Gu, Ming-liang; Chu, Jia-you
2007-12-01
Human genome has structures of haplotype and haplotype block which provide valuable information on human evolutionary history and may lead to the development of more efficient strategies to identify genetic variants that increase susceptibility to complex diseases. Haplotype block can be divided into discrete blocks of limited haplotype diversity. In each block, a small fraction of ptag SNPsq can be used to distinguish a large fraction of the haplotypes. These tag SNPs can be potentially useful for construction of haplotype and haplotype block, and association studies in complex diseases. There are two general classes of methods to construct haplotype and haplotype blocks based on genotypes on large pedigrees and statistical algorithms respectively. The author evaluate several construction methods to assess the power of different association tests with a variety of disease models and block-partitioning criteria. The advantages, limitations and applications of each method and the application in the association studies are discussed equitably. With the completion of the HapMap and development of statistical algorithms for addressing haplotype reconstruction, ideas of construction of haplotype based on combination of mathematics, physics, and computer science etc will have profound impacts on population genetics, location and cloning for susceptible genes in complex diseases, and related domain with life science etc.
Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus
2013-01-01
Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different
RTEL1 tagging SNPs and haplotypes were associated with glioma development.
Li, Gang; Jin, Tianbo; Liang, Hongjuan; Zhang, Zhiguo; He, Shiming; Tu, Yanyang; Yang, Haixia; Geng, Tingting; Cui, Guangbin; Chen, Chao; Gao, Guodong
2013-05-17
As glioma ranks as the first most prevalent solid tumors in primary central nervous system, certain single-nucleotide polymorphisms (SNPs) may be related to increased glioma risk, and have implications in carcinogenesis. The present case-control study was carried out to elucidate how common variants contribute to glioma susceptibility. Ten candidate tagging SNPs (tSNPs) were selected from seven genes whose polymorphisms have been proven by classical literatures and reliable databases to be tended to relate with gliomas, and with the minor allele frequency (MAF)>5% in the HapMap Asian population. The selected tSNPs were genotyped in 629 glioma patients and 645 controls from a Han Chinese population using the multiplexed SNP MassEXTEND assay calibrated. Two significant tSNPs in RTEL1 gene were observed to be associated with glioma risk (rs6010620, P=0.0016, OR: 1.32, 95% CI: 1.11-1.56; rs2297440, P=0.001, OR: 1.33, 95% CI: 1.12-1.58) by χ2 test. It was identified the genotype "GG" of rs6010620 acted as the protective genotype for glioma (OR, 0.46; 95% CI, 0.31-0.7; P=0.0002), while the genotype "CC" of rs2297440 as the protective genotype in glioma (OR, 0.47; 95% CI, 0.31-0.71; P=0.0003). Furthermore, haplotype "GCT" in RTEL1 gene was found to be associated with risk of glioma (OR, 0.7; 95% CI, 0.57-0.86; Fisher's P=0.0005; Pearson's P=0.0005), and haplotype "ATT" was detected to be associated with risk of glioma (OR, 1.32; 95% CI, 1.12-1.57; Fisher's P=0.0013; Pearson's P=0.0013). Two single variants, the genotypes of "GG" of rs6010620 and "CC" of rs2297440 (rs6010620 and rs2297440) in the RTEL1 gene, together with two haplotypes of GCT and ATT, were identified to be associated with glioma development. And it might be used to evaluate the glioma development risks to screen the above RTEL1 tagging SNPs and haplotypes. The virtual slides for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1993021136961998.
RTEL1 tagging SNPs and haplotypes were associated with glioma development
2013-01-01
Abstract As glioma ranks as the first most prevalent solid tumors in primary central nervous system, certain single-nucleotide polymorphisms (SNPs) may be related to increased glioma risk, and have implications in carcinogenesis. The present case–control study was carried out to elucidate how common variants contribute to glioma susceptibility. Ten candidate tagging SNPs (tSNPs) were selected from seven genes whose polymorphisms have been proven by classical literatures and reliable databases to be tended to relate with gliomas, and with the minor allele frequency (MAF) > 5% in the HapMap Asian population. The selected tSNPs were genotyped in 629 glioma patients and 645 controls from a Han Chinese population using the multiplexed SNP MassEXTEND assay calibrated. Two significant tSNPs in RTEL1 gene were observed to be associated with glioma risk (rs6010620, P = 0.0016, OR: 1.32, 95% CI: 1.11-1.56; rs2297440, P = 0.001, OR: 1.33, 95% CI: 1.12-1.58) by χ2 test. It was identified the genotype “GG” of rs6010620 acted as the protective genotype for glioma (OR, 0.46; 95% CI, 0.31-0.7; P = 0.0002), while the genotype “CC” of rs2297440 as the protective genotype in glioma (OR, 0.47; 95% CI, 0.31-0.71; P = 0.0003). Furthermore, haplotype “GCT” in RTEL1 gene was found to be associated with risk of glioma (OR, 0.7; 95% CI, 0.57-0.86; Fisher’s P = 0.0005; Pearson’s P = 0.0005), and haplotype “ATT” was detected to be associated with risk of glioma (OR, 1.32; 95% CI, 1.12-1.57; Fisher’s P = 0.0013; Pearson’s P = 0.0013). Two single variants, the genotypes of “GG” of rs6010620 and “CC” of rs2297440 (rs6010620 and rs2297440) in the RTEL1 gene, together with two haplotypes of GCT and ATT, were identified to be associated with glioma development. And it might be used to evaluate the glioma development risks to screen the above RTEL1 tagging SNPs and haplotypes. Virtual slides The virtual slides for this article
Koskinen, Lotta; Romanos, Jihane; Kaukinen, Katri; Mustalahti, Kirsi; Korponay-Szabo, Ilma; Barisani, Donatella; Bardella, Maria Teresa; Ziberna, Fabiana; Vatta, Serena; Széles, György; Pocsai, Zsuzsa; Karell, Kati; Haimila, Katri; Adány, Róza; Not, Tarcisio; Ventura, Alessandro; Mäki, Markku; Partanen, Jukka; Wijmenga, Cisca; Saavalainen, Päivi
2009-04-01
Human leukocyte antigen (HLA) genes, located on chromosome 6p21.3, have a crucial role in susceptibility to various autoimmune and inflammatory diseases, such as celiac disease and type 1 diabetes. Certain HLA heterodimers, namely DQ2 (encoded by the DQA1*05 and DQB1*02 alleles) and DQ8 (DQA1*03 and DQB1*0302), are necessary for the development of celiac disease. Traditional genotyping of HLA genes is laborious, time-consuming, and expensive. A novel HLA-genotyping method, using six HLA-tagging single-nucleotide polymorphisms (SNPs) and suitable for high-throughput approaches, was described recently. Our aim was to validate this method in the Finnish, Hungarian, and Italian populations. The six previously reported HLA-tagging SNPs were genotyped in patients with celiac disease and in healthy individuals from Finland, Hungary, and two distinct regions of Italy. The potential of this method was evaluated in analyzing how well the tag SNP results correlate with the HLA genotypes previously determined using traditional HLA-typing methods. Using the tagging SNP method, it is possible to determine the celiac disease risk haplotypes accurately in Finnish, Hungarian, and Italian populations, with specificity and sensitivity ranging from 95% to 100%. In addition, it predicts homozygosity and heterozygosity for a risk haplotype, allowing studies on genotypic risk effects. The method is transferable between populations and therefore suited for large-scale research studies and screening of celiac disease among high-risk individuals or at the population level.
Ultraaccurate genome sequencing and haplotyping of single human cells.
Chu, Wai Keung; Edge, Peter; Lee, Ho Suk; Bansal, Vikas; Bafna, Vineet; Huang, Xiaohua; Zhang, Kun
2017-11-21
Accurate detection of variants and long-range haplotypes in genomes of single human cells remains very challenging. Common approaches require extensive in vitro amplification of genomes of individual cells using DNA polymerases and high-throughput short-read DNA sequencing. These approaches have two notable drawbacks. First, polymerase replication errors could generate tens of thousands of false-positive calls per genome. Second, relatively short sequence reads contain little to no haplotype information. Here we report a method, which is dubbed SISSOR (single-stranded sequencing using microfluidic reactors), for accurate single-cell genome sequencing and haplotyping. A microfluidic processor is used to separate the Watson and Crick strands of the double-stranded chromosomal DNA in a single cell and to randomly partition megabase-size DNA strands into multiple nanoliter compartments for amplification and construction of barcoded libraries for sequencing. The separation and partitioning of large single-stranded DNA fragments of the homologous chromosome pairs allows for the independent sequencing of each of the complementary and homologous strands. This enables the assembly of long haplotypes and reduction of sequence errors by using the redundant sequence information and haplotype-based error removal. We demonstrated the ability to sequence single-cell genomes with error rates as low as 10 -8 and average 500-kb-long DNA fragments that can be assembled into haplotype contigs with N50 greater than 7 Mb. The performance could be further improved with more uniform amplification and more accurate sequence alignment. The ability to obtain accurate genome sequences and haplotype information from single cells will enable applications of genome sequencing for diverse clinical needs. Copyright © 2017 the Author(s). Published by PNAS.
Khatkar, Mehar S.; Zenger, Kyall R.; Hobbs, Matthew; Hawken, Rachel J.; Cavanagh, Julie A. L.; Barris, Wes; McClintock, Alexander E.; McClintock, Sara; Thomson, Peter C.; Tier, Bruce; Nicholas, Frank W.; Raadsma, Herman W.
2007-01-01
Analysis of data on 1000 Holstein–Friesian bulls genotyped for 15,036 single-nucleotide polymorphisms (SNPs) has enabled genomewide identification of haplotype blocks and tag SNPs. A final subset of 9195 SNPs in Hardy–Weinberg equilibrium and mapped on autosomes on the bovine sequence assembly (release Btau 3.1) was used in this study. The average intermarker spacing was 251.8 kb. The average minor allele frequency (MAF) was 0.29 (0.05–0.5). Following recent precedents in human HapMap studies, a haplotype block was defined where 95% of combinations of SNPs within a region are in very high linkage disequilibrium. A total of 727 haplotype blocks consisting of ≥3 SNPs were identified. The average block length was 69.7 ± 7.7 kb, which is ∼5–10 times larger than in humans. These blocks comprised a total of 2964 SNPs and covered 50,638 kb of the sequence map, which constitutes 2.18% of the length of all autosomes. A set of tag SNPs, which will be useful for further fine-mapping studies, has been identified. Overall, the results suggest that as many as 75,000–100,000 tag SNPs would be needed to track all important haplotype blocks in the bovine genome. This would require ∼250,000 SNPs in the discovery phase. PMID:17435229
A TNF region haplotype offers protection from typhoid fever in Vietnamese patients
2009-01-01
The genomic region surrounding the TNF locus on human chromosome 6 has previously been associated with typhoid fever in Vietnam. We used a haplotypic approach to understand this association further. Eighty single nucleotide polymorphisms (SNPs) spanning a 150 kb region were genotyped in 95 Vietnamese individuals (typhoid case/mother/father trios). A subset of data from 33 SNPs with a minor allele frequency of >4.3% was used to construct haplotypes. Fifteen SNPs, which tagged the 42 constructed haplotypes were selected. The haplotype tagging SNPs (T1-T15) were genotyped in 380 confirmed typhoid cases and 380 Vietnamese ethnically matched controls. Allelic frequencies of seven SNPs (T1, T2, T3, T5, T6, T7, T8) were significantly different between typhoid cases and controls. Logistic regression results support the hypothesis that there is just one signal associated with disease at this locus. Haplotype-based analysis of the tag SNPs provided positive evidence of association with typhoid (posterior probability 0.821). The analysis highlighted a low-risk cluster of haplotypes that each carry the minor allele of T1 or T7, but not both, and otherwise carry the combination of alleles *12122*1111 at T1-T11, further supporting the one associated signal hypothesis. Finally, individuals that carry the typhoid fever protective haplotype *12122*1111 also produce a relatively low TNF-α response to LPS. PMID:17503085
Haplotag: Software for Haplotype-Based Genotyping-by-Sequencing Analysis
Tinker, Nicholas A.; Bekele, Wubishet A.; Hattori, Jiro
2016-01-01
Genotyping-by-sequencing (GBS), and related methods, are based on high-throughput short-read sequencing of genomic complexity reductions followed by discovery of single nucleotide polymorphisms (SNPs) within sequence tags. This provides a powerful and economical approach to whole-genome genotyping, facilitating applications in genomics, diversity analysis, and molecular breeding. However, due to the complexity of analyzing large data sets, applications of GBS may require substantial time, expertise, and computational resources. Haplotag, the novel GBS software described here, is freely available, and operates with minimal user-investment on widely available computer platforms. Haplotag is unique in fulfilling the following set of criteria: (1) operates without a reference genome; (2) can be used in a polyploid species; (3) provides a discovery mode, and a production mode; (4) discovers polymorphisms based on a model of tag-level haplotypes within sequenced tags; (5) reports SNPs as well as haplotype-based genotypes; and (6) provides an intuitive visual “passport” for each inferred locus. Haplotag is optimized for use in a self-pollinating plant species. PMID:26818073
Haplotype diversity in 11 candidate genes across four populations.
Beaty, T H; Fallin, M D; Hetmanski, J B; McIntosh, I; Chong, S S; Ingersoll, R; Sheng, X; Chakraborty, R; Scott, A F
2005-09-01
Analysis of haplotypes based on multiple single-nucleotide polymorphisms (SNP) is becoming common for both candidate gene and fine-mapping studies. Before embarking on studies of haplotypes from genetically distinct populations, however, it is important to consider variation both in linkage disequilibrium (LD) and in haplotype frequencies within and across populations, as both vary. Such diversity will influence the choice of "tagging" SNPs for candidate gene or whole-genome association studies because some markers will not be polymorphic in all samples and some haplotypes will be poorly represented or completely absent. Here we analyze 11 genes, originally chosen as candidate genes for oral clefts, where multiple markers were genotyped on individuals from four populations. Estimated haplotype frequencies, measures of pairwise LD, and genetic diversity were computed for 135 European-Americans, 57 Chinese-Singaporeans, 45 Malay-Singaporeans, and 46 Indian-Singaporeans. Patterns of pairwise LD were compared across these four populations and haplotype frequencies were used to assess genetic variation. Although these populations are fairly similar in allele frequencies and overall patterns of LD, both haplotype frequencies and genetic diversity varied significantly across populations. Such haplotype diversity has implications for designing studies of association involving samples from genetically distinct populations.
Jannink, Jean-Luc
2010-01-01
Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933
Kullback-Leibler divergence for detection of rare haplotype common disease association.
Lin, Shili
2015-11-01
Rare haplotypes may tag rare causal variants of common diseases; hence, detection of such rare haplotypes may also contribute to our understanding of complex disease etiology. Because rare haplotypes frequently result from common single-nucleotide polymorphisms (SNPs), focusing on rare haplotypes is much more economical compared with using rare single-nucleotide variants (SNVs) from sequencing, as SNPs are available and 'free' from already amassed genome-wide studies. Further, associated haplotypes may shed light on the underlying disease causal mechanism, a feat unmatched by SNV-based collapsing methods. In recent years, data mining approaches have been adapted to detect rare haplotype association. However, as they rely on an assumed underlying disease model and require the specification of a null haplotype, results can be erroneous if such assumptions are violated. In this paper, we present a haplotype association method based on Kullback-Leibler divergence (hapKL) for case-control samples. The idea is to compare haplotype frequencies for the cases versus the controls by computing symmetrical divergence measures. An important property of such measures is that both the frequencies and logarithms of the frequencies contribute in parallel, thus balancing the contributions from rare and common, and accommodating both deleterious and protective, haplotypes. A simulation study under various scenarios shows that hapKL has well-controlled type I error rates and good power compared with existing data mining methods. Application of hapKL to age-related macular degeneration (AMD) shows a strong association of the complement factor H (CFH) gene with AMD, identifying several individual rare haplotypes with strong signals.
Single-molecule dilution and multiple displacement amplification for molecular haplotyping.
Paul, Philip; Apgar, Josh
2005-04-01
Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.
Boulanger, Jérôme; Muresan, Leila; Tiemann-Boege, Irene
2012-01-01
In spite of the many advances in haplotyping methods, it is still very difficult to characterize rare haplotypes in tissues and different environmental samples or to accurately assess the haplotype diversity in large mixtures. This would require a haplotyping method capable of analyzing the phase of single molecules with an unprecedented throughput. Here we describe such a haplotyping method capable of analyzing in parallel hundreds of thousands single molecules in one experiment. In this method, multiple PCR reactions amplify different polymorphic regions of a single DNA molecule on a magnetic bead compartmentalized in an emulsion drop. The allelic states of the amplified polymorphisms are identified with fluorescently labeled probes that are then decoded from images taken of the arrayed beads by a microscope. This method can evaluate the phase of up to 3 polymorphisms separated by up to 5 kilobases in hundreds of thousands single molecules. We tested the sensitivity of the method by measuring the number of mutant haplotypes synthesized by four different commercially available enzymes: Phusion, Platinum Taq, Titanium Taq, and Phire. The digital nature of the method makes it highly sensitive to detecting haplotype ratios of less than 1:10,000. We also accurately quantified chimera formation during the exponential phase of PCR by different DNA polymerases.
Linear reduction methods for tag SNP selection.
He, Jingwu; Zelikovsky, Alex
2004-01-01
It is widely hoped that constructing a complete human haplotype map will help to associate complex diseases with certain SNP's. Unfortunately, the number of SNP's is huge and it is very costly to sequence many individuals. Therefore, it is desirable to reduce the number of SNP's that should be sequenced to considerably small number of informative representatives, so called tag SNP's. In this paper, we propose a new linear algebra based method for selecting and using tag SNP's. Our method is purely combinatorial and can be combined with linkage disequilibrium (LD) and block based methods. We measure the quality of our tag SNP selection algorithm by comparing actual SNP's with SNP's linearly predicted from linearly chosen tag SNP's. We obtain an extremely good compression and prediction rates. For example, for long haplotypes (>25000 SNP's), knowing only 0.4% of all SNP's we predict the entire unknown haplotype with 2% accuracy while the prediction method is based on a 10% sample of the population.
Genetic analysis of autoimmune regulator haplotypes in alopecia areata.
Wengraf, D A; McDonagh, A J G; Lovewell, T R J; Vasilopoulos, Y; Macdonald-Hull, S P; Cork, M J; Messenger, A G; Tazi-Ahnini, R
2008-03-01
Alopecia areata is an immune-mediated disorder, occurring with the highest observed frequency in the rare recessive autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) syndrome caused by mutations of the autoimmune regulator (AIRE) gene on chromosome 21q22.3. We have previously detected association between alopecia areata and a single nucleotide polymorphism (SNP) in the AIRE gene in patients without APECED, and we now report the findings of an extended examination of the association of alopecia areata with haplotype analysis including six SNPs in the AIRE gene: C-103T, C4144G, T5238C, G6528A, T7215C and T11787C. In Caucasian groups of 295 patients and 363 controls, we found strong association between the AIRE 7215C allele and AA [P = 3.8 x 10(-8), OR (95% CI): 2.69 (1.8-4.0)]. The previously reported association between AA and the AIRE 4144G allele was no longer significant on correction for multiple testing. The AIRE haplotypes CCTGCT and CGTGCC showed a highly significant association with AA [P = 6.05 x 10(-6), 9.47 (2.91-30.8) and P = 0.001, 3.51 (1.55-7.95), respectively]. To select the haplotypes most informative for analysis, we tagged the polymorphisms using SNPTag software. Employing AIRE C-103T, G6528A, T7215C and T11787C as tag SNPs, two haplotypes were associated with AA; AIRE CGCT and AIRE CGCC [P = 3.84 x 10(-7), 11.40 (3.53-36.9) and P = 3.94 x 10(-4), 2.13 (1.39-3.24) respectively]. The AIRE risk haplotypes identified in this study potentially account for a major component of the genetic risk of developing alopecia areata.
Linear reduction method for predictive and informative tag SNP selection.
He, Jingwu; Westbrooks, Kelly; Zelikovsky, Alexander
2005-01-01
Constructing a complete human haplotype map is helpful when associating complex diseases with their related SNPs. Unfortunately, the number of SNPs is very large and it is costly to sequence many individuals. Therefore, it is desirable to reduce the number of SNPs that should be sequenced to a small number of informative representatives called tag SNPs. In this paper, we propose a new linear algebra-based method for selecting and using tag SNPs. We measure the quality of our tag SNP selection algorithm by comparing actual SNPs with SNPs predicted from selected linearly independent tag SNPs. Our experiments show that for sufficiently long haplotypes, knowing only 0.4% of all SNPs the proposed linear reduction method predicts an unknown haplotype with the error rate below 2% based on 10% of the population.
FamLBL: detecting rare haplotype disease association based on common SNPs using case-parent triads.
Wang, Meng; Lin, Shili
2014-09-15
In recent years, there has been an increasing interest in using common single-nucleotide polymorphisms (SNPs) amassed in genome-wide association studies to investigate rare haplotype effects on complex diseases. Evidence has suggested that rare haplotypes may tag rare causal single-nucleotide variants, making SNP-based rare haplotype analysis not only cost effective, but also more valuable for detecting causal variants. Although a number of methods for detecting rare haplotype association have been proposed in recent years, they are population based and thus susceptible to population stratification. We propose family-triad-based logistic Bayesian Lasso (famLBL) for estimating effects of haplotypes on complex diseases using SNP data. By choosing appropriate prior distribution, effect sizes of unassociated haplotypes can be shrunk toward zero, allowing for more precise estimation of associated haplotypes, especially those that are rare, thereby achieving greater detection power. We evaluate famLBL using simulation to gauge its type I error and power. Compared with its population counterpart, LBL, highlights famLBL's robustness property in the presence of population substructure. Further investigation by comparing famLBL with Family-Based Association Test (FBAT) reveals its advantage for detecting rare haplotype association. famLBL is implemented as an R-package available at http://www.stat.osu.edu/∼statgen/SOFTWARE/LBL/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
McCaskie, Pamela A; Carter, Kim W; McCaskie, Simon R; Palmer, Lyle J
2005-01-01
We used our newly developed linkage disequilibrium (LD) plotting software, JLIN, to plot linkage disequilibrium between pairs of single-nucleotide polymorphisms (SNPs) for three chromosomes of the Genetic Analysis Workshop 14 Aipotu simulated population to assess the effect of missing data on LD calculations. Our haplotype analysis program, SIMHAP, was used to assess the effect of missing data on haplotype-phenotype association. Genotype data was removed at random, at levels of 1%, 5%, and 10%, and the LD calculations and haplotype association results for these levels of missingness were compared to those for the complete dataset. It was concluded that ignoring individuals with missing data substantially affects the number of regions of LD detected which, in turn, could affect tagging SNPs chosen to generate haplotypes. PMID:16451612
The clinical application of single-sperm-based SNP haplotyping for PGD of osteogenesis imperfecta.
Chen, Linjun; Diao, Zhenyu; Xu, Zhipeng; Zhou, Jianjun; Yan, Guijun; Sun, Haixiang
2018-05-15
Osteogenesis imperfecta (OI) is a genetically heterogeneous disorder, presenting either autosomal dominant, autosomal recessive or X-linked inheritance patterns. The majority of OI cases are autosomal dominant and are caused by heterozygous mutations in either the COL1A1 or COL1A2 gene. In these dominant disorders, allele dropout (ADO) can lead to misdiagnosis in preimplantation genetic diagnosis (PGD). Polymorphic markers linked to the mutated genes have been used to establish haplotypes for identifying ADO and ensuring the accuracy of PGD. However, the haplotype of male patients cannot be determined without data from affected relatives. Here, we developed a method for single-sperm-based single-nucleotide polymorphism (SNP) haplotyping via next-generation sequencing (NGS) for the PGD of OI. After NGS, 10 informative polymorphic SNP markers located upstream and downstream of the COL1A1 gene and its pathogenic mutation site were linked to individual alleles in a single sperm from an affected male. After haplotyping, a normal blastocyst was transferred to the uterus for a subsequent frozen embryo transfer cycle. The accuracy of PGD was confirmed by amniocentesis at 19 weeks of gestation. A healthy infant weighing 4,250 g was born via vaginal delivery at the 40th week of gestation. Single-sperm-based SNP haplotyping can be applied for PGD of any monogenic disorders or de novo mutations in males in whom the haplotype of paternal mutations cannot be determined due to a lack of affected relatives. ADO: allele dropout; DI: dentinogenesis imperfect; ESHRE: European Society of Human Reproduction and Embryology; FET: frozen embryo transfer; gDNA: genomic DNA; ICSI: intracytoplasmic sperm injection; IVF: in vitro fertilization; MDA: multiple displacement amplification; NGS: next-generation sequencing; OI: osteogenesis imperfect; PBS: phosphate buffer saline; PCR: polymerase chain reaction; PGD: preimplantation genetic diagnosis; SNP: single-nucleotide polymorphism; STR
Common PCSK1 haplotypes are associated with obesity in the Chinese population.
Chang, Yi-Cheng; Chiu, Yen-Feng; Shih, Kuang-Chung; Lin, Ming-Wei; Sheu, Wayne Huey-Herng; Donlon, Timothy; Curb, Jess David; Jou, Yuh-Shan; Chang, Tien-Jyun; Li, Hung-Yuan; Chuang, Lee-Ming
2010-07-01
Prohormone convertase subtilisin/kexin type 1 (PCSK1) genetic polymorphisms have recently been associated with obesity in European populations. This study aimed to examine whether common PCSK1 genetic variation is associated with obesity and related metabolic phenotypes in the Chinese population. We genotyped nine common tag single-nucleotide polymorphisms (tagSNP) of the PCSK1 gene in 1,094 subjects of Chinese origin from the Stanford Asia-Pacific Program for Hypertension and Insulin Resistance (SAPPHIRe) family study. One SNP in the PCSK1 gene (rs155971) were nominally associated with risk of obesity in the SAPPHIRe cohort (P = 0.01). A common protective haplotype was associated with reduced risk of obesity (23.79% vs. 32.89%, P = 0.01) and smaller waist circumference (81.71 +/- 10.22 vs. 84.75 +/- 10.48 cm, P = 0.02). Another common haplotype was significantly associated with increased risk of obesity (37.07% vs. 23.84%, P = 0.005). The global P value for haplotype association with obesity was 0.02. We also identified a suggestive association of another PCSK1 SNP (rs3811951) with fasting glucose, fasting insulin, homeostasis model assessment of insulin resistance (HOMA(IR)), triglycerides, and high-density lipoprotein cholesterol (P = 0.05, 0.003, 0.001, 0.04, and 0.04, respectively). These data indicate common PCSK1 genetic variants are associated with obesity in the Chinese population.
Efficient selection of tagging single-nucleotide polymorphisms in multiple populations.
Howie, Bryan N; Carlson, Christopher S; Rieder, Mark J; Nickerson, Deborah A
2006-08-01
Common genetic polymorphism may explain a portion of the heritable risk for common diseases, so considerable effort has been devoted to finding and typing common single-nucleotide polymorphisms (SNPs) in the human genome. Many SNPs show correlated genotypes, or linkage disequilibrium (LD), suggesting that only a subset of all SNPs (known as tagging SNPs, or tagSNPs) need to be genotyped for disease association studies. Based on the genetic differences that exist among human populations, most tagSNP sets are defined in a single population and applied only in populations that are closely related. To improve the efficiency of multi-population analyses, we have developed an algorithm called MultiPop-TagSelect that finds a near-minimal union of population-specific tagSNP sets across an arbitrary number of populations. We present this approach as an extension of LD-select, a tagSNP selection method that uses a greedy algorithm to group SNPs into bins based on their pairwise association patterns, although the MultiPop-TagSelect algorithm could be used with any SNP tagging approach that allows choices between nearly equivalent SNPs. We evaluate the algorithm by considering tagSNP selection in candidate-gene resequencing data and lower density whole-chromosome data. Our analysis reveals that an exhaustive search is often intractable, while the developed algorithm can quickly and reliably find near-optimal solutions even for difficult tagSNP selection problems. Using populations of African, Asian, and European ancestry, we also show that an optimal multi-population set of tagSNPs can be substantially smaller (up to 44%) than a typical set obtained through independent or sequential selection.
Novel and efficient tag SNPs selection algorithms.
Chen, Wen-Pei; Hung, Che-Lun; Tsai, Suh-Jen Jane; Lin, Yaw-Ling
2014-01-01
SNPs are the most abundant forms of genetic variations amongst species; the association studies between complex diseases and SNPs or haplotypes have received great attention. However, these studies are restricted by the cost of genotyping all SNPs; thus, it is necessary to find smaller subsets, or tag SNPs, representing the rest of the SNPs. In fact, the existing tag SNP selection algorithms are notoriously time-consuming. An efficient algorithm for tag SNP selection was presented, which was applied to analyze the HapMap YRI data. The experimental results show that the proposed algorithm can achieve better performance than the existing tag SNP selection algorithms; in most cases, this proposed algorithm is at least ten times faster than the existing methods. In many cases, when the redundant ratio of the block is high, the proposed algorithm can even be thousands times faster than the previously known methods. Tools and web services for haplotype block analysis integrated by hadoop MapReduce framework are also developed using the proposed algorithm as computation kernels.
APC Yin-Yang haplotype associated with colorectal cancer risk
GARRE, P.; DE LA HOYA, M.; INIESTA, P.; ROMERA, A.; LLOVET, P.; GONZALEZ, S.; PEREZ-SEGURA, P.; CAPELLA, G.; DIAZ-RUBIO, E.; CALDES, T.
2010-01-01
The Yin-Yang haplotype is defined as two mismatched haplotypes (Yin and Yang) representing the majority of the existing haplotypes in a particular genomic region. The human adenomatous polyposis coli (APC) gene shows a Yin-Yang haplotype pattern accounting for 84% of all of the haplotypes existing in the Spanish population. Several association studies have been published regarding APC gene variants (SNPs and haplotypes) and colorectal cancer (CRC) risk. However, no studies concerning diplotype structure and CRC risk have been conducted. The aim of the present study was to investigate whether the APC Yin-Yang homozygote diplotype is over-represented in patients with sporadic CRC when compared to its distribution in controls, and its association with CRC risk. TaqMan® assays were used to genotype three tagSNPs selected across the APC Yin-Yang region. Frequencies of the APC Yin-Yang tagSNP alleles, haplotype and diplotype of 378 CRC cases and 642 controls were compared. Two Spanish CRC group samples were included [Hospital Clínico San Carlos in Madrid (HCSC) and Instituto Catalán de Oncología in Barcelona (ICO)]. Analysis of 157 consecutive CRC patients and 405 control subjects from HCSC showed a significative effect for the risk of CRC (OR=1.93; 95% CI 1.32–2.81; P=0.001). However, this effect was not confirmed in 221 CRC patients and 237 control subjects from ICO (OR=0.89; 95% CI 0.61–1.28; P=0.521). We found a significant association between the APC homozygote Yin-Yang diplotype and the risk of colorectal cancer in the HCSC samples. However, we did not observe this association in the ICO samples. These observations suggest that a study with a larger Spanish cohort is necessary to confirm the effects of the APC Yin-Yang diplotype on the risk of CRC. PMID:22993613
APC Yin-Yang haplotype associated with colorectal cancer risk.
Garre, P; DE LA Hoya, M; Iniesta, P; Romera, A; Llovet, P; Gonzalez, S; Perez-Segura, P; Capella, G; Diaz-Rubio, E; Caldes, T
2010-09-01
The Yin-Yang haplotype is defined as two mismatched haplotypes (Yin and Yang) representing the majority of the existing haplotypes in a particular genomic region. The human adenomatous polyposis coli (APC) gene shows a Yin-Yang haplotype pattern accounting for 84% of all of the haplotypes existing in the Spanish population. Several association studies have been published regarding APC gene variants (SNPs and haplotypes) and colorectal cancer (CRC) risk. However, no studies concerning diplotype structure and CRC risk have been conducted. The aim of the present study was to investigate whether the APC Yin-Yang homozygote diplotype is over-represented in patients with sporadic CRC when compared to its distribution in controls, and its association with CRC risk. TaqMan(®) assays were used to genotype three tagSNPs selected across the APC Yin-Yang region. Frequencies of the APC Yin-Yang tagSNP alleles, haplotype and diplotype of 378 CRC cases and 642 controls were compared. Two Spanish CRC group samples were included [Hospital Clínico San Carlos in Madrid (HCSC) and Instituto Catalán de Oncología in Barcelona (ICO)]. Analysis of 157 consecutive CRC patients and 405 control subjects from HCSC showed a significative effect for the risk of CRC (OR=1.93; 95% CI 1.32-2.81; P=0.001). However, this effect was not confirmed in 221 CRC patients and 237 control subjects from ICO (OR=0.89; 95% CI 0.61-1.28; P=0.521). We found a significant association between the APC homozygote Yin-Yang diplotype and the risk of colorectal cancer in the HCSC samples. However, we did not observe this association in the ICO samples. These observations suggest that a study with a larger Spanish cohort is necessary to confirm the effects of the APC Yin-Yang diplotype on the risk of CRC.
A powerful approach reveals numerous expression quantitative trait haplotypes in multiple tissues.
Ying, Dingge; Li, Mulin Jun; Sham, Pak Chung; Li, Miaoxin
2018-04-26
Recently many studies showed single nucleotide polymorphisms (SNPs) affect gene expression and contribute to development of complex traits/diseases in a tissue context-dependent manner. However, little is known about haplotype's influence on gene expression and complex traits, which reflects the interaction effect between SNPs. In the present study, we firstly proposed a regulatory region guided eQTL haplotype association analysis approach, and then systematically investigate the expression quantitative trait loci (eQTL) haplotypes in 20 different tissues by the approach. The approach has a powerful design of reducing computational burden by the utilization of regulatory predictions for candidate SNP selection and multiple testing corrections on non-independent haplotypes. The application results in multiple tissues showed that haplotype-based eQTLs not only increased the number of eQTL genes in a tissue specific manner, but were also enriched in loci that associated with complex traits in a tissue-matched manner. In addition, we found that tag SNPs of eQTL haplotypes from whole blood were selectively enriched in certain combination of regulatory elements (e.g. promoters and enhancers) according to predicted chromatin states. In summary, this eQTL haplotype detection approach, together with the application results, shed insights into synergistic effect of sequence variants on gene expression and their susceptibility to complex diseases. The executable application "eHaplo" is implemented in Java and is publicly available at http://grass.cgs.hku.hk/limx/ehaplo/. jonsonfox@gmail.com, limiaoxin@mail.sysu.edu.cn. Supplementary data are available at Bioinformatics online.
Binan, Loïc; Mazzaferri, Javier; Choquet, Karine; Lorenzo, Louis-Etienne; Wang, Yu Chang; Affar, El Bachir; De Koninck, Yves; Ragoussis, Jiannis; Kleinman, Claudia L; Costantino, Santiago
2016-05-20
The ability to conduct image-based, non-invasive cell tagging, independent of genetic engineering, is key to cell biology applications. Here we introduce cell labelling via photobleaching (CLaP), a method that enables instant, specific tagging of individual cells based on a wide array of criteria such as shape, behaviour or positional information. CLaP uses laser illumination to crosslink biotin onto the plasma membrane, coupled with streptavidin conjugates to label individual cells for genomic, cell-tracking, flow cytometry or ultra-microscopy applications. We show that the incorporated mark is stable, non-toxic, retained for several days, and transferred by cell division but not to adjacent cells in culture. To demonstrate the potential of CLaP for genomic applications, we combine CLaP with microfluidics-based single-cell capture followed by transcriptome-wide next-generation sequencing. Finally, we show that CLaP can also be exploited for inducing transient cell adhesion to substrates for microengineering cultures with spatially patterned cell types.
Haplotype-Based Genotyping in Polyploids.
Clevenger, Josh P; Korani, Walid; Ozias-Akins, Peggy; Jackson, Scott
2018-01-01
Accurate identification of polymorphisms from sequence data is crucial to unlocking the potential of high throughput sequencing for genomics. Single nucleotide polymorphisms (SNPs) are difficult to accurately identify in polyploid crops due to the duplicative nature of polyploid genomes leading to low confidence in the true alignment of short reads. Implementing a haplotype-based method in contrasting subgenome-specific sequences leads to higher accuracy of SNP identification in polyploids. To test this method, a large-scale 48K SNP array (Axiom Arachis2) was developed for Arachis hypogaea (peanut), an allotetraploid, in which 1,674 haplotype-based SNPs were included. Results of the array show that 74% of the haplotype-based SNP markers could be validated, which is considerably higher than previous methods used for peanut. The haplotype method has been implemented in a standalone program, HAPLOSWEEP, which takes as input bam files and a vcf file and identifies haplotype-based markers. Haplotype discovery can be made within single reads or span paired reads, and can leverage long read technology by targeting any length of haplotype. Haplotype-based genotyping is applicable in all allopolyploid genomes and provides confidence in marker identification and in silico-based genotyping for polyploid genomics.
Tag SNP selection via a genetic algorithm.
Mahdevar, Ghasem; Zahiri, Javad; Sadeghi, Mehdi; Nowzari-Dalini, Abbas; Ahrabian, Hayedeh
2010-10-01
Single Nucleotide Polymorphisms (SNPs) provide valuable information on human evolutionary history and may lead us to identify genetic variants responsible for human complex diseases. Unfortunately, molecular haplotyping methods are costly, laborious, and time consuming; therefore, algorithms for constructing full haplotype patterns from small available data through computational methods, Tag SNP selection problem, are convenient and attractive. This problem is proved to be an NP-hard problem, so heuristic methods may be useful. In this paper we present a heuristic method based on genetic algorithm to find reasonable solution within acceptable time. The algorithm was tested on a variety of simulated and experimental data. In comparison with the exact algorithm, based on brute force approach, results show that our method can obtain optimal solutions in almost all cases and runs much faster than exact algorithm when the number of SNP sites is large. Our software is available upon request to the corresponding author.
Variation analysis and gene annotation of eight MHC haplotypes: The MHC Haplotype Project
Horton, Roger; Gibson, Richard; Coggill, Penny; Miretti, Marcos; Allcock, Richard J.; Almeida, Jeff; Forbes, Simon; Gilbert, James G. R.; Halls, Karen; Harrow, Jennifer L.; Hart, Elizabeth; Howe, Kevin; Jackson, David K.; Palmer, Sophie; Roberts, Anne N.; Sims, Sarah; Stewart, C. Andrew; Traherne, James A.; Trevanion, Steve; Wilming, Laurens; Rogers, Jane; de Jong, Pieter J.; Elliott, John F.; Sawcer, Stephen; Todd, John A.; Trowsdale, John
2008-01-01
The human major histocompatibility complex (MHC) is contained within about 4 Mb on the short arm of chromosome 6 and is recognised as the most variable region in the human genome. The primary aim of the MHC Haplotype Project was to provide a comprehensively annotated reference sequence of a single, human leukocyte antigen-homozygous MHC haplotype and to use it as a basis against which variations could be assessed from seven other similarly homozygous cell lines, representative of the most common MHC haplotypes in the European population. Comparison of the haplotype sequences, including four haplotypes not previously analysed, resulted in the identification of >44,000 variations, both substitutions and indels (insertions and deletions), which have been submitted to the dbSNP database. The gene annotation uncovered haplotype-specific differences and confirmed the presence of more than 300 loci, including over 160 protein-coding genes. Combined analysis of the variation and annotation datasets revealed 122 gene loci with coding substitutions of which 97 were non-synonymous. The haplotype (A3-B7-DR15; PGF cell line) designated as the new MHC reference sequence, has been incorporated into the human genome assembly (NCBI35 and subsequent builds), and constitutes the largest single-haplotype sequence of the human genome to date. The extensive variation and annotation data derived from the analysis of seven further haplotypes have been made publicly available and provide a framework and resource for future association studies of all MHC-associated diseases and transplant medicine. PMID:18193213
Single nucleotide polymorphisms and haplotypes associated with feed efficiency in beef cattle
2013-01-01
Background General, breed- and diet-dependent associations between feed efficiency in beef cattle and single nucleotide polymorphisms (SNPs) or haplotypes were identified on a population of 1321 steers using a 50 K SNP panel. Genomic associations with traditional two-step indicators of feed efficiency – residual feed intake (RFI), residual average daily gain (RADG), and residual intake gain (RIG) – were compared to associations with two complementary one-step indicators of feed efficiency: efficiency of intake (EI) and efficiency of gain (EG). Associations uncovered in a training data set were evaluated on independent validation data set. A multi-SNP model was developed to predict feed efficiency. Functional analysis of genes harboring SNPs significantly associated with feed efficiency and network visualization aided in the interpretation of the results. Results For the five feed efficiency indicators, the numbers of general, breed-dependent, and diet-dependent associations with SNPs (P-value < 0.0001) were 31, 40, and 25, and with haplotypes were six, ten, and nine, respectively. Of these, 20 SNP and six haplotype associations overlapped between RFI and EI, and five SNP and one haplotype associations overlapped between RADG and EG. This result confirms the complementary value of the one and two-step indicators. The multi-SNP models included 89 SNPs and offered a precise prediction of the five feed efficiency indicators. The associations of 17 SNPs and 7 haplotypes with feed efficiency were confirmed on the validation data set. Nine clusters of Gene Ontology and KEGG pathway categories (mean P-value < 0.001) including, 9nucleotide binding; ion transport, phosphorous metabolic process, and the MAPK signaling pathway were overrepresented among the genes harboring the SNPs associated with feed efficiency. Conclusions The general SNP associations suggest that a single panel of genomic variants can be used regardless of breed and diet. The breed- and diet
Sprengers, Andre M J; Caan, Matthan W A; Moerman, Kevin M; Nederveen, Aart J; Lamerichs, Rolf M; Stoker, Jaap
2013-04-01
This study proposes a scale space based algorithm for automated segmentation of single-shot tagged images of modest SNR. Furthermore the algorithm was designed for analysis of discontinuous or shearing types of motion, i.e. segmentation of broken tag patterns. The proposed algorithm utilises non-linear scale space for automatic segmentation of single-shot tagged images. The algorithm's ability to automatically segment tagged shearing motion was evaluated in a numerical simulation and in vivo. A typical shearing deformation was simulated in a Shepp-Logan phantom allowing for quantitative evaluation of the algorithm's success rate as a function of both SNR and the amount of deformation. For a qualitative in vivo evaluation tagged images showing deformations in the calf muscles and eye movement in a healthy volunteer were acquired. Both the numerical simulation and the in vivo tagged data demonstrated the algorithm's ability for automated segmentation of single-shot tagged MR provided that SNR of the images is above 10 and the amount of deformation does not exceed the tag spacing. The latter constraint can be met by adjusting the tag delay or the tag spacing. The scale space based algorithm for automatic segmentation of single-shot tagged MR enables the application of tagged MR to complex (shearing) deformation and the processing of datasets with relatively low SNR.
Association of galanin haplotypes with alcoholism and anxiety in two ethnically distinct populations
Belfer, I; Hipp, H; McKnight, C; Evans, C; Buzas, B; Bollettino, A; Albaugh, B; Virkkunen, M; Yuan, Q; Max, MB; Goldman, D; Enoch, MA
2009-01-01
The neuropeptide galanin (GAL) is widely expressed in the central nervous system. Animal studies have implicated GAL in alcohol abuse and anxiety: chronic ethanol intake increases hypothalamic GAL mRNA; high levels of stress increase GAL release in the central amygdala. The coding sequence of the galanin gene, GAL, is highly conserved and a functional polymorphism has not yet been found. The aim of our study was, for the first time, to identify GAL haplotypes and investigate associations with alcoholism and anxiety. Seven single-nucleotide polymorphisms (SNPs) spanning GAL were genotyped in 65 controls from five populations: US and Finnish Caucasians, African Americans, Plains and Southwestern Indians. A single haplotype block with little evidence of historical recombination was observed for each population. Four tag SNPs were then genotyped in DSM-III-R lifetime alcoholics and nonalcoholics from two population isolates: 514 Finnish Caucasian men and 331 Plains Indian men and women. Tridimensional Personality Questionnaire harm avoidance (HA) scores, a dimensional measure of anxiety, were obtained. There was a haplotype association with alcoholism in both the Finnish (P=0.001) and Plains Indian (P=0.004) men. The SNPs were also significantly associated. Alcoholics were divided into high and low HA groups (≥ and < mean HA of population). In the Finns, haplotype (P < 0.0001) and diplotype (P < 0.0001) distributions differed between high HA alcoholics, low HA alcoholics and nonalcoholics. Our results from two independent populations suggest that GAL may contribute to vulnerability to alcoholism, perhaps mediated by dimensional anxiety. PMID:16314872
N'Diaye, Amidou; Haile, Jemanesh K; Cory, Aron T; Clarke, Fran R; Clarke, John M; Knox, Ron E; Pozniak, Curtis J
2017-01-01
Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype
Haile, Jemanesh K.; Cory, Aron T.; Clarke, Fran R.; Clarke, John M.; Knox, Ron E.; Pozniak, Curtis J.
2017-01-01
Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype
Haralambieva, Iana H.; Dhiman, Neelam; Ovsyannikova, Inna G.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.
2010-01-01
Interferon (IFN)-induced antiviral genes are crucial players in innate antiviral defense and potential determinants of immune response heterogeneity. We selected 114 candidate SNPs from 12 antiviral genes using an LD tagSNP selection approach and genotyped them in a cohort of 738 schoolchildren immunized with two doses of rubella vaccine. Associations between SNPs/haplotypes and rubella virus-specific immune measures were assessed using linear regression methodologies. We identified 23 significant associations (p<0.05) between polymorphisms within the 2′-5′-oligoadenylate synthetase (OAS) gene cluster, and rubella virus-specific IL-2, IL-10, IL-6 secretion and antibody levels. The minor allele variants of three OAS1 SNPs (rs3741981/Ser162Gly, rs1051042/Thr361Arg, rs2660), located in a linkage disequilibrium block of functional importance, were significantly associated with an increase in rubella virus-specific IL-2/Th1 response (p≤0.024). Seven OAS1 and OAS3 promoter/regulatory SNPs were similarly associated with IL-2 secretion. Importantly, two SNPs (rs3741981 and rs10774670), independently cross-regulated rubella virus-specific IL-10 secretion levels (p≤0.031). Furthermore, both global tests and individual haplotype analyses revealed significant associations between OAS1 haplotypes and rubella virus-specific cytokine secretion. Our results suggest that innate immunity and OAS genetic variations are likely involved in modulating the magnitude and quality of the adaptive immune responses to live attenuated rubella vaccine. PMID:20079393
TUMOR HAPLOTYPE ASSEMBLY ALGORITHMS FOR CANCER GENOMICS
AGUIAR, DEREK; WONG, WENDY S.W.; ISTRAIL, SORIN
2014-01-01
The growing availability of inexpensive high-throughput sequence data is enabling researchers to sequence tumor populations within a single individual at high coverage. But, cancer genome sequence evolution and mutational phenomena like driver mutations and gene fusions are difficult to investigate without first reconstructing tumor haplotype sequences. Haplotype assembly of single individual tumor populations is an exceedingly difficult task complicated by tumor haplotype heterogeneity, tumor or normal cell sequence contamination, polyploidy, and complex patterns of variation. While computational and experimental haplotype phasing of diploid genomes has seen much progress in recent years, haplotype assembly in cancer genomes remains uncharted territory. In this work, we describe HapCompass-Tumor a computational modeling and algorithmic framework for haplotype assembly of copy number variable cancer genomes containing haplotypes at different frequencies and complex variation. We extend our polyploid haplotype assembly model and present novel algorithms for (1) complex variations, including copy number changes, as varying numbers of disjoint paths in an associated graph, (2) variable haplotype frequencies and contamination, and (3) computation of tumor haplotypes using simple cycles of the compass graph which constrain the space of haplotype assembly solutions. The model and algorithm are implemented in the software package HapCompass-Tumor which is available for download from http://www.brown.edu/Research/Istrail_Lab/. PMID:24297529
Paziewska, Agnieszka; Cukrowska, Bozena; Dabrowska, Michalina; Goryca, Krzysztof; Piatkowska, Magdalena; Kluska, Anna; Mikula, Michal; Karczmarski, Jakub; Oralewska, Beata; Rybak, Anna; Socha, Jerzy; Balabas, Aneta; Zeber-Lubecka, Natalia; Ambrozkiewicz, Filip; Konopka, Ewa; Trojanowska, Ilona; Zagroba, Malgorzata; Szperl, Malgorzata; Ostrowski, Jerzy
2015-01-01
Assessment of non-HLA variants alongside standard HLA testing was previously shown to improve the identification of potential coeliac disease (CD) patients. We intended to identify new genetic variants associated with CD in the Polish population that would improve CD risk prediction when used alongside HLA haplotype analysis. DNA samples of 336 CD and 264 unrelated healthy controls were used to create DNA pools for a genome wide association study (GWAS). GWAS findings were validated with individual HLA tag single nucleotide polymorphism (SNP) typing of 473 patients and 714 healthy controls. Association analysis using four HLA-tagging SNPs showed that, as was found in other populations, positive predicting genotypes (HLA-DQ2.5/DQ2.5, HLA-DQ2.5/DQ2.2, and HLA-DQ2.5/DQ8) were found at higher frequencies in CD patients than in healthy control individuals in the Polish population. Both CD-associated SNPs discovered by GWAS were found in the CD susceptibility region, confirming the previously-determined association of the major histocompatibility (MHC) region with CD pathogenesis. The two most significant SNPs from the GWAS were rs9272346 (HLA-dependent; localized within 1 Kb of DQA1) and rs3130484 (HLA-independent; mapped to MSH5). Specificity of CD prediction using the four HLA-tagging SNPs achieved 92.9%, but sensitivity was only 45.5%. However, when a testing combination of the HLA-tagging SNPs and the MSH5 SNP was used, specificity decreased to 80%, and sensitivity increased to 74%. This study confirmed that improvement of CD risk prediction sensitivity could be achieved by including non-HLA SNPs alongside HLA SNPs in genetic testing.
Effects of IL-10 haplotype and atomic bomb radiation exposure on gastric cancer risk.
Hayashi, Tomonori; Ito, Reiko; Cologne, John; Maki, Mayumi; Morishita, Yukari; Nagamura, Hiroko; Sasaki, Keiko; Hayashi, Ikue; Imai, Kazue; Yoshida, Kengo; Kajimura, Junko; Kyoizumi, Seishi; Kusunoki, Yoichiro; Ohishi, Waka; Fujiwara, Saeko; Akahoshi, Masazumi; Nakachi, Kei
2013-07-01
Gastric cancer (GC) is one of the cancers that reveal increased risk of mortality and incidence in atomic bomb survivors. The incidence of gastric cancer in the Life Span Study cohort of the Radiation Effects Research Foundation (RERF) increased with radiation dose (gender-averaged excess relative risk per Gy = 0.28) and remains high more than 65 years after exposure. To assess a possible role of gene-environment interaction, we examined the dose response for gastric cancer incidence based on immunosuppression-related IL-10 genotype, in a cohort study with 200 cancer cases (93 intestinal, 96 diffuse and 11 other types) among 4,690 atomic bomb survivors participating in an immunological substudy. Using a single haplotype block composed of four haplotype-tagging SNPs (comprising the major haplotype allele IL-10-ATTA and the minor haplotype allele IL-10-GGCG, which are categorized by IL-10 polymorphisms at -819A>G and -592T>G, +1177T>C and +1589A>G), multiplicative and additive models for joint effects of radiation and this IL-10 haplotyping were examined. The IL-10 minor haplotype allele(s) was a risk factor for intestinal type gastric cancer but not for diffuse type gastric cancer. Radiation was not associated with intestinal type gastric cancer. In diffuse type gastric cancer, the haplotype-specific excess relative risk (ERR) for radiation was statistically significant only in the major homozygote category of IL-10 (ERR = 0.46/Gy, P = 0.037), whereas estimated ERR for radiation with the minor IL-10 homozygotes was close to 0 and nonsignificant. Thus, the minor IL-10 haplotype might act to reduce the radiation related risk of diffuse-type gastric cancer. The results suggest that this IL-10 haplotyping might be involved in development of radiation-associated gastric cancer of the diffuse type, and that IL-10 haplotypes may explain individual differences in the radiation-related risk of gastric cancer. © 2013 by Radiation Research Society
HLA Type Inference via Haplotypes Identical by Descent
NASA Astrophysics Data System (ADS)
Setty, Manu N.; Gusev, Alexander; Pe'Er, Itsik
The Human Leukocyte Antigen (HLA) genes play a major role in adaptive immune response and are used to differentiate self antigens from non self ones. HLA genes are hyper variable with nearly every locus harboring over a dozen alleles. This variation plays an important role in susceptibility to multiple autoimmune diseases and needs to be matched on for organ transplantation. Unfortunately, HLA typing by serological methods is time consuming and expensive compared to high throughput Single Nucleotide Polymorphism (SNP) data. We present a new computational method to infer per-locus HLA types using shared segments Identical By Descent (IBD), inferred from SNP genotype data. IBD information is modeled as graph where shared haplotypes are explored among clusters of individuals with known and unknown HLA types to identify the latter. We analyze performance of the method in a previously typed subset of the HapMap population, achieving accuracy of 96% in HLA-A, 94% in HLA-B, 95% in HLA-C, 77% in HLA-DR1, 93% in HLA-DQA1 and 90% in HLA-DQB1 genes. We compare our method to a tag SNP based approach and demonstrate higher sensitivity and specificity. Our method demonstrates the power of using shared haplotype segments for large-scale imputation at the HLA locus.
Prion gene haplotypes of U.S. cattle
Clawson, Michael L; Heaton, Michael P; Keele, John W; Smith, Timothy PL; Harhay, Gregory P; Laegreid, William W
2006-01-01
Background Bovine spongiform encephalopathy (BSE) is a fatal neurological disorder characterized by abnormal deposits of a protease-resistant isoform of the prion protein. Characterizing linkage disequilibrium (LD) and haplotype networks within the bovine prion gene (PRNP) is important for 1) testing rare or common PRNP variation for an association with BSE and 2) interpreting any association of PRNP alleles with BSE susceptibility. The objective of this study was to identify polymorphisms and haplotypes within PRNP from the promoter region through the 3'UTR in a diverse sample of U.S. cattle genomes. Results A 25.2-kb genomic region containing PRNP was sequenced from 192 diverse U.S. beef and dairy cattle. Sequence analyses identified 388 total polymorphisms, of which 287 have not previously been reported. The polymorphism alleles define PRNP by regions of high and low LD. High LD is present between alleles in the promoter region through exon 2 (6.7 kb). PRNP alleles within the majority of intron 2, the entire coding sequence and the untranslated region of exon 3 are in low LD (18.0 kb). Two haplotype networks, one representing the region of high LD and the other the region of low LD yielded nineteen different combinations that represent haplotypes spanning PRNP. The haplotype combinations are tagged by 19 polymorphisms (htSNPS) which characterize variation within and across PRNP. Conclusion The number of polymorphisms in the prion gene region of U.S. cattle is nearly four times greater than previously described. These polymorphisms define PRNP haplotypes that may influence BSE susceptibility in cattle. PMID:17092337
Single cell analysis using surface enhanced Raman scattering (SERS) tags
Nolan, John P.; Duggan, Erika; Liu, Er; Condello, Danilo; Dave, Isha; Stoner, Samuel A.
2013-01-01
Fluorescence is a mainstay of bioanalytical methods, offering sensitive and quantitative reporting, often in multiplexed or multiparameter assays. Perhaps the best example of the latter is flow cytometry, where instruments equipped with multiple lasers and detectors allow measurement of 15 or more different fluorophores simultaneously, but increases beyond this number are limited by the relatively broad emission spectra. Surface enhanced Raman scattering (SERS) from metal nanoparticles can produce signal intensities that rival fluorescence, but with narrower spectral features that allow a greater degree of multiplexing. We are developing nanoparticle SERS tags as well as Raman flow cytometers for multiparameter single cell analysis of suspension or adherent cells. SERS tags are based on plasmonically active nanoparticles (gold nanorods) whose plasmon resonance can be tuned to give optimal SERS signals at a desired excitation wavelength. Raman resonant compounds are adsorbed on the nanoparticles to confer a unique spectral fingerprint on each SERS tag, which are then encapsulated in a polymer coating for conjugation to antibodies or other targeting molecules. Raman flow cytometry employs a high resolution spectral flow cytometer capable of measuring the complete SERS spectra, as well as conventional flow cytometry measurements, from thousands of individual cells per minute. Automated spectral unmixing algorithms extract the contributions of each SERS tag from each cell to generate high content, multiparameter single cell population data. SERS-based cytometry is a powerful complement to conventional fluorescence-based cytometry. The narrow spectral features of the SERS signal enables more distinct probes to be measured in a smaller region of the optical spectrum with a single laser and detector, allowing for higher levels of multiplexing and multiparameter analysis. PMID:22498143
Study of π 0 pair production in single-tag two-photon collisions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Masuda, M.; Uehara, S.; Watanabe, Y.
2016-02-01
We report a measurement of the differential cross section of π^0 pair production in single-tag two-photon collisions, y*y->π^0π^0, in e+e- scattering. The cross section is measured for Q^2up to 30 GeV^2 is the negative of the invariant mass squared of the tagged photon
Steady-state free precession with myocardial tagging: CSPAMM in a single breathhold.
Zwanenburg, Jaco J M; Kuijer, Joost P A; Marcus, J Tim; Heethaar, Robert M
2003-04-01
A method is presented that combines steady-state free precession (SSFP) cine imaging with myocardial tagging. Before the tagging preparation at each ECG-R wave, the steady-state magnetization is stored as longitudinal magnetization by an alpha/2 flip-back pulse. Imaging is continued immediately after tagging preparation, using linearly increasing startup angles (LISA) with a rampup over 10 pulses. Interleaved segmented k-space ordering is used to prevent artifacts from the increasing signal during the LISA rampup. First, this LISA-SSFP method was evaluated regarding ghost artifacts from the steady-state interruption by comparing LISA with an alpha/2 startup method. Next, LISA-SSFP was compared with spoiled gradient echo (SGRE) imaging, regarding tag contrast-to-noise ratio and tag persistence. The measurements were performed in phantoms and in six subjects applying breathhold cine imaging with tagging (temporal resolution 51 ms). The results show that ghost artifacts are negligible for the LISA method. Compared to the SGRE reference, LISA-SSFP was two times faster, with a slightly better tag contrast-to-noise. Additionally, the tags persisted 126 ms longer with LISA-SSFP than with SGRE imaging. The high efficiency of LISA-SSFP enables the acquisition of complementary tagged (CSPAMM) images in a single breathhold. Copyright 2003 Wiley-Liss, Inc.
Association between endothelin type A receptor haplotypes and mortality in coronary heart disease.
Ellis, Katrina L; Pilbrow, Anna P; Potter, Howard C; Frampton, Chris M; Doughty, Rob N; Whalley, Gillian A; Ellis, Chris J; Palmer, Barry R; Skelton, Lorraine; Yandle, Tim G; Troughton, Richard W; Richards, A Mark; A Cameron, Vicky
2012-05-01
The endothelin type A receptor, encoded by EDNRA, mediates the effects of endothelin-1 to promote vasoconstriction, vascular cell growth, adhesion, fibrosis and thrombosis. We investigated the association between EDNRA haplotype and cardiovascular outcomes in patients with coronary artery disease. Coronary disease patients (n = 1007) were genotyped for the His323His (rs5333) variant and one tag SNP from each of the major EDNRA haplotype blocks (rs6537484, rs1568136, rs5335 and rs10003447). EDNRA haplotype associations with clinical history, natriuretic peptides cardiac function and cardiovascular outcomes were tested over a median 3.8 years. Univariate analysis identified a 'low-risk' EDNRA haplotype associated with later age of Type 2 diabetes onset (p = 0.004) smaller BMI (p = 0.021), and reduced mortality (log rank p = 0.001). Cox proportional hazards analysis including established cardiovascular risk factors revealed an independent association between haplotype and mortality (p < 0.0001). These data highlight the potential importance of the endothelin system, and in particular EDNRA in coronary disease.
Haplotypes in the APOA1-C3-A4-A5 gene cluster affect plasma lipids in both humans and baboons
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Qian-fei; Liu, Xin; O'Connell, Jeff
2003-09-15
Genetic studies in non-human primates serve as a potential strategy for identifying genomic intervals where polymorphisms impact upon human disease-related phenotypes. It remains unclear, however, whether independently arising polymorphisms in orthologous regions of non-human primates leads to similar variation in a quantitative trait found in both species. To explore this paradigm, we studied a baboon apolipoprotein gene cluster (APOA1/C3/A4/A5) for which the human gene orthologs have well established roles in influencing plasma HDL-cholesterol and triglyceride concentrations. Our extensive polymorphism analysis of this 68 kb gene cluster in 96 pedigreed baboons identified several haplotype blocks each with limited diversity, consistent withmore » haplotype findings in humans. To determine whether baboons, like humans, also have particular haplotypes associated with lipid phenotypes, we genotyped 634 well characterized baboons using 16 haplotype tagging SNPs. Genetic analysis of single SNPs, as well as haplotypes, revealed an association of APOA5 and APOC3 variants with HDL cholesterol and triglyceride concentrations, respectively. Thus, independent variation in orthologous genomic intervals does associate with similar quantitative lipid traits in both species, supporting the possibility of uncovering human QTL genes in a highly controlled non-human primate model.« less
Population Structure With Localized Haplotype Clusters
Browning, Sharon R.; Weir, Bruce S.
2010-01-01
We propose a multilocus version of FST and a measure of haplotype diversity using localized haplotype clusters. Specifically, we use haplotype clusters identified with BEAGLE, which is a program implementing a hidden Markov model for localized haplotype clustering and performing several functions including inference of haplotype phase. We apply this methodology to HapMap phase 3 data. With this haplotype-cluster approach, African populations have highest diversity and lowest divergence from the ancestral population, East Asian populations have lowest diversity and highest divergence, and other populations (European, Indian, and Mexican) have intermediate levels of diversity and divergence. These relationships accord with expectation based on other studies and accepted models of human history. In contrast, the population-specific FST estimates obtained directly from single-nucleotide polymorphisms (SNPs) do not reflect such expected relationships. We show that ascertainment bias of SNPs has less impact on the proposed haplotype-cluster-based FST than on the SNP-based version, which provides a potential explanation for these results. Thus, these new measures of FST and haplotype-cluster diversity provide an important new tool for population genetic analysis of high-density SNP data. PMID:20457877
Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population.
Saeki, Mayumi; Saito, Yoshiro; Nakamura, Takahiro; Murayama, Norie; Kim, Su-Ryang; Ozawa, Shogo; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Nakajima, Toshiharu; Saito, Hirohisa; Kitamura, Yutaka; Kamatani, Naoyuki; Sawada, Jun-ichi
2003-06-01
In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese. Copyright 2003 Wiley-Liss, Inc.
Peters, Bart D; Voineskos, Aristotle N; Szeszko, Philip R; Lett, Tristram A; DeRosse, Pamela; Guha, Saurav; Karlsgodt, Katherine H; Ikuta, Toshikazu; Felsky, Daniel; John, Majnu; Rotenberg, David J; Kennedy, James L; Lencz, Todd; Malhotra, Anil K
2014-04-30
The genetic and molecular pathways driving human brain white matter (WM) development are only beginning to be discovered. Long chain polyunsaturated fatty acids (LC-PUFAs) have been implicated in myelination in animal models and humans. The biosynthesis of LC-PUFAs is regulated by the fatty acid desaturase (FADS) genes, of which a human-specific haplotype is strongly associated with ω-3 and ω-6 LC-PUFA concentrations in blood. To investigate the relationship between LC-PUFA synthesis and human brain WM development, we examined whether this FADS haplotype is associated with age-related WM differences across the life span in healthy individuals 9-86 years of age (n = 207). Diffusion tensor imaging was performed to measure fractional anisotropy (FA), a putative measure of myelination, of the cerebral WM tracts. FADS haplotype status was determined with a single nucleotide polymorphism (rs174583) that tags this haplotype. Overall, normal age-related WM differences were observed, including higher FA values in early adulthood compared with childhood, followed by lower FA values across older age ranges. However, individuals homozygous for the minor allele (associated with lower LC-PUFA concentrations) did not display these normal age-related WM differences (significant age × genotype interactions, p(corrected) < 0.05). These findings suggest that LC-PUFAs are involved in human brain WM development from childhood into adulthood. This haplotype and LC-PUFAs may play a role in myelin-related disorders of neurodevelopmental origin.
In Vivo Characterization of Human APOA5 Haplotypes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahituv, Nadav; Akiyama, Jennifer; Chapman-Helleboid, Audrey
2006-10-01
Increased plasma triglycerides concentrations are an independent risk factor for cardiovascular disease. Numerous studies support a reproducible genetic association between two minor haplotypes in the human apolipoprotein A5 gene (APOA5) and increased plasma triglyceride concentrations. We thus sought to investigate the effect of these minor haplotypes (APOA5*2 and APOA5*3) on ApoAV plasma levels through the precise insertion of single-copy intact APOA5 haplotypes at a targeted location in the mouse genome. While we found no difference in the amount of human plasma ApoAV in mice containing the common APOA5*1 and minor APOA5*2 haplotype, the introduction of the single APOA5*3 defining allelemore » (19W) resulted in 3-fold lower ApoAV plasma levels consistent with existing genetic association studies. These results indicate that S19W polymorphism is likely to be functional and explain the strong association of this variant with plasma triglycerides supporting the value of sensitive in vivo assays to define the functional nature of human haplotypes.« less
Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue
2016-01-01
DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962
Haplotype-based approach to known MS-associated regions increases the amount of explained risk
Khankhanian, Pouya; Gourraud, Pierre-Antoine; Lizee, Antoine; Goodin, Douglas S
2015-01-01
Genome-wide association studies (GWAS), using single nucleotide polymorphisms (SNPs), have yielded 110 non-human leucocyte antigen genomic regions that are associated with multiple sclerosis (MS). Despite this large number of associations, however, only 28% of MS-heritability can currently be explained. Here we compare the use of multi-SNP-haplotypes to the use of single-SNPs as alternative methods to describe MS genetic risk. SNP-haplotypes (of various lengths from 1 up to 15 contiguous SNPs) were constructed at each of the 110 previously identified, MS-associated, genomic regions. Even after correcting for the larger number of statistical comparisons made when using the haplotype-method, in 32 of the regions, the SNP-haplotype based model was markedly more significant than the single-SNP based model. By contrast, in no region was the single-SNP based model similarly more significant than the SNP-haplotype based model. Moreover, when we included the 932 MS-associated SNP-haplotypes (that we identified from 102 regions) as independent variables into a logistic linear model, the amount of MS-heritability, as assessed by Nagelkerke's R-squared, was 38%, which was considerably better than 29%, which was obtained by using only single-SNPs. This study demonstrates that SNP-haplotypes can be used to fine-map the genetic associations within regions of interest previously identified by single-SNP GWAS. Moreover, the amount of the MS genetic risk explained by the SNP-haplotype associations in the 110 MS-associated genomic regions was considerably greater when using SNP-haplotypes than when using single-SNPs. Also, the use of SNP-haplotypes can lead to the discovery of new regions of interest, which have not been identified by a single-SNP GWAS. PMID:26185143
Stephens, J C; Rogers, J; Ruano, G
1990-01-01
In a recent paper we have shown that DNA haplotypes of multiply heterozygous individuals can be resolved directly by polymerase-chain-reaction (PCR) amplification of a single molecule of genomic template. Our method (the single-molecule-dilution [SMD] method) relies on the stochastic separation of maternal and paternal alleles at high dilution. The stochasticity of separation and the potential for DNA shearing (which could separate the loci of interest) are two factors that can compromise the results of the experiment. This paper explores the consequences of these two factors and shows that the SMD method can be expected to work very reliably even in the presence of a moderate amount of DNA shearing. PMID:2339707
Detecting local haplotype sharing and haplotype association
USDA-ARS?s Scientific Manuscript database
A novel haplotype association method is presented, and its power is demonstrated. Relying on a statistical model for linkage disequilibrium (LD), the method first infers ancestral haplotypes and their loadings at each marker for each individual. The loadings are then used to quantify local haplotype...
Suarez-Kurtz, Guilherme; Fuchshuber-Moraes, Mateus; Struchiner, Claudio J; Parra, Esteban J
2016-08-01
Several algorithms have been proposed to reduce the genotyping effort and cost, while retaining the accuracy of N-acetyltransferase-2 (NAT2) phenotype prediction. Data from the 1000 Genomes (1KG) project and an admixed cohort of Black Brazilians were used to assess the accuracy of NAT2 phenotype prediction using algorithms based on paired single nucleotide polymorphisms (SNPs) (rs1041983 and rs1801280) or a tag SNP (rs1495741). NAT2 haplotypes comprising SNPs rs1801279, rs1041983, rs1801280, rs1799929, rs1799930, rs1208 and rs1799931 were assigned according to the arylamine N-acetyltransferases database. Contingency tables were used to visualize the agreement between the NAT2 acetylator phenotypes on the basis of these haplotypes versus phenotypes inferred by the prediction algorithms. The paired and tag SNP algorithms provided more than 96% agreement with the 7-SNP derived phenotypes in Europeans, East Asians, South Asians and Admixed Americans, but discordance of phenotype prediction occurred in 30.2 and 24.8% 1KG Africans and in 14.4 and 18.6% Black Brazilians, respectively. Paired SNP panel misclassification occurs in carriers of NATs haplotypes *13A (282T alone), *12B (282T and 803G), *6B (590A alone) and *14A (191A alone), whereas haplotype *14, defined by the 191A allele, is the major culprit of misclassification by the tag allele. Both the paired SNP and the tag SNP algorithms may be used, with economy of scale, to infer NAT2 acetylator phenotypes, including the ultra-slow phenotype, in European, East Asian, South Asian and American populations represented in the 1KG cohort. Both algorithms, however, perform poorly in populations of predominant African descent, including admixed African-Americans, African Caribbeans and Black Brazilians.
Y-SNPs haplotype diversity in four Chinese cattle breeds.
Zhang, Runfeng; Cheng, Ming; Li, Xiaofeng; Chen, Fuying; Zheng, Jing; Wang, Xiaofei; Meng, Quanke
2013-01-01
To investigate the genetic diversity of Chinese cattle, 96 male samples of 4 Chinese native cattle breeds were investigated using 5 single nucleotide polymorphisms specific to the bovine Y chromosome. Two previously described haplotypes (taurine Y2 and indicine Y3) were detected in 74 and 22 animals, respectively. The haplotype frequencies varied amongst the four native breeds. The taurine Y2 haplotype dominated in the Qinchuan, Dabieshan, and Yunba breeds. However, the indicine Y3 haplotype occurred in high frequency in the Enshi breed. Among the four native breeds, Yunba had the highest haplotype diversity (0.4330 ± 0.0750), followed by Qinchuan (0.2899 ± 0.1028) and Enshi (0.2222 ± 0.1662), Dabieshan was the least differentiated (0.1079 ± 0.0680). Compared with some foreign cattle breeds, the low level of haplotype diversity was detected in our breeds (0.2633 ± 0.1030).
Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K
2017-09-01
Oxytocin is a potent uterotonic agent that is widely used for induction and augmentation of labor. Oxytocin has a narrow therapeutic index and the optimal dosing for any individual woman varies widely. The objective of this study was to determine whether genetic variation in the oxytocin receptor (OXTR) or in the gene encoding G protein-coupled receptor kinase 6 (GRK6), which regulates desensitization of the oxytocin receptor, could explain variation in oxytocin dosing and labor outcomes among women being induced near term. Pregnant women with a singleton gestation residing in Durham County, NC, were prospectively enrolled as part of the Healthy Pregnancy, Healthy Baby cohort study. Those women undergoing an induction of labor at 36 weeks or greater were genotyped for 18 haplotype-tagging single-nucleotide polymorphisms in OXTR and 7 haplotype-tagging single-nucleotide polymorphisms in GRK6 using TaqMan assays. Linear regression was used to examine the relationship between maternal genotype and maximal oxytocin infusion rate, total oxytocin dose received, and duration of labor. Logistic regression was used to test for the association of maternal genotype with mode of delivery. For each outcome, backward selection techniques were utilized to control for important confounding variables and additive genetic models were used. Race/ethnicity was included in all models because of differences in allele frequencies across populations, and Bonferroni correction for multiple testing was used. DNA was available from 482 women undergoing induction of labor at 36 weeks or greater. Eighteen haplotype-tagging single-nucleotide polymorphisms within OXTR and 7 haplotype-tagging single-nucleotide polymorphisms within GRK6 were examined. Five single-nucleotide polymorphisms in OXTR showed nominal significance with maximal infusion rate of oxytocin, and two single-nucleotide polymorphisms in OXTR were associated with total oxytocin dose received. One single-nucleotide polymorphism in
Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.
2013-01-01
Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145
Nahajevszky, Sarolta; Andrikovics, Hajnalka; Batai, Arpad; Adam, Emma; Bors, Andras; Csomor, Judit; Gopcsa, Laszlo; Koszarska, Magdalena; Kozma, Andras; Lovas, Nora; Lueff, Sandor; Matrai, Zoltan; Meggyesi, Nora; Sinko, Janos; Sipos, Andrea; Varkonyi, Andrea; Fekete, Sandor; Tordai, Attila; Masszi, Tamas
2011-01-01
Background Prognostic risk stratification according to acquired or inherited genetic alterations has received increasing attention in acute myeloid leukemia in recent years. A germline Janus kinase 2 haplotype designated as the 46/1 haplotype has been reported to be associated with an inherited predisposition to myeloproliferative neoplasms, and also to acute myeloid leukemia with normal karyotype. The aim of this study was to assess the prognostic impact of the 46/1 haplotype on disease characteristics and treatment outcome in acute myeloid leukemia. Design and Methods Janus kinase 2 rs12343867 single nucleotide polymorphism tagging the 46/1 haplotype was genotyped by LightCycler technology applying melting curve analysis with the hybridization probe detection format in 176 patients with acute myeloid leukemia under 60 years diagnosed consecutively and treated with curative intent. Results The morphological subtype of acute myeloid leukemia with maturation was less frequent among 46/1 carriers than among non-carriers (5.6% versus 17.2%, P=0.018, cytogenetically normal subgroup: 4.3% versus 20.6%, P=0.031), while the morphological distribution shifted towards the myelomonocytoid form in 46/1 haplotype carriers (28.1% versus 14.9%, P=0.044, cytogenetically normal subgroup: 34.0% versus 11.8%, P=0.035). In cytogenetically normal cases of acute myeloid leukemia, the 46/1 carriers had a considerably lower remission rate (78.7% versus 94.1%, P=0.064) and more deaths in remission or in aplasia caused by infections (46.8% versus 23.5%, P=0.038), resulting in the 46/1 carriers having shorter disease-free survival and overall survival compared to the 46/1 non-carriers. In multivariate analysis, the 46/1 haplotype was an independent adverse prognostic factor for disease-free survival (P=0.024) and overall survival (P=0.024) in patients with a normal karyotype. Janus kinase 2 46/1 haplotype had no impact on prognosis in the subgroup with abnormal karyotype. Conclusions Janus
González-Enríquez, G V; Torres-Mendoza, B M; Márquez-Pedroza, J; Macías-Islas, M A; Ortiz, G G; Cruz-Ramos, J A
2018-02-03
The HLA-DRB1*15:01 allele has a demonstrated risk for the development of multiple sclerosis (MS) in most populations around the world. The single nucleotide polymorphism (SNP) rs3129934 is found in linkage disequilibrium with the risk haplotype formed by the HLA-DRB1*15:01 and HLA-DQB1*06:02 alleles, and it is considered a reliable marker of the presence of this haplotype. Native Americans have a null or low prevalence of MS. In this study, we sought to identify the frequency of rs3129934 in the Wixárika ethnic group as well as in Mestizo (mixed race) patients with MS and in controls from western Mexico. Through real-time polymerase chain reaction (PCR) using TaqMan probes, we analyzed the allele and genotype frequencies of rs3129934 in Mestizo individuals with and without MS and in 73 Wixárika subjects from the state of Jalisco, Mexico. The Wixárika subjects were homozygote for the C allele of rs3129934. The allele and genotype frequency in Mestizos with MS was similar to that of other MS populations with Caucasian ancestry. The absence of the T risk allele rs3129934 (associated with the haplotype HLA-DRB1*15:01, HLA-DQ1*06:02) in this sample of Wixárika subjects is consistent with the unreported MS in this Amerindian group, related to absence of such paramount genetic risk factor.
The analysis of APOL1 genetic variation and haplotype diversity provided by 1000 Genomes project.
Peng, Ting; Wang, Li; Li, Guisen
2017-08-11
The APOL1 gene variants has been shown to be associated with an increased risk of multiple kinds of diseases, particularly in African Americans, but not in Caucasians and Asians. In this study, we explored the single nucleotide polymorphism (SNP) and haplotype diversity of APOL1 gene in different races provided by 1000 Genomes project. Variants of APOL1 gene in 1000 Genome Project were obtained and SNPs located in the regulatory region or coding region were selected for genetic variation analysis. Total 2504 individuals from 26 populations were classified as four groups that included Africa, Europe, Asia and Admixed populations. Tag SNPs were selected to evaluate the haplotype diversities in the four populations by HaploStats software. APOL1 gene was surrounded by some of the most polymorphic genes in the human genome, variation of APOL1 gene was common, with up to 613 SNP (1000 Genome Project reported) and 99 of them (16.2%) with MAF ≥ 1%. There were 79 SNPs in the URR and 92 SNPs in 3'UTR. Total 12 SNPs in URR and 24 SNPs in 3'UTR were considered as common variants with MAF ≥ 1%. It is worth noting that URR-1 was presents lower frequencies in European populations, while other three haplotypes taken an opposite pattern; 3'UTR presents several high-frequency variation sites in a short segment, and the differences of its haplotypes among different population were significant (P < 0.01), UTR-1 and UTR-5 presented much higher frequency in African population, while UTR-2, UTR-3 and UTR-4 were much lower. APOL1 coding region showed that two SNP of G1 with higher frequency are actually pull down the haplotype H-1 frequency when considering all populations pooled together, and the diversity among the four populations be widen by the G1 two mutation (P 1 = 3.33E-4 vs P 2 = 3.61E-30). The distributions of APOL1 gene variants and haplotypes were significantly different among the different populations, in either regulatory or coding regions. It could provide
González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B
2006-03-01
Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.
Retsas, Theodoros; Huse, Klaus; Lazaridis, Lazaros-Dimitrios; Karampela, Niki; Bauer, Michael; Platzer, Matthias; Kolonia, Virginia; Papageorgiou, Eirini; Giamarellos-Bourboulis, Evangelos J; Dimopoulos, George
2018-02-01
Several articles have provided conflicting results regarding the role of single nucleotide polymorphisms (SNPs) in the promoter region of the TNF gene in susceptibility to sepsis. Former articles have been based on previous definitions of sepsis. This study investigated the influence of TNF haplotypes on the development of sepsis using the new Sepsis-3 definitions. DNA was isolated from patients suffering from infection and systemic inflammatory response syndrome. Haplotyping was performed for six SNPs of TNF. The serum levels of tumour necrosis factor alpha (TNF-α) of these patients were measured using an enzyme immunosorbent assay. Patients were classified into infection and sepsis categories using the Sepsis-3 definitions. Associations between the TNF haplotypes and the clinical characteristics and serum TNF-α levels of the patients were examined. The most common TNF haplotype h1 was composed of major alleles of the studied SNPs. Carriage of haplotypes composed of minor frequency alleles was associated with a lower risk of developing sepsis (odds ratio 0.41, 95% confidence interval 0.19-0.88, p=0.022), but this did not affect the 28-day outcome. Serum TNF-α levels were significantly higher among patients homozygous for h1 haplotypes who developed sepsis compared to infection (p=0.032); a similar result was not observed for patients carrying other haplotypes. Haplotypes containing minor frequency SNP alleles of TNF protect against the development of sepsis without affecting the outcome. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
A parsimonious tree-grow method for haplotype inference.
Li, Zhenping; Zhou, Wenfeng; Zhang, Xiang-Sun; Chen, Luonan
2005-09-01
Haplotype information has become increasingly important in analyzing fine-scale molecular genetics data, such as disease genes mapping and drug design. Parsimony haplotyping is one of haplotyping problems belonging to NP-hard class. In this paper, we aim to develop a novel algorithm for the haplotype inference problem with the parsimony criterion, based on a parsimonious tree-grow method (PTG). PTG is a heuristic algorithm that can find the minimum number of distinct haplotypes based on the criterion of keeping all genotypes resolved during tree-grow process. In addition, a block-partitioning method is also proposed to improve the computational efficiency. We show that the proposed approach is not only effective with a high accuracy, but also very efficient with the computational complexity in the order of O(m2n) time for n single nucleotide polymorphism sites in m individual genotypes. The software is available upon request from the authors, or from http://zhangroup.aporc.org/bioinfo/ptg/ chen@elec.osaka-sandai.ac.jp Supporting materials is available from http://zhangroup.aporc.org/bioinfo/ptg/bti572supplementary.pdf
Zhao, Na; Xiao, Jianqiu; Zheng, Zhiyong; Fei, Guoqiang; Zhang, Feng; Jin, Lirong; Zhong, Chunjiu
2015-04-01
Our previous studies have demonstrated that ceruloplasmin (CP) dysmetabolism is correlated with Parkinson's disease (PD). However, the causes of decreased serum CP levels in PD patients remain to be clarified. This study aimed to explore the potential association between genetic variants of the CP gene and PD. Clinical features, serum CP levels, and the CP gene (both promoter and coding regions) were analyzed in 60 PD patients and 50 controls. A luciferase reporter system was used to investigate the function of promoter single-nucleotide polymorphisms (SNPs). High-density comparative genomic hybridization microarrays were also used to detect large-scale copy-number variations in CP and an additional 47 genes involved in PD and/or copper/iron metabolism. The frequencies of eight SNPs (one intronic SNP and seven promoter SNPs of the CP gene) and their haplotypes were significantly different between PD patients, especially those with lowered serum CP levels, and controls. However, the luciferase reporter system revealed no significant effect of the risk haplotype on promoter activity of the CP gene. Neither these SNPs nor their haplotypes were correlated with the Hoehn and Yahr staging of PD. The results of this study suggest that common genetic variants of CP are associated with PD and further investigation is needed to explore their functions in PD.
Haplotype-Based Association Analysis via Variance-Components Score Test
Tzeng, Jung-Ying ; Zhang, Daowen
2007-01-01
Haplotypes provide a more informative format of polymorphisms for genetic association analysis than do individual single-nucleotide polymorphisms. However, the practical efficacy of haplotype-based association analysis is challenged by a trade-off between the benefits of modeling abundant variation and the cost of the extra degrees of freedom. To reduce the degrees of freedom, several strategies have been considered in the literature. They include (1) clustering evolutionarily close haplotypes, (2) modeling the level of haplotype sharing, and (3) smoothing haplotype effects by introducing a correlation structure for haplotype effects and studying the variance components (VC) for association. Although the first two strategies enjoy a fair extent of power gain, empirical evidence showed that VC methods may exhibit only similar or less power than the standard haplotype regression method, even in cases of many haplotypes. In this study, we report possible reasons that cause the underpowered phenomenon and show how the power of the VC strategy can be improved. We construct a score test based on the restricted maximum likelihood or the marginal likelihood function of the VC and identify its nontypical limiting distribution. Through simulation, we demonstrate the validity of the test and investigate the power performance of the VC approach and that of the standard haplotype regression approach. With suitable choices for the correlation structure, the proposed method can be directly applied to unphased genotypic data. Our method is applicable to a wide-ranging class of models and is computationally efficient and easy to implement. The broad coverage and the fast and easy implementation of this method make the VC strategy an effective tool for haplotype analysis, even in modern genomewide association studies. PMID:17924336
Haplotype analysis of the apolipoprotein A5 gene in obese pediatric patients.
Horvatovich, Katalin; Bokor, Szilvia; Baráth, Akos; Maász, Anita; Kisfali, Péter; Járomi, Luca; Polgár, Noémi; Tóth, Dénes; Répásy, Judit; Endreffy, Emoke; Molnár, Dénes; Melegh, Béla
2011-06-01
Apolipoprotein A5 (APOA5) gene variants have been shown to be associated with elevated TG levels; the T-1131C (rs662799) variant has been reported to confer risk for the metabolic syndrome in adult populations. Little is known about the APOA5 variants in pediatric population, no such information is available for pediatric obesity at all. Here we examined four haplotype-tagging polymorphisms (T-1131C, IVS3 + G476A [rs2072560], T1259C [rs2266788] and C56G [rs3135506]) and studied also the frequency of major naturally occurring haplotypes of APOA5 in obese children. The polymorphisms were analyzed in 232 obese children, and in 137 healthy, normal weight controls, using PCR-RFLP methods. In the pediatric patients we could confirm the already known adult subjects based association of -1131C, IVS3 + 476A and 1259C variants with elevated triglyceride concentrations, both in obese patients and in the controls. The prevalence of the APOA5*2 haplotype (containing the minor allele of T-1131C, IVS3 + G476A and T1259C SNPs together) was 15.5% in obese children, and 5.80% in the controls (p<0.001); multiple logistic regression analysis revealed that this haplotype confers susceptibility for development of obesity (OR=2.87; 95% CI: 1.29-6.37; p≤0.01). By contrast, the APOA5*4 haplotype (with -1131C alone) did not show similar associations. Our findings also suggest that the APOA5*5 haplotype (1259C alone) can be protective against obesity (OR=0.25; 95% CI: 0.07-0.80; p<0.05). While previous studies in adults demonstrated, that the APOA5 -1131C minor allele confers risk for adult metabolic syndrome, here we show, that the susceptibility nature of this SNP restricted to the APOA5*2 haplotype in pediatric obese subjects.
Single tag for total carbohydrate analysis.
Anumula, Kalyan Rao
2014-07-15
Anthranilic acid (2-aminobenzoic acid, 2-AA) has the remarkable property of reacting rapidly with every type of reducing carbohydrate. Reactivity of 2-AA with carbohydrates in aqueous solutions surpasses all other tags reported to date. This unique capability is attributed to the strategically located -COOH which accelerates Schiff base formation. Monosaccharides, oligosaccharides (N-, O-, and lipid linked and glycans in secretory fluids), glycosaminoglycans, and polysaccharides can be easily labeled with 2-AA. With 2-AA, labeling is simple in aqueous solutions containing proteins, peptides, buffer salts, and other ingredients (e.g., PNGase F, glycosidase, and transferase reaction mixtures). In contrast, other tags require relatively pure glycans for labeling in anhydrous dimethyl sulfoxide-acetic acid medium. Acidic conditions are known to cause desialylation, thus requiring a great deal of attention to sample preparation. Simpler labeling is achieved with 2-AA within 30-60 min in mild acetate-borate buffered solution. 2-AA provides the highest sensitivity and resolution in chromatographic methods for carbohydrate analysis in a simple manner. Additionally, 2-AA is uniquely qualified for quantitative analysis by mass spectrometry in the negative mode. Analyses of 2-AA-labeled carbohydrates by electrophoresis and other techniques have been reported. Examples cited here demonstrate that 2-AA is the universal tag for total carbohydrate analysis. Copyright © 2014 Elsevier Inc. All rights reserved.
2014-01-01
Background To better understand the genetic determination of udder health, we performed a genome-wide association study (GWAS) on a population of 2354 German Holstein bulls for which daughter yield deviations (DYD) for somatic cell score (SCS) were available. For this study, we used genetic information of 44 576 informative single nucleotide polymorphisms (SNPs) and 11 725 inferred haplotype blocks. Results When accounting for the sub-structure of the analyzed population, 16 SNPs and 10 haplotypes in six genomic regions were significant at the Bonferroni threshold of P ≤ 1.14 × 10-6. The size of the identified regions ranged from 0.05 to 5.62 Mb. Genomic regions on chromosomes 5, 6, 18 and 19 coincided with known QTL affecting SCS, while additional genomic regions were found on chromosomes 13 and X. Of particular interest is the region on chromosome 6 between 85 and 88 Mb, where QTL for mastitis traits and significant SNPs for SCS in different Holstein populations coincide with our results. In all identified regions, except for the region on chromosome X, significant SNPs were present in significant haplotypes. The minor alleles of identified SNPs on chromosomes 18 and 19, and the major alleles of SNPs on chromosomes 6 and X were favorable for a lower SCS. Differences in somatic cell count (SCC) between alternative SNP alleles reached 14 000 cells/mL. Conclusions The results support the polygenic nature of the genetic determination of SCS, confirm the importance of previously reported QTL, and provide evidence for the segregation of additional QTL for SCS in Holstein cattle. The small size of the regions identified here will facilitate the search for causal genetic variations that affect gene functions. PMID:24898131
A phased SNP-based classification of sickle cell anemia HBB haplotypes.
Shaikho, Elmutaz M; Farrell, John J; Alsultan, Abdulrahman; Qutub, Hatem; Al-Ali, Amein K; Figueiredo, Maria Stella; Chui, David H K; Farrer, Lindsay A; Murphy, George J; Mostoslavsky, Gustavo; Sebastiani, Paola; Steinberg, Martin H
2017-08-11
Sickle cell anemia causes severe complications and premature death. Five common β-globin gene cluster haplotypes are each associated with characteristic fetal hemoglobin (HbF) levels. As HbF is the major modulator of disease severity, classifying patients according to haplotype is useful. The first method of haplotype classification used restriction fragment length polymorphisms (RFLPs) to detect single nucleotide polymorphisms (SNPs) in the β-globin gene cluster. This is labor intensive, and error prone. We used genome-wide SNP data imputed to the 1000 Genomes reference panel to obtain phased data distinguishing parental alleles. We successfully haplotyped 813 sickle cell anemia patients previously classified by RFLPs with a concordance >98%. Four SNPs (rs3834466, rs28440105, rs10128556, and rs968857) marking four different restriction enzyme sites unequivocally defined most haplotypes. We were able to assign a haplotype to 86% of samples that were either partially or misclassified using RFLPs. Phased data using only four SNPs allowed unequivocal assignment of a haplotype that was not always possible using a larger number of RFLPs. Given the availability of genome-wide SNP data, our method is rapid and does not require high computational resources.
HERC1 polymorphisms: population-specific variations in haplotype composition.
Yuasa, Isao; Umetsu, Kazuo; Nishimukai, Hiroaki; Fukumori, Yasuo; Harihara, Shinji; Saitou, Naruya; Jin, Feng; Chattopadhyay, Prasanta K; Henke, Lotte; Henke, Jürgen
2009-08-01
Human HERC1 is one of six HERC proteins and may play an important role in intracellular membrane trafficking. The human HERC1 gene is suggested to have been affected by local positive selection. To assess the global frequency distributions of coding and non-coding single nucleotide polymorphisms (SNPs) in the HERC1 gene, we developed a new simultaneous genotyping method for four SNPs, and applied this method to investigate 1213 individuals from 12 global populations. The results confirmed remarked differences in the allele and haplotype frequencies between East Asian and non-East Asian populations. One of the three common haplotypes observed was found to be characteristic of East Asians, who showed a relatively uniform distribution of haplotypes. Information on haplotypes would be useful for testing the function of polymorphisms in the HERC1 gene. This is the first study to investigate the distribution of HERC1 polymorphisms in various populations. (c) 2009 John Wiley & Sons, Ltd.
Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.
Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R
2001-11-23
Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.
Efficient algorithms for polyploid haplotype phasing.
He, Dan; Saha, Subrata; Finkers, Richard; Parida, Laxmi
2018-05-09
Inference of haplotypes, or the sequence of alleles along the same chromosomes, is a fundamental problem in genetics and is a key component for many analyses including admixture mapping, identifying regions of identity by descent and imputation. Haplotype phasing based on sequencing reads has attracted lots of attentions. Diploid haplotype phasing where the two haplotypes are complimentary have been studied extensively. In this work, we focused on Polyploid haplotype phasing where we aim to phase more than two haplotypes at the same time from sequencing data. The problem is much more complicated as the search space becomes much larger and the haplotypes do not need to be complimentary any more. We proposed two algorithms, (1) Poly-Harsh, a Gibbs Sampling based algorithm which alternatively samples haplotypes and the read assignments to minimize the mismatches between the reads and the phased haplotypes, (2) An efficient algorithm to concatenate haplotype blocks into contiguous haplotypes. Our experiments showed that our method is able to improve the quality of the phased haplotypes over the state-of-the-art methods. To our knowledge, our algorithm for haplotype blocks concatenation is the first algorithm that leverages the shared information across multiple individuals to construct contiguous haplotypes. Our experiments showed that it is both efficient and effective.
The role of the JAK2 GGCC haplotype and the TET2 gene in familial myeloproliferative neoplasms
Olcaydu, Damla; Rumi, Elisa; Harutyunyan, Ashot; Passamonti, Francesco; Pietra, Daniela; Pascutto, Cristiana; Berg, Tiina; Jäger, Roland; Hammond, Emma; Cazzola, Mario; Kralovics, Robert
2011-01-01
Background Myeloproliferative neoplasms constitute a group of diverse chronic myeloid malignancies that share pathogenic features such as acquired mutations in the JAK2, TET2, CBL and MPL genes. There are recent reports that a JAK2 gene haplotype (GGCC or 46/1) confers susceptibility to JAK2 mutation-positive myeloproliferative neoplasms. The aim of this study was to examine the role of the JAK2 GGCC haplotype and germline mutations of TET2, CBL and MPL in familial myeloproliferative neoplasms. Design and Methods We investigated patients with familial (n=88) or sporadic (n=684) myeloproliferative neoplasms, and a control population (n=203) from the same demographic area in Italy. Association analysis was performed using tagged single nucleotide polymorphisms (rs10974944 and rs12343867) of the JAK2 haplotype. Sequence analysis of TET2, CBL and MPL was conducted in the 88 patients with familial myeloproliferative neoplasms. Results Association analysis revealed no difference in haplotype frequency between familial and sporadic cases of myeloproliferative neoplasms (P=0.6529). No germline mutations in TET2, CBL or MPL that segregate with the disease phenotype were identified. As we observed variability in somatic mutations in the affected members of a pedigree with myeloproliferative neoplasms, we postulated that somatic mutagenesis is increased in familial myeloproliferative neoplasms. Accordingly, we compared the incidence of malignant disorders between sporadic and familial patients. Although the overall incidence of malignant disorders did not differ significantly between cases of familial and sporadic myeloproliferative neoplasms, malignancies were more frequent in patients with familial disease aged between 50 to 70 years (P=0.0198) than in patients in the same age range with sporadic myeloproliferative neoplasms. Conclusions We conclude that the JAK2 GGCC haplotype and germline mutations of TET2, CBL or MPL do not explain familial clustering of
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohrenweiser, H W; Han, J; Hankinson, S E
2004-01-15
The XRCC1 protein is involved in the base excision repair pathway through interactions with other proteins. Polymorphisms in the XRCC1 gene may lead to variation in repair proficiency and confer inherited predisposition to cancer. We prospectively assessed the associations between polymorphisms and haplotypes in XRCC1 and breast cancer risk in a nested case-control study within the Nurses' Health Study (incident cases, n 1004; controls, n 1385). We further investigated gene-environment interactions between the XRCC1 variations and plasma carotenoids on breast cancer risk. We genotyped four haplotype-tagging single nucleotide polymorphisms Arg {sup 194}Trp, C26602T, Arg{sup 399}Gln, and Gln{sup 632}Gln in themore » XRCC1 gene. Five common haplotypes accounted for 99% of the chromosomes in the present study population of mostly Caucasian women. We observed a marginally significant reduction in the risk of breast cancer among {sup 194}Trp carriers. As compared with no-carriers, women with at least one {sup 194}Trp allele had a multivariate odds ratio of 0.79 (95% of the confidence interval, 0.60 -1.04). The inferred haplotype harboring the {sup 194}Trp allele was more common in controls than in cases (6.6 versus 5.3%, P 0.07). We observed that the Arg {sup 194}Trp modified the inverse associations of plasma -carotene level (P, ordinal test for interaction 0.02) and plasma -carotene level (P, ordinal test for interaction 0.003) with breast cancer risk. No suggestion of an interaction was observed between the Arg {sup 194}Trp and cigarette smoking. Our results suggest an inverse association between XRCC1 {sup 194}Trp allele and breast cancer risk. The findings of the effect modification of the Arg {sup 194}Trp on the relations of plasma -and -carotene levels with breast cancer risk suggest a potential protective effect of carotenoids in breast carcinogenesis by preventing oxidative DNA damage.« less
Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR.
Tyson, Jess; Armour, John A L
2012-12-11
Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.
Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR
2012-01-01
Background Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. Results In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. Conclusion This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example. PMID:23231411
Vidal, Ramon Oliveira; Mondego, Jorge Maurício Costa; Pot, David; Ambrósio, Alinne Batista; Andrade, Alan Carvalho; Pereira, Luiz Filipe Protasio; Colombo, Carlos Augusto; Vieira, Luiz Gonzaga Esteves; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães
2010-01-01
Polyploidization constitutes a common mode of evolution in flowering plants. This event provides the raw material for the divergence of function in homeologous genes, leading to phenotypic novelty that can contribute to the success of polyploids in nature or their selection for use in agriculture. Mounting evidence underlined the existence of homeologous expression biases in polyploid genomes; however, strategies to analyze such transcriptome regulation remained scarce. Important factors regarding homeologous expression biases remain to be explored, such as whether this phenomenon influences specific genes, how paralogs are affected by genome doubling, and what is the importance of the variability of homeologous expression bias to genotype differences. This study reports the expressed sequence tag assembly of the allopolyploid Coffea arabica and one of its direct ancestors, Coffea canephora. The assembly was used for the discovery of single nucleotide polymorphisms through the identification of high-quality discrepancies in overlapped expressed sequence tags and for gene expression information indirectly estimated by the transcript redundancy. Sequence diversity profiles were evaluated within C. arabica (Ca) and C. canephora (Cc) and used to deduce the transcript contribution of the Coffea eugenioides (Ce) ancestor. The assignment of the C. arabica haplotypes to the C. canephora (CaCc) or C. eugenioides (CaCe) ancestral genomes allowed us to analyze gene expression contributions of each subgenome in C. arabica. In silico data were validated by the quantitative polymerase chain reaction and allele-specific combination TaqMAMA-based method. The presence of differential expression of C. arabica homeologous genes and its implications in coffee gene expression, ontology, and physiology are discussed. PMID:20864545
Kettenbach, Arminja N; Sano, Hiroyuki; Keller, Susanna R; Lienhard, Gustav E; Gerber, Scott A
2015-01-30
The study of cellular signaling remains a significant challenge for translational and clinical research. In particular, robust and accurate methods for quantitative phosphoproteomics in tissues and tumors represent significant hurdles for such efforts. In the present work, we design, implement and validate a method for single-stage phosphopeptide enrichment and stable isotope chemical tagging, or SPECHT, that enables the use of iTRAQ, TMT and/or reductive dimethyl-labeling strategies to be applied to phosphoproteomics experiments performed on primary tissue. We develop and validate our approach using reductive dimethyl-labeling and HeLa cells in culture, and find these results indistinguishable from data generated from more traditional SILAC-labeled HeLa cells mixed at the cell level. We apply the SPECHT approach to the quantitative analysis of insulin signaling in a murine myotube cell line and muscle tissue, identify known as well as new phosphorylation events, and validate these phosphorylation sites using phospho-specific antibodies. Taken together, our work validates chemical tagging post-single-stage phosphoenrichment as a general strategy for studying cellular signaling in primary tissues. Through the use of a quantitatively reproducible, proteome-wide phosphopeptide enrichment strategy, we demonstrated the feasibility of post-phosphopeptide purification chemical labeling and tagging as an enabling approach for quantitative phosphoproteomics of primary tissues. Using reductive dimethyl labeling as a generalized chemical tagging strategy, we compared the performance of post-phosphopeptide purification chemical tagging to the well established community standard, SILAC, in insulin-stimulated tissue culture cells. We then extended our method to the analysis of low-dose insulin signaling in murine muscle tissue, and report on the analytical and biological significance of our results. Copyright © 2014 Elsevier B.V. All rights reserved.
Method for designing gas tag compositions
Gross, Kenny C.
1995-01-01
For use in the manufacture of gas tags such as employed in a nuclear reactor gas tagging failure detection system, a method for designing gas tagging compositions utilizes an analytical approach wherein the final composition of a first canister of tag gas as measured by a mass spectrometer is designated as node #1. Lattice locations of tag nodes in multi-dimensional space are then used in calculating the compositions of a node #2 and each subsequent node so as to maximize the distance of each node from any combination of tag components which might be indistinguishable from another tag composition in a reactor fuel assembly. Alternatively, the measured compositions of tag gas numbers 1 and 2 may be used to fix the locations of nodes 1 and 2, with the locations of nodes 3-N then calculated for optimum tag gas composition. A single sphere defining the lattice locations of the tag nodes may be used to define approximately 20 tag nodes, while concentric spheres can extend the number of tag nodes to several hundred.
Method for designing gas tag compositions
Gross, K.C.
1995-04-11
For use in the manufacture of gas tags such as employed in a nuclear reactor gas tagging failure detection system, a method for designing gas tagging compositions utilizes an analytical approach wherein the final composition of a first canister of tag gas as measured by a mass spectrometer is designated as node No. 1. Lattice locations of tag nodes in multi-dimensional space are then used in calculating the compositions of a node No. 2 and each subsequent node so as to maximize the distance of each node from any combination of tag components which might be indistinguishable from another tag composition in a reactor fuel assembly. Alternatively, the measured compositions of tag gas numbers 1 and 2 may be used to fix the locations of nodes 1 and 2, with the locations of nodes 3-N then calculated for optimum tag gas composition. A single sphere defining the lattice locations of the tag nodes may be used to define approximately 20 tag nodes, while concentric spheres can extend the number of tag nodes to several hundred. 5 figures.
Haplotype diversity of the myostatin gene among beef cattle breeds
Dunner, Susana; Miranda, M Eugenia; Amigues, Yves; Cañón, Javier; Georges, Michel; Hanset, Roger; Williams, John; Ménissier, François
2003-01-01
A total of 678 individuals from 28 European bovine breeds were both phenotyped and analysed at the myostatin locus by the Single Strand Conformation Polymorphism (SSCP) method. Seven new mutations were identified which contribute to the high polymorphism (1 SNP every 100 bp) present in this small gene; twenty haplotypes were described and a genotyping method was set up using the Oligonucleotide Ligation Assay (OLA) method. Some haplotypes appeared to be exclusive to a particular breed; this was the case for 5 in the Charolaise (involving mutation Q204X) and 7 in the Maine-Anjou (involving mutation E226X). The relationships between the different haplotypes were studied, thus allowing to test the earlier hypothesis on the origin of muscular hypertrophy in Europe: muscular hypertrophy (namely nt821(del11)) was mainly spread in different waves from northern Europe milk purpose populations in most breeds; however, other mutations (mostly disruptive) arose in a single breed, were highly selected and have since scarcely evolved to other populations. PMID:12605853
TNF-alpha SNP haplotype frequencies in equidae.
Brown, J J; Ollier, W E R; Thomson, W; Matthews, J B; Carter, S D; Binns, M; Pinchbeck, G; Clegg, P D
2006-05-01
Tumour necrosis factor alpha (TNF-alpha) is a pro-inflammatory cytokine that plays a crucial role in the regulation of inflammatory and immune responses. In all vertebrate species the genes encoding TNF-alpha are located within the major histocompatability complex. In the horse TNF-alpha has been ascribed a role in a variety of important disease processes. Previously two single nucleotide polymorphisms (SNPs) have been reported within the 5' un-translated region of the equine TNF-alpha gene. We have examined the equine TNF-alpha promoter region further for additional SNPs by analysing DNA from 131 horses (Equus caballus), 19 donkeys (E. asinus), 2 Grant's zebras (E. burchellii boehmi) and one onager (E. hemionus). Two further SNPs were identified at nucleotide positions 24 (T/G) and 452 (T/C) relative to the first nucleotide of the 522 bp polymerase chain reaction product. A sequence variant at position 51 was observed between equidae. SNaPSHOT genotyping assays for these and the two previously reported SNPs were performed on 457 horses comprising seven different breeds and 23 donkeys to determine the gene frequencies. SNP frequencies varied considerably between different horse breeds and also between the equine species. In total, nine different TNF-alpha promoter SNP haplotypes and their frequencies were established amongst the various equidae examined, with some haplotypes being found only in horses and others only in donkeys or zebras. The haplotype frequencies observed varied greatly between different horse breeds. Such haplotypes may relate to levels of TNF-alpha production and disease susceptibility and further investigation is required to identify associations between particular haplotypes and altered risk of disease.
Xu, Yao; Cai, Hanfang; Zhou, Yang; Shi, Tao; Lan, Xianyong; Zhang, Chunlei; Lei, Chuzhao; Jia, Yutang; Chen, Hong
2014-07-01
Paired box 3 (PAX3) belongs to the PAX superfamily of transcription factors and plays essential roles in the embryogenesis and postnatal formation of limb musculature through affecting the survival of muscle progenitor cells. By genetic mapping, PAX3 gene is assigned in the interval of quantitative trait loci for body weight on bovine BTA2. The objectives of this study were to detect polymorphisms of PAX3 gene in 1,241 cattle from five breeds and to investigate their effects on growth traits. Initially, three novel single nucleotide polymorphisms (SNPs) were identified by DNA pool sequencing and aCRS-RFLP methods (AC_000159: g.T-580G, g.A4617C and g.79018Ins/del G), which were located at 5'-UTR, exon 4 and intron 6, respectively. A total of eight haplotypes were constructed and the frequency of the three main haplotypes H1 (TAG), H2 (GCG) and H3 (GAG) accounted for over 81.7 % of the total individuals. Statistical analysis revealed that the three SNPs were associated with body height and body length of Nanyang and Chinese Caoyuan cattle at the age of 6 and/or 12 months old (P < 0.05), and consistently significant effects were also found in the haplotype combination analysis on these traits (P < 0.05). This study presented a complete scan of variations within bovine PAX3 gene, which could provide evidence for improving the economic traits of cattle by using these variations as potentially genetic markers in early marker-assisted selection programs.
Zhang, RuiJie; Li, Xia; Jiang, YongShuai; Liu, GuiYou; Li, ChuanXing; Zhang, Fan; Xiao, Yun; Gong, BinSheng
2009-02-01
High-throughout single nucleotide polymorphism detection technology and the existing knowledge provide strong support for mining the disease-related haplotypes and genes. In this study, first, we apply four kinds of haplotype identification methods (Confidence Intervals, Four Gamete Tests, Solid Spine of LD and fusing method of haplotype block) into high-throughout SNP genotype data to identify blocks, then use cluster analysis to verify the effectiveness of the four methods, and select the alcoholism-related SNP haplotypes through risk analysis. Second, we establish a mapping from haplotypes to alcoholism-related genes. Third, we inquire NCBI SNP and gene databases to locate the blocks and identify the candidate genes. In the end, we make gene function annotation by KEGG, Biocarta, and GO database. We find 159 haplotype blocks, which relate to the alcoholism most possibly on chromosome 1 approximately 22, including 227 haplotypes, of which 102 SNP haplotypes may increase the risk of alcoholism. We get 121 alcoholism-related genes and verify their reliability by the functional annotation of biology. In a word, we not only can handle the SNP data easily, but also can locate the disease-related genes precisely by combining our novel strategies of mining alcoholism-related haplotypes and genes with existing knowledge framework.
Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F
2009-07-14
In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.
Study of KS0 pair production in single-tag two-photon collisions
NASA Astrophysics Data System (ADS)
Masuda, M.; Uehara, S.; Watanabe, Y.; Adachi, I.; Ahn, J. K.; Aihara, H.; Al Said, S.; Asner, D. M.; Atmacan, H.; Aulchenko, V.; Aushev, T.; Ayad, R.; Babu, V.; Badhrees, I.; Bansal, V.; Behera, P.; Berger, M.; Bhardwaj, V.; Bhuyan, B.; Biswal, J.; Bondar, A.; Bonvicini, G.; Bozek, A.; Bračko, M.; Červenkov, D.; Chen, A.; Cheon, B. G.; Chilikin, K.; Cho, K.; Choi, Y.; Choudhury, S.; Cinabro, D.; Czank, T.; Dash, N.; Di Carlo, S.; Doležal, Z.; Drásal, Z.; Dutta, D.; Eidelman, S.; Epifanov, D.; Fast, J. E.; Ferber, T.; Fulsom, B. G.; Garg, R.; Gaur, V.; Gabyshev, N.; Garmash, A.; Gelb, M.; Giri, A.; Goldenzweig, P.; Guido, E.; Haba, J.; Hayasaka, K.; Hayashii, H.; Hedges, M. T.; Hou, W.-S.; Iijima, T.; Inami, K.; Inguglia, G.; Ishikawa, A.; Itoh, R.; Iwasaki, M.; Iwasaki, Y.; Jacobs, W. W.; Jaegle, I.; Jin, Y.; Joo, K. K.; Julius, T.; Kang, K. H.; Karyan, G.; Kawasaki, T.; Kichimi, H.; Kiesling, C.; Kim, D. Y.; Kim, H. J.; Kim, J. B.; Kim, K. T.; Kim, S. H.; Kodyš, P.; Kotchetkov, D.; Križan, P.; Kroeger, R.; Krokovny, P.; Kulasiri, R.; Kuzmin, A.; Kwon, Y.-J.; Lee, I. S.; Lee, S. C.; Li, L. K.; Li, Y.; Li Gioi, L.; Libby, J.; Liventsev, D.; Lubej, M.; Luo, T.; Matsuda, T.; Matvienko, D.; Merola, M.; Miyabayashi, K.; Miyata, H.; Mizuk, R.; Mohanty, G. B.; Moon, H. K.; Mori, T.; Mussa, R.; Nakao, M.; Nakazawa, H.; Nanut, T.; Nath, K. J.; Natkaniec, Z.; Nayak, M.; Niiyama, M.; Nisar, N. K.; Nishida, S.; Ogawa, S.; Okuno, S.; Ono, H.; Onuki, Y.; Pakhlov, P.; Pakhlova, G.; Pal, B.; Park, H.; Paul, S.; Pedlar, T. K.; Pestotnik, R.; Piilonen, L. E.; Ritter, M.; Rostomyan, A.; Russo, G.; Sakai, Y.; Salehi, M.; Sandilya, S.; Santelj, L.; Sanuki, T.; Savinov, V.; Schneider, O.; Schnell, G.; Schwanda, C.; Seidl, R.; Seino, Y.; Senyo, K.; Seon, O.; Sevior, M. E.; Shebalin, V.; Shen, C. P.; Shibata, T.-A.; Shimizu, N.; Shiu, J.-G.; Shwartz, B.; Sokolov, A.; Solovieva, E.; Starič, M.; Strube, J. F.; Sumihama, M.; Sumiyoshi, T.; Takizawa, M.; Tamponi, U.; Tanida, K.; Tenchini, F.; Teramoto, Y.; Uchida, M.; Uglov, T.; Unno, Y.; Uno, S.; Urquijo, P.; Van Hulse, C.; Varner, G.; Vinokurova, A.; Vorobyev, V.; Vossen, A.; Wang, B.; Wang, C. H.; Wang, M.-Z.; Wang, P.; Wang, X. L.; Watanabe, M.; Widmann, E.; Won, E.; Ye, H.; Yuan, C. Z.; Yusa, Y.; Zakharov, S.; Zhang, Z. P.; Zhilich, V.; Zhukova, V.; Zhulanov, V.; Zupanc, A.; Belle Collaboration
2018-03-01
We report a measurement of the cross section for KS0 pair production in single-tag two-photon collisions, γ*γ →KS0KS0, for Q2 up to 30 GeV2 , where Q2 is the negative of the invariant mass squared of the tagged photon. The measurement covers the kinematic range 1.0 GeV
Lutz, Michael W.; Saul, Robert; Linnertz, Colton; Glenn, Omolara-Chinue; Roses, Allen D.; Chiba-Falek, Ornit
2015-01-01
INTRODUCTION We recently showed that tagging-SNPs across the SNCA locus were significantly associated with increased risk for LB pathology in AD cases. However, the actual genetic variant(s) that underlie the observed associations remain elusive. METHODS We used a bioinformatics algorithm to catalogue Structural-Variants in a region of SNCA-intron4, followed by phased-sequencing. We performed a genetic-association analysis in autopsy series of LBV/AD cases compared with AD-only controls. We investigated the biological functions by expression analysis using temporal-cortex samples. RESULTS We identified four distinct haplotypes within a highly-polymorphic-low-complexity CT-rich region. We showed that a specific haplotype conferred risk to develop LBV/AD. We demonstrated that the CT-rich site acts as an enhancer element, where the risk haplotype was significantly associated with elevated levels of SNCA-mRNA. DISCUSSION We have discovered a novel haplotype in a CT-rich region in SNCA that contributes to LB pathology in AD patients, possibly via cis-regulation of the gene expression. PMID:26079410
Identification and genetic effect of haplotype in the bovine BMP7 gene.
Huang, Yong-Zhen; Wang, Xin-Lei; He, Hua; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong
2013-12-15
Bone morphogenetic proteins (BMPs) are peptide growth factors belonging to the transforming growth factor-beta (TGF-β) superfamily, and some members of the BMP family support white adipocyte differentiation. In this study, we focused on the BMP7 which singularly promotes the differentiation of brown preadipocytes. Haplotypes involving 5 single nucleotide polymorphism (SNP) sites in the bovine BMP7 gene were identified and their effect on body weight was analyzed. 16 haplotypes and 18 combined haplotypes were revealed and the linkage disequilibrium was assessed in the cattle population with 602 individuals representing three main cattle breeds from China. The results showed that haplotypes 3, 10 and 14 were predominant and accounted for 75.64%, 69.85%, and 83.36% in Nanyang, Qinchuan and Jiaxian cattle breeds, respectively. The statistical analyses indicated that the SNP 1, 4, and 5 are associated with the body weight, body length, and heart girth at 12 and 24 months in Nanyang cattle population (P<0.05), whereas there is no significant association between their 16 haplotypes and 18 combined haplotypes. Our results provide evidence that some SNPs and haplotypes in BMP7 are associated with growth traits, and may be utilized as a genetic marker in marker-assisted selection for beef cattle breeding programs. Copyright © 2013. Published by Elsevier B.V.
A Genome-Wide Scan for Breast Cancer Risk Haplotypes among African American Women
Song, Chi; Chen, Gary K.; Millikan, Robert C.; Ambrosone, Christine B.; John, Esther M.; Bernstein, Leslie; Zheng, Wei; Hu, Jennifer J.; Ziegler, Regina G.; Nyante, Sarah; Bandera, Elisa V.; Ingles, Sue A.; Press, Michael F.; Deming, Sandra L.; Rodriguez-Gil, Jorge L.; Chanock, Stephen J.; Wan, Peggy; Sheng, Xin; Pooler, Loreall C.; Van Den Berg, David J.; Le Marchand, Loic; Kolonel, Laurence N.; Henderson, Brian E.; Haiman, Chris A.; Stram, Daniel O.
2013-01-01
Genome-wide association studies (GWAS) simultaneously investigating hundreds of thousands of single nucleotide polymorphisms (SNP) have become a powerful tool in the investigation of new disease susceptibility loci. Haplotypes are sometimes thought to be superior to SNPs and are promising in genetic association analyses. The application of genome-wide haplotype analysis, however, is hindered by the complexity of haplotypes themselves and sophistication in computation. We systematically analyzed the haplotype effects for breast cancer risk among 5,761 African American women (3,016 cases and 2,745 controls) using a sliding window approach on the genome-wide scale. Three regions on chromosomes 1, 4 and 18 exhibited moderate haplotype effects. Furthermore, among 21 breast cancer susceptibility loci previously established in European populations, 10p15 and 14q24 are likely to harbor novel haplotype effects. We also proposed a heuristic of determining the significance level and the effective number of independent tests by the permutation analysis on chromosome 22 data. It suggests that the effective number was approximately half of the total (7,794 out of 15,645), thus the half number could serve as a quick reference to evaluating genome-wide significance if a similar sliding window approach of haplotype analysis is adopted in similar populations using similar genotype density. PMID:23468962
The JAK2 GGCC (46/1) Haplotype in Myeloproliferative Neoplasms: Causal or Random?
Anelli, Luisa; Zagaria, Antonella; Specchia, Giorgina; Albano, Francesco
2018-04-11
The germline JAK2 haplotype known as "GGCC or 46/1 haplotype" (haplotype GGCC_46/1 ) consists of a combination of single nucleotide polymorphisms (SNPs) mapping in a region of about 250 kb, extending from the JAK2 intron 10 to the Insulin-like 4 ( INLS4 ) gene. Four main SNPs (rs3780367, rs10974944, rs12343867, and rs1159782) generating a "GGCC" combination are more frequently indicated to represent the JAK2 haplotype. These SNPs are inherited together and are frequently associated with the onset of myeloproliferative neoplasms (MPN) positive for both JAK2 V617 and exon 12 mutations. The association between the JAK2 haplotype GGCC_46/1 and mutations in other genes, such as thrombopoietin receptor ( MPL ) and calreticulin ( CALR ), or the association with triple negative MPN, is still controversial. This review provides an overview of the frequency and the role of the JAK2 haplotype GGCC_46/1 in the pathogenesis of different myeloid neoplasms and describes the hypothetical mechanisms at the basis of the association with JAK2 gene mutations. Moreover, possible clinical implications are discussed, as different papers reported contrasting data about the correlation between the JAK2 haplotype GGCC_46/1 and blood cell count, survival, or disease progression.
HLA-A*02 allele frequencies and haplotypic associations in Koreans.
Park, M H; Whang, D H; Kang, S J; Han, K S
2000-03-01
We have investigated the frequencies of HLA-A*02 alleles and their haplotypic associations with HLA-B and -DRB1 loci in 439 healthy unrelated Koreans, including 214 parents from 107 families. All of the 227 samples (51.7%) typed as A2 by serology were analyzed for A*02 alleles using polymerase chain reaction (PCR)-low ionic strength-single-strand conformation polymorphism (LIS-SSCP) method. A total of six different A*02 alleles were detected (A*02 allele frequency 29.6%): A*0201/9 (16.6%), *0203 (0.5%), *0206 (9.3%), *0207 (3.0%), and one each case of *0210 and *02 undetermined type. Two characteristic haplotypes showing the strongest linkage disequilibrium were A*0203-B38-DRB]*1502 and A*0207-B46-DRB1*0803. Besides these strong associations, significant two-locus associations (P<0.001) were observed for A*0201 with B61, DRB1*0901 and DRB1*1401, and for A*0206 with B48 and B61. HLA haplotypes carrying HLA-A2 showed a variable distribution of A*02 alleles, and all of the eight most common A2-B-DR haplotypes occurring at frequencies of > or =1% were variably associated with two different A*02 alleles. These results demonstrate that substantial heterogeneity is present in the distribution of HLA-A*02 alleles and related haplotypes in Koreans.
Cloud computing-based TagSNP selection algorithm for human genome data.
Hung, Che-Lun; Chen, Wen-Pei; Hua, Guan-Jie; Zheng, Huiru; Tsai, Suh-Jen Jane; Lin, Yaw-Ling
2015-01-05
Single nucleotide polymorphisms (SNPs) play a fundamental role in human genetic variation and are used in medical diagnostics, phylogeny construction, and drug design. They provide the highest-resolution genetic fingerprint for identifying disease associations and human features. Haplotypes are regions of linked genetic variants that are closely spaced on the genome and tend to be inherited together. Genetics research has revealed SNPs within certain haplotype blocks that introduce few distinct common haplotypes into most of the population. Haplotype block structures are used in association-based methods to map disease genes. In this paper, we propose an efficient algorithm for identifying haplotype blocks in the genome. In chromosomal haplotype data retrieved from the HapMap project website, the proposed algorithm identified longer haplotype blocks than an existing algorithm. To enhance its performance, we extended the proposed algorithm into a parallel algorithm that copies data in parallel via the Hadoop MapReduce framework. The proposed MapReduce-paralleled combinatorial algorithm performed well on real-world data obtained from the HapMap dataset; the improvement in computational efficiency was proportional to the number of processors used.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boyd, James W.; Deters, Katherine A.; Brown, Richard S.
2011-09-01
Reductions in the size of acoustic transmitters implanted in migrating juvenile salmonids have resulted in the use of a shorter incision-one that may warrant only a single suture for closure. However, it is not known whether a single suture will sufficiently hold the incision closed when fish are decompressed and when outward pressure is placed on the surgical site during turbine passage through hydroelectric dams. The objective of this study was to evaluate the effectiveness of single-suture incision closures on five response variables in juvenile Chinook salmon Oncorhynchus tshawytscha that were subjected to simulated turbine passage. An acoustic transmitter (0.43more » g in air) and a passive integrated transponder tag (0.10 g in air) were implanted in each fish; the 6-mm incisions were closed with either one suture or two sutures. After exposure to simulated turbine passage, none of the fish exhibited expulsion of transmitters. In addition, the percentage of fish with suture tearing, incision tearing, or mortal injury did not differ between treatments. Expulsion of viscera through the incision was higher among fish that received one suture (12%) than among fish that received two sutures (1%). The higher incidence of visceral expulsion through single-suture incisions warrants concern. Consequently, for cases in which tagged juvenile salmonidsmay be exposed to turbine passage, we do not recommend the use of one suture to close 6-mm incisions associated with acoustic transmitter implantation.« less
HLA-G Haplotypes Are Differentially Associated with Asthmatic Features.
Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie
2018-01-01
Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA - G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter
HLA-G Haplotypes Are Differentially Associated with Asthmatic Features
Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie
2018-01-01
Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA-G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter
Haplotype estimation using sequencing reads.
Delaneau, Olivier; Howie, Bryan; Cox, Anthony J; Zagury, Jean-François; Marchini, Jonathan
2013-10-03
High-throughput sequencing technologies produce short sequence reads that can contain phase information if they span two or more heterozygote genotypes. This information is not routinely used by current methods that infer haplotypes from genotype data. We have extended the SHAPEIT2 method to use phase-informative sequencing reads to improve phasing accuracy. Our model incorporates the read information in a probabilistic model through base quality scores within each read. The method is primarily designed for high-coverage sequence data or data sets that already have genotypes called. One important application is phasing of single samples sequenced at high coverage for use in medical sequencing and studies of rare diseases. Our method can also use existing panels of reference haplotypes. We tested the method by using a mother-father-child trio sequenced at high-coverage by Illumina together with the low-coverage sequence data from the 1000 Genomes Project (1000GP). We found that use of phase-informative reads increases the mean distance between switch errors by 22% from 274.4 kb to 328.6 kb. We also used male chromosome X haplotypes from the 1000GP samples to simulate sequencing reads with varying insert size, read length, and base error rate. When using short 100 bp paired-end reads, we found that using mixtures of insert sizes produced the best results. When using longer reads with high error rates (5-20 kb read with 4%-15% error per base), phasing performance was substantially improved. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Zhao, Xiaohong; Chen, Xiaogang; Zhao, Yuancun; Zhang, Shu; Gao, Zehua; Yang, Yiwen; Wang, Yufang; Zhang, Ji
2018-05-01
Insertion/deletion polymorphisms (indels), which combine the advantages of both short tandem repeats and single-nucleotide polymorphisms, are suitable for parentage testing. To overcome the limitations of the low polymorphism of di-allelic indels, we constructed a set of haplotypes with physically linked, multi-allelic indels. Candidate haplotypes were selected from the 1000 Genomes Project database, and were subject to the following criteria for inclusion: (i) each marker must have a minimum allele frequency (MAF) of ≥0.1 in the Han population of China; (ii) markers must exist in a non-coding region; (iii) the physical distance between a pair of candidate indels must be <500 bp; (iv) the allele length variation of each indel from 1 to 20 bp; (v) different haplotypes must be located on different chromosomes or chromosomal arms, or be more than 10 Mb apart if on the same chromosomal arm; and (vi) they must not be located across a recombination hotspot. A multiplex system with 11 haplotype markers, comprising 22 tri-allelic indel loci distributed over 10 chromosomes was developed. To validate the multiplex panel, we investigated the haplotype distribution in sets of two and three-generation pedigrees. The results demonstrated that the haplotypes consisting of multi-allelic indel markers exhibited higher polymorphism than a single indel locus, and thus provide Supplementary information for forensic kinship identification. Copyright © 2018 Elsevier B.V. All rights reserved.
Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z
2016-10-01
The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.
McCormick, Norman J.
1976-01-01
For use in the identification of failed fuel assemblies in a nuclear reactor, the ratios of the tag gas isotopic concentrations are located on curved surfaces to enable the ratios corresponding to failure of a single fuel assembly to be distinguished from those formed from any combination of two or more failed assemblies.
H-PoP and H-PoPG: heuristic partitioning algorithms for single individual haplotyping of polyploids.
Xie, Minzhu; Wu, Qiong; Wang, Jianxin; Jiang, Tao
2016-12-15
Some economically important plants including wheat and cotton have more than two copies of each chromosome. With the decreasing cost and increasing read length of next-generation sequencing technologies, reconstructing the multiple haplotypes of a polyploid genome from its sequence reads becomes practical. However, the computational challenge in polyploid haplotyping is much greater than that in diploid haplotyping, and there are few related methods. This article models the polyploid haplotyping problem as an optimal poly-partition problem of the reads, called the Polyploid Balanced Optimal Partition model. For the reads sequenced from a k-ploid genome, the model tries to divide the reads into k groups such that the difference between the reads of the same group is minimized while the difference between the reads of different groups is maximized. When the genotype information is available, the model is extended to the Polyploid Balanced Optimal Partition with Genotype constraint problem. These models are all NP-hard. We propose two heuristic algorithms, H-PoP and H-PoPG, based on dynamic programming and a strategy of limiting the number of intermediate solutions at each iteration, to solve the two models, respectively. Extensive experimental results on simulated and real data show that our algorithms can solve the models effectively, and are much faster and more accurate than the recent state-of-the-art polyploid haplotyping algorithms. The experiments also show that our algorithms can deal with long reads and deep read coverage effectively and accurately. Furthermore, H-PoP might be applied to help determine the ploidy of an organism. https://github.com/MinzhuXie/H-PoPG CONTACT: xieminzhu@hotmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Two families from New England with usher syndrome type IC with distinct haplotypes.
DeAngelis, M M; McGee, T L; Keats, B J; Slim, R; Berson, E L; Dryja, T P
2001-03-01
To search for patients with Usher syndrome type IC among those with Usher syndrome type I who reside in New England. Genotype analysis of microsatellite markers closely linked to the USH1C locus was done using the polymerase chain reaction. We compared the haplotype of our patients who were homozygous in the USH1C region with the haplotypes found in previously reported USH1C Acadian families who reside in southwestern Louisiana and from a single family residing in Lebanon. Of 46 unrelated cases of Usher syndrome type I residing in New England, two were homozygous at genetic markers in the USH1C region. Of these, one carried the Acadian USH1C haplotype and had Acadian ancestors (that is, from Nova Scotia) who did not participate in the 1755 migration of Acadians to Louisiana. The second family had a haplotype that proved to be the same as that of a family with USH1C residing in Lebanon. Each of the two families had haplotypes distinct from the other. This is the first report that some patients residing in New England have Usher syndrome type IC. Patients with Usher syndrome type IC can have the Acadian haplotype or the Lebanese haplotype compatible with the idea that at least two independently arising pathogenic mutations have occurred in the yet-to-be identified USH1C gene.
Cuyabano, B C D; Su, G; Rosa, G J M; Lund, M S; Gianola, D
2015-10-01
This study compared the accuracy of genome-enabled prediction models using individual single nucleotide polymorphisms (SNP) or haplotype blocks as covariates when using either a single breed or a combined population of Nordic Red cattle. The main objective was to compare predictions of breeding values of complex traits using a combined training population with haplotype blocks, with predictions using a single breed as training population and individual SNP as predictors. To compare the prediction reliabilities, bootstrap samples were taken from the test data set. With the bootstrapped samples of prediction reliabilities, we built and graphed confidence ellipses to allow comparisons. Finally, measures of statistical distances were used to calculate the gain in predictive ability. Our analyses are innovative in the context of assessment of predictive models, allowing a better understanding of prediction reliabilities and providing a statistical basis to effectively calibrate whether one prediction scenario is indeed more accurate than another. An ANOVA indicated that use of haplotype blocks produced significant gains mainly when Bayesian mixture models were used but not when Bayesian BLUP was fitted to the data. Furthermore, when haplotype blocks were used to train prediction models in a combined Nordic Red cattle population, we obtained up to a statistically significant 5.5% average gain in prediction accuracy, over predictions using individual SNP and training the model with a single breed. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Larsen, Charles E.; Alford, Dennis R.; Trautwein, Michael R.; Jalloh, Yanoh K.; Tarnacki, Jennifer L.; Kunnenkeri, Sushruta K.; Fici, Dolores A.; Yunis, Edmond J.; Awdeh, Zuheir L.; Alper, Chester A.
2014-01-01
We resequenced and phased 27 kb of DNA within 580 kb of the MHC class II region in 158 population chromosomes, most of which were conserved extended haplotypes (CEHs) of European descent or contained their centromeric fragments. We determined the single nucleotide polymorphism and deletion-insertion polymorphism alleles of the dominant sequences from HLA-DQA2 to DAXX for these CEHs. Nine of 13 CEHs remained sufficiently intact to possess a dominant sequence extending at least to DAXX, 230 kb centromeric to HLA-DPB1. We identified the regions centromeric to HLA-DQB1 within which single instances of eight “common” European MHC haplotypes previously sequenced by the MHC Haplotype Project (MHP) were representative of those dominant CEH sequences. Only two MHP haplotypes had a dominant CEH sequence throughout the centromeric and extended class II region and one MHP haplotype did not represent a known European CEH anywhere in the region. We identified the centromeric recombination transition points of other MHP sequences from CEH representation to non-representation. Several CEH pairs or groups shared sequence identity in small blocks but had significantly different (although still conserved for each separate CEH) sequences in surrounding regions. These patterns partly explain strong calculated linkage disequilibrium over only short (tens to hundreds of kilobases) distances in the context of a finite number of observed megabase-length CEHs comprising half a population's haplotypes. Our results provide a clearer picture of European CEH class II allelic structure and population haplotype architecture, improved regional CEH markers, and raise questions concerning regional recombination hotspots. PMID:25299700
Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin
2007-08-10
The sickle (betas) mutation in the beta-globin gene (HBB) occurs on five "classical" betas haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the betas allele - a consequence of protection from severe malarial infection afforded by heterozygotes - has been associated with a high degree of extended haplotype similarity. The relationship between classical betas haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical betas haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). The most common betas sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the betas mutation. Two different classical betas haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of betas haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle
Delaneau, Olivier; Marchini, Jonathan
2014-06-13
A major use of the 1000 Genomes Project (1000 GP) data is genotype imputation in genome-wide association studies (GWAS). Here we develop a method to estimate haplotypes from low-coverage sequencing data that can take advantage of single-nucleotide polymorphism (SNP) microarray genotypes on the same samples. First the SNP array data are phased to build a backbone (or 'scaffold') of haplotypes across each chromosome. We then phase the sequence data 'onto' this haplotype scaffold. This approach can take advantage of relatedness between sequenced and non-sequenced samples to improve accuracy. We use this method to create a new 1000 GP haplotype reference set for use by the human genetic community. Using a set of validation genotypes at SNP and bi-allelic indels we show that these haplotypes have lower genotype discordance and improved imputation performance into downstream GWAS samples, especially at low-frequency variants.
Monsuur, Alienke J; de Bakker, Paul I W; Zhernakova, Alexandra; Pinto, Dalila; Verduijn, Willem; Romanos, Jihane; Auricchio, Renata; Lopez, Ana; van Heel, David A; Crusius, J Bart A; Wijmenga, Cisca
2008-05-28
The HLA genes, located in the MHC region on chromosome 6p21.3, play an important role in many autoimmune disorders, such as celiac disease (CD), type 1 diabetes (T1D), rheumatoid arthritis, multiple sclerosis, psoriasis and others. Known HLA variants that confer risk to CD, for example, include DQA1*05/DQB1*02 (DQ2.5) and DQA1*03/DQB1*0302 (DQ8). To diagnose the majority of CD patients and to study disease susceptibility and progression, typing these strongly associated HLA risk factors is of utmost importance. However, current genotyping methods for HLA risk factors involve many reactions, and are complicated and expensive. We sought a simple experimental approach using tagging SNPs that predict the CD-associated HLA risk factors. Our tagging approach exploits linkage disequilibrium between single nucleotide polymorphism (SNPs) and the CD-associated HLA risk factors DQ2.5 and DQ8 that indicate direct risk, and DQA1*0201/DQB1*0202 (DQ2.2) and DQA1*0505/DQB1*0301 (DQ7) that attribute to the risk of DQ2.5 to CD. To evaluate the predictive power of this approach, we performed an empirical comparison of the predicted DQ types, based on these six tag SNPs, with those executed with current validated laboratory typing methods of the HLA-DQA1 and -DQB1 genes in three large cohorts. The results were validated in three European celiac populations. Using this method, only six SNPs were needed to predict the risk types carried by >95% of CD patients. We determined that for this tagging approach the sensitivity was >0.991, specificity >0.996 and the predictive value >0.948. Our results show that this tag SNP method is very accurate and provides an excellent basis for population screening for CD. This method is broadly applicable in European populations.
The JAK2 GGCC (46/1) Haplotype in Myeloproliferative Neoplasms: Causal or Random?
Anelli, Luisa; Zagaria, Antonella; Specchia, Giorgina
2018-01-01
The germline JAK2 haplotype known as “GGCC or 46/1 haplotype” (haplotypeGGCC_46/1) consists of a combination of single nucleotide polymorphisms (SNPs) mapping in a region of about 250 kb, extending from the JAK2 intron 10 to the Insulin-like 4 (INLS4) gene. Four main SNPs (rs3780367, rs10974944, rs12343867, and rs1159782) generating a “GGCC” combination are more frequently indicated to represent the JAK2 haplotype. These SNPs are inherited together and are frequently associated with the onset of myeloproliferative neoplasms (MPN) positive for both JAK2 V617 and exon 12 mutations. The association between the JAK2 haplotypeGGCC_46/1 and mutations in other genes, such as thrombopoietin receptor (MPL) and calreticulin (CALR), or the association with triple negative MPN, is still controversial. This review provides an overview of the frequency and the role of the JAK2 haplotypeGGCC_46/1 in the pathogenesis of different myeloid neoplasms and describes the hypothetical mechanisms at the basis of the association with JAK2 gene mutations. Moreover, possible clinical implications are discussed, as different papers reported contrasting data about the correlation between the JAK2 haplotypeGGCC_46/1 and blood cell count, survival, or disease progression. PMID:29641446
Sakai, Satoki
2016-08-01
I developed a gametophytic self-incompatibility (SI) model to study the conditions leading to diversification in SI haplotypes. In the model, the SI system is assumed to be incomplete, and the pollen expressing a given specificity is not fully rejected by the pistils expressing the same specificity. I also assumed that mutations can occur that enhance the rejection of pollen by pistils with the same haplotype variant and reduce rejection by pistils with other variants in the same haplotype. I found that if such mutations occur, the new haplotypes (mutant variants) can stably coexist with the ancestral haplotype in which the mutant arose. This is because pollen bearing the new haplotype is most strongly rejected by pistils bearing the same new haplotype among the pistils in the population; hence, negative frequency-dependent selection prevents their fixation. I also performed simulations and found that the nearly complete SI system evolves from completely self-compatible populations and that SI haplotypes can increase to about 40-50 within a few thousand generations. On the basis of my findings, I propose that diversification of SI haplotypes occurred during the evolution of SI from self-compatibility.
Cloud Computing-Based TagSNP Selection Algorithm for Human Genome Data
Hung, Che-Lun; Chen, Wen-Pei; Hua, Guan-Jie; Zheng, Huiru; Tsai, Suh-Jen Jane; Lin, Yaw-Ling
2015-01-01
Single nucleotide polymorphisms (SNPs) play a fundamental role in human genetic variation and are used in medical diagnostics, phylogeny construction, and drug design. They provide the highest-resolution genetic fingerprint for identifying disease associations and human features. Haplotypes are regions of linked genetic variants that are closely spaced on the genome and tend to be inherited together. Genetics research has revealed SNPs within certain haplotype blocks that introduce few distinct common haplotypes into most of the population. Haplotype block structures are used in association-based methods to map disease genes. In this paper, we propose an efficient algorithm for identifying haplotype blocks in the genome. In chromosomal haplotype data retrieved from the HapMap project website, the proposed algorithm identified longer haplotype blocks than an existing algorithm. To enhance its performance, we extended the proposed algorithm into a parallel algorithm that copies data in parallel via the Hadoop MapReduce framework. The proposed MapReduce-paralleled combinatorial algorithm performed well on real-world data obtained from the HapMap dataset; the improvement in computational efficiency was proportional to the number of processors used. PMID:25569088
Ferrando, Ainhoa; Ponsà, Montserrat; Marmi, Josep; Domingo-Roura, Xavier
2004-01-01
The Eurasian otter, Lutra lutra, has a Palaearctic distribution and has suffered a severe decline throughout Europe during the last century. Previous studies in this and other mustelids have shown reduced levels of variability in mitochondrial DNA, although otter phylogeographic studies were restricted to central-western Europe. In this work we have sequenced 361 bp of the mtDNA control region in 73 individuals from eight countries and added our results to eight sequences available from GenBank and the literature. The range of distribution has been expanded in relation to previous works north towards Scandinavia, east to Russia and Belarus, and south to the Iberian Peninsula. We found a single dominant haplotype in 91.78% of the samples, and six more haplotypes deviating a maximum of two mutations from the dominant haplotype restricted to a single country. Variability was extremely low in western Europe but higher in eastern countries. This, together with the lack of phylogeographical structuring, supports the postglacial recolonization of Europe from a single refugium. The Eurasian otter mtDNA control region has a 220-bp variable minisatellite in Domain III that we sequenced in 29 otters. We found a total of 19 minisatellite haplotypes, but they showed no phylogenetic information.
Analysis of association of clinical aspects and IL1B tagSNPs with severe preeclampsia.
Leme Galvão, Larissa Paes; Menezes, Filipe Emanuel; Mendonca, Caio; Barreto, Ikaro; Alvim-Pereira, Claudia; Alvim-Pereira, Fabiano; Gurgel, Ricardo
2016-01-01
This study investigates the association between IL1B genotypes using a tag SNP (single polymorphism) approach, maternal and environmental factors in Brazilian women with severe preeclampsia. A case-control study with a total of 456 patients (169 preeclamptic women and 287 controls) was conducted in the two reference maternity hospitals of Sergipe state, Northeast Brazil. A questionnaire was administered and DNA was extracted to genotype the population for four tag SNPs of the IL1Beta: rs 1143643, rs 1143633, rs 1143634 and rs 1143630. Haplotype association analysis and p-values were calculated using the THESIAS test. Odds ratio (OR) estimation, confidence interval (CI) and multivariate logistic regression were performed. High pregestational body mass index (pre-BMI), first gestation, cesarean section, more than six medical visits, low level of consciousness on admission and TC and TT genotype in rs1143630 of IL1Beta showed association with the preeclamptic group in univariate analysis. After multivariate logistic regression pre-BMI, first gestation and low level of consciousness on admission remained associated. We identified an association between clinical variables and preeclampsia. Univariate analysis suggested that inflammatory process-related genes, such as IL1B, may be involved and should be targeted in further studies. The identification of the genetic background involved in preeclampsia host response modulation is mandatory in order to understand the preeclampsia process.
Crosstalk between Diverse Synthetic Protein Degradation Tags in Escherichia coli.
Butzin, Nicholas C; Mather, William H
2018-01-19
Recently, a synthetic circuit in E. coli demonstrated that two proteins engineered with LAA tags targeted to the native protease ClpXP are susceptible to crosstalk due to competition for degradation between proteins. To understand proteolytic crosstalk beyond the single protease regime, we investigated in E. coli a set of synthetic circuits designed to probe the dynamics of existing and novel degradation tags fused to fluorescent proteins. These circuits were tested using both microplate reader and single-cell assays. We first quantified the degradation rates of each tag in isolation. We then tested if there was crosstalk between two distinguishable fluorescent proteins engineered with identical or different degradation tags. We demonstrated that proteolytic crosstalk was indeed not limited to the LAA degradation tag, but was also apparent between other diverse tags, supporting the complexity of the E. coli protein degradation system.
Haplotypic Analysis of Wellcome Trust Case Control Consortium Data
Browning, Brian L.; Browning, Sharon R.
2008-01-01
We applied a recently developed multilocus association testing method (localized haplotype clustering) to Wellcome Trust Case Control Consortium data (14,000 cases of seven common diseases and 3,000 shared controls genotyped on the Affymetrix 500K array). After rigorous data quality filtering, we identified three disease-associated loci with strong statistical support from localized haplotype cluster tests but with only marginal significance in single marker tests. These loci are chromosomes 10p15.1 with type 1 diabetes (p = 5.1 × 10-9), 12q15 with type 2 diabetes (p = 1.9 × 10-7) and 15q26.2 with hypertension (p = 2.8 × 10-8). We also detected the association of chromosome 9p21.3 with type 2 diabetes (p = 2.8 × 10-8), although this locus did not pass our stringent genotype quality filters. The association of 10p15.1 with type 1 diabetes and 9p21.3 with type 2 diabetes have both been replicated in other studies using independent data sets. Overall, localized haplotype cluster analysis had better success detecting disease associated variants than a previous single-marker analysis of imputed HapMap SNPs. We found that stringent application of quality score thresholds to genotype data substantially reduced false-positive results arising from genotype error. In addition, we demonstrate that it is possible to simultaneously phase 16,000 individuals genotyped on genome-wide data (450K markers) using the Beagle software package. PMID:18224336
Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin
2007-01-01
Background The sickle (βs) mutation in the beta-globin gene (HBB) occurs on five "classical" βs haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the βs allele – a consequence of protection from severe malarial infection afforded by heterozygotes – has been associated with a high degree of extended haplotype similarity. The relationship between classical βs haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical βs haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). Results The most common βs sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the βs mutation. Conclusion Two different classical βs haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of βs haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence
Subach, Oksana M; Malashkevich, Vladimir N; Zencheck, Wendy D; Morozova, Kateryna S; Piatkevich, Kiryl D; Almo, Steven C; Verkhusha, Vladislav V
2010-04-23
We determined the 2.2 A crystal structures of the red fluorescent protein TagRFP and its derivative, the blue fluorescent protein mTagBFP. The crystallographic analysis is consistent with a model in which TagRFP has the trans coplanar anionic chromophore with the conjugated pi-electron system, similar to that of DsRed-like chromophores. Refined conformation of mTagBFP suggests the presence of an N-acylimine functionality in its chromophore and single C(alpha)-C(beta) bond in the Tyr64 side chain. Mass spectrum of mTagBFP chromophore-bearing peptide indicates a loss of 20 Da upon maturation, whereas tandem mass spectrometry reveals that the C(alpha)-N bond in Leu63 is oxidized. These data indicate that mTagBFP has a new type of the chromophore, N-[(5-hydroxy-1H-imidazole-2-yl)methylidene]acetamide. We propose a chemical mechanism in which the DsRed-like chromophore is formed via the mTagBFP-like blue intermediate. (c) 2010 Elsevier Ltd. All rights reserved.
Mapping of HLA- DQ haplotypes in a group of Danish patients with celiac disease.
Lund, Flemming; Hermansen, Mette N; Pedersen, Merete F; Hillig, Thore; Toft-Hansen, Henrik; Sölétormos, György
2015-10-01
A cost-effective identification of HLA- DQ risk haplotypes using the single nucleotide polymorphism (SNP) technique has recently been applied in the diagnosis of celiac disease (CD) in four European populations. The objective of the study was to map risk HLA- DQ haplotypes in a group of Danish CD patients using the SNP technique. Cohort A: Among 65 patients with gastrointestinal symptoms we compared the HLA- DQ2 and HLA- DQ8 risk haplotypes obtained by the SNP technique (method 1) with results based on a sequence specific primer amplification technique (method 2) and a technique used in an assay from BioDiagene (method 3). Cohort B: 128 patients with histologically verified CD were tested for CD risk haplotypes (method 1). Patients with negative results were further tested for sub-haplotypes of HLA- DQ2 (methods 2 and 3). Cohort A: The three applied methods provided the same HLA- DQ2 and HLA- DQ8 results among 61 patients. Four patients were negative for the HLA- DQ2 and HLA- DQ8 haplotypes (method 1) but were positive for the HLA- DQ2.5-trans and HLA- DQ2.2 haplotypes (methods 2 and 3). Cohort B: A total of 120 patients were positive for the HLA- DQ2.5-cis and HLA- DQ8 haplotypes (method 1). The remaining seven patients were positive for HLA- DQ2.5-trans or HLA- DQ2.2 haplotypes (methods 2 and 3). One patient was negative with all three HLA methods. The HLA- DQ risk haplotypes were detected in 93.8% of the CD patients using the SNP technique (method 1). The sensitivity increased to 99.2% by combining methods 1 - 3.
Phase Transitions of Thermoelectric TAGS-85.
Kumar, Anil; Vermeulen, Paul A; Kooi, Bart J; Rao, Jiancun; van Eijck, Lambert; Schwarzmüller, Stefan; Oeckler, Oliver; Blake, Graeme R
2017-12-18
The alloys (GeTe) x (AgSbTe 2 ) 100-x , commonly known as TAGS-x, are among the best performing p-type thermoelectric materials for the composition range 80 ≤ x ≤ 90 and in the temperature range 200-500 °C. They adopt a rhombohedrally distorted rocksalt structure at room temperature and are reported to undergo a reversible phase transition to a cubic structure at ∼250 °C. However, we show that, for the optimal x = 85 composition (TAGS-85), both the structural and thermoelectric properties are highly sensitive to the initial synthesis method employed. Single-phase rhombohedral samples exhibit the best thermoelectric properties but can only be obtained after an annealing step at 600 °C during initial cooling from the melt. Under faster cooling conditions, the samples obtained are inhomogeneous, containing multiple rhombohedral phases with a range of lattice parameters and exhibiting inferior thermoelectric properties. We also find that when the room-temperature rhombohedral phase is heated, an intermediate trigonal structure containing ordered cation vacancy layers is formed at ∼200 °C, driven by the spontaneous precipitation of argyrodite-type Ag 8 GeTe 6 which alters the stoichiometry of the TAGS-85 matrix. The rhombohedral and trigonal phases of TAGS-85 coexist up to 380 °C, above which a single cubic phase is obtained and the Ag 8 GeTe 6 precipitates redissolve into the matrix. On subsequent cooling a mixture of rhombohedral, trigonal, and Ag 8 GeTe 6 phases is again obtained. Initially single-phase samples exhibit thermoelectric power factors of up to 0.0035 W m -1 K -2 at 500 °C, a value that is maintained on subsequent thermal cycling and which represents the highest power factor yet reported for undoped TAGS-85. Therefore, control over the structural homogeneity of TAGS-85 as demonstrated here is essential in order to optimize the thermoelectric performance.
Terasawa, Hideo; Oda, Masaya; Morino, Hiroyuki; Miyachi, Takafumi; Izumi, Yuishin; Maruyama, Hirofumi; Matsumoto, Masayasu; Kawakami, Hideshi
2004-03-25
The highest prevalence rate of spinocerebellar ataxia type 6 (SCA6) in the worldwide population is in the Chugoku and Kansai areas of Western Japan, but the reason of this geographic characteristics is unclear. We investigated the predisposing haplotypes and their geographic distribution. Genotyping of five microsatellite markers and three single nucleotide polymorphisms linked to the CACNA1A gene in 150 Japanese SCA6 patients from unrelated 118 families revealed three major haplotypes, carrying a pool of one common haplotype core. A founder chromosome was thought to have historically diverged into at least three types. One of the major haplotypes newly identified showed a strong geographical cluster around the Seto Inland Sea in the Chugoku and Kansai areas of Western Japan, whereas the others were widely distributed throughout Japan. The distribution of predisposing haplotypes contributes to the geographical differences in prevalence of SCA6.
Black, F L
1984-11-01
HLA B-C haplotypes exhibit common disequilibria in populations drawn from four continents, indicating that they are subject to broadly active selective forces. However, the A-B and A-C associations we have examined show no consistent disequilibrium pattern, leaving open the possibility that these disequilibria are due to descent from common progenitors. By examining HLA haplotype distributions, I have explored the implications that would follow from the hypothesis that biological selection played no role in determining A-C disequilibria in 10 diverse tribes of the lower Amazon Basin. Certain haplotypes are in strong positive disequilibria across a broad geographic area, suggesting that members of diverse tribes descend from common ancestors. On the basis of the extent of diffusion of the components of these haplotypes, one can estimate that the progenitors lived less than 6,000 years ago. One widely encountered lineage entered the area within the last 1,200 years. When haplotype frequencies are used in genetic distance measurements, they give a pattern of relationships very similar to that obtained by conventional chord measurements based on several genetic markers; but more than that, when individual haplotype disequilibria in the several tribes are compared, multiple origins of a single tribe are discernible and relationships are revealed that correlate more closely to geographic and linguistic patterns than do the genetic distance measurements.
Haplotyping for disease association: a combinatorial approach.
Lancia, Giuseppe; Ravi, R; Rizzi, Romeo
2008-01-01
We consider a combinatorial problem derived from haplotyping a population with respect to a genetic disease, either recessive or dominant. Given a set of individuals, partitioned into healthy and diseased, and the corresponding sets of genotypes, we want to infer "bad'' and "good'' haplotypes to account for these genotypes and for the disease. Assume e.g. the disease is recessive. Then, the resolving haplotypes must consist of bad and good haplotypes, so that (i) each genotype belonging to a diseased individual is explained by a pair of bad haplotypes and (ii) each genotype belonging to a healthy individual is explained by a pair of haplotypes of which at least one is good. We prove that the associated decision problem is NP-complete. However, we also prove that there is a simple solution, provided the data satisfy a very weak requirement.
Fornage, Myriam; Mosley, Thomas H; Jack, Clifford R; de Andrade, Mariza; Kardia, Sharon L R; Boerwinkle, Eric; Turner, Stephen T
2007-01-01
Susceptibility to ischemic damage to the subcortical white matter of the brain has a strong genetic basis. Dysregulation of matrix metalloproteinases (MMPs) contributes to loss of cerebrovascular integrity and white matter injury. We investigated whether sequence variation in the genes encoding MMP3 and MMP9 is associated with variation in leukoaraiosis volume, determined by magnetic resonance imaging, in non-Hispanic whites and African-Americans using family-based association tests. Seven hundred and fifty-six white and 671 African-American individuals from sibships ascertained through two or more siblings with hypertension were genotyped for 7 and 8 haplotype-tagging polymorphisms in the MMP3 and MMP9 genes, respectively. MMP3 sequence variation was significantly associated with variation in leukoaraiosis volume in Whites. Two common haplotypes with opposing relationships to leukoaraiosis volume were identified. MMP9 sequence variation was also significantly associated with variation in leukoaraiosis volume in both African-Americans and Whites. Different haplotypes contributed to these associations in the two racial groups. These findings add to the growing body of evidence from animal models and human clinical studies suggesting a role of MMPs in ischemic white matter injury. They provide the basis for further investigation of the role of these genes in susceptibility and/or progression to clinical disease.
Koblmüller, S; Sefc, K M; Duftner, N; Katongo, C; Tomljanovic, T; Sturmbauer, C
2008-01-01
Some of the diversity of lacustrine cichlid fishes has been ascribed to sympatric divergence, whereas diversification in rivers is generally driven by vicariance and geographic isolation. In the riverine Pseudocrenilabrus philander species complex, several morphologically highly distinct populations are restricted to particular river systems, sinkholes and springs in southern Africa. One of these populations consists of a prevalent yellow morph in sympatry with a less frequent blue morph, and no individuals bear intermediate phenotypes. Genetic variation in microsatellites and AFLP markers was very low in both morphs and one single mtDNA haplotype was fixed in all samples, indicating a very young evolutionary age and small effective population size. Nevertheless, the nuclear markers detected low but significant differentiation between the two morphs. The data suggest recent and perhaps sympatric divergence in the riverine habitat.
The putative oncogene Pim-1 in the mouse: its linkage and variation among t haplotypes.
Nadeau, J H; Phillips, S J
1987-11-01
Pim-1, a putative oncogene involved in T-cell lymphomagenesis, was mapped between the pseudo-alpha globin gene Hba-4ps and the alpha-crystallin gene Crya-1 on mouse chromosome 17 and therefore within the t complex. Pim-1 restriction fragment variants were identified among t haplotypes. Analysis of restriction fragment sizes obtained with 12 endonucleases demonstrated that the Pim-1 genes in some t haplotypes were indistinguishable from the sizes for the Pim-1b allele in BALB/c inbred mice. There are now three genes, Pim-1, Crya-1 and H-2 I-E, that vary among independently derived t haplotypes and that have indistinguishable alleles in t haplotypes and inbred strains. These genes are closely linked within the distal inversion of the t complex. Because it is unlikely that these variants arose independently in t haplotypes and their wild-type homologues, we propose that an exchange of chromosomal segments, probably through double crossingover, was responsible for indistinguishable Pim-1 genes shared by certain t haplotypes and their wild-type homologues. There was, however, no apparent association between variant alleles of these three genes among t haplotypes as would be expected if a single exchange introduced these alleles into t haplotypes. If these variant alleles can be shown to be identical to the wild-type allele, then lack of association suggests that multiple exchanges have occurred during the evolution of the t complex.
Factor IX gene haplotypes in Amerindians.
Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S
1997-02-01
We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.
Intrahaplotypic Variants Differentiate Complex Linkage Disequilibrium within Human MHC Haplotypes
Lam, Tze Hau; Tay, Matthew Zirui; Wang, Bei; Xiao, Ziwei; Ren, Ee Chee
2015-01-01
Distinct regions of long-range genetic fixation in the human MHC region, known as conserved extended haplotypes (CEHs), possess unique genomic characteristics and are strongly associated with numerous diseases. While CEHs appear to be homogeneous by SNP analysis, the nature of fine variations within their genomic structure is unknown. Using multiple, MHC-homozygous cell lines, we demonstrate extensive sequence conservation in two common Asian MHC haplotypes: A33-B58-DR3 and A2-B46-DR9. However, characterization of phase-resolved MHC haplotypes revealed unique intra-CEH patterns of variation and uncovered 127 single nucleotide variants (SNVs) which are missing from public databases. We further show that the strong linkage disequilibrium structure within the human MHC that typically confounds precise identification of genetic features can be resolved using intra-CEH variants, as evidenced by rs3129063 and rs448489, which affect expression of ZFP57, a gene important in methylation and epigenetic regulation. This study demonstrates an improved strategy that can be used towards genetic dissection of diseases. PMID:26593880
Wang, Jianhao; Qin, Yuqin; Qin, Haifang; Liu, Li; Ding, Shumin; Teng, Yiwan; Ji, Junling; Qiu, Lin; Jiang, Pengju
2016-08-01
Herein, we have developed an in-capillary assay for simultaneous detection of the assembly and disassembly of the multivalent HA tag peptide and antibody. HA tag with hexahistidine at C terminus (YPYDVPDYAG4 H6 , termed YPYDH6 ) was conjugated with quantum dots (QDs) by metal-affinity force to form a multivalent HA tag (QD-YPYDH6 ). QD-YPYDH6 and monoclonal anti-HA antibody (anti-HA) were sequentially injected into the capillary. They were mixed and assembled inside the capillary. The reaction products were online discriminated and detected by fluorescence coupled capillary electrophoresis (CE-FL). For the in-capillary assay, the binding efficiency of the multivalent HA tag and antibody on was influenced by the molar ratio and injection time. Such novel assay could even give out the self-assembly kinetic constant of QDs and YPYDH6 as KD of 34.1 μM with n (binding cooperativeness) of 2.2 by Hill equation. More importantly, the simultaneous detection of the assembly and imidazole (Im) induced disassembly of the QD-YPYDH6 -anti-HA complex was achieved in a single in-capillary assay. Our study demonstrated a new method for the online detection of antigen-antibody interactions. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Gu, Chao; Liu, Qing-Zhong; Yang, Ya-Nan; Zhang, Shu-Jun; Khan, Muhammad Awais; Wu, Jun; Zhang, Shao-Ling
2013-01-01
The breakdown of self-incompatibility, which could result from the accumulation of non-functional S-haplotypes or competitive interaction between two different functional S-haplotypes, has been studied extensively at the molecular level in tetraploid Rosaceae species. In this study, two tetraploid Chinese cherry (Prunus pseudocerasus) cultivars and one diploid sweet cherry (Prunus avium) cultivar were used to investigate the ploidy of pollen grains and inheritance of pollen-S alleles. Genetic analysis of the S-genotypes of two intercross-pollinated progenies showed that the pollen grains derived from Chinese cherry cultivars were hetero-diploid, and that the two S-haplotypes were made up of every combination of two of the four possible S-haplotypes. Moreover, the distributions of single S-haplotypes expressed in self- and intercross-pollinated progenies were in disequilibrium. The number of individuals of the two different S-haplotypes was unequal in two self-pollinated and two intercross-pollinated progenies. Notably, the number of individuals containing two different S-haplotypes (S1- and S5-, S5- and S8-, S1- and S4-haplotype) was larger than that of other individuals in the two self-pollinated progenies, indicating that some of these hetero-diploid pollen grains may have the capability to inactivate stylar S-RNase inside the pollen tube and grow better into the ovaries. PMID:23596519
Global variation in CYP2C8–CYP2C9 functional haplotypes
Speed, William C; Kang, Soonmo Peter; Tuck, David P; Harris, Lyndsay N; Kidd, Kenneth K
2009-01-01
We have studied the global frequency distributions of 10 single nucleotide polymorphisms (SNPs) across 132 kb of CYP2C8 and CYP2C9 in ∼2500 individuals representing 45 populations. Five of the SNPs were in noncoding sequences; the other five involved the more common missense variants (four in CYP2C8, one in CYP2C9) that change amino acids in the gene products. One haplotype containing two CYP2C8 coding variants and one CYP2C9 coding variant reaches an average frequency of 10% in Europe; a set of haplotypes with a different CYP2C8 coding variant reaches 17% in Africa. In both cases these haplotypes are found in other regions of the world at <1%. This considerable geographic variation in haplotype frequencies impacts the interpretation of CYP2C8/CYP2C9 association studies, and has pharmacogenomic implications for drug interactions. PMID:19381162
Association of ORAI1 Haplotypes with the Risk of HLA-B27 Positive Ankylosing Spondylitis
Wei, James Cheng-Chung; Yen, Jeng-Hsien; Juo, Suh-Hang Hank; Chen, Wei-Chiao; Wang, Yu-Shiuan; Chiu, Yi-Ching; Hsieh, Tusty-Jiuan; Guo, Yuh-Cherng; Huang, Chun-Huang; Wong, Ruey-Hong; Wang, Hui-Po; Tsai, Ke-Li; Wu, Yang-Chang; Chang, Hsueh-Wei; Hsi, Edward; Chang, Wei-Pin; Chang, Wei-Chiao
2011-01-01
Ankylosing spondylitis (AS) is a chronic inflammation of the sacroiliac joints, spine and peripheral joints. The aetiology of ankylosing spondylitis is still unclear. Previous studies have indicated that genetics factors such as human leukocyte antigen HLA-B27 associates to AS susceptibility. We carried out a case-control study to determine whether the genetic polymorphisms of ORAI1 gene, a major component of store-operated calcium channels that involved the regulation of immune system, is a susceptibility factor to AS in a Taiwanese population. We enrolled 361 AS patients fulfilled the modified New York criteria and 379 controls from community. Five tagging single nucleotides polymorphisms (tSNPs) at ORAI1 were selected from the data of Han Chinese population in HapMap project. Clinical statuses of AS were assessed by the Bath Ankylosing Spondylitis Disease Activity Index (BASDAI), Bath Ankylosing Spondylitis Functional Index (BASFI), and Bath Ankylosing Spondylitis Global Index (BAS-G). Our results indicated that subjects carrying the minor allele homozygote (CC) of the promoter SNP rs12313273 or TT homozygote of the SNP rs7135617 had an increased risk of HLA-B27 positive AS. The minor allele C of 3′UTR SNP rs712853 exerted a protective effect to HLA-B27 positive AS. Furthermore, the rs12313273/rs7135617 pairwise allele analysis found that C-G (OR 1.69, 95% CI 1.27, 2.25; p = 0.0003) and T-T (OR 1.75, 95% CI 1.36, 2.27; p<0.0001) haplotypes had a significantly association with the risk of HLA-B27-positive AS in comparison with the T-G carriers. This is the first study that indicate haplotypes of ORAI1 (rs12313273 and rs7135617) are associated with the risk of HLA-B27 positive AS. PMID:21674042
Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A
2015-10-01
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
RENT+: an improved method for inferring local genealogical trees from haplotypes with recombination
Mirzaei, Sajad; Wu, Yufeng
2017-01-01
Abstract Motivation: Haplotypes from one or multiple related populations share a common genealogical history. If this shared genealogy can be inferred from haplotypes, it can be very useful for many population genetics problems. However, with the presence of recombination, the genealogical history of haplotypes is complex and cannot be represented by a single genealogical tree. Therefore, inference of genealogical history with recombination is much more challenging than the case of no recombination. Results: In this paper, we present a new approach called RENT+ for the inference of local genealogical trees from haplotypes with the presence of recombination. RENT+ builds on a previous genealogy inference approach called RENT, which infers a set of related genealogical trees at different genomic positions. RENT+ represents a significant improvement over RENT in the sense that it is more effective in extracting information contained in the haplotype data about the underlying genealogy than RENT. The key components of RENT+ are several greatly enhanced genealogy inference rules. Through simulation, we show that RENT+ is more efficient and accurate than several existing genealogy inference methods. As an application, we apply RENT+ in the inference of population demographic history from haplotypes, which outperforms several existing methods. Availability and Implementation: RENT+ is implemented in Java, and is freely available for download from: https://github.com/SajadMirzaei/RentPlus. Contacts: sajad@engr.uconn.edu or ywu@engr.uconn.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:28065901
Detecting structure of haplotypes and local ancestry
USDA-ARS?s Scientific Manuscript database
We present a two-layer hidden Markov model to detect the structure of haplotypes for unrelated individuals. This allows us to model two scales of linkage disequilibrium (one within a group of haplotypes and one between groups), thereby taking advantage of rich haplotype information to infer local an...
Li, Xiao-Jing; Liu, Jin-Ling; Gao, Dong-Sheng; Wan, Wen-Yan; Yang, Xia; Li, Yong-Tao; Chang, Hong-Tao; Chen, Lu; Wang, Chuan-Qing; Zhao, Jun
2016-03-01
Previous research showed that a lectin from the mushroom Laetiporus sulphureus, designed LSL, bound to Sepharose and could be eluted by lactose. In this study, by taking advantage of the strong affinity of LSL-tag for Sepharose, we developed a single-step purification method for LSL-tagged fusion proteins. We utilized unmodified Sepharose-4B as a specific adsorbent and 0.2 M lactose solution as an elution buffer. Fusion proteins of LSL-tag and porcine circovirus capsid protein, designated LSL-Cap was recovered with purity of 90 ± 4%, and yield of 87 ± 3% from crude extract of recombinant Escherichia coli. To enable the remove of LSL-tag, tobacco etch virus (TEV) protease recognition sequence was placed downstream of LSL-tag in the expression vector, and LSL-tagged TEV protease, designated LSL-TEV, was also expressed in E. coli., and was recovered with purity of 82 ± 5%, and yield of 85 ± 2% from crude extract of recombinant E. coli. After digestion of LSL-tagged recombinant proteins with LSL-TEV, the LSL tag and LSL-TEV can be easily removed by passing the digested products through the Sepharose column. It is of worthy noting that the Sepharose can be reused after washing with PBS. The LSL affinity purification method enables rapid and inexpensive purification of LSL-tagged fusion proteins and scale-up production of native proteins. Copyright © 2015 Elsevier Inc. All rights reserved.
High-Density SNP Genotyping to Define β-Globin Locus Haplotypes
Liu, Li; Muralidhar, Shalini; Singh, Manisha; Sylvan, Caprice; Kalra, Inderdeep S.; Quinn, Charles T.; Onyekwere, Onyinye C.; Pace, Betty S.
2014-01-01
Five major β-globin locus haplotypes have been established in individuals with sickle cell disease (SCD) from the Benin, Bantu, Senegal, Cameroon, and Arab-Indian populations. Historically, β-haplotypes were established using restriction fragment length polymorphism (RFLP) analysis across the β-locus, which consists of five functional β-like globin genes located on chromosome 11. Previous attempts to correlate these haplotypes as robust predictors of clinical phenotypes observed in SCD have not been successful. We speculate that the coverage and distribution of the RFLP sites located proximal to or within the globin genes are not sufficiently dense to accurately reflect the complexity of this region. To test our hypothesis, we performed RFLP analysis and high-density single nucleotide polymorphism (SNP) genotyping across the β-locus using DNA samples from either healthy African Americans with normal hemoglobin A (HbAA) or individuals with homozygous SS (HbSS) disease. Using the genotyping data from 88 SNPs and Haploview analysis, we generated a greater number of haplotypes than that observed with RFLP analysis alone. Furthermore, a unique pattern of long-range linkage disequilibrium between the locus control region and the β-like globin genes was observed in the HbSS group. Interestingly, we observed multiple SNPs within the HindIII restriction site located in the Gγ-globin intervening sequence II which produced the same RFLP pattern. These findings illustrated the inability of RFLP analysis to decipher the complexity of sequence variations that impacts genomic structure in this region. Our data suggest that high density SNP mapping may be required to accurately define β-haplotypes that correlate with the different clinical phenotypes observed in SCD. PMID:18829352
Extended Islands of Tractability for Parsimony Haplotyping
NASA Astrophysics Data System (ADS)
Fleischer, Rudolf; Guo, Jiong; Niedermeier, Rolf; Uhlmann, Johannes; Wang, Yihui; Weller, Mathias; Wu, Xi
Parsimony haplotyping is the problem of finding a smallest size set of haplotypes that can explain a given set of genotypes. The problem is NP-hard, and many heuristic and approximation algorithms as well as polynomial-time solvable special cases have been discovered. We propose improved fixed-parameter tractability results with respect to the parameter "size of the target haplotype set" k by presenting an O *(k 4k )-time algorithm. This also applies to the practically important constrained case, where we can only use haplotypes from a given set. Furthermore, we show that the problem becomes polynomial-time solvable if the given set of genotypes is complete, i.e., contains all possible genotypes that can be explained by the set of haplotypes.
Lower frequency of the HLA-G UTR-4 haplotype in women with unexplained recurrent miscarriage.
Meuleman, T; Drabbels, J; van Lith, J M M; Dekkers, O M; Rozemuller, E; Cretu-Stancu, M; Claas, F H J; Bloemenkamp, K W M; Eikmans, M
2018-04-01
HLA-G expressed by trophoblasts at the fetal-maternal interface and its soluble form have immunomodulatory effects. HLA-G expression depends on the combination of DNA polymorphisms. We hypothesized that combinations of specific single nucleotide polymorphisms (SNPs) in the 3'untranslated region (3'UTR) of HLA-G play a role in unexplained recurrent miscarriage. In a case control design, 100 cases with at least three unexplained consecutive miscarriages prior to the 20th week of gestation were included. Cases were at time of the third miscarriage younger than 36 years, and they conceived all their pregnancies from the same partner. The control group included 89 women with an uneventful pregnancy. The association of HLA-G 3'UTR SNPs and specific HLA-G haplotype with recurrent miscarriage was studied with logistic regression. Odds ratios (OR) and 95% confidence intervals (95% CI) were reported. Individual SNPs were not significantly associated with recurrent miscarriage after correction for multiple comparisons. However, the presence of the UTR-4 haplotype, which included +3003C, was significantly lower in women with recurrent miscarriage (OR 0.4, 95% CI 0.2-0.8, p = 0.015). In conclusion, this is the first study to perform a comprehensive analysis of HLA-G SNPs and HLA-G haplotypes in a well-defined group of women with recurrent miscarriage and women with uneventful pregnancy. The UTR-4 haplotype was less frequently observed in women with recurrent miscarriage, suggesting an immunoregulatory role of this haplotype for continuation of the pregnancy without complications. Thus, association of HLA-G with recurrent miscarriage is not related to single polymorphisms in the 3'UTR, but is rather dependent on haplotypes. Copyright © 2018 Elsevier B.V. All rights reserved.
Two independent apolipoprotein A5 haplotypes influence human plasma triglyceride levels.
Pennacchio, Len A; Olivier, Michael; Hubacek, Jaroslav A; Krauss, Ronald M; Rubin, Edward M; Cohen, Jonathan C
2002-11-15
The recently identified apolipoprotein A5 gene (APOA5) has been shown to play an important role in determining plasma triglyceride concentrations in humans and mice. We previously identified an APOA5 haplotype (designated APOA5*2) that is present in approximately 16% of Caucasians and is associated with increased plasma triglyceride concentrations. In this report we describe another APOA5 haplotype (APOA5*3) containing the rare allele of the single nucleotide polymorphism c.56C>G that changes serine to tryptophan at codon 19 and is independently associated with high plasma triglyceride levels in three different populations. In a sample of 264 Caucasian men and women with plasma triglyceride concentrations above the 90th percentile or below the 10th percentile, the APOA5*3 haplotype was more than three-fold more common in the group with high plasma triglyceride levels. In a second independently ascertained sample of Caucasian men and women (n=419) who were studied while consuming their self-selected diets as well as after high-carbohydrate diets and high-fat diets, the APOA5*3 haplotype was associated with increased plasma triglyceride levels on all three dietary regimens. In a third population comprising 2660 randomly selected individuals, the APOA5*3 haplotype was found in 12% of Caucasians, 14% of African-Americans and 28% of Hispanics and was associated with increased plasma triglyceride levels in both men and women in each ethnic group. These findings establish that the APOA5 locus contributes significantly to inter-individual variation in plasma triglyceride levels in humans. Together, the APOA5*2 and APOA5*3 haplotypes are found in 25-50% of African-Americans, Hispanics and Caucasians and support the contribution of common human variation to quantitative phenotypes in the general population.
Two independent apolipoprotein a5 Haplotypes influence human plasma triglyceride levels
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pennacchio, Len A.; Olivier, Michael; Hubacek, Jaroslav A.
2002-09-16
The recently identified apolipoprotein A5 gene (APOA5) has been shown to play an important role in determining plasma triglyceride concentrations in humans and mice. We previously identified an APOA5 haplotype (designated APOA5*2) that is present in {approx}16 percent of Caucasians and is associated with increased plasma triglyceride concentrations. In this report we describe another APOA5 haplotype (APOA5*3) containing the rare allele of the single nucleotide polymorphism c.56C>G that changes serine to tryptophan at codon 19 and is independently associated with high plasma triglyceride levels in three different populations. In a sample of 264 Caucasian men and women with plasma triglyceridemore » concentrations above the 90th percentile or below the 10th percentile, the APOA5*3 haplotype was more than three-fold more common in the group with high plasma triglyceride levels. In a second independently ascertained sample of Caucasian men and women (n 1/4 419) who were studied while consuming their self-selected diets as well as after high-carbohydrate diets and high-fat diets, the APOA5*3 haplotype was associated with increased plasma triglyceride levels on all three dietary regimens. In a third population comprising 2660 randomly selected individuals, the APOA5*3 haplotype was found in 12 percent of Caucasians, 14 percent of African-Americans and 28 percent of Hispanics and was associated with increased plasma triglyceride levels in both men and women in each ethnic group. These findings establish that the APOA5 locus contributes significantly to inter-individual variation in plasma triglyceride levels in humans. Together, the APOA5*2 and APOA5*3 haplotypes are found in 25 50 percent of African-Americans, Hispanics and Caucasians and support the contribution of common human variation to quantitative phenotypes in the general population.« less
Drake, B.M.; Goto, R.M.; Miller, M.M.; Gee, G.F.; Briles, W.E.
1999-01-01
The major histocompatibility complex (MHC) is a group of genetic loci coding for haplotypes that have been associated with fitness traits in mammals and birds. Such associations suggest that MHC diversity may be an indicator of overall genetic fitness of endangered or threatened species. The MHC haplotypes of a captive population of 12 families of northern bobwhites (Colinus virginianus) were identified using a combination of immunogenetic and molecular techniques. Alloantisera were produced within families of northern bobwhites and were then tested for differential agglutination of erythrocytes of all members of each family. The pattern of reactions determined from testing these alloantisera identified a single genetic system of alloantigens in the northern bobwhites, resulting in the assignment of a tentative genotype to each individual within the quail families. Restriction fragment patterns of the DNA of each bird were determined using the chicken MHC B-G cDNA probe bg11. The concordance between the restriction fragment patterns and the alloantisera reactions showed that the alloantisera had identified the MHC of the northern bobwhite and supported the tentative genotype assignments, identifying at least 12 northern bobwhite MHC haplotypes.
Iodine Tagging Velocimetry in a Mach 10 Wake
NASA Technical Reports Server (NTRS)
Balla, Robert Jeffrey
2013-01-01
A variation on molecular tagging velocimetry (MTV) [1] designated iodine tagging velocimetry (ITV) is demonstrated. Molecular iodine is tagged by two-photon absorption using an Argon Fluoride (ArF) excimer laser. A single camera measures fluid displacement using atomic iodine emission at 206 nm. Two examples ofMTVfor cold-flowmeasurements areN2OMTV [2] and Femtosecond Laser Electronic Excitation Tagging [3]. These, like most MTV methods, are designed for atmospheric pressure applications. Neither can be implemented at the low pressures (0.1- 1 Torr) in typical hypersonic wakes. Of all the single-laser/singlecamera MTV approaches, only Nitric-Oxide Planar Laser Induced Fluorescence-based MTV [4] has been successfully demonstrated in a Mach 10 wake. Oxygen quenching limits transit times to 500 ns and accuracy to typically 30%. The present note describes the photophysics of the ITV method. Off-body velocimetry along a line is demonstrated in the aerothermodynamically important and experimentally challenging region of a hypersonic low-pressure near-wake in a Mach 10 air wind tunnel. Transit times up to 10 µs are demonstrated with conservative errors of 10%.
Haplotypes of CYP3A4 and their close linkage with CYP3A5 haplotypes in a Japanese population.
Fukushima-Uesaka, Hiromi; Saito, Yoshiro; Watanabe, Hidemi; Shiseki, Kisho; Saeki, Mayumi; Nakamura, Takahiro; Kurose, Kouichi; Sai, Kimie; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Kitakaze, Masafumi; Hanai, Sotaro; Nakajima, Toshiharu; Matsumoto, Kenji; Saito, Hirohisa; Goto, Yu-ichi; Kimura, Hideo; Katoh, Masaaki; Sugai, Kenji; Minami, Narihiro; Shirao, Kuniaki; Tamura, Tomohide; Yamamoto, Noboru; Minami, Hironobu; Ohtsu, Atsushi; Yoshida, Teruhiko; Saijo, Nagahiro; Kitamura, Yutaka; Kamatani, Naoyuki; Ozawa, Shogo; Sawada, Jun-ichi
2004-01-01
In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A4 in a Japanese population, the distal enhancer and proximal promoter regions, all exons, and the surrounding introns were sequenced from genomic DNA of 416 Japanese subjects. We found 24 SNPs, including 17 novel ones: two in the distal enhancer, four in the proximal promoter, one in the 5'-untranslated region (UTR), seven in the introns, and three in the 3'-UTR. The most common SNP was c.1026+12G>A (IVS10+12G>A), with a 0.249 frequency. Four non-synonymous SNPs, c.554C>G (p.T185S, CYP3A4(*)16), c.830_831insA (p.E277fsX8, (*)6), c.878T>C (p.L293P, (*)18), and c.1088 C>T (p.T363M, (*)11) were found with frequencies of 0.014, 0.001, 0.028, and 0.002, respectively. No SNP was found in the known nuclear transcriptional factor-binding sites in the enhancer and promoter regions. Using these 24 SNPs, 16 haplotypes were unambiguously identified, and nine haplotypes were inferred by aid of an expectation-maximization-based program. In addition, using data from 186 subjects enabled a close linkage to be found between CYP3A4 and CYP3A5 SNPs, especially among the SNPs at c.1026+12 in CYP3A4 and c.219-237 (IVS3-237, a key SNP site for CYP3A5(*)3), c.865+77 (IVS9+77) and c.1523 in CYP3A5. This result suggested that CYP3A4 and CYP3A5 are within the same gene block. Haplotype analysis between CYP3A4 and CYP3A5 revealed several major haplotype combinations in the CYP3A4-CYP3A5 block. Our findings provide fundamental and useful information for genotyping CYP3A4 (and CYP3A5) in the Japanese, and probably Asian populations. Copyright 2003 Wiley-Liss, Inc.
Better ILP models for haplotype assembly.
Etemadi, Maryam; Bagherian, Mehri; Chen, Zhi-Zhong; Wang, Lusheng
2018-02-19
The haplotype assembly problem for diploid is to find a pair of haplotypes from a given set of aligned Single Nucleotide Polymorphism (SNP) fragments (reads). It has many applications in association studies, drug design, and genetic research. Since this problem is computationally hard, both heuristic and exact algorithms have been designed for it. Although exact algorithms are much slower, they are still of great interest because they usually output significantly better solutions than heuristic algorithms in terms of popular measures such as the Minimum Error Correction (MEC) score, the number of switch errors, and the QAN50 score. Exact algorithms are also valuable because they can be used to witness how good a heuristic algorithm is. The best known exact algorithm is based on integer linear programming (ILP) and it is known that ILP can also be used to improve the output quality of every heuristic algorithm with a little decline in speed. Therefore, faster ILP models for the problem are highly demanded. As in previous studies, we consider not only the general case of the problem but also its all-heterozygous case where we assume that if a column of the input read matrix contains at least one 0 and one 1, then it corresponds to a heterozygous SNP site. For both cases, we design new ILP models for the haplotype assembly problem which aim at minimizing the MEC score. The new models are theoretically better because they contain significantly fewer constraints. More importantly, our experimental results show that for both simulated and real datasets, the new model for the all-heterozygous (respectively, general) case can usually be solved via CPLEX (an ILP solver) at least 5 times (respectively, twice) faster than the previous bests. Indeed, the running time can sometimes be 41 times better. This paper proposes a new ILP model for the haplotype assembly problem and its all-heterozygous case, respectively. Experiments with both real and simulated datasets show that the
Sugahara, Kanako; Kaneko, Yuko; Ito, Satoshi; Yamanaka, Keisuke; Sakio, Hitoshi; Hoshizaki, Kazuhiko; Suzuki, Wajiro; Yamanaka, Norikazu; Setoguchi, Hiroaki
2011-01-01
Japanese horse chestnut (Aesculus turbinata: Hippocastanaceae) is one of the typical woody plants that grow in temperate riparian forests in the Japanese Archipelago. To analyze the phylogeography of this plant in the Japanese Archipelago, we determined cpDNA haplotypes for 337 samples from 55 populations covering the entire distribution range. Based on 1,313 bp of two spacers, we determined ten haplotypes that are distinguished from adjacent haplotypes by one or two steps. Most of the populations had a single haplotype, suggesting low diversity. Spatial analysis of molecular variance suggested three obvious phylogeographic structures in western Japan, where Japanese horse chestnut is scattered and isolated in mountainous areas. Conversely, no clear phylogeographic structure was observed from the northern to the southern limit of this species, including eastern Japan, where this plant is more common. Rare and private haplotypes were also found in southwestern Japan, where Japanese horse chestnuts are distributed sparsely. These findings imply that western Japan might have maintained a relatively large habitat for A. turbinata during the Quaternary climatic oscillations, while northerly regions could not.
Reconstruction of Haplotype-Blocks Selected during Experimental Evolution.
Franssen, Susanne U; Barton, Nicholas H; Schlötterer, Christian
2017-01-01
The genetic analysis of experimentally evolving populations typically relies on short reads from pooled individuals (Pool-Seq). While this method provides reliable allele frequency estimates, the underlying haplotype structure remains poorly characterized. With small population sizes and adaptive variants that start from low frequencies, the interpretation of selection signatures in most Evolve and Resequencing studies remains challenging. To facilitate the characterization of selection targets, we propose a new approach that reconstructs selected haplotypes from replicated time series, using Pool-Seq data. We identify selected haplotypes through the correlated frequencies of alleles carried by them. Computer simulations indicate that selected haplotype-blocks of several Mb can be reconstructed with high confidence and low error rates, even when allele frequencies change only by 20% across three replicates. Applying this method to real data from D. melanogaster populations adapting to a hot environment, we identify a selected haplotype-block of 6.93 Mb. We confirm the presence of this haplotype-block in evolved populations by experimental haplotyping, demonstrating the power and accuracy of our haplotype reconstruction from Pool-Seq data. We propose that the combination of allele frequency estimates with haplotype information will provide the key to understanding the dynamics of adaptive alleles. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
RENT+: an improved method for inferring local genealogical trees from haplotypes with recombination.
Mirzaei, Sajad; Wu, Yufeng
2017-04-01
: Haplotypes from one or multiple related populations share a common genealogical history. If this shared genealogy can be inferred from haplotypes, it can be very useful for many population genetics problems. However, with the presence of recombination, the genealogical history of haplotypes is complex and cannot be represented by a single genealogical tree. Therefore, inference of genealogical history with recombination is much more challenging than the case of no recombination. : In this paper, we present a new approach called RENT+ for the inference of local genealogical trees from haplotypes with the presence of recombination. RENT+ builds on a previous genealogy inference approach called RENT , which infers a set of related genealogical trees at different genomic positions. RENT+ represents a significant improvement over RENT in the sense that it is more effective in extracting information contained in the haplotype data about the underlying genealogy than RENT . The key components of RENT+ are several greatly enhanced genealogy inference rules. Through simulation, we show that RENT+ is more efficient and accurate than several existing genealogy inference methods. As an application, we apply RENT+ in the inference of population demographic history from haplotypes, which outperforms several existing methods. : RENT+ is implemented in Java, and is freely available for download from: https://github.com/SajadMirzaei/RentPlus . : sajad@engr.uconn.edu or ywu@engr.uconn.edu. : Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
2013-01-01
Background Phylogeny estimation from aligned haplotype sequences has attracted more and more attention in the recent years due to its importance in analysis of many fine-scale genetic data. Its application fields range from medical research, to drug discovery, to epidemiology, to population dynamics. The literature on molecular phylogenetics proposes a number of criteria for selecting a phylogeny from among plausible alternatives. Usually, such criteria can be expressed by means of objective functions, and the phylogenies that optimize them are referred to as optimal. One of the most important estimation criteria is the parsimony which states that the optimal phylogeny T∗for a set H of n haplotype sequences over a common set of variable loci is the one that satisfies the following requirements: (i) it has the shortest length and (ii) it is such that, for each pair of distinct haplotypes hi,hj∈H, the sum of the edge weights belonging to the path from hi to hj in T∗ is not smaller than the observed number of changes between hi and hj. Finding the most parsimonious phylogeny for H involves solving an optimization problem, called the Most Parsimonious Phylogeny Estimation Problem (MPPEP), which is NP-hard in many of its versions. Results In this article we investigate a recent version of the MPPEP that arises when input data consist of single nucleotide polymorphism haplotypes extracted from a population of individuals on a common genomic region. Specifically, we explore the prospects for improving on the implicit enumeration strategy of implicit enumeration strategy used in previous work using a novel problem formulation and a series of strengthening valid inequalities and preliminary symmetry breaking constraints to more precisely bound the solution space and accelerate implicit enumeration of possible optimal phylogenies. We present the basic formulation and then introduce a series of provable valid constraints to reduce the solution space. We then prove
On the optimal identification of tag sets in time-constrained RFID configurations.
Vales-Alonso, Javier; Bueno-Delgado, María Victoria; Egea-López, Esteban; Alcaraz, Juan José; Pérez-Mañogil, Juan Manuel
2011-01-01
In Radio Frequency Identification facilities the identification delay of a set of tags is mainly caused by the random access nature of the reading protocol, yielding a random identification time of the set of tags. In this paper, the cumulative distribution function of the identification time is evaluated using a discrete time Markov chain for single-set time-constrained passive RFID systems, namely those ones where a single group of tags is assumed to be in the reading area and only for a bounded time (sojourn time) before leaving. In these scenarios some tags in a set may leave the reader coverage area unidentified. The probability of this event is obtained from the cumulative distribution function of the identification time as a function of the sojourn time. This result provides a suitable criterion to minimize the probability of losing tags. Besides, an identification strategy based on splitting the set of tags in smaller subsets is also considered. Results demonstrate that there are optimal splitting configurations that reduce the overall identification time while keeping the same probability of losing tags.
Passive UHF RFID Tag with Multiple Sensing Capabilities
Fernández-Salmerón, José; Rivadeneyra, Almudena; Martínez-Martí, Fernando; Capitán-Vallvey, Luis Fermín; Palma, Alberto J.; Carvajal, Miguel A.
2015-01-01
This work presents the design, fabrication, and characterization of a printed radio frequency identification tag in the ultra-high frequency band with multiple sensing capabilities. This passive tag is directly screen printed on a cardboard box with the aim of monitoring the packaging conditions during the different stages of the supply chain. This tag includes a commercial force sensor and a printed opening detector. Hence, the force applied to the package can be measured as well as the opening of the box can be detected. The architecture presented is a passive single-chip RFID tag. An electronic switch has been implemented to be able to measure both sensor magnitudes in the same access without including a microcontroller or battery. Moreover, the chip used here integrates a temperature sensor and, therefore, this tag provides three different parameters in every reading. PMID:26506353
Park, Joonhong; Kim, Myungshin; Jang, Woori; Chae, Hyojin; Kim, Yonggoo; Chung, Nack-Gyun; Lee, Jae-Wook; Cho, Bin; Jeong, Dae-Chul; Park, In Yang; Park, Mi Sun
2015-05-01
A common ancestral haplotype is strongly suggested in the Korean and Japanese patients with Fanconi anemia (FA), because common mutations have been frequently found: c.2546delC and c.3720_3724delAAACA of FANCA; c.307+1G>C, c.1066C>T, and c.1589_1591delATA of FANCG. Our aim in this study was to investigate the origin of these common mutations of FANCA and FANCG. We genotyped 13 FA patients consisting of five FA-A patients and eight FA-G patients from the Korean FA population. Microsatellite markers used for haplotype analysis included four CA repeat markers which are closely linked with FANCA and eight CA repeat markers which are contiguous with FANCG. As a result, Korean FA-A patients carrying c.2546delC or c.3720_3724delAAACA did not share the same haplotypes. However, three unique haplotypes carrying c.307+1G>C, c.1066C > T, or c.1589_1591delATA, that consisted of eight polymorphic loci covering a flanking region were strongly associated with Korean FA-G, consistent with founder haplotypes reported previously in the Japanese FA-G population. Our finding confirmed the common ancestral haplotypes on the origins of the East Asian FA-G patients, which will improve our understanding of the molecular population genetics of FA-G. To the best of our knowledge, this is the first report on the association between disease-linked mutations and common ancestral haplotypes in the Korean FA population. © 2015 John Wiley & Sons Ltd/University College London.
Investigation of extended Y chromosome STR haplotypes in Sardinia.
Lacerenza, D; Aneli, S; Di Gaetano, C; Critelli, R; Piazza, A; Matullo, G; Culigioni, C; Robledo, R; Robino, C; Calò, C
2017-03-01
Y-chromosomal variation of selected single nucleotide polymorphisms (SNPs) and 32 short tandem repeat (STR) loci was evaluated in Sardinia in three open population groups (Northern Sardinia, n=40; Central Sardinia, n=56; Southern Sardinia, n=91) and three isolates (Desulo, n=34; Benetutti, n=45, Carloforte, n=42). The tested Y-STRs consisted of Yfiler ® Plus markers and the seven rapidly mutating (RM) loci not included in the YFiler ® Plus kit (DYF399S1, DYF403S1ab, DYF404S1, DYS526ab, DYS547, DYS612, and DYS626). As expected, inclusion of additional Y-STR loci increased haplotype diversity (h), though complete differentiation of male lineages was impossible even by means of RM Y-STRs (h=0.99997). Analysis of molecular variance indicated that the three open populations were fairly homogeneous, whereas signs of genetic heterogeneity could be detected when the three isolates were also included in the analysis. Multidimensional scaling analysis showed that, even for extended haplotypes including RM Y-STR markers, Sardinians were clearly differentiated from populations of the Italian peninsula and Sicily. The only exception was represented by the Carloforte sample that, in accordance with its peculiar population history, clustered with Northern/Central Italian populations. The introduction of extended forensic Y-STR panels, including highly variable RM Y-STR markers, is expected to reduce the impact of population structure on haplotype frequency estimations. However, our results show that the availability of geographically detailed reference databases is still important for the assessment of the evidential value of a Y-haplotype match. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Haapalainen, Minna L; Wang, Jinhui; Latvala, Satu; Lehtonen, Mikko T; Pirhonen, Minna; Nissinen, Anne I
2018-03-30
'Candidatus Liberibacter solanacearum' (CLso) haplotype C is associated with disease in carrots and transmitted by the carrot psyllid Trioza apicalis. To identify possible other sources and vectors of this pathogen in Finland, samples were taken of wild plants within and near the carrot fields, the psyllids feeding on these plants, parsnips growing next to carrots, and carrot seeds. For analyzing the genotype of the CLso positive samples, a multi-locus sequence typing (MLST) scheme was developed. CLso haplotype C was detected in 11% of the Trioza anthrisci samples, in 35% of the Anthriscus sylvestris plants with discoloration, and in parsnips showing leaf discoloration. MLST revealed that the CLso in T. anthrisci and most A. sylvestris plants represent different strains than the bacteria found in T. apicalis and the cultivated plants. CLso haplotype D was detected in two of the 34 carrot seed lots tested, but was not detected in the plants grown from these seeds. Phylogenetic analysis by UPGMA clustering suggested that the haplotype D is more closely related to the haplotype A than to C. A novel, sixth haplotype of CLso, most closely related to A and D, was found in the psyllid Trioza urticae and stinging nettle (Urtica dioica, Urticaceae), and named as haplotype U.
David, Sean P; Mezuk, Briana; Zandi, Peter P; Strong, David; Anthony, James C; Niaura, Raymond; Uhl, George R; Eaton, William W
2010-03-01
The 11q23.1 genomic region has been associated with nicotine dependence in Black and White Americans. By conducting linkage disequilibrium analyses of 7 informative single nucleotide polymorphisms (SNPs) within the tetratricopeptide repeat domain 12 (TTC12)/ankyrin repeat and kinase containing 1 (ANKK1)/dopamine (D2) receptor gene cluster, we identified haplotype block structures in 270 Black and 368 White (n = 638) participants, from the Baltimore Epidemiologic Catchment Area cohort study, spanning the TTC12 and ANKK1 genes consisting of three SNPs (rs2303380-rs4938015-rs11604671). Informative haplotypes were examined for sex-specific associations with daily tobacco smoking initiation and cessation using longitudinal data from 1993-1994 and 2004-2005 interviews. There was a Haplotype x Sex interaction such that Black men possessing the GTG haplotype who were smokers in 1993-2004 were more likely to have stopped smoking by 2004-2005 (55.6% GTG vs. 22.0% other haplotypes), while Black women were less likely to have quit smoking if they possessed the GTG (20.8%) versus other haplotypes (24.0%; p = .028). In Whites, the GTG haplotype (vs. other haplotypes) was associated with lifetime history of daily smoking (smoking initiation; odds ratio = 1.6; 95% CI = 1.1-2.4; p = .013). Moreover, there was a Haplotype x Sex interaction such that there was higher prevalence of smoking initiation with GTG (77.6%) versus other haplotypes (57.0%; p = .043). In 2 different ethnic American populations, we observed man-woman variation in the influence of the rs2303380-rs4938015-rs11604671 GTG haplotype on smoking initiation and cessation. These results should be replicated in larger cohorts to establish the relationship among the rs2303380-rs4938015-rs11604671 haplotype block, sex, and smoking behavior.
Jugessur, Astanand; Rahimov, Fedik; Lie, Rolv T.; Wilcox, Allen J.; Gjessing, Håkon K.; Nilsen, Roy M.; Nguyen, Truc Trung; Murray, Jeffrey C.
2009-01-01
Mutations in the gene encoding interferon regulatory factor 6 (IRF6) underlie a common form of syndromic clefting known as Van der Woude syndrome. Lip pits and missing teeth are the only additional features distinguishing the syndrome from isolated clefts. Van der Woude syndrome, therefore, provides an excellent model for studying the isolated forms of clefting. From a population-based case-control study of facial clefts in Norway (1996–2001), we selected 377 cleft lip with or without cleft palate (CL/P), 196 cleft palate only (CPO), and 763 control infant-parent triads for analysis. We genotyped six single nucleotide polymorphisms within the IRF6 locus and estimated the relative risks (RR) conferred on the child by alleles and haplotypes of the child and of the mother. On the whole, there were strong statistical associations with CL/P but not CPO in our data. In single-marker analyses, mothers with a double-dose of the ‘a’-allele at rs4844880 had an increased risk of having a child with CL/P (RR = 1.85, 95% confidence interval: 1.04–3.25; P = 0.036). An RR of 0.38 (95% confidence interval: 0.16–0.92; P = 0.031) was obtained when the child carried a single-dose of the ‘a’-allele at rs2235371 (the p.V274I polymorphism). The P-value for the overall test was <0.001. In haplotype analyses, several of the fetal and maternal haplotype relative risks were statistically significant individually but were not strong enough to show up on the overall test (P = 0.113). Taken together, these findings further support a role for IRF6 variants in clefting of the lip and provide specific risk estimates in a Norwegian population. PMID:18278815
Qiu, Anqi; Tuan, Ta Anh; Ong, Mei Lyn; Li, Yue; Chen, Helen; Rifkin-Graboi, Anne; Broekman, Birit F P; Kwek, Kenneth; Saw, Seang-Mei; Chong, Yap-Seng; Gluckman, Peter D; Fortier, Marielle V; Holbrook, Joanna Dawn; Meaney, Michael J
2015-02-01
Exposure to antenatal maternal anxiety and complex genetic variations may shape fetal brain development. In particular, the catechol-O-methyltransferase (COMT) gene, located on chromosome 22q11.2, regulates catecholamine signaling in the prefrontal cortex and is implicated in anxiety, pain, and stress responsivity. This study examined whether individual single-nucleotide polymorphisms (SNPs) of the COMT gene and their haplotypes moderate the association between antenatal maternal anxiety and in utero cortical development. A total of 146 neonates were genotyped and underwent MRI shortly after birth. Neonatal cortical morphology was characterized using cortical thickness. Antenatal maternal anxiety was assessed using the State-Trait Anxiety Inventory at week 26 of pregnancy. Individual COMT SNPs (val158met, rs737865, and rs165599) modulated the association between antenatal maternal anxiety and the prefrontal and parietal cortical thickness in neonates. Based on haplotype trend regression analysis, findings also showed that among rs737865-val158met-rs165599 haplotypes, the A-val-G (AGG) haplotype probabilities modulated positive associations of antenatal maternal anxiety with cortical thickness in the right ventrolateral prefrontal cortex and the right superior parietal cortex and precuneus. In contrast, the G-met-A (GAA) haplotype probabilities modulated negative associations of antenatal maternal anxiety with cortical thickness in bilateral precentral gyrus and the dorsolateral prefrontal cortex. These results suggest that the association between maternal anxiety and in utero neurodevelopment is modified through complex genetic variation in COMT. Such genetic moderation may explain, in part, the variation in phenotypic outcomes in offspring associated with maternal emotional well-being.
Controlling Protein Surface Orientation by Strategic Placement of Oligo-Histidine Tags
2017-01-01
We report oriented immobilization of proteins using the standard hexahistidine (His6)-Ni2+:NTA (nitrilotriacetic acid) methodology, which we systematically tuned to give control of surface coverage. Fluorescence microscopy and surface plasmon resonance measurements of self-assembled monolayers (SAMs) of red fluorescent proteins (TagRFP) showed that binding strength increased by 1 order of magnitude for each additional His6-tag on the TagRFP proteins. All TagRFP variants with His6-tags located on only one side of the barrel-shaped protein yielded a 1.5 times higher surface coverage compared to variants with His6-tags on opposite sides of the so-called β-barrel. Time-resolved fluorescence anisotropy measurements supported by polarized infrared spectroscopy verified that the orientation (and thus coverage and functionality) of proteins on surfaces can be controlled by strategic placement of a His6-tag on the protein. Molecular dynamics simulations show how the differently tagged proteins reside at the surface in “end-on” and “side-on” orientations with each His6-tag contributing to binding. Also, not every dihistidine subunit in a given His6-tag forms a full coordination bond with the Ni2+:NTA SAMs, which varied with the position of the His6-tag on the protein. At equal valency but different tag positions on the protein, differences in binding were caused by probing for Ni2+:NTA moieties and by additional electrostatic interactions between different fractions of the β-barrel structure and charged NTA moieties. Potential of mean force calculations indicate there is no specific single-protein interaction mode that provides a clear preferential surface orientation, suggesting that the experimentally measured preference for the end-on orientation is a supra-protein, not a single-protein, effect. PMID:28850777
Yamaguchi-Kabata, Yumi; Tsunoda, Tatsuhiko; Kumasaka, Natsuhiko; Takahashi, Atsushi; Hosono, Naoya; Kubo, Michiaki; Nakamura, Yusuke; Kamatani, Naoyuki
2012-05-01
Although the Japanese population has a rather low genetic diversity, we recently confirmed the presence of two main clusters (the Hondo and Ryukyu clusters) through principal component analysis of genome-wide single-nucleotide polymorphism (SNP) genotypes. Understanding the genetic differences between the two main clusters requires further genome-wide analyses based on a dense SNP set and comparison of haplotype frequencies. In the present study, we determined haplotypes for the Hondo cluster of the Japanese population by detecting SNP homozygotes with 388,591 autosomal SNPs from 18,379 individuals and estimated the haplotype frequencies. Haplotypes for the Ryukyu cluster were inferred by a statistical approach using the genotype data from 504 individuals. We then compared the haplotype frequencies between the Hondo and Ryukyu clusters. In most genomic regions, the haplotype frequencies in the Hondo and Ryukyu clusters were very similar. However, in addition to the human leukocyte antigen region on chromosome 6, other genomic regions (chromosomes 3, 4, 5, 7, 10 and 12) showed dissimilarities in haplotype frequency. These regions were enriched for genes involved in the immune system, cell-cell adhesion and the intracellular signaling cascade. These differentiated genomic regions between the Hondo and Ryukyu clusters are of interest because they (1) should be examined carefully in association studies and (2) likely contain genes responsible for morphological or physiological differences between the two groups.
Notes on SAW Tag Interrogation Techniques
NASA Technical Reports Server (NTRS)
Barton, Richard J.
2010-01-01
We consider the problem of interrogating a single SAW RFID tag with a known ID and known range in the presence of multiple interfering tags under the following assumptions: (1) The RF propagation environment is well approximated as a simple delay channel with geometric power-decay constant alpha >/= 2. (2) The interfering tag IDs are unknown but well approximated as independent, identically distributed random samples from a probability distribution of tag ID waveforms with known second-order properties, and the tag of interest is drawn independently from the same distribution. (3) The ranges of the interfering tags are unknown but well approximated as independent, identically distributed realizations of a random variable rho with a known probability distribution f(sub rho) , and the tag ranges are independent of the tag ID waveforms. In particular, we model the tag waveforms as random impulse responses from a wide-sense-stationary, uncorrelated-scattering (WSSUS) fading channel with known bandwidth and scattering function. A brief discussion of the properties of such channels and the notation used to describe them in this document is given in the Appendix. Under these assumptions, we derive the expression for the output signal-to-noise ratio (SNR) for an arbitrary combination of transmitted interrogation signal and linear receiver filter. Based on this expression, we derive the optimal interrogator configuration (i.e., transmitted signal/receiver filter combination) in the two extreme noise/interference regimes, i.e., noise-limited and interference-limited, under the additional assumption that the coherence bandwidth of the tags is much smaller than the total tag bandwidth. Finally, we evaluate the performance of both optimal interrogators over a broad range of operating scenarios using both numerical simulation based on the assumed model and Monte Carlo simulation based on a small sample of measured tag waveforms. The performance evaluation results not only
Klitz, W; Maiers, M; Spellman, S; Baxter-Lowe, L A; Schmeckpeper, B; Williams, T M; Fernandez-Viña, M
2003-10-01
A collaborative study involving a large sample of European Americans was typed for the histocompatibility loci of the HLA DR-DQ region and subjected to intensive typing validation measures in order to accurately determine haplotype composition and frequency. The resulting tables have immediate application to HLA typing and allogeneic transplantation. The loci within the DR-DQ region are especially valuable for such an undertaking because of their tight linkage and high linkage disequilibrium. The 3798 haplotypes, derived from 1899 unrelated individuals, had a total of 75 distinct DRB1-DQA1-DQB1 haplotypes. The frequency distribution of the haplotypes was right skewed with haplotypes occurring at a frequency of less than 1% numbering 59 and yet constituting less than 12% of the total sample. Given DRB1 typing, it was possible to infer the exact DQA1 and DQB1 composition of a haplotype with high confidence (>90% likelihood) in 21 of the 35 high-resolution DRB1 alleles present in the sample. Of the DRB1 alleles without high reliability for DQ haplotype inference, only *0401, *0701 and *1302 were common, the remaining 11 DRB1 alleles constituting less than 5% of the total sample. This approach failed for the 13 serologically equivalent DR alleles in which only 33% of DQ haplotypes could be reliably inferred. The 36 DQA1-DQB1 haplotypes present in the total sample conformed to the known pattern of permissible heterodimers. Four DQA1-DQB1 haplotypes, all rare, are reported here for the first time. The haplotype frequency tables are suitable as a reference standard for HLA typing of the DR and DQ loci in European Americans.
Lukeš, Tomáš; Pospíšil, Jakub; Fliegel, Karel; Lasser, Theo; Hagen, Guy M
2018-03-01
Super-resolution single molecule localization microscopy (SMLM) is a method for achieving resolution beyond the classical limit in optical microscopes (approx. 200 nm laterally). Yellow fluorescent protein (YFP) has been used for super-resolution single molecule localization microscopy, but less frequently than other fluorescent probes. Working with YFP in SMLM is a challenge because a lower number of photons are emitted per molecule compared with organic dyes, which are more commonly used. Publically available experimental data can facilitate development of new data analysis algorithms. Four complete, freely available single molecule super-resolution microscopy datasets on YFP-tagged growth factor receptors expressed in a human cell line are presented, including both raw and analyzed data. We report methods for sample preparation, for data acquisition, and for data analysis, as well as examples of the acquired images. We also analyzed the SMLM datasets using a different method: super-resolution optical fluctuation imaging (SOFI). The 2 modes of analysis offer complementary information about the sample. A fifth single molecule super-resolution microscopy dataset acquired with the dye Alexa 532 is included for comparison purposes. This dataset has potential for extensive reuse. Complete raw data from SMLM experiments have typically not been published. The YFP data exhibit low signal-to-noise ratios, making data analysis a challenge. These datasets will be useful to investigators developing their own algorithms for SMLM, SOFI, and related methods. The data will also be useful for researchers investigating growth factor receptors such as ErbB3.
The effect of using genealogy-based haplotypes for genomic prediction.
Edriss, Vahid; Fernando, Rohan L; Su, Guosheng; Lund, Mogens S; Guldbrandtsen, Bernt
2013-03-06
Genomic prediction uses two sources of information: linkage disequilibrium between markers and quantitative trait loci, and additive genetic relationships between individuals. One way to increase the accuracy of genomic prediction is to capture more linkage disequilibrium by regression on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (π) of the haplotype covariates had zero effect, i.e. a Bayesian mixture method. About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some cases, decreased the bias of prediction. With the Bayesian method, accuracy of prediction was less sensitive to parameter π when fitting haplotypes compared to fitting markers. Use of haplotypes based on genealogy can slightly increase the accuracy of genomic prediction. Improved methods to cluster the haplotypes constructed from local genealogy could lead to additional gains in accuracy.
iXora: exact haplotype inferencing and trait association.
Utro, Filippo; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar E; Royaert, Stefan; Schnell, Raymond J; Motamayor, Juan Carlos; Kuhn, David N; Parida, Laxmi
2013-06-06
We address the task of extracting accurate haplotypes from genotype data of individuals of large F1 populations for mapping studies. While methods for inferring parental haplotype assignments on large F1 populations exist in theory, these approaches do not work in practice at high levels of accuracy. We have designed iXora (Identifying crossovers and recombining alleles), a robust method for extracting reliable haplotypes of a mapping population, as well as parental haplotypes, that runs in linear time. Each allele in the progeny is assigned not just to a parent, but more precisely to a haplotype inherited from the parent. iXora shows an improvement of at least 15% in accuracy over similar systems in literature. Furthermore, iXora provides an easy-to-use, comprehensive environment for association studies and hypothesis checking in populations of related individuals. iXora provides detailed resolution in parental inheritance, along with the capability of handling very large populations, which allows for accurate haplotype extraction and trait association. iXora is available for non-commercial use from http://researcher.ibm.com/project/3430.
Tagging Efficiency for Nuclear Physics Measurements at MAX-lab
NASA Astrophysics Data System (ADS)
Miller, Nevin; Elofson, David; Lewis, Codie; O'Brien, Erin; Buggelli, Kelsey; O'Connor, Kyle; O'Rielly, Grant; Maxtagg Team
2014-09-01
A careful study of the tagging efficiency during measurements of near threshold pion photoproduction and high energy Compton scattering has been performed. These experiments are being done at the MAX-lab tagged photon Facility during the June 2014 run period. The determination of the final results from these experiments depends on knowledge of the incident photon flux. The tagging efficiency is a critical part of the photon flux calculation. In addition to daily measurements of the tagging efficiency, a beam monitor was used during the production data runs to monitor the relative tagging efficiency. Two trigger types were used in the daily measurements; one was a logical OR from the tagger array and the other was from the Pb-glass photon detector. Investigations were made to explore the effect of the different trigger conditions and the differences between single and multi hit TDCs on the tagging efficiency. In addition the time evolution and overall uncertainty in the tagging efficiency for each tagger channel was determined. The results will be discussed.
Ancestral Asian source(s) of new world Y-chromosome founder haplotypes.
Karafet, T M; Zegura, S L; Posukh, O; Osipova, L; Bergen, A; Long, J; Goldman, D; Klitz, W; Harihara, S; de Knijff, P; Wiebe, V; Griffiths, R C; Templeton, A R; Hammer, M F
1999-01-01
Haplotypes constructed from Y-chromosome markers were used to trace the origins of Native Americans. Our sample consisted of 2,198 males from 60 global populations, including 19 Native American and 15 indigenous North Asian groups. A set of 12 biallelic polymorphisms gave rise to 14 unique Y-chromosome haplotypes that were unevenly distributed among the populations. Combining multiallelic variation at two Y-linked microsatellites (DYS19 and DXYS156Y) with the unique haplotypes results in a total of 95 combination haplotypes. Contra previous findings based on Y- chromosome data, our new results suggest the possibility of more than one Native American paternal founder haplotype. We postulate that, of the nine unique haplotypes found in Native Americans, haplotypes 1C and 1F are the best candidates for major New World founder haplotypes, whereas haplotypes 1B, 1I, and 1U may either be founder haplotypes and/or have arrived in the New World via recent admixture. Two of the other four haplotypes (YAP+ haplotypes 4 and 5) are probably present because of post-Columbian admixture, whereas haplotype 1G may have originated in the New World, and the Old World source of the final New World haplotype (1D) remains unresolved. The contrasting distribution patterns of the two major candidate founder haplotypes in Asia and the New World, as well as the results of a nested cladistic analysis, suggest the possibility of more than one paternal migration from the general region of Lake Baikal to the Americas. PMID:10053017
Laan, Maris; Wiebe, Victor; Khusnutdinova, Elza; Remm, Maido; Pääbo, Svante
2005-01-01
Linkage disequilibrium structure is still unpredictable because the interplay of regional recombination rate and demographic history is poorly understood. We have compared the distribution of LD across two genomic regions differing in crossing-over activity – Xq13 (0.166 cM/Mb) and Xp22 (1.3 cM/Mb) – in 15 Eurasian populations. Demographic events predicted to increase the LD level – genetic drift, bottleneck and admixture – had a very strong impact on extent and patterns of regional LD across Xq13 compared to Xp22. The haplotype distribution of the DXS1225-DXS8082 microsatellites from Xq13 exhibiting strong association in all populations was remarkably influenced by population history. European populations shared one common haplotype with a frequency of 25-40%. The Volga-Ural populations studied, living at the geographic borderline of Europe, showed elevated LD as well as harboring a significant fraction of haplotypes originating from East Asia, thus reflecting their past migrations and admixture. In the young Kuusamo isolate from Finland, a bottleneck has led to allelic associations between loci and shifted the haplotype distribution, but has much less affected single microsatellite allele frequencies compared to the main Finnish population. The data show that the footprint of a demographic event is longer preserved in haplotype distribution within a region of low crossing-over rate, than in the information content of a single marker, or between actively recombining markers. As the knowledge of LD patterns is often chosen to assist association mapping of common disease, our conclusions emphasise the importance of understanding the history, structure and variation of a study population. PMID:15657606
Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z
2014-03-01
The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P < 0.05), six significantly downregulated MGMT promoter activity (29-97% decrease; P < 0.05) and one haplotype had no effect. Mechanistic studies conducted support the conclusion that MGMT P/E haplotypes, rather than individual SNPs, differentially regulate MGMT transcription and could thus play a significant role in human sensitivity to environmental and therapeutic alkylating agents.
Kelemen, Arpad; Vasilakos, Athanasios V; Liang, Yulan
2009-09-01
Comprehensive evaluation of common genetic variations through association of single-nucleotide polymorphism (SNP) structure with common complex disease in the genome-wide scale is currently a hot area in human genome research due to the recent development of the Human Genome Project and HapMap Project. Computational science, which includes computational intelligence (CI), has recently become the third method of scientific enquiry besides theory and experimentation. There have been fast growing interests in developing and applying CI in disease mapping using SNP and haplotype data. Some of the recent studies have demonstrated the promise and importance of CI for common complex diseases in genomic association study using SNP/haplotype data, especially for tackling challenges, such as gene-gene and gene-environment interactions, and the notorious "curse of dimensionality" problem. This review provides coverage of recent developments of CI approaches for complex diseases in genetic association study with SNP/haplotype data.
Design of Inkjet-Printed RFID-Based Sensor on Paper: Single- and Dual-Tag Sensor Topologies.
Kim, Sangkil; Georgiadis, Apostolos; Tentzeris, Manos M
2018-06-17
The detailed design considerations for the printed RFID-based sensor system is presented in this paper. Starting from material selection and metallization method, this paper discusses types of RFID-based sensors (single- & dual-tag sensor topologies), design procedures, and performance evaluation methods for the wireless sensor system. The electrical properties of the paper substrates (cellulose-based and synthetic papers) and the silver nano-particle-based conductive film are thoroughly characterized for RF applications up to 8 GHz. The reported technology could potentially set the foundation for truly “green”, low-cost, scalable wireless topologies for autonomous Internet-of-Things (IoT), bio-monitoring, and “smart skin” applications.
Mitochondrial haplotype variation and phylogeography of Iberian brown trout populations.
MacHordom, A; Suárez, J; Almodóvar, A; Bautista, J M
2000-09-01
The biogeographical distribution of brown trout mitochondrial DNA haplotypes throughout the Iberian Peninsula was established by polymerase chain reaction-restriction fragment polymorphism analysis. The study of 507 specimens from 58 localities representing eight widely separated Atlantic-slope (north and west Iberian coasts) and six Mediterranean drainage systems served to identify five main groups of mitochondrial haplotypes: (i) haplotypes corresponding to non-native, hatchery-reared brown trout that were widely distributed but also found in wild populations of northern Spain (Cantabrian slope); (ii) a widespread Atlantic haplotype group; (iii) a haplotype restricted to the Duero Basin; (iv) a haplotype shown by southern Iberian populations; and (v) a Mediterranean haplotype. The Iberian distribution of these haplotypes reflects both the current fishery management policy of introducing non-native brown trout, and Messinian palaeobiogeography. Our findings complement and extend previous allozyme studies on Iberian brown trout and improve present knowledge of glacial refugia and postglacial movement of brown trout lineages.
The effect of using genealogy-based haplotypes for genomic prediction
2013-01-01
Background Genomic prediction uses two sources of information: linkage disequilibrium between markers and quantitative trait loci, and additive genetic relationships between individuals. One way to increase the accuracy of genomic prediction is to capture more linkage disequilibrium by regression on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. Methods A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (π) of the haplotype covariates had zero effect, i.e. a Bayesian mixture method. Results About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some cases, decreased the bias of prediction. With the Bayesian method, accuracy of prediction was less sensitive to parameter π when fitting haplotypes compared to fitting markers. Conclusions Use of haplotypes based on genealogy can slightly increase the accuracy of genomic prediction. Improved methods to cluster the haplotypes constructed from local genealogy could lead to additional gains in accuracy. PMID:23496971
Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei
2018-01-01
DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.
Exact algorithms for haplotype assembly from whole-genome sequence data.
Chen, Zhi-Zhong; Deng, Fei; Wang, Lusheng
2013-08-15
Haplotypes play a crucial role in genetic analysis and have many applications such as gene disease diagnoses, association studies, ancestry inference and so forth. The development of DNA sequencing technologies makes it possible to obtain haplotypes from a set of aligned reads originated from both copies of a chromosome of a single individual. This approach is often known as haplotype assembly. Exact algorithms that can give optimal solutions to the haplotype assembly problem are highly demanded. Unfortunately, previous algorithms for this problem either fail to output optimal solutions or take too long time even executed on a PC cluster. We develop an approach to finding optimal solutions for the haplotype assembly problem under the minimum-error-correction (MEC) model. Most of the previous approaches assume that the columns in the input matrix correspond to (putative) heterozygous sites. This all-heterozygous assumption is correct for most columns, but it may be incorrect for a small number of columns. In this article, we consider the MEC model with or without the all-heterozygous assumption. In our approach, we first use new methods to decompose the input read matrix into small independent blocks and then model the problem for each block as an integer linear programming problem, which is then solved by an integer linear programming solver. We have tested our program on a single PC [a Linux (x64) desktop PC with i7-3960X CPU], using the filtered HuRef and the NA 12878 datasets (after applying some variant calling methods). With the all-heterozygous assumption, our approach can optimally solve the whole HuRef data set within a total time of 31 h (26 h for the most difficult block of the 15th chromosome and only 5 h for the other blocks). To our knowledge, this is the first time that MEC optimal solutions are completely obtained for the filtered HuRef dataset. Moreover, in the general case (without the all-heterozygous assumption), for the HuRef dataset our
MHC Class II haplotypes of Colombian Amerindian tribes
Yunis, Juan J.; Yunis, Edmond J.; Yunis, Emilio
2013-01-01
We analyzed 1041 individuals belonging to 17 Amerindian tribes of Colombia, Chimila, Bari and Tunebo (Chibcha linguistic family), Embera, Waunana (Choco linguistic family), Puinave and Nukak (Maku-Puinave linguistic families), Cubeo, Guanano, Tucano, Desano and Piratapuyo (Tukano linguistic family), Guahibo and Guayabero (Guayabero Linguistic Family), Curripaco and Piapoco (Arawak linguistic family) and Yucpa (Karib linguistic family). for MHC class II haplotypes (HLA-DRB1, DQA1, DQB1). Approximately 90% of the MHC class II haplotypes found among these tribes are haplotypes frequently encountered in other Amerindian tribes. Nonetheless, striking differences were observed among Chibcha and non-Chibcha speaking tribes. The DRB1*04:04, DRB1*04:11, DRB1*09:01 carrying haplotypes were frequently found among non-Chibcha speaking tribes, while the DRB1*04:07 haplotype showed significant frequencies among Chibcha speaking tribes, and only marginal frequencies among non-Chibcha speaking tribes. Our results suggest that the differences in MHC class II haplotype frequency found among Chibcha and non-Chibcha speaking tribes could be due to genetic differentiation in Mesoamerica of the ancestral Amerindian population into Chibcha and non-Chibcha speaking populations before they entered into South America. PMID:23885196
Sparse Tensor Decomposition for Haplotype Assembly of Diploids and Polyploids.
Hashemi, Abolfazl; Zhu, Banghua; Vikalo, Haris
2018-03-21
Haplotype assembly is the task of reconstructing haplotypes of an individual from a mixture of sequenced chromosome fragments. Haplotype information enables studies of the effects of genetic variations on an organism's phenotype. Most of the mathematical formulations of haplotype assembly are known to be NP-hard and haplotype assembly becomes even more challenging as the sequencing technology advances and the length of the paired-end reads and inserts increases. Assembly of haplotypes polyploid organisms is considerably more difficult than in the case of diploids. Hence, scalable and accurate schemes with provable performance are desired for haplotype assembly of both diploid and polyploid organisms. We propose a framework that formulates haplotype assembly from sequencing data as a sparse tensor decomposition. We cast the problem as that of decomposing a tensor having special structural constraints and missing a large fraction of its entries into a product of two factors, U and [Formula: see text]; tensor [Formula: see text] reveals haplotype information while U is a sparse matrix encoding the origin of erroneous sequencing reads. An algorithm, AltHap, which reconstructs haplotypes of either diploid or polyploid organisms by iteratively solving this decomposition problem is proposed. The performance and convergence properties of AltHap are theoretically analyzed and, in doing so, guarantees on the achievable minimum error correction scores and correct phasing rate are established. The developed framework is applicable to diploid, biallelic and polyallelic polyploid species. The code for AltHap is freely available from https://github.com/realabolfazl/AltHap . AltHap was tested in a number of different scenarios and was shown to compare favorably to state-of-the-art methods in applications to haplotype assembly of diploids, and significantly outperforms existing techniques when applied to haplotype assembly of polyploids.
HLA-DR2-associated DRB1 and DRB5 alleles and haplotypes in Koreans.
Song, E Y; Kang, S J; Lee, Y J; Park, M H
2000-09-01
There are considerable racial differences in the distribution of HLA-DR2-associated DRB1 and DRB5 alleles and the characteristics of linkage disequilibrium between these alleles. In this study, the frequencies of DR2-associated DRB1 and DRB5 alleles and related haplotypes were analyzed in 186 DR2-positive individuals out of 800 normal Koreans registered for unrelated bone marrow donors. HLA class I antigen typing was performed by the serological method and DRB1 and DRB5 genotyping by the PCR-single strand conformational polymorphism method. Only 3 alleles were detected for DR2-associated DRB1 and DRB5 genes, respectively: DRB1(*)1501 (gene frequency 8.0%), (*)1502 (3.2%), (*)1602 (0.9%); DRB5(*)0101 (8.0%), (*)0102 (3.2%), and (*)0202 (0.9%). DRB1-DRB5 haplotype analysis showed an exclusive association between these alleles: DRB1*1501-DRB5*0101 (haplotype frequency 8.0%), DRB1(*)1502-DRB5(*)0102 (3.2%), and DRB1(*)1602-DRB5(*)0202 (0.9%). The 5 most common DR2-associated A-B-DRB1 haplotypes occurring at frequencies of > or = 0.5% were A24-B52-DRB1(*)1502 (1.8%), A2-B62-DRB1(*)1501, A2-B54-DRB1(*)1501, A26-B61-DRB1(*)1501, and A24-B51-DRB1(*)1501. The remarkable homogeneity in the haplotypic associations between DR2-associated DRB1 and DRB5 alleles in Koreans would be advantageous for organ transplantation compared with other ethnic groups showing considerable heterogeneity in the distribution of DRB1-DRB5 haplotypes.
Yamamoto, Toshio; Nagasaki, Hideki; Yonemaru, Jun-ichi; Ebana, Kaworu; Nakajima, Maiko; Shibaya, Taeko; Yano, Masahiro
2010-04-27
To create useful gene combinations in crop breeding, it is necessary to clarify the dynamics of the genome composition created by breeding practices. A large quantity of single-nucleotide polymorphism (SNP) data is required to permit discrimination of chromosome segments among modern cultivars, which are genetically related. Here, we used a high-throughput sequencer to conduct whole-genome sequencing of an elite Japanese rice cultivar, Koshihikari, which is closely related to Nipponbare, whose genome sequencing has been completed. Then we designed a high-throughput typing array based on the SNP information by comparison of the two sequences. Finally, we applied this array to analyze historical representative rice cultivars to understand the dynamics of their genome composition. The total 5.89-Gb sequence for Koshihikari, equivalent to 15.7 x the entire rice genome, was mapped using the Pseudomolecules 4.0 database for Nipponbare. The resultant Koshihikari genome sequence corresponded to 80.1% of the Nipponbare sequence and led to the identification of 67,051 SNPs. A high-throughput typing array consisting of 1917 SNP sites distributed throughout the genome was designed to genotype 151 representative Japanese cultivars that have been grown during the past 150 years. We could identify the ancestral origin of the pedigree haplotypes in 60.9% of the Koshihikari genome and 18 consensus haplotype blocks which are inherited from traditional landraces to current improved varieties. Moreover, it was predicted that modern breeding practices have generally decreased genetic diversity Detection of genome-wide SNPs by both high-throughput sequencer and typing array made it possible to evaluate genomic composition of genetically related rice varieties. With the aid of their pedigree information, we clarified the dynamics of chromosome recombination during the historical rice breeding process. We also found several genomic regions decreasing genetic diversity which might be
Vathipadiekal, Vinod; Farrell, John J.; Wang, Shuai; Edward, Heather L.; Shappell, Heather; Al-Rubaish, A.M.; Al-Muhanna, Fahad; Naserullah, Z.; Alsuliman, A.; Qutub, Hatem Othman; Simkin, Irene; Farrer, Lindsay A.; Jiang, Zhihua; Luo, Hong-Yuan; Huang, Shengwen; Mostoslavsky, Gustavo; Murphy, George J.; Patra, Pradeep.K.; Chui, David H.K.; Alsultan, Abdulrahman; Al-Ali, Amein K.; Sebastiani, Paola.; Steinberg, Martin. H.
2016-01-01
Fetal hemoglobin (HbF) levels are higher in the Arab-Indian (AI) β-globin gene haplotype of sickle cell anemia compared with African-origin haplotypes. To study genetic elements that effect HbF expression in the AI haplotype we completed whole genome sequencing in 14 Saudi AI haplotype sickle hemoglobin homozygotes—seven selected for low HbF (8.2±1.3%) and seven selected for high HbF (23.5±.2.6%). An intronic single nucleotide polymorphism (SNP) in ANTXR1, an anthrax toxin receptor (chromosome 2p13), was associated with HbF. These results were replicated in two independent Saudi AI haplotype cohorts of 120 and 139 patients, but not in 76 Saudi Benin haplotype, 894 African origin haplotype and 44 Arab Indian haplotype patients of Indian descent, suggesting that this association is effective only in the Saudi AI haplotype background. ANTXR1 variants explained 10% of the HbF variability compared with 8% for BCL11A. These two genes had independent, additive effects on HbF and together explained about 15% of HbF variability in Saudi AI sickle cell anemia patients. ANTXR1 was expressed at mRNA and protein levels in erythroid progenitors derived from induced pluripotent stem cells (iPSCs) and CD34+ cells. As CD34+ cells matured and their HbF decreased ANTXR1 expression increased; as iPSCs differentiated and their HbF increased, ANTXR1 expression decreased. Along with elements in cis to the HbF genes, ANTXR1 contributes to the variation in HbF in Saudi AI haplotype sickle cell anemia and is the first gene in trans to HBB that is associated with HbF only in carriers of the Saudi AI haplotype. PMID:27501013
HaloTag technology for specific and covalent labeling of fusion proteins.
Benink, Hélène A; Urh, Marjeta
2015-01-01
Appending proteins of interest to fluorescent protein tags such as GFP has revolutionized how proteins are studied in the cellular environment. Over the last few decades many varieties of fluorescent proteins have been generated, each bringing new capability to research. However, taking full advantage of standard fluorescent proteins with advanced and differential features requires significant effort on the part of the researcher. This approach necessitates that many genetic fusions be generated and confirmed to function properly in cells with the same protein of interest. To lessen this burden, a newer category of protein fusion tags termed "self-labeling protein tags" has been developed. This approach utilizes a single protein tag, the function of which can be altered by attaching various chemical moieties (fluorescent labels, affinity handles, etc.). In this way a single genetically encoded protein fusion can easily be given functional diversity and adaptability as supplied by synthetic chemistry. Here we present protein labeling methods using HaloTag technology; comprised of HaloTag protein and the collection of small molecules designed to bind it specifically and provide it with varied functionalities. For imaging purposes these small molecules, termed HaloTag ligands, contain distinct fluorophores. Due to covalent and rapid binding between HaloTag protein and its ligands, labeling is permanent and efficient. Many of these ligands have been optimized for permeability across cellular membranes allowing for live cell labeling and imaging analysis. Nonpermeable ligands have also been developed for specific labeling of surface proteins. Overall, HaloTag is a versatile technology that empowers the end user to label a protein of interest with the choice of different fluorophores while alleviating the need for generation of multiple genetic fusions.
Radio tag retention and tag-related mortality among adult sockeye salmon
Ramstad, Kristina M.; Woody, Carol Ann
2003-01-01
Tag retention and tag-related mortality are concerns for any tagging study but are rarely estimated. We assessed retention and mortality rates for esophageal radio tag implants in adult sockeye salmon Oncorhynchus nerka. Migrating sockeye salmon captured at the outlet of Lake Clark, Alaska, were implanted with one of four different radio tags (14.5 × 43 mm (diameter × length), 14.5 × 49 mm, 16 × 46 mm, and 19 × 51 mm). Fish were observed for 15 to 35 d after tagging to determine retention and mortality rates. The overall tag retention rate was high (0.98; 95% confidence interval (CI), 0.92-1.00; minimum, 33 d), with one loss of a 19-mm × 51- mm tag. Mortality of tagged sockeye salmon (0.02; 95% CI, 0-0.08) was similar to that of untagged controls (0.03 (0-0.15)). Sockeye salmon with body lengths (mid-eye to tail fork) of 585-649 mm retained tags as large as 19 × 51 mm and those with body lengths of 499-628 mm retained tags as small as 14.5 × 43 mm for a minimum of 33 d with no increase in mortality. The tags used in this study represent a suite of radio tags that vary in size, operational life, and cost but that are effective in tracking adult anadromous salmon with little tag loss or increase in fish mortality.
Vitamin K epoxide reductase complex subunit 1 (Vkorc1) haplotype diversity in mouse priority strains
Song, Ying; Vera, Nicole; Kohn, Michael H
2008-01-01
Background Polymorphisms in the vitamin K-epoxide reductase complex subunit 1 gene, Vkorc1, could affect blood coagulation and other vitamin K-dependent proteins, such as osteocalcin (bone Gla protein, BGP). Here we sequenced the Vkorc1 gene in 40 mouse priority strains. We analyzed Vkorc1 haplotypes with respect to prothrombin time (PT) and bone mineral density and composition (BMD and BMC); phenotypes expected to be vitamin K-dependent and represented by data in the Mouse Phenome Database (MPD). Findings In the commonly used laboratory strains of Mus musculus domesticus we identified only four haplotypes differing in the intron or 5' region sequence of the Vkorc1. Six haplotypes differing by coding and non-coding polymorphisms were identified in the other subspecies of Mus. We detected no significant association of Vkorc1 haplotypes with PT, BMD and BMC within each subspecies of Mus. Vkorc1 haplotype sequences divergence between subspecies was associated with PT, BMD and BMC. Conclusion Phenotypic variation in PT, BMD and BMC within subspecies of Mus, while substantial, appears to be dominated by genetic variation in genes other than the Vkorc1. This was particularly evident for M. m. domesticus, where a single haplotype was observed in conjunction with virtually the entire range of PT, BMD and BMC values of all 5 subspecies of Mus included in this study. Differences in these phenotypes between subspecies also should not be attributed to Vkorc1 variants, but should be viewed as a result of genome wide genetic divergence. PMID:19046458
HaloTag Technology: A Versatile Platform for Biomedical Applications
2015-01-01
Exploration of protein function and interaction is critical for discovering links among genomics, proteomics, and disease state; yet, the immense complexity of proteomics found in biological systems currently limits our investigational capacity. Although affinity and autofluorescent tags are widely employed for protein analysis, these methods have been met with limited success because they lack specificity and require multiple fusion tags and genetic constructs. As an alternative approach, the innovative HaloTag protein fusion platform allows protein function and interaction to be comprehensively analyzed using a single genetic construct with multiple capabilities. This is accomplished using a simplified process, in which a variable HaloTag ligand binds rapidly to the HaloTag protein (usually linked to the protein of interest) with high affinity and specificity. In this review, we examine all current applications of the HaloTag technology platform for biomedical applications, such as the study of protein isolation and purification, protein function, protein–protein and protein–DNA interactions, biological assays, in vitro cellular imaging, and in vivo molecular imaging. In addition, novel uses of the HaloTag platform are briefly discussed along with potential future applications. PMID:25974629
Tibély, Gergely; Pollner, Péter; Vicsek, Tamás; Palla, Gergely
2013-01-01
Tagging items with descriptive annotations or keywords is a very natural way to compress and highlight information about the properties of the given entity. Over the years several methods have been proposed for extracting a hierarchy between the tags for systems with a "flat", egalitarian organization of the tags, which is very common when the tags correspond to free words given by numerous independent people. Here we present a complete framework for automated tag hierarchy extraction based on tag occurrence statistics. Along with proposing new algorithms, we are also introducing different quality measures enabling the detailed comparison of competing approaches from different aspects. Furthermore, we set up a synthetic, computer generated benchmark providing a versatile tool for testing, with a couple of tunable parameters capable of generating a wide range of test beds. Beside the computer generated input we also use real data in our studies, including a biological example with a pre-defined hierarchy between the tags. The encouraging similarity between the pre-defined and reconstructed hierarchy, as well as the seemingly meaningful hierarchies obtained for other real systems indicate that tag hierarchy extraction is a very promising direction for further research with a great potential for practical applications. Tags have become very prevalent nowadays in various online platforms ranging from blogs through scientific publications to protein databases. Furthermore, tagging systems dedicated for voluntary tagging of photos, films, books, etc. with free words are also becoming popular. The emerging large collections of tags associated with different objects are often referred to as folksonomies, highlighting their collaborative origin and the "flat" organization of the tags opposed to traditional hierarchical categorization. Adding a tag hierarchy corresponding to a given folksonomy can very effectively help narrowing or broadening the scope of search. Moreover
Tibély, Gergely; Pollner, Péter; Vicsek, Tamás; Palla, Gergely
2013-01-01
Tagging items with descriptive annotations or keywords is a very natural way to compress and highlight information about the properties of the given entity. Over the years several methods have been proposed for extracting a hierarchy between the tags for systems with a "flat", egalitarian organization of the tags, which is very common when the tags correspond to free words given by numerous independent people. Here we present a complete framework for automated tag hierarchy extraction based on tag occurrence statistics. Along with proposing new algorithms, we are also introducing different quality measures enabling the detailed comparison of competing approaches from different aspects. Furthermore, we set up a synthetic, computer generated benchmark providing a versatile tool for testing, with a couple of tunable parameters capable of generating a wide range of test beds. Beside the computer generated input we also use real data in our studies, including a biological example with a pre-defined hierarchy between the tags. The encouraging similarity between the pre-defined and reconstructed hierarchy, as well as the seemingly meaningful hierarchies obtained for other real systems indicate that tag hierarchy extraction is a very promising direction for further research with a great potential for practical applications. Tags have become very prevalent nowadays in various online platforms ranging from blogs through scientific publications to protein databases. Furthermore, tagging systems dedicated for voluntary tagging of photos, films, books, etc. with free words are also becoming popular. The emerging large collections of tags associated with different objects are often referred to as folksonomies, highlighting their collaborative origin and the “flat” organization of the tags opposed to traditional hierarchical categorization. Adding a tag hierarchy corresponding to a given folksonomy can very effectively help narrowing or broadening the scope of search
2011-01-01
Background Meta-analysis is a popular methodology in several fields of medical research, including genetic association studies. However, the methods used for meta-analysis of association studies that report haplotypes have not been studied in detail. In this work, methods for performing meta-analysis of haplotype association studies are summarized, compared and presented in a unified framework along with an empirical evaluation of the literature. Results We present multivariate methods that use summary-based data as well as methods that use binary and count data in a generalized linear mixed model framework (logistic regression, multinomial regression and Poisson regression). The methods presented here avoid the inflation of the type I error rate that could be the result of the traditional approach of comparing a haplotype against the remaining ones, whereas, they can be fitted using standard software. Moreover, formal global tests are presented for assessing the statistical significance of the overall association. Although the methods presented here assume that the haplotypes are directly observed, they can be easily extended to allow for such an uncertainty by weighting the haplotypes by their probability. Conclusions An empirical evaluation of the published literature and a comparison against the meta-analyses that use single nucleotide polymorphisms, suggests that the studies reporting meta-analysis of haplotypes contain approximately half of the included studies and produce significant results twice more often. We show that this excess of statistically significant results, stems from the sub-optimal method of analysis used and, in approximately half of the cases, the statistical significance is refuted if the data are properly re-analyzed. Illustrative examples of code are given in Stata and it is anticipated that the methods developed in this work will be widely applied in the meta-analysis of haplotype association studies. PMID:21247440
Impacts of TNF-LTA SNPs/Haplotypes and Lifestyle Factors on Oral Carcinoma in an Indian Population.
Bandil, Kapil; Singhal, Pallavi; Sharma, Upma; Hussain, Showket; Basu, Surojit; Parashari, Aditya; Singh, Veena; Sehgal, Ashok; Shivam, Animesh; Ahuja, Puneet; Bharadwaj, Mausumi; Banerjee, Basu Dev; Mehrotra, Ravi
2016-10-01
To investigate a potential association between single-nucleotide polymorphisms (SNPs) and haplotypes at the TNFA-LTA locus and the development of oral cancer in an Indian population. In this study, 150 oral precancer/cancer samples (50 precancer and 100 cancer), along with an equal number of control samples, were genotyped. Six SNPs at the TNF-LTA locus (i.e., -238G/A, -308G/A, -857C/T, -863C/A, -1031T/C, and +252A/G) were analyzed by use of a polymerase chain reaction-restriction fragment length polymorphism method, the assay was validated by sequencing 10 % of samples. The allelic frequencies of TNFA and LTA SNPs were found to be significantly associated with the risk of oral cancer and precancerous lesions in comparison with controls (P < 0.0003). Further haplotypic analysis showed that two haplotypes (ATCTGG and ACACGG) served as risk haplotypes for oral cancer. These haplotypes were also found to be significantly and positively associated with lifestyle habits (tobacco chewing P = 0.04, odds ratio [OR] 3.4) and socioeconomic status (P = 0.01, OR 3.4). We noticed an increased percentage of risk haplotypes correlating with the aggressiveness of oral cancer. The percentages of risk haplotypes were found to be threefold higher in precancer and fourfold higher in advanced stages of oral cancer in comparison with controls. Five SNPs at the TNF-LTA locus (i.e., -308G>A, -857C>T, -863C>A, -1031T>C, and +252A>G) were found to be associated with the development of oral cancer. Two haplotypes (ATCTGG and ACACGG) emerged as major risk haplotypes for oral carcinoma progression and were also found to be associated with lifestyle factors and clinical aggressiveness. These findings make the TNF-LTA locus a suitable candidate for a future biomarker, which may be used either for early detection or for helping to improve treatment efficacy and effectiveness.
ERIC Educational Resources Information Center
Current: The Journal of Marine Education, 1998
1998-01-01
In this group activity, children learn about the purpose of tagging and how scientists tag a shark. Using a cut-out of a shark, students identify, measure, record data, read coordinates, and tag a shark. Includes introductory information about the purpose of tagging and the procedure, a data sheet showing original tagging data from Tampa Bay, and…
Quantum tagging for tags containing secret classical data
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kent, Adrian
Various authors have considered schemes for quantum tagging, that is, authenticating the classical location of a classical tagging device by sending and receiving quantum signals from suitably located distant sites, in an environment controlled by an adversary whose quantum information processing and transmitting power is potentially unbounded. All of the schemes proposed elsewhere in the literature assume that the adversary is able to inspect the interior of the tagging device. All of these schemes have been shown to be breakable if the adversary has unbounded predistributed entanglement. We consider here the case in which the tagging device contains a finitemore » key string shared with distant sites but kept secret from the adversary, and show this allows the location of the tagging device to be authenticated securely and indefinitely. Our protocol relies on quantum key distribution between the tagging device and at least one distant site, and demonstrates a new practical application of quantum key distribution. It also illustrates that the attainable security in position-based cryptography can depend crucially on apparently subtle details in the security scenario considered.« less
Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila
2010-07-16
Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A
2010-01-01
Background Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Results Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M
Haplotypes and gene expression implicate the MAPT region for Parkinson disease
Tobin, J.E.; Latourelle, J.C.; Lew, M.F.; Klein, C.; Suchowersky, O.; Shill, H.A.; Golbe, L.I.; Mark, M.H.; Growdon, J.H.; Wooten, G.F.; Racette, B.A.; Perlmutter, J.S.; Watts, R.; Guttman, M.; Baker, K.B.; Goldwurm, S.; Pezzoli, G.; Singer, C.; Saint-Hilaire, M.H.; Hendricks, A.E.; Williamson, S.; Nagle, M.W.; Wilk, J.B.; Massood, T.; Laramie, J.M.; DeStefano, A.L.; Litvan, I.; Nicholson, G.; Corbett, A.; Isaacson, S.; Burn, D.J.; Chinnery, P.F.; Pramstaller, P.P.; Sherman, S.; Al-hinti, J.; Drasby, E.; Nance, M.; Moller, A.T.; Ostergaard, K.; Roxburgh, R.; Snow, B.; Slevin, J.T.; Cambi, F.; Gusella, J.F.; Myers, R.H.
2009-01-01
Background Microtubule-associated protein tau (MAPT) has been associated with several neurodegenerative disorders including forms of parkinsonism and Parkinson disease (PD). We evaluated the association of the MAPT region with PD in a large cohort of familial PD cases recruited by the GenePD Study. In addition, postmortem brain samples from patients with PD and neurologically normal controls were used to evaluate whether the expression of the 3-repeat and 4-repeat isoforms of MAPT, and neighboring genes Saitohin (STH) and KIAA1267, are altered in PD cerebellum. Methods Twenty-one single-nucleotide polymorphisms (SNPs) in the region of MAPT on chromosome 17q21 were genotyped in the GenePD Study. Single SNPs and haplotypes, including the H1 haplotype, were evaluated for association to PD. Relative quantification of gene expression was performed using real-time RT-PCR. Results After adjusting for multiple comparisons, SNP rs1800547 was significantly associated with PD affection. While the H1 haplotype was associated with a significantly increased risk for PD, a novel H1 subhaplotype was identified that predicted a greater increased risk for PD. The expression of 4-repeat MAPT, STH, and KIAA1267 was significantly increased in PD brains relative to controls. No difference in expression was observed for 3-repeat MAPT. Conclusions This study supports a role for MAPT in the pathogenesis of familial and idiopathic Parkinson disease (PD). Interestingly, the results of the gene expression studies suggest that other genes in the vicinity of MAPT, specifically STH and KIAA1267, may also have a role in PD and suggest complex effects for the genes in this region on PD risk. PMID:18509094
Gao, Su-Qing; Cheng, Xi; Li, Qian; Li, Yu-Zhu; Deng, Zhi-Hui
2009-06-01
This study was aimed to discover the novel HLA recombination haplotypes and investigate the distribution of haplotypes in Chinese Han population. Based on the HLA-A, B, DRB1 typing results of 179 family members, 791 haplotypes were assigned by the mode of inheritance. The results showed that a total of 4 novel recombinant haplotypes in HLA-DRB1 locus region were observed in 4 families, which ratio of paternal to maternal chromosomes was 3:1. The recombination ratio between HLA-DRB1 and HLA-A or B loci was 0.92% (4/433). There were a total of 362 kinds of HLA-A, -B, -DRB1 haplotypes to be confirmed in Chinese Han partial population. A33-B58-DR17, A2-B46-DR9, A30-B13-DR7, A11-B13-DR15, A11-B75-DR12 and A2-B46-DR14 were the most common haplotypes that was consistent with the distribution of HLA alleles in unrelated donors. There were A1-B63-DR12, A29-B46-DR15, A1-B61-DR10, A34-B35-DR9, A29-B54-DR4, A23-B13-DR16 and A34-B62-DR15 haplotypes and so on, which were rare haplotypes not yet reported in Chinese. It is concluded that the HLA-A-B-DRB1 haplotypes would be confirmed by analysis of their family pedigree. The results obtained in this study are basic data for study of Chinese anthropology, organ transplantation and disease correlation analysis.
Preparative SDS PAGE as an Alternative to His-Tag Purification of Recombinant Amelogenin
Gabe, Claire M.; Brookes, Steven J.; Kirkham, Jennifer
2017-01-01
Recombinant protein technology provides an invaluable source of proteins for use in structure-function studies, as immunogens, and in the development of therapeutics. Recombinant proteins are typically engineered with “tags” that allow the protein to be purified from crude host cell extracts using affinity based chromatography techniques. Amelogenin is the principal component of the developing enamel matrix and a frequent focus for biomineralization researchers. Several groups have reported the successful production of recombinant amelogenins but the production of recombinant amelogenin free of any tags, and at single band purity on silver stained SDS PAGE is technically challenging. This is important, as rigorous structure-function research frequently demands a high degree of protein purity and fidelity of protein sequence. Our aim was to generate His-tagged recombinant amelogenin at single band purity on silver stained SDS PAGE for use in functionality studies after His-tag cleavage. An acetic acid extraction technique (previously reported to produce recombinant amelogenin at 95% purity directly from E. coli) followed by repeated rounds of nickel column affinity chromatography, failed to generate recombinant amelogenin at single band purity. This was because following an initial round of nickel column affinity chromatography, subsequent cleavage of the His-tag was not 100% efficient. A second round of nickel column affinity chromatography, used in attempts to separate the cleaved His-tag free recombinant from uncleaved His-tagged contaminants, was still unsatisfactory as cleaved recombinant amelogenin exhibited significant affinity for the nickel column. To solve this problem, we used preparative SDS PAGE to successfully purify cleaved recombinant amelogenins to single band purity on silver stained SDS PAGE. The resolving power of preparative SDS PAGE was such that His-tag based purification of recombinant amelogenin becomes redundant. We suggest that acetic
Alpha-globin gene haplotypes in South American Indians.
Zago, M A; Melo Santos, E J; Clegg, J B; Guerreiro, J F; Martinson, J J; Norwich, J; Figueiredo, M S
1995-08-01
The haplotypes of the alpha-globin gene cluster were determined for 99 Indians from the Brazilian Amazon region who belong to 5 tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Three predominant haplotypes were identified: Ia (present in 38.9% of chromosomes), IIIa (25.8%), and IIe (22.1%). The only alpha-globin gene rearrangement detected was alpha alpha alpha 3.7 I gene triplication associated with haplotype IIIa, found in high frequencies (5.6% and 10.6%) in two tribes and absent in the others. alpha-Globin gene deletions that cause alpha-thalassemia were not seen, supporting the argument that malaria was absent in these populations until recently. The heterogeneous distribution of alpha-globin gene haplotypes and rearrangements among the different tribes differs markedly from the homogeneous distribution of beta-globin gene cluster haplotypes and reflects the action of various genetic mechanisms (genetic drift, founder effect, consanguinity) on small isolated population groups with a complicated history of divergence-fusion events. The alpha-globin gene haplotype distribution has some similarities to distributions observed in Southeast Asian and Pacific Island populations, indicating that these populations have considerable genetic affinities. However, the absence of several features of the alpha-globin gene cluster that are consistently present among the Pacific Islanders suggests that the similarity of haplotypes between Brazilian Indians and people from Polynesia, Micronesia, and Melanesia is more likely to result of ancient common ancestry rather than the consequence of recent direct genetic contribution through immigration.
A functional haplotype of UBE2L3 confers risk for Systemic Lupus Erythematosus
Wang, Shaofeng; Adrianto, Indra; Wiley, Graham B.; Lessard, Christopher J.; Kelly, Jennifer A.; Adler, Adam J.; Glenn, Stuart B.; Williams, Adrienne H.; Ziegler, Julie T.; Comeau, Mary E.; Marion, Miranda C.; Wakeland, Benjamin E.; Liang, Chaoying; Kaufman, Kenneth M.; Guthridge, Joel M.; Alarcón-Riquelme, Marta E.; Alarcón, Graciela S.; Anaya, Juan-Manuel; Bae, Sang-Cheol; Kim, Jae-Hoon; Joo, Young Bin; Boackle, Susan A.; Brown, Elizabeth E.; Petri, Michelle A.; Ramsey-Goldman, Rosalind; Reveille, John D.; Vilá, Luis M.; Criswell, Lindsey A.; Edberg, Jeffrey C.; Freedman, Barry I.; Gilkeson, Gary S.; Jacob, Chaim O.; James, Judith A.; Kamen, Diane L.; Kimberly, Robert P.; Martin, Javier; Merrill, Joan T.; Niewold, Timothy B.; Pons-Estel, Bernardo A.; Scofield, R. Hal; Stevens, Anne M.; Tsao, Betty P.; Vyse, Timothy J.; Langefeld, Carl D.; Harley, John B.; Wakeland, Edward K.; Moser, Kathy L.; Montgomery, Courtney G.; Gaffney, Patrick M.
2012-01-01
Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical manifestations characterized by the development of pathogenic autoantibodies manifesting in inflammation of target organs such as the kidneys, skin and joints. Genome-wide association studies have identified genetic variants in the UBE2L3 region that are associated with SLE in subjects of European and Asian ancestry. UBE2L3 encodes an ubiquitin-conjugating enzyme, UBCH7, involved in cell proliferation and immune function. In this study, we sought to further characterize the genetic association in the region of UBE2L3 and use molecular methods to determine the functional effect of the risk haplotype. We identified significant associations between variants in the region of UBE2L3 and SLE in individuals of European and Asian ancestry that exceeded a Bonferroni corrected threshold (P < 1 × 10−4). A single risk haplotype was observed in all associated populations. Individuals harboring the risk haplotype display a significant increase in both UBE2L3 mRNA expression (P = 0.0004) and UBCH7 protein expression (P = 0.0068). The results suggest that variants carried on the SLE associated UBE2L3 risk haplotype influence autoimmunity by modulating UBCH7 expression. PMID:22476155
Differential distribution of Y-chromosome haplotypes in Swiss and Southern European goat breeds.
Vidal, Oriol; Drögemüller, Cord; Obexer-Ruff, Gabriela; Reber, Irene; Jordana, Jordi; Martínez, Amparo; Bâlteanu, Valentin Adrian; Delgado, Juan Vicente; Eghbalsaied, Shahin; Landi, Vincenzo; Goyache, Felix; Traoré, Amadou; Pazzola, Michele; Vacca, Giuseppe Massimo; Badaoui, Bouabid; Pilla, Fabio; D'Andrea, Mariasilvia; Álvarez, Isabel; Capote, Juan; Sharaf, Abdoallah; Pons, Àgueda; Amills, Marcel
2017-11-23
The analysis of Y-chromosome variation has provided valuable clues about the paternal history of domestic animal populations. The main goal of the current work was to characterize Y-chromosome diversity in 31 goat populations from Central Eastern (Switzerland and Romania) and Southern Europe (Spain and Italy) as well as in reference populations from Africa and the Near East. Towards this end, we have genotyped seven single nucleotide polymorphisms (SNPs), mapping to the SRY, ZFY, AMELY and DDX3Y Y-linked loci, in 275 bucks from 31 populations. We have observed a low level of variability in the goat Y-chromosome, with just five haplotypes segregating in the whole set of populations. We have also found that Swiss bucks carry exclusively Y1 haplotypes (Y1A: 24%, Y1B1: 15%, Y1B2: 43% and Y1C: 18%), while in Italian and Spanish bucks Y2A is the most abundant haplotype (77%). Interestingly, in Carpathian goats from Romania the Y2A haplotype is also frequent (42%). The high Y-chromosome differentiation between Swiss and Italian/Spanish breeds might be due to the post-domestication spread of two different Near Eastern genetic stocks through the Danubian and Mediterranean corridors. Historical gene flow between Southern European and Northern African goats might have also contributed to generate such pattern of genetic differentiation.
Methyl-CpG island-associated genome signature tags
Dunn, John J
2014-05-20
Disclosed is a method for analyzing the organismic complexity of a sample through analysis of the nucleic acid in the sample. In the disclosed method, through a series of steps, including digestion with a type II restriction enzyme, ligation of capture adapters and linkers and digestion with a type IIS restriction enzyme, genome signature tags are produced. The sequences of a statistically significant number of the signature tags are determined and the sequences are used to identify and quantify the organisms in the sample. Various embodiments of the invention described herein include methods for using single point genome signature tags to analyze the related families present in a sample, methods for analyzing sequences associated with hyper- and hypo-methylated CpG islands, methods for visualizing organismic complexity change in a sampling location over time and methods for generating the genome signature tag profile of a sample of fragmented DNA.
Catechol-O-methyltransferase gene haplotypes in Mexican and Spanish patients with fibromyalgia
Vargas-Alarcón, Gilberto; Fragoso, José-Manuel; Cruz-Robles, David; Vargas, Angélica; Vargas, Alfonso; Lao-Villadóniga, José-Ignacio; García-Fructuoso, Ferrán; Ramos-Kuri, Manuel; Hernández, Fernando; Springall, Rashidi; Bojalil, Rafael; Vallejo, Maite; Martínez-Lavín, Manuel
2007-01-01
Autonomic dysfunction is frequent in patients with fibromyalgia (FM). Heart rate variability analyses have demonstrated signs of ongoing sympathetic hyperactivity. Catecholamines are sympathetic neurotransmitters. Catechol-O-methyltransferase (COMT), an enzyme, is the major catecholamine-clearing pathway. There are several single-nucleotide polymorphisms (SNPs) in the COMT gene associated with the different catecholamine-clearing abilities of the COMT enzyme. These SNPs are in linkage disequilibrium and segregate as 'haplotypes'. Healthy females with a particular COMT gene haplotype (ACCG) producing a defective enzyme are more sensitive to painful stimuli. The objective of our study was to define whether women with FM, from two different countries (Mexico and Spain), have the COMT gene haplotypes that have been previously associated with greater sensitivity to pain. All the individuals in the study were female. Fifty-seven Mexican patients and 78 Spanish patients were compared with their respective healthy control groups. All participants filled out the Fibromyalgia Impact Questionnaire (FIQ). Six COMT SNPs (rs2097903, rs6269, rs4633, rs4818, rs4680, and rs165599) were genotyped from peripheral blood DNA. In Spanish patients, there was a significant association between three SNPs (rs6269, rs4818, and rs4680) and the presence of FM when compared with healthy controls. Moreover, in Spanish patients with the 'high pain sensitivity' haplotype (ACCG), the disease, as assessed by the FIQ, was more severe. By contrast, Mexican patients displayed only a weak association between rs6269 and rs165599, and some FIQ subscales. In our group of Spanish patients, there was an association between FM and the COMT haplotype previously associated with high pain sensitivity. This association was not observed in Mexican patients. Studies with a larger sample size are needed in order to verify or amend these preliminary results. PMID:17961261
Haplotype analysis of the polymorphic 40 Y-STR markers in Chinese populations.
Ou, Xueling; Wang, Ying; Liu, Chao; Yang, Donggui; Zhang, Chuchu; Deng, Shujiao; Sun, Hongyu
2015-11-01
Forty Y-STR loci were analyzed in 1128 males from the following six Chinese ethnic populations: Han (n=300), Hui (n=244), Korean (n=100), Mongolian (n=100), Uighur (n=284) and Tibetan (n=100), utilizing two new generation multiplex Y-STR systems, AGCU Y24 STR and GFS Y24 STR genotyping kits, which allow for the genotyping of 24 loci from a single amplification reaction in each system. The lowest estimates of genetic diversity (below 0.5) correspond to markers DYS391 (0.441658) and DYS437 (0.496977), and the greatest diversity corresponds to markers DYS385a/b (0.969919) and DYS527a/b (0.94676). A considerable number of duplicate and off-ladder alleles were also revealed. Additionally, there were 1111 different haplotypes identified from the total 1128 samples, of which 1095 were unique. Notably, no shared haplotypes between populations were observed. The estimated overall haplotype diversity (HD) was 0.999085, and its discrimination capacity (DC) was 0.970745. An MDS plot based on the genetic distances between populations showed the genetic similarity of the southern Han population to the Northern populations of Hui, Korean, Mongolian and Uighur and a clear genetic departure of the Tibetan population from other populations. For the Y STR markers, population substructure correction was considered when calculating the rarity of the Y STR profile. However, because the haplotype based Fst values are extremely small within the present data (0.000153 with 40 Y-STRs), no substructure correction is required to estimate the rarity of a haplotype comprising 40 markers. In summary, the results of our study indicate that the 40 Y-STRs have a high level of polymorphism in Chinese ethnic groups and could therefore be a powerful tool for forensic applications and population genetic studies. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Tang, Shaowen; Lv, Xiaozhen; Zhang, Yuan; Wu, Shanshan; Yang, Zhirong; Xia, Yinyin; Tu, Dehua; Deng, Peiyuan; Ma, Yu; Chen, Dafang; Zhan, Siyan
2013-01-01
The pathogenic mechanism of anti-tuberculosis (anti-TB) drug-induced hepatitis is associated with drug metabolizing enzymes. No tagging single-nucleotide polymorphisms (tSNPs) of cytochrome P450 2E1(CYP2E1) in the risk of anti-TB drug-induced hepatitis have been reported. The present study was aimed at exploring the role of tSNPs in CYP2E1 gene in a population-based anti-TB treatment cohort. A nested case-control study was designed. Each hepatitis case was 14 matched with controls by age, gender, treatment history, disease severity and drug dosage. The tSNPs were selected by using Haploview 4.2 based on the HapMap database of Han Chinese in Beijing, and detected by using TaqMan allelic discrimination technology. Eighty-nine anti-TB drug-induced hepatitis cases and 356 controls were included in this study. 6 tSNPs (rs2031920, rs2070672, rs915908, rs8192775, rs2515641, rs2515644) were genotyped and minor allele frequencies of these tSNPs were 21.9%, 23.0%, 19.1%, 23.6%, 20.8% and 44.4% in the cases and 20.9%, 22.7%, 18.9%, 23.2%, 18.2% and 43.2% in the controls, respectively. No significant difference was observed in genotypes or allele frequencies of the 6 tSNPs between case group and control group, and neither of haplotypes in block 1 nor in block 2 was significantly associated with the development of hepatitis. Based on the Chinese anti-TB treatment cohort, we did not find a statistically significant association between genetic polymorphisms of CYP2E1 and the risk of anti-TB drug-induced hepatitis. None of the haplotypes showed a significant association with the development of hepatitis in Chinese TB population.
Haplotype Reconstruction in Large Pedigrees with Many Untyped Individuals
NASA Astrophysics Data System (ADS)
Li, Xin; Li, Jing
Haplotypes, as they specify the linkage patterns between dispersed genetic variations, provide important information for understanding the genetics of human traits. However haplotypes are not directly available from current genotyping platforms, and hence there are extensive investigations of computational methods to recover such information. Two major computational challenges arising in current family-based disease studies are large family sizes and many ungenotyped family members. Traditional haplotyping methods can neither handle large families nor families with missing members. In this paper, we propose a method which addresses these issues by integrating multiple novel techniques. The method consists of three major components: pairwise identical-bydescent (IBD) inference, global IBD reconstruction and haplotype restoring. By reconstructing the global IBD of a family from pairwise IBD and then restoring the haplotypes based on the inferred IBD, this method can scale to large pedigrees, and more importantly it can handle families with missing members. Compared with existing methods, this method demonstrates much higher power to recover haplotype information, especially in families with many untyped individuals.
Using haplotypes to unravel the inheritance of Holstein coat color for a larger audience
USDA-ARS?s Scientific Manuscript database
Haplotype testing identifies single-nucleotide polymorphisms that bracket a group of alleles from several different genes located on a specific chromosomal section of DNA. For a trait with a limited number of genotypes and phenotypes, the rules of inheritance can be determined by matching up certain...
High-throughput purification of recombinant proteins using self-cleaving intein tags.
Coolbaugh, M J; Shakalli Tang, M J; Wood, D W
2017-01-01
High throughput methods for recombinant protein production using E. coli typically involve the use of affinity tags for simple purification of the protein of interest. One drawback of these techniques is the occasional need for tag removal before study, which can be hard to predict. In this work, we demonstrate two high throughput purification methods for untagged protein targets based on simple and cost-effective self-cleaving intein tags. Two model proteins, E. coli beta-galactosidase (βGal) and superfolder green fluorescent protein (sfGFP), were purified using self-cleaving versions of the conventional chitin-binding domain (CBD) affinity tag and the nonchromatographic elastin-like-polypeptide (ELP) precipitation tag in a 96-well filter plate format. Initial tests with shake flask cultures confirmed that the intein purification scheme could be scaled down, with >90% pure product generated in a single step using both methods. The scheme was then validated in a high throughput expression platform using 24-well plate cultures followed by purification in 96-well plates. For both tags and with both target proteins, the purified product was consistently obtained in a single-step, with low well-to-well and plate-to-plate variability. This simple method thus allows the reproducible production of highly pure untagged recombinant proteins in a convenient microtiter plate format. Copyright © 2016 Elsevier Inc. All rights reserved.
Comparative Performance of Acoustic-tagged and PIT-tagged Juvenile Salmonids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hockersmith, Eric E.; Brown, Richard S.; Liedtke, Theresa L.
2008-02-01
Numerous research tools and technologies are currently being used to evaluate fish passage and survival to determine the impacts of the Federal Columbia River Power System (FCRPS) on endangered and threatened juvenile salmonids, including PIT tags, balloon tags, hydroacoustic evaluations, radio telemetry, and acoustic telemetry. Each has advantages and disadvantages, but options are restricted in some situations because of limited capabilities of a specific technology, lack of detection capability downstream, or availability of adequate numbers of fish. However, there remains concern about the comparative effects of the tag or the tagging procedure on fish performance. The recently developed Juvenile Salmonidmore » Acoustic Telemetry System (JSATS) acoustic transmitter is the smallest active acoustic tag currently available. The goal of this study was to determine whether fish tagged with the JSATS acoustic-telemetry tag can provide unbiased estimates of passage behavior and survival within the performance life of the tag. We conducted both field and laboratory studies to assess tag effects. For the field evaluation we released a total of 996 acoustic-tagged fish in conjunction with 21,026 PIT-tagged fish into the tailrace of Lower Granite Dam on 6 and 13 May. Travel times between release and downstream dams were not significantly different for the majority of the reaches between acoustic-tagged and PIT-tagged fish. In addition to the field evaluation, a series of laboratory experiments were conducted to determine if growth and survival of juvenile Chinook salmon surgically implanted with acoustic transmitters is different than untagged or PIT tagged juvenile Chinook salmon. Only yearling fish with integrated and non-integrated transmitters experienced mortalities, and these were low (<4.5%). Mortality among sub-yearling control and PIT-tag treatments ranged up to 7.7% while integrated and non-integrated treatments had slightly higher rates (up to 8.3% and 7
Barratt, Daniel T; Coller, Janet K; Hallinan, Richard; Byrne, Andrew; White, Jason M; Foster, David JR; Somogyi, Andrew A
2012-01-01
Background: Genetic variability in ABCB1, encoding the P-glycoprotein efflux transporter, has been linked to altered methadone maintenance treatment dose requirements. However, subsequent studies have indicated that additional environmental or genetic factors may confound ABCB1 pharmacogenetics in different methadone maintenance treatment settings. There is evidence that genetic variability in OPRM1, encoding the mu opioid receptor, and ABCB1 may interact to affect morphine response in opposite ways. This study aimed to examine whether a similar gene-gene interaction occurs for methadone in methadone maintenance treatment. Methods: Opioid-dependent subjects (n = 119) maintained on methadone (15–300 mg/day) were genotyped for five single nucleotide polymorphisms of ABCB1 (61A > G; 1199G > A; 1236C > T; 2677G > T; 3435C > T), as well as for the OPRM1 118A > G single nucleotide polymorphism. Subjects’ methadone doses and trough plasma (R)-methadone concentrations (Ctrough) were compared between ABCB1 haplotypes (with and without controlling for OPRM1 genotype), and between OPRM1 genotypes (with and without controlling for ABCB1 haplotype). Results: Among wild-type OPRM1 subjects, an ABCB1 variant haplotype group (subjects with a wild-type and 61A:1199G:1236C:2677T:3435T haplotype combination, or homozygous for the 61A:1199G:1236C:2677T:3435T haplotype) had significantly lower doses (median ± standard deviation 35 ± 5 versus 180 ± 65 mg/day, P < 0.01) and Ctrough (78 ± 22 versus 177 ± 97 ng/mL, P < 0.05) than ABCB1 wild-type subjects. Among subjects with the most common ABCB1 haplotype combination (wild-type with 61A:1199G:1236T:2677T:3435T), the OPRM1 118 A/G genotype was associated with a significantly higher Ctrough than 118 A/A (250 ± 126 versus 108 ± 36 ng/mL, P = 0.016). No ABCB1 haplotype group or OPRM1 genotype was associated with dose or Ctrough without taking into account confounding genetic variability at the other locus. Therefore, two
Detecting disease-predisposing variants: the haplotype method.
Valdes, A M; Thomson, G
1997-01-01
For many HLA-associated diseases, multiple alleles-- and, in some cases, multiple loci--have been suggested as the causative agents. The haplotype method for identifying disease-predisposing amino acids in a genetic region is a stratification analysis. We show that, for each haplotype combination containing all the amino acid sites involved in the disease process, the relative frequencies of amino acid variants at sites not involved in disease but in linkage disequilibrium with the disease-predisposing sites are expected to be the same in patients and controls. The haplotype method is robust to mode of inheritance and penetrance of the disease and can be used to determine unequivocally whether all amino acid sites involved in the disease have not been identified. Using a resampling technique, we developed a statistical test that takes account of the nonindependence of the sites sampled. Further, when multiple sites in the genetic region are involved in disease, the test statistic gives a closer fit to the null expectation when some--compared with none--of the true predisposing factors are included in the haplotype analysis. Although the haplotype method cannot distinguish between very highly correlated sites in one population, ethnic comparisons may help identify the true predisposing factors. The haplotype method was applied to insulin-dependent diabetes mellitus (IDDM) HLA class II DQA1-DQB1 data from Caucasian, African, and Japanese populations. Our results indicate that the combination DQA1#52 (Arg predisposing) DQB1#57 (Asp protective), which has been proposed as an important IDDM agent, does not include all the predisposing elements. With rheumatoid arthritis HLA class II DRB1 data, the results were consistent with the shared-epitope hypothesis. PMID:9042931
NASA Astrophysics Data System (ADS)
Tibély, Gergely; Pollner, Péter; Vicsek, Tamás; Palla, Gergely
2012-05-01
Due to the increasing popularity of collaborative tagging systems, the research on tagged networks, hypergraphs, ontologies, folksonomies and other related concepts is becoming an important interdisciplinary area with great potential and relevance for practical applications. In most collaborative tagging systems the tagging by the users is completely ‘flat’, while in some cases they are allowed to define a shallow hierarchy for their own tags. However, usually no overall hierarchical organization of the tags is given, and one of the interesting challenges of this area is to provide an algorithm generating the ontology of the tags from the available data. In contrast, there are also other types of tagged networks available for research, where the tags are already organized into a directed acyclic graph (DAG), encapsulating the ‘is a sub-category of’ type of hierarchy between each other. In this paper, we study how this DAG affects the statistical distribution of tags on the nodes marked by the tags in various real networks. The motivation for this research was the fact that understanding the tagging based on a known hierarchy can help in revealing the hidden hierarchy of tags in collaborative tagging systems. We analyse the relation between the tag-frequency and the position of the tag in the DAG in two large sub-networks of the English Wikipedia and a protein-protein interaction network. We also study the tag co-occurrence statistics by introducing a two-dimensional (2D) tag-distance distribution preserving both the difference in the levels and the absolute distance in the DAG for the co-occurring pairs of tags. Our most interesting finding is that the local relevance of tags in the DAG (i.e. their rank or significance as characterized by, e.g., the length of the branches starting from them) is much more important than their global distance from the root. Furthermore, we also introduce a simple tagging model based on random walks on the DAG, capable of
PAX6 Haplotypes Are Associated with High Myopia in Han Chinese
Jiang, Bo; Yap, Maurice K. H.; Leung, Kim Hung; Ng, Po Wah; Fung, Wai Yan; Lam, Wai Wa; Gu, Yang-shun; Yip, Shea Ping
2011-01-01
Background The paired box 6 (PAX6) gene is considered as a master gene for eye development. Linkage of myopia to the PAX6 region on chromosome 11p13 was shown in several studies, but the results for association between myopia and PAX6 were inconsistent so far. Methodology/Principal Findings We genotyped 16 single nucleotide polymorphisms (SNPs) in the PAX6 gene and its regulatory regions in an initial study for 300 high myopia cases and 300 controls (Group 1), and successfully replicated the positive results with another independent group of 299 high myopia cases and 299 controls (Group 2). Five SNPs were genotyped in the replication study. The spherical equivalent of subjects with high myopia was ≤−8.0 dioptres. The PLINK package was used for genetic data analysis. No association was found between each of the SNPs and high myopia. However, exhaustive sliding-window haplotype analysis highlighted an important role for rs12421026 because haplotypes containing this SNP were found to be associated with high myopia. The most significant results were given by the 4-SNP haplotype window consisting of rs2071754, rs3026393, rs1506 and rs12421026 (P = 3.54×10−10, 4.06×10−11 and 1.56×10−18 for Group 1, Group 2 and Combined Group, respectively) and the 3-SNP haplotype window composed of rs3026393, rs1506 and rs12421026 (P = 5.48×10−10, 7.93×10−12 and 6.28×10−23 for the three respective groups). The results remained significant after correction for multiple comparisons by permutations. The associated haplotyes found in a previous study were also successfully replicated in this study. Conclusions/Significance PAX6 haplotypes are associated with susceptibility to the development of high myopia in Chinese. The PAX6 locus plays a role in high myopia. PMID:21589860
Lee, Joungmin; Kim, Minjae; Seo, Youngsil; Lee, Yeonjin; Park, Hyunjoon; Byun, Sung June; Kwon, Myung-Hee
2017-11-01
The antigen-binding properties of single chain Fv antibodies (scFvs) can vary depending on the position and type of fusion tag used, as well as the host cells used for expression. The issue is even more complicated with a catalytic scFv antibody that binds and hydrolyses a specific antigen. Herein, we investigated the antigen-binding and -hydrolysing activities of the catalytic anti-nucleic acid antibody 3D8 scFv expressed in Escherichia coli or HEK293f cells with or without additional amino acid residues at the N- and C-termini. DNA-binding activity was retained in all recombinant forms. However, the DNA-hydrolysing activity varied drastically between forms. The DNA-hydrolysing activity of E. coli-derived 3D8 scFvs was not affected by the presence of a C-terminal human influenza haemagglutinin (HA) or His tag. By contrast, the activity of HEK293f-derived 3D8 scFvs was completely lost when additional residues were included at the N-terminus and/or when a His tag was incorporated at the C-terminus, whereas a HA tag at the C-terminus did not diminish activity. Thus, we demonstrate that the antigen-binding and catalytic activities of a catalytic antibody can be separately affected by the presence of additional residues at the N- and C-termini, and by the host cell type. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Stolerman, Elliot S.; Manning, Alisa K.; McAteer, Jarred B.; Dupuis, Josée; Fox, Caroline S.; Cupples, L. Adrienne; Meigs, James B.; Florez, Jose C.
2008-01-01
OBJECTIVE—A recent meta-analysis demonstrated a nominal association of the ectonucleotide pyrophosphatase phosphodiesterase 1 (ENPP1) K→Q missense single nucleotide polymorphism (SNP) at position 121 with type 2 diabetes. We set out to confirm the association of ENPP1 K121Q with hyperglycemia, expand this association to insulin resistance traits, and determine whether the association stems from K121Q or another variant in linkage disequilibrium with it. RESEARCH DESIGN AND METHODS—We characterized the haplotype structure of ENPP1 and selected 39 tag SNPs that captured 96% of common variation in the region (minor allele frequency ≥5%) with an r2 value ≥0.80. We genotyped the SNPs in 2,511 Framingham Heart Study participants and used age- and sex-adjusted linear mixed effects (LME) models to test for association with quantitative metabolic traits. We also examined whether interaction between K121Q and BMI affected glycemic trait levels. RESULTS—The Q allele of K121Q (rs1044498) was associated with increased fasting plasma glucose (FPG), A1C, fasting insulin, and insulin resistance by homeostasis model assessment (HOMA-IR; all P = 0.01–0.006). Two noncoding SNPs (rs7775386 and rs7773477) demonstrated similar associations, but LME models indicated that their effects were not independent from K121Q. We found no association of K121Q with obesity, but interaction models suggested that the effect of the Q allele on FPG and HOMA-IR was stronger in those with a higher BMI (P = 0.008 and 0.01 for interaction, respectively). CONCLUSIONS—The Q allele of ENPP1 K121Q is associated with hyperglycemia and insulin resistance in whites. We found an adiposity-SNP interaction, with a stronger association of K121Q with diabetes-related quantitative traits in people with a higher BMI. PMID:18426862
Antibiotic use during the intracoelomic implantation of electronic tags into fish
Mulcahy, D.M.
2011-01-01
The use of antibiotics, in particular, the use of a single dose of antibiotics during electronic tag implantation is of unproven value, and carries with it the potential for the development of antibiotic resistance in bacteria and the alteration of the immune response of the fish. Antibiotic use during electronic tag implantation must conform to relevant drug laws and regulations in the country where work is being done, including the requirements for withdrawal times before human consumption is a possibility. Currently, the choice of antibiotics (most often tetracycline or oxytetracycline) and the use of a single dose of the drug are decisions made without knowledge of the basic need for antibiotic usage and of the bacteria involved in infections that occur following electronic tag implantation. Correct perioperative use of an antibiotic is to apply the drug to the animal before surgery begins, to assure serum and tissue levels of the drug are adequate before the incision is made. However, the most common perioperative application of antibiotics during implantation of an electronic tag is to delay the administration of the drug, injecting it into the coelom after the electronic tag is inserted, just prior to closure of the incision. There is little empirical evidence that the present application of antibiotics in fish being implanted with electronic tags is of value. Improvements should first be made to surgical techniques, especially the use of aseptic techniques and sterilized instruments and electronic tags, before resorting to antibiotics. ?? 2010 Springer Science+Business Media B.V.(outside the USA).
Progress towards barium daughter tagging in Xe136 decay using single molecule fluorescence imaging
NASA Astrophysics Data System (ADS)
McDonald, Austin; NEXT Collaboration
2017-09-01
The existence of Majorana fermions is of great interest as it may be related to the asymmetry between matter and anti-matter particles in the universe. However, the search for them has proven to be a difficult one. Neutrino-less Double Beta decay (NLDB) offers a possible opportunity for direct observation of a Majorana Fermion. The rate for NLDB decay may be as low as 1 count /ton /year if the mass ordering is inverted. Current detector technologies have background rates between 4 to 300 count /ton /year /ROI at the 100kg scale which is much larger than the universal goal of 0.1 count /ton /year /ROI desired for ton-scale detectors. The premise of my research is to develop new detector technologies that will allow for a background-free experiment. My current work is to develop a sensor that will tag the daughter ion Ba++ from the Xe136 decay. The development of a sensor that is sensitive to single barium ion detection based on the single molecule fluorescence imaging technique is the major focus of this work. If successful, this could provide a path to a background-free experiment.
Progress towards barium daughter tagging in Xe136 decay using single molecule fluorescence imaging
NASA Astrophysics Data System (ADS)
McDonald, Austin; Jones, Ben; Benson, Jordan; Nygren, David; NEXT Collaboration
2017-01-01
The existence of Majorana Fermions has been predicted, and is of great interest as it may be related to the asymmetry between matter and anti-matter particles in the universe. However, the search for them has proven to be a difficult one. Neutrino-less Double Beta decay (NLDB) offers a possible opportunity for direct observation of a Majorana Fermion. The rate for NLDB decay may be as low as 1 count / ton / year . Current detector technologies have background rates between 4 to 300 count / ton / year / ROI which is much larger than the universal goal of 0 . 1 count / ton / year / ROI desired for ton-scale detectors. The premise of my research is to develop new detector technologies that will allow for a background-free experiment. My current work is to develop a sensor that will tag the daughter ion Ba++ from the Xe136 decay. The development of a sensor that is sensitive to single barium ion detection based on the single molecule fluorescence imaging technique is the major focus of this work. If successful, this could provide a path to a background-free experiment.
Jones, Nathan R; Spratt, Thomas E; Berg, Arthur S; Muscat, Joshua E; Lazarus, Philip; Gallagher, Carla J
2011-04-01
The formation of bulky DNA adducts caused by diol epoxide derivatives of polycyclic aromatic hydrocarbons has been associated with tobacco-induced cancers, and inefficient repair of such adducts by the nucleotide excision repair (NER) system has been linked to increased risk of tobacco-induced lung and head and neck (H&N) cancers. The human excision repair cross-complementation group 1 (ERCC1) protein is essential for a functional NER system and genetic variation in ERCC1 may contribute to impaired DNA repair capacity and increased lung and H&N cancer risk. In order to comprehensively capture common genetic variation in the ERCC1 gene, Caucasian data from the International HapMap project was used to assess linkage disequilibrium and choose four tagSNPs (rs1319052, rs3212955, rs3212948, and rs735482) in the ERCC1 gene to genotype 452 lung cancer cases, 175 H&N cancer cases, and 790 healthy controls. Haplotypes were estimated using expectation maximization (EM) algorithm, and haplotype association with cancer was investigated using Haplo.stats software adjusting for known covariates. The genotype and haplotype frequencies matched previous estimates from Caucasians. There was no significant difference in the prevalence of rs1319052, rs3212955, rs3212948, and rs735482 when comparing lung or H&N cancer cases with controls (p-values>0.05). Similarly, there was no association between ERCC1 haplotypes and lung or H&N cancer susceptibility in this Caucasian population (p-values>0.05). No associations were found when stratifying lung cancer cases by histology, sex, smoking status, or smoking intensity. This study suggests that ERCC1 polymorphisms and haplotypes do not play a role in lung and H&N cancer susceptibility in Caucasians. Copyright © 2010 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Griggs, Steven P.; Mark, Martin B.; Feldman, Barry J.
2004-07-01
The goal of the DARPA Dynamic Optical Tags (DOTs) program is to develop a small, robust, persistent, 2-way tagging, tracking and locating device that also supports communications at data rates greater than 100 kbps and can be interrogated at significant range. These tags will allow for two-way data exchange and tagging operations in friendly and denied areas. The DOTs will be passive and non-RF. To accomplish this, the DOTs program will develop small, thin, retro-reflecting modulators. The tags will operate for long periods of time (greater than two months) in real-world environmental conditions (-40° to +70° C) and allow for a wide interrogation angle (+/-60°). The tags will be passive (in the sleep mode) for most of the time and only become active when interrogated by a laser with the correct code. Once correctly interrogated, the tags will begin to modulate and retro-reflect the incoming beam. The program will also develop two tag specific transceiver systems that are eye-safe, employ automated scanning algorithms, and are capable of short search and interrogate times.
KCNQ1 Haplotypes Associate with Type 2 Diabetes in Malaysian Chinese Subjects
Saif-Ali, Riyadh; Ismail, Ikram S.; Al-Hamodi, Zaid; Al-Mekhlafi, Hesham M.; Siang, Lee C.; Alabsi, Aied M.; Muniandy, Sekaran
2011-01-01
The aim of this study was to investigate the association of single nucleotide polymorphisms (SNPs) and haplotypes of potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1) with type 2 diabetes (T2D) in Malaysian Chinese subjects. The KCNQ1 SNPs rs2237892, rs2283228 and rs2237895 were genotyped in 300 T2D patients and 230 control subjects without diabetes and metabolic syndrome. Two logistic regression models of analysis were applied, the first adjusted for age and gender while the second adjusted for age, gender and body mass index. The additive genetic analysis showed that adjusting for body mass index (BMI) even strengthened association of rs2237892, rs2283228 and rs2237895 with T2D (OR = 2.0, P = 5.1 × 10−5; OR = 1.9, P = 5.2 × 10−5; OR = 1.9, P = 7.8 × 10−5, respectively). The haplotype TCA containing the allele of rs2237892 (T), rs2283228 (C) and rs2237895 (A) was highly protective against T2D (Second model; OR = 0.17, P = 3.7 × 10−11). The KCNQ1 rs2237892 (TT), and the protective haplotype (TCA) were associated with higher beta-cell function (HOMA-B) in normal subjects (P = 0.0002; 0.014, respectively). This study found that KCNQ1 SNPs was associated with T2D susceptibility in Malaysian Chinese subjects. In addition, certain KCNQ1 haplotypes were strongly associated with T2D. PMID:22016621
Zunder, Eli R.; Finck, Rachel; Behbehani, Gregory K.; Amir, El-ad D.; Krishnaswamy, Smita; Gonzalez, Veronica D.; Lorang, Cynthia G.; Bjornson, Zach; Spitzer, Matthew H.; Bodenmiller, Bernd; Fantl, Wendy J.; Pe’er, Dana; Nolan, Garry P.
2015-01-01
SUMMARY Mass-tag cell barcoding (MCB) labels individual cell samples with unique combinatorial barcodes, after which they are pooled for processing and measurement as a single multiplexed sample. The MCB method eliminates variability between samples in antibody staining and instrument sensitivity, reduces antibody consumption, and shortens instrument measurement time. Here, we present an optimized MCB protocol with several improvements over previously described methods. The use of palladium-based labeling reagents expands the number of measurement channels available for mass cytometry and reduces interference with lanthanide-based antibody measurement. An error-detecting combinatorial barcoding scheme allows cell doublets to be identified and removed from the analysis. A debarcoding algorithm that is single cell-based rather than population-based improves the accuracy and efficiency of sample deconvolution. This debarcoding algorithm has been packaged into software that allows rapid and unbiased sample deconvolution. The MCB procedure takes 3–4 h, not including sample acquisition time of ~1 h per million cells. PMID:25612231
HaploForge: a comprehensive pedigree drawing and haplotype visualization web application.
Tekman, Mehmet; Medlar, Alan; Mozere, Monika; Kleta, Robert; Stanescu, Horia
2017-12-15
Haplotype reconstruction is an important tool for understanding the aetiology of human disease. Haplotyping infers the most likely phase of observed genotypes conditional on constraints imposed by the genotypes of other pedigree members. The results of haplotype reconstruction, when visualized appropriately, show which alleles are identical by descent despite the presence of untyped individuals. When used in concert with linkage analysis, haplotyping can help delineate a locus of interest and provide a succinct explanation for the transmission of the trait locus. Unfortunately, the design choices made by existing haplotype visualization programs do not scale to large numbers of markers. Indeed, following haplotypes from generation to generation requires excessive scrolling back and forth. In addition, the most widely used program for haplotype visualization produces inconsistent recombination artefacts for the X chromosome. To resolve these issues, we developed HaploForge, a novel web application for haplotype visualization and pedigree drawing. HaploForge takes advantage of HTML5 to be fast, portable and avoid the need for local installation. It can accurately visualize autosomal and X-linked haplotypes from both outbred and consanguineous pedigrees. Haplotypes are coloured based on identity by descent using a novel A* search algorithm and we provide a flexible viewing mode to aid visual inspection. HaploForge can currently process haplotype reconstruction output from Allegro, GeneHunter, Merlin and Simwalk. HaploForge is licensed under GPLv3 and is hosted and maintained via GitHub. https://github.com/mtekman/haploforge. r.kleta@ucl.ac.uk. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Self-referenced locking of optical coherence by single-detector electronic-frequency tagging
NASA Astrophysics Data System (ADS)
Shay, T. M.; Benham, Vincent; Spring, Justin; Ward, Benjamin; Ghebremichael, F.; Culpepper, Mark A.; Sanchez, Anthony D.; Baker, J. T.; Pilkington, D.; Berdine, Richard
2006-02-01
We report a novel coherent beam combining technique. This is the first actively phase locked optical fiber array that eliminates the need for a separate reference beam. In addition, only a single photodetector is required. The far-field central spot of the array is imaged onto the photodetector to produce the phase control loop signals. Each leg of the fiber array is phase modulated with a separate RF frequency, thus tagging the optical phase shift for each leg by a separate RF frequency. The optical phase errors for the individual array legs are separated in the electronic domain. In contrast with the previous active phase locking techniques, in our system the reference beam is spatially overlapped with all the RF modulated fiber leg beams onto a single detector. The phase shift between the optical wave in the reference leg and in the RF modulated legs is measured separately in the electronic domain and the phase error signal is feedback to the LiNbO 3 phase modulator for that leg to minimize the phase error for that leg relative to the reference leg. The advantages of this technique are 1) the elimination of the reference beam and beam combination optics and 2) the electronic separation of the phase error signals without any degradation of the phase locking accuracy. We will present the first theoretical model for self-referenced LOCSET and describe experimental results for a 3 x 3 array.
Hettinger, Joe A; Liu, Xudong; Schwartz, Charles E; Michaelis, Ron C; Holden, Jeanette J A
2008-07-05
Individuals with autism spectrum disorders (ASDs) have impairments in executive function and social cognition, with males generally being more severely affected in these areas than females. Because the dopamine D1 receptor (encoded by DRD1) is integral to the neural circuitry mediating these processes, we examined the DRD1 gene for its role in susceptibility to ASDs by performing single marker and haplotype case-control comparisons, family-based association tests, and genotype-phenotype assessments (quantitative transmission disequilibrium tests: QTDT) using three DRD1 polymorphisms, rs265981C/T, rs4532A/G, and rs686T/C. Our previous findings suggested that the dopaminergic system may be more integrally involved in families with affected males only than in other families. We therefore restricted our study to families with two or more affected males (N = 112). There was over-transmission of rs265981-C and rs4532-A in these families (P = 0.040, P = 0.038), with haplotype TDT analysis showing over-transmission of the C-A-T haplotype (P = 0.022) from mothers to affected sons (P = 0.013). In addition, haplotype case-control comparisons revealed an increase of this putative risk haplotype in affected individuals relative to a comparison group (P = 0.004). QTDT analyses showed associations of the rs265981-C, rs4532-A, rs686-T alleles, and the C-A-T haplotype with more severe problems in social interaction, greater difficulties with nonverbal communication and increased stereotypies compared to individuals with other haplotypes. Preferential haplotype transmission of markers at the DRD1 locus and an increased frequency of a specific haplotype support the DRD1 gene as a risk gene for core symptoms of ASD in families having only affected males. Copyright 2008 Wiley-Liss, Inc.
Kumada, Yoichi; Ishikawa, Yasuyuki; Fujiwara, Yusuke; Takeda, Rui; Miyamoto, Ryosuke; Niwa, Daisuke; Momose, Shun; Kang, Bongmun; Kishimoto, Michimasa
2014-09-01
In this study, we investigated the efficient refolding and site-specific immobilization of single-chain variable fragments (scFvs) genetically fused with a poly(methylmethacrylate)-binding peptide (PMMA-tag). According to the results of an aggregation test of a scFv-PM in the presence of 0.5 M urea, aggregation was hardly detectable at a weak-alkaline pH (8.5) with lower concentrations of NaCl. Consequently, more than 93% recovery of the anti-RNase scFv-PM model was attained, when it was refolded by dialysis against 50 mM TAPS (pH8.5). These results suggested that the apparent isoelectric point (pI) of a target scFv was decreased to a great extent by the genetic fusion of a PMMA-tag containing 5 acidic amino acids, and, thus, the solubility of the scFv-PM in its semi-denatured form was considerably improved. We also designed alternative peptide-tags composed of plural aspartic acid residues (D5, D10 and D15-tags) to decrease the apparent pI value of the fusion protein. As a consequence, scFv-D5, scFv-D10 and scFv-D15 were also efficiently refolded with yields of more than 95%. It is noteworthy that even scFv-PS-D15, which had both a positively charged polystyrene-binding peptide (PS-tag) and a negatively charged D15-tag, was serially connected at the C-terminal region of scFvs, and also refolded with a yield of 96.1%. These results clearly indicate that controlling the apparent pI value of scFvs by the fusion of oligo-peptides composed of acidic amino acids at the C-terminus resulted in a high degree of recovery via dialysis refolding. According to the results of a sandwich ELISA using scFv-PMs, scFv-D15 and scFv-PS-D15 as ligands, high antigen-binding signals were detected from both the PMMA and phi-PS plates immobilized with scFv-PMs. Furthermore, the high antigen-binding activity of scFv-PMs was maintained in an adsorption state when it was immobilized on the surface of not only PMMA, but also hydrophilic PS (phi-PS) and polycarbonate (PC). These results
A new mathematical modeling for pure parsimony haplotyping problem.
Feizabadi, R; Bagherian, M; Vaziri, H R; Salahi, M
2016-11-01
Pure parsimony haplotyping (PPH) problem is important in bioinformatics because rational haplotyping inference plays important roles in analysis of genetic data, mapping complex genetic diseases such as Alzheimer's disease, heart disorders and etc. Haplotypes and genotypes are m-length sequences. Although several integer programing models have already been presented for PPH problem, its NP-hardness characteristic resulted in ineffectiveness of those models facing the real instances especially instances with many heterozygous sites. In this paper, we assign a corresponding number to each haplotype and genotype and based on those numbers, we set a mixed integer programing model. Using numbers, instead of sequences, would lead to less complexity of the new model in comparison with previous models in a way that there are neither constraints nor variables corresponding to heterozygous nucleotide sites in it. Experimental results approve the efficiency of the new model in producing better solution in comparison to two state-of-the art haplotyping approaches. Copyright © 2016 Elsevier Inc. All rights reserved.
The IGF1 small dog haplotype is derived from Middle Eastern grey wolves.
Gray, Melissa M; Sutter, Nathan B; Ostrander, Elaine A; Wayne, Robert K
2010-02-24
A selective sweep containing the insulin-like growth factor 1 (IGF1) gene is associated with size variation in domestic dogs. Intron 2 of IGF1 contains a SINE element and single nucleotide polymorphism (SNP) found in all small dog breeds that is almost entirely absent from large breeds. In this study, we surveyed a large sample of grey wolf populations to better understand the ancestral pattern of variation at IGF1 with a particular focus on the distribution of the small dog haplotype and its relationship to the origin of the dog. We present DNA sequence data that confirms the absence of the derived small SNP allele in the intron 2 region of IGF1 in a large sample of grey wolves and further establishes the absence of a small dog associated SINE element in all wild canids and most large dog breeds. Grey wolf haplotypes from the Middle East have higher nucleotide diversity suggesting an origin there. Additionally, PCA and phylogenetic analyses suggests a closer kinship of the small domestic dog IGF1 haplotype with those from Middle Eastern grey wolves. The absence of both the SINE element and SNP allele in grey wolves suggests that the mutation for small body size post-dates the domestication of dogs. However, because all small dogs possess these diagnostic mutations, the mutations likely arose early in the history of domestic dogs. Our results show that the small dog haplotype is closely related to those in Middle Eastern wolves and is consistent with an ancient origin of the small dog haplotype there. Thus, in concordance with past archeological studies, our molecular analysis is consistent with the early evolution of small size in dogs from the Middle East.See associated opinion by Driscoll and Macdonald: http://jbiol.com/content/9/2/10.
A laboratory evaluation of tagging-related mortality and tag loss in juvenile humpback chub
Ward, David L.; Persons, William R.; Young, Kirk; Stone, Dennis M.; Van Haverbeke, Randy; Knight, William R.
2015-01-01
We quantified tag retention, survival, and growth in juvenile, captive-reared Humpback Chub Gila cypha marked with three different tag types: (1) Biomark 12.5-mm, 134.2-kHz, full duplex PIT tags injected into the body cavity with a 12-gauge needle; (2) Biomark 8.4-mm, 134.2-kHz, full duplex PIT tags injected with a 16-gauge needle; and (3) Northwest Marine Technology visible implant elastomer (VIE) tags injected under the skin with a 29-gauge needle. Estimates of tag loss, tagging-induced mortality, and growth were evaluated for 60 d with each tag type for four different size-groups of fish: 40–49 mm, 50–59 mm, 60–69 mm, and 70–79 mm TL. Total length was a significant predictor of the probability of PIT tag retention and mortality for both 8-mm and 12-mm PIT tags, and the smallest fish had the highest rates of tag loss (12.5–30.0%) and mortality (7.5–20.0%). Humpback Chub of sizes 40–49 mm TL and tagged with VIE tags had no mortality but did have a 17.5% tag loss. Growth rates of all tagged fish were similar to controls. Our data indicate Humpback Chub can be effectively tagged using either 8-mm or 12-mm PIT tags with little tag loss or mortality at sizes as low as 65 mm TL.
Haplotype assembly in polyploid genomes and identical by descent shared tracts.
Aguiar, Derek; Istrail, Sorin
2013-07-01
Genome-wide haplotype reconstruction from sequence data, or haplotype assembly, is at the center of major challenges in molecular biology and life sciences. For complex eukaryotic organisms like humans, the genome is vast and the population samples are growing so rapidly that algorithms processing high-throughput sequencing data must scale favorably in terms of both accuracy and computational efficiency. Furthermore, current models and methodologies for haplotype assembly (i) do not consider individuals sharing haplotypes jointly, which reduces the size and accuracy of assembled haplotypes, and (ii) are unable to model genomes having more than two sets of homologous chromosomes (polyploidy). Polyploid organisms are increasingly becoming the target of many research groups interested in the genomics of disease, phylogenetics, botany and evolution but there is an absence of theory and methods for polyploid haplotype reconstruction. In this work, we present a number of results, extensions and generalizations of compass graphs and our HapCompass framework. We prove the theoretical complexity of two haplotype assembly optimizations, thereby motivating the use of heuristics. Furthermore, we present graph theory-based algorithms for the problem of haplotype assembly using our previously developed HapCompass framework for (i) novel implementations of haplotype assembly optimizations (minimum error correction), (ii) assembly of a pair of individuals sharing a haplotype tract identical by descent and (iii) assembly of polyploid genomes. We evaluate our methods on 1000 Genomes Project, Pacific Biosciences and simulated sequence data. HapCompass is available for download at http://www.brown.edu/Research/Istrail_Lab/. Supplementary data are available at Bioinformatics online.
BCL11A Enhancer Haplotypes and Fetal Hemoglobin in Sickle Cell Anemia
Sebastiani, P.; Farrell, J.J.; Alsultan, A.; Wang, S.; Edward, H. L.; Shappell, H.; Bae, H.; Milton, J. N.; Baldwin, C.T.; Al-Rubaish, A.M.; Naserullah, Z.; Al-Muhanna, F.; Alsuliman, A.; Patra, P. K.; Farrer, L.A.; Ngo, D.; Vathipadiekal, V.; Chui, D.H.K.; Al-Ali, A.K.; Steinberg, M.H.
2015-01-01
Background Fetal hemoglobin (HbF) levels in sickle cell anemia patients vary. We genotyped polymorphisms in the erythroid-specific enhancer of BCL11A to see if they might account for the very high HbF associated with the Arab-Indian (AI) haplotype and Benin haplotype of sickle cell anemia. Methods and Results Six BCL112A enhancer SNPs and their haplotypes were studied in Saudi Arabs from the Eastern Province and Indian patients with AI haplotype (HbF ~20%), African Americans (HbF ~7%), and Saudi Arabs from the Southwestern Province (HbF ~12%). Four SNPs (rs1427407, rs6706648, rs6738440, and rs7606173) and their haplotypes were consistently associated with HbF levels. The distributions of haplotypes differ in the 3 cohorts but not their genetic effects: the haplotype TCAG was associated with the lowest HbF level and the haplotype GTAC was associated with the highest HbF level and differences in HbF levels between carriers of these haplotypes in all cohorts was approximately 6%. Conclusions Common HbF BCL11A enhancer haplotypes in patients with African origin and AI sickle cell anemia have similar effects on HbF but they do not explain their differences in HbF. PMID:25703683
Pemberton, T J; Jakobsson, M; Conrad, D F; Coop, G; Wall, J D; Pritchard, J K; Patel, P I; Rosenberg, N A
2008-07-01
When performing association studies in populations that have not been the focus of large-scale investigations of haplotype variation, it is often helpful to rely on genomic databases in other populations for study design and analysis - such as in the selection of tag SNPs and in the imputation of missing genotypes. One way of improving the use of these databases is to rely on a mixture of database samples that is similar to the population of interest, rather than using the single most similar database sample. We demonstrate the effectiveness of the mixture approach in the application of African, European, and East Asian HapMap samples for tag SNP selection in populations from India, a genetically intermediate region underrepresented in genomic studies of haplotype variation.
Saad, Mohamed N.; Mabrouk, Mai S.; Eldeib, Ayman M.; Shaker, Olfat G.
2015-01-01
Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA) is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP) approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field. PMID:26843965
Excoffier, L; Smouse, P E; Quattro, J M
1992-06-01
We present here a framework for the study of molecular variation within a single species. Information on DNA haplotype divergence is incorporated into an analysis of variance format, derived from a matrix of squared-distances among all pairs of haplotypes. This analysis of molecular variance (AMOVA) produces estimates of variance components and F-statistic analogs, designated here as phi-statistics, reflecting the correlation of haplotypic diversity at different levels of hierarchical subdivision. The method is flexible enough to accommodate several alternative input matrices, corresponding to different types of molecular data, as well as different types of evolutionary assumptions, without modifying the basic structure of the analysis. The significance of the variance components and phi-statistics is tested using a permutational approach, eliminating the normality assumption that is conventional for analysis of variance but inappropriate for molecular data. Application of AMOVA to human mitochondrial DNA haplotype data shows that population subdivisions are better resolved when some measure of molecular differences among haplotypes is introduced into the analysis. At the intraspecific level, however, the additional information provided by knowing the exact phylogenetic relations among haplotypes or by a nonlinear translation of restriction-site change into nucleotide diversity does not significantly modify the inferred population genetic structure. Monte Carlo studies show that site sampling does not fundamentally affect the significance of the molecular variance components. The AMOVA treatment is easily extended in several different directions and it constitutes a coherent and flexible framework for the statistical analysis of molecular data.
Modeling haplotype block variation using Markov chains.
Greenspan, G; Geiger, D
2006-04-01
Models of background variation in genomic regions form the basis of linkage disequilibrium mapping methods. In this work we analyze a background model that groups SNPs into haplotype blocks and represents the dependencies between blocks by a Markov chain. We develop an error measure to compare the performance of this model against the common model that assumes that blocks are independent. By examining data from the International Haplotype Mapping project, we show how the Markov model over haplotype blocks is most accurate when representing blocks in strong linkage disequilibrium. This contrasts with the independent model, which is rendered less accurate by linkage disequilibrium. We provide a theoretical explanation for this surprising property of the Markov model and relate its behavior to allele diversity.
Modeling Haplotype Block Variation Using Markov Chains
Greenspan, G.; Geiger, D.
2006-01-01
Models of background variation in genomic regions form the basis of linkage disequilibrium mapping methods. In this work we analyze a background model that groups SNPs into haplotype blocks and represents the dependencies between blocks by a Markov chain. We develop an error measure to compare the performance of this model against the common model that assumes that blocks are independent. By examining data from the International Haplotype Mapping project, we show how the Markov model over haplotype blocks is most accurate when representing blocks in strong linkage disequilibrium. This contrasts with the independent model, which is rendered less accurate by linkage disequilibrium. We provide a theoretical explanation for this surprising property of the Markov model and relate its behavior to allele diversity. PMID:16361244
Da, Yang
2015-12-18
The amount of functional genomic information has been growing rapidly but remains largely unused in genomic selection. Genomic prediction and estimation using haplotypes in genome regions with functional elements such as all genes of the genome can be an approach to integrate functional and structural genomic information for genomic selection. Towards this goal, this article develops a new haplotype approach for genomic prediction and estimation. A multi-allelic haplotype model treating each haplotype as an 'allele' was developed for genomic prediction and estimation based on the partition of a multi-allelic genotypic value into additive and dominance values. Each additive value is expressed as a function of h - 1 additive effects, where h = number of alleles or haplotypes, and each dominance value is expressed as a function of h(h - 1)/2 dominance effects. For a sample of q individuals, the limit number of effects is 2q - 1 for additive effects and is the number of heterozygous genotypes for dominance effects. Additive values are factorized as a product between the additive model matrix and the h - 1 additive effects, and dominance values are factorized as a product between the dominance model matrix and the h(h - 1)/2 dominance effects. Genomic additive relationship matrix is defined as a function of the haplotype model matrix for additive effects, and genomic dominance relationship matrix is defined as a function of the haplotype model matrix for dominance effects. Based on these results, a mixed model implementation for genomic prediction and variance component estimation that jointly use haplotypes and single markers is established, including two computing strategies for genomic prediction and variance component estimation with identical results. The multi-allelic genetic partition fills a theoretical gap in genetic partition by providing general formulations for partitioning multi-allelic genotypic values and provides a haplotype
Sanabria-Salas, María Carolina; Hernández-Suárez, Gustavo; Umaña-Pérez, Adriana; Rawlik, Konrad; Tenesa, Albert; Serrano-López, Martha Lucía; Sánchez de Gómez, Myriam; Rojas, Martha Patricia; Bravo, Luis Eduardo; Albis, Rosario; Plata, José Luis; Green, Heather; Borgovan, Theodor; Li, Li; Majumdar, Sumana; Garai, Jone; Lee, Edward; Ashktorab, Hassan; Brim, Hassan; Li, Li; Margolin, David; Fejerman, Laura; Zabaleta, Jovanny
2017-01-01
Single-nucleotide polymorphisms (SNPs) in cytokine genes can affect gene expression and thereby modulate inflammation and carcinogenesis. However, the data on the association between SNPs in the interleukin 1 beta gene (IL1B) and colorectal cancer (CRC) are conflicting. We found an association between a 4-SNP haplotype block of the IL1B (-3737C/-1464G/-511T/-31C) and CRC risk, and this association was exclusively observed in individuals with a higher proportion of African ancestry, such as individuals from the Coastal Colombian region (odds ratio, OR 2.06; 95% CI 1.31–3.25; p < 0.01). Moreover, a significant interaction between this CRC risk haplotype and local African ancestry dosage was identified in locus 2q14 (p = 0.03). We conclude that Colombian individuals with high African ancestry proportions at locus 2q14 harbour more IL1B-CGTC copies and are consequently at an increased risk of CRC. This haplotype has been previously found to increase the IL1B promoter activity and is the most frequent haplotype in African Americans. Despite of limitations in the number of samples and the lack of functional analysis to examine the effect of these haplotypes on CRC cell lines, our results suggest that inflammation and ethnicity play a major role in the modulation of CRC risk. PMID:28157220
CLUSTAG: hierarchical clustering and graph methods for selecting tag SNPs.
Ao, S I; Yip, Kevin; Ng, Michael; Cheung, David; Fong, Pui-Yee; Melhado, Ian; Sham, Pak C
2005-04-15
Cluster and set-cover algorithms are developed to obtain a set of tag single nucleotide polymorphisms (SNPs) that can represent all the known SNPs in a chromosomal region, subject to the constraint that all SNPs must have a squared correlation R2>C with at least one tag SNP, where C is specified by the user. http://hkumath.hku.hk/web/link/CLUSTAG/CLUSTAG.html mng@maths.hku.hk.
Das, Manuj K; Chetry, Sumi; Kalita, Mohan C; Dutta, Prafulla
2016-12-01
North-east region of India has consistent role in the spread of multi drug resistant Plasmodium (P.) falciparum to other parts of Southeast Asia. After rapid clinical treatment failure of Artemisinin based combination therapy-Sulphadoxine/Pyrimethamine (ACT-SP) chemoprophylaxis, Artemether-Lumefantrine (ACT-AL) combination therapy was introduced in the year 2012 in this region for the treatment of uncomplicated P. falciparum malaria. In a DNA sequencing based polymorphism analysis, seven codons of P. falciparum dihydropteroate synthetase ( Pf dhps) gene were screened in a total of 127 P. falciparum isolates collected from Assam, Arunachal Pradesh and Tripura of North-east India during the year 2014 and 2015 to document current sulfadoxine resistant haplotypes. Sequences were analyzed to rearrange both nucleotide and protein haplotypes. Molecular diversity indices were analyzed in DNA Sequence Polymorphism software (DnaSP) on the basis of Pf dhps gene sequences. Disappearance from selective neutrality was assessed based on the ratio of non-synonomous to synonomous nucleotide substitutions [dN/dS ratio]. Moreover, two-tailed Z test was performed in search of the significance for probability of rejecting null hypothesis of strict neutrality [dN = dS]. Presence of mutant P. falciparum multidrug resistance protein1 ( Pf mdr1) was also checked in those isolates that were present with new Pf dhps haplotypes. Phylogenetic relationship based on Pf dhps gene was reconstructed in Molecular Evolutionary Genetics Analysis (MEGA). Among eight different sulfadoxine resistant haplotypes found, IS GNG A haplotype was documented in a total of five isolates from Tripura with association of a new mutant M538 R allele. Sequence analysis of Pf mdr1 gene in these five isolates came to notice that not all but only one isolate was mutant at codon 86 (N86 Y ; Y YSND) in the multidrug resistance protein. Molecular diversity based on Pf dhps haplotypes revealed that P. falciparum
Assessment of PIT tag retention and post-tagging survival in metamorphosing juvenile Sea Lamprey
Simard, Lee G.; Sotola, V. Alex; Marsden, J. Ellen; Miehls, Scott M.
2017-01-01
Background: Passive integrated transponder (PIT) tags have been used to document and monitor the movement or behavior of numerous species of fishes. Data on short-term and long-term survival and tag retention are needed before initiating studies using PIT tags on a new species or life stage. We evaluated the survival and tag retention of 153 metamorphosing juvenile Sea Lamprey Petromyzon marinus tagged with 12 mm PIT tags on three occasions using a simple surgical procedure. Results: Tag retention was 100% and 98.6% at 24 h and 28-105 d post-tagging. Of the lamprey that retained their tags, 87.3% had incisions sufficiently healed to prevent further loss. Survival was 100% and 92.7% at 24 h and 41-118 d post-tagging with no significant difference in survival between tagged and untagged control lamprey. Of the 11 lamprey that died, four had symptoms that indicated their death was directly related to tagging. Survival was positively correlated with Sea Lamprey length. Conclusions: Given the overall high level of survival and tag retention in this study, future studies can utilize 12 mm PIT tags to monitor metamorphosing juvenile Sea Lamprey movement and migration patterns.
Zhu, Xiaofeng; Yan, Denise; Cooper, Richard S.; Luke, Amy; Ikeda, Morna A.; Chang, Yen-Pei C.; Weder, Alan; Chakravarti, Aravinda
2003-01-01
Association studies of candidate genes with complex traits have generally used one or a few single nucleotide polymorphisms (SNPs), although variation in the extent of linkage disequilibrium (LD) within genes markedly influences the sensitivity and precision of association studies. The extent of LD and the underlying haplotype structure for most candidate genes are still unavailable. We sampled 193 blacks (African-Americans) and 160 whites (European-Americans) and estimated the intragenic LD and the haplotype structure in four genes of the renin–angiotensin system. We genotyped 25 SNPs, with all but one of the pairs spaced between 1 and 20 kb, thus providing resolution at small scale. The pattern of LD within a gene was very heterogeneous. Using a robust method to define haplotype blocks, blocks of limited haplotype diversity were identified at each locus; between these blocks, LD was lost owing to the history of recombination events. As anticipated, there was less LD among blacks, the number of haplotypes was substantially larger, and shorter haplotype segments were found, compared with whites. These findings have implications for candidate-gene association studies and indicate that variation between populations of European and African origin in haplotype diversity is characteristic of most genes. [The sequence data described in this paper are available in GenBank under the following accession nos: AGT, MIM 106150; Renin, MIM 179820; ACE, MIM 106180; Angiotensin receptor I, MIM 106165. Supplementary material is available online at http://www.genome.org.] PMID:12566395
Ibe, Susan; Schirrmeister, Jana; Zehner, Susanne
2015-08-20
For fast and easy purification, proteins are typically fused with an affinity tag, which often needs to be removed after purification. Here, we present a method for the removal of the affinity tag from the target protein in a single step protocol. The protein VIC_001052 of the coral pathogen Vibrio coralliilyticus ATCC BAA-450 contains a metal ion-inducible autocatalytic cleavage (MIIA) domain. Its coding sequence was inserted into an expression vector for the production of recombinant fusion proteins. Following, the target proteins MalE and mCherry were produced as MIIA-Strep fusion proteins in Escherichia coli. The target proteins could be separated from the MIIA-Strep part simply by the addition of calcium or manganese(II) ions within minutes. The cleavage is not affected in the pH range from 5.0 to 9.0 or at low temperatures (6°C). Autocleavage was also observed with immobilized protein on an affinity column. The protein yield was similar to that achieved with a conventional purification protocol. Copyright © 2015 Elsevier B.V. All rights reserved.
GSyellow, a Multifaceted Tag for Functional Protein Analysis in Monocot and Dicot Plants.
Besbrugge, Nienke; Van Leene, Jelle; Eeckhout, Dominique; Cannoot, Bernard; Kulkarni, Shubhada R; De Winne, Nancy; Persiau, Geert; Van De Slijke, Eveline; Bontinck, Michiel; Aesaert, Stijn; Impens, Francis; Gevaert, Kris; Van Damme, Daniel; Van Lijsebettens, Mieke; Inzé, Dirk; Vandepoele, Klaas; Nelissen, Hilde; De Jaeger, Geert
2018-06-01
The ability to tag proteins has boosted the emergence of generic molecular methods for protein functional analysis. Fluorescent protein tags are used to visualize protein localization, and affinity tags enable the mapping of molecular interactions by, for example, tandem affinity purification or chromatin immunoprecipitation. To apply these widely used molecular techniques on a single transgenic plant line, we developed a multifunctional tandem affinity purification tag, named GS yellow , which combines the streptavidin-binding peptide tag with citrine yellow fluorescent protein. We demonstrated the versatility of the GS yellow tag in the dicot Arabidopsis ( Arabidopsis thaliana ) using a set of benchmark proteins. For proof of concept in monocots, we assessed the localization and dynamic interaction profile of the leaf growth regulator ANGUSTIFOLIA3 (AN3), fused to the GS yellow tag, along the growth zone of the maize ( Zea mays ) leaf. To further explore the function of ZmAN3, we mapped its DNA-binding landscape in the growth zone of the maize leaf through chromatin immunoprecipitation sequencing. Comparison with AN3 target genes mapped in the developing maize tassel or in Arabidopsis cell cultures revealed strong conservation of AN3 target genes between different maize tissues and across monocots and dicots, respectively. In conclusion, the GS yellow tag offers a powerful molecular tool for distinct types of protein functional analyses in dicots and monocots. As this approach involves transforming a single construct, it is likely to accelerate both basic and translational plant research. © 2018 American Society of Plant Biologists. All rights reserved.
Mineralocorticoid receptor haplotype, oral contraceptives and emotional information processing.
Hamstra, D A; de Kloet, E R; van Hemert, A M; de Rijk, R H; Van der Does, A J W
2015-02-12
Oral contraceptives (OCs) affect mood in some women and may have more subtle effects on emotional information processing in many more users. Female carriers of mineralocorticoid receptor (MR) haplotype 2 have been shown to be more optimistic and less vulnerable to depression. To investigate the effects of oral contraceptives on emotional information processing and a possible moderating effect of MR haplotype. Cross-sectional study in 85 healthy premenopausal women of West-European descent. We found significant main effects of oral contraceptives on facial expression recognition, emotional memory and decision-making. Furthermore, carriers of MR haplotype 1 or 3 were sensitive to the impact of OCs on the recognition of sad and fearful faces and on emotional memory, whereas MR haplotype 2 carriers were not. Different compounds of OCs were included. No hormonal measures were taken. Most naturally cycling participants were assessed in the luteal phase of their menstrual cycle. Carriers of MR haplotype 2 may be less sensitive to depressogenic side-effects of OCs. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
The autoimmune regulator gene (AIRE) is strongly associated with vitiligo.
Tazi-Ahnini, R; McDonagh, A J G; Wengraf, D A; Lovewell, T R J; Vasilopoulos, Y; Messenger, A G; Cork, M J; Gawkrodger, D J
2008-09-01
Vitiligo is an autoimmune disorder that occurs with greatly increased frequency in the rare recessive autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy syndrome (APECED) caused by mutations of the autoimmune regulator (AIRE) gene on chromosome 21q22.3. We have previously detected an association between alopecia areata and single nucleotide polymorphisms (SNPs) in the AIRE gene. To report the findings of an extended study including haplotype analysis on six AIRE polymorphisms (AIRE C-103T, C4144G, T5238C, G6528A, T7215C and T11787C) in vitiligo, another APECED-associated disease. A case-control analysis was performed. Results showed a strong association between AIRE 7215C and vitiligo [P = 1.36 x 10(-5), odds ratio (OR) 3.12, 95% confidence interval (CI) 1.87-5.46]. We found no significant association with the other polymorphisms individually. However, haplotype analysis revealed that the AIRE haplotype CCTGCC showed a highly significant association with vitiligo (P = 4.14 x 10(-4), OR 3.00, 95% CI 1.70-5.28). To select the most informative minimal haplotypes, we tagged the polymorphisms using SNP tag software. Using AIRE C-103T, G6528A, T7215C and T11787C as tag SNPs, the haplotype AIRE CGCC was associated with vitiligo (P = 0.003, OR 2.49, 95% CI 1.45-4.26). The link between vitiligo and AIRE raises the possibility that defective skin peripheral antigen selection in the thymus is involved in the changes that result in melanocyte destruction in this disorder.
TagDust2: a generic method to extract reads from sequencing data.
Lassmann, Timo
2015-01-28
Arguably the most basic step in the analysis of next generation sequencing data (NGS) involves the extraction of mappable reads from the raw reads produced by sequencing instruments. The presence of barcodes, adaptors and artifacts subject to sequencing errors makes this step non-trivial. Here I present TagDust2, a generic approach utilizing a library of hidden Markov models (HMM) to accurately extract reads from a wide array of possible read architectures. TagDust2 extracts more reads of higher quality compared to other approaches. Processing of multiplexed single, paired end and libraries containing unique molecular identifiers is fully supported. Two additional post processing steps are included to exclude known contaminants and filter out low complexity sequences. Finally, TagDust2 can automatically detect the library type of sequenced data from a predefined selection. Taken together TagDust2 is a feature rich, flexible and adaptive solution to go from raw to mappable NGS reads in a single step. The ability to recognize and record the contents of raw reads will help to automate and demystify the initial, and often poorly documented, steps in NGS data analysis pipelines. TagDust2 is freely available at: http://tagdust.sourceforge.net .
DLA-DRB1, DQA1, and DQB1 alleles and haplotypes in North American Gray Wolves.
Kennedy, Lorna J; Angles, John M; Barnes, Annette; Carmichael, Lindsey E; Radford, Alan D; Ollier, William E R; Happ, George M
2007-01-01
The canine major histocompatibility complex contains highly polymorphic genes, many of which are critical in regulating immune response. Since domestic dogs evolved from Gray Wolves (Canis lupus), common DLA class II alleles should exist. Sequencing was used to characterize 175 Gray Wolves for DLA class II alleles, and data from 1856 dogs, covering 85 different breeds of mostly European origin, were available for comparison. Within wolves, 28 new alleles were identified, all occurring in at least 2 individuals. Three DLA-DRB1, 8 DLA-DQA1, and 6 DLA-DQB1 alleles also identified in dogs were present. Twenty-eight haplotypes were identified, of which 2 three-locus haplotypes, and many DLA-DQA1/DQB1 haplotypes, are also found in dogs. The wolves studied had relatively few dog DLA alleles and may therefore represent a remnant population descended from Asian wolves. The single European wolf included carried a haplotype found in both these North American wolves and in many dog breeds. Furthermore, one wolf DQB1 allele has been found in Shih Tzu, a breed of Asian origin. These data suggest that the wolf ancestors of Asian and European dogs may have had different gene pools, currently reflected in the DLA alleles present in dog breeds.
Haplotype Phasing and Inheritance of Copy Number Variants in Nuclear Families
Palta, Priit; Kaplinski, Lauris; Nagirnaja, Liina; Veidenberg, Andres; Möls, Märt; Nelis, Mari; Esko, Tõnu; Metspalu, Andres; Laan, Maris; Remm, Maido
2015-01-01
DNA copy number variants (CNVs) that alter the copy number of a particular DNA segment in the genome play an important role in human phenotypic variability and disease susceptibility. A number of CNVs overlapping with genes have been shown to confer risk to a variety of human diseases thus highlighting the relevance of addressing the variability of CNVs at a higher resolution. So far, it has not been possible to deterministically infer the allelic composition of different haplotypes present within the CNV regions. We have developed a novel computational method, called PiCNV, which enables to resolve the haplotype sequence composition within CNV regions in nuclear families based on SNP genotyping microarray data. The algorithm allows to i) phase normal and CNV-carrying haplotypes in the copy number variable regions, ii) resolve the allelic copies of rearranged DNA sequence within the haplotypes and iii) infer the heritability of identified haplotypes in trios or larger nuclear families. To our knowledge this is the first program available that can deterministically phase null, mono-, di-, tri- and tetraploid genotypes in CNV loci. We applied our method to study the composition and inheritance of haplotypes in CNV regions of 30 HapMap Yoruban trios and 34 Estonian families. For 93.6% of the CNV loci, PiCNV enabled to unambiguously phase normal and CNV-carrying haplotypes and follow their transmission in the corresponding families. Furthermore, allelic composition analysis identified the co-occurrence of alternative allelic copies within 66.7% of haplotypes carrying copy number gains. We also observed less frequent transmission of CNV-carrying haplotypes from parents to children compared to normal haplotypes and identified an emergence of several de novo deletions and duplications in the offspring. PMID:25853576
Haplotype phasing and inheritance of copy number variants in nuclear families.
Palta, Priit; Kaplinski, Lauris; Nagirnaja, Liina; Veidenberg, Andres; Möls, Märt; Nelis, Mari; Esko, Tõnu; Metspalu, Andres; Laan, Maris; Remm, Maido
2015-01-01
DNA copy number variants (CNVs) that alter the copy number of a particular DNA segment in the genome play an important role in human phenotypic variability and disease susceptibility. A number of CNVs overlapping with genes have been shown to confer risk to a variety of human diseases thus highlighting the relevance of addressing the variability of CNVs at a higher resolution. So far, it has not been possible to deterministically infer the allelic composition of different haplotypes present within the CNV regions. We have developed a novel computational method, called PiCNV, which enables to resolve the haplotype sequence composition within CNV regions in nuclear families based on SNP genotyping microarray data. The algorithm allows to i) phase normal and CNV-carrying haplotypes in the copy number variable regions, ii) resolve the allelic copies of rearranged DNA sequence within the haplotypes and iii) infer the heritability of identified haplotypes in trios or larger nuclear families. To our knowledge this is the first program available that can deterministically phase null, mono-, di-, tri- and tetraploid genotypes in CNV loci. We applied our method to study the composition and inheritance of haplotypes in CNV regions of 30 HapMap Yoruban trios and 34 Estonian families. For 93.6% of the CNV loci, PiCNV enabled to unambiguously phase normal and CNV-carrying haplotypes and follow their transmission in the corresponding families. Furthermore, allelic composition analysis identified the co-occurrence of alternative allelic copies within 66.7% of haplotypes carrying copy number gains. We also observed less frequent transmission of CNV-carrying haplotypes from parents to children compared to normal haplotypes and identified an emergence of several de novo deletions and duplications in the offspring.
Food Iron Absorption Measured by an Extrinsic Tag
Cook, J. D.; Layrisse, M.; Martinez-Torres, C.; Walker, R.; Monsen, E.; Finch, C. A.
1972-01-01
The paper describes the use of an extrinsic tag of inorganic radioiron to determine the total absorption of nonheme iron from a complete meal. The method was developed by measuring the iron absorbed from vegetable foods containing biosynthetically incorporated 55Fe (intrinsic tag) and from 59Fe added as a small dose of inorganic iron to the same meal (extrinsic tag). In studies with maize, black bean, and wheat, a consistent extrinsic: intrinsic radioiron absorption ratio averaging 1.10 was observed. Similar results were obtained with either ferrous or ferric iron as the extrinsic tag, and with doses of the latter ranging from 0.001 to 0.5 mg iron added to a test meal containing 2-4 mg of food iron. Adding the radioiron at different stages in preparation of the test meal also had little effect. Separate administration of the extrinsic tag was less satisfactory when small portions of a single food were employed, but with a complete meal, the separate dose was preferable. The extrinsic tag provided a valid measure of absorption despite marked differences in the iron status of the subject, and with wide changes in absorption imposed by adding desferrioxamine or ascorbic acid to the test meal. These findings indicate that there is a common pool of nonheme iron, the absorption of which is influenced by various blocking or enhancing substances present in the meal. PMID:5062612
McCreary, Brome
2008-01-01
The following video demonstrates a procedure to insert a passive integrated transponder (PIT) tag under the skin of an anuran (frog or toad) for research and monitoring purposes. Typically, a 12.5 mm tag (0.5 in.) is used to uniquely identify individual anurans as smal as 40 mm (1.6 in.) in length from snout to vent. Smaller tags are also available and allow smaller anurans to be tagged. The procedure does not differ for other sizes of tages or other sizes of anurans. Anyone using this procedure should ensure that the tag is small enough to fit easily behind the sacral hump of the anuran, as shown in this video.
Mineralocorticoid receptor haplotype, estradiol, progesterone and emotional information processing.
Hamstra, Danielle A; de Kloet, E Ronald; Quataert, Ina; Jansen, Myrthe; Van der Does, Willem
2017-02-01
Carriers of MR-haplotype 1 and 3 (GA/CG; rs5522 and rs2070951) are more sensitive to the influence of oral contraceptives (OC) and menstrual cycle phase on emotional information processing than MR-haplotype 2 (CA) carriers. We investigated whether this effect is associated with estradiol (E2) and/or progesterone (P4) levels. Healthy MR-genotyped premenopausal women were tested twice in a counterbalanced design. Naturally cycling (NC) women were tested in the early-follicular and mid-luteal phase and OC-users during OC-intake and in the pill-free week. At both sessions E2 and P4 were assessed in saliva. Tests included implicit and explicit positive and negative affect, attentional blink accuracy, emotional memory, emotion recognition, and risky decision-making (gambling). MR-haplotype 2 homozygotes had higher implicit happiness scores than MR-haplotype 2 heterozygotes (p=0.031) and MR-haplotype 1/3 carriers (p<0.001). MR-haplotype 2 homozygotes also had longer reaction times to happy faces in an emotion recognition test than MR-haplotype 1/3 (p=0.001). Practice effects were observed for most measures. The pattern of correlations between information processing and P4 or E2 differed between sessions, as well as the moderating effects of the MR genotype. In the first session the MR-genotype moderated the influence of P4 on implicit anxiety (sr=-0.30; p=0.005): higher P4 was associated with reduction in implicit anxiety, but only in MR-haplotype 2 homozygotes (sr=-0.61; p=0.012). In the second session the MR-genotype moderated the influence of E2 on the recognition of facial expressions of happiness (sr=-0.21; p=0.035): only in MR-haplotype 1/3 higher E2 was correlated with happiness recognition (sr=0.29; p=0.005). In the second session higher E2 and P4 were negatively correlated with accuracy in lag2 trials of the attentional blink task (p<0.001). Thus NC women, compared to OC-users, performed worse on lag 2 trials (p=0.041). The higher implicit happiness scores of MR-haplotype
Development of RAP Tag, a Novel Tagging System for Protein Detection and Purification.
Fujii, Yuki; Kaneko, Mika K; Ogasawara, Satoshi; Yamada, Shinji; Yanaka, Miyuki; Nakamura, Takuro; Saidoh, Noriko; Yoshida, Kanae; Honma, Ryusuke; Kato, Yukinari
2017-04-01
Affinity tag systems, possessing high affinity and specificity, are useful for protein detection and purification. The most suitable tag for a particular purpose should be selected from many available affinity tag systems. In this study, we developed a novel affinity tag called the "RAP tag" system, which comprises a mouse antirat podoplanin monoclonal antibody (clone PMab-2) and the RAP tag (DMVNPGLEDRIE). This system is useful not only for protein detection in Western blotting, flow cytometry, and sandwich enzyme-linked immunosorbent assay, but also for protein purification.
Brett, Zoë H.; Henry, Caitlin; Scheeringa, Michael
2013-01-01
Abstract Objective Significant evidence supports a genetic contribution to the development of posttraumatic stress disorder (PTSD). Three previous studies have demonstrated an association between PTSD and the nine repeat allele of the 3′ untranslated region (3′UTR) variable number tandem repeat (VNTR) in the dopamine transporter (DAT, rs28363170). Recently a novel, functionally significant C/T single-nucleotide polymorphism (SNP) in the 3′UTR (rs27072) with putative interactions with the 3′VNTR, has been identified. To provide enhanced support for the role of DAT and striatal dopamine regulation in the development of PTSD, this study examined the impact of a haplotype defined by the C allele of rs27072 and the nine repeat allele of the 3′VNTR on PTSD diagnosis in young trauma-exposed children. Methods DAT haplotypes were determined in 150 trauma-exposed 3–6 year-old children. PTSD was assessed with a semistructured interview. After excluding double heterozygotes, analysis was performed on 143 total subjects. Haplotype was examined in relation to categorical and continuous measures of PTSD, controlling for trauma type and race. Additional analysis within the two largest race categories was performed, as other means of controlling for ethnic stratification were not available. Results The number of haplotypes (0, 1, or 2) defined by the presence of the nine repeat allele of rs28363170 (VNTR in the 3′UTR) and the C allele of rs27072 (SNP in the 3′UTR) was significantly associated with both the diagnosis of PTSD and total PTSD symptoms. Specifically, children with one or two copies of the haplotype had significantly more PTSD symptoms and were more likely to be diagnosed with PTSD than were children without this haplotype. Conclusions These findings extend previous findings associating genetic variation in the DAT with PTSD. The association of a haplotype in DAT with PTSD provides incremental traction for a model of genetic vulnerability to PTSD, a
ezTag: tagging biomedical concepts via interactive learning.
Kwon, Dongseop; Kim, Sun; Wei, Chih-Hsuan; Leaman, Robert; Lu, Zhiyong
2018-05-18
Recently, advanced text-mining techniques have been shown to speed up manual data curation by providing human annotators with automated pre-annotations generated by rules or machine learning models. Due to the limited training data available, however, current annotation systems primarily focus only on common concept types such as genes or diseases. To support annotating a wide variety of biological concepts with or without pre-existing training data, we developed ezTag, a web-based annotation tool that allows curators to perform annotation and provide training data with humans in the loop. ezTag supports both abstracts in PubMed and full-text articles in PubMed Central. It also provides lexicon-based concept tagging as well as the state-of-the-art pre-trained taggers such as TaggerOne, GNormPlus and tmVar. ezTag is freely available at http://eztag.bioqrator.org.
Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...
Genomic evolution in domestic cattle: ancestral haplotypes and healthy beef.
Williamson, Joseph F; Steele, Edward J; Lester, Susan; Kalai, Oscar; Millman, John A; Wolrige, Lindsay; Bayard, Dominic; McLure, Craig; Dawkins, Roger L
2011-05-01
We have identified numerous Ancestral Haplotypes encoding a 14-Mb region of Bota C19. Three are frequent in Simmental, Angus and Wagyu and have been conserved since common progenitor populations. Others are more relevant to the differences between these 3 breeds including fat content and distribution in muscle. SREBF1 and Growth Hormone, which have been implicated in the production of healthy beef, are included within these haplotypes. However, we conclude that alleles at these 2 loci are less important than other sequences within the haplotypes. Identification of breeds and hybrids is improved by using haplotypes rather than individual alleles. Copyright © 2010 Elsevier Inc. All rights reserved.
Semler, Matthew R; Wiseman, Roger W; Karl, Julie A; Graham, Michael E; Gieger, Samantha M; O'Connor, David H
2018-06-01
Pig-tailed macaques (Macaca nemestrina, Mane) are important models for human immunodeficiency virus (HIV) studies. Their infectability with minimally modified HIV makes them a uniquely valuable animal model to mimic human infection with HIV and progression to acquired immunodeficiency syndrome (AIDS). However, variation in the pig-tailed macaque major histocompatibility complex (MHC) and the impact of individual transcripts on the pathogenesis of HIV and other infectious diseases is understudied compared to that of rhesus and cynomolgus macaques. In this study, we used Pacific Biosciences single-molecule real-time circular consensus sequencing to describe full-length MHC class I (MHC-I) transcripts for 194 pig-tailed macaques from three breeding centers. We then used the full-length sequences to infer Mane-A and Mane-B haplotypes containing groups of MHC-I transcripts that co-segregate due to physical linkage. In total, we characterized full-length open reading frames (ORFs) for 313 Mane-A, Mane-B, and Mane-I sequences that defined 86 Mane-A and 106 Mane-B MHC-I haplotypes. Pacific Biosciences technology allows us to resolve these Mane-A and Mane-B haplotypes to the level of synonymous allelic variants. The newly defined haplotypes and transcript sequences containing full-length ORFs provide an important resource for infectious disease researchers as certain MHC haplotypes have been shown to provide exceptional control of simian immunodeficiency virus (SIV) replication and prevention of AIDS-like disease in nonhuman primates. The increased allelic resolution provided by Pacific Biosciences sequencing also benefits transplant research by allowing researchers to more specifically match haplotypes between donors and recipients to the level of nonsynonymous allelic variation, thus reducing the risk of graft-versus-host disease.
Aoyama, N; Takahashi, N; Saito, S; Maeno, N; Ishihara, R; Ji, X; Miura, H; Ikeda, M; Suzuki, T; Kitajima, T; Yamanouchi, Y; Kinoshita, Y; Yoshida, K; Iwata, N; Inada, T; Ozaki, N
2006-06-01
Several lines of evidence suggest that metabolic changes in the kynurenic acid (KYNA) pathway are related to the etiology of schizophrenia. The inhibitor of kynurenine 3-monooxygenase (KMO) is known to increase KYNA levels, and the KMO gene is located in the chromosome region associated with schizophrenia, 1q42-q44. Single-marker and haplotype analyses for 6-tag single nucleotide polymorphisms (SNPs) of KMO were performed (cases = 465, controls = 440). Significant association of rs2275163 with schizophrenia was observed by single-marker comparisons (P = 0.032) and haplotype analysis including this SNP (P = 0.0049). Significant association of rs2275163 and haplotype was not replicated using a second, independent set of samples (cases = 480, controls = 448) (P = 0.706 and P = 0.689, respectively). These results suggest that the KMO is unlikely to be related to the development of schizophrenia in Japanese.
Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.
Guerreiro, J F; Figueiredo, M S; Zago, M A
1994-01-01
We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.
A spatial haplotype copying model with applications to genotype imputation.
Yang, Wen-Yun; Hormozdiari, Farhad; Eskin, Eleazar; Pasaniuc, Bogdan
2015-05-01
Ever since its introduction, the haplotype copy model has proven to be one of the most successful approaches for modeling genetic variation in human populations, with applications ranging from ancestry inference to genotype phasing and imputation. Motivated by coalescent theory, this approach assumes that any chromosome (haplotype) can be modeled as a mosaic of segments copied from a set of chromosomes sampled from the same population. At the core of the model is the assumption that any chromosome from the sample is equally likely to contribute a priori to the copying process. Motivated by recent works that model genetic variation in a geographic continuum, we propose a new spatial-aware haplotype copy model that jointly models geography and the haplotype copying process. We extend hidden Markov models of haplotype diversity such that at any given location, haplotypes that are closest in the genetic-geographic continuum map are a priori more likely to contribute to the copying process than distant ones. Through simulations starting from the 1000 Genomes data, we show that our model achieves superior accuracy in genotype imputation over the standard spatial-unaware haplotype copy model. In addition, we show the utility of our model in selecting a small personalized reference panel for imputation that leads to both improved accuracy as well as to a lower computational runtime than the standard approach. Finally, we show our proposed model can be used to localize individuals on the genetic-geographical map on the basis of their genotype data.
Garud, Nandita R; Rosenberg, Noah A
2015-06-01
Soft selective sweeps represent an important form of adaptation in which multiple haplotypes bearing adaptive alleles rise to high frequency. Most statistical methods for detecting selective sweeps from genetic polymorphism data, however, have focused on identifying hard selective sweeps in which a favored allele appears on a single haplotypic background; these methods might be underpowered to detect soft sweeps. Among exceptions is the set of haplotype homozygosity statistics introduced for the detection of soft sweeps by Garud et al. (2015). These statistics, examining frequencies of multiple haplotypes in relation to each other, include H12, a statistic designed to identify both hard and soft selective sweeps, and H2/H1, a statistic that conditional on high H12 values seeks to distinguish between hard and soft sweeps. A challenge in the use of H2/H1 is that its range depends on the associated value of H12, so that equal H2/H1 values might provide different levels of support for a soft sweep model at different values of H12. Here, we enhance the H12 and H2/H1 haplotype homozygosity statistics for selective sweep detection by deriving the upper bound on H2/H1 as a function of H12, thereby generating a statistic that normalizes H2/H1 to lie between 0 and 1. Through a reanalysis of resequencing data from inbred lines of Drosophila, we show that the enhanced statistic both strengthens interpretations obtained with the unnormalized statistic and leads to empirical insights that are less readily apparent without the normalization. Copyright © 2015 Elsevier Inc. All rights reserved.
Lumkul, Lalita; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn
2018-01-01
Development of an effective vaccine is critically needed for the prevention of malaria. One of the key antigens for malaria vaccines is the apical membrane antigen 1 (AMA-1) of the human malaria parasite Plasmodium falciparum, the surface protein for erythrocyte invasion of the parasite. The gene encoding AMA-1 has been sequenced from populations of P. falciparum worldwide, but the haplotype diversity of the gene in P. falciparum populations in the Greater Mekong Subregion (GMS), including Thailand, remains to be characterized. In the present study, the AMA-1 gene was PCR amplified and sequenced from the genomic DNA of 65 P. falciparum isolates from 5 endemic areas in Thailand. The nearly full-length 1,848 nucleotide sequence of AMA-1 was subjected to molecular analyses, including nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity and neutrality tests. Phylogenetic analysis and pairwise population differentiation (Fst indices) were performed to infer the population structure. The analyses identified 60 single nucleotide polymorphic loci, predominately located in domain I of AMA-1. A total of 31 unique AMA-1 haplotypes were identified, which included 11 novel ones. The phylogenetic tree of the AMA-1 haplotypes revealed multiple clades of AMA-1, each of which contained parasites of multiple geographical origins, consistent with the Fst indices indicating genetic homogeneity or gene flow among geographically distinct populations of P. falciparum in Thailand’s borders with Myanmar, Laos and Cambodia. In summary, the study revealed novel haplotypes and population structure needed for the further advancement of AMA-1-based malaria vaccines in the GMS. PMID:29742870
Mathematical properties and bounds on haplotyping populations by pure parsimony.
Wang, I-Lin; Chang, Chia-Yuan
2011-06-01
Although the haplotype data can be used to analyze the function of DNA, due to the significant efforts required in collecting the haplotype data, usually the genotype data is collected and then the population haplotype inference (PHI) problem is solved to infer haplotype data from genotype data for a population. This paper investigates the PHI problem based on the pure parsimony criterion (HIPP), which seeks the minimum number of distinct haplotypes to infer a given genotype data. We analyze the mathematical structure and properties for the HIPP problem, propose techniques to reduce the given genotype data into an equivalent one of much smaller size, and analyze the relations of genotype data using a compatible graph. Based on the mathematical properties in the compatible graph, we propose a maximal clique heuristic to obtain an upper bound, and a new polynomial-sized integer linear programming formulation to obtain a lower bound for the HIPP problem. Copyright © 2011 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Colotelo, Alison; Deters, Kate
2017-05-26
Pacific Northwest National Laboratory has developed a super-small acoustic tracking tag designed just for juvenile lamprey. In this video, PNNL researcher Alison Colotelo describes how she and her colleague Kate Deters inject young lamprey with the PNNL tag.
PTCH1 gene haplotype association with basal cell carcinoma after transplantation.
Begnini, A; Tessari, G; Turco, A; Malerba, G; Naldi, L; Gotti, E; Boschiero, L; Forni, A; Rugiu, C; Piaserico, S; Fortina, A B; Brunello, A; Cascone, C; Girolomoni, G; Gomez Lira, M
2010-08-01
Basal cell carcinoma (BCC) is 10 times more frequent in organ transplant recipients (OTRs) than in the general population. Factors in OTRs conferring increased susceptibility to BCC include ultraviolet radiation exposure, immunosuppression, viral infections such as human papillomavirus, phototype and genetic predisposition. The PTCH1 gene is a negative regulator of the hedgehog pathway, that provides mitogenic signals to basal cells in skin. PTCH1 gene mutations cause naevoid BCC syndrome, and contribute to the development of sporadic BCC and other types of cancers. Associations have been reported between PTCH1 polymorphisms and BCC susceptibility in nontransplanted individuals. To search for novel common polymorphisms in the proximal 5' regulatory region upstream of PTCH1 gene exon 1B, and to investigate the possible association of PTCH1 polymorphisms and haplotypes with BCC risk after organ transplantation. Three PTCH1 single nucleotide polymorphisms (rs2297086, rs2066836 and rs357564) were analysed by restriction fragment length polymorphism analysis in 161 northern Italian OTRs (56 BCC cases and 105 controls). Two regions of the PTCH1 gene promoter were screened by heteroduplex analysis in 30 cases and 30 controls. Single locus analysis showed no significant association. Haplotype T(1686)-T(3944) appeared to confer a significantly higher risk for BCC development (odds ratio 2.98, 95% confidence interval 2.55-3.48; P = 0.001). Two novel rare polymorphisms were identified at positions 176 and 179 of the 5'UTR. Two novel alleles of the -4 (CGG)(n) microsatellite were identified. No association of this microsatellite with BCC was observed. Haplotypes containing T(1686)-T(3944) alleles were shown to be associated with an increased BCC risk in our study population. These data appear to be of great interest for further investigations in a larger group of transplant individuals. Our results do not support the hypothesis that common polymorphisms in the proximal 5
Origin and Diversification Dynamics of Self-Incompatibility Haplotypes
Gervais, Camille E.; Castric, Vincent; Ressayre, Adrienne; Billiard, Sylvain
2011-01-01
Self-incompatibility (SI) is a genetic system found in some hermaphrodite plants. Recognition of pollen by pistils expressing cognate specificities at two linked genes leads to rejection of self pollen and pollen from close relatives, i.e., to avoidance of self-fertilization and inbred matings, and thus increased outcrossing. These genes generally have many alleles, yet the conditions allowing the evolution of new alleles remain mysterious. Evolutionary changes are clearly necessary in both genes, since any mutation affecting only one of them would result in a nonfunctional self-compatible haplotype. Here, we study diversification at the S-locus (i.e., a stable increase in the total number of SI haplotypes in the population, through the incorporation of new SI haplotypes), both deterministically (by investigating analytically the fate of mutations in an infinite population) and by simulations of finite populations. We show that the conditions allowing diversification are far less stringent in finite populations with recurrent mutations of the pollen and pistil genes, suggesting that diversification is possible in a panmictic population. We find that new SI haplotypes emerge fastest in populations with few SI haplotypes, and we discuss some implications for empirical data on S-alleles. However, allele numbers in our simulations never reach values as high as observed in plants whose SI systems have been studied, and we suggest extensions of our models that may reconcile the theory and data. PMID:21515570
Ancestral inference from haplotypes and mutations.
Griffiths, Robert C; Tavaré, Simon
2018-04-25
We consider inference about the history of a sample of DNA sequences, conditional upon the haplotype counts and the number of segregating sites observed at the present time. After deriving some theoretical results in the coalescent setting, we implement rejection sampling and importance sampling schemes to perform the inference. The importance sampling scheme addresses an extension of the Ewens Sampling Formula for a configuration of haplotypes and the number of segregating sites in the sample. The implementations include both constant and variable population size models. The methods are illustrated by two human Y chromosome datasets. Copyright © 2018. Published by Elsevier Inc.
Tag-to-Tag Interference Suppression Technique Based on Time Division for RFID.
Khadka, Grishma; Hwang, Suk-Seung
2017-01-01
Radio-frequency identification (RFID) is a tracking technology that enables immediate automatic object identification and rapid data sharing for a wide variety of modern applications using radio waves for data transmission from a tag to a reader. RFID is already well established in technical areas, and many companies have developed corresponding standards and measurement techniques. In the construction industry, effective monitoring of materials and equipment is an important task, and RFID helps to improve monitoring and controlling capabilities, in addition to enabling automation for construction projects. However, on construction sites, there are many tagged objects and multiple RFID tags that may interfere with each other's communications. This reduces the reliability and efficiency of the RFID system. In this paper, we propose an anti-collision algorithm for communication between multiple tags and a reader. In order to suppress interference signals from multiple neighboring tags, the proposed algorithm employs the time-division (TD) technique, where tags in the interrogation zone are assigned a specific time slot so that at every instance in time, a reader communicates with tags using the specific time slot. We present representative computer simulation examples to illustrate the performance of the proposed anti-collision technique for multiple RFID tags.
Photon-tagged and B-meson-tagged b-jet production at the LHC
Huang, Jinrui; Kang, Zhong -Bo; Vitev, Ivan; ...
2015-09-18
Tagged jet measurements in high energy hadronic and nuclear reactions provide constraints on the energy and parton flavor origin of the parton shower that recoils against the tagging particle. Such additional insight can be especially beneficial in illuminating the mechanisms of heavy flavor production in proton–proton collisions at the LHC and their modification in the heavy ion environment, which are not fully understood. With this motivation, we present theoretical results for isolated-photon-tagged and B-meson-tagged b-jet production at √s NN = 5.1 TeV for comparison to the upcoming lead–lead data. We find that photon-tagged b-jets exhibit smaller momentum imbalance shift inmore » nuclear matter, and correspondingly smaller energy loss, than photon-tagged light flavor jets. Our results show that B-meson tagging is most effective in ensuring that the dominant fraction of recoiling jets originate from prompt b-quarks. Furthermore, in this channel the large suppression of the cross section is not accompanied by a significant momentum imbalance shift.« less
PWHATSHAP: efficient haplotyping for future generation sequencing.
Bracciali, Andrea; Aldinucci, Marco; Patterson, Murray; Marschall, Tobias; Pisanti, Nadia; Merelli, Ivan; Torquati, Massimo
2016-09-22
Haplotype phasing is an important problem in the analysis of genomics information. Given a set of DNA fragments of an individual, it consists of determining which one of the possible alleles (alternative forms of a gene) each fragment comes from. Haplotype information is relevant to gene regulation, epigenetics, genome-wide association studies, evolutionary and population studies, and the study of mutations. Haplotyping is currently addressed as an optimisation problem aiming at solutions that minimise, for instance, error correction costs, where costs are a measure of the confidence in the accuracy of the information acquired from DNA sequencing. Solutions have typically an exponential computational complexity. WHATSHAP is a recent optimal approach which moves computational complexity from DNA fragment length to fragment overlap, i.e., coverage, and is hence of particular interest when considering sequencing technology's current trends that are producing longer fragments. Given the potential relevance of efficient haplotyping in several analysis pipelines, we have designed and engineered PWHATSHAP, a parallel, high-performance version of WHATSHAP. PWHATSHAP is embedded in a toolkit developed in Python and supports genomics datasets in standard file formats. Building on WHATSHAP, PWHATSHAP exhibits the same complexity exploring a number of possible solutions which is exponential in the coverage of the dataset. The parallel implementation on multi-core architectures allows for a relevant reduction of the execution time for haplotyping, while the provided results enjoy the same high accuracy as that provided by WHATSHAP, which increases with coverage. Due to its structure and management of the large datasets, the parallelisation of WHATSHAP posed demanding technical challenges, which have been addressed exploiting a high-level parallel programming framework. The result, PWHATSHAP, is a freely available toolkit that improves the efficiency of the analysis of genomics
Rubio, Justin P.; Bahlo, Melanie; Butzkueven, Helmut; van der Mei, Ingrid A. F.; Sale, Michèle M.; Dickinson, Joanne L.; Groom, Patricia; Johnson, Laura J.; Simmons, Rex D.; Tait, Brian; Varney, Mike; Taylor, Bruce; Dwyer, Terence; Williamson, Robert; Gough, Nicholas M.; Kilpatrick, Trevor J.; Speed, Terence P.; Foote, Simon J.
2002-01-01
Association of multiple sclerosis (MS) with the human leukocyte antigen (HLA) class II haplotype DRB1*1501-DQB1*0602 is the most consistently replicated finding of genetic studies of the disease. However, the high level of linkage disequilibrium (LD) in the HLA region has hindered the identification of other loci that single-marker tests for association are unlikely to resolve. In order to address this issue, we generated haplotypes spanning 14.754 Mb (5 cM) across the entire HLA region. The haplotypes, which were inferred by genotyping relatives of 152 patients with MS and 105 unaffected control subjects of Tasmanian ancestry, define a genomic segment from D6S276 to D6S291, including 13 microsatellite markers integrated with allele-typing data for DRB1 and DQB1. Association to the DRB1*1501-DQB1*0602 haplotype was replicated. In addition, we found that the class I/extended class I region, defined by a genomic segment of ∼400 kb between MOGCA and D6S265, harbors genes that independently increase risk of, or provide protection from, MS. Log-linear modeling analysis of constituent haplotypes that represent genomic regions containing class I (MOGCA-D6S265), class III (TNFa-TNFd-D6S273), and class II (DRB1-DQB1) genes indicated that having class I and class II susceptibility variants on the same haplotype provides an additive effect on risk. Moreover, we found no evidence for a disease locus in the class III region defined by a 150-kb genomic segment containing the TNF locus and 14 other genes. A global overview of LD performed using GOLD identified two discrete blocks of LD in the HLA region that correspond well with previous findings. We propose that the analysis of haplotypes, by use of the types of approaches outlined in the present article, should make it possible to more accurately define the contribution of the HLA to MS. PMID:11923913
Fully Integrated Passive UHF RFID Tag for Hash-Based Mutual Authentication Protocol.
Mikami, Shugo; Watanabe, Dai; Li, Yang; Sakiyama, Kazuo
2015-01-01
Passive radio-frequency identification (RFID) tag has been used in many applications. While the RFID market is expected to grow, concerns about security and privacy of the RFID tag should be overcome for the future use. To overcome these issues, privacy-preserving authentication protocols based on cryptographic algorithms have been designed. However, to the best of our knowledge, evaluation of the whole tag, which includes an antenna, an analog front end, and a digital processing block, that runs authentication protocols has not been studied. In this paper, we present an implementation and evaluation of a fully integrated passive UHF RFID tag that runs a privacy-preserving mutual authentication protocol based on a hash function. We design a single chip including the analog front end and the digital processing block. We select a lightweight hash function supporting 80-bit security strength and a standard hash function supporting 128-bit security strength. We show that when the lightweight hash function is used, the tag completes the protocol with a reader-tag distance of 10 cm. Similarly, when the standard hash function is used, the tag completes the protocol with the distance of 8.5 cm. We discuss the impact of the peak power consumption of the tag on the distance of the tag due to the hash function.
Fully Integrated Passive UHF RFID Tag for Hash-Based Mutual Authentication Protocol
Mikami, Shugo; Watanabe, Dai; Li, Yang; Sakiyama, Kazuo
2015-01-01
Passive radio-frequency identification (RFID) tag has been used in many applications. While the RFID market is expected to grow, concerns about security and privacy of the RFID tag should be overcome for the future use. To overcome these issues, privacy-preserving authentication protocols based on cryptographic algorithms have been designed. However, to the best of our knowledge, evaluation of the whole tag, which includes an antenna, an analog front end, and a digital processing block, that runs authentication protocols has not been studied. In this paper, we present an implementation and evaluation of a fully integrated passive UHF RFID tag that runs a privacy-preserving mutual authentication protocol based on a hash function. We design a single chip including the analog front end and the digital processing block. We select a lightweight hash function supporting 80-bit security strength and a standard hash function supporting 128-bit security strength. We show that when the lightweight hash function is used, the tag completes the protocol with a reader-tag distance of 10 cm. Similarly, when the standard hash function is used, the tag completes the protocol with the distance of 8.5 cm. We discuss the impact of the peak power consumption of the tag on the distance of the tag due to the hash function. PMID:26491714
Recent Advances in Experimental Whole Genome Haplotyping Methods
Huang, Mengting; Lu, Zuhong
2017-01-01
Haplotype plays a vital role in diverse fields; however, the sequencing technologies cannot resolve haplotype directly. Pioneers demonstrated several approaches to resolve haplotype in the early years, which was extensively reviewed. Since then, numerous methods have been developed recently that have significantly improved phasing performance. Here, we review experimental methods that have emerged mainly over the past five years, and categorize them into five classes according to their maximum scale of contiguity: (i) encapsulation, (ii) 3D structure capture and construction, (iii) compartmentalization, (iv) fluorography, (v) long-read sequencing. Several subsections of certain methods are attached to each class as instances. We also discuss the relative advantages and disadvantages of different classes and make comparisons among representative methods of each class. PMID:28891974
Haplotypic Background of a Private Allele at High Frequency in the Americas
Schroeder, Kari B.; Jakobsson, Mattias; Crawford, Michael H.; Schurr, Theodore G.; Boca, Simina M.; Conrad, Donald F.; Tito, Raul Y.; Osipova, Ludmilla P.; Tarskaia, Larissa A.; Zhadanov, Sergey I.; Wall, Jeffrey D.; Pritchard, Jonathan K.; Malhi, Ripan S.; Smith, David G.; Rosenberg, Noah A.
2009-01-01
Recently, the observation of a high-frequency private allele, the 9-repeat allele at microsatellite D9S1120, in all sampled Native American and Western Beringian populations has been interpreted as evidence that all modern Native Americans descend primarily from a single founding population. However, this inference assumed that all copies of the 9-repeat allele were identical by descent and that the geographic distribution of this allele had not been influenced by natural selection. To investigate whether these assumptions are satisfied, we genotyped 34 single nucleotide polymorphisms across ∼500 kilobases (kb) around D9S1120 in 21 Native American and Western Beringian populations and 54 other worldwide populations. All chromosomes with the 9-repeat allele share the same haplotypic background in the vicinity of D9S1120, suggesting that all sampled copies of the 9-repeat allele are identical by descent. Ninety-one percent of these chromosomes share the same 76.26 kb haplotype, which we call the “American Modal Haplotype” (AMH). Three observations lead us to conclude that the high frequency and widespread distribution of the 9-repeat allele are unlikely to be the result of positive selection: 1) aside from its association with the 9-repeat allele, the AMH does not have a high frequency in the Americas, 2) the AMH is not unusually long for its frequency compared with other haplotypes in the Americas, and 3) in Latin American mestizo populations, the proportion of Native American ancestry at D9S1120 is not unusual compared with that observed at other genomewide microsatellites. Using a new method for estimating the time to the most recent common ancestor (MRCA) of all sampled copies of an allele on the basis of an estimate of the length of the genealogy descended from the MRCA, we calculate the mean time to the MRCA of the 9-repeat allele to be between 7,325 and 39,900 years, depending on the demographic model used. The results support the hypothesis that all
Wone, Bernard W M; Yim, Won C; Schutz, Heidi; Meek, Thomas H; Garland, Theodore
2018-04-04
Mitochondrial haplotypes have been associated with human and rodent phenotypes, including nonshivering thermogenesis capacity, learning capability, and disease risk. Although the mammalian mitochondrial D-loop is highly polymorphic, D-loops in laboratory mice are identical, and variation occurs elsewhere mainly between nucleotides 9820 and 9830. Part of this region codes for the tRNA Arg gene and is associated with mitochondrial densities and number of mtDNA copies. We hypothesized that the capacity for high levels of voluntary wheel-running behavior would be associated with mitochondrial haplotype. Here, we analyzed the mtDNA polymorphic region in mice from each of four replicate lines selectively bred for 54 generations for high voluntary wheel running (HR) and from four control lines (Control) randomly bred for 54 generations. Sequencing the polymorphic region revealed a variable number of adenine repeats. Single nucleotide polymorphisms (SNPs) varied from 2 to 3 adenine insertions, resulting in three haplotypes. We found significant genetic differentiations between the HR and Control groups (F st = 0.779, p ≤ 0.0001), as well as among the replicate lines of mice within groups (F sc = 0.757, p ≤ 0.0001). Haplotypes, however, were not strongly associated with voluntary wheel running (revolutions run per day), nor with either body mass or litter size. This system provides a useful experimental model to dissect the physiological processes linking mitochondrial, genomic SNPs, epigenetics, or nuclear-mitochondrial cross-talk to exercise activity. Copyright © 2018. Published by Elsevier B.V.
Liao, Qing-Chuan; Li, Xiao-Lei; Liu, Si-Ting; Zhang, Yong; Li, Tian-Yuan; Qiu, Jin-Chun
2012-07-01
To investigate the association between single nucleotide polymorphisms (SNP) and its haplotypes of methylenetetrahydrofolate reductase (MTHFR) gene with high dose methotrexate (HDMTX)-induced toxicity in children with acute lymphoblastic leukemia (ALL). HDMTX-treated children with ALL (1.2 to 14-years old) were selected from inpatient and followed for a retrospective study. The toxicity response of HDMTX chemotherapy was evaluated using WHO common toxicity criteria. Sixty-one patients with therapy-related toxicity and 36 patients without therapy-related toxicity were genotyped for 2 SNP (677C > T and 1298A > C) of the MTHFR gene by polymerase chain reaction-restriction fragment length polymorphism. Frequency of haplotypes and linkage disequilibrium of MTHFR gene were analyzed by SHEsis program. The distribution of MTHFR gene 677C > T polymorphism did not appeare different between groups with or without toxicity response (χ(2) = 4.609, P = 0.100), but the 1298A > C polymorphism was significantly different (χ(2) = 10.192, P = 0.006). Individuals who carried C allele (AC + CC genotype) had a decreased risk of toxicity response compared to AA genotype (OR = 0.245, 95%CI: 0.099 - 0.607, P = 0.002). 677C > T and 1298A > C polymorphisms showed strong linkage disequilibrium (D' = 0.895). The CC haplotype was significantly associated with decreased risk of toxicity response (OR = 0.338, 95%CI: 0.155 - 0.738, P = 0.005), while the TA haplotype was significantly associated with the increased risk of toxicity response (OR = 1.907, 95%CI: 1.045 - 3.482, P = 0.035). MTHFR gene 1298C allele and CC haplotype might serve as protective factors while TA haplotype as a risk factor for the susceptibility to toxicity response of HDMTX chemotherapy in children with ALL.
Globally dispersed Y chromosomal haplotypes in wild and domestic sheep.
Meadows, J R S; Hanotte, O; Drögemüller, C; Calvo, J; Godfrey, R; Coltman, D; Maddox, J F; Marzanov, N; Kantanen, J; Kijas, J W
2006-10-01
To date, investigations of genetic diversity and the origins of domestication in sheep have utilised autosomal microsatellites and variation in the mitochondrial genome. We present the first analysis of both domestic and wild sheep using genetic markers residing on the ovine Y chromosome. Analysis of a single nucleotide polymorphism (oY1) in the SRY promoter region revealed that allele A-oY1 was present in all wild bighorn sheep (Ovis canadensis), two subspecies of thinhorn sheep (Ovis dalli), European Mouflon (Ovis musimon) and the Barbary (Ammontragis lervia). A-oY1 also had the highest frequency (71.4%) within 458 domestic sheep drawn from 65 breeds sampled from Africa, Asia, Australia, the Caribbean, Europe, the Middle East and Central Asia. Sequence analysis of a second locus, microsatellite SRYM18, revealed a compound repeat array displaying fixed differences, which identified bighorn and thinhorn sheep as distinct from the European Mouflon and domestic animals. Combined genotypic data identified 11 male-specific haplotypes that represented at least two separate lineages. Investigation of the geographical distribution of each haplotype revealed that one (H6) was both very common and widespread in the global sample of domestic breeds. The remaining haplotypes each displayed more restricted and informative distributions. For example, H5 was likely founded following the domestication of European breeds and was used to trace the recent transportation of animals to both the Caribbean and Australia. A high rate of Y chromosomal dispersal appears to have taken place during the development of domestic sheep as only 12.9% of the total observed variation was partitioned between major geographical regions.
Kunihisa, Miyuki; Moriya, Shigeki; Abe, Kazuyuki; Okada, Kazuma; Haji, Takashi; Hayashi, Takeshi; Kawahara, Yoshihiro; Itoh, Ryutaro; Itoh, Takeshi; Katayose, Yuichi; Kanamori, Hiroyuki; Matsumoto, Toshimi; Mori, Satomi; Sasaki, Harumi; Matsumoto, Takashi; Nishitani, Chikako; Terakami, Shingo; Yamamoto, Toshiya
2016-01-01
‘Fuji’ is one of the most popular and highly-produced apple cultivars worldwide, and has been frequently used in breeding programs. The development of genotypic markers for the preferable phenotypes of ‘Fuji’ is required. Here, we aimed to define the haplotypes of ‘Fuji’ and find associations between haplotypes and phenotypes of five traits (harvest day, fruit weight, acidity, degree of watercore, and flesh mealiness) by using 115 accessions related to ‘Fuji’. Through the re-sequencing of ‘Fuji’ genome, total of 2,820,759 variants, including single nucleotide polymorphisms (SNPs) and insertions or deletions (indels) were detected between ‘Fuji’ and ‘Golden Delicious’ reference genome. We selected mapping-validated 1,014 SNPs, most of which were heterozygous in ‘Fuji’ and capable of distinguishing alleles inherited from the parents of ‘Fuji’ (i.e., ‘Ralls Janet’ and ‘Delicious’). We used these SNPs to define the haplotypes of ‘Fuji’ and trace their inheritance in relatives, which were shown to have an average of 27% of ‘Fuji’ genome. Analysis of variance (ANOVA) based on ‘Fuji’ haplotypes identified one quantitative trait loci (QTL) each for harvest time, acidity, degree of watercore, and mealiness. A haplotype from ‘Delicious’ chr14 was considered to dominantly cause watercore, and one from ‘Ralls Janet’ chr1 was related to low-mealiness. PMID:27795675
Informatics in Radiology: Dual-Energy Electronic Cleansing for Fecal-Tagging CT Colonography
Kim, Se Hyung; Lee, June-Goo; Yoshida, Hiroyuki
2013-01-01
Electronic cleansing (EC) is an emerging technique for the removal of tagged fecal materials at fecal-tagging computed tomographic (CT) colonography. However, existing EC methods may generate various types of artifacts that severely impair the quality of the cleansed CT colonographic images. Dual-energy fecal-tagging CT colonography is regarded as a next-generation imaging modality. EC that makes use of dual-energy fecal-tagging CT colonographic images promises to be effective in reducing cleansing artifacts by means of applying the material decomposition capability of dual-energy CT. The dual-energy index (DEI), which is calculated from the relative change in the attenuation values of a material at two different photon energies, is a reliable and effective indicator for differentiating tagged fecal materials from various types of tissues on fecal-tagging CT colonographic images. A DEI-based dual-energy EC scheme uses the DEI to help differentiate the colonic lumen—including the luminal air, tagged fecal materials, and air-tagging mixture—from the colonic soft-tissue structures, and then segments the entire colonic lumen for cleansing of the tagged fecal materials. As a result, dual-energy EC can help identify partial-volume effects in the air-tagging mixture and inhomogeneous tagging in residual fecal materials, the major causes of EC artifacts. This technique has the potential to significantly improve the quality of EC and promises to provide images of a cleansed colon that are free of the artifacts commonly observed with conventional single-energy EC methods. © RSNA, 2013 PMID:23479680
De novo assembly of a haplotype-resolved human genome.
Cao, Hongzhi; Wu, Honglong; Luo, Ruibang; Huang, Shujia; Sun, Yuhui; Tong, Xin; Xie, Yinlong; Liu, Binghang; Yang, Hailong; Zheng, Hancheng; Li, Jian; Li, Bo; Wang, Yu; Yang, Fang; Sun, Peng; Liu, Siyang; Gao, Peng; Huang, Haodong; Sun, Jing; Chen, Dan; He, Guangzhu; Huang, Weihua; Huang, Zheng; Li, Yue; Tellier, Laurent C A M; Liu, Xiao; Feng, Qiang; Xu, Xun; Zhang, Xiuqing; Bolund, Lars; Krogh, Anders; Kristiansen, Karsten; Drmanac, Radoje; Drmanac, Snezana; Nielsen, Rasmus; Li, Songgang; Wang, Jian; Yang, Huanming; Li, Yingrui; Wong, Gane Ka-Shu; Wang, Jun
2015-06-01
The human genome is diploid, and knowledge of the variants on each chromosome is important for the interpretation of genomic information. Here we report the assembly of a haplotype-resolved diploid genome without using a reference genome. Our pipeline relies on fosmid pooling together with whole-genome shotgun strategies, based solely on next-generation sequencing and hierarchical assembly methods. We applied our sequencing method to the genome of an Asian individual and generated a 5.15-Gb assembled genome with a haplotype N50 of 484 kb. Our analysis identified previously undetected indels and 7.49 Mb of novel coding sequences that could not be aligned to the human reference genome, which include at least six predicted genes. This haplotype-resolved genome represents the most complete de novo human genome assembly to date. Application of our approach to identify individual haplotype differences should aid in translating genotypes to phenotypes for the development of personalized medicine.
Honey bee-inspired algorithms for SNP haplotype reconstruction problem
NASA Astrophysics Data System (ADS)
PourkamaliAnaraki, Maryam; Sadeghi, Mehdi
2016-03-01
Reconstructing haplotypes from SNP fragments is an important problem in computational biology. There have been a lot of interests in this field because haplotypes have been shown to contain promising data for disease association research. It is proved that haplotype reconstruction in Minimum Error Correction model is an NP-hard problem. Therefore, several methods such as clustering techniques, evolutionary algorithms, neural networks and swarm intelligence approaches have been proposed in order to solve this problem in appropriate time. In this paper, we have focused on various evolutionary clustering techniques and try to find an efficient technique for solving haplotype reconstruction problem. It can be referred from our experiments that the clustering methods relying on the behaviour of honey bee colony in nature, specifically bees algorithm and artificial bee colony methods, are expected to result in more efficient solutions. An application program of the methods is available at the following link. http://www.bioinf.cs.ipm.ir/software/haprs/
Short communication: casein haplotype variability in sicilian dairy goat breeds.
Gigli, I; Maizon, D O; Riggio, V; Sardina, M T; Portolano, B
2008-09-01
In the Mediterranean region, goat milk production is an important economic activity. In the present study, 4 casein genes were genotyped in 5 Sicilian goat breeds to 1) identify casein haplotypes present in the Argentata dell'Etna, Girgentana, Messinese, Derivata di Siria, and Maltese goat breeds; and 2) describe the structure of the Sicilian goat breeds based on casein haplotypes and allele frequencies. In a sample of 540 dairy goats, 67 different haplotypes with frequency >or=0.01 and 27 with frequency >or=0.03 were observed. The most common CSN1S1-CSN2-CSN1S2-CSN3 haplotype for Derivata di Siria and Maltese was FCFB (0.17 and 0.22, respectively), whereas for Argentata dell'Etna, Girgentana and Messinese was ACAB (0.06, 0.23, and 0.10, respectively). According to the haplotype reconstruction, Argentata dell'Etna, Girgentana, and Messinese breeds presented the most favorable haplotype for cheese production, because the casein concentration in milk of these breeds might be greater than that in Derivata di Siria and Maltese breeds. Based on a cluster analysis, the breeds formed 2 main groups: Derivata di Siria, and Maltese in one group, and Argentata dell'Etna and Messinese in the other; the Girgentana breed was between these groups but closer to the latter.
Schöning, Caspar
2017-01-01
Understanding the genetic basis of adaption is a central task in biology. Populations of the honey bee Apis mellifera that inhabit the mountain forests of East Africa differ in behavior and morphology from those inhabiting the surrounding lowland savannahs, which likely reflects adaptation to these habitats. We performed whole genome sequencing on 39 samples of highland and lowland bees from two pairs of populations to determine their evolutionary affinities and identify the genetic basis of these putative adaptations. We find that in general, levels of genetic differentiation between highland and lowland populations are very low, consistent with them being a single panmictic population. However, we identify two loci on chromosomes 7 and 9, each several hundred kilobases in length, which exhibit near fixation for different haplotypes between highland and lowland populations. The highland haplotypes at these loci are extremely rare in samples from the rest of the world. Patterns of segregation of genetic variants suggest that recombination between haplotypes at each locus is suppressed, indicating that they comprise independent structural variants. The haplotype on chromosome 7 harbors nearly all octopamine receptor genes in the honey bee genome. These have a role in learning and foraging behavior in honey bees and are strong candidates for adaptation to highland habitats. Molecular analysis of a putative breakpoint indicates that it may disrupt the coding sequence of one of these genes. Divergence between the highland and lowland haplotypes at both loci is extremely high suggesting that they are ancient balanced polymorphisms that greatly predate divergence between the extant honey bee subspecies. PMID:28542163
Vinkers, Christiaan H; Joëls, Marian; Milaneschi, Yuri; Gerritsen, Lotte; Kahn, René S; Penninx, Brenda W J H; Boks, Marco P M
2015-04-01
The MR is an important regulator of the hypothalamic-pituitary-adrenal (HPA) axis and a prime target for corticosteroids. There is increasing evidence from both clinical and preclinical studies that the MR has different effects on behavior and mood in males and females. To investigate the hypothesis that the MR sex-dependently influences the relation between childhood maltreatment and depression, we investigated three common and functional MR haplotypes (GA, CA, and CG haplotype, based on rs5522 and rs2070951) in a population-based cohort (N = 665) and an independent clinical cohort from the Netherlands Study of Depression and Anxiety (NESDA) (N = 1639). The CA haplotype sex-dependently moderated the relation between childhood maltreatment and depressive symptoms both in the population-based sample (sex × maltreatment × haplotype: β = -4.07, P = 0.029) and in the clinical sample (sex × maltreatment × haplotype, β = -2.40, P = 0.011). Specifically, female individuals in the population-based sample were protected (β = -4.58, P = 2.0 e(-5)), whereas males in the clinical sample were at increased risk (β = 2.54, P = 0.0022). In line with these results, female GA haplotype carriers displayed increased vulnerability in the population-based sample (β = 4.58, P = 7.5 e(-5)) whereas male CG-carriers showed increased resilience in the clinical sample (β = -2.71, P = 0.016). Consistently, we found a decreased lifetime MDD risk for male GA haplotype carriers following childhood maltreatment but an increased risk for male CA haplotype carriers in the clinical sample. In both samples, sex-dependent effects were observed for GA-GA diplotype carriers. In summary, sex plays an important role in determining whether functional genetic variation in MR is beneficial or detrimental, with an apparent female advantage for the CA haplotype but male advantage for the GA and CG haplotype. These sex-dependent effects of MR on depression susceptibility following childhood
Landgren, Sara; Jerlhag, Elisabet; Zetterberg, Henrik; Gonzalez-Quintela, Arturo; Campos, Joaquin; Olofsson, Ulrica; Nilsson, Staffan; Blennow, Kaj; Engel, Jörgen A
2008-12-01
Ghrelin, an orexigenic peptide, acts on growth hormone secretagogue receptors (GHS-R1A), expressed in the hypothalamus as well as in important reward nodes such as the ventral tegmental area. Interestingly, ghrelin has been found to activate an important part of the reward systems, i.e., the cholinergic-dopaminergic reward link. Additionally, the rewarding and neurochemical properties of alcohol are, at least in part, mediated via this reward link. There is comorbidity between alcohol dependence and eating disorders. Thus, plasma levels of ghrelin are altered in patients with addictive behaviors such as alcohol and nicotine dependence and in binge eating disorder. This overlap prompted as to investigate the pro-ghrelin and GHS-R1A genes in a haplotype analysis of heavy alcohol-using individuals. A total of 417 Spanish individuals (abstainers, moderate, and heavy alcohol drinkers) were investigated in a haplotype analysis of the pro-ghrelin and GHS-R1A genes. Tag SNPs were chosen using HapMap data and the Tagger and Haploview softwares. These SNPs were then genotyped using TaqMan Allelic Discrimination. SNP rs2232165 of the GHS-R1A gene was associated with heavy alcohol consumption and SNP rs2948694 of the same gene as well as haplotypes of both the pro-ghrelin and the GHS-R1A genes were associated with body mass in heavy alcohol consuming individuals. The present findings are the first to disclose an association between the pro-ghrelin and GHS-R1A genes and heavy alcohol use, further strengthening the role of the ghrelin system in addictive behaviors and brain reward.
NASA Astrophysics Data System (ADS)
Jones, B. J. P.; McDonald, A. D.; Nygren, D. R.
2016-12-01
Background rejection is key to success for future neutrinoless double beta decay experiments. To achieve sensitivity to effective Majorana lifetimes of ~ 1028 years, backgrounds must be controlled to better than 0.1 count per ton per year, beyond the reach of any present technology. In this paper we propose a new method to identify the birth of the barium daughter ion in the neutrinoless double beta decay of 136Xe. The method adapts Single Molecule Fluorescent Imaging, a technique from biochemistry research with demonstrated single ion sensitivity. We explore possible SMFI dyes suitable for the problem of barium ion detection in high pressure xenon gas, and develop a fiber-coupled sensing system with which we can detect the presence of bulk Ba++ ions remotely. We show that our sensor produces signal-to-background ratios as high as 85 in response to Ba++ ions when operated in aqueous solution. We then describe the next stage of this R&D program, which will be to demonstrate chelation and fluorescence in xenon gas. If a successful barium ion tag can be developed using SMFI adapted for high pressure xenon gas detectors, the first essentially zero background, ton-scale neutrinoless double beta decay technology could be realized.
Strohmaier, Markus; Körner, Christian; Kern, Roman
2012-12-01
While recent progress has been achieved in understanding the structure and dynamics of social tagging systems, we know little about the underlying user motivations for tagging, and how they influence resulting folksonomies and tags. This paper addresses three issues related to this question. (1) What distinctions of user motivations are identified by previous research, and in what ways are the motivations of users amenable to quantitative analysis? (2) To what extent does tagging motivation vary across different social tagging systems? (3) How does variability in user motivation influence resulting tags and folksonomies? In this paper, we present measures to detect whether a tagger is primarily motivated by categorizing or describing resources, and apply these measures to datasets from seven different tagging systems. Our results show that (a) users' motivation for tagging varies not only across, but also within tagging systems, and that (b) tag agreement among users who are motivated by categorizing resources is significantly lower than among users who are motivated by describing resources . Our findings are relevant for (1) the development of tag-based user interfaces, (2) the analysis of tag semantics and (3) the design of search algorithms for social tagging systems.
Strohmaier, Markus; Körner, Christian; Kern, Roman
2012-01-01
While recent progress has been achieved in understanding the structure and dynamics of social tagging systems, we know little about the underlying user motivations for tagging, and how they influence resulting folksonomies and tags. This paper addresses three issues related to this question. (1) What distinctions of user motivations are identified by previous research, and in what ways are the motivations of users amenable to quantitative analysis? (2) To what extent does tagging motivation vary across different social tagging systems? (3) How does variability in user motivation influence resulting tags and folksonomies? In this paper, we present measures to detect whether a tagger is primarily motivated by categorizing or describing resources, and apply these measures to datasets from seven different tagging systems. Our results show that (a) users’ motivation for tagging varies not only across, but also within tagging systems, and that (b) tag agreement among users who are motivated by categorizing resources is significantly lower than among users who are motivated by describing resources. Our findings are relevant for (1) the development of tag-based user interfaces, (2) the analysis of tag semantics and (3) the design of search algorithms for social tagging systems. PMID:23471473
Tag retention, growth, and survival of red swamp crayfish marked with a visible implant tag
Isely, J.J.; Stockett, P.E.
2001-01-01
Eighty juvenile (means: 42.4 mm total length, 1.6 g) red swamp crayfish Procambarus clarkii were implanted with sequentially numbered visible implant tags and held in the laboratory. Tags were injected transversely into the musculature just beneath the exoskeleton of the third abdominal segment from the cephalothorax; tags were visible upon inspection. An additional 20 crayfish were left untagged and served as controls. After 150 d, tag retention was 80% and all tags were readable. No tagged crayfish died during the study, and no differences in total length or weight were detected between tagged and control crayfish. All individuals molted at least three times during the 150-d study, and some individuals molted up to six times, suggesting that most tags would be permanently retained. The readability in the field without specialized equipment makes the visible implant tag ideal for studies of crayfish ecology, management, and culture.
Fitchi: haplotype genealogy graphs based on the Fitch algorithm.
Matschiner, Michael
2016-04-15
: In population genetics and phylogeography, haplotype genealogy graphs are important tools for the visualization of population structure based on sequence data. In this type of graph, node sizes are often drawn in proportion to haplotype frequencies and edge lengths represent the minimum number of mutations separating adjacent nodes. I here present Fitchi, a new program that produces publication-ready haplotype genealogy graphs based on the Fitch algorithm. http://www.evoinformatics.eu/fitchi.htm : michaelmatschiner@mac.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Aptamer-based downstream processing of his-tagged proteins utilizing magnetic beads.
Kökpinar, Öznur; Walter, Johanna-Gabriela; Shoham, Yuval; Stahl, Frank; Scheper, Thomas
2011-10-01
Aptamers are synthetic nucleic acid-based high affinity ligands that are able to capture their corresponding target via molecular recognition. Here, aptamer-based affinity purification for His-tagged proteins was developed. Two different aptamers directed against the His-tag were immobilized on magnetic beads covalently. The resulting aptamer-modified magnetic beads were characterized and successfully applied for purification of different His-tagged proteins from complex E. coli cell lysates. Purification effects comparable to conventional immobilized metal affinity chromatography were achieved in one single purification step. Moreover, we have investigated the possibility to regenerate and reuse the aptamer-modified magnetic beads and have shown their long-term stability over a period of 6 months. Copyright © 2011 Wiley Periodicals, Inc.
Polymorphism at Expressed DQ and DR Loci in Five Common Equine MHC Haplotypes
Miller, Donald; Tallmadge, Rebecca L.; Binns, Matthew; Zhu, Baoli; Mohamoud, Yasmin Ali; Ahmed, Ayeda; Brooks, Samantha A.; Antczak, Douglas F.
2016-01-01
The polymorphism of Major Histocompatibility Complex (MHC) class II DQ and DR genes in five common Equine Leukocyte Antigen (ELA) haplotypes was determined through sequencing of mRNA transcripts isolated from lymphocytes of eight ELA homozygous horses. Ten expressed MHC class II genes were detected in horses of the ELA-A3 haplotype carried by the donor horses of the equine Bacterial Artificial Chromosome (BAC) library and the reference genome sequence: four DR genes and six DQ genes. The other four ELA haplotypes contained at least eight expressed polymorphic MHC class II loci. Next Generation Sequencing (NGS) of genomic DNA of these four MHC haplotypes revealed stop codons in the DQA3 gene in the ELA-A2, ELA-A5, and ELA-A9 haplotypes. Few NGS reads were obtained for the other MHC class II genes that were not amplified in these horses. The amino acid sequences across haplotypes contained locus-specific residues, and the locus clusters produced by phylogenetic analysis were well supported. The MHC class II alleles within the five tested haplotypes were largely non-overlapping between haplotypes. The complement of equine MHC class II DQ and DR genes appears to be well conserved between haplotypes, in contrast to the recently described variation in class I gene loci between equine MHC haplotypes. The identification of allelic series of equine MHC class II loci will aid comparative studies of mammalian MHC conservation and evolution and may also help to interpret associations between the equine MHC class II region and diseases of the horse. PMID:27889800
Multi-Threaded DNA Tag/Anti-Tag Library Generator for Multi-Core Platforms
2009-05-01
base pair) Watson ‐ Crick strand pairs that bind perfectly within pairs, but poorly across pairs. A variety of DNA strand hybridization metrics...AFRL-RI-RS-TR-2009-131 Final Technical Report May 2009 MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE PLATFORMS...TYPE Final 3. DATES COVERED (From - To) Jun 08 – Feb 09 4. TITLE AND SUBTITLE MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE
Moldes, Cristina; García, José L; García, Pedro
2004-08-01
The thermophilic inorganic pyrophosphatase (Pyr) from Thermus thermophilus has been produced in Escherichia coli fused to the C terminus of the choline-binding tag (ChB tag) derived from the choline-binding domain (ChBD) of pneumococcal LytA autolysin. The chimeric ChBD-Pyr protein retains its thermostable activity and can be purified in a single step by DEAE-cellulose affinity chromatography. Pyr can be further released from the ChBD by thrombin, using the specific protease recognition site incorporated in the C terminus of this tag. Remarkably, the ChB tag provides a selective and very strong thermostable noncovalent immobilization of ChBD-Pyr in the DEAE-cellulose matrix. The binding of choline or choline analogues, such as DEAE, confers a high thermal stability to this tag; therefore, the immobilized chimeric enzyme can be assayed at high temperature without protein leakage, demonstrating the usefulness of the ChB tag for noncovalent immobilization of thermophilic proteins. Moreover, ChBD-Pyr can be purified and immobilized in a single step on commercial DEAE-cellulose paper. The affinity of the ChB tag for this versatile solid support can be very helpful in developing many biotechnological applications.
efficient association study design via power-optimized tag SNP selection
HAN, BUHM; KANG, HYUN MIN; SEO, MYEONG SEONG; ZAITLEN, NOAH; ESKIN, ELEAZAR
2008-01-01
Discovering statistical correlation between causal genetic variation and clinical traits through association studies is an important method for identifying the genetic basis of human diseases. Since fully resequencing a cohort is prohibitively costly, genetic association studies take advantage of local correlation structure (or linkage disequilibrium) between single nucleotide polymorphisms (SNPs) by selecting a subset of SNPs to be genotyped (tag SNPs). While many current association studies are performed using commercially available high-throughput genotyping products that define a set of tag SNPs, choosing tag SNPs remains an important problem for both custom follow-up studies as well as designing the high-throughput genotyping products themselves. The most widely used tag SNP selection method optimizes over the correlation between SNPs (r2). However, tag SNPs chosen based on an r2 criterion do not necessarily maximize the statistical power of an association study. We propose a study design framework that chooses SNPs to maximize power and efficiently measures the power through empirical simulation. Empirical results based on the HapMap data show that our method gains considerable power over a widely used r2-based method, or equivalently reduces the number of tag SNPs required to attain the desired power of a study. Our power-optimized 100k whole genome tag set provides equivalent power to the Affymetrix 500k chip for the CEU population. For the design of custom follow-up studies, our method provides up to twice the power increase using the same number of tag SNPs as r2-based methods. Our method is publicly available via web server at http://design.cs.ucla.edu. PMID:18702637
HapMap tagSNP transferability in multiple populations: general guidelines
Xing, Jinchuan; Witherspoon, David J.; Watkins, W. Scott; Zhang, Yuhua; Tolpinrud, Whitney; Jorde, Lynn B.
2008-01-01
This PDF receipt will only be used as the basis for generating PubMed Central (PMC) documents. PMC documents will be made available for review after conversion (approx. 2–3 weeks time). Any corrections that need to be made will be done at that time. No materials will be released to PMC without the approval of an author. Only the PMC documents will appear on PubMed Central -- this PDF Receipt will not appear on PubMed Central. Linkage disequilibrium (LD) has received much recent attention because of its value in localizing disease-causing genes. Due to the extensive LD between neighboring loci in the human genome, it is believed that a subset of the single nucleotide polymorphisms in a region (tagSNPs) can be selected to capture most of the remaining SNP variants. In this study, we examined LD patterns and HapMap tagSNP transferability in more than 300 individuals. A South Indian and an African Mbuti Pygmy population sample were included to evaluate the performance of HapMap tagSNPs in geographically distinct and genetically isolated populations. Our results show that HapMap tagSNPs selected with r2 >= 0.8 can capture more than 85% of the SNPs in populations that are from the same continental group. Combined tagSNPs from HapMap CEU and CHB+JPT serve as the best reference for the Indian sample. The HapMap YRI are a sufficient reference for tagSNP selection in the Pygmy sample. In addition to our findings, we reviewed over 25 recent studies of tagSNP transferability and propose a general guideline for selecting tagSNPs from HapMap populations. PMID:18482828
Association of HLA haplotype with alopecia areata in Chinese Hans.
Xiao, F-L; Ye, D-Q; Yang, S; Zhou, F-S; Zhou, S-M; Zhu, Y-G; Liang, Y-H; Ren, Y-Q; Zhang, X-J
2006-11-01
Some studies have shown discrepancies in human leucocyte antigen (HLA) associated with alopecia areata (AA) between different ethnic populations. To investigate whether HLA-I, -DQA1 and -DQB1 alleles and the HLA haplotype are associated with AA, and the correlation between the HLA haplotype profile, age of onset and severity of AA in Chinese Hans. The polymerase chain reaction-sequence specific primer (PCR-SSP) method was used to analyse the frequencies of HLA class I, -DQA1 and -DQB1 alleles in 192 patients with AA and 252 controls in Chinese Hans. The linkage disequilibrium was calculated using the 2 x 2 table. The 24 two-locus haplotypes [including A*02-B*18, A*02-B*27, A*02-B*52, A*02-Cw*0704, A*02-DQA1*0104, A*02-DQB1*0604, A*02-DQB1*0606, B*18-Cw*0704, B*18-DQA1*0104, B*18-DQA1*0302, B*18-DQB1*0606, B*27-Cw*0704, B*27-DQA1*0104, B*27-DQA1*0302, B*52-Cw*0704, B*52-DQA1*0104, B*52-DQA1*0302, B52-DQB1*0606, Cw*0704-DQA1*0104, Cw*0704-DQA1*0302, Cw*0704-DQB1*0606, DQA1*0104-DQB1*0604, DQA1*0104-DQB1*0606, DQA1*0302-DQB1*0606 (P<0.05)] were associated with AA, while eight extended haplotypes (A*02-B*18-DQA1*0104, A*02-B*27-DQA1*0104, A*02-B*52-DQA1*0104, A*02-B*52-DQA1*0302, A*02-B*52-DQB1*0606, B*52-Cw*0704-DQA1*0104, B*52-Cw*0704-DQA1*0302, A*02-B*52-DQA1*0302-DQB1*0606) were found to be related to AA in Chinese Hans. Through stratified analysis, we found that the extended haplotype B*52-Cw*0704-DQA1*0302 was related to early onset of AA, and no haplotype was only associated with severe AA. This is the first detailed report to elucidate HLA haplotypes associated with AA and that demonstrates the significant HLA haplotypes in Chinese Hans AA. The haplotype B*52-Cw*0704-DQA1*0302 was identified to be related to early onset of AA. Our results provide some information for future research on predisposing genes in HLA regions in Chinese Hans.
Dimensional Anxiety Mediates Linkage of GABRA2 Haplotypes With Alcoholism
Enoch, Mary-Anne; Schwartz, Lori; Albaugh, Bernard; Virkkunen, Matti; Goldman, David
2015-01-01
The GABAAα2 receptor gene (GABRA2) modulates anxiety and stress response. Three recent association studies implicate GABRA2 in alcoholism, however in these papers both common, opposite-configuration haplotypes in the region distal to intron3 predict risk. We have now replicated the GABRA2 association with alcoholism in 331 Plains Indian men and women and 461 Finnish Caucasian men. Using a dimensional measure of anxiety, harm avoidance (HA), we also found that the association with alcoholism is mediated, or moderated, by anxiety. Nine SNPs were genotyped revealing two haplotype blocks. Within the previously implicated block 2 region, we identified the two common, opposite-configuration risk haplotypes, A and B. Their frequencies differed markedly in Finns and Plains Indians. In both populations, most block 2 SNPs were significantly associated with alcoholism. The associations were due to increased frequencies of both homozygotes in alcoholics, indicating the possibility of alcoholic subtypes with opposite genotypes. Congruently, there was no significant haplotype association. Using HA as an indicator variable for anxiety, we found haplotype linkage to alcoholism with high and low dimensional anxiety, and to HA itself, in both populations. High HA alcoholics had the highest frequency of the more abundant haplotype (A in Finns, B in Plains Indians); low HA alcoholics had the highest frequency of the less abundant haplotype (B in Finns, A in Plains Indians) (Finns: P α0.007, OR α2.1, Plains Indians: P α0.040, OR α1.9). Non-alcoholics had intermediate frequencies. Our results suggest that within the distal GABRA2 region is a functional locus or loci that may differ between populations but that alters risk for alcoholism via the mediating action of anxiety. PMID:16874763
Identification of single nucleotide polymorphism in ginger using expressed sequence tags
Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J
2009-01-01
Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184
Vázquez-Villamar, M; Palafox-Sánchez, C A; Hernández-Bello, J; Muñoz-Valle, J F; Valle, Y; Cruz, A; Alatorre-Meza, A I; Oregon-Romero, E
2016-11-03
Interleukin 10 (IL-10) is an immunoregulatory cytokine with multiple roles in the immune system. Three single nucleotide polymorphisms at positions -1082 (A>G), -819 (C>T), and -592 (C>A) in the promoter region of the IL10 gene are believed to be associated with different inflammatory, infectious, and autoimmune diseases. These polymorphisms exhibit a strong linkage disequilibrium (LD) and form three principal haplotypes (GCC, ACC, and ATA). The GCC and ATA haplotypes have been associated with high and low levels of IL-10 production, respectively. The aim of this study was to establish the allele and haplotype frequencies of the IL10 polymorphisms in Mestizos from western Mexico. SNPs were analyzed in 340 healthy unrelated Mestizos from western Mexico by polymerase chain reaction-restriction fragment length polymorphism. The studied population presented significant differences, in the distribution of IL10 polymorphisms, from the Asian, African, and European populations. We also observed a strong LD within -1082 A>G, -819 C>T, and -592 C>A (100% pc = 7.735 x 10 -18 ). The haplotypes ACC (45.4%), ATA (22.0%), GTA (14.9%), and GCC (13.9%) were most frequently observed in this population. The haplotype frequencies, however, differed from those reported previously in Mestizos from central Mexico, Asians, Africans, and European Caucasians, suggesting a differential gene flow in the Mexican Mestizo population. This could account for the genetic variability between Mexicans and populations of other ethnicities. The study of these polymorphisms and their haplotypes could help in expanding our knowledge to design future disease-risk studies on the western Mexican population.
Cario, Holger; Schwarz, Klaus; Jorch, Norbert; Kyank, Ulrike; Petrides, Petro E; Schneider, Dominik T; Uhle, Renate; Debatin, Klaus-Michael; Kohne, Elisabeth
2005-01-01
Congenital erythrocytoses or polycythemias are rare and heterogeneous. A homozygous mutation (C598T->Arg200Trp) in the von Hippel-Lindau (VHL) gene was originally identified as the cause of the endemic Chuvash polycythemia. Subsequently this and other mutations in the VHL gene were also detected in several patients of different ethnic origin. Haplotype analyses of the VHL gene suggested a common origin for the Chuvash-type mutation. Thirty-four patients with presumable congenital erythrocytosis due to an unknown underlying disorder were examined for VHL gene mutations and VHL region haplotypes. Four patients were homozygous and one patient heterozygous for the Chuvash-type mutation. One additional patient presented a previously not described heterozygous mutation G311->T VHL in exon 1. The haplotype analyses were in agreement with recently published data for three of the four patients with homozygous mutations as well as for the patient with a heterozygous Chuvash-type mutation. One patient of Turkish origin with homozygous Chuvash-type mutation had a haplotype not previously found in individuals with Chuvash-type mutation. These results confirm that mutations in the VHL gene are responsible for a substantial proportion of patients with congenital erythrocytoses. Erythrocytoses due to a C598->T mutation of the VHL gene are not geographically restricted. The majority of patients with Chuvash polycythemia share a common VHL gene haplotype. The different haplotype in one of the patients with Chuvash-type mutation indicates that this mutation was not spread only from a single founder but developed independently in other individuals.
NASA Astrophysics Data System (ADS)
Schiopu, Paul; Manea, Adrian; Cristea, Ionica; Grosu, Neculai; Vladescu, Marian; Craciun, Anca-Ileana; Craciun, Alexandru
2015-02-01
Minuscule devices, called RFID tags are attached to objects and persons and emit information which positioned readers may capture wirelessly. Many methods of identification have been used, but that of most common is to use a unique serial number for identification of person or object. RFID tags can be characterized as either active or passive [1,2]. Traditional passive tags are typically in "sleep" state until awakened by the reader's emitted field. In passive tags, the reader's field acts to charge the capacitor that powers the badge and this can be a combination of antenna and barcodes obtained with SAW( Surface Acoustic Wave) devices [1,2,3] . The antenna in an RFID tag is a conductive element that permits the tag to exchange data with the reader. The paper contribution are targeted to antenna for passive RFID tags. The electromagnetic field generated by the reader is somehow oriented by the reader antenna and power is induced in the tag only if the orientation of the tag antenna is appropriate. A tag placed orthogonal to the reader yield field will not be read. This is the reason that guided manufacturers to build circular polarized antenna capable of propagating a field that is alternatively polarized on all planes passing on the diffusion axis. Passive RFID tags are operated at the UHF frequencies of 868MHz (Europe) and 915MHz (USA) and at the microwave frequencies of 2,45 GHz and 5,8 GHz . Because the tags are small dimensions, in paper, we present the possibility to use circular polarization microstrip antenna with fractal edge [2].
Futami, K; Valderrama, A; Baldi, M; Minakawa, N; Marín Rodríguez, R; Chaves, L F
2015-04-01
The Asian tiger mosquito, Aedes albopictus (Skuse) (Diptera: Culicidae), is a vector of several human pathogens. Ae. albopictus is also an invasive species that, over recent years, has expanded its range out of its native Asia. Ae. albopictus was suspected to be present in Central America since the 1990s, and its presence was confirmed by most Central American nations by 2010. Recently, this species has been regularly found, yet in low numbers, in limited areas of Panamá and Costa Rica (CR). Here, we report that short sequences (∼558 bp) of the mitochondrial cytochrome oxidase subunit 1 (COI) and NADH dehydrogenase subunit 5 genes of Ae. albopictus, had no haplotype diversity. Instead, there was a common haplotype for each gene in both CR and Panamá. In contrast, a long COI sequence (∼1,390 bp) revealed that haplotype diversity (±SD) was relatively high in CR (0.72±0.04) when compared with Panamá (0.33±0.13), below the global estimate for reported samples (0.89±0.01). The long COI sequence allowed us to identify seven (five new) haplotypes in CR and two (one new) in Panamá. A haplotype network for the long COI gene sequence showed that samples from CR and Panamá belong to a single large group. The long COI gene sequences suggest that haplotypes in Panamá and CR, although similar to each other, had a significant geographic differentiation (Kst=1.33; P<0.001). Thus, most of our results suggest a recent range expansion in CR and Panamá. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
β3 Integrin Haplotype Influences Gene Regulation and Plasma von Willebrand Factor Activity
Payne, Katie E; Bray, Paul F; Grant, Peter J; Carter, Angela M
2008-01-01
The Leu33Pro polymorphism of the gene encoding β3 integrin (ITGB3) is associated with acute coronary syndromes and influences platelet aggregation. Three common promoter polymorphisms have also been identified. The aims of this study were to (1) investigate the influence of the ITGB3 −400C/A, −425A/C and −468G/A promoter polymorphisms on reporter gene expression and nuclear protein binding and (2) determine genotype and haplotype associations with platelet αIIbβ3 receptor density. Promoter haplotypes were introduced into an ITGB3 promoter-pGL3 construct by site directed mutagenesis and luciferase reporter gene expression analysed in HEL and HMEC-1 cells. Binding of nuclear proteins was assessed by electrophoretic mobility shift assay. The association of ITGB3 haplotype with platelet αIIbβ3 receptor density was determined in 223 subjects. Species conserved motifs were identified in the ITGB3 promoter in the vicinity of the 3 polymorphisms. The GAA, GCC, AAC, AAA and ACC constructs induced ~50% increased luciferase expression relative to the GAC construct in both cell types. Haplotype analysis including Leu33Pro indicated 5 common haplotypes; no associations between ITGB3 haplotypes and receptor density were found. However, the GCC-Pro33 haplotype was associated with significantly higher vWF activity (128.6 [112.1–145.1]%) compared with all other haplotypes (107.1 [101.2–113.0]%, p=0.02). In conclusion, the GCC-Pro33 haplotype was associated with increased vWF activity but not with platelet αIIbβ3 receptor density, which may indicate ITGB3 haplotype influences endothelial function. PMID:18045606
BMP4 and FGF3 haplotypes increase the risk of tendinopathy in volleyball athletes.
Salles, José Inácio; Amaral, Marcus Vinícius; Aguiar, Diego Pinheiro; Lira, Daisy Anne; Quinelato, Valquiria; Bonato, Letícia Ladeira; Duarte, Maria Eugenia Leite; Vieira, Alexandre Rezende; Casado, Priscila Ladeira
2015-03-01
To investigate whether genetic variants can be correlated with tendinopathy in elite male volleyball athletes. Case-control study. Fifteen single nucleotide polymorphisms within BMP4, FGF3, FGF10, FGFR1 genes were investigated in 138 elite volleyball athletes, aged between 18 and 35 years, who undergo 4-5h of training per day: 52 with tendinopathy and 86 with no history of pain suggestive of tendinopathy in patellar, Achilles, shoulder, and hip abductors tendons. The clinical diagnostic criterion was progressive pain during training, confirmed by magnetic resonance image. Genomic DNA was obtained from saliva samples. Genetic markers were genotyped using TaqMan real-time PCR. Chi-square test compared genotypes and haplotype differences between groups. Multivariate logistic regression analyzed the significance of covariates and incidence of tendinopathy. Statistical analysis revealed participant age (p=0.005) and years of practice (p=0.004) were risk factors for tendinopathy. A significant association between BMP4 rs2761884 (p=0.03) and tendinopathy was observed. Athletes with a polymorphic genotype have 2.4 times more susceptibility to tendinopathy (OR=2.39; 95%CI=1.10-5.19). Also, association between disease and haplotype TTGGA in BMP4 (p=0.01) was observed. The FGF3 TGGTA haplotype showed a tendency of association with tendinopathy (p=0.05), and so did FGF10 rs900379. FGFR1 showed no association with disease. These findings indicate that haplotypes in BMP4 and FGF3 genes may contribute to the tendon disease process in elite volleyball athletes. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.
Strep-Tagged Protein Purification.
Maertens, Barbara; Spriestersbach, Anne; Kubicek, Jan; Schäfer, Frank
2015-01-01
The Strep-tag system can be used to purify recombinant proteins from any expression system. Here, protocols for lysis and affinity purification of Strep-tagged proteins from E. coli, baculovirus-infected insect cells, and transfected mammalian cells are given. Depending on the amount of Strep-tagged protein in the lysate, a protocol for batch binding and subsequent washing and eluting by gravity flow can be used. Agarose-based matrices with the coupled Strep-Tactin ligand are the resins of choice, with a binding capacity of up to 9 mg ml(-1). For purification of lower amounts of Strep-tagged proteins, the use of Strep-Tactin magnetic beads is suitable. In addition, Strep-tagged protein purification can also be automated using prepacked columns for FPLC or other liquid-handling chromatography instrumentation, but automated purification is not discussed in this protocol. The protocols described here can be regarded as an update of the Strep-Tag Protein Handbook (Qiagen, 2009). © 2015 Elsevier Inc. All rights reserved.
Sodeland, Marte; Grove, Harald; Kent, Matthew; Taylor, Simon; Svendsen, Morten; Hayes, Ben J; Lien, Sigbjørn
2011-08-11
Previous fine mapping studies in Norwegian Red cattle (NRC) in the region 86-90.4 Mb on Bos taurus chromosome 6 (BTA6) has revealed a quantitative trait locus (QTL) for protein yield (PY) around 88 Mb and a QTL for clinical mastitis (CM) around 90 Mb. The close proximity of these QTLs may partly explain the unfavorable genetic correlation between these two traits in NRC. A long range haplotype covering this region was introduced into the NRC population through the importation of a Holstein-Friesian bull (1606 Frasse) from Sweden in the 1970s. It has been suggested that this haplotype has a favorable effect on milk protein content but an unfavorable effect on mastitis susceptibility. Selective breeding for milk production traits is likely to have increased the frequency of this haplotype in the NRC population. Association mapping for PY and CM in NRC was performed using genotypes from 556 SNPs throughout the region 86-97 Mb on BTA6 and daughter-yield-deviations (DYDs) from 2601 bulls made available from the Norwegian dairy herd recording system. Highest test scores for PY were found for single-nucleotide polymorphisms (SNPs) within and surrounding the genes CSN2 and CSN1S2, coding for the β-casein and α(S2)-casein proteins. High coverage re-sequencing by high throughput sequencing technology enabled molecular characterization of a long range haplotype from 1606 Frasse encompassing these two genes. Haplotype analysis of a large number of descendants from this bull indicated that the haplotype was not markedly disrupted by recombination in this region. The haplotype was associated with both increased milk protein content and increased susceptibility to mastitis, which might explain parts of the observed genetic correlation between PY and CM in NRC. Plausible causal polymorphisms affecting PY were detected in the promoter region and in the 5'-flanking UTR of CSN1S2. These polymorphisms could affect transcription or translation of CSN1S2 and thereby affect the amount
Roussos, Panos; Giakoumaki, Stella G; Bitsios, Panos
2009-06-15
Significant associations have been shown for haplotypes comprising three PRODH single nucleotide polymorphisms (SNPs; 1945T/C, 1766A/G, 1852G/A) located in the 3' region of the gene, suggesting a role of these variants in the etiopathogenesis of schizophrenia. We assessed the relationship between these high-risk PRODH polymorphisms and schizophrenia-related endophenotypes in a large and highly homogeneous cohort of healthy males. Participants (n = 217) were tested in prepulse inhibition (PPI), verbal and working memory, trait anxiety and schizotypy. The QTPHASE from the UNPHASED package was used for the association analysis of each SNP or haplotype data. This procedure revealed significant phenotypic impact of the risk CGA haplotype. Subjects were then divided in two groups; levels of PPI, anxiety, and schizotypy, verbal and working memory were compared with analysis of variance. CGA carriers (n = 32) exhibited attenuated PPI (p < .001) and verbal memory (p < .001) and higher anxiety (p < .004) and schizotypy (p < .008) compared with the noncarriers (n = 185). There were no differences in baseline startle, demographics, and working memory. The main significant correlations were schizotypy x PPI [85-dB, 120-msec trials] in the carriers and schizotypy x anxiety in the entire group and the noncarriers but not the carriers group. Our results strongly support PPI as a valid schizophrenia endophenotype and highlight the importance of examining the role of risk haplotypes on multiple endophenotypes and have implications for understanding the continuum from normality to psychosis, transitional states, and the genetics of schizophrenia-related traits.
Uhrhammer, Nancy; Lange, Ethan; Porras, Oscar; Naeim, Arash; Chen, Xiaoguang; Sheikhavandi, Sepideh; Chiplunkar, Sujata; Yang, Lan; Dandekar, Sugandha; Liang, Teresa; Patel, Nima; Teraoka, Sharon; Udar, Nitin; Calvo, Nidia; Concannon, Patrick; Lange, Kenneth; Gatti, Richard A.
1995-01-01
In an effort to localize a gene for ataxia-telangiectasia (A-T), we have genotyped 27 affected Costa Rican families, with 13 markers, in the chromosome 11q22-23 region. Significant linkage disequilibrium was detected for 9/13 markers between D11S1816 and D11S1391. Recombination events observed in these pedigrees places A-T between D11S1819 and D11S1960. One ancestral haplotype is common to 24/54 affected chromosomes and roughly two-thirds of the families. Inferred (ancestral) recombination events involving this common haplotype in earlier generations suggest that A-T is distal to D11S384 and proximal to D11S1960. Several other common haplotypes were identified, consistent with multiple mutations in a single gene. When considered together with all other evidence, this study further sublocalizes the major A-T locus to ≈200 kb, between markers S384 and S535. ImagesFigure 5 PMID:7611278
WebTag: Web browsing into sensor tags over NFC.
Echevarria, Juan Jose; Ruiz-de-Garibay, Jonathan; Legarda, Jon; Alvarez, Maite; Ayerbe, Ana; Vazquez, Juan Ignacio
2012-01-01
Information and Communication Technologies (ICTs) continue to overcome many of the challenges related to wireless sensor monitoring, such as for example the design of smarter embedded processors, the improvement of the network architectures, the development of efficient communication protocols or the maximization of the life cycle autonomy. This work tries to improve the communication link of the data transmission in wireless sensor monitoring. The upstream communication link is usually based on standard IP technologies, but the downstream side is always masked with the proprietary protocols used for the wireless link (like ZigBee, Bluetooth, RFID, etc.). This work presents a novel solution (WebTag) for a direct IP based access to a sensor tag over the Near Field Communication (NFC) technology for secure applications. WebTag allows a direct web access to the sensor tag by means of a standard web browser, it reads the sensor data, configures the sampling rate and implements IP based security policies. It is, definitely, a new step towards the evolution of the Internet of Things paradigm.
WebTag: Web Browsing into Sensor Tags over NFC
Echevarria, Juan Jose; Ruiz-de-Garibay, Jonathan; Legarda, Jon; Álvarez, Maite; Ayerbe, Ana; Vazquez, Juan Ignacio
2012-01-01
Information and Communication Technologies (ICTs) continue to overcome many of the challenges related to wireless sensor monitoring, such as for example the design of smarter embedded processors, the improvement of the network architectures, the development of efficient communication protocols or the maximization of the life cycle autonomy. This work tries to improve the communication link of the data transmission in wireless sensor monitoring. The upstream communication link is usually based on standard IP technologies, but the downstream side is always masked with the proprietary protocols used for the wireless link (like ZigBee, Bluetooth, RFID, etc.). This work presents a novel solution (WebTag) for a direct IP based access to a sensor tag over the Near Field Communication (NFC) technology for secure applications. WebTag allows a direct web access to the sensor tag by means of a standard web browser, it reads the sensor data, configures the sampling rate and implements IP based security policies. It is, definitely, a new step towards the evolution of the Internet of Things paradigm. PMID:23012511
Separation of metadata and pixel data to speed DICOM tag morphing.
Ismail, Mahmoud; Philbin, James
2013-01-01
The DICOM information model combines pixel data and metadata in single DICOM object. It is not possible to access the metadata separately from the pixel data. There are use cases where only metadata is accessed. The current DICOM object format increases the running time of those use cases. Tag morphing is one of those use cases. Tag morphing includes deletion, insertion or manipulation of one or more of the metadata attributes. It is typically used for order reconciliation on study acquisition or to localize the issuer of patient ID (IPID) and the patient ID attributes when data from one domain is transferred to a different domain. In this work, we propose using Multi-Series DICOM (MSD) objects, which separate metadata from pixel data and remove duplicate attributes, to reduce the time required for Tag Morphing. The time required to update a set of study attributes in each format is compared. The results show that the MSD format significantly reduces the time required for tag morphing.
Burdick, Summer M.
2011-01-01
Passive integrated transponder (PIT) tags are commonly used to mark small catostomids, but tag loss and the effect of tagging on mortality have not been assessed for juveniles of the endangered Lost River sucker Deltistes luxatus. I evaluated tag loss and short-term (34-d) mortality associated with the PIT tagging of juvenile Lost River suckers in the laboratory by using a completely randomized design and three treatment groups (PIT tagged, positive control, and control). An empty needle was inserted into each positive control fish, whereas control fish were handled but not tagged. Only one fish expelled its PIT tag. Mortality rate averaged 9.8 ± 3.4% (mean ± SD) for tagged fish; mortality was 0% for control and positive control fish. All tagging mortalities occurred in fish with standard lengths of 71 mm or less, and most of the mortalities occurred within 48 h of tagging. My results indicate that 12.45- × 2.02-mm PIT tags provide a viable method of marking juvenile Lost River suckers that are 72 mm or larger.
MOHANTY, APARAJITA; MARTÍN, JUAN PEDRO; GONZÁLEZ, LUIS MIGUEL; AGUINAGALDE, ITZIAR
2003-01-01
Chloroplast DNA (cpDNA) and mitochondrial DNA (mtDNA) were studied in 24 populations of Prunus spinosa sampled across Europe. The cpDNA and mtDNA fragments were amplified using universal primers and subsequently digested with restriction enzymes to obtain the polymorphisms. Combinations of all the polymorphisms resulted in 33 cpDNA haplotypes and two mtDNA haplotypes. Strict association between the cpDNA haplotypes and the mtDNA haplotypes was detected in most cases, indicating conjoint inheritance of the two genomes. The most frequent and abundant cpDNA haplotype (C20; frequency, 51 %) is always associated with the more frequent and abundant mtDNA haplotype (M1; frequency, 84 %). All but two of the cpDNA haplotypes associated with the less frequent mtDNA haplotype (M2) are private haplotypes. These private haplotypes are phylogenetically related but geographically unrelated. They form a separate cluster on the minimum‐length spanning tree. PMID:14534199
β-globin gene cluster haplotypes in ethnic minority populations of southwest China
Sun, Hao; Liu, Hongxian; Huang, Kai; Lin, Keqin; Huang, Xiaoqin; Chu, Jiayou; Ma, Shaohui; Yang, Zhaoqing
2017-01-01
The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5′ sites and 3′ sites of the β-globin gene cluster. 5′ haplotypes 2 (+−−−), 6 (−++−+), 9 (−++++) and 3′ haplotype FW3 (−+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China. PMID:28205625
Ancient mitochondrial haplotypes and evidence for intragenic recombination in a gynodioecious plant.
Städler, Thomas; Delph, Lynda F
2002-09-03
Because of their extremely low nucleotide mutation rates, plant mitochondrial genes are generally not expected to show variation within species. Remarkably, we found nine distinct cytochrome b sequence haplotypes in the gynodioecious alpine plant Silene acaulis, with two or more haplotypes coexisting locally in each of three sampled regions. Moreover, there is evidence for intragenic recombination in the history of the haplotype sample, implying at least transient heteroplasmy of mitochondrial DNA (mtDNA). Heteroplasmy might be achieved by one of two potential mechanisms, either continuous coexistence of subgenomic fragments in low stoichiometry, or occasional paternal leakage of mtDNA. On the basis of levels of synonymous nucleotide substitutions, the average divergence time between haplotypes is estimated to be at least 15 million years. Ancient coalescence of extant haplotypes is further indicated by the paucity of fixed differences in haplotypes obtained from related species, a pattern expected under trans-specific evolution. Our data are consistent with models of frequency-dependent selection on linked cytoplasmic male-sterility factors, the putative molecular basis of females in gynodioecious populations. However, associations between marker loci and the inferred male-sterility genes can be maintained only with very low rates of recombination. Heteroplasmy and recombination between divergent haplotypes imply unexplored consequences for the evolutionary dynamics of gynodioecy, a widespread plant breeding system.
Geographic distribution of haplotype diversity at the bovine casein locus
Jann, Oliver C; Ibeagha-Awemu, Eveline M; Özbeyaz, Ceyhan; Zaragoza, Pilar; Williams, John L; Ajmone-Marsan, Paolo; Lenstra, Johannes A; Moazami-Goudarzi, Katy; Erhardt, Georg
2004-01-01
The genetic diversity of the casein locus in cattle was studied on the basis of haplotype analysis. Consideration of recently described genetic variants of the casein genes which to date have not been the subject of diversity studies, allowed the identification of new haplotypes. Genotyping of 30 cattle breeds from four continents revealed a geographically associated distribution of haplotypes, mainly defined by frequencies of alleles at CSN1S1 and CSN3. The genetic diversity within taurine breeds in Europe was found to decrease significantly from the south to the north and from the east to the west. Such geographic patterns of cattle genetic variation at the casein locus may be a result of the domestication process of modern cattle as well as geographically differentiated natural or artificial selection. The comparison of African Bos taurus and Bos indicus breeds allowed the identification of several Bos indicus specific haplotypes (CSN1S1*C-CSN2*A2-CSN3*AI/CSN3*H) that are not found in pure taurine breeds. The occurrence of such haplotypes in southern European breeds also suggests that an introgression of indicine genes into taurine breeds could have contributed to the distribution of the genetic variation observed. PMID:15040901
Olsson, K Sigvard; Ritter, Bernd; Hansson, Norbeth; Chowdhury, Ruma R
2008-07-01
The hemochromatosis mutation, C282Y of the HFE gene, seems to have originated from a single event which once occurred in a person living in the north west of Europe carrying human leukocyte antigen (HLA)-A3-B7. In descendants of this ancestor also other haplotypes appear probably caused by local recombinations and founder effects. The background of these associations is unknown. Isolated river valley populations may be fruitful for the mapping of genetic disorders such as hemochromatosis. In this study, we try to test this hypothesis in a study from central Sweden where the haplotyope A1-B8 was common. HLA haplotypes and HFE mutations were studied in hemochromatosis patients with present or past parental origin in a sparsely populated (1/km(2)) rural district (n = 8366 in the year of 2005), in central Sweden. Pedigrees were constructed from the Swedish church book registry. Extended haplotypes were studied to evaluate origin of recombinations. There were 87 original probands, 36 females and 51 males identified during 30 yr, of whom 86% carried C282Y/C282Y and 14% C282Y/H63D. Of 32 different HLA haplotypes A1-B8 was the most common (34%), followed by A3-B7 (16%), both in strong linkage disequilibrium with controls, (P < 0.001). Twenty-nine different families with A1-B8 had a common founder origin 15 generations ago in small bottleneck populations of the late 16th century. A second A1-B8 founder born 1655 was of Norwegian origin. Most of the A3 carriers (n = 26) had a common founder origin 16 generations ago in an even smaller nearby river valley. A fourth founder family carrying HLA-A2 seems to have originated from a recombination along the descendant lines from the A3 ancestor supported by extended haplotype studies. A1-haplotypes with alleles at the B locus different from B8 had a similar recombination origin as HLA-A2 alleles and a common founder origin 11 generations ago. The intergenerational time interval averaged 35.5 +/- 7.9 yr in men and 31.9 +/- 5.9 in
Dixon, Christopher J.; Mesa, Matthew G.
2011-01-01
We monitored survival and tag loss among Moapa White River springfish Crenichthys baileyi moapae that were surgically implanted with passive integrated transponder (PIT; 9 × 2 mm) tags. The fish used in the study ranged from 40 to 67 mm in total length and from 1.0 to 6.5 g in mass; the PIT tag: body weight ratios were 1.0–6.1%. Fish were held for 41 d in live cages within a small, warm desert stream. Survival did not differ between untagged control fish (94.5%) and tagged fish (95.6%). Survival did not appear to be influenced by fish size or PIT tag: body weight ratio, but the small number of fish that died precluded a detailed analysis. Tag retention was 100% among the 86 fish that survived over the 41 d. Our results suggest that surgically implanting 9-mm PIT tags into Moapa White River springfish as small as 40 mm is an effective method for marking them because it has minimal impacts on survival and tag retention is high. More work is needed on the effects of PIT tagging on growth and other performance metrics of springfish and other small desert fishes.
Stram, Daniel O; Leigh Pearce, Celeste; Bretsky, Phillip; Freedman, Matthew; Hirschhorn, Joel N; Altshuler, David; Kolonel, Laurence N; Henderson, Brian E; Thomas, Duncan C
2003-01-01
The US National Cancer Institute has recently sponsored the formation of a Cohort Consortium (http://2002.cancer.gov/scpgenes.htm) to facilitate the pooling of data on very large numbers of people, concerning the effects of genes and environment on cancer incidence. One likely goal of these efforts will be generate a large population-based case-control series for which a number of candidate genes will be investigated using SNP haplotype as well as genotype analysis. The goal of this paper is to outline the issues involved in choosing a method of estimating haplotype-specific risk estimates for such data that is technically appropriate and yet attractive to epidemiologists who are already comfortable with odds ratios and logistic regression. Our interest is to develop and evaluate extensions of methods, based on haplotype imputation, that have been recently described (Schaid et al., Am J Hum Genet, 2002, and Zaykin et al., Hum Hered, 2002) as providing score tests of the null hypothesis of no effect of SNP haplotypes upon risk, which may be used for more complex tasks, such as providing confidence intervals, and tests of equivalence of haplotype-specific risks in two or more separate populations. In order to do so we (1) develop a cohort approach towards odds ratio analysis by expanding the E-M algorithm to provide maximum likelihood estimates of haplotype-specific odds ratios as well as genotype frequencies; (2) show how to correct the cohort approach, to give essentially unbiased estimates for population-based or nested case-control studies by incorporating the probability of selection as a case or control into the likelihood, based on a simplified model of case and control selection, and (3) finally, in an example data set (CYP17 and breast cancer, from the Multiethnic Cohort Study) we compare likelihood-based confidence interval estimates from the two methods with each other, and with the use of the single-imputation approach of Zaykin et al. applied under both
Discovery, evaluation and distribution of haplotypes of the wheat Ppd-D1 gene.
Guo, Zhiai; Song, Yanxia; Zhou, Ronghua; Ren, Zhenglong; Jia, Jizeng
2010-02-01
Ppd-D1 is one of the most potent genes affecting the photoperiod response of wheat (Triticum aestivum). Only two alleles, insensitive Ppd-D1a and sensitive Ppd-D1b, were known previously, and these did not adequately explain the broad adaptation of wheat to photoperiod variation. In this study, five diagnostic molecular markers were employed to identify Ppd-D1 haplotypes in 492 wheat varieties from diverse geographic locations and 55 accessions of Aegilops tauschii, the D genome donor species of wheat. Six Ppd-D1 haplotypes, designated I-VI, were identified. Types II, V and VI were considered to be more ancient and types I, III and IV were considered to be derived from type II. The transcript abundances of the Ppd-D1 haplotypes showed continuous variation, being highest for haplotype I, lowest for haplotype III, and correlating negatively with varietal differences in heading time. These haplotypes also significantly affected other agronomic traits. The distribution frequency of Ppd-D1 haplotypes showed partial correlations with both latitudes and altitudes of wheat cultivation regions. The evolution, expression and distribution of Ppd-D1 haplotypes were consistent evidentially with each other. What was regarded as a pair of alleles in the past can now be considered a series of alleles leading to continuous variation.
Simčič, Mojca; Smetko, Anamarija; Sölkner, Johann; Seichter, Doris; Gorjanc, Gregor; Kompan, Dragomir; Medugorac, Ivica
2015-01-01
The aim of this study was to obtain unbiased estimates of the diversity parameters, the population history, and the degree of admixture in Cika cattle which represents the local admixed breeds at risk of extinction undergoing challenging conservation programs. Genetic analyses were performed on the genome-wide Single Nucleotide Polymorphism (SNP) Illumina Bovine SNP50 array data of 76 Cika animals and 531 animals from 14 reference populations. To obtain unbiased estimates we used short haplotypes spanning four markers instead of single SNPs to avoid an ascertainment bias of the BovineSNP50 array. Genome-wide haplotypes combined with partial pedigree and type trait classification show the potential to improve identification of purebred animals with a low degree of admixture. Phylogenetic analyses demonstrated unique genetic identity of Cika animals. Genetic distance matrix presented by rooted Neighbour-Net suggested long and broad phylogenetic connection between Cika and Pinzgauer. Unsupervised clustering performed by the admixture analysis and two-dimensional presentation of the genetic distances between individuals also suggest Cika is a distinct breed despite being similar in appearance to Pinzgauer. Animals identified as the most purebred could be used as a nucleus for a recovery of the native genetic background in the current admixed population. The results show that local well-adapted strains, which have never been intensively managed and differentiated into specific breeds, exhibit large haplotype diversity. They suggest a conservation and recovery approach that does not rely exclusively on the search for the original native genetic background but rather on the identification and removal of common introgressed haplotypes would be more powerful. Successful implementation of such an approach should be based on combining phenotype, pedigree, and genome-wide haplotype data of the breed of interest and a spectrum of reference breeds which potentially have had
Daza-Criado, L; Hernández-Fernández, J
2014-02-21
Hawksbill sea turtles Eretmochelys imbricata are found extensively around the world, including the Atlantic, Pacific, and Indian Oceans; the Persian Gulf, and the Red and Mediterranean Seas. Populations of this species are affected by international trafficking of their shields, meat, and eggs, making it a critically endangered animal. We determined the haplotypes of 17 hawksbill foraging turtles of Islas del Rosario (Bolivar) and of the nesting beach Don Diego (Magdalena) in the Colombian Caribbean based on amplification and sequencing of the mitochondrial gene cytochrome oxidase c subunit I (COI). We identified 5 haplotypes, including EI-A1 previously reported in Puerto Rico, which was similar to 10 of the study samples. To our knowledge, the remaining 4 haplotypes have not been described. Samples EICOI11 and EICOI3 showed 0.2% divergence from EI-A1, by a single nucleotide change, and were classified as the EI-A2 haplotype. EICOI6, EICOI14, and EICOI12 samples showed 0.2% divergence from EI-A1 and 0.3% divergence from EI-A2 and were classified as EI-A3 haplotype. Samples EICOI16 and EICOI15 presented 5 nucleotide changes each and were classified as 2 different haplotypes, EI-A4 and EI-A5, respectively. The last 2 haplotypes had higher nucleotide diversity (K2P=1.7%) than that by the first 3 haplotypes. EI-A1 and EI-A2 occurred in nesting individuals, and EI-A2, EI-A3, EI-A4, and EI-A5 occurred in foraging individuals. The description of the haplotypes may be associated with reproductive migrations or foraging and could support the hypothesis of natal homing. Furthermore, they can be used in phylogeographic studies.
In vivo phosphorylation of a peptide tag for protein purification.
Goux, Marine; Fateh, Amina; Defontaine, Alain; Cinier, Mathieu; Tellier, Charles
2016-05-01
To design a new system for the in vivo phosphorylation of proteins in Escherichia coli using the co-expression of the α-subunit of casein kinase II (CKIIα) and a target protein, (Nanofitin) fused with a phosphorylatable tag. The level of the co-expressed CKIIα was controlled by the arabinose promoter and optimal phosphorylation was obtained with 2 % (w/v) arabinose as inductor. The effectiveness of the phosphorylation system was demonstrated by electrophoretic mobility shift assay (NUT-PAGE) and staining with a specific phosphoprotein-staining gel. The resulting phosphorylated tag was also used to purify the phosphoprotein by immobilized metal affinity chromatography, which relies on the specific interaction of phosphate moieties with Fe(III). The use of a single tag for both the purification and protein array anchoring provides a simple and straightforward system for protein analysis.
The discrete Laplace exponential family and estimation of Y-STR haplotype frequencies.
Andersen, Mikkel Meyer; Eriksen, Poul Svante; Morling, Niels
2013-07-21
Estimating haplotype frequencies is important in e.g. forensic genetics, where the frequencies are needed to calculate the likelihood ratio for the evidential weight of a DNA profile found at a crime scene. Estimation is naturally based on a population model, motivating the investigation of the Fisher-Wright model of evolution for haploid lineage DNA markers. An exponential family (a class of probability distributions that is well understood in probability theory such that inference is easily made by using existing software) called the 'discrete Laplace distribution' is described. We illustrate how well the discrete Laplace distribution approximates a more complicated distribution that arises by investigating the well-known population genetic Fisher-Wright model of evolution by a single-step mutation process. It was shown how the discrete Laplace distribution can be used to estimate haplotype frequencies for haploid lineage DNA markers (such as Y-chromosomal short tandem repeats), which in turn can be used to assess the evidential weight of a DNA profile found at a crime scene. This was done by making inference in a mixture of multivariate, marginally independent, discrete Laplace distributions using the EM algorithm to estimate the probabilities of membership of a set of unobserved subpopulations. The discrete Laplace distribution can be used to estimate haplotype frequencies with lower prediction error than other existing estimators. Furthermore, the calculations could be performed on a normal computer. This method was implemented in the freely available open source software R that is supported on Linux, MacOS and MS Windows. Copyright © 2013 Elsevier Ltd. All rights reserved.
Congruence as a measurement of extended haplotype structure across the genome
2012-01-01
Background Historically, extended haplotypes have been defined using only a few data points, such as alleles for several HLA genes in the MHC. High-density SNP data, and the increasing affordability of whole genome SNP typing, creates the opportunity to define higher resolution extended haplotypes. This drives the need for new tools that support quantification and visualization of extended haplotypes as defined by as many as 2000 SNPs. Confronted with high-density SNP data across the major histocompatibility complex (MHC) for 2,300 complete families, compiled by the Type 1 Diabetes Genetics Consortium (T1DGC), we developed software for studying extended haplotypes. Methods The software, called ExHap (Extended Haplotype), uses a similarity measurement we term congruence to identify and quantify long-range allele identity. Using ExHap, we analyzed congruence in both the T1DGC data and family-phased data from the International HapMap Project. Results Congruent chromosomes from the T1DGC data have between 96.5% and 99.9% allele identity over 1,818 SNPs spanning 2.64 megabases of the MHC (HLA-DRB1 to HLA-A). Thirty-three of 132 DQ-DR-B-A defined haplotype groups have > 50% congruent chromosomes in this region. For example, 92% of chromosomes within the DR3-B8-A1 haplotype are congruent from HLA-DRB1 to HLA-A (99.8% allele identity). We also applied ExHap to all 22 autosomes for both CEU and YRI cohorts from the International HapMap Project, identifying multiple candidate extended haplotypes. Conclusions Long-range congruence is not unique to the MHC region. Patterns of allele identity on phased chromosomes provide a simple, straightforward approach to visually and quantitatively inspect complex long-range structural patterns in the genome. Such patterns aid the biologist in appreciating genetic similarities and differences across cohorts, and can lead to hypothesis generation for subsequent studies. PMID:22369243
Social Tagging of Mission Data
NASA Technical Reports Server (NTRS)
Norris, Jeffrey S.; Wallick, Michael N.; Joswig, Joseph C.; Powell, Mark W.; Torres, Recaredo J.; Mittman, David S.; Abramyan, Lucy; Crockett, Thomas M.; Shams, Khawaja S.; Fox, Jason M.;
2010-01-01
Mars missions will generate a large amount of data in various forms, such as daily plans, images, and scientific information. Often, there is a semantic linkage between images that cannot be captured automatically. Software is needed that will provide a method for creating arbitrary tags for this mission data so that items with a similar tag can be related to each other. The tags should be visible and searchable for all users. A new routine was written to offer a new and more flexible search option over previous applications. This software allows users of the MSLICE program to apply any number of arbitrary tags to a piece of mission data through a MSLICE search interface. The application of tags creates relationships between data that did not previously exist. These tags can be easily removed and changed, and contain enough flexibility to be specifically configured for any mission. This gives users the ability to quickly recall or draw attention to particular pieces of mission data, for example: Give a semantic and meaningful description to mission data; for example, tag all images with a rock in them with the tag "rock." Rapidly recall specific and useful pieces of data; for example, tag a plan as"driving template." Call specific data to a user s attention; for example, tag a plan as "for:User." This software is part of the MSLICE release, which was written in Java. It will run on any current Windows, Macintosh, or Linux system.
2011-01-01
Background Preeclampsia (PE) is the first worldwide cause of death in pregnant women, intra-uterine growth retardation, and fetal prematurity. Some vascular endothelial grown factor gene (VEGF) polymorphisms have been associated to PE and other pregnancy disturbances. We evaluated the associations between VEGF genotypes/haplotypes and PE in Mexican women. Methods 164 pregnant women were enrolled in a case-control study (78 cases and 86 normotensive pregnant controls). The rs699947 (-2578C/A), rs1570360 (-1154G/A), rs2010963 (+405G/C), and rs25648 (-7C/T), VEGF variants were discriminated using Polymerase Chain Reaction - Restriction Fragment Length Polymorphism (PCR-RFLP) methods or Taqman single nucleotide polymorphism (SNP) assays. Results The proportions of the minor allele for rs699947, rs1570360, rs2010963, and rs25648 VEGF SNPs were 0.33, 0.2, 0.39, and 0.17 in controls, and 0.39, 0.23, 0.41, and 0.15 in cases, respectively (P values > 0.05). The most frequent haplotypes of rs699947, rs1570360, rs2010963, and rs25648 VEGF SNPs, were C-G-C-C and C-G-G-C with frequencies of 0.39, 0.21 in cases and 0.37, 0.25 in controls, respectively (P values > 0.05) Conclusion There was no evidence of an association between VEGF alleles, genotypes, or haplotypes frequencies and PE in our study. PMID:21575227
Y-STR haplotypes of Native American populations from the Brazilian Amazon region.
Palha, Teresinha Jesus Brabo Ferreira; Rodrigues, Elzemar Martins Ribeiro; dos Santos, Sidney Emanuel Batista
2010-10-01
The allele and haplotype frequencies of nine Y-STRs (DYS19, DYS389 I, DYS389 II, DYS390, DYS391, DYS392, DYS393, DYS385 I/II) were determined in a sample of six native tribes from the Brazilian Amazon (Tiriyó, Awa-Guajá, Waiãpi, Urubu-Kaapor, Zoé and Parakanã). Forty-eight different haplotypes were identified, 28 of which unique. Five haplotypes are very frequent and were shared by over 10 individuals. The estimated haplotype diversity (0.9114) was very low compared to other geographic groups, including Africans, Europeans and Asians. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Pseudo-orthogonal frequency coded wireless SAW RFID temperature sensor tags.
Saldanha, Nancy; Malocha, Donald C
2012-08-01
SAW sensors are ideal for various wireless, passive multi-sensor applications because they are small, rugged, radiation hard, and offer a wide range of material choices for operation over broad temperature ranges. The readable distance of a tag in a multi-sensor environment is dependent on the insertion loss of the device and the processing gain of the system. Single-frequency code division multiple access (CDMA) tags that are used in high-volume commercial applications must have universal coding schemes and large numbers of codes. The use of a large number of bits at the common center frequency to achieve sufficient code diversity in CDMA tags necessitates reflector banks with >30 dB loss. Orthogonal frequency coding is a spread-spectrum approach that employs frequency and time diversity to achieve enhanced tag properties. The use of orthogonal frequency coded (OFC) SAW tags reduces adjacent reflector interactions for low insertion loss, increased range, complex coding, and system processing gain. This work describes a SAW tag-sensor platform that reduces device loss by implementing long reflector banks with optimized spectral coding. This new pseudo-OFC (POFC) coding is defined and contrasted with the previously defined OFC coding scheme. Auto- and cross-correlation properties of the chips and their relation to reflectivity per strip and reflector length are discussed. Results at 250 MHz of 8-chip OFC and POFC SAW tags will be compared. The key parameters of insertion loss, cross-correlation, and autocorrelation of the two types of frequency-coded tags will be analyzed, contrasted, and discussed. It is shown that coded reflector banks can be achieved with near-zero loss and still maintain good coding properties. Experimental results and results predicted by the coupling of modes model are presented for varying reflector designs and codes. A prototype 915-MHz POFC sensor tag is used as a wireless temperature sensor and the results are shown.
Singh, Kanhaiya; Kant, Shri; Singh, Vivek Kumar; Agrawal, Neeraj K.; Gupta, Sanjeev K.
2014-01-01
Purpose Persistent inflammation and impaired neovascularization in type 2 diabetes mellitus (T2DM) patients may lead to development of macro- and microvascular complications. Diabetic retinopathy (DR) is one of the secondary microvascular complications of T2DM. Improper activation of the innate immune system may be an important contributor in the pathophysiology of DR. Toll-like receptor 4 (TLR4) is an important mediator of innate immunity, and genetic alterations in TLR4 support inflammation in the hyperglycemic condition. The present work was designed to investigate whether the TLR4 single nucleotide polymorphisms (SNPs) rs4986790, rs4986791, rs10759931, rs1927911, and rs1927914 are associated with DR in a north Indian population. Methods The study group of 698 individuals (128 DR, 250 T2DM, 320 controls) was genotyped by PCR-RFLP. Haplotype and linkage disequilibrium between SNPs were determined using Haploview software. Results Combined risk genotypes of TLR4 SNPs rs10759931 (odds ratio [OR] 1.50, p = 0.05) and rs1927914 (OR 1.48, p = 0.05) were found to be significantly associated with pathogenesis of DR. A total of 14 haplotypes with frequency >1% were obtained using Haploview software. Haplotypes ACATC (37.5%) and ACATT (14.8%) were the two most common haplotypes obtained. Conclusions Results of the present case-control study that included 698 north Indian subjects suggested that TLR4 SNPs rs10759931 and rs1927914 modulate the risk of DR in T2DM cases. Association analysis using haplotypes showed none of the haplotypes were associated with either susceptibility or resistance to DR in a north Indian population. PMID:24883015
Genetically encoded fluorescent tags
Thorn, Kurt
2017-01-01
Genetically encoded fluorescent tags are protein sequences that can be fused to a protein of interest to render it fluorescent. These tags have revolutionized cell biology by allowing nearly any protein to be imaged by light microscopy at submicrometer spatial resolution and subsecond time resolution in a live cell or organism. They can also be used to measure protein abundance in thousands to millions of cells using flow cytometry. Here I provide an introduction to the different genetic tags available, including both intrinsically fluorescent proteins and proteins that derive their fluorescence from binding of either endogenous or exogenous fluorophores. I discuss their optical and biological properties and guidelines for choosing appropriate tags for an experiment. Tools for tagging nucleic acid sequences and reporter molecules that detect the presence of different biomolecules are also briefly discussed. PMID:28360214
Vehicle Tracking System using Nanotechnology Satellites and Tags
NASA Technical Reports Server (NTRS)
Lorenzini, Dino A.; Tubis, Chris
1995-01-01
This paper describes a joint project to design, develop, and deploy a satellite based tracking system incorporating micro-nanotechnology components. The system consists of a constellation of 'nanosats', a satellite command station and data collection sites, and a large number of low-cost electronic 'tags'. Both government and commercial applications are envisioned for the satellite based tracking system. The projected low price for the tracking service is made possible by the lightweight nanosats and inexpensive electronic tags which use high production volume single chip transceivers and microprocessor devices. The nanosat consists of a five inch aluminum cube with body mounted solar panels (GaAs solar cells) on all six faces. A UHF turnstile antenna and a simple, spring release mechanism complete the external configuration of the spacecraft.
Risk of pediatric celiac disease according to HLA haplotype and country.
Liu, Edwin; Lee, Hye-Seung; Aronsson, Carin A; Hagopian, William A; Koletzko, Sibylle; Rewers, Marian J; Eisenbarth, George S; Bingley, Polly J; Bonifacio, Ezio; Simell, Ville; Agardh, Daniel
2014-07-03
The presence of HLA haplotype DR3-DQ2 or DR4-DQ8 is associated with an increased risk of celiac disease. In addition, nearly all children with celiac disease have serum antibodies against tissue transglutaminase (tTG). We studied 6403 children with HLA haplotype DR3-DQ2 or DR4-DQ8 prospectively from birth in the United States, Finland, Germany, and Sweden. The primary end point was the development of celiac disease autoimmunity, which was defined as the presence of tTG antibodies on two consecutive tests at least 3 months apart. The secondary end point was the development of celiac disease, which was defined for the purpose of this study as either a diagnosis on biopsy or persistently high levels of tTG antibodies. The median follow-up was 60 months (interquartile range, 46 to 77). Celiac disease autoimmunity developed in 786 children (12%). Of the 350 children who underwent biopsy, 291 had confirmed celiac disease; an additional 21 children who did not undergo biopsy had persistently high levels of tTG antibodies. The risks of celiac disease autoimmunity and celiac disease by the age of 5 years were 11% and 3%, respectively, among children with a single DR3-DQ2 haplotype, and 26% and 11%, respectively, among those with two copies (DR3-DQ2 homozygosity). In the adjusted model, the hazard ratios for celiac disease autoimmunity were 2.09 (95% confidence interval [CI], 1.70 to 2.56) among heterozygotes and 5.70 (95% CI, 4.66 to 6.97) among homozygotes, as compared with children who had the lowest-risk genotypes (DR4-DQ8 heterozygotes or homozygotes). Residence in Sweden was also independently associated with an increased risk of celiac disease autoimmunity (hazard ratio, 1.90; 95% CI, 1.61 to 2.25). Children with the HLA haplotype DR3-DQ2, especially homozygotes, were found to be at high risk for celiac disease autoimmunity and celiac disease early in childhood. The higher risk in Sweden than in other countries highlights the importance of studying environmental
Louzoun, Yoram; Alter, Idan; Gragert, Loren; Albrecht, Mark; Maiers, Martin
2018-05-01
Regardless of sampling depth, accurate genotype imputation is limited in regions of high polymorphism which often have a heavy-tailed haplotype frequency distribution. Many rare haplotypes are thus unobserved. Statistical methods to improve imputation by extending reference haplotype distributions using linkage disequilibrium patterns that relate allele and haplotype frequencies have not yet been explored. In the field of unrelated stem cell transplantation, imputation of highly polymorphic human leukocyte antigen (HLA) genes has an important application in identifying the best-matched stem cell donor when searching large registries totaling over 28,000,000 donors worldwide. Despite these large registry sizes, a significant proportion of searched patients present novel HLA haplotypes. Supporting this observation, HLA population genetic models have indicated that many extant HLA haplotypes remain unobserved. The absent haplotypes are a significant cause of error in haplotype matching. We have applied a Bayesian inference methodology for extending haplotype frequency distributions, using a model where new haplotypes are created by recombination of observed alleles. Applications of this joint probability model offer significant improvement in frequency distribution estimates over the best existing alternative methods, as we illustrate using five-locus HLA frequency data from the National Marrow Donor Program registry. Transplant matching algorithms and disease association studies involving phasing and imputation of rare variants may benefit from this statistical inference framework.
Plessky, Victor P; Reindl, Leonhard M
2010-03-01
SAW tags were invented more than 30 years ago, but only today are the conditions united for mass application of this technology. The devices in the 2.4-GHz ISM band can be routinely produced with optical lithography, high-resolution radar systems can be built up using highly sophisticated, but low-cost RF-chips, and the Internet is available for global access to the tag databases. The "Internet of Things," or I-o-T, will demand trillions of cheap tags and sensors. The SAW tags can overcome semiconductor-based analogs in many aspects: they can be read at a distance of a few meters with readers radiating power levels 2 to 3 orders lower, they are cheap, and they can operate in robust environments. Passive SAW tags are easily combined with sensors. Even the "anti-collision" problem (i.e., the simultaneous reading of many nearby tags) has adequate solutions for many practical applications. In this paper, we discuss the state-of-the-art in the development of SAW tags. The design approaches will be reviewed and optimal tag designs, as well as encoding methods, will be demonstrated. We discuss ways to reduce the size and cost of these devices. A few practical examples of tags using a time-position coding with 10(6) different codes will be demonstrated. Phase-coded devices can additionally increase the number of codes at the expense of a reduction of reading distance. We also discuss new and exciting perspectives of using ultra wide band (UWB) technology for SAW-tag systems. The wide frequency band available for this standard provides a great opportunity for SAW tags to be radically reduced in size to about 1 x 1 mm(2) while keeping a practically infinite number of possible different codes. Finally, the reader technology will be discussed, as well as detailed comparison made between SAW tags and IC-based semiconductor device.
Isely, J.J.; Eversole, A.G.
1998-01-01
Juvenile red swamp crayfish (or crawfish), Procambarus clarkii (20-41 mm in total length) were collected from a crayfish culture pond by dipnetting and tagged with sequentially numbered, standard length, binary-coded wire tags. Four replicates of 50 crayfish were impaled perpendicular to the long axis of the abdomen with a fixed needle. Tags were injected transversely into the ventral surface of the first or second abdominal segment and were imbedded in the musculature just beneath the abdominal sternum. Tags were visible upon inspection. Additionally, two replicates of 50 crayfish were not tagged and were used as controls. Growth, survival, and tag retention were evaluated after 7 d in individual containers, after 100 d in aquaria, and after 200 d in field cages. Tag retention during each sample period was 100%, and average mortality of tagged crayfish within 7 d of tagging was 1%. Mortality during the remainder of the study was high (75-91%) but was similar between treatment and control samples. Most of the deaths were probably due to cannibalism. Average total length increased threefold during the course of the study, and crayfish reached maturity. Because crayfish were mature by the end of the study, we concluded that the coded wire tag was retained through the life history of the crayfish.
Patterns of linkage disequilibrium and haplotype distribution in disease candidate genes.
Long, Ji-Rong; Zhao, Lan-Juan; Liu, Peng-Yuan; Lu, Yan; Dvornyk, Volodymyr; Shen, Hui; Liu, Yong-Jun; Zhang, Yuan-Yuan; Xiong, Dong-Hai; Xiao, Peng; Deng, Hong-Wen
2004-05-24
The adequacy of association studies for complex diseases depends critically on the existence of linkage disequilibrium (LD) between functional alleles and surrounding SNP markers. We examined the patterns of LD and haplotype distribution in eight candidate genes for osteoporosis and/or obesity using 31 SNPs in 1,873 subjects. These eight genes are apolipoprotein E (APOE), type I collagen alpha1 (COL1A1), estrogen receptor-alpha (ER-alpha), leptin receptor (LEPR), parathyroid hormone (PTH)/PTH-related peptide receptor type 1 (PTHR1), transforming growth factor-beta1 (TGF-beta1), uncoupling protein 3 (UCP3), and vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR). Yin yang haplotypes, two high-frequency haplotypes composed of completely mismatching SNP alleles, were examined. To quantify LD patterns, two common measures of LD, D' and r2, were calculated for the SNPs within the genes. The haplotype distribution varied in the different genes. Yin yang haplotypes were observed only in PTHR1 and UCP3. D' ranged from 0.020 to 1.000 with the average of 0.475, whereas the average r2 was 0.158 (ranging from 0.000 to 0.883). A decay of LD was observed as the intermarker distance increased, however, there was a great difference in LD characteristics of different genes or even in different regions within gene. The differences in haplotype distributions and LD patterns among the genes underscore the importance of characterizing genomic regions of interest prior to association studies.
Staubach, Fabian; Lorenc, Anna; Messer, Philipp W.; Tang, Kun; Petrov, Dmitri A.; Tautz, Diethard
2012-01-01
General parameters of selection, such as the frequency and strength of positive selection in natural populations or the role of introgression, are still insufficiently understood. The house mouse (Mus musculus) is a particularly well-suited model system to approach such questions, since it has a defined history of splits into subspecies and populations and since extensive genome information is available. We have used high-density single-nucleotide polymorphism (SNP) typing arrays to assess genomic patterns of positive selection and introgression of alleles in two natural populations of each of the subspecies M. m. domesticus and M. m. musculus. Applying different statistical procedures, we find a large number of regions subject to apparent selective sweeps, indicating frequent positive selection on rare alleles or novel mutations. Genes in the regions include well-studied imprinted loci (e.g. Plagl1/Zac1), homologues of human genes involved in adaptations (e.g. alpha-amylase genes) or in genetic diseases (e.g. Huntingtin and Parkin). Haplotype matching between the two subspecies reveals a large number of haplotypes that show patterns of introgression from specific populations of the respective other subspecies, with at least 10% of the genome being affected by partial or full introgression. Using neutral simulations for comparison, we find that the size and the fraction of introgressed haplotypes are not compatible with a pure migration or incomplete lineage sorting model. Hence, it appears that introgressed haplotypes can rise in frequency due to positive selection and thus can contribute to the adaptive genomic landscape of natural populations. Our data support the notion that natural genomes are subject to complex adaptive processes, including the introgression of haplotypes from other differentiated populations or species at a larger scale than previously assumed for animals. This implies that some of the admixture found in inbred strains of mice may also have
Sun, Yujia; Lan, Xianyong; Lei, Chuzhao; Zhang, Chunlei; Chen, Hong
2015-06-01
The aim of this study was to examine the association of cofilin2 (CFL2) gene polymorphisms with growth traits in Chinese Qinchuan cattle. Three single nucleotide polymorphisms (SNPs) were identified in the bovine CFL2 gene using DNA sequencing and (forced) PCR-RFLP methods. These polymorphisms included a missense mutation (NC_007319.5: g. C 2213 G) in exon 4, one synonymous mutation (NC_007319.5: g. T 1694 A) in exon 4, and a mutation (NC_007319.5: g. G 1500 A) in intron 2, respectively. In addition, we evaluated the haplotype frequency and linkage disequilibrium coefficient of three sequence variants in 488 individuals in QC cattle. All the three SNPs in QC cattle belonged to an intermediate level of genetic diversity (0.25
Rexrode, Kathryn M; Ridker, Paul M; Hegener, Hillary H; Buring, Julie E; Manson, JoAnn E; Zee, Robert Y L
2008-05-01
Androgen receptors (AR) are expressed in endothelial cells and vascular smooth-muscle cells. Some studies suggest an association between AR gene variation and risk of cardiovascular disease (CVD) in men; however, the relationship has not been examined in women. Six haplotype block-tagging single nucleotide polymorphisms (rs962458, rs6152, rs1204038, rs2361634, rs1337080, rs1337082), as well as the cysteine, adenine, guanine (CAG) microsatellite in exon 1, of the AR gene were evaluated among 300 white postmenopausal women who developed CVD (158 myocardial infarctions and 142 ischemic strokes) and an equal number of matched controls within the Women's Health Study. Genotype distributions were similar between cases and controls, and genotypes were not significantly related to risk of CVD, myocardial infarctions or ischemic stroke in conditional logistic regression models. Seven common haplotypes were observed, but distributions did not differ between cases and controls nor were significant associations observed in logistic regression analysis. The median CAG repeat length was 21. In conditional logistic regression, there was no association between the number of alleles with CAG repeat length >or=21 (or >or=22) and risk of CVD, myocardial infarctions or ischemic stroke. No association between AR genetic variation, as measured by haplotype-tagging single nucleotide polymorphisms and CAG repeat number, and risk of CVD was observed in women.
VNTR alleles associated with the {alpha}-globin locus are haplotype and population related
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martinson, J.J.; Clegg, J.B.; Boyce, A.J.
1994-09-01
The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception ofmore » closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brown, Richard S.; Oldenburg, Eric W.; Seaburg, Adam
Studies examining the survival of juvenile salmon as they emigrate to the ocean provide important information regarding the management of regulated river systems. Acoustic telemetry is a widely used tool for evaluating the behavior and survival of juvenile salmonids in the Columbia River basin. Thus, it is important to understand how the surgical tagging process and the presence of a transmitter affect survival so any biases can be accounted for or eliminated. This study evaluated the effects of fish length and tag type on the survival of yearling and subyearling Chinook salmon during their seaward migrations through the Snake andmore » Columbia rivers during 2006, 2007, and 2008. Fish were collected at Lower Granite Dam on the Snake River (river kilometer 695) and implanted with either only a passive integrated transponder (PIT) tag (PIT fish) or both a PIT tag and an acoustic transmitter (AT fish). Survival was estimated from release at Lower Granite Dam to multiple downstream locations (dams) using the Cormack–Jolly–Seber single release model, and analysis of variance was used to test for differences among length-classes and between tag types. No length-specific tag effect was detected between PIT and AT fish (i.e., length affected the survival of PIT fish in a manner similar to which it affected the survival of AT fish). Survival among the smallest length class (i.e., 80–89 mm) of both PIT and AT subyearling Chinook salmon was markedly low (i.e., 4%). Fish length was positively correlated with the survival of both PIT and AT fish. Significant differences in survival were detected between tag types; the survival of PIT fish was generally greater than that of AT fish. However, confounding variables warrant caution in making strong inferences regarding this factor. Further, results suggest that tag effects may be due to the process of surgically implanting the transmitter rather than the presence of the transmitter.« less
Jaramillo-Correa, J P; Bousquet, J; Beaulieu, J; Isabel, N; Perron, M; Bouillé, M
2003-05-01
Primers previously developed to amplify specific non-coding regions of the mitochondrial genome in Angiosperms, and new primers for additional non-coding mtDNA regions, were tested for their ability to direct DNA amplification in 12 conifer taxa and to detect sequence-tagged-site (STS) polymorphisms within and among eight species in Picea. Out of 12 primer pairs, nine were successful at amplifying mtDNA in most of the taxa surveyed. In conifers, indels and substitutions were observed for several loci, allowing them to distinguish between families, genera and, in some cases, between species within genera. In Picea, interspecific polymorphism was detected for four loci, while intraspecific variation was observed for three of the mtDNA regions studied. One of these (SSU rRNA V1 region) exhibited indel polymorphisms, and the two others ( nad1 intron b/c and nad5 intron1) revealed restriction differences after digestion with Sau3AI (PCR-RFLP). A fourth locus, the nad4L- orf25 intergenic region, showed a multibanding pattern for most of the spruce species, suggesting a possible gene duplication. Maternal inheritance, expected for mtDNA in conifers, was observed for all polymorphic markers except the intergenic region nad4L- orf25. Pooling of the variation observed with the remaining three markers resulted in two to six different mtDNA haplotypes within the different species of Picea. Evidence for intra-genomic recombination was observed in at least two taxa. Thus, these mitotypes are likely to be more informative than single-locus haplotypes. They should be particularly useful for the study of biogeography and the dynamics of hybrid zones.
Directional Radio-Frequency Identification Tag Reader
NASA Technical Reports Server (NTRS)
Medelius, Pedro J.; Taylor, John D.; Henderson, John J.
2004-01-01
A directional radio-frequency identification (RFID) tag reader has been designed to facilitate finding a specific object among many objects in a crowded room. The device could be an adjunct to an electronic inventory system that tracks RFID-tagged objects as they move through reader-equipped doorways. Whereas commercial RFID-tag readers do not measure directions to tagged objects, the device is equipped with a phased-array antenna and a received signal-strength indicator (RSSI) circuit for measuring direction. At the beginning of operation, it is set to address only the RFID tag of interest. It then continuously transmits a signal to interrogate that tag while varying the radiation pattern of the antenna. It identifies the direction to the tag as the radiation pattern direction of peak strength of the signal returned by the tag. An approximate distance to the tag is calculated from the peak signal strength. The direction and distance can be displayed on a screen. A prototype containing a Yagi antenna was found to be capable of detecting a 915.5-MHz tag at a distance of approximately equal to 15 ft (approximately equal to 4.6 m).
Hao, Chenyang; Wang, Yuquan; Chao, Shiaoman; Li, Tian; Liu, Hongxia; Wang, Lanfen; Zhang, Xueyong
2017-01-30
A Chinese wheat mini core collection was genotyped using the wheat 9 K iSelect SNP array. Total 2420 and 2396 polymorphic SNPs were detected on the A and the B genome chromosomes, which formed 878 haplotype blocks. There were more blocks in the B genome, but the average block size was significantly (P < 0.05) smaller than those in the A genome. Intense selection (domestication and breeding) had a stronger effect on the A than on the B genome chromosomes. Based on the genetic pedigrees, many blocks can be traced back to a well-known Strampelli cross, which was made one century ago. Furthermore, polyploidization of wheat (both tetraploidization and hexaploidization) induced revolutionary changes in both the A and the B genomes, with a greater increase of gene diversity compared to their diploid ancestors. Modern breeding has dramatically increased diversity in the gene coding regions, though obvious blocks were formed on most of the chromosomes in both tetraploid and hexaploid wheats. Tag-SNP markers identified in this study can be used for marker assisted selection using haplotype blocks as a wheat breeding strategy. This strategy can also be employed to facilitate genome selection in other self-pollinating crop species.
The α‐synuclein gene in multiple system atrophy
Ozawa, T; Healy, D G; Abou‐Sleiman, P M; Ahmadi, K R; Quinn, N; Lees, A J; Shaw, K; Wullner, U; Berciano, J; Moller, J C; Kamm, C; Burk, K; Josephs, K A; Barone, P; Tolosa, E; Goldstein, D B; Wenning, G; Geser, F; Holton, J L; Gasser, T; Revesz, T; Wood, N W
2006-01-01
Background The formation of α‐synuclein aggregates may be a critical event in the pathogenesis of multiple system atrophy (MSA). However, the role of this gene in the aetiology of MSA is unknown and untested. Method The linkage disequilibrium (LD) structure of the α‐synuclein gene was established and LD patterns were used to identify a set of tagging single nucleotide polymorphisms (SNPs) that represent 95% of the haplotype diversity across the entire gene. The effect of polymorphisms on the pathological expression of MSA in pathologically confirmed cases was also evaluated. Results and conclusion In 253 Gilman probable or definite MSA patients, 457 possible, probable, and definite MSA cases and 1472 controls, a frequency difference for the individual tagging SNPs or tag‐defined haplotypes was not detected. No effect was observed of polymorphisms on the pathological expression of MSA in pathologically confirmed cases. PMID:16543523
Exploring and Harnessing Haplotype Diversity to Improve Yield Stability in Crops.
Qian, Lunwen; Hickey, Lee T; Stahl, Andreas; Werner, Christian R; Hayes, Ben; Snowdon, Rod J; Voss-Fels, Kai P
2017-01-01
In order to meet future food, feed, fiber, and bioenergy demands, global yields of all major crops need to be increased significantly. At the same time, the increasing frequency of extreme weather events such as heat and drought necessitates improvements in the environmental resilience of modern crop cultivars. Achieving sustainably increase yields implies rapid improvement of quantitative traits with a very complex genetic architecture and strong environmental interaction. Latest advances in genome analysis technologies today provide molecular information at an ultrahigh resolution, revolutionizing crop genomic research, and paving the way for advanced quantitative genetic approaches. These include highly detailed assessment of population structure and genotypic diversity, facilitating the identification of selective sweeps and signatures of directional selection, dissection of genetic variants that underlie important agronomic traits, and genomic selection (GS) strategies that not only consider major-effect genes. Single-nucleotide polymorphism (SNP) markers today represent the genotyping system of choice for crop genetic studies because they occur abundantly in plant genomes and are easy to detect. SNPs are typically biallelic, however, hence their information content compared to multiallelic markers is low, limiting the resolution at which SNP-trait relationships can be delineated. An efficient way to overcome this limitation is to construct haplotypes based on linkage disequilibrium, one of the most important features influencing genetic analyses of crop genomes. Here, we give an overview of the latest advances in genomics-based haplotype analyses in crops, highlighting their importance in the context of polyploidy and genome evolution, linkage drag, and co-selection. We provide examples of how haplotype analyses can complement well-established quantitative genetics frameworks, such as quantitative trait analysis and GS, ultimately providing an effective tool
NASA Astrophysics Data System (ADS)
Guo, Y.; Liu, J.; Mauzerall, D. L.; Emmons, L. K.; Horowitz, L. W.; Fan, S.; Li, X.; Tao, S.
2014-12-01
Long-range transport of ozone is of great concern, yet the source-receptor relationships derived previously depend strongly on the source attribution techniques used. Here we describe a new tagged ozone mechanism (full-tagged), the design of which seeks to take into account the combined effects of emissions of ozone precursors, CO, NOx and VOCs, from a particular source, while keeping the current state of chemical equilibrium unchanged. We label emissions from the target source (A) and background (B). When two species from A and B sources react with each other, half of the resulting products are labeled A, and half B. Thus the impact of a given source on downwind regions is recorded through tagged chemistry. We then incorporate this mechanism into the Model for Ozone and Related chemical Tracers (MOZART-4) to examine the impact of anthropogenic emissions within North America, Europe, East Asia and South Asia on ground-level ozone downwind of source regions during 1999-2000. We compare our results with two previously used methods -- the sensitivity and tagged-N approaches. The ozone attributed to a given source by the full-tagged method is more widely distributed spatially, but has weaker seasonal variability than that estimated by the other methods. On a seasonal basis, for most source/receptor pairs, the full-tagged method estimates the largest amount of tagged ozone, followed by the sensitivity and tagged-N methods. In terms of trans-Pacific influence of ozone pollution, the full-tagged method estimates the strongest impact of East Asian (EA) emissions on the western U.S. (WUS) in MAM and JJA (~3 ppbv), which is substantially different in magnitude and seasonality from tagged-N and sensitivity studies. This difference results from the full-tagged method accounting for the maintenance of peroxy radicals (e.g., CH3O2, CH3CO3, and HO2), in addition to NOy, as effective reservoirs of EA source impact across the Pacific, allowing for a significant contribution to
Assessing transmission of ‘Candidatus Liberibacter solanacearum’ haplotypes through seed potato
USDA-ARS?s Scientific Manuscript database
Conflicting data has previously been reported concerning the impact of zebra chip disease transmission through seed tubers. These discrepancies may be due to the experimental design of each study, whereby different pathogen haplotypes, insect vector haplotypes, and potato plant varieties were used....
Zumárraga, Mercedes; Arrúe, Aurora; Basterreche, Nieves; Macías, Isabel; Catalán, Ana; Madrazo, Arantza; Bustamante, Sonia; Zamalloa, María I; Erkoreka, Leire; Gordo, Estibaliz; Arnaiz, Ainara; Olivas, Olga; Arroita, Ariane; Marín, Elena; González-Torres, Miguel A
2016-06-01
We examined the association of COMT haplotypes and plasma metabolites of catecholamines in relation to the clinical response to antipsychotics in schizophrenic and bipolar patients. We studied 165 patients before and after four weeks of treatment, and 163 healthy controls. We assessed four COMT haplotypes and the plasma concentrations of HVA, DOPAC and MHPG. Bipolar patients: haplotypes are associated with age at onset and clinical evolution. In schizophrenic patients, an haplotype previously associated with increased risk, is related to better response of negative symptoms. Haplotypes would be good indicators of the clinical status and the treatment response in bipolar and schizophrenic patients. Larger studies are required to elucidate the clinical usefulness of these findings.
Machiela, Mitchell J; Chanock, Stephen J
2015-11-01
Assessing linkage disequilibrium (LD) across ancestral populations is a powerful approach for investigating population-specific genetic structure as well as functionally mapping regions of disease susceptibility. Here, we present LDlink, a web-based collection of bioinformatic modules that query single nucleotide polymorphisms (SNPs) in population groups of interest to generate haplotype tables and interactive plots. Modules are designed with an emphasis on ease of use, query flexibility, and interactive visualization of results. Phase 3 haplotype data from the 1000 Genomes Project are referenced for calculating pairwise metrics of LD, searching for proxies in high LD, and enumerating all observed haplotypes. LDlink is tailored for investigators interested in mapping common and uncommon disease susceptibility loci by focusing on output linking correlated alleles and highlighting putative functional variants. LDlink is a free and publically available web tool which can be accessed at http://analysistools.nci.nih.gov/LDlink/. mitchell.machiela@nih.gov. Published by Oxford University Press 2015. This work is written by US Government employees and is in the public domain in the US.
Fetal hemoglobin in sickle cell anemia: The Arab-Indian haplotype and new therapeutic agents.
Habara, Alawi H; Shaikho, Elmutaz M; Steinberg, Martin H
2017-11-01
Fetal hemoglobin (HbF) has well-known tempering effects on the symptoms of sickle cell disease and its levels vary among patients with different haplotypes of the sickle hemoglobin gene. Compared with sickle cell anemia haplotypes found in patients of African descent, HbF levels in Saudi and Indian patients with the Arab-Indian (AI) haplotype exceed that in any other haplotype by nearly twofold. Genetic association studies have identified some loci associated with high HbF in the AI haplotype but these observations require functional confirmation. Saudi patients with the Benin haplotype have HbF levels almost twice as high as African patients with this haplotype but this difference is unexplained. Hydroxyurea is still the only FDA approved drug for HbF induction in sickle cell disease. While most patients treated with hydroxyurea have an increase in HbF and some clinical improvement, 10 to 20% of adults show little response to this agent. We review the genetic basis of HbF regulation focusing on sickle cell anemia in Saudi Arabia and discuss new drugs that can induce increased levels of HbF. © 2017 Wiley Periodicals, Inc.
Two Orangutan Species Have Evolved Different KIR Alleles and Haplotypes1
Guethlein, Lisbeth A.; Norman, Paul J.; Heijmans, Corinne M. C.; de Groot, Natasja G.; Hilton, Hugo G.; Babrzadeh, Farbod; Abi-Rached, Laurent; Bontrop, Ronald E.; Parham, Peter
2017-01-01
The immune and reproductive functions of human Natural Killer (NK) cells are regulated by interactions of the C1 and C2 epitopes of HLA-C with C1-specific and C2-specific lineage III killer cell immunoglobulin-like receptors (KIR). This rapidly evolving and diverse system of ligands and receptors is restricted to humans and great apes. In this context, the orangutan has particular relevance because it represents an evolutionary intermediate, one having the C1 epitope and corresponding KIR, but lacking the C2 epitope. Through a combination of direct sequencing, KIR genotyping and data mining from the Great Ape Genome Project (GAGP) we characterized the KIR alleles and haplotypes for panels of ten Bornean orangutans and 19 Sumatran orangutans. The orangutan KIR haplotypes have between five and ten KIR genes. The seven orangutan lineage III KIR genes all locate to the centromeric region of the KIR locus, whereas their human counterparts also populate the telomeric region. One lineage III KIR gene is Bornean-specific, one is Sumatran-specific and five are shared. Of twelve KIR gene-content haplotypes five are Bornean-specific, five are Sumatran-specific and two are shared. The haplotypes have different combinations of genes encoding activating and inhibitory C1 receptors that can be of higher or lower affinity. All haplotypes encode an inhibitory C1 receptor, but only some haplotypes encode an activating C1 receptor. Of 130 KIR alleles, 55 are Bornean-specific, 65 are Sumatran specific and ten are shared. PMID:28264973
Browning, Brian L.; Browning, Sharon R.
2009-01-01
We present methods for imputing data for ungenotyped markers and for inferring haplotype phase in large data sets of unrelated individuals and parent-offspring trios. Our methods make use of known haplotype phase when it is available, and our methods are computationally efficient so that the full information in large reference panels with thousands of individuals is utilized. We demonstrate that substantial gains in imputation accuracy accrue with increasingly large reference panel sizes, particularly when imputing low-frequency variants, and that unphased reference panels can provide highly accurate genotype imputation. We place our methodology in a unified framework that enables the simultaneous use of unphased and phased data from trios and unrelated individuals in a single analysis. For unrelated individuals, our imputation methods produce well-calibrated posterior genotype probabilities and highly accurate allele-frequency estimates. For trios, our haplotype-inference method is four orders of magnitude faster than the gold-standard PHASE program and has excellent accuracy. Our methods enable genotype imputation to be performed with unphased trio or unrelated reference panels, thus accounting for haplotype-phase uncertainty in the reference panel. We present a useful measure of imputation accuracy, allelic R2, and show that this measure can be estimated accurately from posterior genotype probabilities. Our methods are implemented in version 3.0 of the BEAGLE software package. PMID:19200528
Larson, D.L.; Galatowitsch, S.M.; Larson, J.L.
2011-01-01
Phragmites australis (common reed) is known to have occurred along the Platte River historically, but recent rapid increases in both distribution and density have begun to impact habitat for migrating sandhill cranes and nesting piping plovers and least terns. Invasiveness in Phragmites has been associated with the incursion of a European genotype (haplotype M) in other areas; determining the genotype of Phragmites along the central Platte River has implications for proper management of the river system. In 2008 we sampled Phragmites patches along the central Platte River from Lexington to Chapman, NE, stratified by bridge segments, to determine the current distribution of haplotype E (native) and haplotype M genotypes. In addition, we did a retrospective analysis of historical Phragmites collections from the central Platte watershed (1902-2006) at the Bessey Herbarium. Fresh tissue from the 2008 survey and dried tissue from the herbarium specimens were classified as haplotype M or E using the restriction fragment length polymorphism procedure. The European haplotype was predominant in the 2008 samples: only 14 Phragmites shoots were identified as native haplotype E; 224 were non-native haplotype M. The retrospective analysis revealed primarily native haplotype individuals. Only collections made in Lancaster County, near Lincoln, NE, were haplotype M, and the earliest of these was collected in 1973. ?? 2011 Copyright by the Center for Great Plains Studies, University of Nebraska-Lincoln.
Dong, Chaoling; Ptacek, Travis S; Redden, David T; Zhang, Kui; Brown, Elizabeth E; Edberg, Jeffrey C; McGwin, Gerald; Alarcón, Graciela S; Ramsey-Goldman, Rosalind; Reveille, John D; Vilá, Luis M; Petri, Michelle; Qin, Aijian; Wu, Jianming; Kimberly, Robert P
2014-05-01
To investigate whether the Fcγ receptor IIIa-66L/R/H (FcγRIIIa-66L/R/H) polymorphism influences net effective receptor function and to assess if the FCGR3A combined genotypes formed by FcγRIIIa-66L/R/H and FcγRIIIa-176F/V, as well as copy number variation (CNV), confer risk of developing systemic lupus erythematosus (SLE) and lupus nephritis. FcγRIIIa variants, expressed on A20 IIA1.6 cells, were used in flow cytometry-based human IgG-binding assays. Using Pyrosequencing methodology, FCGR3A single-nucleotide polymorphism and CNV genotypes were determined in a cohort of 1,728 SLE patients and 2,404 healthy controls. The FcγRIIIa-66L/R/H (rs10127939) polymorphism influenced ligand binding capacity in the presence of the FcγRIIIa-176V (rs396991) allele. There was a trend toward an association of the low-binding FcγRIIIa-176F allele with lupus nephritis among African Americans (P = 0.0609) but not among European Americans (P > 0.10). Nephritis among African American patients with SLE was associated with FcγRIIIa low-binding haplotypes containing the 66L/R/H and 176F variants (P = 0.03) and with low-binding genotype combinations (P = 0.002). No association was observed among European American patients with SLE. The distribution of FCGR3A CNV was not significantly different among controls and SLE patients with or without nephritis. FcγRIIIa-66L/R/H influences ligand binding. The low-binding haplotypes formed by 66L/R/H and 176F confer enhanced risk of lupus nephritis in African Americans. FCGR3A CNVs are not associated with SLE or lupus nephritis in either African Americans or European Americans. Copyright © 2014 by the American College of Rheumatology.
Browning, Brian L.; Yu, Zhaoxia
2009-01-01
We present a novel method for simultaneous genotype calling and haplotype-phase inference. Our method employs the computationally efficient BEAGLE haplotype-frequency model, which can be applied to large-scale studies with millions of markers and thousands of samples. We compare genotype calls made with our method to genotype calls made with the BIRDSEED, CHIAMO, GenCall, and ILLUMINUS genotype-calling methods, using genotype data from the Illumina 550K and Affymetrix 500K arrays. We show that our method has higher genotype-call accuracy and yields fewer uncalled genotypes than competing methods. We perform single-marker analysis of data from the Wellcome Trust Case Control Consortium bipolar disorder and type 2 diabetes studies. For bipolar disorder, the genotype calls in the original study yield 25 markers with apparent false-positive association with bipolar disorder at a p < 10−7 significance level, whereas genotype calls made with our method yield no associated markers at this significance threshold. Conversely, for markers with replicated association with type 2 diabetes, there is good concordance between genotype calls used in the original study and calls made by our method. Results from single-marker and haplotypic analysis of our method's genotype calls for the bipolar disorder study indicate that our method is highly effective at eliminating genotyping artifacts that cause false-positive associations in genome-wide association studies. Our new genotype-calling methods are implemented in the BEAGLE and BEAGLECALL software packages. PMID:19931040
Haplotypes in SLC24A5 Gene as Ancestry Informative Markers in Different Populations
Giardina, Emiliano; Pietrangeli, Ilenia; Martínez-Labarga, Cristina; Martone, Claudia; de Angelis, Flavio; Spinella, Aldo; De Stefano, Gianfranco; Rickards, Olga; Novelli, Giuseppe
2008-01-01
Ancestry informative markers (AIMs) are human polymorphisms that exhibit substantially allele frequency differences among populations. These markers can be useful to provide information about ancestry of samples which may be useful in predicting a perpetrator’s ethnic origin to aid criminal investigations. Variations in human pigmentation are the most obvious phenotypes to distinguish individuals. It has been recently shown that the variation of a G in an A allele of the coding single-nucleotide polymorphism (SNP) rs1426654 within SLC24A5 gene varies in frequency among several population samples according to skin pigmentation. Because of these observations, the SLC24A5 locus has been evaluated as Ancestry Informative Region (AIR) by typing rs1426654 together with two additional intragenic markers (rs2555364 and rs16960620) in 471 unrelated individuals originating from three different continents (Africa, Asia and Europe). This study further supports the role of human SLC24A5 gene in skin pigmentation suggesting that variations in SLC24A5 haplotypes can correlate with human migration and ancestry. Furthermore, our data do reveal the utility of haplotype and combined unphased genotype analysis of SLC24A5 in predicting ancestry and provide a good example of usefulness of genetic characterization of larger regions, in addition to single polymorphisms, as candidates for population-specific sweeps in the ancestral population. PMID:19440451
Haplotype-Based Genome-Wide Prediction Models Exploit Local Epistatic Interactions Among Markers
Jiang, Yong; Schmidt, Renate H.; Reif, Jochen C.
2018-01-01
Genome-wide prediction approaches represent versatile tools for the analysis and prediction of complex traits. Mostly they rely on marker-based information, but scenarios have been reported in which models capitalizing on closely-linked markers that were combined into haplotypes outperformed marker-based models. Detailed comparisons were undertaken to reveal under which circumstances haplotype-based genome-wide prediction models are superior to marker-based models. Specifically, it was of interest to analyze whether and how haplotype-based models may take local epistatic effects between markers into account. Assuming that populations consisted of fully homozygous individuals, a marker-based model in which local epistatic effects inside haplotype blocks were exploited (LEGBLUP) was linearly transformable into a haplotype-based model (HGBLUP). This theoretical derivation formally revealed that haplotype-based genome-wide prediction models capitalize on local epistatic effects among markers. Simulation studies corroborated this finding. Due to its computational efficiency the HGBLUP model promises to be an interesting tool for studies in which ultra-high-density SNP data sets are studied. Applying the HGBLUP model to empirical data sets revealed higher prediction accuracies than for marker-based models for both traits studied using a mouse panel. In contrast, only a small subset of the traits analyzed in crop populations showed such a benefit. Cases in which higher prediction accuracies are observed for HGBLUP than for marker-based models are expected to be of immediate relevance for breeders, due to the tight linkage a beneficial haplotype will be preserved for many generations. In this respect the inheritance of local epistatic effects very much resembles the one of additive effects. PMID:29549092
Haplotype-Based Genome-Wide Prediction Models Exploit Local Epistatic Interactions Among Markers.
Jiang, Yong; Schmidt, Renate H; Reif, Jochen C
2018-05-04
Genome-wide prediction approaches represent versatile tools for the analysis and prediction of complex traits. Mostly they rely on marker-based information, but scenarios have been reported in which models capitalizing on closely-linked markers that were combined into haplotypes outperformed marker-based models. Detailed comparisons were undertaken to reveal under which circumstances haplotype-based genome-wide prediction models are superior to marker-based models. Specifically, it was of interest to analyze whether and how haplotype-based models may take local epistatic effects between markers into account. Assuming that populations consisted of fully homozygous individuals, a marker-based model in which local epistatic effects inside haplotype blocks were exploited (LEGBLUP) was linearly transformable into a haplotype-based model (HGBLUP). This theoretical derivation formally revealed that haplotype-based genome-wide prediction models capitalize on local epistatic effects among markers. Simulation studies corroborated this finding. Due to its computational efficiency the HGBLUP model promises to be an interesting tool for studies in which ultra-high-density SNP data sets are studied. Applying the HGBLUP model to empirical data sets revealed higher prediction accuracies than for marker-based models for both traits studied using a mouse panel. In contrast, only a small subset of the traits analyzed in crop populations showed such a benefit. Cases in which higher prediction accuracies are observed for HGBLUP than for marker-based models are expected to be of immediate relevance for breeders, due to the tight linkage a beneficial haplotype will be preserved for many generations. In this respect the inheritance of local epistatic effects very much resembles the one of additive effects. Copyright © 2018 Jiang et al.
Barbero, Marina M. D.; Oliveira, Henrique N.; de Camargo, Gregório M. F.; Fernandes Júnior, Gerardo A.; Aspilcueta-Borquis, Rusbel R.; Souza, Fabio R. P.; Boligon, Arione A.; Melo, Thaise P.; Regatieri, Inaê C.; Feitosa, Fabieli L. B.; Fonseca, Larissa F. S.; Magalhães, Ana F. B.; Costa, Raphael B.; Albuquerque, Lucia G.
2018-01-01
Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs. PMID:29293544
Takada, Luciana; Barbero, Marina M D; Oliveira, Henrique N; de Camargo, Gregório M F; Fernandes Júnior, Gerardo A; Aspilcueta-Borquis, Rusbel R; Souza, Fabio R P; Boligon, Arione A; Melo, Thaise P; Regatieri, Inaê C; Feitosa, Fabieli L B; Fonseca, Larissa F S; Magalhães, Ana F B; Costa, Raphael B; Albuquerque, Lucia G
2018-01-01
Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs.
2013-01-01
Background In current protein research, a limitation still is the production of active recombinant proteins or native protein associations to assess their function. Especially the localization and analysis of protein-complexes or the identification of modifications and small molecule interaction partners by co-purification experiments requires a controllable expression of affinity- and/or fluorescence tagged variants of a protein of interest in its native cellular background. Advantages of periplasmic and/or homologous expressions can frequently not be realized due to a lack of suitable tools. Instead, experiments are often limited to the heterologous production in one of the few well established expression strains. Results Here, we introduce a series of new RK2 based broad host range expression plasmids for inducible production of affinity- and fluorescence tagged proteins in the cytoplasm and periplasm of a wide range of Gram negative hosts which are designed to match the recently suggested modular Standard European Vector Architecture and database. The vectors are equipped with a yellow fluorescent protein variant which is engineered to fold and brightly fluoresce in the bacterial periplasm following Sec-mediated export, as shown from fractionation and imaging studies. Expression of Strep-tag®II and Twin-Strep-tag® fusion proteins in Pseudomonas putida KT2440 is demonstrated for various ORFs. Conclusion The broad host range constructs we have produced enable good and controlled expression of affinity tagged protein variants for single-step purification and qualify for complex co-purification experiments. Periplasmic export variants enable production of affinity tagged proteins and generation of fusion proteins with a novel engineered Aequorea-based yellow fluorescent reporter protein variant with activity in the periplasm of the tested Gram-negative model bacteria Pseudomonas putida KT2440 and Escherichia coli K12 for production, localization or co
Buddy Tag CONOPS and Requirements.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brotz, Jay Kristoffer; Deland, Sharon M.
2015-12-01
This document defines the concept of operations (CONOPS) and the requirements for the Buddy Tag, which is conceived and designed in collaboration between Sandia National Laboratories and Princeton University under the Department of State Key VerificationAssets Fund. The CONOPS describe how the tags are used to support verification of treaty limitations and is only defined to the extent necessary to support a tag design. The requirements define the necessary functions and desired non-functional features of the Buddy Tag at a high level
Contu, L; Carcassi, C; Dausset, J
1989-01-01
The C4 and 21-OH loci of the class III HLA have been studied by specific DNA probes and the restriction enzyme Taq 1 in 24 unrelated Sardinian individuals selected from completely HLA-typed families. All 24 individuals had the HLA extended haplotype A30,Cw5,B18, BfF1,DR3,DRw52,DQw2, named "Sardinian" in the present paper because of its frequency of 15% in the Sardinian population. Eighteen of these were homozygous for the entire haplotype, and six were heterozygous at the A locus and blank (or homozygous) at all the other loci. In all completely homozygous cells and in four heterozygous cells at the A locus, the restriction fragments of the 21-OHA (3.2 kb) and C4B (5.8 kb or 5.4 kb) genes were absent, and the fragments of the C4A (7.0 kb) and 21-OHB (3.7 kb) genes were present. It is suggested that the "Sardinian" haplotype is an ancestral haplotype without duplication of the C4 and 21-OH genes, practically always identical in its structure, also in unrelated individuals. The diversity of this haplotype in the class III region (about 30 kb less) may be at least partially responsible for its misalignment with most haplotypes, which have duplicated C4 and 21-OH genes, and therefore also for its decreased probability to recombine. This can help explain its high stability and frequency in the Sardinian population. The same conclusion can be suggested for the Caucasian extended haplotype A1,B8,DR3 that always seems to lack the C4A and 21-OHA genes.
Yin, Honglei; Zhang, Yuzhen; Hua, Linlin; Li, Jinfeng; Zeng, Zhilei; Yang, Xiaopeng; Gong, Bin; Geng, Shuang; Liu, Yajun; Zhang, Hui; Liu, Yanqiu; Zhao, Jing; Wang, Yunliang
2017-01-01
Aims To investigate the impact of Interleukin-16 (IL- 16) and Adiponectin (ANP) gene single nucleotide polymorphisms (SNPs), gene- gene interactions and haplotype on late-onset Alzheimer’s disease (LOAD) risk. Methods Hardy-Weinberg equilibrium (HWE), haplotype and pairwise linkage disequilibrium (LD) analysis were investigated by using SNPstats (available online at http://bioinfo.iconcologia.net/SNPstats). Generalized multifactor dimensionality reduction (GMDR) was used to examine interaction among 4 SNPs, odds ratio (OR) and 95% confident interval (95%CI) were calculated by logistic regression model. Results LOAD risk was significantly higher in carriers of rs266729- G allele than those with CC genotype (CG+ GG versus CC), OR (95%CI) =1.61 (1.26-1.96), and higher in carriers of rs1501299- T allele, OR (95%CI) = 1.62 (1.32-2.12), lower in carriers of rs4072111- T allele, adjusted OR (95%CI) =0.65 (0.44-0.93). We also found a significant gene- gene interaction between rs266729 and rs4072111. Participants with CG or GG of rs266729 and CC of rs4072111 genotype have the highest LOAD risk, OR (95%CI) = 2.62 (1.64 -3.58). Haplotype containing the rs266729- G and rs1501299- T alleles were associated with increased LOAD risk, OR (95%CI)= 1.83 (1.32- 2.43), and haplotype containing the rs1131445- C and rs4072111- T alleles were associated with decreased LOAD risk, OR (95%CI)= 0.53 (0.18- 0.95). Conclusions We concluded that rs266729 and rs1501299 minor alleles were associated with increased LOAD risk, but rs4072111 minor allele was associated with decreased LOAD risk. We also found that interaction involving rs266729 and rs4072111, and haplotype combinations were associated with LOAD risk. PMID:29108295
Bodea, Corneliu A; Middleton, Frank A; Melhem, Nadine M; Klei, Lambertus; Song, Youeun; Tiobech, Josepha; Marumoto, Pearl; Yano, Victor; Faraone, Stephen V; Roeder, Kathryn; Myles-Worsley, Marina; Devlin, Bernie; Byerley, William
2017-02-01
To localize genetic variation affecting risk for psychotic disorders in the population of Palau, we genotyped DNA samples from 203 Palauan individuals diagnosed with psychotic disorders, broadly defined, and 125 control subjects using a genome-wide single nucleotide polymorphism array. Palau has unique features advantageous for this study: due to its population history, Palauans are substantially interrelated; affected individuals often, but not always, cluster in families; and we have essentially complete ascertainment of affected individuals. To localize risk variants to genomic regions, we evaluated long-shared haplotypes, ≥10 Mb, identifying clusters of affected individuals who share such haplotypes. This extensive sharing, typically identical by descent, was significantly greater in cases than population controls, even after controlling for relatedness. Several regions of the genome exhibited substantial excess of shared haplotypes for affected individuals, including 3p21, 3p12, 4q28, and 5q23-q31. Two of these regions, 4q28 and 5q23-q31, showed significant linkage by traditional LOD score analysis and could harbor variants of more sizeable risk for psychosis or a multiplicity of risk variants. The pattern of haplotype sharing in 4q28 highlights PCDH10 , encoding a cadherin-related neuronal receptor, as possibly involved in risk.
SparkClouds: visualizing trends in tag clouds.
Lee, Bongshin; Riche, Nathalie Henry; Karlson, Amy K; Carpendale, Sheelash
2010-01-01
Tag clouds have proliferated over the web over the last decade. They provide a visual summary of a collection of texts by visually depicting the tag frequency by font size. In use, tag clouds can evolve as the associated data source changes over time. Interesting discussions around tag clouds often include a series of tag clouds and consider how they evolve over time. However, since tag clouds do not explicitly represent trends or support comparisons, the cognitive demands placed on the person for perceiving trends in multiple tag clouds are high. In this paper, we introduce SparkClouds, which integrate sparklines into a tag cloud to convey trends between multiple tag clouds. We present results from a controlled study that compares SparkClouds with two traditional trend visualizations—multiple line graphs and stacked bar charts—as well as Parallel Tag Clouds. Results show that SparkClouds ability to show trends compares favourably to the alternative visualizations.
Missing data imputation and haplotype phase inference for genome-wide association studies
Browning, Sharon R.
2009-01-01
Imputation of missing data and the use of haplotype-based association tests can improve the power of genome-wide association studies (GWAS). In this article, I review methods for haplotype inference and missing data imputation, and discuss their application to GWAS. I discuss common features of the best algorithms for haplotype phase inference and missing data imputation in large-scale data sets, as well as some important differences between classes of methods, and highlight the methods that provide the highest accuracy and fastest computational performance. PMID:18850115
Analysis of MHC class I genes across horse MHC haplotypes
Tallmadge, Rebecca L.; Campbell, Julie A.; Miller, Donald C.; Antczak, Douglas F.
2010-01-01
The genomic sequences of 15 horse Major Histocompatibility Complex (MHC) class I genes and a collection of MHC class I homozygous horses of five different haplotypes were used to investigate the genomic structure and polymorphism of the equine MHC. A combination of conserved and locus-specific primers was used to amplify horse MHC class I genes with classical and non-classical characteristics. Multiple clones from each haplotype identified three to five classical sequences per homozygous animal, and two to three non-classical sequences. Phylogenetic analysis was applied to these sequences and groups were identified which appear to be allelic series, but some sequences were left ungrouped. Sequences determined from MHC class I heterozygous horses and previously described MHC class I sequences were then added, representing a total of ten horse MHC haplotypes. These results were consistent with those obtained from the MHC homozygous horses alone, and 30 classical sequences were assigned to four previously confirmed loci and three new provisional loci. The non-classical genes had few alleles and the classical genes had higher levels of allelic polymorphism. Alleles for two classical loci with the expected pattern of polymorphism were found in the majority of haplotypes tested, but alleles at two other commonly detected loci had more variation outside of the hypervariable region than within. Our data indicate that the equine Major Histocompatibility Complex is characterized by variation in the complement of class I genes expressed in different haplotypes in addition to the expected allelic polymorphism within loci. PMID:20099063
Wang, Yibo; Zhang, Weili; Zhang, Yuhui; Yang, Yuejin; Sun, Lizhong; Hu, Shengshou; Chen, Jilin; Zhang, Channa; Zheng, Yi; Zhen, Yisong; Sun, Kai; Fu, Chunyan; Yang, Tao; Wang, Jianwei; Sun, Jing; Wu, Haiying; Glasgow, Wayne C; Hui, Rutai
2006-03-28
The haplotypes in the gene vitamin K epoxide reductase complex subunit 1 (VKORC1) have been found to affect warfarin dose response through effects on the formation of reduced-form vitamin K, a cofactor for gamma-carboxylation of vitamin K-dependent proteins, which is involved in the coagulation cascade and has a potential impact on atherosclerosis. We hypothesized that VKORC1-dependent effects on the coagulation cascade and atherosclerosis would contribute to susceptibility for vascular diseases. To test the hypothesis, we studied the association of polymorphisms of VKORC1 with stroke (1811 patients), coronary heart disease (740 patients), and aortic dissection (253 patients) compared with matched controls (n=1811, 740, and 416, respectively). Five common noncoding single-nucleotide polymorphisms of VKORC1 were identified in a natural haplotype block with strong linkage disequilibrium (D'>0.9, r2>0.9), then single-nucleotide polymorphism (SNP) +2255 in the block was selected for the association study. We found that the presence of the C allele of the +2255 locus conferred almost twice the risk of vascular disease (odds ratio [OR] 1.95, 95% confidence interval [CI] .58 to 2.41, P<0.001 for stroke; OR 1.72, 95% CI 1.24 to 2.38, P<0.01 for coronary heart disease; and OR 1.90, 95% CI 1.04 to 3.48, P<0.05 for aortic dissection). We also observed that subjects with the CC and CT genotypes had lower levels of undercarboxylated osteocalcin (a regulator for the bone), probably vascular calcification, and lower levels of protein induced in vitamin K absence or antagonism II (PIVKA-II, a des-gamma-carboxy prothrombin) than those with TT genotypes. The haplotype of VKORC1 may serve as a novel genetic marker for the risk of stroke, coronary heart disease, and aortic dissection.
Tiffan, Kenneth F.; Perry, Russell W.; Connor, William P.; Mullins, Frank L.; Rabe, Craig; Nelson, Doug D
2015-01-01
The ability to represent a population of migratory juvenile fish with PIT tags becomes difficult when the minimum tagging size is larger than the average size at which fish begin to move downstream. Tags that are smaller (e.g., 8 and 9 mm) than the commonly used 12-mm PIT tags are currently available, but their effects on survival, growth, and tag retention in small salmonid juveniles have received little study. We evaluated growth, survival, and tag retention in age-0 Chinook Salmon Oncorhynchus tshawytscha of three size-groups: 40–49-mm fish were implanted with 8- and 9-mm tags, and 50– 59-mm and 60–69-mm fish were implanted with 8-, 9-, and 12-mm tags. Survival 28 d after tagging ranged from 97.8% to 100% across all trials, providing no strong evidence for a fish-size-related tagging effect or a tag size effect. No biologically significant effects of tagging on growth in FL (mm/d) or weight (g/d) were observed. Although FL growth in tagged fish was significantly reduced for the 40–49-mm and 50–59-mm groups over the first 7 d, growth rates were not different thereafter, and all fish were similar in size by the end of the trials (day 28). Tag retention across all tests ranged from 93% to 99%. We acknowledge that actual implantation of 8- or 9-mm tags into small fish in the field will pose additional challenges (e.g., capture and handling stress) beyond those observed in our laboratory. However, we conclude that experimental use of the smaller tags for small fish in the field is supported by our findings.
Immobilization of proteins onto microbeads using a DNA binding tag for enzymatic assays.
Kojima, Takaaki; Mizoguchi, Takuro; Ota, Eri; Hata, Jumpei; Homma, Keisuke; Zhu, Bo; Hitomi, Kiyotaka; Nakano, Hideo
2016-02-01
A novel DNA-binding protein tag, scCro-tag, which is a single-chain derivative of the bacteriophage lambda Cro repressor, has been developed to immobilize proteins of interest (POI) on a solid support through binding OR consensus DNA (ORC) that is tightly bound by the scCro protein. The scCro-tag successfully bound a transglutaminase 2 (TGase 2) substrate and manganese peroxidase (MnP) to microbeads via scaffolding DNA. The resulting protein-coated microbeads can be utilized for functional analysis of the enzymatic activity using flow cytometry. The quantity of bead-bound proteins can be enhanced by increasing the number of ORCs. In addition, proteins with the scCro-tag that were synthesized using a cell-free protein synthesis system were also immobilized onto the beads, thus indicating that this bead-based system would be applicable to high-throughput analysis of various enzymatic activities. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Palfreyman, Justin J.; Beldon, Patrick; Hong, Bingyan; Vyas, Kunal N.; Cooper, Joshaniel F. K.; Mitrelias, Thanos; Barnes, Crispin H. W.
2010-12-01
Rows of rectangular magnetic elements with different aspect ratio are encapsulated in polymer microcarriers to form a novel magnetic label, or tag, for multiplexed biological and chemical assays. We demonstrate that each tag can be encoded using an external magnetic field applied to the whole tag, which will allow for in-flow writing, thanks to shape-anisotropy controlled coercivity of the individual bits. This paper focuses on the fabrication of our 2nd generation tags, which facilitate optical trapping, do not require a sacrificial release layer, and the alignment procedure has been simplified to a single step. A new procedure is described for recovering a functional surface from fully cross-linked SU-8 via a cerium (IV) ammonium nitrate based chemical etch, and a novel method for releasing patterned photoresist from a bare Si wafer is discussed. In addition, a series of homobifunctional amine spacer compounds are compared as a method of increasing the binding efficiency of surface probe molecules.
Molecular pathology and haplotype analysis of Wilson disease in Mediterranean populations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Figus, A.; Farcia, A.M.G.; Nurchi, A.
1995-12-01
We analyzed mutations and defined the chromosomal haplotype in 127 patients of Mediterranean descent who were affected in Wilson disease (WD): 39 Sardinians, 49 Italians, 33 Turks, and 6 Albanians. Haplotypes were derived by use of the microsatellite markers D13S301, D13S296, D13S297, and D13S298, which are linked to the WD locus. There were five common haplotypes in Sardinians, three in Italians, and two in Turks, which accounted for 85%, 32%, and 30% of the WD chromosomes, respectively. We identified 16 novel mutations: 8 frameshifts, 7 missense mutations, and 1 splicing defect. In addition, we detected the previously described mutations: 2302insC,more » 3404delC, Arg1320ter, Gly944Ser, and His1070Gin. Of the new mutations detected, two, the 1515insT on haplotype I and 2464delC on haplotype XVI, accounted for 6% and 13%, respectively, of the mutations in WD chromsomes in the Sardinian populations. Mutations H1070Q, 2302insC, and 2533delA represented 13%, 8%, and 8%, respectively, of the mutations in WD chromsomes in other Mediterranean populations. The remaining mutations were rare and limited to one or two patients from different populations. Thus, WD results from some frequent mutations and many rare defects. 28 refs., 1 fig., 3 tabs.« less
Haplotype analysis of the apolipoprotein gene cluster on human chromosome 11
Olivier, Michael; Wang, Xujing; Cole, Regina; Gau, Brian; Kim, Jessica; Rubin, Edward M.; Pennacchio, Len A.
2009-01-01
Members of the apolipoprotein gene cluster (APOA1/C3/A4/A5) on human chromosome 11q23 play an important role in lipid metabolism. Polymorphisms in both APOA5 and APOC3 are strongly associated with plasma triglyceride concentrations. The close genomic locations of these two genes as well as their functional similarity have hindered efforts to define whether each gene independently influences human triglyceride concentrations. In this study, we examined the linkage disequilibrium and haplotype structure of 49 SNPs in a 150-kb region spanning the gene cluster. We identified a total of five common APOA5 haplotypes with a frequency of greater than 8% in samples of northern European origin. The APOA5 haplotype block did not extend past the 7 SNPs in the gene and was separated from the other apolipoprotein gene in the cluster by a region of significantly increased recombination. Furthermore, one previously identified triglyceride risk haplotype of APOA5 (APOA5*3) showed no association with three APOC3 SNPs previously associated with triglyceride concentrations, in contrast to the other risk haplotype (APOA5*2), which was associated with all three minor APOC3 SNP alleles. These results highlight the complex genetic relationship between APOA5 and APOC3 and support the notion that APOA5 represents an independent risk gene affecting plasma triglyceride concentrations in humans. PMID:15081120
Comparing the hierarchy of author given tags and repository given tags in a large document archive
NASA Astrophysics Data System (ADS)
Tibély, Gergely; Pollner, Péter; Palla, Gergely
2016-10-01
Folksonomies - large databases arising from collaborative tagging of items by independent users - are becoming an increasingly important way of categorizing information. In these systems users can tag items with free words, resulting in a tripartite item-tag-user network. Although there are no prescribed relations between tags, the way users think about the different categories presumably has some built in hierarchy, in which more special concepts are descendants of some more general categories. Several applications would benefit from the knowledge of this hierarchy. Here we apply a recent method to check the differences and similarities of hierarchies resulting from tags given by independent individuals and from tags given by a centrally managed repository system. The results from our method showed substantial differences between the lower part of the hierarchies, and in contrast, a relatively high similarity at the top of the hierarchies.
Risk of Pediatric Celiac Disease According to HLA Haplotype and Country
Liu, Edwin; Lee, Hye-Seung; Aronsson, Carin A.; Hagopian, William A.; Koletzko, Sibylle; Rewers, Marian J.; Eisenbarth, George S.; Bingley, Polly J.; Bonifacio, Ezio; Simell, Ville; Agardh, Daniel
2014-01-01
BACKGROUND The presence of HLA haplotype DR3–DQ2 or DR4–DQ8 is associated with an increased risk of celiac disease. In addition, nearly all children with celiac disease have serum antibodies against tissue transglutaminase (tTG). METHODS We studied 6403 children with HLA haplotype DR3–DQ2 or DR4–DQ8 prospectively from birth in the United States, Finland, Germany, and Sweden. The primary end point was the development of celiac disease autoimmunity, which was defined as the presence of tTG antibodies on two consecutive tests at least 3 months apart. The secondary end point was the development of celiac disease, which was defined for the purpose of this study as either a diagnosis on biopsy or persistently high levels of tTG antibodies. RESULTS The median follow-up was 60 months (interquartile range, 46 to 77). Celiac disease autoimmunity developed in 786 children (12%). Of the 350 children who underwent biopsy, 291 had confirmed celiac disease; an additional 21 children who did not undergo biopsy had persistently high levels of tTG antibodies. The risks of celiac disease autoimmunity and celiac disease by the age of 5 years were 11% and 3%, respectively, among children with a single DR3–DQ2 haplotype, and 26% and 11%, respectively, among those with two copies (DR3–DQ2 homozygosity). In the adjusted model, the hazard ratios for celiac disease autoimmunity were 2.09 (95% confidence interval [CI], 1.70 to 2.56) among heterozygotes and 5.70 (95% CI, 4.66 to 6.97) among homozygotes, as compared with children who had the lowest-risk genotypes (DR4–DQ8 heterozygotes or homozygotes). Residence in Sweden was also independently associated with an increased risk of celiac disease autoimmunity (hazard ratio, 1.90; 95% CI, 1.61 to 2.25). CONCLUSIONS Children with the HLA haplotype DR3–DQ2, especially homozygotes, were found to be at high risk for celiac disease autoimmunity and celiac disease early in childhood. The higher risk in Sweden than in other countries
COLE-TOBIAN, JENNIFER L.; ZIMMERMAN, PETER A.; KING, CHRISTOPHER L.
2013-01-01
Individuals living in malaria endemic areas are often infected with multiple parasite clones. Currently used single nucleotide polymorphism (SNP) genotyping methods for malaria parasites are cumbersome; furthermore, few methods currently exist that can rapidly determine the most abundant clone in these complex infections. Here we describe an oligonucleotide ligation assay (OLA) to distinguish SNPs in the Plasmodium vivax Duffy binding protein gene (Pvdbp) at 14 polymorphic residues simultaneously. Allele abundance is determined by the highest mean fluorescent intensity of each allele. Using mixtures of plasmids encoding known haplotypes of the Pvdbp, single clones of P. vivax parasites from infected Aotus monkeys, and well-defined mixed infections from field samples, we were able to identify the predominant Pvdbp genotype with > 93% accuracy when the dominant clone is twice as abundant as a lesser genotype and > 97% of the time if the ratio was 5:1 or greater. Thus, the OLA can accurately, reproducibly, and rapidly determine the predominant parasite haplotype in complex blood stage infections. PMID:17255222
Mendel-GPU: haplotyping and genotype imputation on graphics processing units
Chen, Gary K.; Wang, Kai; Stram, Alex H.; Sobel, Eric M.; Lange, Kenneth
2012-01-01
Motivation: In modern sequencing studies, one can improve the confidence of genotype calls by phasing haplotypes using information from an external reference panel of fully typed unrelated individuals. However, the computational demands are so high that they prohibit researchers with limited computational resources from haplotyping large-scale sequence data. Results: Our graphics processing unit based software delivers haplotyping and imputation accuracies comparable to competing programs at a fraction of the computational cost and peak memory demand. Availability: Mendel-GPU, our OpenCL software, runs on Linux platforms and is portable across AMD and nVidia GPUs. Users can download both code and documentation at http://code.google.com/p/mendel-gpu/. Contact: gary.k.chen@usc.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22954633
Manlig, Erika; Wahlberg, Per
2017-01-01
Abstract Sodium bisulphite treatment of DNA combined with next generation sequencing (NGS) is a powerful combination for the interrogation of genome-wide DNA methylation profiles. Library preparation for whole genome bisulphite sequencing (WGBS) is challenging due to side effects of the bisulphite treatment, which leads to extensive DNA damage. Recently, a new generation of methods for bisulphite sequencing library preparation have been devised. They are based on initial bisulphite treatment of the DNA, followed by adaptor tagging of single stranded DNA fragments, and enable WGBS using low quantities of input DNA. In this study, we present a novel approach for quick and cost effective WGBS library preparation that is based on splinted adaptor tagging (SPLAT) of bisulphite-converted single-stranded DNA. Moreover, we validate SPLAT against three commercially available WGBS library preparation techniques, two of which are based on bisulphite treatment prior to adaptor tagging and one is a conventional WGBS method. PMID:27899585
Modeling misidentification errors that result from use of genetic tags in capture-recapture studies
Yoshizaki, J.; Brownie, C.; Pollock, K.H.; Link, W.A.
2011-01-01
Misidentification of animals is potentially important when naturally existing features (natural tags) such as DNA fingerprints (genetic tags) are used to identify individual animals. For example, when misidentification leads to multiple identities being assigned to an animal, traditional estimators tend to overestimate population size. Accounting for misidentification in capture-recapture models requires detailed understanding of the mechanism. Using genetic tags as an example, we outline a framework for modeling the effect of misidentification in closed population studies when individual identification is based on natural tags that are consistent over time (non-evolving natural tags). We first assume a single sample is obtained per animal for each capture event, and then generalize to the case where multiple samples (such as hair or scat samples) are collected per animal per capture occasion. We introduce methods for estimating population size and, using a simulation study, we show that our new estimators perform well for cases with moderately high capture probabilities or high misidentification rates. In contrast, conventional estimators can seriously overestimate population size when errors due to misidentification are ignored. ?? 2009 Springer Science+Business Media, LLC.
Extended-Range Passive RFID and Sensor Tags
NASA Technical Reports Server (NTRS)
Fink, Patrick W.; Kennedy, Timothy F.; Lin, Gregory Y.; Barton, Richard
2012-01-01
an electrical signal to an acoustic wave that propagates along a surface and encounters multiple reflectors suitably positioned along the surface. Upon returning to the input end, the reflected acoustic wave is re-converted to an electrical signal, which, in turn, is reradiated from an antenna. The distances between the reflectors in the SAW device and the corresponding times between reflections encode the identifying or sensory information onto the reradiated signal. The fundamental problem in the present development is how to combine a Van Atta antenna array (which is inherently a multiple-port device) and one or more one-port SAW device(s) into a single, compact, passive unit that can function as a retroreflective RFID tag. The solution is to use one or more hybrid, half-power 90 couplers. A basic unit of this type, shown in Figure 2, includes a half-power 90 hybrid coupler; two identical SAW devices (SAW1 and SAW2) connected to ports 3 and 4 of the coupler, respectively; and antenna elements connected to ports 1 and 2 of the coupler. Necessarily omitting details for the sake of brevity, it must suffice to report that the phase relationships among the coupler inputs and outputs are such as to couple the incident signal from the antenna elements to the SAW devices and couple the reflected signals from the SAW devices back to the antenna elements in the phase relationships required for a Van Atta array. Hence, the reradiated signal is automatically directed back toward the interrogating transceiver and contains identifying and/or sensory information encoded in time intervals between reflections.
NASA Astrophysics Data System (ADS)
Ryan, Diarmuid; Wögerbauer, Ciara; Roche, William
2016-12-01
The ability to determine connectivity between juveniles in nursery estuaries and adult populations is an important tool for fisheries management. Otoliths of juvenile fish contain geochemical tags, which reflect the variation in estuarine elemental chemistry, and allow discrimination of their natal and/or nursery estuaries. These tags can be used to investigate connectivity patterns between juveniles and adults. However, inter-annual variability of geochemical tags may limit the accuracy of nursery origin determinations. Otolith elemental composition was used to assign a single cohort of 0-group sea bass Dicentrarchus labrax to their nursery estuary thus establishing an initial baseline for stocks in waters around Ireland. Using a standard LDFA model, high classification accuracies to nursery sites (80-88%) were obtained. Temporal stability of otolith geochemical tags was also investigated to assess if annual sampling is required for connectivity studies. Geochemical tag stability was found to be strongly estuary dependent.
Schlebusch, Carina M; Soodyall, Himlya
2012-12-01
The San and Khoe people currently represent remnant groups of a much larger and widely distributed population of hunter-gatherers and pastoralists who had exclusive occupation of southern Africa before the arrival of Bantu-speaking groups in the past 1,200 years and sea-borne immigrants within the last 350 years. Genetic studies [mitochondrial deoxyribonucleic acid (DNA) and Y-chromosome] conducted on San and Khoe groups revealed that they harbor some of the most divergent lineages found in living peoples throughout the world. Recently, high-density, autosomal, single-nucleotide polymorphism (SNP)-array studies confirmed the early divergence of Khoe-San population groups from all other human populations. The present study made use of 220 autosomal SNP markers (in the format of both haplotypes and genotypes) to examine the population structure of various San and Khoe groups and their relationship to other neighboring groups. Whereas analyses based on the genotypic SNP data only supported the division of the included populations into three main groups-Khoe-San, Bantu-speakers, and non-African populations-haplotype analyses revealed finer structure within Khoe-San populations. By the use of only 44 short SNP haplotypes (compiled from a total of 220 SNPs), most of the Khoe-San groups could be resolved as separate groups by applying STRUCTURE analyses. Therefore, by carefully selecting a few SNPs and combining them into haplotypes, we were able to achieve the same level of population distinction that was achieved previously in high-density SNP studies on the same population groups. Using haplotypes proved to be a very efficient and cost-effective way to study population structure. Copyright © 2013 Wayne State University Press, Detroit, Michigan 48201-1309.
The whole genome sequences and experimentally phased haplotypes of over 100 personal genomes.
Mao, Qing; Ciotlos, Serban; Zhang, Rebecca Yu; Ball, Madeleine P; Chin, Robert; Carnevali, Paolo; Barua, Nina; Nguyen, Staci; Agarwal, Misha R; Clegg, Tom; Connelly, Abram; Vandewege, Ward; Zaranek, Alexander Wait; Estep, Preston W; Church, George M; Drmanac, Radoje; Peters, Brock A
2016-10-11
Since the completion of the Human Genome Project in 2003, it is estimated that more than 200,000 individual whole human genomes have been sequenced. A stunning accomplishment in such a short period of time. However, most of these were sequenced without experimental haplotype data and are therefore missing an important aspect of genome biology. In addition, much of the genomic data is not available to the public and lacks phenotypic information. As part of the Personal Genome Project, blood samples from 184 participants were collected and processed using Complete Genomics' Long Fragment Read technology. Here, we present the experimental whole genome haplotyping and sequencing of these samples to an average read coverage depth of 100X. This is approximately three-fold higher than the read coverage applied to most whole human genome assemblies and ensures the highest quality results. Currently, 114 genomes from this dataset are freely available in the GigaDB repository and are associated with rich phenotypic data; the remaining 70 should be added in the near future as they are approved through the PGP data release process. For reproducibility analyses, 20 genomes were sequenced at least twice using independent LFR barcoded libraries. Seven genomes were also sequenced using Complete Genomics' standard non-barcoded library process. In addition, we report 2.6 million high-quality, rare variants not previously identified in the Single Nucleotide Polymorphisms database or the 1000 Genomes Project Phase 3 data. These genomes represent a unique source of haplotype and phenotype data for the scientific community and should help to expand our understanding of human genome evolution and function.
Balam-Ortiz, Eros; Esquivel-Villarreal, Adolfo; Huerta-Hernandez, David; Fernandez-Lopez, Juan Carlos; Alfaro-Ruiz, Luis; Muñoz-Monroy, Omar; Gutierrez, Ruth; Figueroa-Genis, Enrique; Carrillo, Karol; Elizalde, Adela; Hidalgo, Alfredo; Rodriguez, Mauricio; Urushihara, Maki; Kobori, Hiroyuki; Jimenez-Sanchez, Gerardo
2012-04-01
The angiotensinogen gene locus has been associated with essential hypertension in most populations analyzed to date. Increased plasma angiotensinogen levels have been proposed as an underlying cause of essential hypertension in whites; however, differences in the genetic regulation of plasma angiotensinogen levels have also been reported for other populations. The aim of this study was to analyze the relationship between angiotensinogen gene polymorphisms and haplotypes with plasma angiotensinogen levels and the risk of essential hypertension in the Mexican population. We genotyped 9 angiotensinogen gene polymorphisms in 706 individuals. Four polymorphisms, A-6, C4072, C6309, and G12775, were associated with increased risk, and the strongest association was found for the C6309 allele (χ(2)=23.9; P=0.0000009), which resulted in an odds ratio of 3.0 (95% CI: 1.8-4.9; P=0.000006) in the recessive model. Two polymorphisms, A-20C (P=0.003) and C3389T (P=0.0001), were associated with increased plasma angiotensinogen levels but did not show association with essential hypertension. The haplotypes H1 (χ(2)=8.1; P=0.004) and H5 (χ(2)=5.1; P=0.02) were associated with essential hypertension. Using phylogenetic analysis, we found that haplotypes 1 and 5 are the human ancestral haplotypes. Our results suggest that the positive association between angiotensinogen gene polymorphisms and haplotypes with essential hypertension is not simply explained by an increase in plasma angiotensinogen concentration. Complex interactions between risk alleles suggest that these haplotypes act as "superalleles."
Balam-Ortiz, Eros; Esquivel-Villarreal, Adolfo; Huerta-Hernandez, David; Fernandez-Lopez, Juan Carlos; Alfaro-Ruiz, Luis; Muñoz-Monroy, Omar; Gutierrez, Ruth; Figueroa-Genis, Enrique; Carrillo, Karol; Elizalde, Adela; Hidalgo, Alfredo; Rodriguez, Mauricio; Urushihara, Maki; Kobori, Hiroyuki; Jimenez-Sanchez, Gerardo
2012-01-01
The angiotensinogen gene locus has been associated with essential hypertension in most populations analyzed to date. Increased plasma angiotensinogen levels have been proposed as an underlying cause of essential hypertension in whites; however, differences in the genetic regulation of plasma angiotensinogen levels have also been reported for other populations. The aim of this study was to analyze the relationship between angiotensinogen gene polymorphisms and haplotypes with plasma angiotensinogen levels and the risk of essential hypertension in the Mexican population. We genotyped 9 angiotensinogen gene polymorphisms in 706 individuals. Four polymorphisms, A-6, C4072, C6309, and G12775, were associated with increased risk, and the strongest association was found for the C6309 allele (χ2 = 23.9; P = 0.0000009), which resulted in an odds ratio of 3.0 (95% CI: 1.8–4.9; P = 0.000006) in the recessive model. Two polymorphisms, A-20C (P = 0.003) and C3389T (P = 0.0001), were associated with increased plasma angiotensinogen levels but did not show association with essential hypertension. The haplotypes H1 (χ2 = 8.1; P = 0.004) and H5 (χ2 = 5.1; P = 0.02) were associated with essential hypertension. Using phylogenetic analysis, we found that haplotypes 1 and 5 are the human ancestral haplotypes. Our results suggest that the positive association between angiotensinogen gene polymorphisms and haplotypes with essential hypertension is not simply explained by an increase in plasma angiotensinogen concentration. Complex interactions between risk alleles suggest that these haplotypes act as “superalleles.” PMID:22371359
The HLA-DRB9 gene and the origin of HLA-DR haplotypes.
Gongora, R; Figueroa, F; Klein, J
1996-11-01
HLA-DRB9 is a gene fragment consisting of exon 2 and flanking intron sequences. It is located at the extreme end of the DRB subregion, whose other end is demarcated by the DRB1 locus. We sequenced approximately 1400 base pairs of the segment encompassing the DRB9 locus from eight human haplotypes (DR1, DR10, DR2, DR3, DR5, DR6, DR8, and DR9, the DR4 and DR7 having been sequenced by others earlier), as well as two chimpanzee, five gorillas, one orangutan and one macaque haplotype. The analysis of these sequences indicates that the DRB9 locus, which we estimate to be more than 58 million years (my) old, has been coevolving with the DRB1 locus for the last 4.2 my. As a consequence of this coevolution, the human DRB9 alleles fall into groups that correlate with the DRB1 allelic groups and with the gene organization of the human haplotypes. This observation implies that the present-day HLA-DR haplotype groups (DR1, DR51, DR52, DR8, and DR53) were founded more than 4 my ago and have remained intact (barring minor internal rearrangements that did not recombine the DRB1 and DRB9 genes) for this period of time. The haplotypes have been transmitted during speciations from ancestral to emerging species just like allelic lineages at the DRB1 locus. Thus not only allelic but also haplotype polymorphism evolves trans-specifically.
Powers, T O; Bernard, E C; Harris, T; Higgins, R; Olson, M; Lodema, M; Mullin, P; Sutton, L; Powers, K S
2014-07-03
Without applying an a priori bias for species boundaries, specimen identities in the plant-parasitic nematode genus Mesocriconema were evaluated by examining mitochondrial COI nucleotide sequences, morphology, and biogeography. A total of 242 specimens that morphologically conformed to the genus were individually photographed, measured, and amplified by a PCR primer set to preserve the linkage between specimen morphology and a specific DNA barcode sequence. Specimens were extracted from soil samples representing 45 locations across 23 ecoregions in North America. Dendrograms constructed by neighbor-joining, maximum likelihood, and Bayesian Inference using a 721-bp COI barcode were used to group COI haplotypes. Each tree-building approach resulted in 24 major haplotype groups within the dataset. The distinctiveness of these groups was evaluated by node support, genetic distance, absence of intermediates, and several measures of distinctiveness included in software used for the exploration of species boundaries. Five of the 24 COI haplotype groups corresponded to morphologically characterized, Linnaean species. Morphospecies conforming to M. discus, Discocriconemella inarata, M. rusticum, M. onoense, and M. kirjanovae were represented by groups composed of multiple closely related or identical COI haplotypes. In other cases, morphospecies names could be equally applied to multiple haplotype groups that were genetically distant from each other. Identification based on morphology alone resulted in M. curvatum and M. ornatum species designations applied to seven and three groups, respectively. Morphological characters typically used for species level identification were demonstrably variable within haplotype groups, suggesting caution in assigning species names based on published compendia that solely consider morphological characters. Morphospecies classified as M. xenoplax formed a monophyletic group composed of seven genetically distinct COI subgroups. The species
Chan, Kitti W. K.; Choy, Kit-Ying; Rénia, Laurent; Russell, Bruce; Lear, Martin J.; Nosten, François H.; Tan, Kevin S. W.; Chow, Larry M. C.
2014-01-01
Chloroquine was a cheap, extremely effective drug against Plasmodium falciparum until resistance arose. One approach to reversing resistance is the inhibition of chloroquine efflux from its site of action, the parasite digestive vacuole. Chloroquine accumulation studies have traditionally relied on radiolabelled chloroquine, which poses several challenges. There is a need for development of a safe and biologically relevant substitute. We report here a commercially-available green fluorescent chloroquine-BODIPY conjugate, LynxTag-CQGREEN, as a proxy for chloroquine accumulation. This compound localized to the digestive vacuole of the parasite as observed under confocal microscopy, and inhibited growth of chloroquine-sensitive strain 3D7 more extensively than in the resistant strains 7G8 and K1. Microplate reader measurements indicated suppression of LynxTag-CQGREEN efflux after pretreatment of parasites with known reversal agents. Microsomes carrying either sensitive- or resistant-type PfCRT were assayed for uptake; resistant-type PfCRT exhibited increased accumulation of LynxTag-CQGREEN, which was suppressed by pretreatment with known chemosensitizers. Eight laboratory strains and twelve clinical isolates were sequenced for PfCRT and Pgh1 haplotypes previously reported to contribute to drug resistance, and pfmdr1 copy number and chloroquine IC50s were determined. These data were compared with LynxTag-CQGREEN uptake/fluorescence by multiple linear regression to identify genetic correlates of uptake. Uptake of the compound correlated with the logIC50 of chloroquine and, more weakly, a mutation in Pgh1, F1226Y. PMID:25343249
49 CFR 234.239 - Tagging of wires and interference of wires or tags with signal apparatus.
Code of Federal Regulations, 2011 CFR
2011-10-01
... with signal apparatus. 234.239 Section 234.239 Transportation Other Regulations Relating to... Tagging of wires and interference of wires or tags with signal apparatus. Each wire shall be tagged or... of the apparatus. This requirement applies to each wire at each terminal in all housings including...
49 CFR 234.239 - Tagging of wires and interference of wires or tags with signal apparatus.
Code of Federal Regulations, 2010 CFR
2010-10-01
... with signal apparatus. 234.239 Section 234.239 Transportation Other Regulations Relating to... Tagging of wires and interference of wires or tags with signal apparatus. Each wire shall be tagged or... of the apparatus. This requirement applies to each wire at each terminal in all housings including...
Dos Santos Silva, Wellington; de Nazaré Klautau-Guimarães, Maria; Grisolia, Cesar Koppe
2010-07-01
Five restriction site polymorphisms in the β-globin gene cluster (HincII-5' ε, HindIII-(G) γ, HindIII-(A) γ, HincII- ψβ1 and HincII-3' ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the β(A) chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.
2010-01-01
Five restriction site polymorphisms in the β-globin gene cluster (HincII-5‘ ε, HindIII-G γ, HindIII-A γ, HincII- ψβ1 and HincII-3‘ ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the “quilombo community”, from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the βA chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil. PMID:21637405
Dewari, Pooran Singh; Southgate, Benjamin; Mccarten, Katrina; Monogarov, German; O'Duibhir, Eoghan; Quinn, Niall; Tyrer, Ashley; Leitner, Marie-Christin; Plumb, Colin; Kalantzaki, Maria; Blin, Carla; Finch, Rebecca; Bressan, Raul Bardini; Morrison, Gillian; Jacobi, Ashley M; Behlke, Mark A; von Kriegsheim, Alex; Tomlinson, Simon; Krijgsveld, Jeroen
2018-01-01
CRISPR/Cas9 can be used for precise genetic knock-in of epitope tags into endogenous genes, simplifying experimental analysis of protein function. However, Cas9-assisted epitope tagging in primary mammalian cell cultures is often inefficient and reliant on plasmid-based selection strategies. Here, we demonstrate improved knock-in efficiencies of diverse tags (V5, 3XFLAG, Myc, HA) using co-delivery of Cas9 protein pre-complexed with two-part synthetic modified RNAs (annealed crRNA:tracrRNA) and single-stranded oligodeoxynucleotide (ssODN) repair templates. Knock-in efficiencies of ~5–30%, were achieved without selection in embryonic stem (ES) cells, neural stem (NS) cells, and brain-tumor-derived stem cells. Biallelic-tagged clonal lines were readily derived and used to define Olig2 chromatin-bound interacting partners. Using our novel web-based design tool, we established a 96-well format pipeline that enabled V5-tagging of 60 different transcription factors. This efficient, selection-free and scalable epitope tagging pipeline enables systematic surveys of protein expression levels, subcellular localization, and interactors across diverse mammalian stem cells. PMID:29638216
Ken-Dror, Gie; Goldbourt, Uri; Dankner, Rachel
2010-05-01
Several polymorphisms in the ApoA5 gene emerged as important candidate genes in triglyceride metabolism. The aim of this study was to determine the associations between ApoA5 polymorphisms, plasma triglyceride concentrations and the presence of cardiovascular disease (CVD) in three ethnic origins. Genotypes for 15 single nucleotide polymorphisms (SNPs) were determined in 659 older adults (mean age 71+/-7 years) who immigrated to Israel or whose ancestors originated from East Europe (Ashkenazi), North Africa, Asia (Sephardic) or Yemen (Yemenite). The minor alleles of the four common SNPs (rs662799, rs651821, rs2072560 and rs2266788) are associated with an increase of 27-38% in triglyceride concentration among Ashkenazi and Yemenite Jews compared with the major alleles, but not among those of Sephardic origin. Conversely, among the Sephardic group, the presence of the minor allele in SNP rs3135506 compared with the major allele was associated with an increase of 34% in triglyceride concentration. The four SNPs were in significant linkage disequilibrium (D'=0.96-0.99), resulting in three haplotypes H1, H2 and H3, representing 98-99% of the population. Haplotype H2 was significantly associated with triglyceride concentration among Ashkenazi and Yemenite but not among Sephardic Jews. Conversely, haplotype H3 was associated with triglyceride concentration in Sephardic but not in Ashkenazi and Yemenite Jews. Ashkenazi carriers of H2 haplotype had a CVD odds ratio of 2.19 (95% CI: 1.05-4.58) compared with H1 (the most frequent), after adjustment for all other risk factors. These results suggest that different SNPs in ApoA5 polymorphisms may be associated with triglyceride concentration and CVD in each of these ethnic origins.
Soldier Data Tag Study Effort.
1985-06-10
interested in protecting it. The tag itself is difficult--though not impossible--to counterfeit . Also, it (’• iii 71 -, potentially improves the data...attacks during the design, manufacture, and distribution processes, counterfeiting , unauthorized access/alteration of tag data, and use of the tag to...45 3.3.2 Hijacking of SOT System Shipments, or Large- Scale Counterfeit of SOT Systems ....................... 46 3.3.3 Unauthorized Alteration
Cluster analysis of European Y-chromosomal STR haplotypes using the discrete Laplace method.
Andersen, Mikkel Meyer; Eriksen, Poul Svante; Morling, Niels
2014-07-01
The European Y-chromosomal short tandem repeat (STR) haplotype distribution has previously been analysed in various ways. Here, we introduce a new way of analysing population substructure using a new method based on clustering within the discrete Laplace exponential family that models the probability distribution of the Y-STR haplotypes. Creating a consistent statistical model of the haplotypes enables us to perform a wide range of analyses. Previously, haplotype frequency estimation using the discrete Laplace method has been validated. In this paper we investigate how the discrete Laplace method can be used for cluster analysis to further validate the discrete Laplace method. A very important practical fact is that the calculations can be performed on a normal computer. We identified two sub-clusters of the Eastern and Western European Y-STR haplotypes similar to results of previous studies. We also compared pairwise distances (between geographically separated samples) with those obtained using the AMOVA method and found good agreement. Further analyses that are impossible with AMOVA were made using the discrete Laplace method: analysis of the homogeneity in two different ways and calculating marginal STR distributions. We found that the Y-STR haplotypes from e.g. Finland were relatively homogeneous as opposed to the relatively heterogeneous Y-STR haplotypes from e.g. Lublin, Eastern Poland and Berlin, Germany. We demonstrated that the observed distributions of alleles at each locus were similar to the expected ones. We also compared pairwise distances between geographically separated samples from Africa with those obtained using the AMOVA method and found good agreement. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Three Novel Haplotypes of Theileria bicornis in Black and White Rhinoceros in Kenya.
Otiende, M Y; Kivata, M W; Jowers, M J; Makumi, J N; Runo, S; Obanda, V; Gakuya, F; Mutinda, M; Kariuki, L; Alasaad, S
2016-02-01
Piroplasms, especially those in the genera Babesia and Theileria, have been found to naturally infect rhinoceros. Due to natural or human-induced stress factors such as capture and translocations, animals often develop fatal clinical piroplasmosis, which causes death if not treated. This study examines the genetic diversity and occurrence of novel Theileria species infecting both black and white rhinoceros in Kenya. Samples collected opportunistically during routine translocations and clinical interventions from 15 rhinoceros were analysed by polymerase chain reaction (PCR) using a nested amplification of the small subunit ribosomal RNA (18S rRNA) gene fragments of Babesia and Theileria. Our study revealed for the first time in Kenya the presence of Theileria bicornis in white (Ceratotherium simum simum) and black (Diceros bicornis michaeli) rhinoceros and the existence of three new haplotypes: haplotypes H1 and H3 were present in white rhinoceros, while H2 was present in black rhinoceros. No specific haplotype was correlated to any specific geographical location. The Bayesian inference 50% consensus phylogram recovered the three haplotypes monophyleticly, and Theileria bicornis had very high support (BPP: 0.98). Furthermore, the genetic p-uncorrected distances and substitutions between T. bicornis and the three haplotypes were the same in all three haplotypes, indicating a very close genetic affinity. This is the first report of the occurrence of Theileria species in white and black rhinoceros from Kenya. The three new haplotypes reported here for the first time have important ecological and conservational implications, especially for population management and translocation programs and as a means of avoiding the transport of infected animals into non-affected areas. © 2014 Blackwell Verlag GmbH.
Intricacies in arrangement of SNP haplotypes suggest "Great Admixture" that created modern humans.
Dutta, Rajib; Mainsah, Joseph; Yatskiv, Yuriy; Chakrabortty, Sharmistha; Brennan, Patrick; Khuder, Basil; Qiu, Shuhao; Fedorova, Larisa; Fedorov, Alexei
2017-06-05
Inferring history from genomic sequences is challenging and problematic because chromosomes are mosaics of thousands of small Identicalby-descent (IBD) fragments, each of them having their own unique story. However, the main events in recent evolution might be deciphered from comparative analysis of numerous loci. A paradox of why humans, whose effective population size is only 10 4 , have nearly three million frequent SNPs is formulated and examined. We studied 5398 loci evenly covering all human autosomes. Common haplotypes built from frequent SNPs that are present in people from various populations have been examined. We demonstrated highly non-random arrangement of alleles in common haplotypes. Abundance of mutually exclusive pairs of common haplotypes that have different alleles at every polymorphic position (so-called Yin/Yang haplotypes) was found in 56% of loci. A novel widely spread category of common haplotypes named Mosaic has been described. Mosaic consists of numerous pieces of Yin/Yang haplotypes and represents an ancestral stage of one of them. Scenarios of possible appearance of large number of frequent human SNPs and their habitual arrangement in Yin/Yang common haplotypes have been evaluated with an advanced genomic simulation algorithm. Computer modeling demonstrated that the observed arrangement of 2.9 million frequent SNPs could not originate from a sole stand-alone population. A "Great Admixture" event has been proposed that can explain peculiarities with frequent SNP distributions. This Great Admixture presumably occurred 100-300 thousand years ago between two ancestral populations that had been separated from each other about a million years ago. Our programs and algorithms can be applied to other species to perform evolutionary and comparative genomics.
Gu, Jun-dong; Hua, Feng; Mei, Chao-rong; Zheng, De-jie; Wang, Guo-fan; Zhou, Qing-hua
2014-01-01
Aim: Myeloperoxidase (MPO) and glutathione S-transferase pi 1 (GSTP1) are important carcinogen-metabolizing enzymes. The aim of this study was to investigate the association between the common polymorphisms of MPO and GSTP1 genes and lung cancer risk in Chinese Han population. Methods: A total of 266 subjects with lung cancer and 307 controls without personal history of the disease were recruited in this case control study. The tagSNPs approach was used to assess the common polymorphisms of MOP and GSTP1 genes and lung cancer risk according to the disequilibrium information from the HapMap project. The tagSNP rs7208693 was selected as the polymorphism site for MPO, while the haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174 were selected as the polymorphism sites for GSTP1. The gene polymorphisms were confirmed using real-time PCR, cloning and sequencing. Results: The four GSTP1 haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174, but not the MPO tagSNP rs7208693, exhibited an association with lung cancer susceptibility in smokers in the overall population and in the studied subgroups. When Phase 2 software was used to reconstruct the haplotype for GSTP1, the haplotype CACA (rs749174+rs1695 + rs762803+rs4891) exhibited an increased risk of lung cancer among smokers (adjust odds ratio 1.53; 95%CI 1.04–2.25, P=0.033). Furthermore, diplotype analyses demonstrated that the significant association between the risk haplotype and lung cancer. The risk haplotypes co-segregated with one or more biologically functional polymorphisms and corresponded to a recessive inheritance model. Conclusion: The common polymorphisms of the GSTP1 gene may be the candidates for SNP markers for lung cancer susceptibility in Chinese Han population. PMID:24786234
High Level Expression and Purification of Recombinant Proteins from Escherichia coli with AK-TAG
Luo, Dan; Wen, Caixia; Zhao, Rongchuan; Liu, Xinyu; Liu, Xinxin; Cui, Jingjing; Liang, Joshua G.; Liang, Peng
2016-01-01
Adenylate kinase (AK) from Escherichia coli was used as both solubility and affinity tag for recombinant protein production. When fused to the N-terminus of a target protein, an AK fusion protein could be expressed in soluble form and purified to near homogeneity in a single step from Blue-Sepherose via affinity elution with micromolar concentration of P1, P5- di (adenosine—5’) pentaphosphate (Ap5A), a transition-state substrate analog of AK. Unlike any other affinity tags, the level of a recombinant protein expression in soluble form and its yield of recovery during each purification step could be readily assessed by AK enzyme activity in near real time. Coupled to a His-Tag installed at the N-terminus and a thrombin cleavage site at the C terminus of AK, the streamlined method, here we dubbed AK-TAG, could also allow convenient expression and retrieval of a cleaved recombinant protein in high yield and purity via dual affinity purification steps. Thus AK-TAG is a new addition to the arsenal of existing affinity tags for recombinant protein expression and purification, and is particularly useful where soluble expression and high degree of purification are at stake. PMID:27214237
Association of ESR1 gene tagging SNPs with breast cancer risk
Dunning, Alison M.; Healey, Catherine S.; Baynes, Caroline; Maia, Ana-Teresa; Scollen, Serena; Vega, Ana; Rodríguez, Raquel; Barbosa-Morais, Nuno L.; Ponder, Bruce A.J.; Low, Yen-Ling; Bingham, Sheila; Haiman, Christopher A.; Le Marchand, Loic; Broeks, Annegien; Schmidt, Marjanka K.; Hopper, John; Southey, Melissa; Beckmann, Matthias W.; Fasching, Peter A.; Peto, Julian; Johnson, Nichola; Bojesen, Stig E.; Nordestgaard, Børge; Milne, Roger L.; Benitez, Javier; Hamann, Ute; Ko, Yon; Schmutzler, Rita K.; Burwinkel, Barbara; Schürmann, Peter; Dörk, Thilo; Heikkinen, Tuomas; Nevanlinna, Heli; Lindblom, Annika; Margolin, Sara; Mannermaa, Arto; Kosma, Veli-Matti; Chen, Xiaoqing; Spurdle, Amanda; Change-Claude, Jenny; Flesch-Janys, Dieter; Couch, Fergus J.; Olson, Janet E.; Severi, Gianluca; Baglietto, Laura; Børresen-Dale, Anne-Lise; Kristensen, Vessela; Hunter, David J.; Hankinson, Susan E.; Devilee, Peter; Vreeswijk, Maaike; Lissowska, Jolanta; Brinton, Louise; Liu, Jianjun; Hall, Per; Kang, Daehee; Yoo, Keun-Young; Shen, Chen-Yang; Yu, Jyh-Cherng; Anton-Culver, Hoda; Ziogoas, Argyrios; Sigurdson, Alice; Struewing, Jeff; Easton, Douglas F.; Garcia-Closas, Montserrat; Humphreys, Manjeet K.; Morrison, Jonathan; Pharoah, Paul D.P.; Pooley, Karen A.; Chenevix-Trench, Georgia
2009-01-01
We have conducted a three-stage, comprehensive single nucleotide polymorphism (SNP)-tagging association study of ESR1 gene variants (SNPs) in more than 55 000 breast cancer cases and controls from studies within the Breast Cancer Association Consortium (BCAC). No large risks or highly significant associations were revealed. SNP rs3020314, tagging a region of ESR1 intron 4, is associated with an increase in breast cancer susceptibility with a dominant mode of action in European populations. Carriers of the c-allele have an odds ratio (OR) of 1.05 [95% Confidence Intervals (CI) 1.02–1.09] relative to t-allele homozygotes, P = 0.004. There is significant heterogeneity between studies, P = 0.002. The increased risk appears largely confined to oestrogen receptor-positive tumour risk. The region tagged by SNP rs3020314 contains sequence that is more highly conserved across mammalian species than the rest of intron 4, and it may subtly alter the ratio of two mRNA splice forms. PMID:19126777
Salem, Rany M; Wessel, Jennifer; Schork, Nicholas J
2005-03-01
Interest in the assignment and frequency analysis of haplotypes in samples of unrelated individuals has increased immeasurably as a result of the emphasis placed on haplotype analyses by, for example, the International HapMap Project and related initiatives. Although there are many available computer programs for haplotype analysis applicable to samples of unrelated individuals, many of these programs have limitations and/or very specific uses. In this paper, the key features of available haplotype analysis software for use with unrelated individuals, as well as pooled DNA samples from unrelated individuals, are summarised. Programs for haplotype analysis were identified through keyword searches on PUBMED and various internet search engines, a review of citations from retrieved papers and personal communications, up to June 2004. Priority was given to functioning computer programs, rather than theoretical models and methods. The available software was considered in light of a number of factors: the algorithm(s) used, algorithm accuracy, assumptions, the accommodation of genotyping error, implementation of hypothesis testing, handling of missing data, software characteristics and web-based implementations. Review papers comparing specific methods and programs are also summarised. Forty-six haplotyping programs were identified and reviewed. The programs were divided into two groups: those designed for individual genotype data (a total of 43 programs) and those designed for use with pooled DNA samples (a total of three programs). The accuracy of programs using various criteria are assessed and the programs are categorised and discussed in light of: algorithm and method, accuracy, assumptions, genotyping error, hypothesis testing, missing data, software characteristics and web implementation. Many available programs have limitations (eg some cannot accommodate missing data) and/or are designed with specific tasks in mind (eg estimating haplotype frequencies rather than
Tracking intracellular uptake and localisation of alkyne tagged fatty acids using Raman spectroscopy
NASA Astrophysics Data System (ADS)
Jamieson, Lauren E.; Greaves, Jennifer; McLellan, Jayde A.; Munro, Kevin R.; Tomkinson, Nicholas C. O.; Chamberlain, Luke H.; Faulds, Karen; Graham, Duncan
2018-05-01
Intracellular uptake, distribution and metabolism of lipids are tightly regulated characteristics in healthy cells. An analytical technique capable of understanding these characteristics with a high level of species specificity in a minimally invasive manner is highly desirable in order to understand better how these become disrupted during disease. In this study, the uptake and distribution of three different alkyne tagged fatty acids in single cells were monitored and compared, highlighting the ability of Raman spectroscopy combined with alkyne tags for better understanding of the fine details with regard to uptake, distribution and metabolism of very chemically specific lipid species. This indicates the promise of using Raman spectroscopy directly with alkyne tagged lipids for cellular studies as opposed to subsequently clicking of a fluorophore onto the alkyne for fluorescence imaging.
Uncertainty of exploitation estimates made from tag returns
Miranda, L.E.; Brock, R.E.; Dorr, B.S.
2002-01-01
Over 6,000 crappies Pomoxis spp. were tagged in five water bodies to estimate exploitation rates by anglers. Exploitation rates were computed as the percentage of tags returned after adjustment for three sources of uncertainty: postrelease mortality due to the tagging process, tag loss, and the reporting rate of tagged fish. Confidence intervals around exploitation rates were estimated by resampling from the probability distributions of tagging mortality, tag loss, and reporting rate. Estimates of exploitation rates ranged from 17% to 54% among the five study systems. Uncertainty around estimates of tagging mortality, tag loss, and reporting resulted in 90% confidence intervals around the median exploitation rate as narrow as 15 percentage points and as broad as 46 percentage points. The greatest source of estimation error was uncertainty about tag reporting. Because the large investments required by tagging and reward operations produce imprecise estimates of the exploitation rate, it may be worth considering other approaches to estimating it or simply circumventing the exploitation question altogether.
Baker, Peter R.; Baschal, Erin E.; Fain, Pam R.; Triolo, Taylor M.; Nanduri, Priyaanka; Siebert, Janet C.; Armstrong, Taylor K.; Babu, Sunanda R.; Rewers, Marian J.; Gottlieb, Peter A.; Barker, Jennifer M.; Eisenbarth, George S.
2010-01-01
Context: Multiple autoimmune disorders (e.g. Addison’s disease, type 1 diabetes, celiac disease) are associated with HLA-DR3, but it is likely that alleles of additional genes in linkage disequilibrium with HLA-DRB1 contribute to disease. Objective: The objective of the study was to characterize major histocompatability complex (MHC) haplotypes conferring extreme risk for autoimmune Addison’s disease (AD). Design, Setting, and Participants: Eighty-six 21-hydroxylase autoantibody-positive, nonautoimmune polyendocrine syndrome type 1, Caucasian individuals collected from 1992 to 2009 with clinical AD from 68 families (12 multiplex and 56 simplex) were genotyped for HLA-DRB1, HLA-DQB1, MICA, HLA-B, and HLA-A as well as high density MHC single-nucleotide polymorphism (SNP) analysis for 34. Main Outcome Measures: AD and genotype were measured. Result: Ninety-seven percent of the multiplex individuals had both HLA-DR3 and HLA-B8 vs. 60% of simplex AD patients (P = 9.72 × 10−4) and 13% of general population controls (P = 3.00 × 10−19). The genotype DR3/DR4 with B8 was present in 85% of AD multiplex patients, 24% of simplex patients, and 1.5% of control individuals (P = 4.92 × 10−191). The DR3-B8 haplotype of AD patients had HLA-A1 less often (47%) than controls (81%, P = 7.00 × 10−5) and type 1 diabetes patients (73%, P = 1.93 × 10−3). Analysis of 1228 SNPs across the MHC for individuals with AD revealed a shorter conserved haplotype (3.8) with the loss of the extended conserved 3.8.1 haplotype approximately halfway between HLA-B and HLA-A. Conclusion: Extreme risk for AD, especially in multiplex families, is associated with haplotypic DR3 variants, in particular a portion (3.8) but not all of the conserved 3.8.1 haplotype. PMID:20631027
Mapping transcription factor interactome networks using HaloTag protein arrays.
Yazaki, Junshi; Galli, Mary; Kim, Alice Y; Nito, Kazumasa; Aleman, Fernando; Chang, Katherine N; Carvunis, Anne-Ruxandra; Quan, Rosa; Nguyen, Hien; Song, Liang; Alvarez, José M; Huang, Shao-Shan Carol; Chen, Huaming; Ramachandran, Niroshan; Altmann, Stefan; Gutiérrez, Rodrigo A; Hill, David E; Schroeder, Julian I; Chory, Joanne; LaBaer, Joshua; Vidal, Marc; Braun, Pascal; Ecker, Joseph R
2016-07-19
Protein microarrays enable investigation of diverse biochemical properties for thousands of proteins in a single experiment, an unparalleled capacity. Using a high-density system called HaloTag nucleic acid programmable protein array (HaloTag-NAPPA), we created high-density protein arrays comprising 12,000 Arabidopsis ORFs. We used these arrays to query protein-protein interactions for a set of 38 transcription factors and transcriptional regulators (TFs) that function in diverse plant hormone regulatory pathways. The resulting transcription factor interactome network, TF-NAPPA, contains thousands of novel interactions. Validation in a benchmarked in vitro pull-down assay revealed that a random subset of TF-NAPPA validated at the same rate of 64% as a positive reference set of literature-curated interactions. Moreover, using a bimolecular fluorescence complementation (BiFC) assay, we confirmed in planta several interactions of biological interest and determined the interaction localizations for seven pairs. The application of HaloTag-NAPPA technology to plant hormone signaling pathways allowed the identification of many novel transcription factor-protein interactions and led to the development of a proteome-wide plant hormone TF interactome network.
RAC-tagging: Recombineering And Cas9-assisted targeting for protein tagging and conditional analyses
Baker, Oliver; Gupta, Ashish; Obst, Mandy; Zhang, Youming; Anastassiadis, Konstantinos; Fu, Jun; Stewart, A. Francis
2016-01-01
A fluent method for gene targeting to establish protein tagged and ligand inducible conditional loss-of-function alleles is described. We couple new recombineering applications for one-step cloning of gRNA oligonucleotides and rapid generation of short-arm (~1 kb) targeting constructs with the power of Cas9-assisted targeting to establish protein tagged alleles in embryonic stem cells at high efficiency. RAC (Recombineering And Cas9)-tagging with Venus, BirM, APEX2 and the auxin degron is facilitated by a recombineering-ready plasmid series that permits the reuse of gene-specific reagents to insert different tags. Here we focus on protein tagging with the auxin degron because it is a ligand-regulated loss-of-function strategy that is rapid and reversible. Furthermore it includes the additional challenge of biallelic targeting. Despite high frequencies of monoallelic RAC-targeting, we found that simultaneous biallelic targeting benefits from long-arm (>4 kb) targeting constructs. Consequently an updated recombineering pipeline for fluent generation of long arm targeting constructs is also presented. PMID:27216209
Ando, A; Imaeda, N; Ohshima, S; Miyamoto, A; Kaneko, N; Takasu, M; Shiina, T; Kulski, J K; Inoko, H; Kitagawa, H
2014-12-01
Microminipigs are extremely small-sized, novel miniature pigs that were recently developed for medical research. The inbred Microminipigs with defined swine leukocyte antigen (SLA) haplotypes are expected to be useful for allo- and xenotransplantation studies and also for association analyses between SLA haplotypes and immunological traits. To establish SLA-defined Microminipig lines, we characterized the polymorphic SLA alleles for three class I (SLA-1, SLA-2 and SLA-3) and two class II (SLA-DRB1 and SLA-DQB1) genes of 14 parental Microminipigs using a high-resolution nucleotide sequence-based typing method. Eleven class I and II haplotypes, including three recombinant haplotypes, were found in the offspring of the parental Microminipigs. Two class I and class II haplotypes, Hp-31.0 (SLA-1*1502-SLA-3*070102-SLA-2*1601) and Hp-0.37 (SLA-DRB1*0701-SLA-DQB1*0502), are novel and have not so far been reported in other pig breeds. Crossover regions were defined by the analysis of 22 microsatellite markers within the SLA class III region of three recombinant haplotypes. The SLA allele and haplotype information of Microminipigs in this study will be useful to establish SLA homozygous lines including three recombinants for transplantation and immunological studies. © 2014 Stichting International Foundation for Animal Genetics.
Ramanathan, Gnanasambandan; Ghosh, Santu; Elumalai, Ramprasad; Periyasamy, Soundararajan; Lakkakula, Bhaskar V K S
2016-06-01
Autosomal dominant polycystic kidney disease (ADPKD) is an inherited systemic disorder, characterized by the fluid filled cysts in the kidneys leading to end stage renal failure in later years of life. Hypertension is one of the major factors independently contributing to the chronic kidney disease (CKD) progression. The renin-angiotensin aldosterone system (RAAS) genes have been extensively studied as hypertension candidate genes. The aim of the present study was to investigate the role of angiotensin converting enzyme tagging - single nucleotide polymorphisms (ACE tag-SNPs) in progression of CKD in patients with ADPKD. m0 ethods: In the present study six ACE tagSNPs (angiotensin converting enzyme tag single nucleotide polymorphisms) and insertion/deletion (I/D) in 102 ADPKD patients and 106 control subjects were investigated. The tagSNPs were genotyped using FRET-based KASPar method and ACE ID by polymerase chain reaction (PCR) and electrophoresis. Genotypes and haplotypes were compared between ADPKD patients and controls. Univariate and multivariate logistic regression analyses were performed to assess the effect of genotypes and hypertension on CKD advancement. Mantel-Haenszel (M-H) stratified analysis was performed to study the relationship between different CKD stages and hypertension and their interaction. All loci were polymorphic and except rs4293 SNP the remaining loci followed Hardy-Weinberg equilibrium. Distribution of ACE genotypes and haplotypes in controls and ADPKD patients was not significant. A significant linkage disequilibrium (LD) was observed between SNPs forming two LD blocks. The univariate analysis revealed that the age, hypertension, family history of diabetes and ACE rs4362 contributed to the advancement of CKD. The results suggest that the ACE genotypes are effect modifiers of the relationship between hypertension and CKD advancement among the ADPKD patients.
4G/5G Plasminogen Activator Inhibitor-1 Polymorphisms and Haplotypes Are Associated with Pneumonia
Yende, Sachin; Angus, Derek C.; Ding, Jingzhong; Newman, Anne B.; Kellum, John A.; Li, Rongling; Ferrell, Robert E.; Zmuda, Joseph; Kritchevsky, Stephen B.; Harris, Tamara B.; Garcia, Melissa; Yaffe, Kristine; Wunderink, Richard G.
2007-01-01
Rationale: Plasminogen activator inhibitor (PAI)-1 inhibits urokinase and tissue plasminogen activator, required for host response to infection. Whether variation within the PAI-1 gene is associated with increased susceptibility to infection is unknown. Objectives: To ascertain the role of the 4G/5G polymorphism and other genetic variants within the PAI-1 gene. We hypothesized that variants associated with increased PAI-1 expression would be associated with an increased occurrence of community-acquired pneumonia (CAP). Methods: Longitudinal analysis (>12 yr) of the Health, Aging, and Body Composition cohort, aged 65–74 years at start of analysis. Measurements and Main Results: We genotyped the 4G/5G PAI-1 polymorphism and six additional single nucleotide polymorphisms. Of the 3,075 subjects, 272 (8.8%) had at least one hospitalization for CAP. Among whites, variants at the PAI4G,5G, PAI2846, and PAI7343 sites had higher risk of CAP (P = 0.018, 0.021, and 0.021, respectively). At these sites, variants associated with higher PAI-1 expression were associated with increased CAP susceptibility. Compared with the 5G/5G genotypes at PAI4G,5G site, the 4G/4G and 4G/5G genotypes were associated with a 1.98-fold increased risk of CAP (95% confidence interval, 1.2–3.2; P = 0.006). In whole blood stimulation assay, subjects with a 4G allele had 3.3- and 1.9-fold increased PAI-1 expression (P = 0.043 and 0.034, respectively). In haplotype analysis, the 4G/G/C/A haplotype at the PAI4G,5G, PAI2846, PAI4588, and PAI7343 single nucleotide polymorphisms was associated with higher CAP susceptibility, whereas the 5G/G/C/A haplotype was associated with lower CAP susceptibility. No associations were seen among blacks. Conclusions: Genotypes associated with increased expression of PAI-1 were associated with increased susceptibility to CAP in elderly whites. PMID:17761618
Analysis of Multiallelic CNVs by Emulsion Haplotype Fusion PCR.
Tyson, Jess; Armour, John A L
2017-01-01
Emulsion-fusion PCR recovers long-range sequence information by combining products in cis from individual genomic DNA molecules. Emulsion droplets act as very numerous small reaction chambers in which different PCR products from a single genomic DNA molecule are condensed into short joint products, to unite sequences in cis from widely separated genomic sites. These products can therefore provide information about the arrangement of sequences and variants at a larger scale than established long-read sequencing methods. The method has been useful in defining the phase of variants in haplotypes, the typing of inversions, and determining the configuration of sequence variants in multiallelic CNVs. In this description we outline the rationale for the application of emulsion-fusion PCR methods to the analysis of multiallelic CNVs, and give practical details for our own implementation of the method in that context.
The use of tags and tag clouds to discern credible content in online health message forums.
O'Grady, Laura; Wathen, C Nadine; Charnaw-Burger, Jill; Betel, Lisa; Shachak, Aviv; Luke, Robert; Hockema, Stephen; Jadad, Alejandro R
2012-01-01
Web sites with health-oriented content are potentially harmful if inaccurate or inappropriate medical information is used to make health-related decisions. Checklists, rating systems and guidelines have been developed to help people determine what is credible, but recent Internet technologies emphasize applications that are collaborative in nature, including tags and tag clouds, where site users 'tag' or label online content, each using their own labelling system. Concepts such as the date, reference, author, testimonial and quotations are considered predictors of credible content. An understanding of these descriptive tools, how they relate to the depiction of credibility and how this relates to overall efforts to label data in relation to the semantic web has yet to emerge. This study investigates how structured (pre-determined) and unstructured (user-generated) tags and tag clouds with a multiple word search feature are used by participants to assess credibility of messages posted in online message forums. The targeted respondents were those using web sites message forums for disease self-management. We also explored the relevancy of our findings to the labelling or indexing of data in the context of the semantic web. Diabetes was chosen as the content area in this study, since (a) this is a condition with increasing prevalence and (b) diabetics have been shown to actively use the Internet to manage their condition. From January to March 2010 participants were recruited using purposive sampling techniques. A screening instrument was used to determine eligibility. The study consisted of a demographic and computer usage survey, a series of usability tests and an interview. We tested participants (N=22) on two scenarios, each involving tasks that assessed their ability to tag content and search using a tag cloud that included six structured credibility terms (statistics, date, reference, author, testimonial and quotations). MORAE Usability software (version 3
Use of the Nanofitin Alternative Scaffold as a GFP-Ready Fusion Tag
Huet, Simon; Gorre, Harmony; Perrocheau, Anaëlle; Picot, Justine; Cinier, Mathieu
2015-01-01
illustrated with previously described state-of-the-art anti-GFP binders applied to living cells and in vitro applications). Through a single fusion domain, the GFP-ready tagged proteins benefit from subsequent customization within a wide range of fluorescence spectra upon indirect binding of a chosen GFP variant. PMID:26539718
Use of the Nanofitin Alternative Scaffold as a GFP-Ready Fusion Tag.
Huet, Simon; Gorre, Harmony; Perrocheau, Anaëlle; Picot, Justine; Cinier, Mathieu
2015-01-01
illustrated with previously described state-of-the-art anti-GFP binders applied to living cells and in vitro applications). Through a single fusion domain, the GFP-ready tagged proteins benefit from subsequent customization within a wide range of fluorescence spectra upon indirect binding of a chosen GFP variant.
Using RFID and PIT tags to Quantify Bedload Transport in the Oregon Coast Range
NASA Astrophysics Data System (ADS)
Sanfilippo, J.; Lancaster, S. T.
2017-12-01
Introducing the methods, issues, and data collection techniques and interpretation over one water year using RFID (radio frequency identification) and PIT (passive integrated transponder) tags in Oak Creek, near Corvallis Oregon. We constructed an RFID four-antenna array that runs off of a single radiofrequency reader via a multiplexer board. Using 4 grain sizes we tagged 990 individual rocks, roughly 250 in of each four size ranges (8-16mm, 16-32mm, 32-64mm, 64-128mm). Using 12 mm and 23 mm PIT tags during 1 water year the antennas logged 477 tracer passage events. To calculate bedload transport for each size range, at each antenna, interarrival times yield count rates when combined with grain size fractions of the bed and tracer concentrations, yield bedload transport for each size class. We calculated transport rates for five events of varying magnitude and found that PIT tag RFID method under predicts transport between 1 and 3 orders of magnitude.
Global selection on sucrose synthase haplotypes during a century of wheat breeding.
Hou, Jian; Jiang, Qiyan; Hao, Chenyang; Wang, Yuquan; Zhang, Hongna; Zhang, Xueyong
2014-04-01
Spike number per unit area, number of grains per spike, and thousand kernel weight (TKW) are important yield components. In China, increases in wheat (Triticum aestivum) yields are mainly due to increases in grain number per spike and TKW. TKW mainly depends on starch content, as starch accounts for about 70% of the grain endosperm. Sucrose synthase catalysis is the first step in the conversion of sucrose to starch, that is, the conversion of sucrose to fructose and UDP-glucose by the wheat sucrose synthase genes (TaSus1 and TaSus2) that are located on chromosomes 7A/7B/7D and 2A/2B/2D, respectively. A total of 1,520 wheat accessions were genotyped at the six loci. Two, two, five, and two haplotypes were identified at the TaSus2-2A, TaSus2-2B, TaSus1-7A, and TaSus1-7B loci, respectively. Their main variations were detected within the introns. Significant differences between the haplotypes correlated with TKW differences among 348 modern Chinese cultivars from the core collection. Frequency changes for favored haplotypes showed gradual increases in cultivars released since beginning of the last century in China, Europe, and North America. Geographic distributions and time changes of favored haplotypes were characterized in six major wheat production regions worldwide. Strong selection bottlenecks to haplotype variations occurred at polyploidization and domestication and during breeding of wheat. Genetic-effect differences between haplotypes at the same locus influence the selection time and intensity. This work shows that the endosperm starch synthesis pathway is a major target of indirect selection in global wheat breeding for higher yield.
Härmä, Sanna; Plessky, Victor P; Hartmann, Clinton S; Steichen, William
2008-01-01
Surface acoustic wave (SAW) radio-frequency identification (RFID) tags are soon expected to be produced in very high volumes. The size and cost of a SAW RFID tag will be key parameters for many applications. Therefore, it is of primary importance to reduce the chip size. In this work, we describe the design principles of a 2.4-GHz SAW RFID tag that is significantly smaller than earlier reported tags. We also present simulated and experimental results. The coded signal should arrive at the reader with a certain delay (typically about 1 micros), i.e., after the reception of environmental echoes. If the tag uses a bidirectional interdigital transducer (IDT), space for the initial delay is needed on both sides of the IDT. In this work, we replace the bidirectional IDT by a unidirectional one. This halves the space required by the initial delay because all the code reflectors must now be placed on the same side of the IDT. We reduce tag size even further by using a Z-path geometry in which the same space in x-direction is used for both the initial delay and the code reflectors. Chip length is thus determined only by the space required by the code reflectors.
Novel Tenascin-C Haplotype Modifies the Risk for a Failure to Heal After Rotator Cuff Repair.
Kluger, Rainer; Huber, Klaus R; Seely, Philipp G; Berger, Christian E; Frommlet, Florian
2017-11-01
Several single-nucleotide polymorphisms (SNPs) in the TNC gene have recently been found to be associated with degenerative rotator cuff tears. Exonic SNPs in the TNC gene are related to the risk for a failure to heal after rotator cuff repair. Case-control study; Level of evidence, 3. A total of 302 patients from the Vienna area and European Caucasian ancestry underwent mini-open rotator cuff repair for a full-thickness superior or posterosuperior tear and were assessed for the integrity of the repair 1 year postoperatively with a real-time 7.5- to 10-MHz ultrasound linear array transducer. Outcomes were classified as intact (complete footprint coverage), small (<200 mm 2 ), or large (≥200 mm 2 ) recurrent defect. Patients were genotyped for 15 previously identified risk SNPs within a 49-kbp segment of the TNC gene with the KASP genotyping technology or the Ion-Torrent Personal Genome Machine System. All recurrent defects were atraumatic failures, and the overall failure rate was 39.7%. Of the traditional risk factors, only the initial tear size was significantly associated with a failure to heal. In a multinomial logistic regression model, the T allele at rs1138545 [C>T] was protective for a large recurrent defect (odds ratio = 0.16; 95% CI, 0.09-0.31). The role of rs1138545 was further backed by haplotype analysis, which showed that the combination of the C allele at rs1138545 [C>T], the A allele at rs2104772 [A>T], and the G allele at rs10759752 [A>G] formed the risk-related haplotype [CAG]. The CAG haplotype was associated with large recurrent defects ( P < .0001; haplotype frequency, 0.394; haplotype score, 4.518). Exonic marker rs1138545 transcribed into all isoforms of the TNC protein, whereas exonic marker rs2104772, which has been associated with Achilles tendinopathy before, transcribed only into large isoforms of the TNC protein. Recurrent defects after rotator cuff repairs are clinically relevant, and a heritable component of the disorder is plausible
Aldehyde dehydrogenase-2 genotypes and HLA haplotypes in Japanese patients with esophageal cancer.
Watanabe, Seishiro; Sasahara, Katsuyuki; Kinekawa, Fumihiko; Uchida, Naohito; Masaki, Tsutomu; Kurokohchi, Kazutaka; Murota, Masayuki; Touge, Tetsuo; Kawauchi, Kazuyoshi; Oda, Syuji; Kuriyama, Shigeki
2002-01-01
The aim of this study was to examine how aldehyde dehydrogenase-2 (ALDH2) genotypes and human leukocyte antigen (HLA) haplotypes contribute to the risk for esophageal cancer. We examined ALDH2 genotypes and HLA haplotypes in 29 Japanese patients with esophageal cancer. The ratio of patients who experienced current or former intense vasodilatation upon consuming alcohol (flushing type) was much higher in individuals with the inactive form of ALDH2 encoded by the ALDH2(2)/2(2) or ALDH2(1)/2(2) genotype than in those with the active form of ALDH2 encoded by the ALDH2(1)/2(1) genotype. The ratio of inactive ALDH2 was significantly higher in patients with esophageal cancer than in control normal subjects, suggesting that alcoholics with inactive ALDH2 were susceptible to esophageal cancer. HLA haplotypes A24, A26, B54, B61 and DR9 were prevalent in patients with esophageal cancer (82.8, 24.1, 34.5, 37.9 and 44.8%, respectively). HLA haplotype of A24 and inactive ALDH2 were simultaneously found in 58.6% of patients with esophageal cancer. Furthermore, we found other primary malignancies in 6 of 29 (20.7%) patients with esophageal cancer, and 4 of these 6 patients had both the inactive form of ALDH2 and the HLA A24 haplotype. The present study showed the high prevalence of the inactive form of ALDH2 and HLA haplotypes A24, A26, B54, B61 and DR9 in Japanese patients with esophageal cancer. Therefore, the examination of genotypes of ALDH2 loci and HLA haplotypes may allow the early detection of esophageal cancer in the Japanese population.
Association between β2-adrenoceptor (ADRB2) haplotypes and insulin resistance in PCOS.
Tellechea, Mariana L; Muzzio, Damián O; Iglesias Molli, Andrea E; Belli, Susana H; Graffigna, Mabel N; Levalle, Oscar A; Frechtel, Gustavo D; Cerrone, Gloria E
2013-04-01
The aim of this study was to explore β2-adrenoceptor (ADRB2) haplotype associations with phenotypes and quantitative traits related to insulin resistance (IR) and the metabolic syndrome (MS) in a polycystic ovary syndrome (PCOS) population. A secondary purpose was to assess the association between ADRB2 haplotype and PCOS. Genetic polymorphism analysis. Cross-sectional case-control association study. Medical University Hospital and research laboratory. One hundred and sixty-five unrelated women with PCOS and 116 unrelated women without PCOS (control sample). Clinical and biochemical measurements, and ADRB2 genotyping in PCOS patients and control subjects. ADRB2 haplotypes (comprising rs1042711, rs1801704, rs1042713 and rs1042714 in that order), genotyping and statistical analysis to evaluate associations with continuous variables and traits related to IR and MS in a PCOS population. Associations between ADRB2 haplotypes and PCOS were also assessed. We observed an age-adjusted association between ADRB2 haplotype CCGG and lower insulin (P = 0·018) and HOMA (P = 0·008) in the PCOS sample. Interestingly, the expected differences in surrogate measures of IR between cases and controls were not significant in CCGG/CCGG carriers. In the case-control study, genotype CCGG/CCGG was associated with a 14% decrease in PCOS risk (P = 0·043), taking into account confounding variables. Haplotype I (CCGG) has a protective role for IR and MS in PCOS. © 2012 Blackwell Publishing Ltd.
A scalable strategy for high-throughput GFP tagging of endogenous human proteins.
Leonetti, Manuel D; Sekine, Sayaka; Kamiyama, Daichi; Weissman, Jonathan S; Huang, Bo
2016-06-21
A central challenge of the postgenomic era is to comprehensively characterize the cellular role of the ∼20,000 proteins encoded in the human genome. To systematically study protein function in a native cellular background, libraries of human cell lines expressing proteins tagged with a functional sequence at their endogenous loci would be very valuable. Here, using electroporation of Cas9 nuclease/single-guide RNA ribonucleoproteins and taking advantage of a split-GFP system, we describe a scalable method for the robust, scarless, and specific tagging of endogenous human genes with GFP. Our approach requires no molecular cloning and allows a large number of cell lines to be processed in parallel. We demonstrate the scalability of our method by targeting 48 human genes and show that the resulting GFP fluorescence correlates with protein expression levels. We next present how our protocols can be easily adapted for the tagging of a given target with GFP repeats, critically enabling the study of low-abundance proteins. Finally, we show that our GFP tagging approach allows the biochemical isolation of native protein complexes for proteomic studies. Taken together, our results pave the way for the large-scale generation of endogenously tagged human cell lines for the proteome-wide analysis of protein localization and interaction networks in a native cellular context.
Huang, Yong-Zhen; Zhan, Zhao-Yang; Sun, Yu-Jia; Wang, Jing; Li, Ming-Xun; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong
2013-06-01
Muscle growth is a complex phenomenon regulated by many factors, whereby net growth results from the combined action of synthesis and turnover. Insulin-like growth factor 2 (IGF2) is a fetal growth and differentiation factor that plays an important role in muscle growth and in myoblast proliferation and differentiation; Zinc finger, BED-type containing 6 (ZBED6) is a novel transcription factor that was identified and shown to act as a repressor of IGF2 transcription in skeletal muscle. In this study, a total of seven single nucleotide polymorphisms (SNPs) were identified, four SNPs in intron 8 of IGF2 and one promoter SNP and two missense mutations in the coding region of ZBED6, two of which were in complete linkage disequilibrium (LD) in the bovine IGF2. The 58 haplotypes were inferred in 1522 individuals representing four purebred cattle breeds from China. The seven SNPs, 79 and 66 combined diplotypes were revealed for association with body mass in Nanyang and Jiaxian cattle populations at five different ages (P < 0.05 or 0.01). The mutant-type variants and haplotype 58 (likely in LD with the beneficial quantitative trait nucleotide allele) was superior for body mass; the heterozygote diplotype of the most common haplotypes 58 was associated with higher body mass compared to either heterozygote or homozygote. The statistical analyses indicated that the mutant-type variants and haplotypes are significantly associated with body mass in study cattle populations at different ages. These data demonstrate that variants and haplotypes are associated with growth traits, and these results may provide important biological insights into the phenotypic differentiation that is associated with adaptation and specialization of cattle breeds.
Scalable Faceted Ranking in Tagging Systems
NASA Astrophysics Data System (ADS)
Orlicki, José I.; Alvarez-Hamelin, J. Ignacio; Fierens, Pablo I.
Nowadays, web collaborative tagging systems which allow users to upload, comment on and recommend contents, are growing. Such systems can be represented as graphs where nodes correspond to users and tagged-links to recommendations. In this paper we analyze the problem of computing a ranking of users with respect to a facet described as a set of tags. A straightforward solution is to compute a PageRank-like algorithm on a facet-related graph, but it is not feasible for online computation. We propose an alternative: (i) a ranking for each tag is computed offline on the basis of tag-related subgraphs; (ii) a faceted order is generated online by merging rankings corresponding to all the tags in the facet. Based on the graph analysis of YouTube and Flickr, we show that step (i) is scalable. We also present efficient algorithms for step (ii), which are evaluated by comparing their results with two gold standards.
Tags, wireless communication systems, tag communication methods, and wireless communications methods
Scott,; Jeff W. , Pratt; Richard, M [Richland, WA
2006-09-12
Tags, wireless communication systems, tag communication methods, and wireless communications methods are described. In one aspect, a tag includes a plurality of antennas configured to receive a plurality of first wireless communication signals comprising data from a reader, a plurality of rectifying circuits coupled with. respective individual ones of the antennas and configured to provide rectified signals corresponding to the first wireless communication signals, wherein the rectified signals are combined to produce a composite signal, an adaptive reference circuit configured to vary a reference signal responsive to the composite signal, a comparator coupled with the adaptive reference circuit and the rectifying circuits and configured to compare the composite signal with respect to the reference signal and to output the data responsive to the comparison, and processing circuitry configured to receive the data from the comparator and to process the data.
African gene flow to north Brazil as revealed by HBB*S gene haplotype analysis.
Lemos Cardoso, Greice; Farias Guerreiro, João
2006-01-01
Haplotypes linked to the HBB*S gene were analyzed in a sample of 260 chromosomes of Brazilian sickle cell anemia patients from the population of Belém, state of Pará, to evaluate if the present-day haplotype frequencies correlate as well as expected with historical information on the geographic origin of African slaves sent directly to Northern Brazil. The HBB*S gene haplotype distribution (66% Bantu, 21.8% Benin, 10.9% Senegal, and 1.3% Cameroon) is in agreement with those observed for other Brazilian populations regarding the highest proportion of the Bantu type, followed by the Benin type, but it differs significantly concerning the Senegal type as this haplotype is rare or absent in samples from other Brazilian regions already studied. In addition, our results are in accordance with historical records that establish that about 90% of the slaves sent to Northern Brazil were from Angola, Congo, and Mozambique, where the Bantu haplotype predominates, in contrast to 10% of slaves from Senegambia, Guine-Bissau, and Cape Verde, where the Senegal haplotype is the most common. On the other hand, the observed frequency of the Benin haplotype in Belém was much higher than that expected by historical data. This fact corroborates the suggestion that the high prevalence of the Benin type in Belém is due to domestic slave trade and later internal migrations, mainly from the Northeast, since there are no historical records of direct slave trade from Central West Africa to North Brazil. Am. J. Hum. Biol. 18:93-98, 2006. (c) 2005 Wiley-Liss, Inc.
Ruaño, Gualberto; Kocherla, Mohan; Graydon, James S; Holford, Theodore R; Makowski, Gregory S; Goethe, John W
2016-05-01
We describe a population genetic approach to compare samples interpreted with expert calling (EC) versus automated calling (AC) for CYP2D6 haplotyping. The analysis represents 4812 haplotype calls based on signal data generated by the Luminex xMap analyzers from 2406 patients referred to a high-complexity molecular diagnostics laboratory for CYP450 testing. DNA was extracted from buccal swabs. We compared the results of expert calls (EC) and automated calls (AC) with regard to haplotype number and frequency. The ratio of EC to AC was 1:3. Haplotype frequencies from EC and AC samples were convergent across haplotypes, and their distribution was not statistically different between the groups. Most duplications required EC, as only expansions with homozygous or hemizygous haplotypes could be automatedly called. High-complexity laboratories can offer equivalent interpretation to automated calling for non-expanded CYP2D6 loci, and superior interpretation for duplications. We have validated scientific expert calling specified by scoring rules as standard operating procedure integrated with an automated calling algorithm. The integration of EC with AC is a practical strategy for CYP2D6 clinical haplotyping. Copyright © 2016 Elsevier B.V. All rights reserved.
Levels of human platelet-derived soluble CD40 ligand depend on haplotypes of CD40LG-CD40-ITGA2
Aloui, Chaker; Prigent, Antoine; Tariket, Sofiane; Sut, Caroline; Fagan, Jocelyne; Cognasse, Fabrice; Chakroun, Tahar; Garraud, Olivier; Laradi, Sandrine
2016-01-01
Increased circulating soluble CD40 ligand (sCD40L) is commonly associated with inflammatory disorders. We aimed to investigate whether gene polymorphisms in CD40LG, CD40 and ITGA2 are associated with a propensity to secrete sCD40L; thus, we examined this issue at the level of human platelets, the principal source of sCD40L. We performed single polymorphism and haplotype analyses to test for the effect of twelve polymorphisms across the CD40LG, CD40 and ITGA2 genes in blood donors. ITGA2 presented a positive association with rs1126643, with a significant modification in sCD40L secretion (carriers of C allele, P = 0.02), unlike the investigated CD40LG and CD40 polymorphisms. One CD40LG haplotype (TGGC) showing rs975379 (C/T), rs3092952 (A/G), rs3092933 (A/G) and rs3092929 (A/C) was associated with increased sCD40L levels (1.906 μg/L (95% CI: 1.060 to 2.751); P = 0.000009). The sCD40L level was associated with the inter-chromosomal CD40LG/CD40/ITGA2 haplotype (ATC), displaying rs3092952 (A/G), rs1883832 (C/T) and rs1126643 (C/T), with increased sCD40L levels (P = 0.0135). Our results help to decipher the genetic role of CD40LG, CD40 and ITGA2 with regard to sCD40L levels found in platelet components. Given the crucial role of sCD40L, this haplotype study in a transfusion model may be helpful to further determine the role of haplotypes in inflammatory clinical settings. PMID:27094978
Ruiz-Narváez, Edward A; Yang, Yadong; Nakanishi, Yukiko; Kirchdorfer, Jill; Campos, Hannia
2005-12-01
Genetic variation in the APOC3 and APOA5 genes has been associated with plasma triglyceride concentrations and may affect the risk of myocardial infarction (MI). To assess whether APOC3/A5 haplotypes are associated with risk of MI, we examined three single-nucleotide polymorphisms (SNPs) in APOC3 (3238C>G, -455T>C, and -482C>T) and six SNPs in the APOA5 gene (-1131T>C, c.-3A>G, c.56C>G, IVS3+476G>A, c.553G>T, and c.1259T>C) in incident cases (n = 1,703) of a first nonfatal MI matched for gender, age, and area of residence with population-based controls (n = 1,703). Conditional logistic regression models, adjusted for potential environmental confounders, were used for analysis. The common APOC3*222 haplotype was more frequent in cases than in controls (17.4% and 13.7%, respectively, P < 0.001) and was associated with increased risk of MI [odds ratio (OR) = 1.27; 95% confidence interval (95% CI), 1.09, 1.48] compared with APOC3*111 wild-type haplotype. This association was independent of the APOA5 SNPs. Although the APOC3 3238G, APOA5 -1131C, APOA5 c.-3G, and APOA5 c.1259C alleles were associated with higher triglyceride plasma concentrations, these effects could not explain the associations with MI in this population. In summary, this study supports the hypothesis that haplotypes in the APOC3 gene but not in the APOA5 gene increase susceptibility to MI.
Cha, Seongwon; Yu, Hyunjoo; Park, Ah Yeon; Song, Kwang Hoon
2014-03-12
Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C-G-A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS.
Evans, Adam R; Robinson, Renã A S
2013-11-01
Recently, we reported a novel proteomics quantitation scheme termed "combined precursor isotopic labeling and isobaric tagging (cPILOT)" that allows for the identification and quantitation of nitrated peptides in as many as 12-16 samples in a single experiment. cPILOT offers enhanced multiplexing and posttranslational modification specificity, however excludes global quantitation for all peptides present in a mixture and underestimates reporter ion ratios similar to other isobaric tagging methods due to precursor co-isolation. Here, we present a novel chemical workflow for cPILOT that can be used for global tagging of all peptides in a mixture. Specifically, through low pH precursor dimethylation of tryptic or LysC peptides followed by high pH tandem mass tags, the same reporter ion can be used twice in a single experiment. Also, to improve triple-stage mass spectrometry (MS(3) ) data acquisition, a selective MS(3) method that focuses on product selection of the y1 fragment of lysine-terminated peptides is incorporated into the workflow. This novel cPILOT workflow has potential for global peptide quantitation that could lead to enhanced sample multiplexing and increase the number of quantifiable spectra obtained from MS(3) acquisition methods. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hockersmith, E.E.; Muir, W.D.; Smith, S.G.; Sandford, B.P.; Perry, R.W.; Adams, N.S.; Rondorf, D.W.
2003-01-01
A study was conducted to compare the travel times, detection probabilities, and survival of migrant hatchery-reared yearling chinook salmon Oncorhynchus tshawytscha tagged with either gastrically or surgically implanted sham radio tags (with an imbedded passive integrated transponder [PIT] tag) with those of their cohorts tagged only with PIT tags in the Snake and Columbia rivers. Juvenile chinook salmon with gastrically implanted radio tags migrated significantly faster than either surgically radio-tagged or PIT-tagged fish, while migration rates were similar among surgically radio-tagged and PIT-tagged fish. The probabilities of PIT tag detection at downstream dams varied by less than 5% and were not significantly different among the three groups. Survival was similar among treatments for median travel times of less than approximately 6 d (migration distance of 106 km). However, for both gastrically and surgically radio-tagged fish, survival was significantly less than for PIT-tagged fish, for which median travel times exceeded approximately 10 d (migration distance of 225 km). The results of this study support the use of radio tags to estimate the survival of juvenile chinook salmon having a median fork length of approximately 150 mm (range, 127-285 mm) and a median travel time of migration of less than approximately 6 d.
Slattery, Martha L.; Lundgreen, Abbie; Herrick, Jennifer S.; Caan, Bette J.; Potter, John D.; Wolff, Roger K.
2012-01-01
There is considerable biologic plausibility to the hypothesis that genetic variability in pathways involved in insulin signaling and energy homeostasis may modulate dietary risk associated with colorectal cancer. We utilized data from 2 population-based case-control studies of colon (n = 1,574 cases, 1,970 controls) and rectal (n = 791 cases, 999 controls) cancer to evaluate genetic variation in candidate SNPs identified from 9 genes in a candidate pathway: PDK1, RP6KA1, RPS6KA2, RPS6KB1, RPS6KB2, PTEN, FRAP1 (mTOR), TSC1, TSC2, Akt1, PIK3CA, and PRKAG2 with dietary intake of total energy, carbohydrates, fat, and fiber. We employed SNP, haplotype, and multiple-gene analysis to evaluate associations. PDK1 interacted with dietary fat for both colon and rectal cancer and with dietary carbohydrates for colon cancer. Statistically significant interaction with dietary carbohydrates and rectal cancer was detected by haplotype analysis of PDK1. Evaluation of dietary interactions with multiple genes in this candidate pathway showed several interactions with pairs of genes: Akt1 and PDK1, PDK1 and PTEN, PDK1 and TSC1, and PRKAG2 and PTEN. Analyses show that genetic variation influences risk of colorectal cancer associated with diet and illustrate the importance of evaluating dietary interactions beyond the level of single SNPs or haplotypes when a biologically relevant candidate pathway is examined. PMID:21999454
BAsE-Seq: a method for obtaining long viral haplotypes from short sequence reads.
Hong, Lewis Z; Hong, Shuzhen; Wong, Han Teng; Aw, Pauline P K; Cheng, Yan; Wilm, Andreas; de Sessions, Paola F; Lim, Seng Gee; Nagarajan, Niranjan; Hibberd, Martin L; Quake, Stephen R; Burkholder, William F
2014-01-01
We present a method for obtaining long haplotypes, of over 3 kb in length, using a short-read sequencer, Barcode-directed Assembly for Extra-long Sequences (BAsE-Seq). BAsE-Seq relies on transposing a template-specific barcode onto random segments of the template molecule and assembling the barcoded short reads into complete haplotypes. We applied BAsE-Seq on mixed clones of hepatitis B virus and accurately identified haplotypes occurring at frequencies greater than or equal to 0.4%, with >99.9% specificity. Applying BAsE-Seq to a clinical sample, we obtained over 9,000 viral haplotypes, which provided an unprecedented view of hepatitis B virus population structure during chronic infection. BAsE-Seq is readily applicable for monitoring quasispecies evolution in viral diseases.
Wang, Linsheng; Zeng, Zixian; Zhang, Wenli; Jiang, Jiming
2014-02-01
We report discoveries of different haplotypes associated with the centromeres of three potato chromosomes, including haplotypes composed of long arrays of satellite repeats and haplotypes lacking the same repeats. These results are in favor of the hypothesis that satellite repeat-based centromeres may originate from neocentromeres that lack repeats.
Phylogeny and Haplotype Analysis of Fungi Within the Fusarium incarnatum-equiseti Species Complex.
Ramdial, H; Latchoo, R K; Hosein, F N; Rampersad, S N
2017-01-01
Fusarium spp. are ranked among the top 10 most economically and scientifically important plant-pathogenic fungi in the world and are associated with plant diseases that include fruit decay of a number of crops. Fusarium isolates infecting bell pepper in Trinidad were identified based on sequence comparisons of the translation elongation factor gene (EF-1a) with sequences of Fusarium incarnatum-equiseti species complex (FIESC) verified in the FUSARIUM-ID database. Eighty-two isolates were identified as belonging to one of four phylogenetic species within the subclades FIESC-1, FIESC-15, FIESC-16, and FIESC-26, with the majority of isolates belonging to FIESC-15. A comparison of the level of DNA polymorphism and phylogenetic inference for sequences of the internal transcribed spacer region (ITS1-5.8S-ITS2) and EF-1a sequences for Trinidad and FUSARIUM-ID type species was carried out. The ITS sequences were less informative, had lower haplotype diversity and restricted haplotype distribution, and resulted in poor resolution and taxa placement in the consensus maximum-likelihood tree. EF-1a sequences enabled strongly supported phylogenetic inference with highly resolved branching patterns of the 30 phylogenetic species within the FIESC and placement of representative Trinidad isolates. Therefore, global phylogeny was inferred from EF-1a sequences representing 11 countries, and separation into distinct Incarnatum and Equiseti clades was again evident. In total, 42 haplotypes were identified: 12 were shared and the remaining were unique haplotypes. The most diverse haplotype was represented by sequences from China, Indonesia, Malaysia, and Trinidad and consisted exclusively of F. incarnatum isolates. Spain had the highest haplotype diversity, perhaps because both F. equiseti and F. incarnatum sequences were represented; followed by the United States, which contributed both F. equiseti and F. incarnatum sequences to the data set; then by countries representing Southeast
Occurrence of 15 Haplotypes of Linepithema micans (Hymenoptera: Formicidae) in Southern Brazil.
Ramalho, Manuela Oliveira; Martins, C; Campos, T; Nondillo, A; Botton, M; Bueno, O C
2017-08-01
The ant genus Linepithema is widely known, thanks to the pest species Linepithema humile (Mayr), which is easily mistaken for Linepithema micans (Forel) due to their morphological similarity. Like L. humile, L. micans is associated to the main grapevine pest in Brazil, Eurhizococcus brasiliensis (Wille), also known as ground pearl. Therefore, the present study uses mtDNA fragments to expand the knowledge of haplotype diversity and distribution of L. micans in the state of Rio Grande do Sul (Brazil), to understand the genetic differences of the populations identified in this study. We identified 15 haplotypes of L. micans spread across different localities. Twelve of these haplotypes were new for the species. The high haplotype diversity uncovered in Rio Grande do Sul (Brazil) for this species was predictable, as L. micans is in its native environment. Additional studies that take gene flow into account may reveal interesting aspects of diversity in these populations. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Novel Harmful Recessive Haplotypes Identified for Fertility Traits in Nordic Holstein Cattle
Sahana, Goutam; Nielsen, Ulrik Sander; Aamand, Gert Pedersen; Lund, Mogens Sandø; Guldbrandtsen, Bernt
2013-01-01
Using genomic data, lethal recessives may be discovered from haplotypes that are common in the population but never occur in the homozygote state in live animals. This approach only requires genotype data from phenotypically normal (i.e. live) individuals and not from the affected embryos that die. A total of 7,937 Nordic Holstein animals were genotyped with BovineSNP50 BeadChip and haplotypes including 25 consecutive markers were constructed and tested for absence of homozygotes states. We have identified 17 homozygote deficient haplotypes which could be loosely clustered into eight genomic regions harboring possible recessive lethal alleles. Effects of the identified haplotypes were estimated on two fertility traits: non-return rates and calving interval. Out of the eight identified genomic regions, six regions were confirmed as having an effect on fertility. The information can be used to avoid carrier-by-carrier mattings in practical animal breeding. Further, identification of causative genes/polymorphisms responsible for lethal effects will lead to accurate testing of the individuals carrying a lethal allele. PMID:24376603
Tag-mediated cooperation with non-deterministic genotype-phenotype mapping
NASA Astrophysics Data System (ADS)
Zhang, Hong; Chen, Shu
2016-01-01
Tag-mediated cooperation provides a helpful framework for resolving evolutionary social dilemmas. However, most of the previous studies have not taken into account genotype-phenotype distinction in tags, which may play an important role in the process of evolution. To take this into consideration, we introduce non-deterministic genotype-phenotype mapping into a tag-based model with spatial prisoner's dilemma. By our definition, the similarity between genotypic tags does not directly imply the similarity between phenotypic tags. We find that the non-deterministic mapping from genotypic tag to phenotypic tag has non-trivial effects on tag-mediated cooperation. Although we observe that high levels of cooperation can be established under a wide variety of conditions especially when the decisiveness is moderate, the uncertainty in the determination of phenotypic tags may have a detrimental effect on the tag mechanism by disturbing the homophilic interaction structure which can explain the promotion of cooperation in tag systems. Furthermore, the non-deterministic mapping may undermine the robustness of the tag mechanism with respect to various factors such as the structure of the tag space and the tag flexibility. This observation warns us about the danger of applying the classical tag-based models to the analysis of empirical phenomena if genotype-phenotype distinction is significant in real world. Non-deterministic genotype-phenotype mapping thus provides a new perspective to the understanding of tag-mediated cooperation.
Method and apparatus for manufacturing gas tags
Gross, K.C.; Laug, M.T.
1996-12-17
For use in the manufacture of gas tags employed in a gas tagging failure detection system for a nuclear reactor, a plurality of commercial feed gases each having a respective noble gas isotopic composition are blended under computer control to provide various tag gas mixtures having selected isotopic ratios which are optimized for specified defined conditions such as cost. Using a new approach employing a discrete variable structure rather than the known continuous-variable optimization problem, the computer controlled gas tag manufacturing process employs an analytical formalism from condensed matter physics known as stochastic relaxation, which is a special case of simulated annealing, for input feed gas selection. For a tag blending process involving M tag isotopes with N distinct feed gas mixtures commercially available from an enriched gas supplier, the manufacturing process calculates the cost difference between multiple combinations and specifies gas mixtures which approach the optimum defined conditions. The manufacturing process is then used to control tag blending apparatus incorporating tag gas canisters connected by stainless-steel tubing with computer controlled valves, with the canisters automatically filled with metered quantities of the required feed gases. 4 figs.
Method and apparatus for manufacturing gas tags
Gross, Kenny C.; Laug, Matthew T.
1996-01-01
For use in the manufacture of gas tags employed in a gas tagging failure detection system for a nuclear reactor, a plurality of commercial feed gases each having a respective noble gas isotopic composition are blended under computer control to provide various tag gas mixtures having selected isotopic ratios which are optimized for specified defined conditions such as cost. Using a new approach employing a discrete variable structure rather than the known continuous-variable optimization problem, the computer controlled gas tag manufacturing process employs an analytical formalism from condensed matter physics known as stochastic relaxation, which is a special case of simulated annealing, for input feed gas selection. For a tag blending process involving M tag isotopes with N distinct feed gas mixtures commercially available from an enriched gas supplier, the manufacturing process calculates the cost difference between multiple combinations and specifies gas mixtures which approach the optimum defined conditions. The manufacturing process is then used to control tag blending apparatus incorporating tag gas canisters connected by stainless-steel tubing with computer controlled valves, with the canisters automatically filled with metered quantities of the required feed gases.
Rood, M; Keijsers, V; van der Linden, M W; Tong, T; Borggreve, S; Verweij, C; Breedveld, F; Huizinga, T
1999-01-01
OBJECTIVE—To investigate the association of interleukin 10 (IL10) promoter polymorphisms and neuropsychiatric manifestations of systemic lupus erythematosus (SLE). METHODS—IL10 haplotypes of 11 healthy volunteers were cloned to confirm that in the Dutch population, only the three common haplotypes (-1082/-819/-592) GCC, ACC and ATA exist. The IL10 promoter polymorphisms of 92 SLE patients and 162 healthy controls were determined. The medical records of the SLE patients were screened for the presence of neuropsychiatric involvement. RESULTS—All cloned haplotypes were either GCC, ACC or ATA. Forty two SLE patients had suffered from neuropsychiatric manifestations (NP-SLE). In NP-SLE patients, the frequency of the ATA haplotype is 30% versus 18% in the controls and 17% in the non-NP-SLE group (odds ratios 1.9, p=0.02, and 2.1, p=0.04, respectively), whereas the GCC haplotype frequency is lower in the NP-SLE group compared with controls and non-NP-SLE patients (40% versus 55% and 61%, odds ratios 0.6, p=0.02 and 0.4 p=0.006). The odds ratio for the presence of NP-SLE is inversely proportional to the number of GCC haplotypes per genotype when the NP-SLE group is compared with non-NP-SLE patients. CONCLUSIONS—The IL10 locus is associated with neuropsychiatric manifestations in SLE. This suggests that IL10 is implicated in the immunopathogenesis of neuropsychiatric manifestations in SLE. Keywords: systemic lupus erythematosus; neuropsychiatric manifestations; genetics; interleukin 10 promoter haplotypes PMID:10343522
Dehghanian, Fatemeh; Silawi, Mohammad; Tabei, Seyed M B
2017-02-01
Deficiency of phenylalanine hydroxylase (PAH) enzyme and elevation of phenylalanine in body fluids cause phenylketonuria (PKU). The gold standard for confirming PKU and PAH deficiency is detecting causal mutations by direct sequencing of the coding exons and splicing involved sequences of the PAH gene. Furthermore, haplotype analysis could be considered as an auxiliary approach for detecting PKU causative mutations before direct sequencing of the PAH gene by making comparisons between prior detected mutation linked-haplotypes and new PKU case haplotypes with undetermined mutations. In this study, 13 unrelated classical PKU patients took part in the study detecting causative mutations. Mutations were identified by polymerase chain reaction (PCR) and direct sequencing in all patients. After that, haplotype analysis was performed by studying VNTR and PAHSTR markers (linked genetic markers of the PAH gene) through application of PCR and capillary electrophoresis (CE). Mutation analysis was performed successfully and the detected mutations were as follows: c.782G>A, c.754C>T, c.842C>G, c.113-115delTCT, c.688G>A, and c.696A>G. Additionally, PAHSTR/VNTR haplotypes were detected to discover haplotypes linked to each mutation. Mutation detection is the best approach for confirming PAH enzyme deficiency in PKU patients. Due to the relatively large size of the PAH gene and high cost of the direct sequencing in developing countries, haplotype analysis could be used before DNA sequencing and mutation detection for a faster and cheaper way via identifying probable mutated exons.
Divergence at the casein haplotypes in dairy and meat goat breeds.
Küpper, Julia; Chessa, Stefania; Rignanese, Daniela; Caroli, Anna; Erhardt, Georg
2010-02-01
Casein genes have been proved to have an influence on milk properties, and are in addition appropriate for phylogeny studies. A large number of casein polymorphisms exist in goats, making their analysis quite complex. The four casein loci were analyzed by molecular techniques for genetic polymorphism detection in the two dairy goat breeds Bunte Deutsche Edelziege (BDE; n=96), Weisse Deutsche Edelziege (WDE; n=91), and the meat goat breed Buren (n=75). Of the 35 analyzed alleles, 18 were found in BDE, and 17 in Buren goats and WDE. In addition, a new allele was identified at the CSN1S1 locus in the BDE, showing a frequency of 0.05. This variant, named CSN1S1*A', is characterized by a t-->c transversion in intron 9. Linkage disequilibrium was found at the casein haplotype in all three breeds. A total of 30 haplotypes showed frequencies higher than 0.01. In the Buren breed only one haplotype showed a frequency higher than 0.1. The ancestral haplotype B-A-A-B (in the order: CSN1S1-CSN2-CSN1S2-CSN3) occurred in all three breeds, showing a very high frequency (>0.8) in the Buren.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, Nora G.; Herrwerth, O.; Wirth, A.
2011-01-15
Single-shot carrier-envelope-phase (CEP) tagging is combined with a reaction mircoscope (REMI) to investigate CEP-dependent processes in atoms. Excellent experimental stability and data acquisition longevity are achieved. Using this approach, we study the CEP effects for nonsequential double ionization of argon in 4-fs laser fields at 750 nm and an intensity of 1.6x10{sup 14} W/cm{sup 2}. The Ar{sup 2+} ionization yield shows a pronounced CEP dependence which compares well with recent theoretical predictions employing quantitative rescattering theory [S. Micheau et al., Phys. Rev. A 79, 013417 (2009)]. Furthermore, we find strong CEP influences on the Ar{sup 2+} momentum spectra along themore » laser polarization axis.« less
Buderman, Frances E; Diefenbach, Duane R; Casalena, Mary Jo; Rosenberry, Christopher S; Wallingford, Bret D
2014-04-01
The Brownie tag-recovery model is useful for estimating harvest rates but assumes all tagged individuals survive to the first hunting season; otherwise, mortality between time of tagging and the hunting season will cause the Brownie estimator to be negatively biased. Alternatively, fitting animals with radio transmitters can be used to accurately estimate harvest rate but may be more costly. We developed a joint model to estimate harvest and annual survival rates that combines known-fate data from animals fitted with transmitters to estimate the probability of surviving the period from capture to the first hunting season, and data from reward-tagged animals in a Brownie tag-recovery model. We evaluated bias and precision of the joint estimator, and how to optimally allocate effort between animals fitted with radio transmitters and inexpensive ear tags or leg bands. Tagging-to-harvest survival rates from >20 individuals with radio transmitters combined with 50-100 reward tags resulted in an unbiased and precise estimator of harvest rates. In addition, the joint model can test whether transmitters affect an individual's probability of being harvested. We illustrate application of the model using data from wild turkey, Meleagris gallapavo, to estimate harvest rates, and data from white-tailed deer, Odocoileus virginianus, to evaluate whether the presence of a visible radio transmitter is related to the probability of a deer being harvested. The joint known-fate tag-recovery model eliminates the requirement to capture and mark animals immediately prior to the hunting season to obtain accurate and precise estimates of harvest rate. In addition, the joint model can assess whether marking animals with radio transmitters affects the individual's probability of being harvested, caused by hunter selectivity or changes in a marked animal's behavior.
Buderman, Frances E.; Diefenbach, Duane R.; Casalena, Mary Jo; Rosenberry, Christopher S.; Wallingford, Bret D.
2014-01-01
The Brownie tag-recovery model is useful for estimating harvest rates but assumes all tagged individuals survive to the first hunting season; otherwise, mortality between time of tagging and the hunting season will cause the Brownie estimator to be negatively biased. Alternatively, fitting animals with radio transmitters can be used to accurately estimate harvest rate but may be more costly. We developed a joint model to estimate harvest and annual survival rates that combines known-fate data from animals fitted with transmitters to estimate the probability of surviving the period from capture to the first hunting season, and data from reward-tagged animals in a Brownie tag-recovery model. We evaluated bias and precision of the joint estimator, and how to optimally allocate effort between animals fitted with radio transmitters and inexpensive ear tags or leg bands. Tagging-to-harvest survival rates from >20 individuals with radio transmitters combined with 50–100 reward tags resulted in an unbiased and precise estimator of harvest rates. In addition, the joint model can test whether transmitters affect an individual's probability of being harvested. We illustrate application of the model using data from wild turkey, Meleagris gallapavo,to estimate harvest rates, and data from white-tailed deer, Odocoileus virginianus, to evaluate whether the presence of a visible radio transmitter is related to the probability of a deer being harvested. The joint known-fate tag-recovery model eliminates the requirement to capture and mark animals immediately prior to the hunting season to obtain accurate and precise estimates of harvest rate. In addition, the joint model can assess whether marking animals with radio transmitters affects the individual's probability of being harvested, caused by hunter selectivity or changes in a marked animal's behavior.
NASA Astrophysics Data System (ADS)
Sell, Jerzy
2003-11-01
The distribution pattern of mtDNA haplotypes in distinct populations of the glacial relict crustacean Saduria entomon was examined to assess phylogeographic relationships among them. Populations from the Baltic, the White Sea and the Barents Sea were screened for mtDNA variation using PCR-based RFLP analysis of a 1150 bp fragment containing part of the CO I and CO II genes. Five mtDNA haplotypes were recorded. An analysis of geographical heterogeneity in haplotype frequency distributions revealed significant differences among populations. The isolated populations of S. entomon have diverged since the retreat of the last glaciation. The geographical pattern of variation is most likely the result of stochastic (founder effect, genetic drift) mechanisms and suggests that the haplotype differentiation observed is probably older than the isolation of the Baltic and Arctic seas.
Improved imputation of low-frequency and rare variants using the UK10K haplotype reference panel.
Huang, Jie; Howie, Bryan; McCarthy, Shane; Memari, Yasin; Walter, Klaudia; Min, Josine L; Danecek, Petr; Malerba, Giovanni; Trabetti, Elisabetta; Zheng, Hou-Feng; Gambaro, Giovanni; Richards, J Brent; Durbin, Richard; Timpson, Nicholas J; Marchini, Jonathan; Soranzo, Nicole
2015-09-14
Imputing genotypes from reference panels created by whole-genome sequencing (WGS) provides a cost-effective strategy for augmenting the single-nucleotide polymorphism (SNP) content of genome-wide arrays. The UK10K Cohorts project has generated a data set of 3,781 whole genomes sequenced at low depth (average 7x), aiming to exhaustively characterize genetic variation down to 0.1% minor allele frequency in the British population. Here we demonstrate the value of this resource for improving imputation accuracy at rare and low-frequency variants in both a UK and an Italian population. We show that large increases in imputation accuracy can be achieved by re-phasing WGS reference panels after initial genotype calling. We also present a method for combining WGS panels to improve variant coverage and downstream imputation accuracy, which we illustrate by integrating 7,562 WGS haplotypes from the UK10K project with 2,184 haplotypes from the 1000 Genomes Project. Finally, we introduce a novel approximation that maintains speed without sacrificing imputation accuracy for rare variants.
Gerber, Kayla M.; Mather, Martha E.; Smith, Joseph M.
2017-01-01
Telemetry can inform many scientific and research questions if a context exists for integrating individual studies into the larger body of literature. Creating cumulative distributions of post-tagging evaluation metrics would allow individual researchers to relate their telemetry data to other studies. Widespread reporting of standard metrics is a precursor to the calculation of benchmarks for these distributions (e.g., mean, SD, 95% CI). Here we illustrate five types of standard post-tagging evaluation metrics using acoustically tagged Blue Catfish (Ictalurus furcatus) released into a Kansas reservoir. These metrics included: (1) percent of tagged fish detected overall, (2) percent of tagged fish detected daily using abacus plot data, (3) average number of (and percent of available) receiver sites visited, (4) date of last movement between receiver sites (and percent of tagged fish moving during that time period), and (5) number (and percent) of fish that egressed through exit gates. These metrics were calculated for one to three time periods: early (<10 d), during (weekly), and at the end of the study (5 months). Over three-quarters of our tagged fish were detected early (85%) and at the end (85%) of the study. Using abacus plot data, all tagged fish (100%) were detected at least one day and 96% were detected for > 5 days early in the study. On average, tagged Blue Catfish visited 9 (50%) and 13 (72%) of 18 within-reservoir receivers early and at the end of the study, respectively. At the end of the study, 73% of all tagged fish were detected moving between receivers. Creating statistical benchmarks for individual metrics can provide useful reference points. In addition, combining multiple metrics can inform ecology and research design. Consequently, individual researchers and the field of telemetry research can benefit from widespread, detailed, and standard reporting of post-tagging detection metrics.
Tagging as a Social Literacy Practice
ERIC Educational Resources Information Center
MacGillivray, Laurie; Curwen, Margaret Sauceda
2007-01-01
Tagging is not simply an act of vandalism or violence; it is a social practice with its own rules and codes--a literacy practice imbued with intent and meaning. Three aspects of tagging reflect its nature as a literate practice: (1) The purpose of tagging to achieve particular social goals and group affiliations; (2) The role of talent to be…
Liu, Mei; Li, Mijie; Wang, Shaoqiang; Xu, Yao; Lan, Xianyong; Li, Zhuanjian; Lei, Chuzhao; Yang, Dongying; Jia, Yutang; Chen, Hong
2014-02-25
Forkhead box A2 (Foxa2) has been recognized as one of the most potent transcriptional activators that is implicated in the control of feeding behavior and energy homeostasis. However, similar researches about the effects of genetic variations of Foxa2 gene on growth traits are lacking. Therefore, this study detected Foxa2 gene polymorphisms by DNA pool sequencing, PCR-RFLP and PCR-ACRS methods in 822 individuals from three Chinese cattle breeds. The results showed that four sequence variants (SVs) were screened, including two mutations (SV1, g. 7005 C>T and SV2, g. 7044 C>G) in intron 4, one mutation (SV3, g. 8449 A>G) in exon 5 and one mutation (SV4, g. 8537 T>C) in the 3'UTR. Notably, association analysis of the single mutations with growth traits in total individuals (at 24months) revealed that significant statistical difference was found in four SVs, and SV4 locus was highly significantly associated with growth traits throughout all three breeds (P<0.05 or P<0.01). Meanwhile, haplotype combination CCCCAGTC also indicated remarkably associated to better chest girth and body weight in Jiaxian Red cattle (P<0.05). We herein described a comprehensive study on the variability of bovine Foxa2 gene that was predictive of molecular markers in cattle breeding for the first time. Copyright © 2013 Elsevier B.V. All rights reserved.
Curry, Caitlin J.; White, Paula A.; Derr, James N.
2015-01-01
Analysis of DNA sequence diversity at the 12S to 16S mitochondrial genes of 165 African lions (Panthera leo) from five main areas in Zambia has uncovered haplotypes which link Southern Africa with East Africa. Phylogenetic analysis suggests Zambia may serve as a bridge connecting the lion populations in southern Africa to eastern Africa, supporting earlier hypotheses that eastern-southern Africa may represent the evolutionary cradle for the species. Overall gene diversity throughout the Zambian lion population was 0.7319 +/- 0.0174 with eight haplotypes found; three haplotypes previously described and the remaining five novel. The addition of these five novel haplotypes, so far only found within Zambia, nearly doubles the number of haplotypes previously reported for any given geographic location of wild lions. However, based on an AMOVA analysis of these haplotypes, there is little to no matrilineal gene flow (Fst = 0.47) when the eastern and western regions of Zambia are considered as two regional sub-populations. Crossover haplotypes (H9, H11, and Z1) appear in both populations as rare in one but common in the other. This pattern is a possible result of the lion mating system in which predominately males disperse, as all individuals with crossover haplotypes were male. The determination and characterization of lion sub-populations, such as done in this study for Zambia, represent a higher-resolution of knowledge regarding both the genetic health and connectivity of lion populations, which can serve to inform conservation and management of this iconic species. PMID:26674533
Kay, Chris; Tirado-Hurtado, Indira; Cornejo-Olivas, Mario; Collins, Jennifer A; Wright, Galen; Inca-Martinez, Miguel; Veliz-Otani, Diego; Ketelaar, Maria E; Slama, Ramy A; Ross, Colin J; Mazzetti, Pilar; Hayden, Michael R
2017-01-01
Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin (HTT) gene. HD occurs worldwide, but the causative mutation is found on different HTT haplotypes in distinct ethnic groups. In Latin America, HD is thought to have European origins, but indigenous Amerindian ancestry has not been investigated. Here, we report dense HTT haplotypes in 62 mestizo Peruvian HD families, 17 HD families from across Latin America, and 42 controls of defined Peruvian Amerindian ethnicity to determine the origin of HD in populations of admixed Amerindian and European descent. HD in Peru occurs most frequently on the A1 HTT haplotype (73%), as in Europe, but on an unexpected indigenous variant also found in Amerindian controls. This Amerindian A1 HTT haplotype predominates over the European A1 variant among geographically disparate Latin American controls and in HD families from across Latin America, supporting an indigenous origin of the HD mutation in mestizo American populations. We also show that a proportion of HD mutations in Peru occur on a C1 HTT haplotype of putative Amerindian origin (14%). The majority of HD mutations in Latin America may therefore occur on haplotypes of Amerindian ancestry rather than on haplotypes resulting from European admixture. Despite the distinct ethnic ancestry of Amerindian and European A1 HTT, alleles on the parent A1 HTT haplotype allow for development of identical antisense molecules to selectively silence the HD mutation in the greatest proportion of patients in both Latin American and European populations. PMID:28000697
Curry, Caitlin J; White, Paula A; Derr, James N
2015-01-01
Analysis of DNA sequence diversity at the 12S to 16S mitochondrial genes of 165 African lions (Panthera leo) from five main areas in Zambia has uncovered haplotypes which link Southern Africa with East Africa. Phylogenetic analysis suggests Zambia may serve as a bridge connecting the lion populations in southern Africa to eastern Africa, supporting earlier hypotheses that eastern-southern Africa may represent the evolutionary cradle for the species. Overall gene diversity throughout the Zambian lion population was 0.7319 +/- 0.0174 with eight haplotypes found; three haplotypes previously described and the remaining five novel. The addition of these five novel haplotypes, so far only found within Zambia, nearly doubles the number of haplotypes previously reported for any given geographic location of wild lions. However, based on an AMOVA analysis of these haplotypes, there is little to no matrilineal gene flow (Fst = 0.47) when the eastern and western regions of Zambia are considered as two regional sub-populations. Crossover haplotypes (H9, H11, and Z1) appear in both populations as rare in one but common in the other. This pattern is a possible result of the lion mating system in which predominately males disperse, as all individuals with crossover haplotypes were male. The determination and characterization of lion sub-populations, such as done in this study for Zambia, represent a higher-resolution of knowledge regarding both the genetic health and connectivity of lion populations, which can serve to inform conservation and management of this iconic species.
Deletion analysis of male sterility effects of t-haplotypes in the mouse.
Bennett, D; Artzt, K
1990-01-01
We present data on the effects of three chromosome 17 deletions on transmission ratio distortion (TRD) and sterility of several t-haplotypes. All three deletions have similar effects on male TRD: that is, Tdel/tcomplete genotypes all transmit their t-haplotype in very high proportion. However, each deletion has different effects on sterility of heterozygous males, with TOr/t being fertile, Thp/t less fertile, and TOrl/t still less fertile. These data suggest that wild-type genes on chromosomes homologous to t-haplotypes can be important regulators of both TRD and fertility in males, and that the wild-type genes concerned with TRD and fertility are at least to some extent different. The data also provide a rough map of the positions of these genes.
Ruiz-Narváez, Edward A; Sacks, Frank M; Campos, Hannia
2013-01-01
Background Plasma apolipoprotein (apo) C-III strongly predicts myocardial infarction (MI) and directly activates atherogenic processes invascularcells.Geneticvariationintheinsulinresponseelementofthe APOC3 promoter is associated with an increased risk of MI. Objective The objective was to determine whether the APOC3 promoter variation affects plasma apo C-III concentrations and MI only when insulin sensitivity is normal. Design TheAPOC3*222haplotype,definedbytheminorallelesofthe single nucleotide polymorphisms 3238C→G, –455T→C, and –482C→T, was studied in 1703 matched nonfatal case-control pairs with MI in the Central Valley of Costa Rica. We used fasting hyper-glycemia and abdominal obesity as surrogates for insulin sensitivity. Results The APOC3*222 haplotype was associated with higher apo C-III concentrations only in those with the lowest waist circumference or fasting glucose concentration. The association between the APOC3*222 haplotype and nonfatal MI, previously reported in this population, was strongly influenced by fasting hyperglycemia and abdominal obesity. The odds ratios for MI for the APOC3*222 haplotype were 1.72 (95% CI: 1.16, 2.54) and 1.84 (1.31, 2.59) in subjects in the lowest quintiles of abdominal obesity and fasting hyperglycemia, respectively, and were 0.75 (0.54, 1.05) and 1.16 (0.85, 1.59) in subjects in the highest quintiles, respectively (P for interaction <0.05). Conclusion The results support the concept that mutations in the APOC3 promoter inhibit the down-regulation of APOC3 expression by insulin. This cardioprotective system becomes dysfunctional in abdominal obesity and hyperglycemia. PMID:18541587
Surface Acoustic Wave Tag-Based Coherence Multiplexing
NASA Technical Reports Server (NTRS)
Youngquist, Robert C. (Inventor); Malocha, Donald (Inventor); Saldanha, Nancy (Inventor)
2016-01-01
A surface acoustic wave (SAW)-based coherence multiplexing system includes SAW tags each including a SAW transducer, a first SAW reflector positioned a first distance from the SAW transducer and a second SAW reflector positioned a second distance from the SAW transducer. A transceiver including a wireless transmitter has a signal source providing a source signal and circuitry for transmitting interrogation pulses including a first and a second interrogation pulse toward the SAW tags, and a wireless receiver for receiving and processing response signals from the SAW tags. The receiver receives scrambled signals including a convolution of the wideband interrogation pulses with response signals from the SAW tags and includes a computing device which implements an algorithm that correlates the interrogation pulses or the source signal before transmitting against the scrambled signals to generate tag responses for each of the SAW tags.
Haplotype Sharing Provides Insights into Fine-Scale Population History and Disease in Finland.
Martin, Alicia R; Karczewski, Konrad J; Kerminen, Sini; Kurki, Mitja I; Sarin, Antti-Pekka; Artomov, Mykyta; Eriksson, Johan G; Esko, Tõnu; Genovese, Giulio; Havulinna, Aki S; Kaprio, Jaakko; Konradi, Alexandra; Korányi, László; Kostareva, Anna; Männikkö, Minna; Metspalu, Andres; Perola, Markus; Prasad, Rashmi B; Raitakari, Olli; Rotar, Oxana; Salomaa, Veikko; Groop, Leif; Palotie, Aarno; Neale, Benjamin M; Ripatti, Samuli; Pirinen, Matti; Daly, Mark J
2018-05-03
Finland provides unique opportunities to investigate population and medical genomics because of its adoption of unified national electronic health records, detailed historical and birth records, and serial population bottlenecks. We assembled a comprehensive view of recent population history (≤100 generations), the timespan during which most rare-disease-causing alleles arose, by comparing pairwise haplotype sharing from 43,254 Finns to that of 16,060 Swedes, Estonians, Russians, and Hungarians from geographically and linguistically adjacent countries with different population histories. We find much more extensive sharing in Finns, with at least one ≥ 5 cM tract on average between pairs of unrelated individuals. By coupling haplotype sharing with fine-scale birth records from more than 25,000 individuals, we find that although haplotype sharing broadly decays with geographical distance, there are pockets of excess haplotype sharing; individuals from northeast Finland typically share several-fold more of their genome in identity-by-descent segments than individuals from southwest regions. We estimate recent effective population-size changes through time across regions of Finland, and we find that there was more continuous gene flow as Finns migrated from southwest to northeast between the early- and late-settlement regions than was dichotomously described previously. Lastly, we show that haplotype sharing is locally enriched by an order of magnitude among pairs of individuals sharing rare alleles and especially among pairs sharing rare disease-causing variants. Our work provides a general framework for using haplotype sharing to reconstruct an integrative view of recent population history and gain insight into the evolutionary origins of rare variants contributing to disease. Copyright © 2018 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
The effects of old and recent migration waves in the distribution of HBB*S globin gene haplotypes
Lindenau, Juliana D.; Wagner, Sandrine C.; de Castro, Simone M.; Hutz, Mara H.
2016-01-01
Abstract Sickle cell hemoglobin is the result of a mutation at the sixth amino acid position of the beta (β) globin chain. The HBB*S gene is in linkage disequilibrium with five main haplotypes in the β-globin-like gene cluster named according to their ethnic and geographic origins: Bantu (CAR), Benin (BEN), Senegal (SEN), Cameroon (CAM) and Arabian-Indian (ARAB). These haplotypes demonstrated that the sickle cell mutation arose independently at least five times in human history. The distribution of βS haplotypes among Brazilian populations showed a predominance of the CAR haplotype. American populations were clustered in two groups defined by CAR or BEN haplotype frequencies. This scenario is compatible with historical records about the slave trade in the Americas. When all world populations where the sickle cell gene occurs were analyzed, three clusters were disclosed based on CAR, BEN or ARAB haplotype predominance. These patterns may change in the next decades due to recent migrations waves. Since these haplotypes show different clinical characteristics, these recent migrations events raise the necessity to develop optimized public health programs for sickle cell disease screening and management. PMID:27706371
48 CFR 908.7101-7 - Government license tags.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 48 Federal Acquisition Regulations System 5 2012-10-01 2012-10-01 false Government license tags... Government license tags. (a) Government license tags shall be procured and assignments recorded by DOE... the District of Columbia, official Government tags shall be obtained from the Department of...
Unique haplotypes of cacao trees as revealed by trnH-psbA chloroplast DNA
Gutiérrez-López, Nidia; Ovando-Medina, Isidro; Salvador-Figueroa, Miguel; Molina-Freaner, Francisco; Avendaño-Arrazate, Carlos H.
2016-01-01
Cacao trees have been cultivated in Mesoamerica for at least 4,000 years. In this study, we analyzed sequence variation in the chloroplast DNA trnH-psbA intergenic spacer from 28 cacao trees from different farms in the Soconusco region in southern Mexico. Genetic relationships were established by two analysis approaches based on geographic origin (five populations) and genetic origin (based on a previous study). We identified six polymorphic sites, including five insertion/deletion (indels) types and one transversion. The overall nucleotide diversity was low for both approaches (geographic = 0.0032 and genetic = 0.0038). Conversely, we obtained moderate to high haplotype diversity (0.66 and 0.80) with 10 and 12 haplotypes, respectively. The common haplotype (H1) for both networks included cacao trees from all geographic locations (geographic approach) and four genetic groups (genetic approach). This common haplotype (ancient) derived a set of intermediate haplotypes and singletons interconnected by one or two mutational steps, which suggested directional selection and event purification from the expansion of narrow populations. Cacao trees from Soconusco region were grouped into one cluster without any evidence of subclustering based on AMOVA (FST = 0) and SAMOVA (FST = 0.04393) results. One population (Mazatán) showed a high haplotype frequency; thus, this population could be considered an important reservoir of genetic material. The indels located in the trnH-psbA intergenic spacer of cacao trees could be useful as markers for the development of DNA barcoding. PMID:27076998
Baessler, Andrea; Fischer, Marcus; Mayer, Bjoern; Koehler, Martina; Wiedmann, Silke; Stark, Klaus; Doering, Angela; Erdmann, Jeanette; Riegger, Guenter; Schunkert, Heribert; Kwitek, Anne E; Hengstenberg, Christian
2007-04-15
Data from both experimental models and humans provide evidence that ghrelin and its receptor, the growth hormone secretagogue receptor (ghrelin receptor, GHSR), possess a variety of cardiovascular effects. Thus, we hypothesized that genetic variants within the ghrelin system (ligand ghrelin and its receptor GHSR) are associated with susceptibility to myocardial infarction (MI) and coronary artery disease (CAD). Seven single nucleotide polymorphisms (SNPs) covering the GHSR region as well as eight SNPs across the ghrelin gene (GHRL) region were genotyped in index MI patients (864 Caucasians, 'index MI cases') from the German MI family study and in matched controls without evidence of CAD (864 Caucasians, 'controls', MONICA Augsburg). In addition, siblings of these MI patients with documented severe CAD (826 'affected sibs') were matched likewise with controls (n = 826 Caucasian 'controls') and used for verification. The effect of interactions between genetic variants of both genes of the ghrelin system was explored by conditional classification tree models. We found association of several GHSR SNPs with MI [best SNP odds ratio (OR) 1.7 (1.2-2.5); P = 0.002] using a recessive model. Moreover, we identified a common GHSR haplotype which significantly increases the risk for MI [multivariate adjusted OR for homozygous carriers 1.6 (1.1-2.5) and CAD OR 1.6 (1.1-2.5)]. In contrast, no relationship between genetic variants and the disease could be revealed for GHRL. However, the increase in MI/CAD frequency related to the susceptible GHSR haplotype was abolished when it coincided with a common GHRL haplotype. Multivariate adjustments as well as permutation-based methods conveyed the same results. These data are the first to demonstrate an association of SNPs and haplotypes within important genes of the ghrelin system and the susceptibility to MI, whereas association with MI/CAD could be identified for genetic variants across GHSR, no relationship could be revealed for GHRL
HLA-G, -A haplotypes in Amerindians (Ecuador): HLA-G*01:05N World distribution.
Arnaiz-Villena, Antonio; Palacio-Gruber, Jose; Enriquez de Salamanca, Mercedes; Juárez, Ignacio; Campos, Cristina; Nieto, Jorge; Muñiz, Ester; Martin-Villa, Jose Manuel
2018-02-01
HLA-G and HLA-A frequencies have been analysed in Amerindians from Ecuador. HLA-G allele frequencies are found to be closer to those of other Amerindians (Mayas from Guatemala and Uros from Peru) and closer to European ones than to Far East Asians groups, particularly, regarding to HLA-G*01:04 allele. HLA-G/-A haplotypes have been calculated for the first time in Amerindians. It is remarkable that HLA-G*01:05N "null" allele is found in a very low frequency (like in Amerindian Mayas and Uros) and is also found in haplotypes belonging to the HLA-A19 group of alleles (HLA-A*30, -A*31, -A*33). It was previously postulated that HLA-G*01:05N appeared in HLA-A*30/-B*13 haplotypes in Middle East Mediterraneans. It may be hypothesized that in Evolution, HLA-G*01:05N existed primarily in one of the HLA extant or extinct -A19 haplotype, whether this haplotype was placed in Middle East or other World areas, including America. However, the highest present day HLA-G*01:05N frequencies are found in Middle East Mediterraneans. Copyright © 2017. Published by Elsevier Inc.
Grubic, Z; Maskalan, M; Stingl Jankovic, K; Zvecic, S; Dumic Kubat, K; Krnic, N; Zunec, R; Ille, J; Kusec, V; Dumic, M
2016-11-01
The CYP21A2 mutations that are in linkage disequilibrium with particular HLA-A, -B, -DRB1 alleles/haplotypes, cause deficiency of the 21-hydroxylase enzyme (21-OHD) and account for the majority of congenital adrenal hyperplasia (CAH) cases. The aim of this study was to investigate those associations with the p.V282L mutation linked to the non-classical (NC) form of CAH among Croatians. The study included parents of patients with the NC form of CAH, positive for the p.V282L mutation (N = 55) and cadaveric donor samples (N = 231). All subjects were HLA-A, -B, and -DRB1 typed and tested for the presence of the p.V282L mutation. Among parents of patients, 92.73% of subjects were positive for the B*14:02 allele and almost half of them carried the HLA-A*33:01-B*14:02-DRB1*01:02 haplotype. Among cadaveric samples 77 out of 96 subjects positive for the B*14:02 allele had the p.V282L mutation. Among them, 37 were positive for the HLA-A*33:01-B*14:02-DRB1*01:02 haplotype, 23 had the HLA-A*33:01-B*14:02-DRB1*03:01 haplotype, 8 had the B*14:02-DRB1*01:02 combination and 5 were carrying the HLA-A*68:02-B*14:02-DRB1*13:03 haplotype. Only 4 of these subjects were positive for the B*14:02 allele. HLA-B*14:02 was the only single allele with association that reached statistically significant P value (RR = 12.00; P = 0.0024). Haplotypes B*14:02-DRB1*01:02 (P < 0.001) and HLA-A*68:02-B*14:02-DRB1*13:03 (P < 0.001) as well as HLA-A*33:01-B*14:02-DRB1*01:02 and HLA-A*33:01-B*14:02-DRB1*03:01 showed high relative risks (RR = 45.00, RR = 41.63 and RR = 36.96, respectively). Our data support the previously documented association of the HLA-A*33:01-B*14:02-DRB1*01:02 haplotype with the p.V282L mutation, but also point out a high frequency of the p.V282L mutation among Croatians with HLA-A*33:01-B*14:02-DRB1*03:01 and HLA-A*68:02-B*14:02-DRB1*13:03 haplotypes. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
[Frequency distribution of HLA antigens and haplotypes in newly arrived inhabitants of Magadan].
Solovenchuk, L L; Pereverzeva, V V; Nevretdinova, Z G
1994-09-01
Peculiarities of the frequency distribution of antigens and haplotypes of A, B, and Cw subloci of the HLA system in 924 Slavic inhabitants of Magadan are described. Significant differences in gene and haplotype frequencies between inhabitants of Magadan and those of Moscow, Odessa, Poles'e, Latvia, and England were revealed, which could not be attributed solely to the specificity of migration processes. On the basis of an analysis of gamete associations of the A and B subloci, an attempt was made to explain the specificity of the frequency distribution of HLA system alleles and haplotypes in the investigated sample from an ecological point of view.
Schäfer, Christian; Schmidt, Alexander H; Sauter, Jürgen
2017-05-30
Knowledge of HLA haplotypes is helpful in many settings as disease association studies, population genetics, or hematopoietic stem cell transplantation. Regarding the recruitment of unrelated hematopoietic stem cell donors, HLA haplotype frequencies of specific populations are used to optimize both donor searches for individual patients and strategic donor registry planning. However, the estimation of haplotype frequencies from HLA genotyping data is challenged by the large amount of genotype data, the complex HLA nomenclature, and the heterogeneous and ambiguous nature of typing records. To meet these challenges, we have developed the open-source software Hapl-o-Mat. It estimates haplotype frequencies from population data including an arbitrary number of loci using an expectation-maximization algorithm. Its key features are the processing of different HLA typing resolutions within a given population sample and the handling of ambiguities recorded via multiple allele codes or genotype list strings. Implemented in C++, Hapl-o-Mat facilitates efficient haplotype frequency estimation from large amounts of genotype data. We demonstrate its accuracy and performance on the basis of artificial and real genotype data. Hapl-o-Mat is a versatile and efficient software for HLA haplotype frequency estimation. Its capability of processing various forms of HLA genotype data allows for a straightforward haplotype frequency estimation from typing records usually found in stem cell donor registries.
Hamstra, Danielle A; de Kloet, E Ronald; Tollenaar, Marieke; Verkuil, Bart; Manai, Meriem; Putman, Peter; Van der Does, Willem
2016-10-01
The processing of emotional information is affected by menstrual cycle phase and by the use of oral contraceptives (OCs). The stress hormone cortisol is known to affect emotional information processing via the limbic mineralocorticoid receptor (MR). We investigated in an exploratory study whether the MR-genotype moderates the effect of both OC-use and menstrual cycle phase on emotional cognition. Healthy premenopausal volunteers (n=93) of West-European descent completed a battery of emotional cognition tests. Forty-nine participants were OC users and 44 naturally cycling, 21 of whom were tested in the early follicular (EF) and 23 in the mid-luteal (ML) phase of the menstrual cycle. In MR-haplotype 1/3 carriers, ML women gambled more than EF women when their risk to lose was relatively small. In MR-haplotype 2, ML women gambled more than EF women, regardless of their odds of winning. OC-users with MR-haplotype 1/3 recognised fewer facial expressions than ML women with MR-haplotype 1/3. MR-haplotype 1/3 carriers may be more sensitive to the influence of their female hormonal status. MR-haplotype 2 carriers showed more risky decision-making. As this may reflect optimistic expectations, this finding may support previous observations in female carriers of MR-haplotype 2 in a naturalistic cohort study. © The Author(s) 2016.
48 CFR 908.7101-7 - Government license tags.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false Government license tags... Government license tags. (a) Government license tags shall be procured and assignments recorded by DOE... local laws, regulations, and procedures. (d) In the District of Columbia, official Government tags shall...
2014-01-01
Background Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. Methods The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). Results The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C–G–A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. Conclusions We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS. PMID:24618354
Ruiz-Narváez, Edward A; Sacks, Frank M; Campos, Hannia
2008-06-01
Plasma apolipoprotein (apo) C-III strongly predicts myocardial infarction (MI) and directly activates atherogenic processes in vascular cells. Genetic variation in the insulin response element of the APOC3 promoter is associated with an increased risk of MI. The objective was to determine whether the APOC3 promoter variation affects plasma apo C-III concentrations and MI only when insulin sensitivity is normal. The APOC3*222 haplotype, defined by the minor alleles of the single nucleotide polymorphisms 3238C-->G, -455T-->C, and -482C-->T, was studied in 1703 matched nonfatal case-control pairs with MI in the Central Valley of Costa Rica. We used fasting hyperglycemia and abdominal obesity as surrogates for insulin sensitivity. The APOC3*222 haplotype was associated with higher apo C-III concentrations only in those with the lowest waist circumference or fasting glucose concentration. The association between the APOC3*222 haplotype and nonfatal MI, previously reported in this population, was strongly influenced by fasting hyperglycemia and abdominal obesity. The odds ratios for MI for the APOC3*222 haplotype were 1.72 (95% CI: 1.16, 2.54) and 1.84 (1.31, 2.59) in subjects in the lowest quintiles of abdominal obesity and fasting hyperglycemia, respectively, and were 0.75 (0.54, 1.05) and 1.16 (0.85, 1.59) in subjects in the highest quintiles, respectively (P for interaction <0.05). The results support the concept that mutations in the APOC3 promoter inhibit the down-regulation of APOC3 expression by insulin. This cardioprotective system becomes dysfunctional in abdominal obesity and hyperglycemia.
Kalantari, Naser; Keshavarz Mohammadi, Nastaran; Izadi, Pantea; Doaei, Saeid; Gholamalizadeh, Maryam; Eini-Zinab, Hassan; Salonurmi, Tuire; Rafieifar, Shahram; Janipoor, Reza; Azizi Tabesh, Ghasem
2018-01-01
Single-nucleotide polymorphisms (SNPs), which are located in the first intron of the FTO gene, are reported to be associated with body weight and the body mass index (BMI). However, their effects on anthropometric measurements in adolescents are poorly understood. This study aimed to investigate the association of three adjacent polymorphisms (rs9930506, rs9930501, & rs9932754) in the FTO gene with anthropometric indices in Iranian adolescent males. The participants comprised a total of 237 adolescent males who were recruited randomly from two high schools in Tehran, Iran. The DNA samples were genotyped for the FTO gene polymorphisms by DNA sequencing. BMI, body fat percentage (BF%), and body muscle percentage (BM%) were determined using a validated bioelectrical impedance analysis scale. The association of the FTO polymorphisms with weight, height, BMI, BF%, and BM% was investigated. A haplotype of rs9930506, rs9930501, and rs9932754 (GGT) in the first intron of the FTO with complete linkage disequilibrium (LD) was found to be significantly associated with higher weight (OR = 1.32), BMI (OR = 5.36) and BF% (OR = 1.46), and lower BM% (OR = 3.59) (all P<0.001). None of the students with GGC genotypes were underweight, while all of the students with AAT genotypes had high muscle mass. A haplotype in the first intron of the FTO gene had a strong association with obesity indices in Iranian adolescent males. The FTO gene polymorphisms might have greater effects on anthropometric indices than what was previously imagined. Moreover, we suggested that the FTO gene exerted their effects on anthropometric measurements through haplotypes (and not single SNPs).
Behavioral tagging of extinction learning.
de Carvalho Myskiw, Jociane; Benetti, Fernando; Izquierdo, Iván
2013-01-15
Extinction of contextual fear in rats is enhanced by exposure to a novel environment at 1-2 h before or 1 h after extinction training. This effect is antagonized by administration of protein synthesis inhibitors anisomycin and rapamycin into the hippocampus, but not into the amygdala, immediately after either novelty or extinction training, as well as by the gene expression blocker 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole administered after novelty training, but not after extinction training. Thus, this effect can be attributed to a mechanism similar to synaptic tagging, through which long-term potentiation can be enhanced by other long-term potentiations or by exposure to a novel environment in a protein synthesis-dependent fashion. Extinction learning produces a tag at the appropriate synapses, whereas novelty learning causes the synthesis of plasticity-related proteins that are captured by the tag, strengthening the synapses that generated this tag.
Vasquez, Edward A.; Glenn, Edward P.; Brown, J. Jed; Guntenspergen, Glenn R.; Nelson, Stephen G.
2005-01-01
A distinct, non-native haplotype of the common reed Phragmites australis has become invasive in Atlantic coastal Spartina marshes. We compared the salt tolerance and other growth characteristics of the invasive M haplotype with 2 native haplotypes (F and AC) in greenhouse experiments. The M haplotype retained 50% of its growth potential up to 0.4 M NaCl, whereas the F and AC haplotypes did not grow above 0.1 M NaCl. The M haplotype produced more shoots per gram of rhizome tissue and had higher relative growth rates than the native haplotypes on both freshwater and saline water treatments. The M haplotype also differed from the native haplotypes in shoot water content and the biometrics of shoots and rhizomes. The results offer an explanation for how the M haplotype is able to spread in coastal salt marshes and support the conclusion of DNA analyses that the M haplotype is a distinct ecotype of P. australis.
Specific CAPN10 gene haplotypes influence the clinical profile of polycystic ovary patients.
Gonzalez, Alejandro; Abril, Eduardo; Roca, Alfredo; Aragón, Maria José; Figueroa, Maria José; Velarde, Pilar; Ruiz, Rocío; Fayez, Omar; Galán, José Jorge; Herreros, José Antonio; Real, Luis Miguel; Ruiz, Agustín
2003-11-01
Recently, several research groups have evaluated CAPN10 gene in polycystic ovarian syndrome (PCOS) patients and other phenotypes, including hirsutism or intermediate phenotypes of PCOS. Molecular genetic analysis of CAPN10 gene indicates that different alleles may play a role in PCOS susceptibility and could be associated with idiopathic hirsutism. However, these observations are not exempt from controversy, because independent studies cannot replicate these preliminary findings. We present a haplotype-phenotype correlation study of CAPN10 haplotypes in 148 women showing ecographically detected polycystic ovaries (PCO) combined with one or more of these clinical symptoms: amenorrhea or severe oligomenorrhea, hyperandrogenism, and anovulatory infertility, as well as 93 unrelated controls. We have reconstructed and analyzed 482 CAPN10 haplotypes in patients and controls. We detected the association of UCSNP-44 allele with PCO phenotype in the Spanish population (P = 0.02). In addition, we identified several CAPN10 alleles associated to phenotypic differences observed between PCO patients, such as the presence of hypercholesterolemia (haplotype 1121, P = 0.005), presence of hyperandrogenic features (P = 0.05), and familial cancer incidence (haplotype 1111, P = 0.0005). Our results confirm the association of UCSNP-44 allele with PCO phenotype in the Spanish population. Moreover, we have identified novel candidate risk alleles and genotypes, within CAPN10 gene, that could be associated with important phenotypic and prognosis differences observed in PCOS patients.
Luukkonen, Aino; Teramo, Kari; Puttonen, Hilkka; Ojaniemi, Marja; Varilo, Teppo; Chaudhari, Bimal P.; Plunkett, Jevon; Murray, Jeffrey C.; McCarroll, Steven A.; Muglia, Louis J.; Palotie, Aarno; Hallman, Mikko
2011-01-01
Preterm birth is the major cause of neonatal death and serious morbidity. Most preterm births are due to spontaneous onset of labor without a known cause or effective prevention. Both maternal and fetal genomes influence the predisposition to spontaneous preterm birth (SPTB), but the susceptibility loci remain to be defined. We utilized a combination of unique population structures, family-based linkage analysis, and subsequent case-control association to identify a susceptibility haplotype for SPTB. Clinically well-characterized SPTB families from northern Finland, a subisolate founded by a relatively small founder population that has subsequently experienced a number of bottlenecks, were selected for the initial discovery sample. Genome-wide linkage analysis using a high-density single-nucleotide polymorphism (SNP) array in seven large northern Finnish non-consanginous families identified a locus on 15q26.3 (HLOD 4.68). This region contains the IGF1R gene, which encodes the type 1 insulin-like growth factor receptor IGF-1R. Haplotype segregation analysis revealed that a 55 kb 12-SNP core segment within the IGF1R gene was shared identical-by-state (IBS) in five families. A follow-up case-control study in an independent sample representing the more general Finnish population showed an association of a 6-SNP IGF1R haplotype with SPTB in the fetuses, providing further evidence for IGF1R as a SPTB predisposition gene (frequency in cases versus controls 0.11 versus 0.05, P = 0.001, odds ratio 2.3). This study demonstrates the identification of a predisposing, low-frequency haplotype in a multifactorial trait using a well-characterized population and a combination of family and case-control designs. Our findings support the identification of the novel susceptibility gene IGF1R for predisposition by the fetal genome to being born preterm. PMID:21304894
Measurement of tag confidence in user generated contents retrieval
NASA Astrophysics Data System (ADS)
Lee, Sihyoung; Min, Hyun-Seok; Lee, Young Bok; Ro, Yong Man
2009-01-01
As online image sharing services are becoming popular, the importance of correctly annotated tags is being emphasized for precise search and retrieval. Tags created by user along with user-generated contents (UGC) are often ambiguous due to the fact that some tags are highly subjective and visually unrelated to the image. They cause unwanted results to users when image search engines rely on tags. In this paper, we propose a method of measuring tag confidence so that one can differentiate confidence tags from noisy tags. The proposed tag confidence is measured from visual semantics of the image. To verify the usefulness of the proposed method, experiments were performed with UGC database from social network sites. Experimental results showed that the image retrieval performance with confidence tags was increased.
Haplotype Analysis of the Melanopsin Gene in Seasonal Affective Disorder and Controls
2007-06-19
Cole, P. A. (2002). Serotonin n-acetyltransferase: Mechanism and inhibition. Current Medicinal Chemistry , 9(12), 1187-1199. 152 APPENDIX A STRUCTURED ...such that low light levels fall below this threshold during winter in individuals with SAD. The present study investigated the haplotype structure of...Association Studies 51 Advantages of Population-Based Case-Control Samples 52 Haplotype Structure 53 Linkage Disequilibrium: A Measure of Correlation Between
2012-09-30
migration routes and on sperm whales in 2010 and 2011 (funded by BP and NOAA-NRDA) to follow-up on the consequences of the Deepwater Horizon (DWH...dive behavior to especially examine sperm whale foraging behavior. The data will be downloaded from recovered tags to evaluate complex foraging...with the WC Location-only tags off Sakhalin Island, Russia to determine migration routes and tag a small number of sperm whales in the Gulf of Mexico
Harendra, Galhenagey Gayani; Jayasekara, Rohan W; Dissanayake, Vajira H W
2012-01-01
Heparin-binding epidermal-growth-factor-like growth factor (HBEGF) plays an important role in placentation, including impaired placentation, the primary defect seen in pre-eclampsia. We carried out a case-control disease-association study to examine the association of single nucleotide polymorphisms (SNP) in the HBEGF gene and haplotypes defined by them with pre-eclampsia in a Sinhalese population in Sri Lanka. A total of 175 women with pre-eclampsia and 171 matched normotensive controls were genotyped for six SNP selected in silico as having putative functional effects using mass array Sequenom iplex methodology and a newly designed polymerase chain reaction-restriction fragment length polymorphism assay. The individual SNP were not associated with pre-eclampsia. The haplotypes defined by them, however, showed both predisposing (rs13385T,rs2074613G,rs2237076G,rs2074611C,rs4150196A,rs1862176A; odds ratio,1.65; 95% confidence interval1.04-2.60; P=0.032) and protective (rs13385C,rs2074613G,rs2237076A,rs2074611C,rs4150196A,rs1862176A; odds ratio,0.20; 95% confidence interval, 0.04-0.89; P=0.034) effects. These results confirm that polymorphisms in the HGEGF gene are associated with pre-eclampsia. The haplotypes are likely to exert their effects through the numerous transcription regulation factors binding to the polymorphic sites, namely GATA-1, GATA-3, MZF-1 and AML-1a. © 2011 The Authors. Journal of Obstetrics and Gynaecology Research © 2011 Japan Society of Obstetrics and Gynecology.
Insights into HLA-G Genetics Provided by Worldwide Haplotype Diversity
Castelli, Erick C.; Ramalho, Jaqueline; Porto, Iane O. P.; Lima, Thálitta H. A.; Felício, Leandro P.; Sabbagh, Audrey; Donadi, Eduardo A.; Mendes-Junior, Celso T.
2014-01-01
Human leukocyte antigen G (HLA-G) belongs to the family of non-classical HLA class I genes, located within the major histocompatibility complex (MHC). HLA-G has been the target of most recent research regarding the function of class I non-classical genes. The main features that distinguish HLA-G from classical class I genes are (a) limited protein variability, (b) alternative splicing generating several membrane bound and soluble isoforms, (c) short cytoplasmic tail, (d) modulation of immune response (immune tolerance), and (e) restricted expression to certain tissues. In the present work, we describe the HLA-G gene structure and address the HLA-G variability and haplotype diversity among several populations around the world, considering each of its major segments [promoter, coding, and 3′ untranslated region (UTR)]. For this purpose, we developed a pipeline to reevaluate the 1000Genomes data and recover miscalled or missing genotypes and haplotypes. It became clear that the overall structure of the HLA-G molecule has been maintained during the evolutionary process and that most of the variation sites found in the HLA-G coding region are either coding synonymous or intronic mutations. In addition, only a few frequent and divergent extended haplotypes are found when the promoter, coding, and 3′UTRs are evaluated together. The divergence is particularly evident for the regulatory regions. The population comparisons confirmed that most of the HLA-G variability has originated before human dispersion from Africa and that the allele and haplotype frequencies have probably been shaped by strong selective pressures. PMID:25339953
Ma, Jennie Z; Beuten, Joke; Payne, Thomas J; Dupont, Randolph T; Elston, Robert C; Li, Ming D
2005-06-15
DOPA decarboxylase (DDC; also known as L-amino acid decarboxylase; AADC) is involved in the synthesis of dopamine, norepinephrine and serotonin. Because the mesolimbic dopaminergic system is implicated in the reinforcing effects of many drugs, including nicotine, the DDC gene is considered a plausible candidate for involvement in the development of vulnerability to nicotine dependence (ND). Further, this gene is located within the 7p11 region that showed a 'suggestive linkage' to ND in our previous genome-wide scan in the Framingham Heart Study population. In the present study, we tested eight single nucleotide polymorphisms (SNPs) within DDC for association with ND, which was assessed by smoking quantity (SQ), the heaviness of smoking index (HSI) and the Fagerstrom test for ND (FTND) score, in a total of 2037 smokers and non-smokers from 602 nuclear families of African- or European-American (AA or EA, respectively) ancestry. Association analysis for individual SNPs using the PBAT-GEE program indicated that SNP rs921451 was significantly associated with two of the three adjusted ND measures in the EA sample (P=0.01-0.04). Haplotype-based association analysis revealed a protective T-G-T-G haplotype for rs921451-rs3735273-rs1451371-rs2060762 in the AA sample, which was significantly associated with all three adjusted ND measures after correction for multiple testing (min Z=-2.78, P=0.006 for HSI). In contrast, we found a high-risk T-G-T-G haplotype for a different SNP combination in the EA sample, rs921451-rs3735273-rs1451371-rs3757472, which showed a significant association after Bonferroni correction with the SQ and FTND score (max Z=2.73, P=0.005 for FTND). In summary, our findings provide the first evidence for the involvement of DDC in the susceptibility to ND and, further, reveal the racial specificity of its impact.
Zheng, Jie; Rodriguez, Santiago; Laurin, Charles; Baird, Denis; Trela-Larsen, Lea; Erzurumluoglu, Mesut A; Zheng, Yi; White, Jon; Giambartolomei, Claudia; Zabaneh, Delilah; Morris, Richard; Kumari, Meena; Casas, Juan P; Hingorani, Aroon D; Evans, David M; Gaunt, Tom R; Day, Ian N M
2017-01-01
Fine mapping is a widely used approach for identifying the causal variant(s) at disease-associated loci. Standard methods (e.g. multiple regression) require individual level genotypes. Recent fine mapping methods using summary-level data require the pairwise correlation coefficients ([Formula: see text]) of the variants. However, haplotypes rather than pairwise [Formula: see text], are the true biological representation of linkage disequilibrium (LD) among multiple loci. In this article, we present an empirical iterative method, HAPlotype Regional Association analysis Program (HAPRAP), that enables fine mapping using summary statistics and haplotype information from an individual-level reference panel. Simulations with individual-level genotypes show that the results of HAPRAP and multiple regression are highly consistent. In simulation with summary-level data, we demonstrate that HAPRAP is less sensitive to poor LD estimates. In a parametric simulation using Genetic Investigation of ANthropometric Traits height data, HAPRAP performs well with a small training sample size (N < 2000) while other methods become suboptimal. Moreover, HAPRAP's performance is not affected substantially by single nucleotide polymorphisms (SNPs) with low minor allele frequencies. We applied the method to existing quantitative trait and binary outcome meta-analyses (human height, QTc interval and gallbladder disease); all previous reported association signals were replicated and two additional variants were independently associated with human height. Due to the growing availability of summary level data, the value of HAPRAP is likely to increase markedly for future analyses (e.g. functional prediction and identification of instruments for Mendelian randomization). The HAPRAP package and documentation are available at http://apps.biocompute.org.uk/haprap/ CONTACT: : jie.zheng@bristol.ac.uk or tom.gaunt@bristol.ac.ukSupplementary information: Supplementary data are available at
Overview of Fusion Tags for Recombinant Proteins.
Kosobokova, E N; Skrypnik, K A; Kosorukov, V S
2016-03-01
Virtually all recombinant proteins are now prepared using fusion domains also known as "tags". The use of tags helps to solve some serious problems: to simplify procedures of protein isolation, to increase expression and solubility of the desired protein, to simplify protein refolding and increase its efficiency, and to prevent proteolysis. In this review, advantages and disadvantages of such fusion tags are analyzed and data on both well-known and new tags are generalized. The authors own data are also presented.
Submegabase Clusters of Unstable Tandem Repeats Unique to the Tla Region of Mouse T Haplotypes
Uehara, H.; Ebersole, T.; Bennett, D.; Artzt, K.
1990-01-01
We describe here the identification and genomic organization of mouse t haplotype-specific elements (TSEs) 7.8 and 5.8 kb in length. The TSEs exist as submegabase-long clusters of tandem repeats localized in the Tla region of the major histocompatibility complex of all t haplotype chromosomes examined. In contrast, no such clusters were detected among 12 inbred strains of Mus musculus and other Mus species; thus, clusters of TSEs represent the first absolutely qualitative difference between t haplotypes and wild-type chromosomes. Pulsed field gel electrophoresis shows that the number of clusters, and the number of repeats in each cluster are extremely variable. Dramatic quantitative differences of TSEs uniquely distinguish every independent t haplotype from any other. The complete nucleotide sequence of one 7.8-kb TSE reveals significant homology to the ETn (a major transcript in the early embryo of the mouse), and some homologies to intracisternal A-particles and the mammary tumor virus env gene. Apart from the diagnostic relevance to t haplotypes, evolutionary and functional significances are discussed with respect to chromosome structure and genetic recombination. PMID:2076812
Jenkins, Nathan T; McKenzie, Jennifer A; Damcott, Coleen M; Witkowski, Sarah; Hagberg, James M
2010-03-01
Perilipins are lipid droplet-coating proteins that regulate intracellular lipolysis in adipocytes. A haplotype of two perilipin gene (PLIN) single nucleotide polymorphisms, 13041A>G and 14995A>T, has been previously associated with obesity risk. Furthermore, the available data indicate that this association may be modified by sex. We hypothesized that this haplotype would associate with body fatness, aerobic fitness, and a number of cardiovascular (CV) risk factor phenotypes before and after a 6-mo endurance exercise training program in sedentary older Caucasians. The major haplotype group (13041A/14995A; n = 57) had significantly lower body mass index (BMI) and body fatness compared with noncarriers of the AA haplotype (n = 44) before the training intervention. Training improved body composition in both groups, but fatness remained higher in noncarriers than AA carriers after training. This fat retention in noncarriers blunted their maximal oxygen uptake (Vo(2 max)) adaptation to training. Female noncarriers had substantially higher concentrations of several conventionally and NMR-measured HDL-C subfractions than male noncarriers before and after training, but only minimal differences were found between the sexes in the AA haplotype group. Haplotype group differences in baseline and after-training responses to an oral glucose tolerance test (OGTT) also differed by sex, as noncarrier men had the highest baseline area under the insulin curve (insulin AUC), but were the only group to significantly improve insulin AUC with training. The insulin sensitivity index and plasma glucose responses to the OGTT were more favorable in AA carriers than noncarriers before and after training. Overall, our findings suggest that PLIN variation explains some of the interindividual differences in the response of obesity and CV phenotypes to exercise training. Furthermore, these data contribute to the growing understanding of PLIN as a candidate gene for human obesity and the
Swisher, Kylie D.; Henne, Donald C.; Crosslin, James M.
2014-01-01
Abstract The potato psyllid, Bactericera cockerelli (Sulc) (Hemiptera: Triozidae), is a pest of potato and other solanaceous crops in North and Central America and New Zealand. Previous genotyping studies have demonstrated the presence of three different haplotypes of B. cockerelli in the United States corresponding to three geographical regions: Central, Western, and Northwestern. These studies utilized psyllids collected in the western and central United States between 1998 and 2011. In an effort to further genotype potato psyllids collected in the 2012 growing season, a fourth B. cockerelli haplotype was discovered corresponding to the Southwestern United States geographical region. High-resolution melting analyses identified this new haplotype using an amplicon generated from a portion of the B. cockerelli mitochondrial cytochrome coxidase subunit I gene. Sequencing of this gene, as well as use of a restriction enzyme assay, confirmed the identification of the novel B. cockerelli haplotype in the United States. PMID:25368079
... an ear tag or pit are: An inherited tendency to have this facial feature A genetic syndrome ... Elsevier Churchill Livingstone; 2016:chap 19. Review Date 4/24/2017 Updated by: Liora C Adler, MD, ...
Hudson, Nicholas J; Naval-Sánchez, Marina; Porto-Neto, Laercio; Pérez-Enciso, Miguel; Reverter, Antonio
2018-06-05
Asian and European wild boars were independently domesticated ca. 10,000 years ago. Since the 17th century, Chinese breeds have been imported to Europe to improve the genetics of European animals by introgression of favourable alleles, resulting in a complex mosaic of haplotypes. To interrogate the structure of these haplotypes further, we have run a new haplotype segregation analysis based on information theory, namely compression efficiency (CE). We applied the approach to sequence data from individuals from each phylogeographic region (n = 23 from Asia and Europe) including a number of major pig breeds. Our genome-wide CE is able to discriminate the breeds in a manner reflecting phylogeography. Furthermore, 24,956 non-overlapping sliding windows (each comprising 1,000 consecutive SNP) were quantified for extent of haplotype sharing within and between Asia and Europe. The genome-wide distribution of extent of haplotype sharing was quite different between groups. Unlike European pigs, Asian pigs haplotype sharing approximates a normal distribution. In line with this, we found the European breeds possessed a number of genomic windows of dramatically higher haplotype sharing than the Asian breeds. Our CE analysis of sliding windows capture some of the genomic regions reported to contain signatures of selection in domestic pigs. Prominent among these regions, we highlight the role of a gene encoding the mitochondrial enzyme LACTB which has been associated with obesity, and the gene encoding MYOG a fundamental transcriptional regulator of myogenesis. The origin of these regions likely reflects either a population bottleneck in European animals, or selective targets on commercial phenotypes reducing allelic diversity in particular genes and/or regulatory regions.
Evaluation of Tag Attachments on Small Cetaceans
2013-09-30
silicon-based antifouling coating, “Propspeed,” as a means to further reduce drag and improve tag performance. Examples of the experimental tags are...the TDR tags, prepared by Wildlife Computers (Figure 1). Half of these were treated with Propspeed antifouling coating, and the other half were left
17 Y-STR haplotype diversity in São Paulo state (southeast of Brazil).
de Souza, Leandro Fonseca; da Motta, Carlos Henrique Ares Silveira; Moura-Neto, Rodrigo Soares
2018-03-12
A sample of 158 Brazilian males from São Paulo (SP), Brazilian southeast, was typed for 17 Y-STR loci (DYS19, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458, DYS635, YGATA_H4.1, and DYS385ab). A total of 158 haplotypes were identified, of which all were unique. The haplotype diversity and discrimination capacity were calculated in 1.0 and the genetic diversity was 67.4%. Pairwise haplotype distances showed that the São Paulo population is not significantly different from Rio de Janeiro and Portugal, but is different from African and Native American.
PIT tags increase effectiveness of freshwater mussel recaptures
Kurth, J.; Loftin, C.; Zydlewski, Joseph D.; Rhymer, Judith
2007-01-01
Translocations are used increasingly to conserve populations of rare freshwater mussels. Recovery of translocated mussels is essential to accurate assessment of translocation success. We designed an experiment to evaluate the use of passive integrated transponder (PIT) tags to mark and track individual freshwater mussels. We used eastern lampmussels (Lampsilis radiata radiata) as a surrogate for 2 rare mussel species. We assessed internal and external PIT-tag retention in the laboratory and field. Internal tag retention was high (75-100%), and tag rejection occurred primarily during the first 3 wk after tagging. A thin layer of nacre coated internal tags 3 to 4 mo after insertion, suggesting that long-term retention is likely. We released mussels with external PIT tags at 3 field study sites and recaptured them with a PIT pack (mobile interrogation unit) 8 to 10 mo and 21 to 23 mo after release. Numbers of recaptured mussels differed among study sites; however, we found more tagged mussels with the PIT-pack searches with visual confirmation (72-80%) than with visual searches alone (30-47%) at all sites. PIT tags offer improved recapture of translocated mussels and increased accuracy of posttranslocation monitoring. ?? 2007 by The North American Benthological Society.
DNA origami-based shape IDs for single-molecule nanomechanical genotyping
NASA Astrophysics Data System (ADS)
Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai
2017-04-01
Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.
DNA origami-based shape IDs for single-molecule nanomechanical genotyping
Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai
2017-01-01
Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928
SALIMI, SAEEDEH; KHODAMIAN, MARYAM; NAROOIE-NEJAD, MEHRNAZ; HAJIZADEH, AZAM; FAZELI, KIMIA; NAMAZI, LIDA; YAGHMAEI, MINOO
2015-01-01
Uterine leiomyoma (UL) is an estrogen-dependent neoplasm of the uterus and estrogen metabolizing enzymes affect its promotion and progression. The aim of the present study was to evaluate the association between four single-nucleotide polymorphisms (SNPs) of the cytochrome P450 1B1 (CYP1B1) gene and UL risk. Four SNPs of the CYP1B1 gene in 105 UL patients and 112 unrelated healthy controls were genotyped using a direct sequencing method. Haplotype analyses were performed with UNPHASED software and linkage disequilibrium (LD) was assessed by Haploview software. There were no associations between Leu432Val (rs1056836), Asp449Asp (rs1056837) and Asn453Ser (rs1800440) polymorphisms of the CYP1B1 gene and UL. Although the genotypic frequencies of the Arg368His (rs79204362) polymorphism did not differ between the two groups, the frequency of A (His) allele was significantly higher in UL females (P=0.02). In addition, the frequency of GTAA haplotype was significantly higher in the controls and played a protective role in UL susceptibility. A strong LD between the three common SNPs (rs1056836, rs1056837 and rs1800440) in the CYP1B1 gene was observed in the population. In conclusion, a higher frequency of the CYP1B1 368His (A) allele was observed in UL females. The frequency of the GTAA haplotype was significantly higher in healthy females and this haplotype played a protective role in UL susceptibility. PMID:26075073
Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi
2012-01-01
We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.
Silva, Sarah Pagliarini- e-; Santos, Bruna Cunha; de Figueiredo Pereira, Elizangela Mendes; Ferreira, Mari Ellen; Baraldi, Elaine Cristina; Sell, Ana Maria; Visentainer, Jeane Eliete Laguila
2013-01-01
OBJECTIVE: The JAK2 46/1 haplotype has recently been described as a major contributing factor to the development of myeloproliferative neoplasm, whether positive or negative for the JAK2 V617F mutation. The G allele, identified by a single-nucleotide polymorphism known as JAK2 rs10974944, is part of the JAK2 46/1 haplotype. The aim of this study was to verify the association between the presence of the G allele and the development of BCR-ABL-negative chronic myeloproliferative neoplasms in our population. METHODS: Blood and oral mucosa swab samples were obtained from 56 patients of two local Brazilian hospitals who had previously been diagnosed with BCR-ABL-negative chronic myeloproliferative neoplasms. Blood samples from 90 local blood donors were used as controls. The presence of the G allele was assessed using a PCR-RFLP assay after extracting DNA from the samples. RESULTS: The presence of the G allele was strongly associated with the presence of BCR-ABL-negative chronic myeloproliferative neoplasms (p = 0.0001; OR = 2.674; 95% CI = 1.630−4.385) in the studied population. CONCLUSION: In agreement with previous reports, the JAK2 46/1 haplotype, represented in this study by the presence of the G allele, is an important predisposing factor in the oncogenetic development of these neoplasms in our population. PMID:23420150
Wu, Pingsheng; Larkin, Emma K; Reiss, Sara S; Carroll, Kecia N; Summar, Marshall L; Minton, Patricia A; Woodward, Kimberly B; Liu, Zhouwen; Islam, Jessica Y; Hartert, Tina V; Moore, Paul E
2015-09-14
Despite the significant interest in β2-Adrenergic receptor (ADRB2) polymorphisms related to asthma, whether ADRB2 genetic variants are similarly associated with acute respiratory tract infections have not been studied. We hypothesized that genetic variants in ADRB2 associated with a response to asthma therapy during an asthma exacerbation were also associated with severity of acute respiratory tract infections. To test this hypothesis, we genotyped 5 common polymorphisms in the promoter region and coding block of the ADRB2 gene (loci -2387, -2274, -1343, +46, and +79) from 374 Caucasian and African American term infants who were enrolled at the time of acute respiratory illness over four respiratory viral seasons. Severity of respiratory tract infections was measured using a bronchiolitis severity score (BSS; range = 0-12, clinically significant difference = 0.5) with a higher score indicating more severe disease. We assigned the promoter, coding and combined promoter and coding haplotypes to the unphased genotype data. The associations between each of these five single-nucleotide polymorphisms (SNPs) as well as the haplotypes and infant BSS were analyzed using nonparametric univariate analysis and multivariable proportional odds model separately in Caucasians and African Americans. There was no significant association between infant BSS and each of the SNPs in both Caucasians and African Americans. However, promoter haplotype CCA was associated with a decreased BSS in African Americans in a dose dependent manner. The median (interquartile range) BSS of infants with no copies of the CCA haplotype, one copy, and two copies of the CCA haplotype were 5.5 (2.0, 8.0), 4.0 (1.0, 7.5), and 3.0 (1.0, 4.0), respectively. This dose dependent relationship persisted after adjusting for infant age, gender, daycare exposure, secondhand smoke exposure, prior history of breastfeeding, siblings at home, and enrollment season (adjusted odds ratio: 0.59, 95% confidence
Potter, Kevin M; Hipkins, Valerie D; Mahalovich, Mary F; Means, Robert E
2013-08-01
Ponderosa pine (Pinus ponderosa Douglas ex P. Lawson & C. Lawson) exhibits complicated patterns of morphological and genetic variation across its range in western North America. This study aims to clarify P. ponderosa evolutionary history and phylogeography using a highly polymorphic mitochondrial DNA marker, with results offering insights into how geographical and climatological processes drove the modern evolutionary structure of tree species in the region. We amplified the mtDNA nad1 second intron minisatellite region for 3,100 trees representing 104 populations, and sequenced all length variants. We estimated population-level haplotypic diversity and determined diversity partitioning among varieties, races and populations. After aligning sequences of minisatellite repeat motifs, we evaluated evolutionary relationships among haplotypes. The geographical structuring of the 10 haplotypes corresponded with division between Pacific and Rocky Mountain varieties. Pacific haplotypes clustered with high bootstrap support, and appear to have descended from Rocky Mountain haplotypes. A greater proportion of diversity was partitioned between Rocky Mountain races than between Pacific races. Areas of highest haplotypic diversity were the southern Sierra Nevada mountain range in California, northwestern California, and southern Nevada. Pinus ponderosa haplotype distribution patterns suggest a complex phylogeographic history not revealed by other genetic and morphological data, or by the sparse paleoecological record. The results appear consistent with long-term divergence between the Pacific and Rocky Mountain varieties, along with more recent divergences not well-associated with race. Pleistocene refugia may have existed in areas of high haplotypic diversity, as well as the Great Basin, Southwestern United States/northern Mexico, and the High Plains.
ABO, Rhesus, and Kell Antigens, Alleles, and Haplotypes in West Bengal, India
Basu, Debapriya; Datta, Suvro Sankha; Montemayor, Celina; Bhattacharya, Prasun; Mukherjee, Krishnendu; Flegel, Willy A.
2018-01-01
Background Few studies have documented the blood group antigens in the population of eastern India. Frequencies of some common alleles and haplotypes were unknown. We describe phenotype, allele, and haplotype frequencies in the state of West Bengal, India. Methods We tested 1,528 blood donors at the Medical College Hospital, Kolkata. The common antigens of the ABO, Rhesus, and Kell blood group systems were determined by standard serologic methods in tubes. Allele and haplotype frequencies were calculated with an iterative method that yielded maximum-likelihood estimates under the assumption of a Hardy-Weinberg equilibrium. Results The prevalence of ABO antigens were B (34%), O (32%), A (25%), and AB (9%) with ABO allele frequencies for O = 0.567, A = 0.189, and B = 0.244. The D antigen (RH1) was observed in 96.6% of the blood donors with RH haplotype frequencies, such as for CDe = 0.688809, cde = 0.16983 and CdE = 0.000654. The K antigen (K1) was observed in 12 donors (0.79%) with KEL allele frequencies for K = 0.004 and k = 0.996. Conclusions: For the Bengali population living in the south of West Bengal, we established the frequencies of the major clinically relevant antigens in the ABO, Rhesus, and Kell blood group systems and derived estimates for the underlying ABO and KEL alleles and RH haplotypes. Such blood donor screening will improve the availability of compatible red cell units for transfusion. Our approach using widely available routine methods can readily be applied in other regions, where the sufficient supply of blood typed for the Rh and K antigens is lacking. PMID:29593462