-1 infection in Chongqing, China.

    PubMed

    Huang, Xia; Ling, Hua; Mao, Wei; Ding, Xianbin; Zhou, Quanhua; Han, Mei; Wang, Fang; Cheng, Lei; Xiong, Hongyan

    2009-12-12

    The human immunodeficiency virus type 1(HIV-1) epidemic in Chongqing, China, is increasing rapidly with the dominant subtype of CRF07_BC over the past 3 years. Since human leukocyte antigen (HLA) polymorphisms have shown strong association with susceptibility/resistance to HIV-1 infection from individuals with different ethnic backgrounds, a recent investigation on frequencies of HLA class I and class II alleles in a Chinese cohort also indicated that similar correlation existed in HIV infected individuals from several provinces in China, however, such information is unavailable in Chongqing, southwest China. In this population-based study, we performed polymerase chain reaction analysis with sequence-specific oligonucleotide probes (PCR-SSOP) for intermediate-low-resolution HLA typing in a cohort of 549 HIV-1 infected individuals, another 2475 healthy subjects from the Han nationality in Chongqing, China, were selected as population control. We compared frequencies of HLA-A, B, DRB1 alleles, haplotypes and genotypes between the two groups, and analyzed their association with HIV-1 susceptibility or resistance. The genetic profile of HLA (A, B, DRB1) alleles of HIV-1 infected individuals from Chongqing Han of China was obtained. Several alleles of HLA-B such as B*46 (P = 0.001, OR = 1.38, 95%CI = 1.13-1.68), B*1501G(B62) (P = 0.013, OR = 1.42, 95%CI = 1.08-1.88), B*67 (P = 0.022, OR = 2.76, 95%CI = 1.16-6.57), B*37 (P = 0.014, OR = 1.93, 95%CI = 1.14-3.28) and B*52 (P = 0.038, OR = 1.64, 95%CI = 1.03-2.61) were observed to have association with susceptibility to HIV-1 infection in this population. In addition, the haplotype analysis revealed that A*11-B*46, A*24-B*54 and A*01-B*37 for 2-locus, and A*11-B*46-DRB1*09, A*02-B*46-DRB1*08, A*11-B*4001G-DRB1*15, A*02-B*4001G-DRB1*04, A*11-B*46-DRB1*08 and A*02-B*4001G-DRB1*12 for 3-locus had significantly overrepresented in HIV-1 infected individuals, whereas A*11-B*1502G, A*11-B*1502G-DRB1*12 and A*33-B*58-DRB1*13 were

  10. BAsE-Seq: a method for obtaining long viral haplotypes from short sequence reads.

    PubMed

    Hong, Lewis Z; Hong, Shuzhen; Wong, Han Teng; Aw, Pauline P K; Cheng, Yan; Wilm, Andreas; de Sessions, Paola F; Lim, Seng Gee; Nagarajan, Niranjan; Hibberd, Martin L; Quake, Stephen R; Burkholder, William F

    2014-01-01

    We present a method for obtaining long haplotypes, of over 3 kb in length, using a short-read sequencer, Barcode-directed Assembly for Extra-long Sequences (BAsE-Seq). BAsE-Seq relies on transposing a template-specific barcode onto random segments of the template molecule and assembling the barcoded short reads into complete haplotypes. We applied BAsE-Seq on mixed clones of hepatitis B virus and accurately identified haplotypes occurring at frequencies greater than or equal to 0.4%, with >99.9% specificity. Applying BAsE-Seq to a clinical sample, we obtained over 9,000 viral haplotypes, which provided an unprecedented view of hepatitis B virus population structure during chronic infection. BAsE-Seq is readily applicable for monitoring quasispecies evolution in viral diseases.

  11. Haplotypes and effects on growth traits of bovine Wnt7a gene in Chinese Qinchuan cattle.

    PubMed

    Xue, Jing; Sun, Yujia; Guo, Wenjiao; Yang, Ziqi; Tian, Huibin; Zhang, Chunlei; Lei, Chuzhao; Lan, Xianyong; Chen, Hong

    2013-07-25

    Wnt7a is a member of the WNT gene family, which encodes secreted signaling proteins and responds to many biological processes. Specifically Wnt7a influences satellite stem cells and regulates the regenerative potential of the muscle. However, similar researches about the bovine Wnt7a gene are lacking. Therefore, in this study, polymorphisms of the bovine Wnt7a gene were detected in 488 individuals from Chinese Qinchuan cattle by DNA pooling, forced PCR-RFLP, and DNA sequencing methods. 3 novel SNPs were identified, two SNPs (g.T4926C and g.A21943G) were in the intron and the last one (g.C63777T) was in the exon. Five haplotypes involved in these three variant sites in the Wnt7a gene were identified and their effects on growth traits were analyzed. The results revealed that haplotype 1 had the highest haplotype frequencies and was highly significantly associated with body height (P<0.01), body weight (P<0.05), chest width (P<0.05) and height at hip cross (P<0.01) respectively. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Autosomal dominant retinitis pigmentosa with macular involvement associated with a disease haplotype that included a novel PRPH2 variant (p.Cys250Gly).

    PubMed

    Katagiri, Satoshi; Hayashi, Takaaki; Mizobuchi, Kei; Yoshitake, Kazutoshi; Iwata, Takeshi; Nakano, Tadashi

    2018-06-01

    It is known that PRPH2 variants appear to be rare causes of retinitis pigmentosa (RP) in the Japanese population. The purpose of this study was to describe clinical and genetic features in autosomal dominant RP (adRP) patients with a novel disease-causing variant in the PRHP2 gene. A total of 57 unrelated Japanese probands with adRP were investigated in this study. Comprehensive ophthalmic examinations include fundus photography, fundus autofluorescence imaging, spectral-domain optical coherence tomography, and electroretinography. Whole exome sequencing or Sanger sequencing for 25 targeted exons of multiple genes causing adRP was performed to identify disease-causing variants. Co-segregation and haplotype analyses were performed to determine a disease-causing gene variant and its haplotype. Genetic analysis identified a novel heterozygous PRPH2 variant (c.748T>G, p.Cys250Gly) as disease causing in four probands from four families. The variant co-segregated with the RP phenotype in the eight affected patients in all families. At least three of the four families shared the same haplotype for the variant allele. Clinically, seven of the eight affected patients exhibited typical RP presentation, as well as variable macular involvement including cystoid macular change, vitelliform-like appearance, choroidal neovascularization, and macular atrophy. The same disease haplotype that included a novel PRPH2 variant (p.Cys250Gly) was identified in three of the four Japanese families with adRP, suggesting a founder effect. Our clinical findings indicate that adRP caused by the p.Cys250Gly variant may accompany macular involvement with high frequency.

  13. Functional Haplotypes of Fc gamma (Fcγ) receptor (FcγRIIA and FcγRIIIB) predict risk to repeated episodes of severe malarial anemia and mortality in Kenyan children

    PubMed Central

    Ouma, Collins; Davenport, Gregory C.; Garcia, Steven; Kempaiah, Prakasha; Chaudhary, Ateefa; Were, Tom; Anyona, Samuel B.; Raballah, Evans; Konah, Stephen N.; Hittner, James B.; Vulule, John M.; Ong’echa, John M.; Perkins, Douglas J.

    2011-01-01

    Development of protective immunity against Plasmodium falciparum is partially mediated through binding of malaria-specific IgG to Fc gamma (γ) receptors. Variation in human FcγRIIA-H/R-131 and FcγRIIIB-NA1/NA2 affect differential binding of IgG sub-classes. Since variability in FcγR may play an important role in severe malarial anemia (SMA) pathogenesis by mediating phagocytosis of red blood cells and triggering cytokine production, the relationship between FcγRIIA-H/R131 and FcγRIIIB-NA1/NA2 haplotypes and susceptibility to SMA (Hb<6.0g/dL) was investigated in Kenyan children (n=528) with acute malaria residing in a holoendemic P. falciparum transmission region. In addition, the association between carriage of the haplotypes and repeated episodes of SMA and all-cause mortality were investigated over a three-year follow-up period. Since variability in FcγR can alter interferon (IFN)-γ production, a mediator of innate and adaptive immune responses, functional associations between the haplotypes and IFN-γ were also explored. During acute malaria, children with SMA had elevated peripheral IFN-γ levels (P=0.006). Although multivariate logistic regression analyses (controlling for covariates) revealed no associations between the FcγR haplotypes and susceptibility to SMA during acute infection, the FcγRIIA-131H/FcγRIIIB-NA1 haplotype was associated with decreased peripheral IFN-γ (P=0.046). Longitudinal analyses showed that carriage of the FcγRIIA-131H/FcγRIIIB-NA1 haplotype was associated with reduced risk of SMA (RR; 0.65, 95%CI, 0.46-0.90; P=0.012) and all-cause mortality (P=0.002). In contrast, carriers of the FcγRIIA-131H/FcγRIIIB-NA2 haplotype had increased susceptibility to SMA (RR; 1.47, 95%CI, 1.06-2.04; P=0.020). Results here demonstrate that variation in the FcγR gene alters susceptibility to repeated episodes of SMA and mortality, as well as functional changes in IFN-γ production. PMID:21818580

  14. Novel Harmful Recessive Haplotypes Identified for Fertility Traits in Nordic Holstein Cattle

    PubMed Central

    Sahana, Goutam; Nielsen, Ulrik Sander; Aamand, Gert Pedersen; Lund, Mogens Sandø; Guldbrandtsen, Bernt

    2013-01-01

    Using genomic data, lethal recessives may be discovered from haplotypes that are common in the population but never occur in the homozygote state in live animals. This approach only requires genotype data from phenotypically normal (i.e. live) individuals and not from the affected embryos that die. A total of 7,937 Nordic Holstein animals were genotyped with BovineSNP50 BeadChip and haplotypes including 25 consecutive markers were constructed and tested for absence of homozygotes states. We have identified 17 homozygote deficient haplotypes which could be loosely clustered into eight genomic regions harboring possible recessive lethal alleles. Effects of the identified haplotypes were estimated on two fertility traits: non-return rates and calving interval. Out of the eight identified genomic regions, six regions were confirmed as having an effect on fertility. The information can be used to avoid carrier-by-carrier mattings in practical animal breeding. Further, identification of causative genes/polymorphisms responsible for lethal effects will lead to accurate testing of the individuals carrying a lethal allele. PMID:24376603

  15. Maternal smoking during pregnancy and offspring type 1 diabetes mellitus risk: accounting for HLA haplotype.

    PubMed

    Mattsson, Kristina; Jönsson, Ida; Malmqvist, Ebba; Larsson, Helena Elding; Rylander, Lars

    2015-03-01

    The main objective of this study was to investigate the risk of type 1 diabetes mellitus (T1D) in children exposed to tobacco smoking in utero, also taking genetic predisposition as expressed by HLA haplotype into account. In Skåne, the southernmost county of Sweden, all children born 1999-2005 who developed T1D were registered, resulting in 344 cases. For each child with T1D, three control children, matched for HLA haplotype and birthyear, were selected. Information on prenatal smoking exposure was retrieved from a regional birth register. Conditional logistic regressions were used to evaluate T1D risk following prenatal smoking exposure. In these data, maternal smoking in early pregnancy was associated with a higher risk of her child developing T1D [odds ratio (OR) 2.83; 95% confidence interval (CI) 1.67-4.80 for 1-9 cigarettes/day, and OR 3.91; 95% CI 1.22-12.51 for >9 cigarettes/day]. Results remained through all adjustments and sensitivity analyses. When genetic predisposition in terms of HLA haplotype was taken into account, we found that children exposed to smoking during fetal life were at higher risk of developing T1D in childhood.

  16. RENT+: an improved method for inferring local genealogical trees from haplotypes with recombination.

    PubMed

    Mirzaei, Sajad; Wu, Yufeng

    2017-04-01

    : Haplotypes from one or multiple related populations share a common genealogical history. If this shared genealogy can be inferred from haplotypes, it can be very useful for many population genetics problems. However, with the presence of recombination, the genealogical history of haplotypes is complex and cannot be represented by a single genealogical tree. Therefore, inference of genealogical history with recombination is much more challenging than the case of no recombination. : In this paper, we present a new approach called RENT+  for the inference of local genealogical trees from haplotypes with the presence of recombination. RENT+  builds on a previous genealogy inference approach called RENT , which infers a set of related genealogical trees at different genomic positions. RENT+  represents a significant improvement over RENT in the sense that it is more effective in extracting information contained in the haplotype data about the underlying genealogy than RENT . The key components of RENT+  are several greatly enhanced genealogy inference rules. Through simulation, we show that RENT+  is more efficient and accurate than several existing genealogy inference methods. As an application, we apply RENT+  in the inference of population demographic history from haplotypes, which outperforms several existing methods. : RENT+  is implemented in Java, and is freely available for download from: https://github.com/SajadMirzaei/RentPlus . : sajad@engr.uconn.edu or ywu@engr.uconn.edu. : Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  17. Genome-Wide Association Mapping of Correlated Traits in Cassava: Dry Matter and Total Carotenoid Content.

    PubMed

    Rabbi, Ismail Y; Udoh, Lovina I; Wolfe, Marnin; Parkes, Elizabeth Y; Gedil, Melaku A; Dixon, Alfred; Ramu, Punna; Jannink, Jean-Luc; Kulakow, Peter

    2017-11-01

    Cassava is a starchy root crop cultivated in the tropics for fresh consumption and commercial processing. Primary selection objectives in cassava breeding include dry matter content and micronutrient density, particularly provitamin A carotenoids. These traits are negatively correlated in the African germplasm. This study aimed at identifying genetic markers associated with these traits and uncovering whether linkage and/or pleiotropy were responsible for observed negative correlation. A genome-wide association mapping using 672 clones genotyped at 72,279 single nucleotide polymorphism (SNP) loci was performed. Root yellowness was used indirectly to assess variation in carotenoid content. Two major loci for root yellowness were identified on chromosome 1 at positions 24.1 and 30.5 Mbp. A single locus for dry matter content that colocated with the 24.1 Mbp peak for carotenoids was identified. Haplotypes at these loci explained 70 and 37% of the phenotypic variability for root yellowness and dry matter content, respectively. Evidence of megabase-scale linkage disequilibrium (LD) around the major loci of the two traits and detection of the major dry matter locus in independent analysis for the white- and yellow-root subpopulations suggests that physical linkage rather that pleiotropy is more likely to be the cause of the negative correlation between the target traits. Moreover, candidate genes for carotenoid () and starch biosynthesis ( and ) occurred in the vicinity of the identified locus at 24.1 Mbp. These findings elucidate the genetic architecture of carotenoids and dry matter in cassava and provide an opportunity to accelerate breeding of these traits. Copyright © 2017 Crop Science Society of America.

  18. HapMap filter 1.0: a tool to preprocess the HapMap genotypic data for association studies.

    PubMed

    Zhang, Wei; Duan, Shiwei; Dolan, M Eileen

    2008-05-13

    The International HapMap Project provides a resource of genotypic data on single nucleotide polymorphisms (SNPs), which can be used in various association studies to identify the genetic determinants for phenotypic variations. Prior to the association studies, the HapMap dataset should be preprocessed in order to reduce the computation time and control the multiple testing problem. The less informative SNPs including those with very low genotyping rate and SNPs with rare minor allele frequencies to some extent in one or more population are removed. Some research designs only use SNPs in a subset of HapMap cell lines. Although the HapMap website and other association software packages have provided some basic tools for optimizing these datasets, a fast and user-friendly program to generate the output for filtered genotypic data would be beneficial for association studies. Here, we present a flexible, straight-forward bioinformatics program that can be useful in preparing the HapMap genotypic data for association studies by specifying cell lines and two common filtering criteria: minor allele frequencies and genotyping rate. The software was developed for Microsoft Windows and written in C++. The Windows executable and source code in Microsoft Visual C++ are available at Google Code (http://hapmap-filter-v1.googlecode.com/) or upon request. Their distribution is subject to GNU General Public License v3.

  19. Genome-wide association study identifies HLA 8.1 ancestral haplotype alleles as major genetic risk factors for myositis phenotypes.

    PubMed

    Miller, F W; Chen, W; O'Hanlon, T P; Cooper, R G; Vencovsky, J; Rider, L G; Danko, K; Wedderburn, L R; Lundberg, I E; Pachman, L M; Reed, A M; Ytterberg, S R; Padyukov, L; Selva-O'Callaghan, A; Radstake, T R; Isenberg, D A; Chinoy, H; Ollier, W E R; Scheet, P; Peng, B; Lee, A; Byun, J; Lamb, J A; Gregersen, P K; Amos, C I

    2015-10-01

    Autoimmune muscle diseases (myositis) comprise a group of complex phenotypes influenced by genetic and environmental factors. To identify genetic risk factors in patients of European ancestry, we conducted a genome-wide association study (GWAS) of the major myositis phenotypes in a total of 1710 cases, which included 705 adult dermatomyositis, 473 juvenile dermatomyositis, 532 polymyositis and 202 adult dermatomyositis, juvenile dermatomyositis or polymyositis patients with anti-histidyl-tRNA synthetase (anti-Jo-1) autoantibodies, and compared them with 4724 controls. Single-nucleotide polymorphisms showing strong associations (P<5×10(-8)) in GWAS were identified in the major histocompatibility complex (MHC) region for all myositis phenotypes together, as well as for the four clinical and autoantibody phenotypes studied separately. Imputation and regression analyses found that alleles comprising the human leukocyte antigen (HLA) 8.1 ancestral haplotype (AH8.1) defined essentially all the genetic risk in the phenotypes studied. Although the HLA DRB1*03:01 allele showed slightly stronger associations with adult and juvenile dermatomyositis, and HLA B*08:01 with polymyositis and anti-Jo-1 autoantibody-positive myositis, multiple alleles of AH8.1 were required for the full risk effects. Our findings establish that alleles of the AH8.1 comprise the primary genetic risk factors associated with the major myositis phenotypes in geographically diverse Caucasian populations.

  20. Investigation of extended Y chromosome STR haplotypes in Sardinia.

    PubMed

    Lacerenza, D; Aneli, S; Di Gaetano, C; Critelli, R; Piazza, A; Matullo, G; Culigioni, C; Robledo, R; Robino, C; Calò, C

    2017-03-01

    Y-chromosomal variation of selected single nucleotide polymorphisms (SNPs) and 32 short tandem repeat (STR) loci was evaluated in Sardinia in three open population groups (Northern Sardinia, n=40; Central Sardinia, n=56; Southern Sardinia, n=91) and three isolates (Desulo, n=34; Benetutti, n=45, Carloforte, n=42). The tested Y-STRs consisted of Yfiler ® Plus markers and the seven rapidly mutating (RM) loci not included in the YFiler ® Plus kit (DYF399S1, DYF403S1ab, DYF404S1, DYS526ab, DYS547, DYS612, and DYS626). As expected, inclusion of additional Y-STR loci increased haplotype diversity (h), though complete differentiation of male lineages was impossible even by means of RM Y-STRs (h=0.99997). Analysis of molecular variance indicated that the three open populations were fairly homogeneous, whereas signs of genetic heterogeneity could be detected when the three isolates were also included in the analysis. Multidimensional scaling analysis showed that, even for extended haplotypes including RM Y-STR markers, Sardinians were clearly differentiated from populations of the Italian peninsula and Sicily. The only exception was represented by the Carloforte sample that, in accordance with its peculiar population history, clustered with Northern/Central Italian populations. The introduction of extended forensic Y-STR panels, including highly variable RM Y-STR markers, is expected to reduce the impact of population structure on haplotype frequency estimations. However, our results show that the availability of geographically detailed reference databases is still important for the assessment of the evidential value of a Y-haplotype match. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.