RTEL1 tagging SNPs and haplotypes were associated with glioma development.
Li, Gang; Jin, Tianbo; Liang, Hongjuan; Zhang, Zhiguo; He, Shiming; Tu, Yanyang; Yang, Haixia; Geng, Tingting; Cui, Guangbin; Chen, Chao; Gao, Guodong
2013-05-17
As glioma ranks as the first most prevalent solid tumors in primary central nervous system, certain single-nucleotide polymorphisms (SNPs) may be related to increased glioma risk, and have implications in carcinogenesis. The present case-control study was carried out to elucidate how common variants contribute to glioma susceptibility. Ten candidate tagging SNPs (tSNPs) were selected from seven genes whose polymorphisms have been proven by classical literatures and reliable databases to be tended to relate with gliomas, and with the minor allele frequency (MAF)>5% in the HapMap Asian population. The selected tSNPs were genotyped in 629 glioma patients and 645 controls from a Han Chinese population using the multiplexed SNP MassEXTEND assay calibrated. Two significant tSNPs in RTEL1 gene were observed to be associated with glioma risk (rs6010620, P=0.0016, OR: 1.32, 95% CI: 1.11-1.56; rs2297440, P=0.001, OR: 1.33, 95% CI: 1.12-1.58) by χ2 test. It was identified the genotype "GG" of rs6010620 acted as the protective genotype for glioma (OR, 0.46; 95% CI, 0.31-0.7; P=0.0002), while the genotype "CC" of rs2297440 as the protective genotype in glioma (OR, 0.47; 95% CI, 0.31-0.71; P=0.0003). Furthermore, haplotype "GCT" in RTEL1 gene was found to be associated with risk of glioma (OR, 0.7; 95% CI, 0.57-0.86; Fisher's P=0.0005; Pearson's P=0.0005), and haplotype "ATT" was detected to be associated with risk of glioma (OR, 1.32; 95% CI, 1.12-1.57; Fisher's P=0.0013; Pearson's P=0.0013). Two single variants, the genotypes of "GG" of rs6010620 and "CC" of rs2297440 (rs6010620 and rs2297440) in the RTEL1 gene, together with two haplotypes of GCT and ATT, were identified to be associated with glioma development. And it might be used to evaluate the glioma development risks to screen the above RTEL1 tagging SNPs and haplotypes. The virtual slides for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1993021136961998.
RTEL1 tagging SNPs and haplotypes were associated with glioma development
2013-01-01
Abstract As glioma ranks as the first most prevalent solid tumors in primary central nervous system, certain single-nucleotide polymorphisms (SNPs) may be related to increased glioma risk, and have implications in carcinogenesis. The present case–control study was carried out to elucidate how common variants contribute to glioma susceptibility. Ten candidate tagging SNPs (tSNPs) were selected from seven genes whose polymorphisms have been proven by classical literatures and reliable databases to be tended to relate with gliomas, and with the minor allele frequency (MAF) > 5% in the HapMap Asian population. The selected tSNPs were genotyped in 629 glioma patients and 645 controls from a Han Chinese population using the multiplexed SNP MassEXTEND assay calibrated. Two significant tSNPs in RTEL1 gene were observed to be associated with glioma risk (rs6010620, P = 0.0016, OR: 1.32, 95% CI: 1.11-1.56; rs2297440, P = 0.001, OR: 1.33, 95% CI: 1.12-1.58) by χ2 test. It was identified the genotype “GG” of rs6010620 acted as the protective genotype for glioma (OR, 0.46; 95% CI, 0.31-0.7; P = 0.0002), while the genotype “CC” of rs2297440 as the protective genotype in glioma (OR, 0.47; 95% CI, 0.31-0.71; P = 0.0003). Furthermore, haplotype “GCT” in RTEL1 gene was found to be associated with risk of glioma (OR, 0.7; 95% CI, 0.57-0.86; Fisher’s P = 0.0005; Pearson’s P = 0.0005), and haplotype “ATT” was detected to be associated with risk of glioma (OR, 1.32; 95% CI, 1.12-1.57; Fisher’s P = 0.0013; Pearson’s P = 0.0013). Two single variants, the genotypes of “GG” of rs6010620 and “CC” of rs2297440 (rs6010620 and rs2297440) in the RTEL1 gene, together with two haplotypes of GCT and ATT, were identified to be associated with glioma development. And it might be used to evaluate the glioma development risks to screen the above RTEL1 tagging SNPs and haplotypes. Virtual slides The virtual slides for this article
Novel and efficient tag SNPs selection algorithms.
Chen, Wen-Pei; Hung, Che-Lun; Tsai, Suh-Jen Jane; Lin, Yaw-Ling
2014-01-01
SNPs are the most abundant forms of genetic variations amongst species; the association studies between complex diseases and SNPs or haplotypes have received great attention. However, these studies are restricted by the cost of genotyping all SNPs; thus, it is necessary to find smaller subsets, or tag SNPs, representing the rest of the SNPs. In fact, the existing tag SNP selection algorithms are notoriously time-consuming. An efficient algorithm for tag SNP selection was presented, which was applied to analyze the HapMap YRI data. The experimental results show that the proposed algorithm can achieve better performance than the existing tag SNP selection algorithms; in most cases, this proposed algorithm is at least ten times faster than the existing methods. In many cases, when the redundant ratio of the block is high, the proposed algorithm can even be thousands times faster than the previously known methods. Tools and web services for haplotype block analysis integrated by hadoop MapReduce framework are also developed using the proposed algorithm as computation kernels.
Koskinen, Lotta; Romanos, Jihane; Kaukinen, Katri; Mustalahti, Kirsi; Korponay-Szabo, Ilma; Barisani, Donatella; Bardella, Maria Teresa; Ziberna, Fabiana; Vatta, Serena; Széles, György; Pocsai, Zsuzsa; Karell, Kati; Haimila, Katri; Adány, Róza; Not, Tarcisio; Ventura, Alessandro; Mäki, Markku; Partanen, Jukka; Wijmenga, Cisca; Saavalainen, Päivi
2009-04-01
Human leukocyte antigen (HLA) genes, located on chromosome 6p21.3, have a crucial role in susceptibility to various autoimmune and inflammatory diseases, such as celiac disease and type 1 diabetes. Certain HLA heterodimers, namely DQ2 (encoded by the DQA1*05 and DQB1*02 alleles) and DQ8 (DQA1*03 and DQB1*0302), are necessary for the development of celiac disease. Traditional genotyping of HLA genes is laborious, time-consuming, and expensive. A novel HLA-genotyping method, using six HLA-tagging single-nucleotide polymorphisms (SNPs) and suitable for high-throughput approaches, was described recently. Our aim was to validate this method in the Finnish, Hungarian, and Italian populations. The six previously reported HLA-tagging SNPs were genotyped in patients with celiac disease and in healthy individuals from Finland, Hungary, and two distinct regions of Italy. The potential of this method was evaluated in analyzing how well the tag SNP results correlate with the HLA genotypes previously determined using traditional HLA-typing methods. Using the tagging SNP method, it is possible to determine the celiac disease risk haplotypes accurately in Finnish, Hungarian, and Italian populations, with specificity and sensitivity ranging from 95% to 100%. In addition, it predicts homozygosity and heterozygosity for a risk haplotype, allowing studies on genotypic risk effects. The method is transferable between populations and therefore suited for large-scale research studies and screening of celiac disease among high-risk individuals or at the population level.
Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus
2013-01-01
Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different
Linear reduction method for predictive and informative tag SNP selection.
He, Jingwu; Westbrooks, Kelly; Zelikovsky, Alexander
2005-01-01
Constructing a complete human haplotype map is helpful when associating complex diseases with their related SNPs. Unfortunately, the number of SNPs is very large and it is costly to sequence many individuals. Therefore, it is desirable to reduce the number of SNPs that should be sequenced to a small number of informative representatives called tag SNPs. In this paper, we propose a new linear algebra-based method for selecting and using tag SNPs. We measure the quality of our tag SNP selection algorithm by comparing actual SNPs with SNPs predicted from selected linearly independent tag SNPs. Our experiments show that for sufficiently long haplotypes, knowing only 0.4% of all SNPs the proposed linear reduction method predicts an unknown haplotype with the error rate below 2% based on 10% of the population.
Gu, Ming-liang; Chu, Jia-you
2007-12-01
Human genome has structures of haplotype and haplotype block which provide valuable information on human evolutionary history and may lead to the development of more efficient strategies to identify genetic variants that increase susceptibility to complex diseases. Haplotype block can be divided into discrete blocks of limited haplotype diversity. In each block, a small fraction of ptag SNPsq can be used to distinguish a large fraction of the haplotypes. These tag SNPs can be potentially useful for construction of haplotype and haplotype block, and association studies in complex diseases. There are two general classes of methods to construct haplotype and haplotype blocks based on genotypes on large pedigrees and statistical algorithms respectively. The author evaluate several construction methods to assess the power of different association tests with a variety of disease models and block-partitioning criteria. The advantages, limitations and applications of each method and the application in the association studies are discussed equitably. With the completion of the HapMap and development of statistical algorithms for addressing haplotype reconstruction, ideas of construction of haplotype based on combination of mathematics, physics, and computer science etc will have profound impacts on population genetics, location and cloning for susceptible genes in complex diseases, and related domain with life science etc.
A TNF region haplotype offers protection from typhoid fever in Vietnamese patients
2009-01-01
The genomic region surrounding the TNF locus on human chromosome 6 has previously been associated with typhoid fever in Vietnam. We used a haplotypic approach to understand this association further. Eighty single nucleotide polymorphisms (SNPs) spanning a 150 kb region were genotyped in 95 Vietnamese individuals (typhoid case/mother/father trios). A subset of data from 33 SNPs with a minor allele frequency of >4.3% was used to construct haplotypes. Fifteen SNPs, which tagged the 42 constructed haplotypes were selected. The haplotype tagging SNPs (T1-T15) were genotyped in 380 confirmed typhoid cases and 380 Vietnamese ethnically matched controls. Allelic frequencies of seven SNPs (T1, T2, T3, T5, T6, T7, T8) were significantly different between typhoid cases and controls. Logistic regression results support the hypothesis that there is just one signal associated with disease at this locus. Haplotype-based analysis of the tag SNPs provided positive evidence of association with typhoid (posterior probability 0.821). The analysis highlighted a low-risk cluster of haplotypes that each carry the minor allele of T1 or T7, but not both, and otherwise carry the combination of alleles *12122*1111 at T1-T11, further supporting the one associated signal hypothesis. Finally, individuals that carry the typhoid fever protective haplotype *12122*1111 also produce a relatively low TNF-α response to LPS. PMID:17503085
FamLBL: detecting rare haplotype disease association based on common SNPs using case-parent triads.
Wang, Meng; Lin, Shili
2014-09-15
In recent years, there has been an increasing interest in using common single-nucleotide polymorphisms (SNPs) amassed in genome-wide association studies to investigate rare haplotype effects on complex diseases. Evidence has suggested that rare haplotypes may tag rare causal single-nucleotide variants, making SNP-based rare haplotype analysis not only cost effective, but also more valuable for detecting causal variants. Although a number of methods for detecting rare haplotype association have been proposed in recent years, they are population based and thus susceptible to population stratification. We propose family-triad-based logistic Bayesian Lasso (famLBL) for estimating effects of haplotypes on complex diseases using SNP data. By choosing appropriate prior distribution, effect sizes of unassociated haplotypes can be shrunk toward zero, allowing for more precise estimation of associated haplotypes, especially those that are rare, thereby achieving greater detection power. We evaluate famLBL using simulation to gauge its type I error and power. Compared with its population counterpart, LBL, highlights famLBL's robustness property in the presence of population substructure. Further investigation by comparing famLBL with Family-Based Association Test (FBAT) reveals its advantage for detecting rare haplotype association. famLBL is implemented as an R-package available at http://www.stat.osu.edu/∼statgen/SOFTWARE/LBL/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
CLUSTAG: hierarchical clustering and graph methods for selecting tag SNPs.
Ao, S I; Yip, Kevin; Ng, Michael; Cheung, David; Fong, Pui-Yee; Melhado, Ian; Sham, Pak C
2005-04-15
Cluster and set-cover algorithms are developed to obtain a set of tag single nucleotide polymorphisms (SNPs) that can represent all the known SNPs in a chromosomal region, subject to the constraint that all SNPs must have a squared correlation R2>C with at least one tag SNP, where C is specified by the user. http://hkumath.hku.hk/web/link/CLUSTAG/CLUSTAG.html mng@maths.hku.hk.
Impacts of TNF-LTA SNPs/Haplotypes and Lifestyle Factors on Oral Carcinoma in an Indian Population.
Bandil, Kapil; Singhal, Pallavi; Sharma, Upma; Hussain, Showket; Basu, Surojit; Parashari, Aditya; Singh, Veena; Sehgal, Ashok; Shivam, Animesh; Ahuja, Puneet; Bharadwaj, Mausumi; Banerjee, Basu Dev; Mehrotra, Ravi
2016-10-01
To investigate a potential association between single-nucleotide polymorphisms (SNPs) and haplotypes at the TNFA-LTA locus and the development of oral cancer in an Indian population. In this study, 150 oral precancer/cancer samples (50 precancer and 100 cancer), along with an equal number of control samples, were genotyped. Six SNPs at the TNF-LTA locus (i.e., -238G/A, -308G/A, -857C/T, -863C/A, -1031T/C, and +252A/G) were analyzed by use of a polymerase chain reaction-restriction fragment length polymorphism method, the assay was validated by sequencing 10 % of samples. The allelic frequencies of TNFA and LTA SNPs were found to be significantly associated with the risk of oral cancer and precancerous lesions in comparison with controls (P < 0.0003). Further haplotypic analysis showed that two haplotypes (ATCTGG and ACACGG) served as risk haplotypes for oral cancer. These haplotypes were also found to be significantly and positively associated with lifestyle habits (tobacco chewing P = 0.04, odds ratio [OR] 3.4) and socioeconomic status (P = 0.01, OR 3.4). We noticed an increased percentage of risk haplotypes correlating with the aggressiveness of oral cancer. The percentages of risk haplotypes were found to be threefold higher in precancer and fourfold higher in advanced stages of oral cancer in comparison with controls. Five SNPs at the TNF-LTA locus (i.e., -308G>A, -857C>T, -863C>A, -1031T>C, and +252A>G) were found to be associated with the development of oral cancer. Two haplotypes (ATCTGG and ACACGG) emerged as major risk haplotypes for oral carcinoma progression and were also found to be associated with lifestyle factors and clinical aggressiveness. These findings make the TNF-LTA locus a suitable candidate for a future biomarker, which may be used either for early detection or for helping to improve treatment efficacy and effectiveness.
Khatkar, Mehar S.; Zenger, Kyall R.; Hobbs, Matthew; Hawken, Rachel J.; Cavanagh, Julie A. L.; Barris, Wes; McClintock, Alexander E.; McClintock, Sara; Thomson, Peter C.; Tier, Bruce; Nicholas, Frank W.; Raadsma, Herman W.
2007-01-01
Analysis of data on 1000 Holstein–Friesian bulls genotyped for 15,036 single-nucleotide polymorphisms (SNPs) has enabled genomewide identification of haplotype blocks and tag SNPs. A final subset of 9195 SNPs in Hardy–Weinberg equilibrium and mapped on autosomes on the bovine sequence assembly (release Btau 3.1) was used in this study. The average intermarker spacing was 251.8 kb. The average minor allele frequency (MAF) was 0.29 (0.05–0.5). Following recent precedents in human HapMap studies, a haplotype block was defined where 95% of combinations of SNPs within a region are in very high linkage disequilibrium. A total of 727 haplotype blocks consisting of ≥3 SNPs were identified. The average block length was 69.7 ± 7.7 kb, which is ∼5–10 times larger than in humans. These blocks comprised a total of 2964 SNPs and covered 50,638 kb of the sequence map, which constitutes 2.18% of the length of all autosomes. A set of tag SNPs, which will be useful for further fine-mapping studies, has been identified. Overall, the results suggest that as many as 75,000–100,000 tag SNPs would be needed to track all important haplotype blocks in the bovine genome. This would require ∼250,000 SNPs in the discovery phase. PMID:17435229
Haplotag: Software for Haplotype-Based Genotyping-by-Sequencing Analysis
Tinker, Nicholas A.; Bekele, Wubishet A.; Hattori, Jiro
2016-01-01
Genotyping-by-sequencing (GBS), and related methods, are based on high-throughput short-read sequencing of genomic complexity reductions followed by discovery of single nucleotide polymorphisms (SNPs) within sequence tags. This provides a powerful and economical approach to whole-genome genotyping, facilitating applications in genomics, diversity analysis, and molecular breeding. However, due to the complexity of analyzing large data sets, applications of GBS may require substantial time, expertise, and computational resources. Haplotag, the novel GBS software described here, is freely available, and operates with minimal user-investment on widely available computer platforms. Haplotag is unique in fulfilling the following set of criteria: (1) operates without a reference genome; (2) can be used in a polyploid species; (3) provides a discovery mode, and a production mode; (4) discovers polymorphisms based on a model of tag-level haplotypes within sequenced tags; (5) reports SNPs as well as haplotype-based genotypes; and (6) provides an intuitive visual “passport” for each inferred locus. Haplotag is optimized for use in a self-pollinating plant species. PMID:26818073
Evaluating information content of SNPs for sample-tagging in re-sequencing projects.
Hu, Hao; Liu, Xiang; Jin, Wenfei; Hilger Ropers, H; Wienker, Thomas F
2015-05-15
Sample-tagging is designed for identification of accidental sample mix-up, which is a major issue in re-sequencing studies. In this work, we develop a model to measure the information content of SNPs, so that we can optimize a panel of SNPs that approach the maximal information for discrimination. The analysis shows that as low as 60 optimized SNPs can differentiate the individuals in a population as large as the present world, and only 30 optimized SNPs are in practice sufficient in labeling up to 100 thousand individuals. In the simulated populations of 100 thousand individuals, the average Hamming distances, generated by the optimized set of 30 SNPs are larger than 18, and the duality frequency, is lower than 1 in 10 thousand. This strategy of sample discrimination is proved robust in large sample size and different datasets. The optimized sets of SNPs are designed for Whole Exome Sequencing, and a program is provided for SNP selection, allowing for customized SNP numbers and interested genes. The sample-tagging plan based on this framework will improve re-sequencing projects in terms of reliability and cost-effectiveness.
Ken-Dror, Gie; Goldbourt, Uri; Dankner, Rachel
2010-05-01
Several polymorphisms in the ApoA5 gene emerged as important candidate genes in triglyceride metabolism. The aim of this study was to determine the associations between ApoA5 polymorphisms, plasma triglyceride concentrations and the presence of cardiovascular disease (CVD) in three ethnic origins. Genotypes for 15 single nucleotide polymorphisms (SNPs) were determined in 659 older adults (mean age 71+/-7 years) who immigrated to Israel or whose ancestors originated from East Europe (Ashkenazi), North Africa, Asia (Sephardic) or Yemen (Yemenite). The minor alleles of the four common SNPs (rs662799, rs651821, rs2072560 and rs2266788) are associated with an increase of 27-38% in triglyceride concentration among Ashkenazi and Yemenite Jews compared with the major alleles, but not among those of Sephardic origin. Conversely, among the Sephardic group, the presence of the minor allele in SNP rs3135506 compared with the major allele was associated with an increase of 34% in triglyceride concentration. The four SNPs were in significant linkage disequilibrium (D'=0.96-0.99), resulting in three haplotypes H1, H2 and H3, representing 98-99% of the population. Haplotype H2 was significantly associated with triglyceride concentration among Ashkenazi and Yemenite but not among Sephardic Jews. Conversely, haplotype H3 was associated with triglyceride concentration in Sephardic but not in Ashkenazi and Yemenite Jews. Ashkenazi carriers of H2 haplotype had a CVD odds ratio of 2.19 (95% CI: 1.05-4.58) compared with H1 (the most frequent), after adjustment for all other risk factors. These results suggest that different SNPs in ApoA5 polymorphisms may be associated with triglyceride concentration and CVD in each of these ethnic origins.
A tool for selecting SNPs for association studies based on observed linkage disequilibrium patterns.
De La Vega, Francisco M; Isaac, Hadar I; Scafe, Charles R
2006-01-01
The design of genetic association studies using single-nucleotide polymorphisms (SNPs) requires the selection of subsets of the variants providing high statistical power at a reasonable cost. SNPs must be selected to maximize the probability that a causative mutation is in linkage disequilibrium (LD) with at least one marker genotyped in the study. The HapMap project performed a genome-wide survey of genetic variation with about a million SNPs typed in four populations, providing a rich resource to inform the design of association studies. A number of strategies have been proposed for the selection of SNPs based on observed LD, including construction of metric LD maps and the selection of haplotype tagging SNPs. Power calculations are important at the study design stage to ensure successful results. Integrating these methods and annotations can be challenging: the algorithms required to implement these methods are complex to deploy, and all the necessary data and annotations are deposited in disparate databases. Here, we present the SNPbrowser Software, a freely available tool to assist in the LD-based selection of markers for association studies. This stand-alone application provides fast query capabilities and swift visualization of SNPs, gene annotations, power, haplotype blocks, and LD map coordinates. Wizards implement several common SNP selection workflows including the selection of optimal subsets of SNPs (e.g. tagging SNPs). Selected SNPs are screened for their conversion potential to either TaqMan SNP Genotyping Assays or the SNPlex Genotyping System, two commercially available genotyping platforms, expediting the set-up of genetic studies with an increased probability of success.
Salas, Antonio; Amigo, Jorge
2010-05-03
The high levels of variation characterising the mitochondrial DNA (mtDNA) molecule are due ultimately to its high average mutation rate; moreover, mtDNA variation is deeply structured in different populations and ethnic groups. There is growing interest in selecting a reduced number of mtDNA single nucleotide polymorphisms (mtSNPs) that account for the maximum level of discrimination power in a given population. Applications of the selected mtSNP panel range from anthropologic and medical studies to forensic genetic casework. This study proposes a new simulation-based method that explores the ability of different mtSNP panels to yield the maximum levels of discrimination power. The method explores subsets of mtSNPs of different sizes randomly chosen from a preselected panel of mtSNPs based on frequency. More than 2,000 complete genomes representing three main continental human population groups (Africa, Europe, and Asia) and two admixed populations ("African-Americans" and "Hispanics") were collected from GenBank and the literature, and were used as training sets. Haplotype diversity was measured for each combination of mtSNP and compared with existing mtSNP panels available in the literature. The data indicates that only a reduced number of mtSNPs ranging from six to 22 are needed to account for 95% of the maximum haplotype diversity of a given population sample. However, only a small proportion of the best mtSNPs are shared between populations, indicating that there is not a perfect set of "universal" mtSNPs suitable for all population contexts. The discrimination power provided by these mtSNPs is much higher than the power of the mtSNP panels proposed in the literature to date. Some mtSNP combinations also yield high diversity values in admixed populations. The proposed computational approach for exploring combinations of mtSNPs that optimise the discrimination power of a given set of mtSNPs is more efficient than previous empirical approaches. In contrast to
Salas, Antonio; Amigo, Jorge
2010-01-01
Background The high levels of variation characterising the mitochondrial DNA (mtDNA) molecule are due ultimately to its high average mutation rate; moreover, mtDNA variation is deeply structured in different populations and ethnic groups. There is growing interest in selecting a reduced number of mtDNA single nucleotide polymorphisms (mtSNPs) that account for the maximum level of discrimination power in a given population. Applications of the selected mtSNP panel range from anthropologic and medical studies to forensic genetic casework. Methodology/Principal Findings This study proposes a new simulation-based method that explores the ability of different mtSNP panels to yield the maximum levels of discrimination power. The method explores subsets of mtSNPs of different sizes randomly chosen from a preselected panel of mtSNPs based on frequency. More than 2,000 complete genomes representing three main continental human population groups (Africa, Europe, and Asia) and two admixed populations (“African-Americans” and “Hispanics”) were collected from GenBank and the literature, and were used as training sets. Haplotype diversity was measured for each combination of mtSNP and compared with existing mtSNP panels available in the literature. The data indicates that only a reduced number of mtSNPs ranging from six to 22 are needed to account for 95% of the maximum haplotype diversity of a given population sample. However, only a small proportion of the best mtSNPs are shared between populations, indicating that there is not a perfect set of “universal” mtSNPs suitable for all population contexts. The discrimination power provided by these mtSNPs is much higher than the power of the mtSNP panels proposed in the literature to date. Some mtSNP combinations also yield high diversity values in admixed populations. Conclusions/Significance The proposed computational approach for exploring combinations of mtSNPs that optimise the discrimination power of a given set of
APC Yin-Yang haplotype associated with colorectal cancer risk
GARRE, P.; DE LA HOYA, M.; INIESTA, P.; ROMERA, A.; LLOVET, P.; GONZALEZ, S.; PEREZ-SEGURA, P.; CAPELLA, G.; DIAZ-RUBIO, E.; CALDES, T.
2010-01-01
The Yin-Yang haplotype is defined as two mismatched haplotypes (Yin and Yang) representing the majority of the existing haplotypes in a particular genomic region. The human adenomatous polyposis coli (APC) gene shows a Yin-Yang haplotype pattern accounting for 84% of all of the haplotypes existing in the Spanish population. Several association studies have been published regarding APC gene variants (SNPs and haplotypes) and colorectal cancer (CRC) risk. However, no studies concerning diplotype structure and CRC risk have been conducted. The aim of the present study was to investigate whether the APC Yin-Yang homozygote diplotype is over-represented in patients with sporadic CRC when compared to its distribution in controls, and its association with CRC risk. TaqMan® assays were used to genotype three tagSNPs selected across the APC Yin-Yang region. Frequencies of the APC Yin-Yang tagSNP alleles, haplotype and diplotype of 378 CRC cases and 642 controls were compared. Two Spanish CRC group samples were included [Hospital Clínico San Carlos in Madrid (HCSC) and Instituto Catalán de Oncología in Barcelona (ICO)]. Analysis of 157 consecutive CRC patients and 405 control subjects from HCSC showed a significative effect for the risk of CRC (OR=1.93; 95% CI 1.32–2.81; P=0.001). However, this effect was not confirmed in 221 CRC patients and 237 control subjects from ICO (OR=0.89; 95% CI 0.61–1.28; P=0.521). We found a significant association between the APC homozygote Yin-Yang diplotype and the risk of colorectal cancer in the HCSC samples. However, we did not observe this association in the ICO samples. These observations suggest that a study with a larger Spanish cohort is necessary to confirm the effects of the APC Yin-Yang diplotype on the risk of CRC. PMID:22993613
APC Yin-Yang haplotype associated with colorectal cancer risk.
Garre, P; DE LA Hoya, M; Iniesta, P; Romera, A; Llovet, P; Gonzalez, S; Perez-Segura, P; Capella, G; Diaz-Rubio, E; Caldes, T
2010-09-01
The Yin-Yang haplotype is defined as two mismatched haplotypes (Yin and Yang) representing the majority of the existing haplotypes in a particular genomic region. The human adenomatous polyposis coli (APC) gene shows a Yin-Yang haplotype pattern accounting for 84% of all of the haplotypes existing in the Spanish population. Several association studies have been published regarding APC gene variants (SNPs and haplotypes) and colorectal cancer (CRC) risk. However, no studies concerning diplotype structure and CRC risk have been conducted. The aim of the present study was to investigate whether the APC Yin-Yang homozygote diplotype is over-represented in patients with sporadic CRC when compared to its distribution in controls, and its association with CRC risk. TaqMan(®) assays were used to genotype three tagSNPs selected across the APC Yin-Yang region. Frequencies of the APC Yin-Yang tagSNP alleles, haplotype and diplotype of 378 CRC cases and 642 controls were compared. Two Spanish CRC group samples were included [Hospital Clínico San Carlos in Madrid (HCSC) and Instituto Catalán de Oncología in Barcelona (ICO)]. Analysis of 157 consecutive CRC patients and 405 control subjects from HCSC showed a significative effect for the risk of CRC (OR=1.93; 95% CI 1.32-2.81; P=0.001). However, this effect was not confirmed in 221 CRC patients and 237 control subjects from ICO (OR=0.89; 95% CI 0.61-1.28; P=0.521). We found a significant association between the APC homozygote Yin-Yang diplotype and the risk of colorectal cancer in the HCSC samples. However, we did not observe this association in the ICO samples. These observations suggest that a study with a larger Spanish cohort is necessary to confirm the effects of the APC Yin-Yang diplotype on the risk of CRC.
Analysis of association of clinical aspects and IL1B tagSNPs with severe preeclampsia.
Leme Galvão, Larissa Paes; Menezes, Filipe Emanuel; Mendonca, Caio; Barreto, Ikaro; Alvim-Pereira, Claudia; Alvim-Pereira, Fabiano; Gurgel, Ricardo
2016-01-01
This study investigates the association between IL1B genotypes using a tag SNP (single polymorphism) approach, maternal and environmental factors in Brazilian women with severe preeclampsia. A case-control study with a total of 456 patients (169 preeclamptic women and 287 controls) was conducted in the two reference maternity hospitals of Sergipe state, Northeast Brazil. A questionnaire was administered and DNA was extracted to genotype the population for four tag SNPs of the IL1Beta: rs 1143643, rs 1143633, rs 1143634 and rs 1143630. Haplotype association analysis and p-values were calculated using the THESIAS test. Odds ratio (OR) estimation, confidence interval (CI) and multivariate logistic regression were performed. High pregestational body mass index (pre-BMI), first gestation, cesarean section, more than six medical visits, low level of consciousness on admission and TC and TT genotype in rs1143630 of IL1Beta showed association with the preeclamptic group in univariate analysis. After multivariate logistic regression pre-BMI, first gestation and low level of consciousness on admission remained associated. We identified an association between clinical variables and preeclampsia. Univariate analysis suggested that inflammatory process-related genes, such as IL1B, may be involved and should be targeted in further studies. The identification of the genetic background involved in preeclampsia host response modulation is mandatory in order to understand the preeclampsia process.
McCaskie, Pamela A; Carter, Kim W; McCaskie, Simon R; Palmer, Lyle J
2005-01-01
We used our newly developed linkage disequilibrium (LD) plotting software, JLIN, to plot linkage disequilibrium between pairs of single-nucleotide polymorphisms (SNPs) for three chromosomes of the Genetic Analysis Workshop 14 Aipotu simulated population to assess the effect of missing data on LD calculations. Our haplotype analysis program, SIMHAP, was used to assess the effect of missing data on haplotype-phenotype association. Genotype data was removed at random, at levels of 1%, 5%, and 10%, and the LD calculations and haplotype association results for these levels of missingness were compared to those for the complete dataset. It was concluded that ignoring individuals with missing data substantially affects the number of regions of LD detected which, in turn, could affect tagging SNPs chosen to generate haplotypes. PMID:16451612
Genetic analysis of autoimmune regulator haplotypes in alopecia areata.
Wengraf, D A; McDonagh, A J G; Lovewell, T R J; Vasilopoulos, Y; Macdonald-Hull, S P; Cork, M J; Messenger, A G; Tazi-Ahnini, R
2008-03-01
Alopecia areata is an immune-mediated disorder, occurring with the highest observed frequency in the rare recessive autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) syndrome caused by mutations of the autoimmune regulator (AIRE) gene on chromosome 21q22.3. We have previously detected association between alopecia areata and a single nucleotide polymorphism (SNP) in the AIRE gene in patients without APECED, and we now report the findings of an extended examination of the association of alopecia areata with haplotype analysis including six SNPs in the AIRE gene: C-103T, C4144G, T5238C, G6528A, T7215C and T11787C. In Caucasian groups of 295 patients and 363 controls, we found strong association between the AIRE 7215C allele and AA [P = 3.8 x 10(-8), OR (95% CI): 2.69 (1.8-4.0)]. The previously reported association between AA and the AIRE 4144G allele was no longer significant on correction for multiple testing. The AIRE haplotypes CCTGCT and CGTGCC showed a highly significant association with AA [P = 6.05 x 10(-6), 9.47 (2.91-30.8) and P = 0.001, 3.51 (1.55-7.95), respectively]. To select the haplotypes most informative for analysis, we tagged the polymorphisms using SNPTag software. Employing AIRE C-103T, G6528A, T7215C and T11787C as tag SNPs, two haplotypes were associated with AA; AIRE CGCT and AIRE CGCC [P = 3.84 x 10(-7), 11.40 (3.53-36.9) and P = 3.94 x 10(-4), 2.13 (1.39-3.24) respectively]. The AIRE risk haplotypes identified in this study potentially account for a major component of the genetic risk of developing alopecia areata.
A powerful approach reveals numerous expression quantitative trait haplotypes in multiple tissues.
Ying, Dingge; Li, Mulin Jun; Sham, Pak Chung; Li, Miaoxin
2018-04-26
Recently many studies showed single nucleotide polymorphisms (SNPs) affect gene expression and contribute to development of complex traits/diseases in a tissue context-dependent manner. However, little is known about haplotype's influence on gene expression and complex traits, which reflects the interaction effect between SNPs. In the present study, we firstly proposed a regulatory region guided eQTL haplotype association analysis approach, and then systematically investigate the expression quantitative trait loci (eQTL) haplotypes in 20 different tissues by the approach. The approach has a powerful design of reducing computational burden by the utilization of regulatory predictions for candidate SNP selection and multiple testing corrections on non-independent haplotypes. The application results in multiple tissues showed that haplotype-based eQTLs not only increased the number of eQTL genes in a tissue specific manner, but were also enriched in loci that associated with complex traits in a tissue-matched manner. In addition, we found that tag SNPs of eQTL haplotypes from whole blood were selectively enriched in certain combination of regulatory elements (e.g. promoters and enhancers) according to predicted chromatin states. In summary, this eQTL haplotype detection approach, together with the application results, shed insights into synergistic effect of sequence variants on gene expression and their susceptibility to complex diseases. The executable application "eHaplo" is implemented in Java and is publicly available at http://grass.cgs.hku.hk/limx/ehaplo/. jonsonfox@gmail.com, limiaoxin@mail.sysu.edu.cn. Supplementary data are available at Bioinformatics online.
Kullback-Leibler divergence for detection of rare haplotype common disease association.
Lin, Shili
2015-11-01
Rare haplotypes may tag rare causal variants of common diseases; hence, detection of such rare haplotypes may also contribute to our understanding of complex disease etiology. Because rare haplotypes frequently result from common single-nucleotide polymorphisms (SNPs), focusing on rare haplotypes is much more economical compared with using rare single-nucleotide variants (SNVs) from sequencing, as SNPs are available and 'free' from already amassed genome-wide studies. Further, associated haplotypes may shed light on the underlying disease causal mechanism, a feat unmatched by SNV-based collapsing methods. In recent years, data mining approaches have been adapted to detect rare haplotype association. However, as they rely on an assumed underlying disease model and require the specification of a null haplotype, results can be erroneous if such assumptions are violated. In this paper, we present a haplotype association method based on Kullback-Leibler divergence (hapKL) for case-control samples. The idea is to compare haplotype frequencies for the cases versus the controls by computing symmetrical divergence measures. An important property of such measures is that both the frequencies and logarithms of the frequencies contribute in parallel, thus balancing the contributions from rare and common, and accommodating both deleterious and protective, haplotypes. A simulation study under various scenarios shows that hapKL has well-controlled type I error rates and good power compared with existing data mining methods. Application of hapKL to age-related macular degeneration (AMD) shows a strong association of the complement factor H (CFH) gene with AMD, identifying several individual rare haplotypes with strong signals.
Slattery, Martha L.; Lundgreen, Abbie; Herrick, Jennifer S.; Caan, Bette J.; Potter, John D.; Wolff, Roger K.
2012-01-01
There is considerable biologic plausibility to the hypothesis that genetic variability in pathways involved in insulin signaling and energy homeostasis may modulate dietary risk associated with colorectal cancer. We utilized data from 2 population-based case-control studies of colon (n = 1,574 cases, 1,970 controls) and rectal (n = 791 cases, 999 controls) cancer to evaluate genetic variation in candidate SNPs identified from 9 genes in a candidate pathway: PDK1, RP6KA1, RPS6KA2, RPS6KB1, RPS6KB2, PTEN, FRAP1 (mTOR), TSC1, TSC2, Akt1, PIK3CA, and PRKAG2 with dietary intake of total energy, carbohydrates, fat, and fiber. We employed SNP, haplotype, and multiple-gene analysis to evaluate associations. PDK1 interacted with dietary fat for both colon and rectal cancer and with dietary carbohydrates for colon cancer. Statistically significant interaction with dietary carbohydrates and rectal cancer was detected by haplotype analysis of PDK1. Evaluation of dietary interactions with multiple genes in this candidate pathway showed several interactions with pairs of genes: Akt1 and PDK1, PDK1 and PTEN, PDK1 and TSC1, and PRKAG2 and PTEN. Analyses show that genetic variation influences risk of colorectal cancer associated with diet and illustrate the importance of evaluating dietary interactions beyond the level of single SNPs or haplotypes when a biologically relevant candidate pathway is examined. PMID:21999454
Haplotype diversity in 11 candidate genes across four populations.
Beaty, T H; Fallin, M D; Hetmanski, J B; McIntosh, I; Chong, S S; Ingersoll, R; Sheng, X; Chakraborty, R; Scott, A F
2005-09-01
Analysis of haplotypes based on multiple single-nucleotide polymorphisms (SNP) is becoming common for both candidate gene and fine-mapping studies. Before embarking on studies of haplotypes from genetically distinct populations, however, it is important to consider variation both in linkage disequilibrium (LD) and in haplotype frequencies within and across populations, as both vary. Such diversity will influence the choice of "tagging" SNPs for candidate gene or whole-genome association studies because some markers will not be polymorphic in all samples and some haplotypes will be poorly represented or completely absent. Here we analyze 11 genes, originally chosen as candidate genes for oral clefts, where multiple markers were genotyped on individuals from four populations. Estimated haplotype frequencies, measures of pairwise LD, and genetic diversity were computed for 135 European-Americans, 57 Chinese-Singaporeans, 45 Malay-Singaporeans, and 46 Indian-Singaporeans. Patterns of pairwise LD were compared across these four populations and haplotype frequencies were used to assess genetic variation. Although these populations are fairly similar in allele frequencies and overall patterns of LD, both haplotype frequencies and genetic diversity varied significantly across populations. Such haplotype diversity has implications for designing studies of association involving samples from genetically distinct populations.
Association of ESR1 gene tagging SNPs with breast cancer risk
Dunning, Alison M.; Healey, Catherine S.; Baynes, Caroline; Maia, Ana-Teresa; Scollen, Serena; Vega, Ana; Rodríguez, Raquel; Barbosa-Morais, Nuno L.; Ponder, Bruce A.J.; Low, Yen-Ling; Bingham, Sheila; Haiman, Christopher A.; Le Marchand, Loic; Broeks, Annegien; Schmidt, Marjanka K.; Hopper, John; Southey, Melissa; Beckmann, Matthias W.; Fasching, Peter A.; Peto, Julian; Johnson, Nichola; Bojesen, Stig E.; Nordestgaard, Børge; Milne, Roger L.; Benitez, Javier; Hamann, Ute; Ko, Yon; Schmutzler, Rita K.; Burwinkel, Barbara; Schürmann, Peter; Dörk, Thilo; Heikkinen, Tuomas; Nevanlinna, Heli; Lindblom, Annika; Margolin, Sara; Mannermaa, Arto; Kosma, Veli-Matti; Chen, Xiaoqing; Spurdle, Amanda; Change-Claude, Jenny; Flesch-Janys, Dieter; Couch, Fergus J.; Olson, Janet E.; Severi, Gianluca; Baglietto, Laura; Børresen-Dale, Anne-Lise; Kristensen, Vessela; Hunter, David J.; Hankinson, Susan E.; Devilee, Peter; Vreeswijk, Maaike; Lissowska, Jolanta; Brinton, Louise; Liu, Jianjun; Hall, Per; Kang, Daehee; Yoo, Keun-Young; Shen, Chen-Yang; Yu, Jyh-Cherng; Anton-Culver, Hoda; Ziogoas, Argyrios; Sigurdson, Alice; Struewing, Jeff; Easton, Douglas F.; Garcia-Closas, Montserrat; Humphreys, Manjeet K.; Morrison, Jonathan; Pharoah, Paul D.P.; Pooley, Karen A.; Chenevix-Trench, Georgia
2009-01-01
We have conducted a three-stage, comprehensive single nucleotide polymorphism (SNP)-tagging association study of ESR1 gene variants (SNPs) in more than 55 000 breast cancer cases and controls from studies within the Breast Cancer Association Consortium (BCAC). No large risks or highly significant associations were revealed. SNP rs3020314, tagging a region of ESR1 intron 4, is associated with an increase in breast cancer susceptibility with a dominant mode of action in European populations. Carriers of the c-allele have an odds ratio (OR) of 1.05 [95% Confidence Intervals (CI) 1.02–1.09] relative to t-allele homozygotes, P = 0.004. There is significant heterogeneity between studies, P = 0.002. The increased risk appears largely confined to oestrogen receptor-positive tumour risk. The region tagged by SNP rs3020314 contains sequence that is more highly conserved across mammalian species than the rest of intron 4, and it may subtly alter the ratio of two mRNA splice forms. PMID:19126777
Yamaguchi-Kabata, Yumi; Tsunoda, Tatsuhiko; Kumasaka, Natsuhiko; Takahashi, Atsushi; Hosono, Naoya; Kubo, Michiaki; Nakamura, Yusuke; Kamatani, Naoyuki
2012-05-01
Although the Japanese population has a rather low genetic diversity, we recently confirmed the presence of two main clusters (the Hondo and Ryukyu clusters) through principal component analysis of genome-wide single-nucleotide polymorphism (SNP) genotypes. Understanding the genetic differences between the two main clusters requires further genome-wide analyses based on a dense SNP set and comparison of haplotype frequencies. In the present study, we determined haplotypes for the Hondo cluster of the Japanese population by detecting SNP homozygotes with 388,591 autosomal SNPs from 18,379 individuals and estimated the haplotype frequencies. Haplotypes for the Ryukyu cluster were inferred by a statistical approach using the genotype data from 504 individuals. We then compared the haplotype frequencies between the Hondo and Ryukyu clusters. In most genomic regions, the haplotype frequencies in the Hondo and Ryukyu clusters were very similar. However, in addition to the human leukocyte antigen region on chromosome 6, other genomic regions (chromosomes 3, 4, 5, 7, 10 and 12) showed dissimilarities in haplotype frequency. These regions were enriched for genes involved in the immune system, cell-cell adhesion and the intracellular signaling cascade. These differentiated genomic regions between the Hondo and Ryukyu clusters are of interest because they (1) should be examined carefully in association studies and (2) likely contain genes responsible for morphological or physiological differences between the two groups.
Portability of tag SNPs across isolated population groups: an example from India.
Sarkar Roy, N; Farheen, S; Roy, N; Sengupta, S; Majumder, P P
2008-01-01
Isolated population groups are useful in conducting association studies of complex diseases to avoid various pitfalls, including those arising from population stratification. Since DNA resequencing is expensive, it is recommended that genotyping be carried out at tagSNP (tSNP) loci. For this, tSNPs identified in one isolated population need to be used in another. Unless tSNPs are highly portable across populations this strategy may result in loss of information in association studies. We examined the issue of tSNP portability by sampling individuals from 10 isolated ethnic groups from India. We generated DNA resequencing data pertaining to 3 genomic regions and identified tSNPs in each population. We defined an index of tSNP portability and showed that portability is low across isolated Indian ethnic groups. The extent of portability did not significantly correlate with genetic similarity among the populations studied here. We also analyzed our data with sequence data from individuals of African and European descent. Our results indicated that it may be necessary to carry out resequencing in a small number of individuals to discover SNPs and identify tSNPs in the specific isolated population in which a disease association study is to be conducted.
SNPs and Haplotypes in Native American Populations
Kidd, Judith R.; Friedlaender, Françoise; Pakstis, Andrew J.; Furtado, Manohar; Fang, Rixun; Wang, Xudong; Nievergelt, Caroline M.; Kidd, Kenneth K.
2013-01-01
Autosomal DNA polymorphisms can provide new information and understanding of both the origins of and relationships among modern Native American populations. At the same time that autosomal markers can be highly informative, they are also susceptible to ascertainment biases in the selection of the markers to use. Identifying markers that can be used for ancestry inference among Native American populations can be considered separate from identifying markers to further the quest for history. In the current study we are using data on nine Native American populations to compare the results based on a large haplotype-based dataset with relatively small independent sets of SNPs. We are interested in what types of limited datasets an individual laboratory might be able to collect are best for addressing two different questions of interest. First, how well can we differentiate the Native American populations and/or infer ancestry by assigning an individual to her population(s) of origin? Second, how well can we infer the historical/evolutionary relationships among Native American populations and their Eurasian origins. We conclude that only a large comprehensive dataset involving multiple autosomal markers on multiple populations will be able to answer both questions; different small sets of markers are able to answer only one or the other of these questions. Using our largest dataset we see a general increasing distance from Old World populations from North to South in the New World except for an unexplained close relationship between our Maya and Quechua samples. PMID:21913176
The analysis of APOL1 genetic variation and haplotype diversity provided by 1000 Genomes project.
Peng, Ting; Wang, Li; Li, Guisen
2017-08-11
The APOL1 gene variants has been shown to be associated with an increased risk of multiple kinds of diseases, particularly in African Americans, but not in Caucasians and Asians. In this study, we explored the single nucleotide polymorphism (SNP) and haplotype diversity of APOL1 gene in different races provided by 1000 Genomes project. Variants of APOL1 gene in 1000 Genome Project were obtained and SNPs located in the regulatory region or coding region were selected for genetic variation analysis. Total 2504 individuals from 26 populations were classified as four groups that included Africa, Europe, Asia and Admixed populations. Tag SNPs were selected to evaluate the haplotype diversities in the four populations by HaploStats software. APOL1 gene was surrounded by some of the most polymorphic genes in the human genome, variation of APOL1 gene was common, with up to 613 SNP (1000 Genome Project reported) and 99 of them (16.2%) with MAF ≥ 1%. There were 79 SNPs in the URR and 92 SNPs in 3'UTR. Total 12 SNPs in URR and 24 SNPs in 3'UTR were considered as common variants with MAF ≥ 1%. It is worth noting that URR-1 was presents lower frequencies in European populations, while other three haplotypes taken an opposite pattern; 3'UTR presents several high-frequency variation sites in a short segment, and the differences of its haplotypes among different population were significant (P < 0.01), UTR-1 and UTR-5 presented much higher frequency in African population, while UTR-2, UTR-3 and UTR-4 were much lower. APOL1 coding region showed that two SNP of G1 with higher frequency are actually pull down the haplotype H-1 frequency when considering all populations pooled together, and the diversity among the four populations be widen by the G1 two mutation (P 1 = 3.33E-4 vs P 2 = 3.61E-30). The distributions of APOL1 gene variants and haplotypes were significantly different among the different populations, in either regulatory or coding regions. It could provide
Haralambieva, Iana H.; Dhiman, Neelam; Ovsyannikova, Inna G.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.
2010-01-01
Interferon (IFN)-induced antiviral genes are crucial players in innate antiviral defense and potential determinants of immune response heterogeneity. We selected 114 candidate SNPs from 12 antiviral genes using an LD tagSNP selection approach and genotyped them in a cohort of 738 schoolchildren immunized with two doses of rubella vaccine. Associations between SNPs/haplotypes and rubella virus-specific immune measures were assessed using linear regression methodologies. We identified 23 significant associations (p<0.05) between polymorphisms within the 2′-5′-oligoadenylate synthetase (OAS) gene cluster, and rubella virus-specific IL-2, IL-10, IL-6 secretion and antibody levels. The minor allele variants of three OAS1 SNPs (rs3741981/Ser162Gly, rs1051042/Thr361Arg, rs2660), located in a linkage disequilibrium block of functional importance, were significantly associated with an increase in rubella virus-specific IL-2/Th1 response (p≤0.024). Seven OAS1 and OAS3 promoter/regulatory SNPs were similarly associated with IL-2 secretion. Importantly, two SNPs (rs3741981 and rs10774670), independently cross-regulated rubella virus-specific IL-10 secretion levels (p≤0.031). Furthermore, both global tests and individual haplotype analyses revealed significant associations between OAS1 haplotypes and rubella virus-specific cytokine secretion. Our results suggest that innate immunity and OAS genetic variations are likely involved in modulating the magnitude and quality of the adaptive immune responses to live attenuated rubella vaccine. PMID:20079393
Association of galanin haplotypes with alcoholism and anxiety in two ethnically distinct populations
Belfer, I; Hipp, H; McKnight, C; Evans, C; Buzas, B; Bollettino, A; Albaugh, B; Virkkunen, M; Yuan, Q; Max, MB; Goldman, D; Enoch, MA
2009-01-01
The neuropeptide galanin (GAL) is widely expressed in the central nervous system. Animal studies have implicated GAL in alcohol abuse and anxiety: chronic ethanol intake increases hypothalamic GAL mRNA; high levels of stress increase GAL release in the central amygdala. The coding sequence of the galanin gene, GAL, is highly conserved and a functional polymorphism has not yet been found. The aim of our study was, for the first time, to identify GAL haplotypes and investigate associations with alcoholism and anxiety. Seven single-nucleotide polymorphisms (SNPs) spanning GAL were genotyped in 65 controls from five populations: US and Finnish Caucasians, African Americans, Plains and Southwestern Indians. A single haplotype block with little evidence of historical recombination was observed for each population. Four tag SNPs were then genotyped in DSM-III-R lifetime alcoholics and nonalcoholics from two population isolates: 514 Finnish Caucasian men and 331 Plains Indian men and women. Tridimensional Personality Questionnaire harm avoidance (HA) scores, a dimensional measure of anxiety, were obtained. There was a haplotype association with alcoholism in both the Finnish (P=0.001) and Plains Indian (P=0.004) men. The SNPs were also significantly associated. Alcoholics were divided into high and low HA groups (≥ and < mean HA of population). In the Finns, haplotype (P < 0.0001) and diplotype (P < 0.0001) distributions differed between high HA alcoholics, low HA alcoholics and nonalcoholics. Our results from two independent populations suggest that GAL may contribute to vulnerability to alcoholism, perhaps mediated by dimensional anxiety. PMID:16314872
LD2SNPing: linkage disequilibrium plotter and RFLP enzyme mining for tag SNPs
Chang, Hsueh-Wei; Chuang, Li-Yeh; Chang, Yan-Jhu; Cheng, Yu-Huei; Hung, Yu-Chen; Chen, Hsiang-Chi; Yang, Cheng-Hong
2009-01-01
Background Linkage disequilibrium (LD) mapping is commonly used to evaluate markers for genome-wide association studies. Most types of LD software focus strictly on LD analysis and visualization, but lack supporting services for genotyping. Results We developed a freeware called LD2SNPing, which provides a complete package of mining tools for genotyping and LD analysis environments. The software provides SNP ID- and gene-centric online retrievals for SNP information and tag SNP selection from dbSNP/NCBI and HapMap, respectively. Restriction fragment length polymorphism (RFLP) enzyme information for SNP genotype is available to all SNP IDs and tag SNPs. Single and multiple SNP inputs are possible in order to perform LD analysis by online retrieval from HapMap and NCBI. An LD statistics section provides D, D', r2, δQ, ρ, and the P values of the Hardy-Weinberg Equilibrium for each SNP marker, and Chi-square and likelihood-ratio tests for the pair-wise association of two SNPs in LD calculation. Finally, 2D and 3D plots, as well as plain-text output of the results, can be selected. Conclusion LD2SNPing thus provides a novel visualization environment for multiple SNP input, which facilitates SNP association studies. The software, user manual, and tutorial are freely available at . PMID:19500380
Y-SNPs haplotype diversity in four Chinese cattle breeds.
Zhang, Runfeng; Cheng, Ming; Li, Xiaofeng; Chen, Fuying; Zheng, Jing; Wang, Xiaofei; Meng, Quanke
2013-01-01
To investigate the genetic diversity of Chinese cattle, 96 male samples of 4 Chinese native cattle breeds were investigated using 5 single nucleotide polymorphisms specific to the bovine Y chromosome. Two previously described haplotypes (taurine Y2 and indicine Y3) were detected in 74 and 22 animals, respectively. The haplotype frequencies varied amongst the four native breeds. The taurine Y2 haplotype dominated in the Qinchuan, Dabieshan, and Yunba breeds. However, the indicine Y3 haplotype occurred in high frequency in the Enshi breed. Among the four native breeds, Yunba had the highest haplotype diversity (0.4330 ± 0.0750), followed by Qinchuan (0.2899 ± 0.1028) and Enshi (0.2222 ± 0.1662), Dabieshan was the least differentiated (0.1079 ± 0.0680). Compared with some foreign cattle breeds, the low level of haplotype diversity was detected in our breeds (0.2633 ± 0.1030).
Aali, Mohsen; Moradi-Shahrbabak, Mohammad; Moradi-Shahrbabak, Hosein; Sadeghi, Mostafa
2014-03-01
Calpastatin has been introduced as a potential candidate gene for growth and meat quality traits. In this study, genetic variability was investigated in the exon 6 and its intron boundaries of ovine CAST gene by PCR-SSCP analysis and DNA sequencing. Also a protein sequence and structural analysis were performed to predict the possible impact of amino acid substitutions on physicochemical properties and structure of the CAST protein. A total of 487 animals belonging to four ancient Iranian sheep breeds with different fat metabolisms, Lori-Bakhtiari and Chall (fat-tailed), Zel-Atabay cross-bred (medium fat-tailed) and Zel (thin-tailed), were analyzed. Eight unique SSCP patterns, representing eight different sequences or haplotypes, CAST-1, CAST-2 and CAST-6 to CAST-11, were identified. Haplotypes CAST-1 and CAST-2 were most common with frequency of 0.365 and 0.295. The novel haplotype CAST-8 had considerable frequency in Iranian sheep breeds (0.129). All the consensus sequences showed 98-99%, 94-98%, 92-93% and 82-83% similarity to the published ovine, caprine, bovine and porcine CAST locus sequences, respectively. Sequence analysis revealed four SNPs in intron 5 (C24T, G62A, G65T and T69-) and three SNPs in exon 6 (c.197A>T, c.282G>T and c.296C>G). All three SNPs in exon 6 were missense mutations which would result in p.Gln 66 Leu, p.Glu 94 Asp and p.Pro 99 Arg substitutions, respectively, in CAST protein. All three amino acid substitutions affected the physicochemical properties of ovine CAST protein including hydrophobicity, amphiphilicity and net charge and subsequently might influence its structure and effect on the activity of Ca2+ channels; hence, they might regulate calpain activity and afterwards meat tenderness and growth rate. The Lori-Bakhtiari population showed the highest heterozygosity in the ovine CAST locus (0.802). Frequency difference of haplotypes CAST-10 and CAST-8 between Lori-Bakhtiari (fat-tailed) and Zel (thin-tailed) breeds was highly
Haplotype-Based Genotyping in Polyploids.
Clevenger, Josh P; Korani, Walid; Ozias-Akins, Peggy; Jackson, Scott
2018-01-01
Accurate identification of polymorphisms from sequence data is crucial to unlocking the potential of high throughput sequencing for genomics. Single nucleotide polymorphisms (SNPs) are difficult to accurately identify in polyploid crops due to the duplicative nature of polyploid genomes leading to low confidence in the true alignment of short reads. Implementing a haplotype-based method in contrasting subgenome-specific sequences leads to higher accuracy of SNP identification in polyploids. To test this method, a large-scale 48K SNP array (Axiom Arachis2) was developed for Arachis hypogaea (peanut), an allotetraploid, in which 1,674 haplotype-based SNPs were included. Results of the array show that 74% of the haplotype-based SNP markers could be validated, which is considerably higher than previous methods used for peanut. The haplotype method has been implemented in a standalone program, HAPLOSWEEP, which takes as input bam files and a vcf file and identifies haplotype-based markers. Haplotype discovery can be made within single reads or span paired reads, and can leverage long read technology by targeting any length of haplotype. Haplotype-based genotyping is applicable in all allopolyploid genomes and provides confidence in marker identification and in silico-based genotyping for polyploid genomics.
Prion gene haplotypes of U.S. cattle
Clawson, Michael L; Heaton, Michael P; Keele, John W; Smith, Timothy PL; Harhay, Gregory P; Laegreid, William W
2006-01-01
Background Bovine spongiform encephalopathy (BSE) is a fatal neurological disorder characterized by abnormal deposits of a protease-resistant isoform of the prion protein. Characterizing linkage disequilibrium (LD) and haplotype networks within the bovine prion gene (PRNP) is important for 1) testing rare or common PRNP variation for an association with BSE and 2) interpreting any association of PRNP alleles with BSE susceptibility. The objective of this study was to identify polymorphisms and haplotypes within PRNP from the promoter region through the 3'UTR in a diverse sample of U.S. cattle genomes. Results A 25.2-kb genomic region containing PRNP was sequenced from 192 diverse U.S. beef and dairy cattle. Sequence analyses identified 388 total polymorphisms, of which 287 have not previously been reported. The polymorphism alleles define PRNP by regions of high and low LD. High LD is present between alleles in the promoter region through exon 2 (6.7 kb). PRNP alleles within the majority of intron 2, the entire coding sequence and the untranslated region of exon 3 are in low LD (18.0 kb). Two haplotype networks, one representing the region of high LD and the other the region of low LD yielded nineteen different combinations that represent haplotypes spanning PRNP. The haplotype combinations are tagged by 19 polymorphisms (htSNPS) which characterize variation within and across PRNP. Conclusion The number of polymorphisms in the prion gene region of U.S. cattle is nearly four times greater than previously described. These polymorphisms define PRNP haplotypes that may influence BSE susceptibility in cattle. PMID:17092337
Paziewska, Agnieszka; Cukrowska, Bozena; Dabrowska, Michalina; Goryca, Krzysztof; Piatkowska, Magdalena; Kluska, Anna; Mikula, Michal; Karczmarski, Jakub; Oralewska, Beata; Rybak, Anna; Socha, Jerzy; Balabas, Aneta; Zeber-Lubecka, Natalia; Ambrozkiewicz, Filip; Konopka, Ewa; Trojanowska, Ilona; Zagroba, Malgorzata; Szperl, Malgorzata; Ostrowski, Jerzy
2015-01-01
Assessment of non-HLA variants alongside standard HLA testing was previously shown to improve the identification of potential coeliac disease (CD) patients. We intended to identify new genetic variants associated with CD in the Polish population that would improve CD risk prediction when used alongside HLA haplotype analysis. DNA samples of 336 CD and 264 unrelated healthy controls were used to create DNA pools for a genome wide association study (GWAS). GWAS findings were validated with individual HLA tag single nucleotide polymorphism (SNP) typing of 473 patients and 714 healthy controls. Association analysis using four HLA-tagging SNPs showed that, as was found in other populations, positive predicting genotypes (HLA-DQ2.5/DQ2.5, HLA-DQ2.5/DQ2.2, and HLA-DQ2.5/DQ8) were found at higher frequencies in CD patients than in healthy control individuals in the Polish population. Both CD-associated SNPs discovered by GWAS were found in the CD susceptibility region, confirming the previously-determined association of the major histocompatibility (MHC) region with CD pathogenesis. The two most significant SNPs from the GWAS were rs9272346 (HLA-dependent; localized within 1 Kb of DQA1) and rs3130484 (HLA-independent; mapped to MSH5). Specificity of CD prediction using the four HLA-tagging SNPs achieved 92.9%, but sensitivity was only 45.5%. However, when a testing combination of the HLA-tagging SNPs and the MSH5 SNP was used, specificity decreased to 80%, and sensitivity increased to 74%. This study confirmed that improvement of CD risk prediction sensitivity could be achieved by including non-HLA SNPs alongside HLA SNPs in genetic testing.
Haplotypes in the APOA1-C3-A4-A5 gene cluster affect plasma lipids in both humans and baboons
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Qian-fei; Liu, Xin; O'Connell, Jeff
2003-09-15
Genetic studies in non-human primates serve as a potential strategy for identifying genomic intervals where polymorphisms impact upon human disease-related phenotypes. It remains unclear, however, whether independently arising polymorphisms in orthologous regions of non-human primates leads to similar variation in a quantitative trait found in both species. To explore this paradigm, we studied a baboon apolipoprotein gene cluster (APOA1/C3/A4/A5) for which the human gene orthologs have well established roles in influencing plasma HDL-cholesterol and triglyceride concentrations. Our extensive polymorphism analysis of this 68 kb gene cluster in 96 pedigreed baboons identified several haplotype blocks each with limited diversity, consistent withmore » haplotype findings in humans. To determine whether baboons, like humans, also have particular haplotypes associated with lipid phenotypes, we genotyped 634 well characterized baboons using 16 haplotype tagging SNPs. Genetic analysis of single SNPs, as well as haplotypes, revealed an association of APOA5 and APOC3 variants with HDL cholesterol and triglyceride concentrations, respectively. Thus, independent variation in orthologous genomic intervals does associate with similar quantitative lipid traits in both species, supporting the possibility of uncovering human QTL genes in a highly controlled non-human primate model.« less
Population Structure With Localized Haplotype Clusters
Browning, Sharon R.; Weir, Bruce S.
2010-01-01
We propose a multilocus version of FST and a measure of haplotype diversity using localized haplotype clusters. Specifically, we use haplotype clusters identified with BEAGLE, which is a program implementing a hidden Markov model for localized haplotype clustering and performing several functions including inference of haplotype phase. We apply this methodology to HapMap phase 3 data. With this haplotype-cluster approach, African populations have highest diversity and lowest divergence from the ancestral population, East Asian populations have lowest diversity and highest divergence, and other populations (European, Indian, and Mexican) have intermediate levels of diversity and divergence. These relationships accord with expectation based on other studies and accepted models of human history. In contrast, the population-specific FST estimates obtained directly from single-nucleotide polymorphisms (SNPs) do not reflect such expected relationships. We show that ascertainment bias of SNPs has less impact on the proposed haplotype-cluster-based FST than on the SNP-based version, which provides a potential explanation for these results. Thus, these new measures of FST and haplotype-cluster diversity provide an important new tool for population genetic analysis of high-density SNP data. PMID:20457877
Kalantari, Naser; Keshavarz Mohammadi, Nastaran; Izadi, Pantea; Doaei, Saeid; Gholamalizadeh, Maryam; Eini-Zinab, Hassan; Salonurmi, Tuire; Rafieifar, Shahram; Janipoor, Reza; Azizi Tabesh, Ghasem
2018-01-01
Single-nucleotide polymorphisms (SNPs), which are located in the first intron of the FTO gene, are reported to be associated with body weight and the body mass index (BMI). However, their effects on anthropometric measurements in adolescents are poorly understood. This study aimed to investigate the association of three adjacent polymorphisms (rs9930506, rs9930501, & rs9932754) in the FTO gene with anthropometric indices in Iranian adolescent males. The participants comprised a total of 237 adolescent males who were recruited randomly from two high schools in Tehran, Iran. The DNA samples were genotyped for the FTO gene polymorphisms by DNA sequencing. BMI, body fat percentage (BF%), and body muscle percentage (BM%) were determined using a validated bioelectrical impedance analysis scale. The association of the FTO polymorphisms with weight, height, BMI, BF%, and BM% was investigated. A haplotype of rs9930506, rs9930501, and rs9932754 (GGT) in the first intron of the FTO with complete linkage disequilibrium (LD) was found to be significantly associated with higher weight (OR = 1.32), BMI (OR = 5.36) and BF% (OR = 1.46), and lower BM% (OR = 3.59) (all P<0.001). None of the students with GGC genotypes were underweight, while all of the students with AAT genotypes had high muscle mass. A haplotype in the first intron of the FTO gene had a strong association with obesity indices in Iranian adolescent males. The FTO gene polymorphisms might have greater effects on anthropometric indices than what was previously imagined. Moreover, we suggested that the FTO gene exerted their effects on anthropometric measurements through haplotypes (and not single SNPs).
Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.
Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R
2001-11-23
Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.
Reddy, Umesh K.; Nimmakayala, Padma; Abburi, Venkata Lakshmi; Reddy, C. V. C. M.; Saminathan, Thangasamy; Percy, Richard G.; Yu, John Z.; Frelichowski, James; Udall, Joshua A.; Page, Justin T.; Zhang, Dong; Shehzad, Tariq; Paterson, Andrew H.
2017-01-01
Use of 10,129 singleton SNPs of known genomic location in tetraploid cotton provided unique opportunities to characterize genome-wide diversity among 440 Gossypium hirsutum and 219 G. barbadense cultivars and landrace accessions of widespread origin. Using the SNPs distributed genome-wide, we examined genetic diversity, haplotype distribution and linkage disequilibrium patterns in the G. hirsutum and G. barbadense genomes to clarify population demographic history. Diversity and identity-by-state analyses have revealed little sharing of alleles between the two cultivated allotetraploid genomes, with a few exceptions that indicated sporadic gene flow. We found a high number of new alleles, representing increased nucleotide diversity, on chromosomes 1 and 2 in cultivated G. hirsutum as compared with low nucleotide diversity on these chromosomes in landrace G. hirsutum. In contrast, G. barbadense chromosomes showed negative Tajima’s D on several chromosomes for both cultivated and landrace types, which indicate that speciation of G. barbadense itself, might have occurred with relatively narrow genetic diversity. The presence of conserved linkage disequilibrium (LD) blocks and haplotypes between G. hirsutum and G. barbadense provides strong evidence for comparable patterns of evolution in their domestication processes. Our study illustrates the potential use of population genetic techniques to identify genomic regions for domestication. PMID:28128280
Tag SNP selection via a genetic algorithm.
Mahdevar, Ghasem; Zahiri, Javad; Sadeghi, Mehdi; Nowzari-Dalini, Abbas; Ahrabian, Hayedeh
2010-10-01
Single Nucleotide Polymorphisms (SNPs) provide valuable information on human evolutionary history and may lead us to identify genetic variants responsible for human complex diseases. Unfortunately, molecular haplotyping methods are costly, laborious, and time consuming; therefore, algorithms for constructing full haplotype patterns from small available data through computational methods, Tag SNP selection problem, are convenient and attractive. This problem is proved to be an NP-hard problem, so heuristic methods may be useful. In this paper we present a heuristic method based on genetic algorithm to find reasonable solution within acceptable time. The algorithm was tested on a variety of simulated and experimental data. In comparison with the exact algorithm, based on brute force approach, results show that our method can obtain optimal solutions in almost all cases and runs much faster than exact algorithm when the number of SNP sites is large. Our software is available upon request to the corresponding author.
A phased SNP-based classification of sickle cell anemia HBB haplotypes.
Shaikho, Elmutaz M; Farrell, John J; Alsultan, Abdulrahman; Qutub, Hatem; Al-Ali, Amein K; Figueiredo, Maria Stella; Chui, David H K; Farrer, Lindsay A; Murphy, George J; Mostoslavsky, Gustavo; Sebastiani, Paola; Steinberg, Martin H
2017-08-11
Sickle cell anemia causes severe complications and premature death. Five common β-globin gene cluster haplotypes are each associated with characteristic fetal hemoglobin (HbF) levels. As HbF is the major modulator of disease severity, classifying patients according to haplotype is useful. The first method of haplotype classification used restriction fragment length polymorphisms (RFLPs) to detect single nucleotide polymorphisms (SNPs) in the β-globin gene cluster. This is labor intensive, and error prone. We used genome-wide SNP data imputed to the 1000 Genomes reference panel to obtain phased data distinguishing parental alleles. We successfully haplotyped 813 sickle cell anemia patients previously classified by RFLPs with a concordance >98%. Four SNPs (rs3834466, rs28440105, rs10128556, and rs968857) marking four different restriction enzyme sites unequivocally defined most haplotypes. We were able to assign a haplotype to 86% of samples that were either partially or misclassified using RFLPs. Phased data using only four SNPs allowed unequivocal assignment of a haplotype that was not always possible using a larger number of RFLPs. Given the availability of genome-wide SNP data, our method is rapid and does not require high computational resources.
TNF-alpha SNP haplotype frequencies in equidae.
Brown, J J; Ollier, W E R; Thomson, W; Matthews, J B; Carter, S D; Binns, M; Pinchbeck, G; Clegg, P D
2006-05-01
Tumour necrosis factor alpha (TNF-alpha) is a pro-inflammatory cytokine that plays a crucial role in the regulation of inflammatory and immune responses. In all vertebrate species the genes encoding TNF-alpha are located within the major histocompatability complex. In the horse TNF-alpha has been ascribed a role in a variety of important disease processes. Previously two single nucleotide polymorphisms (SNPs) have been reported within the 5' un-translated region of the equine TNF-alpha gene. We have examined the equine TNF-alpha promoter region further for additional SNPs by analysing DNA from 131 horses (Equus caballus), 19 donkeys (E. asinus), 2 Grant's zebras (E. burchellii boehmi) and one onager (E. hemionus). Two further SNPs were identified at nucleotide positions 24 (T/G) and 452 (T/C) relative to the first nucleotide of the 522 bp polymerase chain reaction product. A sequence variant at position 51 was observed between equidae. SNaPSHOT genotyping assays for these and the two previously reported SNPs were performed on 457 horses comprising seven different breeds and 23 donkeys to determine the gene frequencies. SNP frequencies varied considerably between different horse breeds and also between the equine species. In total, nine different TNF-alpha promoter SNP haplotypes and their frequencies were established amongst the various equidae examined, with some haplotypes being found only in horses and others only in donkeys or zebras. The haplotype frequencies observed varied greatly between different horse breeds. Such haplotypes may relate to levels of TNF-alpha production and disease susceptibility and further investigation is required to identify associations between particular haplotypes and altered risk of disease.
Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z
2014-03-01
The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P < 0.05), six significantly downregulated MGMT promoter activity (29-97% decrease; P < 0.05) and one haplotype had no effect. Mechanistic studies conducted support the conclusion that MGMT P/E haplotypes, rather than individual SNPs, differentially regulate MGMT transcription and could thus play a significant role in human sensitivity to environmental and therapeutic alkylating agents.
Jannink, Jean-Luc
2010-01-01
Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933
Haplotype-based approach to known MS-associated regions increases the amount of explained risk
Khankhanian, Pouya; Gourraud, Pierre-Antoine; Lizee, Antoine; Goodin, Douglas S
2015-01-01
Genome-wide association studies (GWAS), using single nucleotide polymorphisms (SNPs), have yielded 110 non-human leucocyte antigen genomic regions that are associated with multiple sclerosis (MS). Despite this large number of associations, however, only 28% of MS-heritability can currently be explained. Here we compare the use of multi-SNP-haplotypes to the use of single-SNPs as alternative methods to describe MS genetic risk. SNP-haplotypes (of various lengths from 1 up to 15 contiguous SNPs) were constructed at each of the 110 previously identified, MS-associated, genomic regions. Even after correcting for the larger number of statistical comparisons made when using the haplotype-method, in 32 of the regions, the SNP-haplotype based model was markedly more significant than the single-SNP based model. By contrast, in no region was the single-SNP based model similarly more significant than the SNP-haplotype based model. Moreover, when we included the 932 MS-associated SNP-haplotypes (that we identified from 102 regions) as independent variables into a logistic linear model, the amount of MS-heritability, as assessed by Nagelkerke's R-squared, was 38%, which was considerably better than 29%, which was obtained by using only single-SNPs. This study demonstrates that SNP-haplotypes can be used to fine-map the genetic associations within regions of interest previously identified by single-SNP GWAS. Moreover, the amount of the MS genetic risk explained by the SNP-haplotype associations in the 110 MS-associated genomic regions was considerably greater when using SNP-haplotypes than when using single-SNPs. Also, the use of SNP-haplotypes can lead to the discovery of new regions of interest, which have not been identified by a single-SNP GWAS. PMID:26185143
Neslund-Dudas, Christine; Levin, Albert M.; Rundle, Andrew; Beebe-Dimmer, Jennifer; Bock, Cathryn H.; Nock, Nora L.; Jankowski, Michelle; Datta, Indrani; Krajenta, Richard; Dou, Q. Ping; Mitra, Bharati; Tang, Deliang; Rybicki, Benjamin A.
2014-01-01
BACKGROUND Black men have historically had higher blood lead levels than white men in the U.S. and have the highest incidence of prostate cancer in the world. Inorganic lead has been classified as a probable human carcinogen. Lead (Pb) inhibits delta-aminolevulinic acid dehydratase (ALAD), a gene recently implicated in other genitourinary cancers. The ALAD enzyme is involved in the second step of heme biosynthesis and is an endogenous inhibitor of the 26S proteasome, a master system for protein degradation and a current target of cancer therapy. METHODS Using a case-only study design, we assessed potential gene–environment (G × E) interactions between lifetime occupational Pb exposure and 11 tagSNPs within ALAD in black (N = 260) and white (N = 343) prostate cancer cases. RESULTS Two ALAD tagSNPs in high linkage disequilibrium showed significant interaction with high Pb exposure among black cases (rs818684 interaction odds ratio or IOR = 2.73, 95% CI 1.43–5.22, P = 0.002; rs818689 IOR = 2.20, 95% CI 1.15–4.21, P = 0.017) and an additional tagSNP, rs2761016, showed G × E interaction with low Pb exposure (IOR = 2.08, 95% CI 1.13– 3.84, P = 0.019). Further, the variant allele of rs818684 was associated with a higher Gleason grade in those with high Pb exposure among both blacks (OR 3.96, 95% CI 1.01–15.46, P = 0.048) and whites (OR 2.95, 95% CI 1.18–7.39, P = 0.020). CONCLUSIONS Genetic variation in ALAD may modify associations between Pb and prostate cancer. Additional studies of ALAD, Pb, and prostate cancer are warranted and should include black men. PMID:24500903
Neslund-Dudas, Christine; Levin, Albert M; Rundle, Andrew; Beebe-Dimmer, Jennifer; Bock, Cathryn H; Nock, Nora L; Jankowski, Michelle; Datta, Indrani; Krajenta, Richard; Dou, Q Ping; Mitra, Bharati; Tang, Deliang; Rybicki, Benjamin A
2014-05-01
Black men have historically had higher blood lead levels than white men in the U.S. and have the highest incidence of prostate cancer in the world. Inorganic lead has been classified as a probable human carcinogen. Lead (Pb) inhibits delta-aminolevulinic acid dehydratase (ALAD), a gene recently implicated in other genitourinary cancers. The ALAD enzyme is involved in the second step of heme biosynthesis and is an endogenous inhibitor of the 26S proteasome, a master system for protein degradation and a current target of cancer therapy. Using a case-only study design, we assessed potential gene-environment (G × E) interactions between lifetime occupational Pb exposure and 11 tagSNPs within ALAD in black (N = 260) and white (N = 343) prostate cancer cases. Two ALAD tagSNPs in high linkage disequilibrium showed significant interaction with high Pb exposure among black cases (rs818684 interaction odds ratio or IOR = 2.73, 95% CI 1.43-5.22, P = 0.002; rs818689 IOR = 2.20, 95% CI 1.15-4.21, P = 0.017) and an additional tagSNP, rs2761016, showed G × E interaction with low Pb exposure (IOR = 2.08, 95% CI 1.13-3.84, P = 0.019). Further, the variant allele of rs818684 was associated with a higher Gleason grade in those with high Pb exposure among both blacks (OR 3.96, 95% CI 1.01-15.46, P = 0.048) and whites (OR 2.95, 95% CI 1.18-7.39, P = 0.020). Genetic variation in ALAD may modify associations between Pb and prostate cancer. Additional studies of ALAD, Pb, and prostate cancer are warranted and should include black men. Prostate 74:637-646, 2014. © 2014 Wiley Periodicals, Inc. © 2014 Wiley Periodicals, Inc.
Haplotypes of CYP3A4 and their close linkage with CYP3A5 haplotypes in a Japanese population.
Fukushima-Uesaka, Hiromi; Saito, Yoshiro; Watanabe, Hidemi; Shiseki, Kisho; Saeki, Mayumi; Nakamura, Takahiro; Kurose, Kouichi; Sai, Kimie; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Kitakaze, Masafumi; Hanai, Sotaro; Nakajima, Toshiharu; Matsumoto, Kenji; Saito, Hirohisa; Goto, Yu-ichi; Kimura, Hideo; Katoh, Masaaki; Sugai, Kenji; Minami, Narihiro; Shirao, Kuniaki; Tamura, Tomohide; Yamamoto, Noboru; Minami, Hironobu; Ohtsu, Atsushi; Yoshida, Teruhiko; Saijo, Nagahiro; Kitamura, Yutaka; Kamatani, Naoyuki; Ozawa, Shogo; Sawada, Jun-ichi
2004-01-01
In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A4 in a Japanese population, the distal enhancer and proximal promoter regions, all exons, and the surrounding introns were sequenced from genomic DNA of 416 Japanese subjects. We found 24 SNPs, including 17 novel ones: two in the distal enhancer, four in the proximal promoter, one in the 5'-untranslated region (UTR), seven in the introns, and three in the 3'-UTR. The most common SNP was c.1026+12G>A (IVS10+12G>A), with a 0.249 frequency. Four non-synonymous SNPs, c.554C>G (p.T185S, CYP3A4(*)16), c.830_831insA (p.E277fsX8, (*)6), c.878T>C (p.L293P, (*)18), and c.1088 C>T (p.T363M, (*)11) were found with frequencies of 0.014, 0.001, 0.028, and 0.002, respectively. No SNP was found in the known nuclear transcriptional factor-binding sites in the enhancer and promoter regions. Using these 24 SNPs, 16 haplotypes were unambiguously identified, and nine haplotypes were inferred by aid of an expectation-maximization-based program. In addition, using data from 186 subjects enabled a close linkage to be found between CYP3A4 and CYP3A5 SNPs, especially among the SNPs at c.1026+12 in CYP3A4 and c.219-237 (IVS3-237, a key SNP site for CYP3A5(*)3), c.865+77 (IVS9+77) and c.1523 in CYP3A5. This result suggested that CYP3A4 and CYP3A5 are within the same gene block. Haplotype analysis between CYP3A4 and CYP3A5 revealed several major haplotype combinations in the CYP3A4-CYP3A5 block. Our findings provide fundamental and useful information for genotyping CYP3A4 (and CYP3A5) in the Japanese, and probably Asian populations. Copyright 2003 Wiley-Liss, Inc.
Efficient selection of tagging single-nucleotide polymorphisms in multiple populations.
Howie, Bryan N; Carlson, Christopher S; Rieder, Mark J; Nickerson, Deborah A
2006-08-01
Common genetic polymorphism may explain a portion of the heritable risk for common diseases, so considerable effort has been devoted to finding and typing common single-nucleotide polymorphisms (SNPs) in the human genome. Many SNPs show correlated genotypes, or linkage disequilibrium (LD), suggesting that only a subset of all SNPs (known as tagging SNPs, or tagSNPs) need to be genotyped for disease association studies. Based on the genetic differences that exist among human populations, most tagSNP sets are defined in a single population and applied only in populations that are closely related. To improve the efficiency of multi-population analyses, we have developed an algorithm called MultiPop-TagSelect that finds a near-minimal union of population-specific tagSNP sets across an arbitrary number of populations. We present this approach as an extension of LD-select, a tagSNP selection method that uses a greedy algorithm to group SNPs into bins based on their pairwise association patterns, although the MultiPop-TagSelect algorithm could be used with any SNP tagging approach that allows choices between nearly equivalent SNPs. We evaluate the algorithm by considering tagSNP selection in candidate-gene resequencing data and lower density whole-chromosome data. Our analysis reveals that an exhaustive search is often intractable, while the developed algorithm can quickly and reliably find near-optimal solutions even for difficult tagSNP selection problems. Using populations of African, Asian, and European ancestry, we also show that an optimal multi-population set of tagSNPs can be substantially smaller (up to 44%) than a typical set obtained through independent or sequential selection.
efficient association study design via power-optimized tag SNP selection
HAN, BUHM; KANG, HYUN MIN; SEO, MYEONG SEONG; ZAITLEN, NOAH; ESKIN, ELEAZAR
2008-01-01
Discovering statistical correlation between causal genetic variation and clinical traits through association studies is an important method for identifying the genetic basis of human diseases. Since fully resequencing a cohort is prohibitively costly, genetic association studies take advantage of local correlation structure (or linkage disequilibrium) between single nucleotide polymorphisms (SNPs) by selecting a subset of SNPs to be genotyped (tag SNPs). While many current association studies are performed using commercially available high-throughput genotyping products that define a set of tag SNPs, choosing tag SNPs remains an important problem for both custom follow-up studies as well as designing the high-throughput genotyping products themselves. The most widely used tag SNP selection method optimizes over the correlation between SNPs (r2). However, tag SNPs chosen based on an r2 criterion do not necessarily maximize the statistical power of an association study. We propose a study design framework that chooses SNPs to maximize power and efficiently measures the power through empirical simulation. Empirical results based on the HapMap data show that our method gains considerable power over a widely used r2-based method, or equivalently reduces the number of tag SNPs required to attain the desired power of a study. Our power-optimized 100k whole genome tag set provides equivalent power to the Affymetrix 500k chip for the CEU population. For the design of custom follow-up studies, our method provides up to twice the power increase using the same number of tag SNPs as r2-based methods. Our method is publicly available via web server at http://design.cs.ucla.edu. PMID:18702637
The JAK2 GGCC (46/1) Haplotype in Myeloproliferative Neoplasms: Causal or Random?
Anelli, Luisa; Zagaria, Antonella; Specchia, Giorgina; Albano, Francesco
2018-04-11
The germline JAK2 haplotype known as "GGCC or 46/1 haplotype" (haplotype GGCC_46/1 ) consists of a combination of single nucleotide polymorphisms (SNPs) mapping in a region of about 250 kb, extending from the JAK2 intron 10 to the Insulin-like 4 ( INLS4 ) gene. Four main SNPs (rs3780367, rs10974944, rs12343867, and rs1159782) generating a "GGCC" combination are more frequently indicated to represent the JAK2 haplotype. These SNPs are inherited together and are frequently associated with the onset of myeloproliferative neoplasms (MPN) positive for both JAK2 V617 and exon 12 mutations. The association between the JAK2 haplotype GGCC_46/1 and mutations in other genes, such as thrombopoietin receptor ( MPL ) and calreticulin ( CALR ), or the association with triple negative MPN, is still controversial. This review provides an overview of the frequency and the role of the JAK2 haplotype GGCC_46/1 in the pathogenesis of different myeloid neoplasms and describes the hypothetical mechanisms at the basis of the association with JAK2 gene mutations. Moreover, possible clinical implications are discussed, as different papers reported contrasting data about the correlation between the JAK2 haplotype GGCC_46/1 and blood cell count, survival, or disease progression.
Tang, Shaowen; Lv, Xiaozhen; Zhang, Yuan; Wu, Shanshan; Yang, Zhirong; Xia, Yinyin; Tu, Dehua; Deng, Peiyuan; Ma, Yu; Chen, Dafang; Zhan, Siyan
2013-01-01
The pathogenic mechanism of anti-tuberculosis (anti-TB) drug-induced hepatitis is associated with drug metabolizing enzymes. No tagging single-nucleotide polymorphisms (tSNPs) of cytochrome P450 2E1(CYP2E1) in the risk of anti-TB drug-induced hepatitis have been reported. The present study was aimed at exploring the role of tSNPs in CYP2E1 gene in a population-based anti-TB treatment cohort. A nested case-control study was designed. Each hepatitis case was 14 matched with controls by age, gender, treatment history, disease severity and drug dosage. The tSNPs were selected by using Haploview 4.2 based on the HapMap database of Han Chinese in Beijing, and detected by using TaqMan allelic discrimination technology. Eighty-nine anti-TB drug-induced hepatitis cases and 356 controls were included in this study. 6 tSNPs (rs2031920, rs2070672, rs915908, rs8192775, rs2515641, rs2515644) were genotyped and minor allele frequencies of these tSNPs were 21.9%, 23.0%, 19.1%, 23.6%, 20.8% and 44.4% in the cases and 20.9%, 22.7%, 18.9%, 23.2%, 18.2% and 43.2% in the controls, respectively. No significant difference was observed in genotypes or allele frequencies of the 6 tSNPs between case group and control group, and neither of haplotypes in block 1 nor in block 2 was significantly associated with the development of hepatitis. Based on the Chinese anti-TB treatment cohort, we did not find a statistically significant association between genetic polymorphisms of CYP2E1 and the risk of anti-TB drug-induced hepatitis. None of the haplotypes showed a significant association with the development of hepatitis in Chinese TB population.
Ozturk, Ayla; Minster, Ryan L; DeKosky, Steven T; Kamboh, M Ilyas
2007-01-05
The gene coding for urokinase-plasminogen activator (PLAU) is a strong biological and positional candidate gene for Alzheimer's disease (AD). Previously some studies have examined the role of common variation in the PLAU gene with AD risk but the results have been inconsistent and this inconsistency could have been due to the use of relatively small sample sizes. In this study we evaluated the distribution of four tagSNPs (rs2227562 in intron 5, rs2227564 in exon 6, rs2227571 in intron 9, and rs4065 in 3'UTR) in the PLAU gene in a large case-control study consisting of up to 1,000 AD patients and 697 white control subjects. We examined the role of these tagSNPs with AD risk and quantitative traits of AD, including age-at-onset (AAO), disease duration, and mini-mental state examination (MMSE) scores. The 3'UTR SNP revealed modest significant association with risk (OR = 0.71, 95% CI: 0.53-0.95; P = 0.02), AAO (P = 0.036) and disease duration (P = 0.04) of AD. In addition, the intron 9 SNP also revealed a significant association with AAO (P = 0.01) and disease duration (P = 0.006). Our data on a large number of AD cases and controls suggest that genetic variation in PLAU may affect the risk and AAO of AD.
HERC1 polymorphisms: population-specific variations in haplotype composition.
Yuasa, Isao; Umetsu, Kazuo; Nishimukai, Hiroaki; Fukumori, Yasuo; Harihara, Shinji; Saitou, Naruya; Jin, Feng; Chattopadhyay, Prasanta K; Henke, Lotte; Henke, Jürgen
2009-08-01
Human HERC1 is one of six HERC proteins and may play an important role in intracellular membrane trafficking. The human HERC1 gene is suggested to have been affected by local positive selection. To assess the global frequency distributions of coding and non-coding single nucleotide polymorphisms (SNPs) in the HERC1 gene, we developed a new simultaneous genotyping method for four SNPs, and applied this method to investigate 1213 individuals from 12 global populations. The results confirmed remarked differences in the allele and haplotype frequencies between East Asian and non-East Asian populations. One of the three common haplotypes observed was found to be characteristic of East Asians, who showed a relatively uniform distribution of haplotypes. Information on haplotypes would be useful for testing the function of polymorphisms in the HERC1 gene. This is the first study to investigate the distribution of HERC1 polymorphisms in various populations. (c) 2009 John Wiley & Sons, Ltd.
Structural forms of the human amylase locus and their relationships to SNPs, haplotypes, and obesity
Usher, Christina L; Handsaker, Robert E; Esko, Tõnu; Tuke, Marcus A; Weedon, Michael N; Hastie, Alex R; Cao, Han; Moon, Jennifer E; Kashin, Seva; Fuchsberger, Christian; Metspalu, Andres; Pato, Carlos N; Pato, Michele T; McCarthy, Mark I; Boehnke, Michael; Altshuler, David M; Frayling, Timothy M; Hirschhorn, Joel N; McCarroll, Steven A
2016-01-01
Hundreds of genes reside in structurally complex, poorly understood regions of the human genome1-3. One such region contains the three amylase genes (AMY2B, AMY2A, and AMY1) responsible for digesting starch into sugar. The copy number of AMY1 is reported to be the genome’s largest influence on obesity4, though genome-wide association studies for obesity have found this locus unremarkable. Using whole genome sequence analysis3,5, droplet digital PCR6, and genome mapping7, we identified eight common structural haplotypes of the amylase locus that suggest its mutational history. We found that AMY1 copy number in individuals’ genomes is generally even (rather than odd) and partially correlates to nearby SNPs, which do not associate with BMI. We measured amylase gene copy number in 1,000 obese or lean Estonians and in two other cohorts totaling ~3,500 individuals. We had 99% power to detect the lower bound of the reported effects on BMI4, yet found no association. PMID:26098870
Intricacies in arrangement of SNP haplotypes suggest "Great Admixture" that created modern humans.
Dutta, Rajib; Mainsah, Joseph; Yatskiv, Yuriy; Chakrabortty, Sharmistha; Brennan, Patrick; Khuder, Basil; Qiu, Shuhao; Fedorova, Larisa; Fedorov, Alexei
2017-06-05
Inferring history from genomic sequences is challenging and problematic because chromosomes are mosaics of thousands of small Identicalby-descent (IBD) fragments, each of them having their own unique story. However, the main events in recent evolution might be deciphered from comparative analysis of numerous loci. A paradox of why humans, whose effective population size is only 10 4 , have nearly three million frequent SNPs is formulated and examined. We studied 5398 loci evenly covering all human autosomes. Common haplotypes built from frequent SNPs that are present in people from various populations have been examined. We demonstrated highly non-random arrangement of alleles in common haplotypes. Abundance of mutually exclusive pairs of common haplotypes that have different alleles at every polymorphic position (so-called Yin/Yang haplotypes) was found in 56% of loci. A novel widely spread category of common haplotypes named Mosaic has been described. Mosaic consists of numerous pieces of Yin/Yang haplotypes and represents an ancestral stage of one of them. Scenarios of possible appearance of large number of frequent human SNPs and their habitual arrangement in Yin/Yang common haplotypes have been evaluated with an advanced genomic simulation algorithm. Computer modeling demonstrated that the observed arrangement of 2.9 million frequent SNPs could not originate from a sole stand-alone population. A "Great Admixture" event has been proposed that can explain peculiarities with frequent SNP distributions. This Great Admixture presumably occurred 100-300 thousand years ago between two ancestral populations that had been separated from each other about a million years ago. Our programs and algorithms can be applied to other species to perform evolutionary and comparative genomics.
The JAK2 GGCC (46/1) Haplotype in Myeloproliferative Neoplasms: Causal or Random?
Anelli, Luisa; Zagaria, Antonella; Specchia, Giorgina
2018-01-01
The germline JAK2 haplotype known as “GGCC or 46/1 haplotype” (haplotypeGGCC_46/1) consists of a combination of single nucleotide polymorphisms (SNPs) mapping in a region of about 250 kb, extending from the JAK2 intron 10 to the Insulin-like 4 (INLS4) gene. Four main SNPs (rs3780367, rs10974944, rs12343867, and rs1159782) generating a “GGCC” combination are more frequently indicated to represent the JAK2 haplotype. These SNPs are inherited together and are frequently associated with the onset of myeloproliferative neoplasms (MPN) positive for both JAK2 V617 and exon 12 mutations. The association between the JAK2 haplotypeGGCC_46/1 and mutations in other genes, such as thrombopoietin receptor (MPL) and calreticulin (CALR), or the association with triple negative MPN, is still controversial. This review provides an overview of the frequency and the role of the JAK2 haplotypeGGCC_46/1 in the pathogenesis of different myeloid neoplasms and describes the hypothetical mechanisms at the basis of the association with JAK2 gene mutations. Moreover, possible clinical implications are discussed, as different papers reported contrasting data about the correlation between the JAK2 haplotypeGGCC_46/1 and blood cell count, survival, or disease progression. PMID:29641446
Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population.
Saeki, Mayumi; Saito, Yoshiro; Nakamura, Takahiro; Murayama, Norie; Kim, Su-Ryang; Ozawa, Shogo; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Nakajima, Toshiharu; Saito, Hirohisa; Kitamura, Yutaka; Kamatani, Naoyuki; Sawada, Jun-ichi
2003-06-01
In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese. Copyright 2003 Wiley-Liss, Inc.
Lutz, Michael W.; Saul, Robert; Linnertz, Colton; Glenn, Omolara-Chinue; Roses, Allen D.; Chiba-Falek, Ornit
2015-01-01
INTRODUCTION We recently showed that tagging-SNPs across the SNCA locus were significantly associated with increased risk for LB pathology in AD cases. However, the actual genetic variant(s) that underlie the observed associations remain elusive. METHODS We used a bioinformatics algorithm to catalogue Structural-Variants in a region of SNCA-intron4, followed by phased-sequencing. We performed a genetic-association analysis in autopsy series of LBV/AD cases compared with AD-only controls. We investigated the biological functions by expression analysis using temporal-cortex samples. RESULTS We identified four distinct haplotypes within a highly-polymorphic-low-complexity CT-rich region. We showed that a specific haplotype conferred risk to develop LBV/AD. We demonstrated that the CT-rich site acts as an enhancer element, where the risk haplotype was significantly associated with elevated levels of SNCA-mRNA. DISCUSSION We have discovered a novel haplotype in a CT-rich region in SNCA that contributes to LB pathology in AD patients, possibly via cis-regulation of the gene expression. PMID:26079410
BCL11A Enhancer Haplotypes and Fetal Hemoglobin in Sickle Cell Anemia
Sebastiani, P.; Farrell, J.J.; Alsultan, A.; Wang, S.; Edward, H. L.; Shappell, H.; Bae, H.; Milton, J. N.; Baldwin, C.T.; Al-Rubaish, A.M.; Naserullah, Z.; Al-Muhanna, F.; Alsuliman, A.; Patra, P. K.; Farrer, L.A.; Ngo, D.; Vathipadiekal, V.; Chui, D.H.K.; Al-Ali, A.K.; Steinberg, M.H.
2015-01-01
Background Fetal hemoglobin (HbF) levels in sickle cell anemia patients vary. We genotyped polymorphisms in the erythroid-specific enhancer of BCL11A to see if they might account for the very high HbF associated with the Arab-Indian (AI) haplotype and Benin haplotype of sickle cell anemia. Methods and Results Six BCL112A enhancer SNPs and their haplotypes were studied in Saudi Arabs from the Eastern Province and Indian patients with AI haplotype (HbF ~20%), African Americans (HbF ~7%), and Saudi Arabs from the Southwestern Province (HbF ~12%). Four SNPs (rs1427407, rs6706648, rs6738440, and rs7606173) and their haplotypes were consistently associated with HbF levels. The distributions of haplotypes differ in the 3 cohorts but not their genetic effects: the haplotype TCAG was associated with the lowest HbF level and the haplotype GTAC was associated with the highest HbF level and differences in HbF levels between carriers of these haplotypes in all cohorts was approximately 6%. Conclusions Common HbF BCL11A enhancer haplotypes in patients with African origin and AI sickle cell anemia have similar effects on HbF but they do not explain their differences in HbF. PMID:25703683
Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z
2016-10-01
The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.
Haplotype analysis of the apolipoprotein gene cluster on human chromosome 11
Olivier, Michael; Wang, Xujing; Cole, Regina; Gau, Brian; Kim, Jessica; Rubin, Edward M.; Pennacchio, Len A.
2009-01-01
Members of the apolipoprotein gene cluster (APOA1/C3/A4/A5) on human chromosome 11q23 play an important role in lipid metabolism. Polymorphisms in both APOA5 and APOC3 are strongly associated with plasma triglyceride concentrations. The close genomic locations of these two genes as well as their functional similarity have hindered efforts to define whether each gene independently influences human triglyceride concentrations. In this study, we examined the linkage disequilibrium and haplotype structure of 49 SNPs in a 150-kb region spanning the gene cluster. We identified a total of five common APOA5 haplotypes with a frequency of greater than 8% in samples of northern European origin. The APOA5 haplotype block did not extend past the 7 SNPs in the gene and was separated from the other apolipoprotein gene in the cluster by a region of significantly increased recombination. Furthermore, one previously identified triglyceride risk haplotype of APOA5 (APOA5*3) showed no association with three APOC3 SNPs previously associated with triglyceride concentrations, in contrast to the other risk haplotype (APOA5*2), which was associated with all three minor APOC3 SNP alleles. These results highlight the complex genetic relationship between APOA5 and APOC3 and support the notion that APOA5 represents an independent risk gene affecting plasma triglyceride concentrations in humans. PMID:15081120
Single nucleotide polymorphisms and haplotypes associated with feed efficiency in beef cattle
2013-01-01
Background General, breed- and diet-dependent associations between feed efficiency in beef cattle and single nucleotide polymorphisms (SNPs) or haplotypes were identified on a population of 1321 steers using a 50 K SNP panel. Genomic associations with traditional two-step indicators of feed efficiency – residual feed intake (RFI), residual average daily gain (RADG), and residual intake gain (RIG) – were compared to associations with two complementary one-step indicators of feed efficiency: efficiency of intake (EI) and efficiency of gain (EG). Associations uncovered in a training data set were evaluated on independent validation data set. A multi-SNP model was developed to predict feed efficiency. Functional analysis of genes harboring SNPs significantly associated with feed efficiency and network visualization aided in the interpretation of the results. Results For the five feed efficiency indicators, the numbers of general, breed-dependent, and diet-dependent associations with SNPs (P-value < 0.0001) were 31, 40, and 25, and with haplotypes were six, ten, and nine, respectively. Of these, 20 SNP and six haplotype associations overlapped between RFI and EI, and five SNP and one haplotype associations overlapped between RADG and EG. This result confirms the complementary value of the one and two-step indicators. The multi-SNP models included 89 SNPs and offered a precise prediction of the five feed efficiency indicators. The associations of 17 SNPs and 7 haplotypes with feed efficiency were confirmed on the validation data set. Nine clusters of Gene Ontology and KEGG pathway categories (mean P-value < 0.001) including, 9nucleotide binding; ion transport, phosphorous metabolic process, and the MAPK signaling pathway were overrepresented among the genes harboring the SNPs associated with feed efficiency. Conclusions The general SNP associations suggest that a single panel of genomic variants can be used regardless of breed and diet. The breed- and diet
Tachykinin 1 (TAC1) gene SNPs and haplotypes with autism: a case-control study.
Marui, Tetsuya; Funatogawa, Ikuko; Koishi, Shinko; Yamamoto, Kenji; Matsumoto, Hideo; Hashimoto, Ohiko; Nanba, Eiji; Nishida, Hisami; Sugiyama, Toshiro; Kasai, Kiyoto; Watanabe, Keiichiro; Kano, Yukiko; Kato, Nobumasa; Sasaki, Tsukasa
2007-09-01
Autism (MIM 209850) is a severe neurodevelopmental disorder characterized by disturbances in social interaction and communication, by repetitive body movements and restricted interests, and by atypical language development. Several twin and family studies have shown strong evidence for genetic factors in the etiology of autism. Glutamate is a major excitatory neurotransmitter in the human brain. Glutamate systems are involved in the pathophysiology of autism. There are many similarities between the symptoms evoked by glutamate antagonist treatment and symptoms of autism found in several human and animal studies. To elucidate the genetic background of autism, we analyzed the relationship between three single nucleotide polymorphisms (SNPs) of the Tachykinin 1 gene (TAC1) and autism, because TAC1 is located in the candidate region for autism and produces substance P and neurokinins. These products modulate glutamatergic excitatory synaptic transmission and are also involved in inflammation. Many different inflammation-related mechanisms could be involved in the autistic brain. Therefore, TAC1 may have some functions associated with the presumable pathophysiology of autism. We compared the allele and haplotype frequencies between autistic patients (n=170) and normal controls (n=214) in the Japanese population, but no significant difference was observed. Thus, the TAC1 locus is not likely to play a major role in the development of autism.
Linear reduction methods for tag SNP selection.
He, Jingwu; Zelikovsky, Alex
2004-01-01
It is widely hoped that constructing a complete human haplotype map will help to associate complex diseases with certain SNP's. Unfortunately, the number of SNP's is huge and it is very costly to sequence many individuals. Therefore, it is desirable to reduce the number of SNP's that should be sequenced to considerably small number of informative representatives, so called tag SNP's. In this paper, we propose a new linear algebra based method for selecting and using tag SNP's. Our method is purely combinatorial and can be combined with linkage disequilibrium (LD) and block based methods. We measure the quality of our tag SNP selection algorithm by comparing actual SNP's with SNP's linearly predicted from linearly chosen tag SNP's. We obtain an extremely good compression and prediction rates. For example, for long haplotypes (>25000 SNP's), knowing only 0.4% of all SNP's we predict the entire unknown haplotype with 2% accuracy while the prediction method is based on a 10% sample of the population.
Effects of IL-10 haplotype and atomic bomb radiation exposure on gastric cancer risk.
Hayashi, Tomonori; Ito, Reiko; Cologne, John; Maki, Mayumi; Morishita, Yukari; Nagamura, Hiroko; Sasaki, Keiko; Hayashi, Ikue; Imai, Kazue; Yoshida, Kengo; Kajimura, Junko; Kyoizumi, Seishi; Kusunoki, Yoichiro; Ohishi, Waka; Fujiwara, Saeko; Akahoshi, Masazumi; Nakachi, Kei
2013-07-01
Gastric cancer (GC) is one of the cancers that reveal increased risk of mortality and incidence in atomic bomb survivors. The incidence of gastric cancer in the Life Span Study cohort of the Radiation Effects Research Foundation (RERF) increased with radiation dose (gender-averaged excess relative risk per Gy = 0.28) and remains high more than 65 years after exposure. To assess a possible role of gene-environment interaction, we examined the dose response for gastric cancer incidence based on immunosuppression-related IL-10 genotype, in a cohort study with 200 cancer cases (93 intestinal, 96 diffuse and 11 other types) among 4,690 atomic bomb survivors participating in an immunological substudy. Using a single haplotype block composed of four haplotype-tagging SNPs (comprising the major haplotype allele IL-10-ATTA and the minor haplotype allele IL-10-GGCG, which are categorized by IL-10 polymorphisms at -819A>G and -592T>G, +1177T>C and +1589A>G), multiplicative and additive models for joint effects of radiation and this IL-10 haplotyping were examined. The IL-10 minor haplotype allele(s) was a risk factor for intestinal type gastric cancer but not for diffuse type gastric cancer. Radiation was not associated with intestinal type gastric cancer. In diffuse type gastric cancer, the haplotype-specific excess relative risk (ERR) for radiation was statistically significant only in the major homozygote category of IL-10 (ERR = 0.46/Gy, P = 0.037), whereas estimated ERR for radiation with the minor IL-10 homozygotes was close to 0 and nonsignificant. Thus, the minor IL-10 haplotype might act to reduce the radiation related risk of diffuse-type gastric cancer. The results suggest that this IL-10 haplotyping might be involved in development of radiation-associated gastric cancer of the diffuse type, and that IL-10 haplotypes may explain individual differences in the radiation-related risk of gastric cancer. © 2013 by Radiation Research Society
GrigoraSNPs: Optimized Analysis of SNPs for DNA Forensics.
Ricke, Darrell O; Shcherbina, Anna; Michaleas, Adam; Fremont-Smith, Philip
2018-04-16
High-throughput sequencing (HTS) of single nucleotide polymorphisms (SNPs) enables additional DNA forensic capabilities not attainable using traditional STR panels. However, the inclusion of sets of loci selected for mixture analysis, extended kinship, phenotype, biogeographic ancestry prediction, etc., can result in large panel sizes that are difficult to analyze in a rapid fashion. GrigoraSNP was developed to address the allele-calling bottleneck that was encountered when analyzing SNP panels with more than 5000 loci using HTS. GrigoraSNPs uses a MapReduce parallel data processing on multiple computational threads plus a novel locus-identification hashing strategy leveraging target sequence tags. This tool optimizes the SNP calling module of the DNA analysis pipeline with runtimes that scale linearly with the number of HTS reads. Results are compared with SNP analysis pipelines implemented with SAMtools and GATK. GrigoraSNPs removes a computational bottleneck for processing forensic samples with large HTS SNP panels. Published 2018. This article is a U.S. Government work and is in the public domain in the USA.
HapMap tagSNP transferability in multiple populations: general guidelines
Xing, Jinchuan; Witherspoon, David J.; Watkins, W. Scott; Zhang, Yuhua; Tolpinrud, Whitney; Jorde, Lynn B.
2008-01-01
This PDF receipt will only be used as the basis for generating PubMed Central (PMC) documents. PMC documents will be made available for review after conversion (approx. 2–3 weeks time). Any corrections that need to be made will be done at that time. No materials will be released to PMC without the approval of an author. Only the PMC documents will appear on PubMed Central -- this PDF Receipt will not appear on PubMed Central. Linkage disequilibrium (LD) has received much recent attention because of its value in localizing disease-causing genes. Due to the extensive LD between neighboring loci in the human genome, it is believed that a subset of the single nucleotide polymorphisms in a region (tagSNPs) can be selected to capture most of the remaining SNP variants. In this study, we examined LD patterns and HapMap tagSNP transferability in more than 300 individuals. A South Indian and an African Mbuti Pygmy population sample were included to evaluate the performance of HapMap tagSNPs in geographically distinct and genetically isolated populations. Our results show that HapMap tagSNPs selected with r2 >= 0.8 can capture more than 85% of the SNPs in populations that are from the same continental group. Combined tagSNPs from HapMap CEU and CHB+JPT serve as the best reference for the Indian sample. The HapMap YRI are a sufficient reference for tagSNP selection in the Pygmy sample. In addition to our findings, we reviewed over 25 recent studies of tagSNP transferability and propose a general guideline for selecting tagSNPs from HapMap populations. PMID:18482828
Haplotype analysis of the apolipoprotein A5 gene in obese pediatric patients.
Horvatovich, Katalin; Bokor, Szilvia; Baráth, Akos; Maász, Anita; Kisfali, Péter; Járomi, Luca; Polgár, Noémi; Tóth, Dénes; Répásy, Judit; Endreffy, Emoke; Molnár, Dénes; Melegh, Béla
2011-06-01
Apolipoprotein A5 (APOA5) gene variants have been shown to be associated with elevated TG levels; the T-1131C (rs662799) variant has been reported to confer risk for the metabolic syndrome in adult populations. Little is known about the APOA5 variants in pediatric population, no such information is available for pediatric obesity at all. Here we examined four haplotype-tagging polymorphisms (T-1131C, IVS3 + G476A [rs2072560], T1259C [rs2266788] and C56G [rs3135506]) and studied also the frequency of major naturally occurring haplotypes of APOA5 in obese children. The polymorphisms were analyzed in 232 obese children, and in 137 healthy, normal weight controls, using PCR-RFLP methods. In the pediatric patients we could confirm the already known adult subjects based association of -1131C, IVS3 + 476A and 1259C variants with elevated triglyceride concentrations, both in obese patients and in the controls. The prevalence of the APOA5*2 haplotype (containing the minor allele of T-1131C, IVS3 + G476A and T1259C SNPs together) was 15.5% in obese children, and 5.80% in the controls (p<0.001); multiple logistic regression analysis revealed that this haplotype confers susceptibility for development of obesity (OR=2.87; 95% CI: 1.29-6.37; p≤0.01). By contrast, the APOA5*4 haplotype (with -1131C alone) did not show similar associations. Our findings also suggest that the APOA5*5 haplotype (1259C alone) can be protective against obesity (OR=0.25; 95% CI: 0.07-0.80; p<0.05). While previous studies in adults demonstrated, that the APOA5 -1131C minor allele confers risk for adult metabolic syndrome, here we show, that the susceptibility nature of this SNP restricted to the APOA5*2 haplotype in pediatric obese subjects.
Catechol-O-methyltransferase gene haplotypes in Mexican and Spanish patients with fibromyalgia
Vargas-Alarcón, Gilberto; Fragoso, José-Manuel; Cruz-Robles, David; Vargas, Angélica; Vargas, Alfonso; Lao-Villadóniga, José-Ignacio; García-Fructuoso, Ferrán; Ramos-Kuri, Manuel; Hernández, Fernando; Springall, Rashidi; Bojalil, Rafael; Vallejo, Maite; Martínez-Lavín, Manuel
2007-01-01
Autonomic dysfunction is frequent in patients with fibromyalgia (FM). Heart rate variability analyses have demonstrated signs of ongoing sympathetic hyperactivity. Catecholamines are sympathetic neurotransmitters. Catechol-O-methyltransferase (COMT), an enzyme, is the major catecholamine-clearing pathway. There are several single-nucleotide polymorphisms (SNPs) in the COMT gene associated with the different catecholamine-clearing abilities of the COMT enzyme. These SNPs are in linkage disequilibrium and segregate as 'haplotypes'. Healthy females with a particular COMT gene haplotype (ACCG) producing a defective enzyme are more sensitive to painful stimuli. The objective of our study was to define whether women with FM, from two different countries (Mexico and Spain), have the COMT gene haplotypes that have been previously associated with greater sensitivity to pain. All the individuals in the study were female. Fifty-seven Mexican patients and 78 Spanish patients were compared with their respective healthy control groups. All participants filled out the Fibromyalgia Impact Questionnaire (FIQ). Six COMT SNPs (rs2097903, rs6269, rs4633, rs4818, rs4680, and rs165599) were genotyped from peripheral blood DNA. In Spanish patients, there was a significant association between three SNPs (rs6269, rs4818, and rs4680) and the presence of FM when compared with healthy controls. Moreover, in Spanish patients with the 'high pain sensitivity' haplotype (ACCG), the disease, as assessed by the FIQ, was more severe. By contrast, Mexican patients displayed only a weak association between rs6269 and rs165599, and some FIQ subscales. In our group of Spanish patients, there was an association between FM and the COMT haplotype previously associated with high pain sensitivity. This association was not observed in Mexican patients. Studies with a larger sample size are needed in order to verify or amend these preliminary results. PMID:17961261
Cloud computing-based TagSNP selection algorithm for human genome data.
Hung, Che-Lun; Chen, Wen-Pei; Hua, Guan-Jie; Zheng, Huiru; Tsai, Suh-Jen Jane; Lin, Yaw-Ling
2015-01-05
Single nucleotide polymorphisms (SNPs) play a fundamental role in human genetic variation and are used in medical diagnostics, phylogeny construction, and drug design. They provide the highest-resolution genetic fingerprint for identifying disease associations and human features. Haplotypes are regions of linked genetic variants that are closely spaced on the genome and tend to be inherited together. Genetics research has revealed SNPs within certain haplotype blocks that introduce few distinct common haplotypes into most of the population. Haplotype block structures are used in association-based methods to map disease genes. In this paper, we propose an efficient algorithm for identifying haplotype blocks in the genome. In chromosomal haplotype data retrieved from the HapMap project website, the proposed algorithm identified longer haplotype blocks than an existing algorithm. To enhance its performance, we extended the proposed algorithm into a parallel algorithm that copies data in parallel via the Hadoop MapReduce framework. The proposed MapReduce-paralleled combinatorial algorithm performed well on real-world data obtained from the HapMap dataset; the improvement in computational efficiency was proportional to the number of processors used.
Genetic association of SNPs in the FTO gene and predisposition to obesity in Malaysian Malays.
Apalasamy, Y D; Ming, M F; Rampal, S; Bulgiba, A; Mohamed, Z
2012-12-01
The common variants in the fat mass- and obesity-associated (FTO) gene have been previously found to be associated with obesity in various adult populations. The objective of the present study was to investigate whether the single nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) blocks in various regions of the FTO gene are associated with predisposition to obesity in Malaysian Malays. Thirty-one FTO SNPs were genotyped in 587 (158 obese and 429 non-obese) Malaysian Malay subjects. Obesity traits and lipid profiles were measured and single-marker association testing, LD testing, and haplotype association analysis were performed. LD analysis of the FTO SNPs revealed the presence of 57 regions with complete LD (D' = 1.0). In addition, we detected the association of rs17817288 with low-density lipoprotein cholesterol. The FTO gene may therefore be involved in lipid metabolism in Malaysian Malays. Two haplotype blocks were present in this region of the FTO gene, but no particular haplotype was found to be significantly associated with an increased risk of obesity in Malaysian Malays.
Genetic association of SNPs in the FTO gene and predisposition to obesity in Malaysian Malays
Apalasamy, Y.D.; Ming, M.F.; Rampal, S.; Bulgiba, A.; Mohamed, Z.
2012-01-01
The common variants in the fat mass- and obesity-associated (FTO) gene have been previously found to be associated with obesity in various adult populations. The objective of the present study was to investigate whether the single nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) blocks in various regions of the FTO gene are associated with predisposition to obesity in Malaysian Malays. Thirty-one FTO SNPs were genotyped in 587 (158 obese and 429 non-obese) Malaysian Malay subjects. Obesity traits and lipid profiles were measured and single-marker association testing, LD testing, and haplotype association analysis were performed. LD analysis of the FTO SNPs revealed the presence of 57 regions with complete LD (D' = 1.0). In addition, we detected the association of rs17817288 with low-density lipoprotein cholesterol. The FTO gene may therefore be involved in lipid metabolism in Malaysian Malays. Two haplotype blocks were present in this region of the FTO gene, but no particular haplotype was found to be significantly associated with an increased risk of obesity in Malaysian Malays. PMID:22911346
Shirts, Brian H; Wood, Joel; Yolken, Robert H; Nimgaonkar, Vishwajit L
2006-12-01
Genetic association studies of several candidate cytokine genes have been motivated by evidence of immune dysfunction among patients with schizophrenia. Intriguing but inconsistent associations have been reported with polymorphisms of three positional candidate genes, namely IL1beta, IL1RN, and IL10. We used comprehensive sequencing data from the Seattle SNPs database to select tag SNPs that represent all common polymorphisms in the Caucasian population at these loci. Associations with 28 tag SNPs were evaluated in 478 cases and 501 unscreened control individuals, while accounting for population sub-structure using the genomic control method. The samples were also stratified by gender, diagnostic category, and exposure to infectious agents. Significant association was not detected after correcting for multiple comparisons. However, meta-analysis of our data combined with previously published association studies of rs16944 (IL1beta -511) suggests that the C allele confers modest risk for schizophrenia among individuals reporting Caucasian ancestry, but not Asians (Caucasians, n=819 cases, 1292 controls; p=0.0013, OR=1.24, 95% CI 1.09, 1.41).
Gu, Jun-dong; Hua, Feng; Mei, Chao-rong; Zheng, De-jie; Wang, Guo-fan; Zhou, Qing-hua
2014-01-01
Aim: Myeloperoxidase (MPO) and glutathione S-transferase pi 1 (GSTP1) are important carcinogen-metabolizing enzymes. The aim of this study was to investigate the association between the common polymorphisms of MPO and GSTP1 genes and lung cancer risk in Chinese Han population. Methods: A total of 266 subjects with lung cancer and 307 controls without personal history of the disease were recruited in this case control study. The tagSNPs approach was used to assess the common polymorphisms of MOP and GSTP1 genes and lung cancer risk according to the disequilibrium information from the HapMap project. The tagSNP rs7208693 was selected as the polymorphism site for MPO, while the haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174 were selected as the polymorphism sites for GSTP1. The gene polymorphisms were confirmed using real-time PCR, cloning and sequencing. Results: The four GSTP1 haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174, but not the MPO tagSNP rs7208693, exhibited an association with lung cancer susceptibility in smokers in the overall population and in the studied subgroups. When Phase 2 software was used to reconstruct the haplotype for GSTP1, the haplotype CACA (rs749174+rs1695 + rs762803+rs4891) exhibited an increased risk of lung cancer among smokers (adjust odds ratio 1.53; 95%CI 1.04–2.25, P=0.033). Furthermore, diplotype analyses demonstrated that the significant association between the risk haplotype and lung cancer. The risk haplotypes co-segregated with one or more biologically functional polymorphisms and corresponded to a recessive inheritance model. Conclusion: The common polymorphisms of the GSTP1 gene may be the candidates for SNP markers for lung cancer susceptibility in Chinese Han population. PMID:24786234
Xu, Yao; Cai, Hanfang; Zhou, Yang; Shi, Tao; Lan, Xianyong; Zhang, Chunlei; Lei, Chuzhao; Jia, Yutang; Chen, Hong
2014-07-01
Paired box 3 (PAX3) belongs to the PAX superfamily of transcription factors and plays essential roles in the embryogenesis and postnatal formation of limb musculature through affecting the survival of muscle progenitor cells. By genetic mapping, PAX3 gene is assigned in the interval of quantitative trait loci for body weight on bovine BTA2. The objectives of this study were to detect polymorphisms of PAX3 gene in 1,241 cattle from five breeds and to investigate their effects on growth traits. Initially, three novel single nucleotide polymorphisms (SNPs) were identified by DNA pool sequencing and aCRS-RFLP methods (AC_000159: g.T-580G, g.A4617C and g.79018Ins/del G), which were located at 5'-UTR, exon 4 and intron 6, respectively. A total of eight haplotypes were constructed and the frequency of the three main haplotypes H1 (TAG), H2 (GCG) and H3 (GAG) accounted for over 81.7 % of the total individuals. Statistical analysis revealed that the three SNPs were associated with body height and body length of Nanyang and Chinese Caoyuan cattle at the age of 6 and/or 12 months old (P < 0.05), and consistently significant effects were also found in the haplotype combination analysis on these traits (P < 0.05). This study presented a complete scan of variations within bovine PAX3 gene, which could provide evidence for improving the economic traits of cattle by using these variations as potentially genetic markers in early marker-assisted selection programs.
Lower frequency of the HLA-G UTR-4 haplotype in women with unexplained recurrent miscarriage.
Meuleman, T; Drabbels, J; van Lith, J M M; Dekkers, O M; Rozemuller, E; Cretu-Stancu, M; Claas, F H J; Bloemenkamp, K W M; Eikmans, M
2018-04-01
HLA-G expressed by trophoblasts at the fetal-maternal interface and its soluble form have immunomodulatory effects. HLA-G expression depends on the combination of DNA polymorphisms. We hypothesized that combinations of specific single nucleotide polymorphisms (SNPs) in the 3'untranslated region (3'UTR) of HLA-G play a role in unexplained recurrent miscarriage. In a case control design, 100 cases with at least three unexplained consecutive miscarriages prior to the 20th week of gestation were included. Cases were at time of the third miscarriage younger than 36 years, and they conceived all their pregnancies from the same partner. The control group included 89 women with an uneventful pregnancy. The association of HLA-G 3'UTR SNPs and specific HLA-G haplotype with recurrent miscarriage was studied with logistic regression. Odds ratios (OR) and 95% confidence intervals (95% CI) were reported. Individual SNPs were not significantly associated with recurrent miscarriage after correction for multiple comparisons. However, the presence of the UTR-4 haplotype, which included +3003C, was significantly lower in women with recurrent miscarriage (OR 0.4, 95% CI 0.2-0.8, p = 0.015). In conclusion, this is the first study to perform a comprehensive analysis of HLA-G SNPs and HLA-G haplotypes in a well-defined group of women with recurrent miscarriage and women with uneventful pregnancy. The UTR-4 haplotype was less frequently observed in women with recurrent miscarriage, suggesting an immunoregulatory role of this haplotype for continuation of the pregnancy without complications. Thus, association of HLA-G with recurrent miscarriage is not related to single polymorphisms in the 3'UTR, but is rather dependent on haplotypes. Copyright © 2018 Elsevier B.V. All rights reserved.
Cloud Computing-Based TagSNP Selection Algorithm for Human Genome Data
Hung, Che-Lun; Chen, Wen-Pei; Hua, Guan-Jie; Zheng, Huiru; Tsai, Suh-Jen Jane; Lin, Yaw-Ling
2015-01-01
Single nucleotide polymorphisms (SNPs) play a fundamental role in human genetic variation and are used in medical diagnostics, phylogeny construction, and drug design. They provide the highest-resolution genetic fingerprint for identifying disease associations and human features. Haplotypes are regions of linked genetic variants that are closely spaced on the genome and tend to be inherited together. Genetics research has revealed SNPs within certain haplotype blocks that introduce few distinct common haplotypes into most of the population. Haplotype block structures are used in association-based methods to map disease genes. In this paper, we propose an efficient algorithm for identifying haplotype blocks in the genome. In chromosomal haplotype data retrieved from the HapMap project website, the proposed algorithm identified longer haplotype blocks than an existing algorithm. To enhance its performance, we extended the proposed algorithm into a parallel algorithm that copies data in parallel via the Hadoop MapReduce framework. The proposed MapReduce-paralleled combinatorial algorithm performed well on real-world data obtained from the HapMap dataset; the improvement in computational efficiency was proportional to the number of processors used. PMID:25569088
Modeling haplotype block variation using Markov chains.
Greenspan, G; Geiger, D
2006-04-01
Models of background variation in genomic regions form the basis of linkage disequilibrium mapping methods. In this work we analyze a background model that groups SNPs into haplotype blocks and represents the dependencies between blocks by a Markov chain. We develop an error measure to compare the performance of this model against the common model that assumes that blocks are independent. By examining data from the International Haplotype Mapping project, we show how the Markov model over haplotype blocks is most accurate when representing blocks in strong linkage disequilibrium. This contrasts with the independent model, which is rendered less accurate by linkage disequilibrium. We provide a theoretical explanation for this surprising property of the Markov model and relate its behavior to allele diversity.
Modeling Haplotype Block Variation Using Markov Chains
Greenspan, G.; Geiger, D.
2006-01-01
Models of background variation in genomic regions form the basis of linkage disequilibrium mapping methods. In this work we analyze a background model that groups SNPs into haplotype blocks and represents the dependencies between blocks by a Markov chain. We develop an error measure to compare the performance of this model against the common model that assumes that blocks are independent. By examining data from the International Haplotype Mapping project, we show how the Markov model over haplotype blocks is most accurate when representing blocks in strong linkage disequilibrium. This contrasts with the independent model, which is rendered less accurate by linkage disequilibrium. We provide a theoretical explanation for this surprising property of the Markov model and relate its behavior to allele diversity. PMID:16361244
Global variation in CYP2C8–CYP2C9 functional haplotypes
Speed, William C; Kang, Soonmo Peter; Tuck, David P; Harris, Lyndsay N; Kidd, Kenneth K
2009-01-01
We have studied the global frequency distributions of 10 single nucleotide polymorphisms (SNPs) across 132 kb of CYP2C8 and CYP2C9 in ∼2500 individuals representing 45 populations. Five of the SNPs were in noncoding sequences; the other five involved the more common missense variants (four in CYP2C8, one in CYP2C9) that change amino acids in the gene products. One haplotype containing two CYP2C8 coding variants and one CYP2C9 coding variant reaches an average frequency of 10% in Europe; a set of haplotypes with a different CYP2C8 coding variant reaches 17% in Africa. In both cases these haplotypes are found in other regions of the world at <1%. This considerable geographic variation in haplotype frequencies impacts the interpretation of CYP2C8/CYP2C9 association studies, and has pharmacogenomic implications for drug interactions. PMID:19381162
Landgren, Sara; Jerlhag, Elisabet; Zetterberg, Henrik; Gonzalez-Quintela, Arturo; Campos, Joaquin; Olofsson, Ulrica; Nilsson, Staffan; Blennow, Kaj; Engel, Jörgen A
2008-12-01
Ghrelin, an orexigenic peptide, acts on growth hormone secretagogue receptors (GHS-R1A), expressed in the hypothalamus as well as in important reward nodes such as the ventral tegmental area. Interestingly, ghrelin has been found to activate an important part of the reward systems, i.e., the cholinergic-dopaminergic reward link. Additionally, the rewarding and neurochemical properties of alcohol are, at least in part, mediated via this reward link. There is comorbidity between alcohol dependence and eating disorders. Thus, plasma levels of ghrelin are altered in patients with addictive behaviors such as alcohol and nicotine dependence and in binge eating disorder. This overlap prompted as to investigate the pro-ghrelin and GHS-R1A genes in a haplotype analysis of heavy alcohol-using individuals. A total of 417 Spanish individuals (abstainers, moderate, and heavy alcohol drinkers) were investigated in a haplotype analysis of the pro-ghrelin and GHS-R1A genes. Tag SNPs were chosen using HapMap data and the Tagger and Haploview softwares. These SNPs were then genotyped using TaqMan Allelic Discrimination. SNP rs2232165 of the GHS-R1A gene was associated with heavy alcohol consumption and SNP rs2948694 of the same gene as well as haplotypes of both the pro-ghrelin and the GHS-R1A genes were associated with body mass in heavy alcohol consuming individuals. The present findings are the first to disclose an association between the pro-ghrelin and GHS-R1A genes and heavy alcohol use, further strengthening the role of the ghrelin system in addictive behaviors and brain reward.
Patterns of linkage disequilibrium and haplotype distribution in disease candidate genes.
Long, Ji-Rong; Zhao, Lan-Juan; Liu, Peng-Yuan; Lu, Yan; Dvornyk, Volodymyr; Shen, Hui; Liu, Yong-Jun; Zhang, Yuan-Yuan; Xiong, Dong-Hai; Xiao, Peng; Deng, Hong-Wen
2004-05-24
The adequacy of association studies for complex diseases depends critically on the existence of linkage disequilibrium (LD) between functional alleles and surrounding SNP markers. We examined the patterns of LD and haplotype distribution in eight candidate genes for osteoporosis and/or obesity using 31 SNPs in 1,873 subjects. These eight genes are apolipoprotein E (APOE), type I collagen alpha1 (COL1A1), estrogen receptor-alpha (ER-alpha), leptin receptor (LEPR), parathyroid hormone (PTH)/PTH-related peptide receptor type 1 (PTHR1), transforming growth factor-beta1 (TGF-beta1), uncoupling protein 3 (UCP3), and vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR). Yin yang haplotypes, two high-frequency haplotypes composed of completely mismatching SNP alleles, were examined. To quantify LD patterns, two common measures of LD, D' and r2, were calculated for the SNPs within the genes. The haplotype distribution varied in the different genes. Yin yang haplotypes were observed only in PTHR1 and UCP3. D' ranged from 0.020 to 1.000 with the average of 0.475, whereas the average r2 was 0.158 (ranging from 0.000 to 0.883). A decay of LD was observed as the intermarker distance increased, however, there was a great difference in LD characteristics of different genes or even in different regions within gene. The differences in haplotype distributions and LD patterns among the genes underscore the importance of characterizing genomic regions of interest prior to association studies.
Dimensional Anxiety Mediates Linkage of GABRA2 Haplotypes With Alcoholism
Enoch, Mary-Anne; Schwartz, Lori; Albaugh, Bernard; Virkkunen, Matti; Goldman, David
2015-01-01
The GABAAα2 receptor gene (GABRA2) modulates anxiety and stress response. Three recent association studies implicate GABRA2 in alcoholism, however in these papers both common, opposite-configuration haplotypes in the region distal to intron3 predict risk. We have now replicated the GABRA2 association with alcoholism in 331 Plains Indian men and women and 461 Finnish Caucasian men. Using a dimensional measure of anxiety, harm avoidance (HA), we also found that the association with alcoholism is mediated, or moderated, by anxiety. Nine SNPs were genotyped revealing two haplotype blocks. Within the previously implicated block 2 region, we identified the two common, opposite-configuration risk haplotypes, A and B. Their frequencies differed markedly in Finns and Plains Indians. In both populations, most block 2 SNPs were significantly associated with alcoholism. The associations were due to increased frequencies of both homozygotes in alcoholics, indicating the possibility of alcoholic subtypes with opposite genotypes. Congruently, there was no significant haplotype association. Using HA as an indicator variable for anxiety, we found haplotype linkage to alcoholism with high and low dimensional anxiety, and to HA itself, in both populations. High HA alcoholics had the highest frequency of the more abundant haplotype (A in Finns, B in Plains Indians); low HA alcoholics had the highest frequency of the less abundant haplotype (B in Finns, A in Plains Indians) (Finns: P α0.007, OR α2.1, Plains Indians: P α0.040, OR α1.9). Non-alcoholics had intermediate frequencies. Our results suggest that within the distal GABRA2 region is a functional locus or loci that may differ between populations but that alters risk for alcoholism via the mediating action of anxiety. PMID:16874763
KCNQ1 Haplotypes Associate with Type 2 Diabetes in Malaysian Chinese Subjects
Saif-Ali, Riyadh; Ismail, Ikram S.; Al-Hamodi, Zaid; Al-Mekhlafi, Hesham M.; Siang, Lee C.; Alabsi, Aied M.; Muniandy, Sekaran
2011-01-01
The aim of this study was to investigate the association of single nucleotide polymorphisms (SNPs) and haplotypes of potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1) with type 2 diabetes (T2D) in Malaysian Chinese subjects. The KCNQ1 SNPs rs2237892, rs2283228 and rs2237895 were genotyped in 300 T2D patients and 230 control subjects without diabetes and metabolic syndrome. Two logistic regression models of analysis were applied, the first adjusted for age and gender while the second adjusted for age, gender and body mass index. The additive genetic analysis showed that adjusting for body mass index (BMI) even strengthened association of rs2237892, rs2283228 and rs2237895 with T2D (OR = 2.0, P = 5.1 × 10−5; OR = 1.9, P = 5.2 × 10−5; OR = 1.9, P = 7.8 × 10−5, respectively). The haplotype TCA containing the allele of rs2237892 (T), rs2283228 (C) and rs2237895 (A) was highly protective against T2D (Second model; OR = 0.17, P = 3.7 × 10−11). The KCNQ1 rs2237892 (TT), and the protective haplotype (TCA) were associated with higher beta-cell function (HOMA-B) in normal subjects (P = 0.0002; 0.014, respectively). This study found that KCNQ1 SNPs was associated with T2D susceptibility in Malaysian Chinese subjects. In addition, certain KCNQ1 haplotypes were strongly associated with T2D. PMID:22016621
Identifying tagging SNPs for African specific genetic variation from the African Diaspora Genome
Johnston, Henry Richard; Hu, Yi-Juan; Gao, Jingjing; O’Connor, Timothy D.; Abecasis, Gonçalo R.; Wojcik, Genevieve L; Gignoux, Christopher R.; Gourraud, Pierre-Antoine; Lizee, Antoine; Hansen, Mark; Genuario, Rob; Bullis, Dave; Lawley, Cindy; Kenny, Eimear E.; Bustamante, Carlos; Beaty, Terri H.; Mathias, Rasika A.; Barnes, Kathleen C.; Qin, Zhaohui S.; Preethi Boorgula, Meher; Campbell, Monica; Chavan, Sameer; Ford, Jean G.; Foster, Cassandra; Gao, Li; Hansel, Nadia N.; Horowitz, Edward; Huang, Lili; Ortiz, Romina; Potee, Joseph; Rafaels, Nicholas; Ruczinski, Ingo; Scott, Alan F.; Taub, Margaret A.; Vergara, Candelaria; Levin, Albert M.; Padhukasahasram, Badri; Williams, L. Keoki; Dunston, Georgia M.; Faruque, Mezbah U.; Gietzen, Kimberly; Deshpande, Aniket; Grus, Wendy E.; Locke, Devin P.; Foreman, Marilyn G.; Avila, Pedro C.; Grammer, Leslie; Kim, Kwang-Youn A.; Kumar, Rajesh; Schleimer, Robert; De La Vega, Francisco M.; Shringarpure, Suyash S.; Musharoff, Shaila; Burchard, Esteban G.; Eng, Celeste; Hernandez, Ryan D.; Pino-Yanes, Maria; Torgerson, Dara G.; Szpiech, Zachary A.; Torres, Raul; Nicolae, Dan L.; Ober, Carole; Olopade, Christopher O; Olopade, Olufunmilayo; Oluwole, Oluwafemi; Arinola, Ganiyu; Song, Wei; Correa, Adolfo; Musani, Solomon; Wilson, James G.; Lange, Leslie A.; Akey, Joshua; Bamshad, Michael; Chong, Jessica; Fu, Wenqing; Nickerson, Deborah; Reiner, Alexander; Hartert, Tina; Ware, Lorraine B.; Bleecker, Eugene; Meyers, Deborah; Ortega, Victor E.; Maul, Pissamai; Maul, Trevor; Watson, Harold; Ilma Araujo, Maria; Riccio Oliveira, Ricardo; Caraballo, Luis; Marrugo, Javier; Martinez, Beatriz; Meza, Catherine; Ayestas, Gerardo; Francisco Herrera-Paz, Edwin; Landaverde-Torres, Pamela; Erazo, Said Omar Leiva; Martinez, Rosella; Mayorga, Alvaro; Mayorga, Luis F.; Mejia-Mejia, Delmy-Aracely; Ramos, Hector; Saenz, Allan; Varela, Gloria; Marina Vasquez, Olga; Ferguson, Trevor; Knight-Madden, Jennifer; Samms-Vaughan, Maureen; Wilks, Rainford J.; Adegnika, Akim; Ateba-Ngoa, Ulysse; Yazdanbakhsh, Maria
2017-01-01
A primary goal of The Consortium on Asthma among African-ancestry Populations in the Americas (CAAPA) is to develop an ‘African Diaspora Power Chip’ (ADPC), a genotyping array consisting of tagging SNPs, useful in comprehensively identifying African specific genetic variation. This array is designed based on the novel variation identified in 642 CAAPA samples of African ancestry with high coverage whole genome sequence data (~30× depth). This novel variation extends the pattern of variation catalogued in the 1000 Genomes and Exome Sequencing Projects to a spectrum of populations representing the wide range of West African genomic diversity. These individuals from CAAPA also comprise a large swath of the African Diaspora population and incorporate historical genetic diversity covering nearly the entire Atlantic coast of the Americas. Here we show the results of designing and producing such a microchip array. This novel array covers African specific variation far better than other commercially available arrays, and will enable better GWAS analyses for researchers with individuals of African descent in their study populations. A recent study cataloging variation in continental African populations suggests this type of African-specific genotyping array is both necessary and valuable for facilitating large-scale GWAS in populations of African ancestry. PMID:28429804
Singh, Kanhaiya; Kant, Shri; Singh, Vivek Kumar; Agrawal, Neeraj K.; Gupta, Sanjeev K.
2014-01-01
Purpose Persistent inflammation and impaired neovascularization in type 2 diabetes mellitus (T2DM) patients may lead to development of macro- and microvascular complications. Diabetic retinopathy (DR) is one of the secondary microvascular complications of T2DM. Improper activation of the innate immune system may be an important contributor in the pathophysiology of DR. Toll-like receptor 4 (TLR4) is an important mediator of innate immunity, and genetic alterations in TLR4 support inflammation in the hyperglycemic condition. The present work was designed to investigate whether the TLR4 single nucleotide polymorphisms (SNPs) rs4986790, rs4986791, rs10759931, rs1927911, and rs1927914 are associated with DR in a north Indian population. Methods The study group of 698 individuals (128 DR, 250 T2DM, 320 controls) was genotyped by PCR-RFLP. Haplotype and linkage disequilibrium between SNPs were determined using Haploview software. Results Combined risk genotypes of TLR4 SNPs rs10759931 (odds ratio [OR] 1.50, p = 0.05) and rs1927914 (OR 1.48, p = 0.05) were found to be significantly associated with pathogenesis of DR. A total of 14 haplotypes with frequency >1% were obtained using Haploview software. Haplotypes ACATC (37.5%) and ACATT (14.8%) were the two most common haplotypes obtained. Conclusions Results of the present case-control study that included 698 north Indian subjects suggested that TLR4 SNPs rs10759931 and rs1927914 modulate the risk of DR in T2DM cases. Association analysis using haplotypes showed none of the haplotypes were associated with either susceptibility or resistance to DR in a north Indian population. PMID:24883015
A second generation human haplotype map of over 3.1 million SNPs.
Frazer, Kelly A; Ballinger, Dennis G; Cox, David R; Hinds, David A; Stuve, Laura L; Gibbs, Richard A; Belmont, John W; Boudreau, Andrew; Hardenbol, Paul; Leal, Suzanne M; Pasternak, Shiran; Wheeler, David A; Willis, Thomas D; Yu, Fuli; Yang, Huanming; Zeng, Changqing; Gao, Yang; Hu, Haoran; Hu, Weitao; Li, Chaohua; Lin, Wei; Liu, Siqi; Pan, Hao; Tang, Xiaoli; Wang, Jian; Wang, Wei; Yu, Jun; Zhang, Bo; Zhang, Qingrun; Zhao, Hongbin; Zhao, Hui; Zhou, Jun; Gabriel, Stacey B; Barry, Rachel; Blumenstiel, Brendan; Camargo, Amy; Defelice, Matthew; Faggart, Maura; Goyette, Mary; Gupta, Supriya; Moore, Jamie; Nguyen, Huy; Onofrio, Robert C; Parkin, Melissa; Roy, Jessica; Stahl, Erich; Winchester, Ellen; Ziaugra, Liuda; Altshuler, David; Shen, Yan; Yao, Zhijian; Huang, Wei; Chu, Xun; He, Yungang; Jin, Li; Liu, Yangfan; Shen, Yayun; Sun, Weiwei; Wang, Haifeng; Wang, Yi; Wang, Ying; Xiong, Xiaoyan; Xu, Liang; Waye, Mary M Y; Tsui, Stephen K W; Xue, Hong; Wong, J Tze-Fei; Galver, Luana M; Fan, Jian-Bing; Gunderson, Kevin; Murray, Sarah S; Oliphant, Arnold R; Chee, Mark S; Montpetit, Alexandre; Chagnon, Fanny; Ferretti, Vincent; Leboeuf, Martin; Olivier, Jean-François; Phillips, Michael S; Roumy, Stéphanie; Sallée, Clémentine; Verner, Andrei; Hudson, Thomas J; Kwok, Pui-Yan; Cai, Dongmei; Koboldt, Daniel C; Miller, Raymond D; Pawlikowska, Ludmila; Taillon-Miller, Patricia; Xiao, Ming; Tsui, Lap-Chee; Mak, William; Song, You Qiang; Tam, Paul K H; Nakamura, Yusuke; Kawaguchi, Takahisa; Kitamoto, Takuya; Morizono, Takashi; Nagashima, Atsushi; Ohnishi, Yozo; Sekine, Akihiro; Tanaka, Toshihiro; Tsunoda, Tatsuhiko; Deloukas, Panos; Bird, Christine P; Delgado, Marcos; Dermitzakis, Emmanouil T; Gwilliam, Rhian; Hunt, Sarah; Morrison, Jonathan; Powell, Don; Stranger, Barbara E; Whittaker, Pamela; Bentley, David R; Daly, Mark J; de Bakker, Paul I W; Barrett, Jeff; Chretien, Yves R; Maller, Julian; McCarroll, Steve; Patterson, Nick; Pe'er, Itsik; Price, Alkes; Purcell, Shaun; Richter, Daniel J; Sabeti, Pardis; Saxena, Richa; Schaffner, Stephen F; Sham, Pak C; Varilly, Patrick; Altshuler, David; Stein, Lincoln D; Krishnan, Lalitha; Smith, Albert Vernon; Tello-Ruiz, Marcela K; Thorisson, Gudmundur A; Chakravarti, Aravinda; Chen, Peter E; Cutler, David J; Kashuk, Carl S; Lin, Shin; Abecasis, Gonçalo R; Guan, Weihua; Li, Yun; Munro, Heather M; Qin, Zhaohui Steve; Thomas, Daryl J; McVean, Gilean; Auton, Adam; Bottolo, Leonardo; Cardin, Niall; Eyheramendy, Susana; Freeman, Colin; Marchini, Jonathan; Myers, Simon; Spencer, Chris; Stephens, Matthew; Donnelly, Peter; Cardon, Lon R; Clarke, Geraldine; Evans, David M; Morris, Andrew P; Weir, Bruce S; Tsunoda, Tatsuhiko; Mullikin, James C; Sherry, Stephen T; Feolo, Michael; Skol, Andrew; Zhang, Houcan; Zeng, Changqing; Zhao, Hui; Matsuda, Ichiro; Fukushima, Yoshimitsu; Macer, Darryl R; Suda, Eiko; Rotimi, Charles N; Adebamowo, Clement A; Ajayi, Ike; Aniagwu, Toyin; Marshall, Patricia A; Nkwodimmah, Chibuzor; Royal, Charmaine D M; Leppert, Mark F; Dixon, Missy; Peiffer, Andy; Qiu, Renzong; Kent, Alastair; Kato, Kazuto; Niikawa, Norio; Adewole, Isaac F; Knoppers, Bartha M; Foster, Morris W; Clayton, Ellen Wright; Watkin, Jessica; Gibbs, Richard A; Belmont, John W; Muzny, Donna; Nazareth, Lynne; Sodergren, Erica; Weinstock, George M; Wheeler, David A; Yakub, Imtaz; Gabriel, Stacey B; Onofrio, Robert C; Richter, Daniel J; Ziaugra, Liuda; Birren, Bruce W; Daly, Mark J; Altshuler, David; Wilson, Richard K; Fulton, Lucinda L; Rogers, Jane; Burton, John; Carter, Nigel P; Clee, Christopher M; Griffiths, Mark; Jones, Matthew C; McLay, Kirsten; Plumb, Robert W; Ross, Mark T; Sims, Sarah K; Willey, David L; Chen, Zhu; Han, Hua; Kang, Le; Godbout, Martin; Wallenburg, John C; L'Archevêque, Paul; Bellemare, Guy; Saeki, Koji; Wang, Hongguang; An, Daochang; Fu, Hongbo; Li, Qing; Wang, Zhen; Wang, Renwu; Holden, Arthur L; Brooks, Lisa D; McEwen, Jean E; Guyer, Mark S; Wang, Vivian Ota; Peterson, Jane L; Shi, Michael; Spiegel, Jack; Sung, Lawrence M; Zacharia, Lynn F; Collins, Francis S; Kennedy, Karen; Jamieson, Ruth; Stewart, John
2007-10-18
We describe the Phase II HapMap, which characterizes over 3.1 million human single nucleotide polymorphisms (SNPs) genotyped in 270 individuals from four geographically diverse populations and includes 25-35% of common SNP variation in the populations surveyed. The map is estimated to capture untyped common variation with an average maximum r2 of between 0.9 and 0.96 depending on population. We demonstrate that the current generation of commercial genome-wide genotyping products captures common Phase II SNPs with an average maximum r2 of up to 0.8 in African and up to 0.95 in non-African populations, and that potential gains in power in association studies can be obtained through imputation. These data also reveal novel aspects of the structure of linkage disequilibrium. We show that 10-30% of pairs of individuals within a population share at least one region of extended genetic identity arising from recent ancestry and that up to 1% of all common variants are untaggable, primarily because they lie within recombination hotspots. We show that recombination rates vary systematically around genes and between genes of different function. Finally, we demonstrate increased differentiation at non-synonymous, compared to synonymous, SNPs, resulting from systematic differences in the strength or efficacy of natural selection between populations.
Sun, Yujia; Lan, Xianyong; Lei, Chuzhao; Zhang, Chunlei; Chen, Hong
2015-06-01
The aim of this study was to examine the association of cofilin2 (CFL2) gene polymorphisms with growth traits in Chinese Qinchuan cattle. Three single nucleotide polymorphisms (SNPs) were identified in the bovine CFL2 gene using DNA sequencing and (forced) PCR-RFLP methods. These polymorphisms included a missense mutation (NC_007319.5: g. C 2213 G) in exon 4, one synonymous mutation (NC_007319.5: g. T 1694 A) in exon 4, and a mutation (NC_007319.5: g. G 1500 A) in intron 2, respectively. In addition, we evaluated the haplotype frequency and linkage disequilibrium coefficient of three sequence variants in 488 individuals in QC cattle. All the three SNPs in QC cattle belonged to an intermediate level of genetic diversity (0.25
PAX6 Haplotypes Are Associated with High Myopia in Han Chinese
Jiang, Bo; Yap, Maurice K. H.; Leung, Kim Hung; Ng, Po Wah; Fung, Wai Yan; Lam, Wai Wa; Gu, Yang-shun; Yip, Shea Ping
2011-01-01
Background The paired box 6 (PAX6) gene is considered as a master gene for eye development. Linkage of myopia to the PAX6 region on chromosome 11p13 was shown in several studies, but the results for association between myopia and PAX6 were inconsistent so far. Methodology/Principal Findings We genotyped 16 single nucleotide polymorphisms (SNPs) in the PAX6 gene and its regulatory regions in an initial study for 300 high myopia cases and 300 controls (Group 1), and successfully replicated the positive results with another independent group of 299 high myopia cases and 299 controls (Group 2). Five SNPs were genotyped in the replication study. The spherical equivalent of subjects with high myopia was ≤−8.0 dioptres. The PLINK package was used for genetic data analysis. No association was found between each of the SNPs and high myopia. However, exhaustive sliding-window haplotype analysis highlighted an important role for rs12421026 because haplotypes containing this SNP were found to be associated with high myopia. The most significant results were given by the 4-SNP haplotype window consisting of rs2071754, rs3026393, rs1506 and rs12421026 (P = 3.54×10−10, 4.06×10−11 and 1.56×10−18 for Group 1, Group 2 and Combined Group, respectively) and the 3-SNP haplotype window composed of rs3026393, rs1506 and rs12421026 (P = 5.48×10−10, 7.93×10−12 and 6.28×10−23 for the three respective groups). The results remained significant after correction for multiple comparisons by permutations. The associated haplotyes found in a previous study were also successfully replicated in this study. Conclusions/Significance PAX6 haplotypes are associated with susceptibility to the development of high myopia in Chinese. The PAX6 locus plays a role in high myopia. PMID:21589860
2014-01-01
Background To better understand the genetic determination of udder health, we performed a genome-wide association study (GWAS) on a population of 2354 German Holstein bulls for which daughter yield deviations (DYD) for somatic cell score (SCS) were available. For this study, we used genetic information of 44 576 informative single nucleotide polymorphisms (SNPs) and 11 725 inferred haplotype blocks. Results When accounting for the sub-structure of the analyzed population, 16 SNPs and 10 haplotypes in six genomic regions were significant at the Bonferroni threshold of P ≤ 1.14 × 10-6. The size of the identified regions ranged from 0.05 to 5.62 Mb. Genomic regions on chromosomes 5, 6, 18 and 19 coincided with known QTL affecting SCS, while additional genomic regions were found on chromosomes 13 and X. Of particular interest is the region on chromosome 6 between 85 and 88 Mb, where QTL for mastitis traits and significant SNPs for SCS in different Holstein populations coincide with our results. In all identified regions, except for the region on chromosome X, significant SNPs were present in significant haplotypes. The minor alleles of identified SNPs on chromosomes 18 and 19, and the major alleles of SNPs on chromosomes 6 and X were favorable for a lower SCS. Differences in somatic cell count (SCC) between alternative SNP alleles reached 14 000 cells/mL. Conclusions The results support the polygenic nature of the genetic determination of SCS, confirm the importance of previously reported QTL, and provide evidence for the segregation of additional QTL for SCS in Holstein cattle. The small size of the regions identified here will facilitate the search for causal genetic variations that affect gene functions. PMID:24898131
Kunihisa, Miyuki; Moriya, Shigeki; Abe, Kazuyuki; Okada, Kazuma; Haji, Takashi; Hayashi, Takeshi; Kawahara, Yoshihiro; Itoh, Ryutaro; Itoh, Takeshi; Katayose, Yuichi; Kanamori, Hiroyuki; Matsumoto, Toshimi; Mori, Satomi; Sasaki, Harumi; Matsumoto, Takashi; Nishitani, Chikako; Terakami, Shingo; Yamamoto, Toshiya
2016-01-01
‘Fuji’ is one of the most popular and highly-produced apple cultivars worldwide, and has been frequently used in breeding programs. The development of genotypic markers for the preferable phenotypes of ‘Fuji’ is required. Here, we aimed to define the haplotypes of ‘Fuji’ and find associations between haplotypes and phenotypes of five traits (harvest day, fruit weight, acidity, degree of watercore, and flesh mealiness) by using 115 accessions related to ‘Fuji’. Through the re-sequencing of ‘Fuji’ genome, total of 2,820,759 variants, including single nucleotide polymorphisms (SNPs) and insertions or deletions (indels) were detected between ‘Fuji’ and ‘Golden Delicious’ reference genome. We selected mapping-validated 1,014 SNPs, most of which were heterozygous in ‘Fuji’ and capable of distinguishing alleles inherited from the parents of ‘Fuji’ (i.e., ‘Ralls Janet’ and ‘Delicious’). We used these SNPs to define the haplotypes of ‘Fuji’ and trace their inheritance in relatives, which were shown to have an average of 27% of ‘Fuji’ genome. Analysis of variance (ANOVA) based on ‘Fuji’ haplotypes identified one quantitative trait loci (QTL) each for harvest time, acidity, degree of watercore, and mealiness. A haplotype from ‘Delicious’ chr14 was considered to dominantly cause watercore, and one from ‘Ralls Janet’ chr1 was related to low-mealiness. PMID:27795675
Feigelson, Heather Spencer; Teras, Lauren R; Diver, W Ryan; Tang, Weining; Patel, Alpa V; Stevens, Victoria L; Calle, Eugenia E; Thun, Michael J; Bouzyk, Mark
2008-01-01
Obesity has consistently been associated with postmenopausal breast cancer risk. Proteins that are secreted by adipose tissue or are involved in regulating body mass may play a role in breast tumor development. We conducted a nested case-control study among postmenopausal women from the American Cancer Society Cancer Prevention Study II Nutrition Cohort to determine whether genes associated with obesity increase risk for breast cancer. Tagging single nucleotide polymorphisms (SNPs) were selected to capture common variation across seven candidate genes that encode adipose-related proteins: ADRB2, ADRB3, GHRL, HSD11B1, IRS1, IRS2, and SHC1. Thirty-nine SNPs were genotyped in 648 cases and 659 controls. Logistic regression models were used to examine the association between each tagging SNP and risk for breast cancer while adjusting for matching factors and potential confounders. We also examined whether these SNPs were associated with measures of adult adiposity. Two out of five tagging SNPs in HSD11B1 were associated with breast cancer (rs11807619, P = 0.006; rs932335, P = 0.0001). rs11807619 and rs932335 were highly correlated (r2 = 0.74) and, when modeled as a haplotype, only haplotypes containing the rs932335 C allele were associated with breast cancer. The rs932335 C allele was associated with a nearly twofold increased risk for breast cancer (odds ratio = 1.83, 95% confidence interval = 1.01-3.33 for C/C versus G/G). Three of the 11 SNPs for IRS2 were associated with breast cancer (rs4773082, P = 0.007; rs2289046, P = 0.016; rs754204, P = 0.03). When these three SNPs were examined as a haplotype, only the haplotype that included the G allele of rs2289046 was associated with breast cancer (odds ratio = 0.76, 95% confidence interval = 0.63-0.92 for TGC versus CAT). IRS2 rs2289046, rs754204, and rs12584136 were also associated with adult weight gain but only among cases. None of the other SNPs in any gene investigated were associated with breast cancer or
Feigelson, Heather Spencer; Teras, Lauren R; Diver, W Ryan; Tang, Weining; Patel, Alpa V; Stevens, Victoria L; Calle, Eugenia E; Thun, Michael J; Bouzyk, Mark
2008-01-01
Introduction Obesity has consistently been associated with postmenopausal breast cancer risk. Proteins that are secreted by adipose tissue or are involved in regulating body mass may play a role in breast tumor development. Methods We conducted a nested case-control study among postmenopausal women from the American Cancer Society Cancer Prevention Study II Nutrition Cohort to determine whether genes associated with obesity increase risk for breast cancer. Tagging single nucleotide polymorphisms (SNPs) were selected to capture common variation across seven candidate genes that encode adipose-related proteins: ADRB2, ADRB3, GHRL, HSD11B1, IRS1, IRS2, and SHC1. Thirty-nine SNPs were genotyped in 648 cases and 659 controls. Logistic regression models were used to examine the association between each tagging SNP and risk for breast cancer while adjusting for matching factors and potential confounders. We also examined whether these SNPs were associated with measures of adult adiposity. Results Two out of five tagging SNPs in HSD11B1 were associated with breast cancer (rs11807619, P = 0.006; rs932335, P = 0.0001). rs11807619 and rs932335 were highly correlated (r2 = 0.74) and, when modeled as a haplotype, only haplotypes containing the rs932335 C allele were associated with breast cancer. The rs932335 C allele was associated with a nearly twofold increased risk for breast cancer (odds ratio = 1.83, 95% confidence interval = 1.01–3.33 for C/C versus G/G). Three of the 11 SNPs for IRS2 were associated with breast cancer (rs4773082, P = 0.007; rs2289046, P = 0.016; rs754204, P = 0.03). When these three SNPs were examined as a haplotype, only the haplotype that included the G allele of rs2289046 was associated with breast cancer (odds ratio = 0.76, 95% confidence interval = 0.63–0.92 for TGC versus CAT). IRS2 rs2289046, rs754204, and rs12584136 were also associated with adult weight gain but only among cases. None of the other SNPs in any gene investigated were
Congruence as a measurement of extended haplotype structure across the genome
2012-01-01
Background Historically, extended haplotypes have been defined using only a few data points, such as alleles for several HLA genes in the MHC. High-density SNP data, and the increasing affordability of whole genome SNP typing, creates the opportunity to define higher resolution extended haplotypes. This drives the need for new tools that support quantification and visualization of extended haplotypes as defined by as many as 2000 SNPs. Confronted with high-density SNP data across the major histocompatibility complex (MHC) for 2,300 complete families, compiled by the Type 1 Diabetes Genetics Consortium (T1DGC), we developed software for studying extended haplotypes. Methods The software, called ExHap (Extended Haplotype), uses a similarity measurement we term congruence to identify and quantify long-range allele identity. Using ExHap, we analyzed congruence in both the T1DGC data and family-phased data from the International HapMap Project. Results Congruent chromosomes from the T1DGC data have between 96.5% and 99.9% allele identity over 1,818 SNPs spanning 2.64 megabases of the MHC (HLA-DRB1 to HLA-A). Thirty-three of 132 DQ-DR-B-A defined haplotype groups have > 50% congruent chromosomes in this region. For example, 92% of chromosomes within the DR3-B8-A1 haplotype are congruent from HLA-DRB1 to HLA-A (99.8% allele identity). We also applied ExHap to all 22 autosomes for both CEU and YRI cohorts from the International HapMap Project, identifying multiple candidate extended haplotypes. Conclusions Long-range congruence is not unique to the MHC region. Patterns of allele identity on phased chromosomes provide a simple, straightforward approach to visually and quantitatively inspect complex long-range structural patterns in the genome. Such patterns aid the biologist in appreciating genetic similarities and differences across cohorts, and can lead to hypothesis generation for subsequent studies. PMID:22369243
High-Density SNP Genotyping to Define β-Globin Locus Haplotypes
Liu, Li; Muralidhar, Shalini; Singh, Manisha; Sylvan, Caprice; Kalra, Inderdeep S.; Quinn, Charles T.; Onyekwere, Onyinye C.; Pace, Betty S.
2014-01-01
Five major β-globin locus haplotypes have been established in individuals with sickle cell disease (SCD) from the Benin, Bantu, Senegal, Cameroon, and Arab-Indian populations. Historically, β-haplotypes were established using restriction fragment length polymorphism (RFLP) analysis across the β-locus, which consists of five functional β-like globin genes located on chromosome 11. Previous attempts to correlate these haplotypes as robust predictors of clinical phenotypes observed in SCD have not been successful. We speculate that the coverage and distribution of the RFLP sites located proximal to or within the globin genes are not sufficiently dense to accurately reflect the complexity of this region. To test our hypothesis, we performed RFLP analysis and high-density single nucleotide polymorphism (SNP) genotyping across the β-locus using DNA samples from either healthy African Americans with normal hemoglobin A (HbAA) or individuals with homozygous SS (HbSS) disease. Using the genotyping data from 88 SNPs and Haploview analysis, we generated a greater number of haplotypes than that observed with RFLP analysis alone. Furthermore, a unique pattern of long-range linkage disequilibrium between the locus control region and the β-like globin genes was observed in the HbSS group. Interestingly, we observed multiple SNPs within the HindIII restriction site located in the Gγ-globin intervening sequence II which produced the same RFLP pattern. These findings illustrated the inability of RFLP analysis to decipher the complexity of sequence variations that impacts genomic structure in this region. Our data suggest that high density SNP mapping may be required to accurately define β-haplotypes that correlate with the different clinical phenotypes observed in SCD. PMID:18829352
Zhao, Na; Xiao, Jianqiu; Zheng, Zhiyong; Fei, Guoqiang; Zhang, Feng; Jin, Lirong; Zhong, Chunjiu
2015-04-01
Our previous studies have demonstrated that ceruloplasmin (CP) dysmetabolism is correlated with Parkinson's disease (PD). However, the causes of decreased serum CP levels in PD patients remain to be clarified. This study aimed to explore the potential association between genetic variants of the CP gene and PD. Clinical features, serum CP levels, and the CP gene (both promoter and coding regions) were analyzed in 60 PD patients and 50 controls. A luciferase reporter system was used to investigate the function of promoter single-nucleotide polymorphisms (SNPs). High-density comparative genomic hybridization microarrays were also used to detect large-scale copy-number variations in CP and an additional 47 genes involved in PD and/or copper/iron metabolism. The frequencies of eight SNPs (one intronic SNP and seven promoter SNPs of the CP gene) and their haplotypes were significantly different between PD patients, especially those with lowered serum CP levels, and controls. However, the luciferase reporter system revealed no significant effect of the risk haplotype on promoter activity of the CP gene. Neither these SNPs nor their haplotypes were correlated with the Hoehn and Yahr staging of PD. The results of this study suggest that common genetic variants of CP are associated with PD and further investigation is needed to explore their functions in PD.
Sun, Jiajie; Gao, Yuan; Liu, Dong; Ma, Wei; Xue, Jing; Zhang, Chunlei; Lan, Xianyong; Lei, Chuzhao; Chen, Hong
2012-06-01
The insulin-induced gene 1 (INSIG1) gene encodes a protein that blocks proteolytic activation of sterol regulatory element binding proteins, which are transcription factors that activate genes that regulate cholesterol, fatty acid, and glucose metabolism. However, similar research for the bovine INSIG1 gene is lacking. Therefore, in this study, polymorphisms of the bovine INSIG1 gene were detected in 643 individuals from four cattle breeds by DNA pooling, forced PCR-RFLP, PCR-SSCP, and DNA sequencing methods. Only 10 novel SNPs were identified, which included four mutations in the coding region and the others in the introns. In Nanyang individuals, seven common haplotypes were identified based on four coding region SNPs. The haplotype GACT, with a frequency of 75.4%, was the most prevalent haplotypes and SNPs formed two linkage disequilibrium blocks with strong multi-allelic D' (D' = 1). Additionally, association analysis between mutations of the bovine INSIG1 gene and growth traits in Nanyang cattle at 6, 12, 18, and 24 months old was performed, and the results indicated that the polymorphisms were not significantly associated with body mass.
Haplotypes and Sequence Variation in the Ovine Adiponectin Gene (ADIPOQ)
An, Qing-Ming; Zhou, Hui-Tong; Hu, Jiang; Luo, Yu-Zhu; Hickford, Jon G. H.
2015-01-01
The adiponectin gene (ADIPOQ) plays an important role in energy homeostasis. In this study five separate regions (regions 1 to 5) of ovine ADIPOQ were analysed using PCR-SSCP. Four different PCR-SSCP patterns (A1-D1, A2-D2) were detected in region-1 and region-2, respectively, with seven and six SNPs being revealed. In region-3, three different patterns (A3-C3) and three SNPs were observed. Two patterns (A4-B4, A5-B5) and two and one SNPs were observed in region-4 and region-5, respectively. In total, nineteen SNPs were detected, with five of them in the coding region and two (c.46T/C and c.515G/A) putatively resulting in amino acid changes (p.Tyr16His and p.Lys172Arg). In region-1, -2 and -3 of 316 sheep from eight New Zealand breeds, variants A1, A2 and A3 were the most common, although variant frequencies differed in the eight breeds. Across region-1 and region-3, nine haplotypes were identified and haplotypes A1-A3, A1-C3, B1-A3 and B1-C3 were most common. These results indicate that the ADIPOQ gene is polymorphic and suggest that further analysis is required to see if the variation in the gene is associated with animal production traits. PMID:26610572
Law, Amanda J.; Lipska, Barbara K.; Weickert, Cynthia Shannon; Hyde, Thomas M.; Straub, Richard E.; Hashimoto, Ryota; Harrison, Paul J.; Kleinman, Joel E.; Weinberger, Daniel R.
2006-01-01
Genetic variation in neuregulin 1 (NRG1) is associated with schizophrenia. The disease-associated SNPs are noncoding, and their functional implications remain unknown. We hypothesized that differential expression of the NRG1 gene explains its association to the disease. We examined four of the disease-associated SNPs that make up the original risk haplotype in the 5′ upstream region of the gene for their effects on mRNA abundance of NRG1 types I–IV in human postmortem hippocampus. Diagnostic comparisons revealed a 34% increase in type I mRNA in schizophrenia and an interaction of diagnosis and genotype (SNP8NRG221132) on this transcript. Of potentially greater interest, a single SNP within the risk haplotype (SNP8NRG243177) and a 22-kb block of this core haplotype are associated with mRNA expression for the novel type IV isoform in patients and controls. Bioinformatic promoter analyses indicate that both SNPs lead to a gain/loss of putative binding sites for three transcription factors, serum response factor, myelin transcription factor-1, and High Mobility Group Box Protein-1. These data implicate variation in isoform expression as a molecular mechanism for the genetic association of NRG1 with schizophrenia. PMID:16618933
Cha, Seongwon; Yu, Hyunjoo; Park, Ah Yeon; Song, Kwang Hoon
2014-03-12
Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C-G-A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS.
Qiu, Anqi; Tuan, Ta Anh; Ong, Mei Lyn; Li, Yue; Chen, Helen; Rifkin-Graboi, Anne; Broekman, Birit F P; Kwek, Kenneth; Saw, Seang-Mei; Chong, Yap-Seng; Gluckman, Peter D; Fortier, Marielle V; Holbrook, Joanna Dawn; Meaney, Michael J
2015-02-01
Exposure to antenatal maternal anxiety and complex genetic variations may shape fetal brain development. In particular, the catechol-O-methyltransferase (COMT) gene, located on chromosome 22q11.2, regulates catecholamine signaling in the prefrontal cortex and is implicated in anxiety, pain, and stress responsivity. This study examined whether individual single-nucleotide polymorphisms (SNPs) of the COMT gene and their haplotypes moderate the association between antenatal maternal anxiety and in utero cortical development. A total of 146 neonates were genotyped and underwent MRI shortly after birth. Neonatal cortical morphology was characterized using cortical thickness. Antenatal maternal anxiety was assessed using the State-Trait Anxiety Inventory at week 26 of pregnancy. Individual COMT SNPs (val158met, rs737865, and rs165599) modulated the association between antenatal maternal anxiety and the prefrontal and parietal cortical thickness in neonates. Based on haplotype trend regression analysis, findings also showed that among rs737865-val158met-rs165599 haplotypes, the A-val-G (AGG) haplotype probabilities modulated positive associations of antenatal maternal anxiety with cortical thickness in the right ventrolateral prefrontal cortex and the right superior parietal cortex and precuneus. In contrast, the G-met-A (GAA) haplotype probabilities modulated negative associations of antenatal maternal anxiety with cortical thickness in bilateral precentral gyrus and the dorsolateral prefrontal cortex. These results suggest that the association between maternal anxiety and in utero neurodevelopment is modified through complex genetic variation in COMT. Such genetic moderation may explain, in part, the variation in phenotypic outcomes in offspring associated with maternal emotional well-being.
Retsas, Theodoros; Huse, Klaus; Lazaridis, Lazaros-Dimitrios; Karampela, Niki; Bauer, Michael; Platzer, Matthias; Kolonia, Virginia; Papageorgiou, Eirini; Giamarellos-Bourboulis, Evangelos J; Dimopoulos, George
2018-02-01
Several articles have provided conflicting results regarding the role of single nucleotide polymorphisms (SNPs) in the promoter region of the TNF gene in susceptibility to sepsis. Former articles have been based on previous definitions of sepsis. This study investigated the influence of TNF haplotypes on the development of sepsis using the new Sepsis-3 definitions. DNA was isolated from patients suffering from infection and systemic inflammatory response syndrome. Haplotyping was performed for six SNPs of TNF. The serum levels of tumour necrosis factor alpha (TNF-α) of these patients were measured using an enzyme immunosorbent assay. Patients were classified into infection and sepsis categories using the Sepsis-3 definitions. Associations between the TNF haplotypes and the clinical characteristics and serum TNF-α levels of the patients were examined. The most common TNF haplotype h1 was composed of major alleles of the studied SNPs. Carriage of haplotypes composed of minor frequency alleles was associated with a lower risk of developing sepsis (odds ratio 0.41, 95% confidence interval 0.19-0.88, p=0.022), but this did not affect the 28-day outcome. Serum TNF-α levels were significantly higher among patients homozygous for h1 haplotypes who developed sepsis compared to infection (p=0.032); a similar result was not observed for patients carrying other haplotypes. Haplotypes containing minor frequency SNP alleles of TNF protect against the development of sepsis without affecting the outcome. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
David, Sean P; Mezuk, Briana; Zandi, Peter P; Strong, David; Anthony, James C; Niaura, Raymond; Uhl, George R; Eaton, William W
2010-03-01
The 11q23.1 genomic region has been associated with nicotine dependence in Black and White Americans. By conducting linkage disequilibrium analyses of 7 informative single nucleotide polymorphisms (SNPs) within the tetratricopeptide repeat domain 12 (TTC12)/ankyrin repeat and kinase containing 1 (ANKK1)/dopamine (D2) receptor gene cluster, we identified haplotype block structures in 270 Black and 368 White (n = 638) participants, from the Baltimore Epidemiologic Catchment Area cohort study, spanning the TTC12 and ANKK1 genes consisting of three SNPs (rs2303380-rs4938015-rs11604671). Informative haplotypes were examined for sex-specific associations with daily tobacco smoking initiation and cessation using longitudinal data from 1993-1994 and 2004-2005 interviews. There was a Haplotype x Sex interaction such that Black men possessing the GTG haplotype who were smokers in 1993-2004 were more likely to have stopped smoking by 2004-2005 (55.6% GTG vs. 22.0% other haplotypes), while Black women were less likely to have quit smoking if they possessed the GTG (20.8%) versus other haplotypes (24.0%; p = .028). In Whites, the GTG haplotype (vs. other haplotypes) was associated with lifetime history of daily smoking (smoking initiation; odds ratio = 1.6; 95% CI = 1.1-2.4; p = .013). Moreover, there was a Haplotype x Sex interaction such that there was higher prevalence of smoking initiation with GTG (77.6%) versus other haplotypes (57.0%; p = .043). In 2 different ethnic American populations, we observed man-woman variation in the influence of the rs2303380-rs4938015-rs11604671 GTG haplotype on smoking initiation and cessation. These results should be replicated in larger cohorts to establish the relationship among the rs2303380-rs4938015-rs11604671 haplotype block, sex, and smoking behavior.
Hu, Wei-wei; He, Jin-wei; Zhang, Hao; Wang, Chun; Gu, Jie-mei; Yue, Hua; Ke, Yao-hua; Hu, Yun-qiu; Fu, Wen-zhen; Li, Miao; Liu, Yu-juan; Zhang, Zhen-lin
2011-01-01
Aim: To study whether genetic polymorphisms of COL1A1 and COL1A2 genes affected the onset of fracture in postmenopausal Chinese women. Methods: SNPs in COL1A1 and COL1A2 genes were identified via direct sequencing in 32 unrelated postmenopausal Chinese women. Ten SNPs were genotyped in 1252 postmenopausal Chinese women. The associations were examined using both single-SNP and haplotype tests using logistic regression. Results: Twenty four (4 novel) and 28 (7 novel) SNPs were identified in COL1A1 and COL1A2 gene, respectively. The distribution frequencies of 2 SNPs in COL1A1 (rs2075554 and rs2586494) and 3 SNPs in COL1A2 (rs42517, rs1801182, and rs42524) were significantly different from those documented for the European Caucasian population. No significant difference was observed between fracture and control groups with respect to allele frequency or genotype distribution in 9 selected SNPs and haplotype. No significant association was found between fragility fracture and each SNP or haplotype. The results remained the same after additional corrections for other risk factors such as weight, height, and bone mineral density. Conclusion: Our results show no association between common genetic variations of COL1A1 and COL1A2 genes and fracture, suggesting the complex genetic background of osteoporotic fractures. PMID:21602843
LS-SNP: large-scale annotation of coding non-synonymous SNPs based on multiple information sources.
Karchin, Rachel; Diekhans, Mark; Kelly, Libusha; Thomas, Daryl J; Pieper, Ursula; Eswar, Narayanan; Haussler, David; Sali, Andrej
2005-06-15
The NCBI dbSNP database lists over 9 million single nucleotide polymorphisms (SNPs) in the human genome, but currently contains limited annotation information. SNPs that result in amino acid residue changes (nsSNPs) are of critical importance in variation between individuals, including disease and drug sensitivity. We have developed LS-SNP, a genomic scale software pipeline to annotate nsSNPs. LS-SNP comprehensively maps nsSNPs onto protein sequences, functional pathways and comparative protein structure models, and predicts positions where nsSNPs destabilize proteins, interfere with the formation of domain-domain interfaces, have an effect on protein-ligand binding or severely impact human health. It currently annotates 28,043 validated SNPs that produce amino acid residue substitutions in human proteins from the SwissProt/TrEMBL database. Annotations can be viewed via a web interface either in the context of a genomic region or by selecting sets of SNPs, genes, proteins or pathways. These results are useful for identifying candidate functional SNPs within a gene, haplotype or pathway and in probing molecular mechanisms responsible for functional impacts of nsSNPs. http://www.salilab.org/LS-SNP CONTACT: rachelk@salilab.org http://salilab.org/LS-SNP/supp-info.pdf.
Lah, Ljerka; Trense, Daronja; Benke, Harald; Berggren, Per; Gunnlaugsson, Þorvaldur; Lockyer, Christina; Öztürk, Ayaka; Öztürk, Bayram; Pawliczka, Iwona; Roos, Anna; Siebert, Ursula; Víkingsson, Gísli; Tiedemann, Ralph
2016-01-01
The population structure of the highly mobile marine mammal, the harbor porpoise (Phocoena phocoena), in the Atlantic shelf waters follows a pattern of significant isolation-by-distance. The population structure of harbor porpoises from the Baltic Sea, which is connected with the North Sea through a series of basins separated by shallow underwater ridges, however, is more complex. Here, we investigated the population differentiation of harbor porpoises in European Seas with a special focus on the Baltic Sea and adjacent waters, using a population genomics approach. We used 2872 single nucleotide polymorphisms (SNPs), derived from double digest restriction-site associated DNA sequencing (ddRAD-seq), as well as 13 microsatellite loci and mitochondrial haplotypes for the same set of individuals. Spatial principal components analysis (sPCA), and Bayesian clustering on a subset of SNPs suggest three main groupings at the level of all studied regions: the Black Sea, the North Atlantic, and the Baltic Sea. Furthermore, we observed a distinct separation of the North Sea harbor porpoises from the Baltic Sea populations, and identified splits between porpoise populations within the Baltic Sea. We observed a notable distinction between the Belt Sea and the Inner Baltic Sea sub-regions. Improved delineation of harbor porpoise population assignments for the Baltic based on genomic evidence is important for conservation management of this endangered cetacean in threatened habitats, particularly in the Baltic Sea proper. In addition, we show that SNPs outperform microsatellite markers and demonstrate the utility of RAD-tags from a relatively small, opportunistically sampled cetacean sample set for population diversity and divergence analysis. PMID:27783621
2014-01-01
Background Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. Methods The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). Results The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C–G–A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. Conclusions We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS. PMID:24618354
A comprehensively molecular haplotype-resolved genome of a European individual
Suk, Eun-Kyung; McEwen, Gayle K.; Duitama, Jorge; Nowick, Katja; Schulz, Sabrina; Palczewski, Stefanie; Schreiber, Stefan; Holloway, Dustin T.; McLaughlin, Stephen; Peckham, Heather; Lee, Clarence; Huebsch, Thomas; Hoehe, Margret R.
2011-01-01
Independent determination of both haplotype sequences of an individual genome is essential to relate genetic variation to genome function, phenotype, and disease. To address the importance of phase, we have generated the most complete haplotype-resolved genome to date, “Max Planck One” (MP1), by fosmid pool-based next generation sequencing. Virtually all SNPs (>99%) and 80,000 indels were phased into haploid sequences of up to 6.3 Mb (N50 ∼1 Mb). The completeness of phasing allowed determination of the concrete molecular haplotype pairs for the vast majority of genes (81%) including potential regulatory sequences, of which >90% were found to be constituted by two different molecular forms. A subset of 159 genes with potentially severe mutations in either cis or trans configurations exemplified in particular the role of phase for gene function, disease, and clinical interpretation of personal genomes (e.g., BRCA1). Extended genomic regions harboring manifold combinations of physically and/or functionally related genes and regulatory elements were resolved into their underlying “haploid landscapes,” which may define the functional genome. Moreover, the majority of genes and functional sequences were found to contain individual or rare SNPs, which cannot be phased from population data alone, emphasizing the importance of molecular phasing for characterizing a genome in its molecular individuality. Our work provides the foundation to understand that the distinction of molecular haplotypes is essential to resolve the (inherently individual) biology of genes, genomes, and disease, establishing a reference point for “phase-sensitive” personal genomics. MP1's annotated haploid genomes are available as a public resource. PMID:21813624
Mai, Ingrid; Perloff, Elke S; Bauer, Steffen; Goldammer, Mark; Johne, Andreas; Filler, Guido; Budde, Klemens; Roots, Ivar
2004-11-01
This retrospective study investigated the influence of MDR1 haplotypes derived from the polymorphisms 2677G > T (exon 21) and 3435C > T (exon 26) on the pharmacokinetics of the immunosuppressant drug tacrolimus in 73 renal transplant patients. Based on both variants of SNPs 2677 and 3435, four different haplotypes and eight different genotypes were identified in the study sample. Tacrolimus trough concentrations (C(0)) were compared between different SNP variants and genotypes, as well as between carriers and noncarriers of each haplotype. Additionally, CYP3A5 genotype (6956G > A) was determined. No significant differences were observed between groups. Differences in mean tacrolimus C(0) values between carriers and noncarriers of each haplotype ranged from -0.04 microg/litre (95% confidence interval: -0.53 to 0.60) to -23 microg/litre (-1.07 to 1.53). No association was found between CYP3A5*1/*3 genotype and tacrolimus Co concentractions. MDR1 haplotypes derived from the SNPs 2677G > T (exon 21) and 3435C > T (exon 26) do not influence the pharmacokinetics of tacrolimus in renal transplant patients.
González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B
2006-03-01
Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.
PExFInS: An Integrative Post-GWAS Explorer for Functional Indels and SNPs
Cheng, Zhongshan; Chu, Hin; Fan, Yanhui; Li, Cun; Song, You-Qiang; Zhou, Jie; Yuen, Kwok-Yung
2015-01-01
Expression quantitative trait loci (eQTLs) mapping and linkage disequilibrium (LD) analysis have been widely employed to interpret findings of genome-wide association studies (GWAS). With the availability of deep sequencing data of 423 lymphoblastoid cell lines (LCLs) from six global populations and the microarray expression data, we performed eQTL analysis, identified more than 228 K SNP cis-eQTLs and 21 K indel cis-eQTLs and generated a LCL cis-eQTL database. We demonstrate that the percentages of population-shared and population-specific cis-eQTLs are comparable; while indel cis-eQTLs in the population-specific subsection make more contribution to gene expression variations than those in the population-shared subsection. We found cis-eQTLs, especially the population-shared cis-eQTLs are significantly enriched toward transcription start site. Moreover, the National Human Genome Research Institute cataloged GWAS SNPs are enriched for LCL cis-eQTLs. Specifically, 32.8% GWAS SNPs are LCL cis-eQTLs, among which 12.5% can be tagged by indel cis-eQTLs, suggesting the fundamental contribution of indel cis-eQTLs to GWAS association signals. To search for functional indels and SNPs tagging GWAS SNPs, a pipeline Post-GWAS Explorer for Functional Indels and SNPs (PExFInS) has been developed, integrating LD analysis, functional annotation from public databases, cis-eQTL mapping with our LCL cis-eQTL database and other published cis-eQTL datasets. PMID:26612672
Sanabria-Salas, María Carolina; Hernández-Suárez, Gustavo; Umaña-Pérez, Adriana; Rawlik, Konrad; Tenesa, Albert; Serrano-López, Martha Lucía; Sánchez de Gómez, Myriam; Rojas, Martha Patricia; Bravo, Luis Eduardo; Albis, Rosario; Plata, José Luis; Green, Heather; Borgovan, Theodor; Li, Li; Majumdar, Sumana; Garai, Jone; Lee, Edward; Ashktorab, Hassan; Brim, Hassan; Li, Li; Margolin, David; Fejerman, Laura; Zabaleta, Jovanny
2017-01-01
Single-nucleotide polymorphisms (SNPs) in cytokine genes can affect gene expression and thereby modulate inflammation and carcinogenesis. However, the data on the association between SNPs in the interleukin 1 beta gene (IL1B) and colorectal cancer (CRC) are conflicting. We found an association between a 4-SNP haplotype block of the IL1B (-3737C/-1464G/-511T/-31C) and CRC risk, and this association was exclusively observed in individuals with a higher proportion of African ancestry, such as individuals from the Coastal Colombian region (odds ratio, OR 2.06; 95% CI 1.31–3.25; p < 0.01). Moreover, a significant interaction between this CRC risk haplotype and local African ancestry dosage was identified in locus 2q14 (p = 0.03). We conclude that Colombian individuals with high African ancestry proportions at locus 2q14 harbour more IL1B-CGTC copies and are consequently at an increased risk of CRC. This haplotype has been previously found to increase the IL1B promoter activity and is the most frequent haplotype in African Americans. Despite of limitations in the number of samples and the lack of functional analysis to examine the effect of these haplotypes on CRC cell lines, our results suggest that inflammation and ethnicity play a major role in the modulation of CRC risk. PMID:28157220
CGDSNPdb: a database resource for error-checked and imputed mouse SNPs.
Hutchins, Lucie N; Ding, Yueming; Szatkiewicz, Jin P; Von Smith, Randy; Yang, Hyuna; de Villena, Fernando Pardo-Manuel; Churchill, Gary A; Graber, Joel H
2010-07-06
The Center for Genome Dynamics Single Nucleotide Polymorphism Database (CGDSNPdb) is an open-source value-added database with more than nine million mouse single nucleotide polymorphisms (SNPs), drawn from multiple sources, with genotypes assigned to multiple inbred strains of laboratory mice. All SNPs are checked for accuracy and annotated for properties specific to the SNP as well as those implied by changes to overlapping protein-coding genes. CGDSNPdb serves as the primary interface to two unique data sets, the 'imputed genotype resource' in which a Hidden Markov Model was used to assess local haplotypes and the most probable base assignment at several million genomic loci in tens of strains of mice, and the Affymetrix Mouse Diversity Genotyping Array, a high density microarray with over 600,000 SNPs and over 900,000 invariant genomic probes. CGDSNPdb is accessible online through either a web-based query tool or a MySQL public login. Database URL: http://cgd.jax.org/cgdsnpdb/
Zhang, Z; Guillaume, F; Sartelet, A; Charlier, C; Georges, M; Farnir, F; Druet, T
2012-10-01
In many situations, genome-wide association studies are performed in populations presenting stratification. Mixed models including a kinship matrix accounting for genetic relatedness among individuals have been shown to correct for population and/or family structure. Here we extend this methodology to generalized linear mixed models which properly model data under various distributions. In addition we perform association with ancestral haplotypes inferred using a hidden Markov model. The method was shown to properly account for stratification under various simulated scenari presenting population and/or family structure. Use of ancestral haplotypes resulted in higher power than SNPs on simulated datasets. Application to real data demonstrates the usefulness of the developed model. Full analysis of a dataset with 4600 individuals and 500 000 SNPs was performed in 2 h 36 min and required 2.28 Gb of RAM. The software GLASCOW can be freely downloaded from www.giga.ulg.ac.be/jcms/prod_381171/software. francois.guillaume@jouy.inra.fr Supplementary data are available at Bioinformatics online.
Hu, Shanyao; Lin, Bin; Yan, Dechao; Xu, Zaiyan; Zhang, Zijun; Mao, Yuanliang; Mao, Huimin; Wang, Litong; Wang, Guoshui; Xiong, Yuanzhu; Zuo, Bo
2015-01-01
Peroxisome proliferator-activated receptor delta (PPARD) is a key regulator of lipid metabolism, insulin sensitivity, cell proliferation and differentiation. In this study, we identified two Single Nucleotide Polymorphisms (SNPs, g.1015 A>G and g.1018 T>C) constituting four haplotypes (GT, GC, AC and AT) in the 5’ regulatory region of porcine PPARD gene. Functional analysis of the four haplotypes showed that the transcriptional activity of the PPARD promoter fragment carrying haplotype AC was significantly lower than that of the other haplotypes in 3T3-L1, C2C12 and PK-15 cells, and haplotype AC had the lowest binding capacities to the nuclear extracts. Transcription factor 7-like 2 (TCF7L2) enhanced the transcription activities of promoter fragments of PPARD gene carrying haplotypes GT, GC and AT in C2C12 and 3T3-L1 cells, and increased the protein expression of PPARD gene in C2C12 myoblasts. TCF7L2 differentially bound to the four haplotypes, and the binding capacity of TCF7L2 to haplotype AC was the lowest. There were significant associations between -655A/G and fat deposition traits in three pig populations including the Large White × Meishan F2 pigs, France and American Large White pigs. Pigs with genotype GG had significantly higher expression of PPARD at both mRNA and protein level than those with genotype AG. These results strongly suggested that the SNPs in 5’ regulatory region of PPARD genes had significant impact on pig fat deposition traits. PMID:26599230
Baessler, Andrea; Fischer, Marcus; Mayer, Bjoern; Koehler, Martina; Wiedmann, Silke; Stark, Klaus; Doering, Angela; Erdmann, Jeanette; Riegger, Guenter; Schunkert, Heribert; Kwitek, Anne E; Hengstenberg, Christian
2007-04-15
Data from both experimental models and humans provide evidence that ghrelin and its receptor, the growth hormone secretagogue receptor (ghrelin receptor, GHSR), possess a variety of cardiovascular effects. Thus, we hypothesized that genetic variants within the ghrelin system (ligand ghrelin and its receptor GHSR) are associated with susceptibility to myocardial infarction (MI) and coronary artery disease (CAD). Seven single nucleotide polymorphisms (SNPs) covering the GHSR region as well as eight SNPs across the ghrelin gene (GHRL) region were genotyped in index MI patients (864 Caucasians, 'index MI cases') from the German MI family study and in matched controls without evidence of CAD (864 Caucasians, 'controls', MONICA Augsburg). In addition, siblings of these MI patients with documented severe CAD (826 'affected sibs') were matched likewise with controls (n = 826 Caucasian 'controls') and used for verification. The effect of interactions between genetic variants of both genes of the ghrelin system was explored by conditional classification tree models. We found association of several GHSR SNPs with MI [best SNP odds ratio (OR) 1.7 (1.2-2.5); P = 0.002] using a recessive model. Moreover, we identified a common GHSR haplotype which significantly increases the risk for MI [multivariate adjusted OR for homozygous carriers 1.6 (1.1-2.5) and CAD OR 1.6 (1.1-2.5)]. In contrast, no relationship between genetic variants and the disease could be revealed for GHRL. However, the increase in MI/CAD frequency related to the susceptible GHSR haplotype was abolished when it coincided with a common GHRL haplotype. Multivariate adjustments as well as permutation-based methods conveyed the same results. These data are the first to demonstrate an association of SNPs and haplotypes within important genes of the ghrelin system and the susceptibility to MI, whereas association with MI/CAD could be identified for genetic variants across GHSR, no relationship could be revealed for GHRL
Geographic differences in allele frequencies of susceptibility SNPs for cardiovascular disease
2011-01-01
Background We hypothesized that the frequencies of risk alleles of SNPs mediating susceptibility to cardiovascular diseases differ among populations of varying geographic origin and that population-specific selection has operated on some of these variants. Methods From the database of genome-wide association studies (GWAS), we selected 36 cardiovascular phenotypes including coronary heart disease, hypertension, and stroke, as well as related quantitative traits (eg, body mass index and plasma lipid levels). We identified 292 SNPs in 270 genes associated with a disease or trait at P < 5 × 10-8. As part of the Human Genome-Diversity Project (HGDP), 158 (54.1%) of these SNPs have been genotyped in 938 individuals belonging to 52 populations from seven geographic areas. A measure of population differentiation, FST, was calculated to quantify differences in risk allele frequencies (RAFs) among populations and geographic areas. Results Large differences in RAFs were noted in populations of Africa, East Asia, America and Oceania, when compared with other geographic regions. The mean global FST (0.1042) for 158 SNPs among the populations was not significantly higher than the mean global FST of 158 autosomal SNPs randomly sampled from the HGDP database. Significantly higher global FST (P < 0.05) was noted in eight SNPs, based on an empirical distribution of global FST of 2036 putatively neutral SNPs. For four of these SNPs, additional evidence of selection was noted based on the integrated Haplotype Score. Conclusion Large differences in RAFs for a set of common SNPs that influence risk of cardiovascular disease were noted between the major world populations. Pairwise comparisons revealed RAF differences for at least eight SNPs that might be due to population-specific selection or demographic factors. These findings are relevant to a better understanding of geographic variation in the prevalence of cardiovascular disease. PMID:21507254
Zhu, Xiaofeng; Yan, Denise; Cooper, Richard S.; Luke, Amy; Ikeda, Morna A.; Chang, Yen-Pei C.; Weder, Alan; Chakravarti, Aravinda
2003-01-01
Association studies of candidate genes with complex traits have generally used one or a few single nucleotide polymorphisms (SNPs), although variation in the extent of linkage disequilibrium (LD) within genes markedly influences the sensitivity and precision of association studies. The extent of LD and the underlying haplotype structure for most candidate genes are still unavailable. We sampled 193 blacks (African-Americans) and 160 whites (European-Americans) and estimated the intragenic LD and the haplotype structure in four genes of the renin–angiotensin system. We genotyped 25 SNPs, with all but one of the pairs spaced between 1 and 20 kb, thus providing resolution at small scale. The pattern of LD within a gene was very heterogeneous. Using a robust method to define haplotype blocks, blocks of limited haplotype diversity were identified at each locus; between these blocks, LD was lost owing to the history of recombination events. As anticipated, there was less LD among blacks, the number of haplotypes was substantially larger, and shorter haplotype segments were found, compared with whites. These findings have implications for candidate-gene association studies and indicate that variation between populations of European and African origin in haplotype diversity is characteristic of most genes. [The sequence data described in this paper are available in GenBank under the following accession nos: AGT, MIM 106150; Renin, MIM 179820; ACE, MIM 106180; Angiotensin receptor I, MIM 106165. Supplementary material is available online at http://www.genome.org.] PMID:12566395
Barbero, Marina M. D.; Oliveira, Henrique N.; de Camargo, Gregório M. F.; Fernandes Júnior, Gerardo A.; Aspilcueta-Borquis, Rusbel R.; Souza, Fabio R. P.; Boligon, Arione A.; Melo, Thaise P.; Regatieri, Inaê C.; Feitosa, Fabieli L. B.; Fonseca, Larissa F. S.; Magalhães, Ana F. B.; Costa, Raphael B.; Albuquerque, Lucia G.
2018-01-01
Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs. PMID:29293544
Takada, Luciana; Barbero, Marina M D; Oliveira, Henrique N; de Camargo, Gregório M F; Fernandes Júnior, Gerardo A; Aspilcueta-Borquis, Rusbel R; Souza, Fabio R P; Boligon, Arione A; Melo, Thaise P; Regatieri, Inaê C; Feitosa, Fabieli L B; Fonseca, Larissa F S; Magalhães, Ana F B; Costa, Raphael B; Albuquerque, Lucia G
2018-01-01
Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs.
Jones, Nathan R; Spratt, Thomas E; Berg, Arthur S; Muscat, Joshua E; Lazarus, Philip; Gallagher, Carla J
2011-04-01
The formation of bulky DNA adducts caused by diol epoxide derivatives of polycyclic aromatic hydrocarbons has been associated with tobacco-induced cancers, and inefficient repair of such adducts by the nucleotide excision repair (NER) system has been linked to increased risk of tobacco-induced lung and head and neck (H&N) cancers. The human excision repair cross-complementation group 1 (ERCC1) protein is essential for a functional NER system and genetic variation in ERCC1 may contribute to impaired DNA repair capacity and increased lung and H&N cancer risk. In order to comprehensively capture common genetic variation in the ERCC1 gene, Caucasian data from the International HapMap project was used to assess linkage disequilibrium and choose four tagSNPs (rs1319052, rs3212955, rs3212948, and rs735482) in the ERCC1 gene to genotype 452 lung cancer cases, 175 H&N cancer cases, and 790 healthy controls. Haplotypes were estimated using expectation maximization (EM) algorithm, and haplotype association with cancer was investigated using Haplo.stats software adjusting for known covariates. The genotype and haplotype frequencies matched previous estimates from Caucasians. There was no significant difference in the prevalence of rs1319052, rs3212955, rs3212948, and rs735482 when comparing lung or H&N cancer cases with controls (p-values>0.05). Similarly, there was no association between ERCC1 haplotypes and lung or H&N cancer susceptibility in this Caucasian population (p-values>0.05). No associations were found when stratifying lung cancer cases by histology, sex, smoking status, or smoking intensity. This study suggests that ERCC1 polymorphisms and haplotypes do not play a role in lung and H&N cancer susceptibility in Caucasians. Copyright © 2010 Elsevier Ltd. All rights reserved.
The autoimmune regulator gene (AIRE) is strongly associated with vitiligo.
Tazi-Ahnini, R; McDonagh, A J G; Wengraf, D A; Lovewell, T R J; Vasilopoulos, Y; Messenger, A G; Cork, M J; Gawkrodger, D J
2008-09-01
Vitiligo is an autoimmune disorder that occurs with greatly increased frequency in the rare recessive autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy syndrome (APECED) caused by mutations of the autoimmune regulator (AIRE) gene on chromosome 21q22.3. We have previously detected an association between alopecia areata and single nucleotide polymorphisms (SNPs) in the AIRE gene. To report the findings of an extended study including haplotype analysis on six AIRE polymorphisms (AIRE C-103T, C4144G, T5238C, G6528A, T7215C and T11787C) in vitiligo, another APECED-associated disease. A case-control analysis was performed. Results showed a strong association between AIRE 7215C and vitiligo [P = 1.36 x 10(-5), odds ratio (OR) 3.12, 95% confidence interval (CI) 1.87-5.46]. We found no significant association with the other polymorphisms individually. However, haplotype analysis revealed that the AIRE haplotype CCTGCC showed a highly significant association with vitiligo (P = 4.14 x 10(-4), OR 3.00, 95% CI 1.70-5.28). To select the most informative minimal haplotypes, we tagged the polymorphisms using SNP tag software. Using AIRE C-103T, G6528A, T7215C and T11787C as tag SNPs, the haplotype AIRE CGCC was associated with vitiligo (P = 0.003, OR 2.49, 95% CI 1.45-4.26). The link between vitiligo and AIRE raises the possibility that defective skin peripheral antigen selection in the thymus is involved in the changes that result in melanocyte destruction in this disorder.
Ruiz-Narváez, Edward A; Yang, Yadong; Nakanishi, Yukiko; Kirchdorfer, Jill; Campos, Hannia
2005-12-01
Genetic variation in the APOC3 and APOA5 genes has been associated with plasma triglyceride concentrations and may affect the risk of myocardial infarction (MI). To assess whether APOC3/A5 haplotypes are associated with risk of MI, we examined three single-nucleotide polymorphisms (SNPs) in APOC3 (3238C>G, -455T>C, and -482C>T) and six SNPs in the APOA5 gene (-1131T>C, c.-3A>G, c.56C>G, IVS3+476G>A, c.553G>T, and c.1259T>C) in incident cases (n = 1,703) of a first nonfatal MI matched for gender, age, and area of residence with population-based controls (n = 1,703). Conditional logistic regression models, adjusted for potential environmental confounders, were used for analysis. The common APOC3*222 haplotype was more frequent in cases than in controls (17.4% and 13.7%, respectively, P < 0.001) and was associated with increased risk of MI [odds ratio (OR) = 1.27; 95% confidence interval (95% CI), 1.09, 1.48] compared with APOC3*111 wild-type haplotype. This association was independent of the APOA5 SNPs. Although the APOC3 3238G, APOA5 -1131C, APOA5 c.-3G, and APOA5 c.1259C alleles were associated with higher triglyceride plasma concentrations, these effects could not explain the associations with MI in this population. In summary, this study supports the hypothesis that haplotypes in the APOC3 gene but not in the APOA5 gene increase susceptibility to MI.
Qi, Jie; Liu, Xudong; Liu, Jinxiang; Yu, Haiyang; Wang, Wenji; Wang, Zhigang; Zhang, Quanqi
2014-08-01
Ambient temperature is one of the major abiotic environmental factors determining the main parameters of fish vital activity. HSP70 plays an essential role in heat response. In this investigation, the promoter and structure of Paralichthys olivaceus hsp70 (Pohsp70) gene was cloned and predicted. 2558 bp upstream regulatory region of Pohsp70 was annotated with four potential promoter elements and four putative binding sites of transcription factors heat shock elements (HSE, nGAAn) in the upstream of the transcription start site. In addition, one intron with 454 bp in the 5'-noncoding region was found. Quantitative Real Time PCR analysis indicated that the transcript level of Pohsp70 was raised markedly after 1 h by heat shocked. Furthermore, 25 SNPs were identified in Pohsp70 by resequencing, seven of which was associated with heat resistance. In addition, two of the seven SNPs, namely SNP14 and SNP16, were observed in strong linkage disequilibrium. The haplotype with association analysis showed TAGGAG haplotype was more represented in heat susceptible group while (DEL/T) GAATA haplotype was more frequent in heat resistant group. The heat resistant SNPs and haplotype could be candidate markers potentially serving for selective breeding programs of Japanese flounder aimed at improving anti-stress and production. Copyright © 2014 Elsevier Ltd. All rights reserved.
Huang, Yong-Zhen; Zhan, Zhao-Yang; Sun, Yu-Jia; Wang, Jing; Li, Ming-Xun; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong
2013-06-01
Muscle growth is a complex phenomenon regulated by many factors, whereby net growth results from the combined action of synthesis and turnover. Insulin-like growth factor 2 (IGF2) is a fetal growth and differentiation factor that plays an important role in muscle growth and in myoblast proliferation and differentiation; Zinc finger, BED-type containing 6 (ZBED6) is a novel transcription factor that was identified and shown to act as a repressor of IGF2 transcription in skeletal muscle. In this study, a total of seven single nucleotide polymorphisms (SNPs) were identified, four SNPs in intron 8 of IGF2 and one promoter SNP and two missense mutations in the coding region of ZBED6, two of which were in complete linkage disequilibrium (LD) in the bovine IGF2. The 58 haplotypes were inferred in 1522 individuals representing four purebred cattle breeds from China. The seven SNPs, 79 and 66 combined diplotypes were revealed for association with body mass in Nanyang and Jiaxian cattle populations at five different ages (P < 0.05 or 0.01). The mutant-type variants and haplotype 58 (likely in LD with the beneficial quantitative trait nucleotide allele) was superior for body mass; the heterozygote diplotype of the most common haplotypes 58 was associated with higher body mass compared to either heterozygote or homozygote. The statistical analyses indicated that the mutant-type variants and haplotypes are significantly associated with body mass in study cattle populations at different ages. These data demonstrate that variants and haplotypes are associated with growth traits, and these results may provide important biological insights into the phenotypic differentiation that is associated with adaptation and specialization of cattle breeds.
A Genome-Wide Scan for Breast Cancer Risk Haplotypes among African American Women
Song, Chi; Chen, Gary K.; Millikan, Robert C.; Ambrosone, Christine B.; John, Esther M.; Bernstein, Leslie; Zheng, Wei; Hu, Jennifer J.; Ziegler, Regina G.; Nyante, Sarah; Bandera, Elisa V.; Ingles, Sue A.; Press, Michael F.; Deming, Sandra L.; Rodriguez-Gil, Jorge L.; Chanock, Stephen J.; Wan, Peggy; Sheng, Xin; Pooler, Loreall C.; Van Den Berg, David J.; Le Marchand, Loic; Kolonel, Laurence N.; Henderson, Brian E.; Haiman, Chris A.; Stram, Daniel O.
2013-01-01
Genome-wide association studies (GWAS) simultaneously investigating hundreds of thousands of single nucleotide polymorphisms (SNP) have become a powerful tool in the investigation of new disease susceptibility loci. Haplotypes are sometimes thought to be superior to SNPs and are promising in genetic association analyses. The application of genome-wide haplotype analysis, however, is hindered by the complexity of haplotypes themselves and sophistication in computation. We systematically analyzed the haplotype effects for breast cancer risk among 5,761 African American women (3,016 cases and 2,745 controls) using a sliding window approach on the genome-wide scale. Three regions on chromosomes 1, 4 and 18 exhibited moderate haplotype effects. Furthermore, among 21 breast cancer susceptibility loci previously established in European populations, 10p15 and 14q24 are likely to harbor novel haplotype effects. We also proposed a heuristic of determining the significance level and the effective number of independent tests by the permutation analysis on chromosome 22 data. It suggests that the effective number was approximately half of the total (7,794 out of 15,645), thus the half number could serve as a quick reference to evaluating genome-wide significance if a similar sliding window approach of haplotype analysis is adopted in similar populations using similar genotype density. PMID:23468962
The α‐synuclein gene in multiple system atrophy
Ozawa, T; Healy, D G; Abou‐Sleiman, P M; Ahmadi, K R; Quinn, N; Lees, A J; Shaw, K; Wullner, U; Berciano, J; Moller, J C; Kamm, C; Burk, K; Josephs, K A; Barone, P; Tolosa, E; Goldstein, D B; Wenning, G; Geser, F; Holton, J L; Gasser, T; Revesz, T; Wood, N W
2006-01-01
Background The formation of α‐synuclein aggregates may be a critical event in the pathogenesis of multiple system atrophy (MSA). However, the role of this gene in the aetiology of MSA is unknown and untested. Method The linkage disequilibrium (LD) structure of the α‐synuclein gene was established and LD patterns were used to identify a set of tagging single nucleotide polymorphisms (SNPs) that represent 95% of the haplotype diversity across the entire gene. The effect of polymorphisms on the pathological expression of MSA in pathologically confirmed cases was also evaluated. Results and conclusion In 253 Gilman probable or definite MSA patients, 457 possible, probable, and definite MSA cases and 1472 controls, a frequency difference for the individual tagging SNPs or tag‐defined haplotypes was not detected. No effect was observed of polymorphisms on the pathological expression of MSA in pathologically confirmed cases. PMID:16543523
Identification and genetic effect of haplotype in the bovine BMP7 gene.
Huang, Yong-Zhen; Wang, Xin-Lei; He, Hua; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong
2013-12-15
Bone morphogenetic proteins (BMPs) are peptide growth factors belonging to the transforming growth factor-beta (TGF-β) superfamily, and some members of the BMP family support white adipocyte differentiation. In this study, we focused on the BMP7 which singularly promotes the differentiation of brown preadipocytes. Haplotypes involving 5 single nucleotide polymorphism (SNP) sites in the bovine BMP7 gene were identified and their effect on body weight was analyzed. 16 haplotypes and 18 combined haplotypes were revealed and the linkage disequilibrium was assessed in the cattle population with 602 individuals representing three main cattle breeds from China. The results showed that haplotypes 3, 10 and 14 were predominant and accounted for 75.64%, 69.85%, and 83.36% in Nanyang, Qinchuan and Jiaxian cattle breeds, respectively. The statistical analyses indicated that the SNP 1, 4, and 5 are associated with the body weight, body length, and heart girth at 12 and 24 months in Nanyang cattle population (P<0.05), whereas there is no significant association between their 16 haplotypes and 18 combined haplotypes. Our results provide evidence that some SNPs and haplotypes in BMP7 are associated with growth traits, and may be utilized as a genetic marker in marker-assisted selection for beef cattle breeding programs. Copyright © 2013. Published by Elsevier B.V.
Haplotypes and effects on growth traits of bovine Wnt7a gene in Chinese Qinchuan cattle.
Xue, Jing; Sun, Yujia; Guo, Wenjiao; Yang, Ziqi; Tian, Huibin; Zhang, Chunlei; Lei, Chuzhao; Lan, Xianyong; Chen, Hong
2013-07-25
Wnt7a is a member of the WNT gene family, which encodes secreted signaling proteins and responds to many biological processes. Specifically Wnt7a influences satellite stem cells and regulates the regenerative potential of the muscle. However, similar researches about the bovine Wnt7a gene are lacking. Therefore, in this study, polymorphisms of the bovine Wnt7a gene were detected in 488 individuals from Chinese Qinchuan cattle by DNA pooling, forced PCR-RFLP, and DNA sequencing methods. 3 novel SNPs were identified, two SNPs (g.T4926C and g.A21943G) were in the intron and the last one (g.C63777T) was in the exon. Five haplotypes involved in these three variant sites in the Wnt7a gene were identified and their effects on growth traits were analyzed. The results revealed that haplotype 1 had the highest haplotype frequencies and was highly significantly associated with body height (P<0.01), body weight (P<0.05), chest width (P<0.05) and height at hip cross (P<0.01) respectively. Copyright © 2013 Elsevier B.V. All rights reserved.
The versican gene and the risk of intracranial aneurysms.
Ruigrok, Ynte M; Rinkel, Gabriël J E; Wijmenga, Cisca
2006-09-01
The proteoglycan versican is an excellent candidate gene for intracranial aneurysms (IAs) because it plays an important role in extracellular matrix assembly and is localized in a previously implicated locus for IAs on chromosome 5q. We analyzed all the common variations using 16-tag single nucleotide polymorphisms (SNPs) and haplotypes in the versican gene using a 2-stage genotyping approach. For stage 1, 16 SNPs were genotyped in 307 cases and 639 controls. For stage 2, the two SNPs yielding the most significant associations (P<0.01) were genotyped in a second independent cohort of 310 cases for confirmation of the associations. In stage 1, we found several SNPs in strong linkage disequilibrium and haplotypes constituting these SNPs associated with IAs in the Dutch population (strongest SNP association for rs173686 with odds ratio=1.34, 95% CI=1.09 to 1.65, P=0.004). In stage 2, we confirmed association for the 2 SNPs with the most significant associations (strongest SNP association for rs173686 with odds ratio=1.36, 95% CI=1.11 to 1.67, P=0.003). SNPs in strong linkage disequilibrium and haplotypes constituting these SNPs in the versican gene are associated with IAs suggesting that variation in or near the versican gene plays a role in susceptibility to IAs.
Hao, Chenyang; Wang, Yuquan; Chao, Shiaoman; Li, Tian; Liu, Hongxia; Wang, Lanfen; Zhang, Xueyong
2017-01-30
A Chinese wheat mini core collection was genotyped using the wheat 9 K iSelect SNP array. Total 2420 and 2396 polymorphic SNPs were detected on the A and the B genome chromosomes, which formed 878 haplotype blocks. There were more blocks in the B genome, but the average block size was significantly (P < 0.05) smaller than those in the A genome. Intense selection (domestication and breeding) had a stronger effect on the A than on the B genome chromosomes. Based on the genetic pedigrees, many blocks can be traced back to a well-known Strampelli cross, which was made one century ago. Furthermore, polyploidization of wheat (both tetraploidization and hexaploidization) induced revolutionary changes in both the A and the B genomes, with a greater increase of gene diversity compared to their diploid ancestors. Modern breeding has dramatically increased diversity in the gene coding regions, though obvious blocks were formed on most of the chromosomes in both tetraploid and hexaploid wheats. Tag-SNP markers identified in this study can be used for marker assisted selection using haplotype blocks as a wheat breeding strategy. This strategy can also be employed to facilitate genome selection in other self-pollinating crop species.
Liu, Jiewei; Li, Ming; Su, Bing
2016-12-01
Genome-wide association studies (GWASs) have identified multiple schizophrenia (SCZ) risk variants for samples of European and East Asian descent, but most of the identified susceptibility variants are population-specific to either Europeans or East Asians. This strong genetic heterogeneity suggests that differential population histories may play a role in SCZ susceptibility. Here, we explored this possibility by examining the allele frequency divergence of 136 previously reported genome-wide SCZ risk SNPs between European and East Asian populations. Our results showed that two SNPs (rs11038167 and rs11038172) at TSPAN18, reported as genome-wide significant SCZ risk variants in Han Chinese, were entirely monomorphic in Europeans, indicating a deep between-population divergence at this gene locus. To explore the evolutionary history of TSPAN18 in East Asians, we conducted population genetic analyses including multiple neutrality tests, the haplotype-based iHS and EHH tests, as well as haplotype bifurcation map and network constructions. We found that the protective allele of rs11038172 (G allele) had a long extended haplotype with much slower decay compared to the A allele. The star-like shape of the G-allele-carrying haplotypes indicates a recent enrichment in East Asians. Together, the evidences suggest that the protective allele of rs11038172 has experienced recent Darwinian positive selection in East Asians. These findings provide new insights that may help explain the strong genetic heterogeneity in SCZ risk and previous inconsistent association results for SCZ among both Europeans and East Asians. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Ban, Yoshiyuki; Tozaki, Teruaki; Taniyama, Matsuo; Skrabanek, Luce; Nakano, Yasuko; Ban, Yoshio; Hirano, Tsutomu
2012-01-01
Background The etiology of the autoimmune thyroid diseases (AITDs), Graves' disease (GD) and Hashimoto's thyroiditis (HT), is largely unknown. However, genetic susceptibility is believed to play a major role. Two whole genome scans from Japan and from the US identified a locus on chromosome 8q24 that showed evidence for linkage with AITD and HT. Recent studies have demonstrated an association between thyroglobulin (Tg) polymorphisms and AITD in Caucasians, suggesting that Tg is a susceptibility gene on 8q24. Objectives The objective of the study was to refine Tg association with AITD, by analyzing a panel of 25 SNPs across an extended 260 kb region of the Tg. Methods We studied 458 Japanese AITD patients (287 GD and 171 HT patients) and 221 matched Japanese control subjects in association studies. Case-control association studies were performed using 25 Tg single nucleotide polymorphisms (SNPs) chosen from a database of the Single Nucleotide Polymorphism Database (dbSNP). Haplotype analysis was undertaken using the computer program SNPAlyze version 7.0. Principal Findings and Conclusions In total, 5 SNPs revealed association with GD (P<0.05), with the strongest SNP associations at rs2256366 (P = 0.002) and rs2687836 (P = 0.0077), both located in intron 41 of the Tg gene. Because of the strong LD between these two strongest associated variants, we performed the haplotype analysis, and identified a major protective haplotype for GD (P = 0.001).These results suggested that the Tg gene is involved in susceptibility for GD and AITD in the Japanese. PMID:22662162
Ramanathan, Gnanasambandan; Ghosh, Santu; Elumalai, Ramprasad; Periyasamy, Soundararajan; Lakkakula, Bhaskar V K S
2016-06-01
Autosomal dominant polycystic kidney disease (ADPKD) is an inherited systemic disorder, characterized by the fluid filled cysts in the kidneys leading to end stage renal failure in later years of life. Hypertension is one of the major factors independently contributing to the chronic kidney disease (CKD) progression. The renin-angiotensin aldosterone system (RAAS) genes have been extensively studied as hypertension candidate genes. The aim of the present study was to investigate the role of angiotensin converting enzyme tagging - single nucleotide polymorphisms (ACE tag-SNPs) in progression of CKD in patients with ADPKD. m0 ethods: In the present study six ACE tagSNPs (angiotensin converting enzyme tag single nucleotide polymorphisms) and insertion/deletion (I/D) in 102 ADPKD patients and 106 control subjects were investigated. The tagSNPs were genotyped using FRET-based KASPar method and ACE ID by polymerase chain reaction (PCR) and electrophoresis. Genotypes and haplotypes were compared between ADPKD patients and controls. Univariate and multivariate logistic regression analyses were performed to assess the effect of genotypes and hypertension on CKD advancement. Mantel-Haenszel (M-H) stratified analysis was performed to study the relationship between different CKD stages and hypertension and their interaction. All loci were polymorphic and except rs4293 SNP the remaining loci followed Hardy-Weinberg equilibrium. Distribution of ACE genotypes and haplotypes in controls and ADPKD patients was not significant. A significant linkage disequilibrium (LD) was observed between SNPs forming two LD blocks. The univariate analysis revealed that the age, hypertension, family history of diabetes and ACE rs4362 contributed to the advancement of CKD. The results suggest that the ACE genotypes are effect modifiers of the relationship between hypertension and CKD advancement among the ADPKD patients.
Wone, Bernard W M; Yim, Won C; Schutz, Heidi; Meek, Thomas H; Garland, Theodore
2018-04-04
Mitochondrial haplotypes have been associated with human and rodent phenotypes, including nonshivering thermogenesis capacity, learning capability, and disease risk. Although the mammalian mitochondrial D-loop is highly polymorphic, D-loops in laboratory mice are identical, and variation occurs elsewhere mainly between nucleotides 9820 and 9830. Part of this region codes for the tRNA Arg gene and is associated with mitochondrial densities and number of mtDNA copies. We hypothesized that the capacity for high levels of voluntary wheel-running behavior would be associated with mitochondrial haplotype. Here, we analyzed the mtDNA polymorphic region in mice from each of four replicate lines selectively bred for 54 generations for high voluntary wheel running (HR) and from four control lines (Control) randomly bred for 54 generations. Sequencing the polymorphic region revealed a variable number of adenine repeats. Single nucleotide polymorphisms (SNPs) varied from 2 to 3 adenine insertions, resulting in three haplotypes. We found significant genetic differentiations between the HR and Control groups (F st = 0.779, p ≤ 0.0001), as well as among the replicate lines of mice within groups (F sc = 0.757, p ≤ 0.0001). Haplotypes, however, were not strongly associated with voluntary wheel running (revolutions run per day), nor with either body mass or litter size. This system provides a useful experimental model to dissect the physiological processes linking mitochondrial, genomic SNPs, epigenetics, or nuclear-mitochondrial cross-talk to exercise activity. Copyright © 2018. Published by Elsevier B.V.
Wu, Dong-Feng; Yin, Rui-Xing; Cao, Xiao-Li; Huang, Feng; Wu, Jin-Zhen; Chen, Wu-Xian
2016-04-08
This study aimed to detect the association of the MADD-FOLH1 single nucleotide polymorphisms (SNPs) and their haplotypes with the risk of coronary heart disease (CHD) and ischemic stroke (IS) in a Chinese Han population. Six SNPs of rs7395662, rs326214, rs326217, rs1051006, rs3736101, and rs7120118 were genotyped in 584 CHD and 555 IS patients, and 596 healthy controls. The genotypic and allelic frequencies of the rs7395662 SNP were different between controls and patients, and the genotypes of the rs7395662 SNP were associated with the risk of CHD and IS in different genetic models. Six main haplotypes among the rs1051006, rs326214, rs326217, rs3736101, and rs7120118 SNPs were detected in our study population, the haplotypes of G-G-T-G-C and G-A-T-G-T were associated with an increased risk of CHD and IS, respectively. The subjects with rs7395662GG genotype in controls had higher triglyceride (TG) and lower high-density lipoprotein cholesterol (HDL-C) levels than the subjects with AA/AG genotypes. Several SNPs interacted with alcohol consumption to influence serum TG (rs326214, rs326217, and rs7120118) and HDL-C (rs7395662) levels. The SNP of rs3736101 interacted with cigarette smoking to modify serum HDL-C levels. The SNP of rs1051006 interacted with body mass index ≥24 kg/m² to modulate serum low-density lipoprotein cholesterol levels. The interactions of several haplotypes and alcohol consumption on the risk of CHD and IS were also observed.
Association between endothelin type A receptor haplotypes and mortality in coronary heart disease.
Ellis, Katrina L; Pilbrow, Anna P; Potter, Howard C; Frampton, Chris M; Doughty, Rob N; Whalley, Gillian A; Ellis, Chris J; Palmer, Barry R; Skelton, Lorraine; Yandle, Tim G; Troughton, Richard W; Richards, A Mark; A Cameron, Vicky
2012-05-01
The endothelin type A receptor, encoded by EDNRA, mediates the effects of endothelin-1 to promote vasoconstriction, vascular cell growth, adhesion, fibrosis and thrombosis. We investigated the association between EDNRA haplotype and cardiovascular outcomes in patients with coronary artery disease. Coronary disease patients (n = 1007) were genotyped for the His323His (rs5333) variant and one tag SNP from each of the major EDNRA haplotype blocks (rs6537484, rs1568136, rs5335 and rs10003447). EDNRA haplotype associations with clinical history, natriuretic peptides cardiac function and cardiovascular outcomes were tested over a median 3.8 years. Univariate analysis identified a 'low-risk' EDNRA haplotype associated with later age of Type 2 diabetes onset (p = 0.004) smaller BMI (p = 0.021), and reduced mortality (log rank p = 0.001). Cox proportional hazards analysis including established cardiovascular risk factors revealed an independent association between haplotype and mortality (p < 0.0001). These data highlight the potential importance of the endothelin system, and in particular EDNRA in coronary disease.
SALIMI, SAEEDEH; KHODAMIAN, MARYAM; NAROOIE-NEJAD, MEHRNAZ; HAJIZADEH, AZAM; FAZELI, KIMIA; NAMAZI, LIDA; YAGHMAEI, MINOO
2015-01-01
Uterine leiomyoma (UL) is an estrogen-dependent neoplasm of the uterus and estrogen metabolizing enzymes affect its promotion and progression. The aim of the present study was to evaluate the association between four single-nucleotide polymorphisms (SNPs) of the cytochrome P450 1B1 (CYP1B1) gene and UL risk. Four SNPs of the CYP1B1 gene in 105 UL patients and 112 unrelated healthy controls were genotyped using a direct sequencing method. Haplotype analyses were performed with UNPHASED software and linkage disequilibrium (LD) was assessed by Haploview software. There were no associations between Leu432Val (rs1056836), Asp449Asp (rs1056837) and Asn453Ser (rs1800440) polymorphisms of the CYP1B1 gene and UL. Although the genotypic frequencies of the Arg368His (rs79204362) polymorphism did not differ between the two groups, the frequency of A (His) allele was significantly higher in UL females (P=0.02). In addition, the frequency of GTAA haplotype was significantly higher in the controls and played a protective role in UL susceptibility. A strong LD between the three common SNPs (rs1056836, rs1056837 and rs1800440) in the CYP1B1 gene was observed in the population. In conclusion, a higher frequency of the CYP1B1 368His (A) allele was observed in UL females. The frequency of the GTAA haplotype was significantly higher in healthy females and this haplotype played a protective role in UL susceptibility. PMID:26075073
Boulling, Arnaud; Masson, Emmanuelle; Zou, Wen-Bin; Paliwal, Sumit; Wu, Hao; Issarapu, Prachand; Bhaskar, Seema; Génin, Emmanuelle; Cooper, David N; Li, Zhao-Shen; Chandak, Giriraj R; Liao, Zhuan; Chen, Jian-Min; Férec, Claude
2017-08-01
The haplotype harboring the SPINK1 c.101A>G (p.Asn34Ser) variant (also known as rs17107315:T>C) represents the most important heritable risk factor for idiopathic chronic pancreatitis identified to date. The causal variant contained within this risk haplotype has however remained stubbornly elusive. Herein, we set out to resolve this enigma by employing a hypothesis-driven approach. First, we searched for variants in strong linkage disequilibrium (LD) with rs17107315:T>C using HaploReg v4.1. Second, we identified two candidate SNPs by visual inspection of sequences spanning all 25 SNPs found to be in LD with rs17107315:T>C, guided by prior knowledge of pancreas-specific transcription factors and their cognate binding sites. Third, employing a novel cis-regulatory module (CRM)-guided approach to further filter the two candidate SNPs yielded a solitary candidate causal variant. Finally, combining data from phylogenetic conservation and chromatin accessibility, cotransfection transactivation experiments, and population genetic studies, we suggest that rs142703147:C>A, which disrupts a PTF1L-binding site within an evolutionarily conserved HNF1A-PTF1L CRM located ∼4 kb upstream of the SPINK1 promoter, contributes to the aforementioned chronic pancreatitis risk haplotype. Further studies are required not only to improve the characterization of this functional SNP but also to identify other functional components that might contribute to this high-risk haplotype. © 2017 Wiley Periodicals, Inc.
El-Magd, Mohammed Abu; Saleh, Ayman A; Abdel-Hamid, Tamer M; Saleh, Rasha M; Afifi, Mohammed A
2016-10-01
Chicken growth hormone secretagogue receptor (GHSR) is a receptor for ghrelin (GHRL), a peptide hormone produced by chicken proventriculus, which stimulates growth hormone (GH) release and food intake. The purpose of this study was to search for single nucleotide polymorphisms (SNPs) in exon 2 of GHSR gene and to analyze their effect on the appetite, growth traits and expression levels of GHSR, GHRL, and GH genes as well as serum levels of GH and GHRL in Mandara chicken. Two adjacent SNPs, A239G and G244A, were detected in exon 2 of GHSR gene. G244A SNP was non-synonymous mutation and led to replacement of lysine amino acid (aa) by arginine aa, while A239G SNP was synonymous mutation. The combined genotypes of A239G and G244A SNPs produced three haplotypes; GG/GG, GG/AG, AG/AG, which associated significantly (P<0.05) with growth traits (body weight, average daily gain, shank length, keel length, chest circumference) at age from >4 to 16w. Chickens with the homozygous GG/GG haplotype showed higher growth performance than other chickens. The two SNPs were also correlated with mRNA levels of GHSR and GH (in pituitary gland), and GHRL (in proventriculus and hypothalamus) as well as with serum level of GH and GHRL. Also, chickens with GG/GG haplotype showed higher mRNA and serum levels. This is the first study to demonstrate that SNPs in GHSR can increase appetite, growth traits, expression and level of GHRL, suggesting a hunger signal role for endogenous GHRL. Copyright © 2016 Elsevier Inc. All rights reserved.
Weinsheimer, Shantel; Kim, Helen; Pawlikowska, Ludmila; Chen, Yongmei; Lawton, Michael T.; Sidney, Stephen; Kwok, Pui-Yan; McCulloch, Charles E.; Young, William L.
2009-01-01
Background Brain arteriovenous malformations (BAVM) are a tangle of abnormal vessels directly shunting blood from the arterial to venous circulation and an important cause of intracranial hemorrhage (ICH). EphB4 is involved in arterial-venous determination during embryogenesis; altered signaling could lead to vascular instability resulting in ICH. We investigated the association of single-nucleotide polymorphisms (SNPs) and haplotypes in EPHB4 with risk of ICH at clinical presentation in BAVM patients. Methods and Results Eight haplotype-tagging SNPs spanning ∼29 kb were tested for association with ICH presentation in 146 Caucasian BAVM patients (phase I: 56 ICH, 90 non-ICH) using allelic, haplotypic, and principal components analysis. Associated SNPs were then genotyped in 102 additional cases (phase II: 37 ICH, 65 non-ICH) and data combined for multivariable logistic regression. Minor alleles of 2 SNPs were associated with reduced risk of ICH presentation (rs314313 C, P=0.005; rs314308 T, P=0.0004). Overall, haplotypes were also significantly associated with ICH presentation (χ2=17.24, 6 df, P=0.008); 2 haplotypes containing the rs314308 T allele (GCCTGGGT, P=0.003; GTCTGGGC, P=0.036) were associated with reduced risk. In principal components analysis, 2 components explained 91% of the variance, and complemented haplotype results by implicating 4 SNPs at the 5′ end, including rs314308 and rs314313. These 2 SNPs were replicated in the phase II cohort, and combined data resulted in greater significance (rs314313, P=0.0007; rs314308, P=0.00008). SNP association with ICH presentation persisted after adjusting for age, sex, BAVM size, and deep venous drainage. Conclusions EPHB4 polymorphisms are associated with risk of ICH presentation in BAVM patients, warranting further study. PMID:20031623
Haralambieva, Iana H.; Ovsyannikova, Inna G.; Umlauf, Benjamin J.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.
2014-01-01
Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans. Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20. In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African
Novel Tenascin-C Haplotype Modifies the Risk for a Failure to Heal After Rotator Cuff Repair.
Kluger, Rainer; Huber, Klaus R; Seely, Philipp G; Berger, Christian E; Frommlet, Florian
2017-11-01
Several single-nucleotide polymorphisms (SNPs) in the TNC gene have recently been found to be associated with degenerative rotator cuff tears. Exonic SNPs in the TNC gene are related to the risk for a failure to heal after rotator cuff repair. Case-control study; Level of evidence, 3. A total of 302 patients from the Vienna area and European Caucasian ancestry underwent mini-open rotator cuff repair for a full-thickness superior or posterosuperior tear and were assessed for the integrity of the repair 1 year postoperatively with a real-time 7.5- to 10-MHz ultrasound linear array transducer. Outcomes were classified as intact (complete footprint coverage), small (<200 mm 2 ), or large (≥200 mm 2 ) recurrent defect. Patients were genotyped for 15 previously identified risk SNPs within a 49-kbp segment of the TNC gene with the KASP genotyping technology or the Ion-Torrent Personal Genome Machine System. All recurrent defects were atraumatic failures, and the overall failure rate was 39.7%. Of the traditional risk factors, only the initial tear size was significantly associated with a failure to heal. In a multinomial logistic regression model, the T allele at rs1138545 [C>T] was protective for a large recurrent defect (odds ratio = 0.16; 95% CI, 0.09-0.31). The role of rs1138545 was further backed by haplotype analysis, which showed that the combination of the C allele at rs1138545 [C>T], the A allele at rs2104772 [A>T], and the G allele at rs10759752 [A>G] formed the risk-related haplotype [CAG]. The CAG haplotype was associated with large recurrent defects ( P < .0001; haplotype frequency, 0.394; haplotype score, 4.518). Exonic marker rs1138545 transcribed into all isoforms of the TNC protein, whereas exonic marker rs2104772, which has been associated with Achilles tendinopathy before, transcribed only into large isoforms of the TNC protein. Recurrent defects after rotator cuff repairs are clinically relevant, and a heritable component of the disorder is plausible
Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F
2009-07-14
In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.
2011-01-01
Background Preeclampsia (PE) is the first worldwide cause of death in pregnant women, intra-uterine growth retardation, and fetal prematurity. Some vascular endothelial grown factor gene (VEGF) polymorphisms have been associated to PE and other pregnancy disturbances. We evaluated the associations between VEGF genotypes/haplotypes and PE in Mexican women. Methods 164 pregnant women were enrolled in a case-control study (78 cases and 86 normotensive pregnant controls). The rs699947 (-2578C/A), rs1570360 (-1154G/A), rs2010963 (+405G/C), and rs25648 (-7C/T), VEGF variants were discriminated using Polymerase Chain Reaction - Restriction Fragment Length Polymorphism (PCR-RFLP) methods or Taqman single nucleotide polymorphism (SNP) assays. Results The proportions of the minor allele for rs699947, rs1570360, rs2010963, and rs25648 VEGF SNPs were 0.33, 0.2, 0.39, and 0.17 in controls, and 0.39, 0.23, 0.41, and 0.15 in cases, respectively (P values > 0.05). The most frequent haplotypes of rs699947, rs1570360, rs2010963, and rs25648 VEGF SNPs, were C-G-C-C and C-G-G-C with frequencies of 0.39, 0.21 in cases and 0.37, 0.25 in controls, respectively (P values > 0.05) Conclusion There was no evidence of an association between VEGF alleles, genotypes, or haplotypes frequencies and PE in our study. PMID:21575227
The evolutionary history of the DMRT3 'Gait keeper' haplotype.
Staiger, E A; Almén, M S; Promerová, M; Brooks, S; Cothran, E G; Imsland, F; Jäderkvist Fegraeus, K; Lindgren, G; Mehrabani Yeganeh, H; Mikko, S; Vega-Pla, J L; Tozaki, T; Rubin, C J; Andersson, L
2017-10-01
A previous study revealed a strong association between the DMRT3:Ser301STOP mutation in horses and alternate gaits as well as performance in harness racing. Several follow-up studies have confirmed a high frequency of the mutation in gaited horse breeds and an effect on gait quality. The aim of this study was to determine when and where the mutation arose, to identify additional potential causal mutations and to determine the coalescence time for contemporary haplotypes carrying the stop mutation. We utilized sequences from 89 horses representing 26 breeds to identify 102 SNPs encompassing the DMRT3 gene that are in strong linkage disequilibrium with the stop mutation. These 102 SNPs were genotyped in an additional 382 horses representing 72 breeds, and we identified 14 unique haplotypes. The results provided conclusive evidence that DMRT3:Ser301STOP is causal, as no other sequence polymorphisms showed an equally strong association to locomotion traits. The low sequence diversity among mutant chromosomes demonstrated that they must have diverged from a common ancestral sequence within the last 10 000 years. Thus, the mutation occurred either just before domestication or more likely some time after domestication and then spread across the world as a result of selection on locomotion traits. © 2017 Stichting International Foundation for Animal Genetics.
Haplotypes and gene expression implicate the MAPT region for Parkinson disease
Tobin, J.E.; Latourelle, J.C.; Lew, M.F.; Klein, C.; Suchowersky, O.; Shill, H.A.; Golbe, L.I.; Mark, M.H.; Growdon, J.H.; Wooten, G.F.; Racette, B.A.; Perlmutter, J.S.; Watts, R.; Guttman, M.; Baker, K.B.; Goldwurm, S.; Pezzoli, G.; Singer, C.; Saint-Hilaire, M.H.; Hendricks, A.E.; Williamson, S.; Nagle, M.W.; Wilk, J.B.; Massood, T.; Laramie, J.M.; DeStefano, A.L.; Litvan, I.; Nicholson, G.; Corbett, A.; Isaacson, S.; Burn, D.J.; Chinnery, P.F.; Pramstaller, P.P.; Sherman, S.; Al-hinti, J.; Drasby, E.; Nance, M.; Moller, A.T.; Ostergaard, K.; Roxburgh, R.; Snow, B.; Slevin, J.T.; Cambi, F.; Gusella, J.F.; Myers, R.H.
2009-01-01
Background Microtubule-associated protein tau (MAPT) has been associated with several neurodegenerative disorders including forms of parkinsonism and Parkinson disease (PD). We evaluated the association of the MAPT region with PD in a large cohort of familial PD cases recruited by the GenePD Study. In addition, postmortem brain samples from patients with PD and neurologically normal controls were used to evaluate whether the expression of the 3-repeat and 4-repeat isoforms of MAPT, and neighboring genes Saitohin (STH) and KIAA1267, are altered in PD cerebellum. Methods Twenty-one single-nucleotide polymorphisms (SNPs) in the region of MAPT on chromosome 17q21 were genotyped in the GenePD Study. Single SNPs and haplotypes, including the H1 haplotype, were evaluated for association to PD. Relative quantification of gene expression was performed using real-time RT-PCR. Results After adjusting for multiple comparisons, SNP rs1800547 was significantly associated with PD affection. While the H1 haplotype was associated with a significantly increased risk for PD, a novel H1 subhaplotype was identified that predicted a greater increased risk for PD. The expression of 4-repeat MAPT, STH, and KIAA1267 was significantly increased in PD brains relative to controls. No difference in expression was observed for 3-repeat MAPT. Conclusions This study supports a role for MAPT in the pathogenesis of familial and idiopathic Parkinson disease (PD). Interestingly, the results of the gene expression studies suggest that other genes in the vicinity of MAPT, specifically STH and KIAA1267, may also have a role in PD and suggest complex effects for the genes in this region on PD risk. PMID:18509094
Gonzalez, Suzanne; Xu, Chun; Ramirez, Mercedes; Zavala, Juan; Armas, Regina; Contreras, Salvador A; Contreras, Javier; Dassori, Albana; Leach, Robin J; Flores, Deborah; Jerez, Alvaro; Raventós, Henriette; Ontiveros, Alfonso; Nicolini, Humberto; Escamilla, Michael
2013-01-01
Objectives Through recent genome-wide association studies (GWAS), several groups have reported significant association between variants in the alpha 1C subunit of the L-type voltage-gated calcium channel (CACNA1C) and bipolar disorder (BP) in European and European-American cohorts. We performed a family-based association study to determine whether CACNA1C is associated with BP in the Latino population. Methods This study consisted of 913 individuals from 215 Latino pedigrees recruited from the United States, Mexico, Guatemala, and Costa Rica. The Illumina GoldenGate Genotyping Assay was used to genotype 58 single-nucleotide polymorphisms (SNPs) that spanned a 602.9 kb region encompassing the CACNA1C gene including two SNPs (rs7297582 and rs1006737) previously shown to associate with BP. Individual SNP and haplotype association analyses were performed using Family-Based Association Test (version 2.0.3) and Haploview (version 4.2) software. Results An eight-locus haplotype block that included these two markers showed significant association with BP (global marker permuted p = 0.0018) in the Latino population. For individual SNPs, this sample had insufficient power (10%) to detect associations with SNPs with minor effect (odds ratio = 1.15). Conclusions Although we were not able to replicate findings of association between individual CACNA1C SNPs rs7297582 and rs1006737 and BP, we were able to replicate the GWAS signal reported for CACNA1C through a haplotype analysis that encompassed these previously reported significant SNPs. These results provide additional evidence that CACNA1C is associated with BP and provides the first evidence that variations in this gene might play a role in the pathogenesis of this disorder in the Latino population. PMID:23437964
Suarez-Kurtz, Guilherme; Fuchshuber-Moraes, Mateus; Struchiner, Claudio J; Parra, Esteban J
2016-08-01
Several algorithms have been proposed to reduce the genotyping effort and cost, while retaining the accuracy of N-acetyltransferase-2 (NAT2) phenotype prediction. Data from the 1000 Genomes (1KG) project and an admixed cohort of Black Brazilians were used to assess the accuracy of NAT2 phenotype prediction using algorithms based on paired single nucleotide polymorphisms (SNPs) (rs1041983 and rs1801280) or a tag SNP (rs1495741). NAT2 haplotypes comprising SNPs rs1801279, rs1041983, rs1801280, rs1799929, rs1799930, rs1208 and rs1799931 were assigned according to the arylamine N-acetyltransferases database. Contingency tables were used to visualize the agreement between the NAT2 acetylator phenotypes on the basis of these haplotypes versus phenotypes inferred by the prediction algorithms. The paired and tag SNP algorithms provided more than 96% agreement with the 7-SNP derived phenotypes in Europeans, East Asians, South Asians and Admixed Americans, but discordance of phenotype prediction occurred in 30.2 and 24.8% 1KG Africans and in 14.4 and 18.6% Black Brazilians, respectively. Paired SNP panel misclassification occurs in carriers of NATs haplotypes *13A (282T alone), *12B (282T and 803G), *6B (590A alone) and *14A (191A alone), whereas haplotype *14, defined by the 191A allele, is the major culprit of misclassification by the tag allele. Both the paired SNP and the tag SNP algorithms may be used, with economy of scale, to infer NAT2 acetylator phenotypes, including the ultra-slow phenotype, in European, East Asian, South Asian and American populations represented in the 1KG cohort. Both algorithms, however, perform poorly in populations of predominant African descent, including admixed African-Americans, African Caribbeans and Black Brazilians.
Genetic variation of the ghrelin signaling system in females with severe alcohol dependence.
Landgren, Sara; Jerlhag, Elisabet; Hallman, Jarmila; Oreland, Lars; Lissner, Lauren; Strandhagen, Elisabeth; Thelle, Dag S; Zetterberg, Henrik; Blennow, Kaj; Engel, Jörgen A
2010-09-01
Central ghrelin signaling is required for the rewarding effects of alcohol in mice. Because ghrelin is implied in other addictive behaviors such as eating disorders and smoking, and because there is co-morbidity between these disorders and alcohol dependence, the ghrelin signaling system could be involved in mediating reward in general. Furthermore, in humans, single nucleotide polymorphisms (SNPs) and haplotypes of the pro-ghrelin gene (GHRL) and the ghrelin receptor gene (GHSR) have previously been associated with increased alcohol consumption and increased body weight. Known gender differences in plasma ghrelin levels prompted us to investigate genetic variation of the ghrelin signaling system in females with severe alcohol dependence (n = 113) and in a selected control sample of female low-consumers of alcohol from a large cohort study in southwest Sweden (n = 212). Six tag SNPs in the GHRL (rs696217, rs3491141, rs4684677, rs35680, rs42451, and rs26802) and four tag SNPs in the GHSR (rs495225, rs2232165, rs572169, and rs2948694) were genotyped in all individuals. We found that one GHRL haplotype was associated with reports of paternal alcohol dependence as well as with reports of withdrawal symptoms in the female alcohol-dependent group. Associations with 2 GHSR haplotypes and smoking were also shown. One of these haplotypes was also negatively associated with BMI in controls, while another haplotype was associated with having the early-onset, more heredity-driven, type 2 form of alcohol dependence in the patient group. Taken together, the genes encoding the ghrelin signaling system cannot be regarded as major susceptibility genes for female alcohol dependence, but is, however, involved in paternal heritability and may affect other reward- and energy-related factors such as smoking and BMI.
Common PCSK1 haplotypes are associated with obesity in the Chinese population.
Chang, Yi-Cheng; Chiu, Yen-Feng; Shih, Kuang-Chung; Lin, Ming-Wei; Sheu, Wayne Huey-Herng; Donlon, Timothy; Curb, Jess David; Jou, Yuh-Shan; Chang, Tien-Jyun; Li, Hung-Yuan; Chuang, Lee-Ming
2010-07-01
Prohormone convertase subtilisin/kexin type 1 (PCSK1) genetic polymorphisms have recently been associated with obesity in European populations. This study aimed to examine whether common PCSK1 genetic variation is associated with obesity and related metabolic phenotypes in the Chinese population. We genotyped nine common tag single-nucleotide polymorphisms (tagSNP) of the PCSK1 gene in 1,094 subjects of Chinese origin from the Stanford Asia-Pacific Program for Hypertension and Insulin Resistance (SAPPHIRe) family study. One SNP in the PCSK1 gene (rs155971) were nominally associated with risk of obesity in the SAPPHIRe cohort (P = 0.01). A common protective haplotype was associated with reduced risk of obesity (23.79% vs. 32.89%, P = 0.01) and smaller waist circumference (81.71 +/- 10.22 vs. 84.75 +/- 10.48 cm, P = 0.02). Another common haplotype was significantly associated with increased risk of obesity (37.07% vs. 23.84%, P = 0.005). The global P value for haplotype association with obesity was 0.02. We also identified a suggestive association of another PCSK1 SNP (rs3811951) with fasting glucose, fasting insulin, homeostasis model assessment of insulin resistance (HOMA(IR)), triglycerides, and high-density lipoprotein cholesterol (P = 0.05, 0.003, 0.001, 0.04, and 0.04, respectively). These data indicate common PCSK1 genetic variants are associated with obesity in the Chinese population.
Matimba, Alice; Li, Fang; Livshits, Alina; Cartwright, Cher S; Scully, Stephen; Fridley, Brooke L; Jenkins, Gregory; Batzler, Anthony; Wang, Liewei; Weinshilboum, Richard; Lennard, Lynne
2014-01-01
Aim We investigated candidate genes associated with thiopurine metabolism and clinical response in childhood acute lymphoblastic leukemia. Materials & methods We performed genome-wide SNP association studies of 6-thioguanine and 6-mercaptopurine cytotoxicity using lymphoblastoid cell lines. We then genotyped the top SNPs associated with lymphoblastoid cell line cytotoxicity, together with tagSNPs for genes in the ‘thiopurine pathway’ (686 total SNPs), in DNA from 589 Caucasian UK ALL97 patients. Functional validation studies were performed by siRNA knockdown in cancer cell lines. Results SNPs in the thiopurine pathway genes ABCC4, ABCC5, IMPDH1, ITPA, SLC28A3 and XDH, and SNPs located within or near ATP6AP2, FRMD4B, GNG2, KCNMA1 and NME1, were associated with clinical response and measures of thiopurine metabolism. Functional validation showed shifts in cytotoxicity for these genes. Conclusion The clinical response to thiopurines may be regulated by variation in known thiopurine pathway genes and additional novel genes outside of the thiopurine pathway. PMID:24624911
Mining SNPs from EST sequences using filters and ensemble classifiers.
Wang, J; Zou, Q; Guo, M Z
2010-05-04
Abundant single nucleotide polymorphisms (SNPs) provide the most complete information for genome-wide association studies. However, due to the bottleneck of manual discovery of putative SNPs and the inaccessibility of the original sequencing reads, it is essential to develop a more efficient and accurate computational method for automated SNP detection. We propose a novel computational method to rapidly find true SNPs in public-available EST (expressed sequence tag) databases; this method is implemented as SNPDigger. EST sequences are clustered and aligned. SNP candidates are then obtained according to a measure of redundant frequency. Several new informative biological features, such as the structural neighbor profiles and the physical position of the SNP, were extracted from EST sequences, and the effectiveness of these features was demonstrated. An ensemble classifier, which employs a carefully selected feature set, was included for the imbalanced training data. The sensitivity and specificity of our method both exceeded 80% for human genetic data in the cross validation. Our method enables detection of SNPs from the user's own EST dataset and can be used on species for which there is no genome data. Our tests showed that this method can effectively guide SNP discovery in ESTs and will be useful to avoid and save the cost of biological analyses.
NASA Astrophysics Data System (ADS)
Yang, Shun-Fa; Yeh, Chao-Bin; Chou, Ying-Erh; Lee, Hsiang-Lin; Liu, Yu-Fan
2016-05-01
Hepatocellular carcinoma (HCC) represents the second leading cause of cancer-related death worldwide. The serpin peptidase inhibitor SERPINB5 is a tumour-suppressor gene that promotes the development of various cancers in humans. However, whether SERPINB5 gene variants play a role in HCC susceptibility remains unknown. In this study, we genotyped 6 SNPs of the SERPINB5 gene in an independent cohort from a replicate population comprising 302 cases and 590 controls. Additionally, patients who had at least one rs2289520 C allele in SERPINB5 tended to exhibit better liver function than patients with genotype GG (Child-Pugh grade A vs. B or C; P = 0.047). Next, haplotype blocks were reconstructed according to the linkage disequilibrium structure of the SERPINB5 gene. A haplotype “C-C-C” (rs17071138 + rs3744941 + rs8089204) in SERPINB5-correlated promoter showed a significant association with an increased HCC risk (AOR = 1.450 P = 0.031). Haplotypes “T-C-A” and “C-C-C” (rs2289519 + rs2289520 + rs1455555) located in the SERPINB5 coding region had a decreased (AOR = 0.744 P = 0.031) and increased (AOR = 1.981 P = 0.001) HCC risk, respectively. Finally, an additional integrated in silico analysis confirmed that these SNPs affected SERPINB5 expression and protein stability, which significantly correlated with tumour expression and subsequently with tumour development and aggressiveness. Taken together, our findings regarding these biomarkers provide a prediction model for risk assessment.
Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A
2015-10-01
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
N'Diaye, Amidou; Haile, Jemanesh K; Cory, Aron T; Clarke, Fran R; Clarke, John M; Knox, Ron E; Pozniak, Curtis J
2017-01-01
Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype
Haile, Jemanesh K.; Cory, Aron T.; Clarke, Fran R.; Clarke, John M.; Knox, Ron E.; Pozniak, Curtis J.
2017-01-01
Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype
Monsuur, Alienke J; de Bakker, Paul I W; Zhernakova, Alexandra; Pinto, Dalila; Verduijn, Willem; Romanos, Jihane; Auricchio, Renata; Lopez, Ana; van Heel, David A; Crusius, J Bart A; Wijmenga, Cisca
2008-05-28
The HLA genes, located in the MHC region on chromosome 6p21.3, play an important role in many autoimmune disorders, such as celiac disease (CD), type 1 diabetes (T1D), rheumatoid arthritis, multiple sclerosis, psoriasis and others. Known HLA variants that confer risk to CD, for example, include DQA1*05/DQB1*02 (DQ2.5) and DQA1*03/DQB1*0302 (DQ8). To diagnose the majority of CD patients and to study disease susceptibility and progression, typing these strongly associated HLA risk factors is of utmost importance. However, current genotyping methods for HLA risk factors involve many reactions, and are complicated and expensive. We sought a simple experimental approach using tagging SNPs that predict the CD-associated HLA risk factors. Our tagging approach exploits linkage disequilibrium between single nucleotide polymorphism (SNPs) and the CD-associated HLA risk factors DQ2.5 and DQ8 that indicate direct risk, and DQA1*0201/DQB1*0202 (DQ2.2) and DQA1*0505/DQB1*0301 (DQ7) that attribute to the risk of DQ2.5 to CD. To evaluate the predictive power of this approach, we performed an empirical comparison of the predicted DQ types, based on these six tag SNPs, with those executed with current validated laboratory typing methods of the HLA-DQA1 and -DQB1 genes in three large cohorts. The results were validated in three European celiac populations. Using this method, only six SNPs were needed to predict the risk types carried by >95% of CD patients. We determined that for this tagging approach the sensitivity was >0.991, specificity >0.996 and the predictive value >0.948. Our results show that this tag SNP method is very accurate and provides an excellent basis for population screening for CD. This method is broadly applicable in European populations.
Dai, Yaoyao; Zhang, Xia; Pan, Hongqiu; Tang, Shaowen; Shen, Hongbing; Wang, Jianming
2011-10-22
Recently, one genome-wide association study identified a susceptibility locus of rs4331426 on chromosome 18q11.2 for tuberculosis in the African population. To validate the significance of this susceptibility locus in other areas, we conducted a case-control study in the Chinese population. The present study consisted of 578 cases and 756 controls. The SNP rs4331426 and other six tag SNPs in the 100 Kbp up and down stream of rs4331426 on chromosome 18q11.2 were genotyped by using the Taqman-based allelic discrimination system. As compared with the findings from the African population, genetic variation of the SNP rs4331426 was rare among the Chinese. No significant differences were observed in genotypes or allele frequencies of the tag SNPs between cases and controls either before or after adjusting for age, sex, education, smoking, and drinking history. However, we observed strong linkage disequilibrium of SNPs. Constructed haplotypes within this block were linked the altered risks of tuberculosis. For example, in comparison with the common haplotype AA(rs8087945-rs12456774), haplotypes AG(rs8087945-rs12456774) and GA(rs8087945-rs12456774) were associated with a decreased risk of tuberculosis, with the adjusted odds ratio(95% confidence interval) of 0.34(0.27-0.42) and 0.22(0.16-0.29), respectively. Susceptibility locus of rs4331426 discovered in the African population could not be validated in the Chinese population. None of genetic polymorphisms we genotyped were related to tuberculosis in the single-point analysis. However, haplotypes on chromosome 18q11.2 might contribute to an individual's susceptibility. More work is necessary to identify the true causative variants of tuberculosis.
Fisher, Colleen A.; Bhattarai, Eric K.; Osterstock, Jason B.; Dowd, Scot E.; Seabury, Paul M.; Vikram, Meenu; Whitlock, Robert H.; Schukken, Ynte H.; Schnabel, Robert D.; Taylor, Jeremy F.; Womack, James E.; Seabury, Christopher M.
2011-01-01
Members of the Toll-like receptor (TLR) gene family occupy key roles in the mammalian innate immune system by functioning as sentries for the detection of invading pathogens, thereafter provoking host innate immune responses. We utilized a custom next-generation sequencing approach and allele-specific genotyping assays to detect and validate 280 biallelic variants across all 10 bovine TLR genes, including 71 nonsynonymous single nucleotide polymorphisms (SNPs) and one putative nonsense SNP. Bayesian haplotype reconstructions and median joining networks revealed haplotype sharing between Bos taurus taurus and Bos taurus indicus breeds at every locus, and specialized beef and dairy breeds could not be differentiated despite an average polymorphism density of 1 marker/158 bp. Collectively, 160 tagSNPs and two tag insertion-deletion mutations (indels) were sufficient to predict 100% of the variation at 280 variable sites for both Bos subspecies and their hybrids, whereas 118 tagSNPs and 1 tagIndel predictively captured 100% of the variation at 235 variable sites for B. t. taurus. Polyphen and SIFT analyses of amino acid (AA) replacements encoded by bovine TLR SNPs indicated that up to 32% of the AA substitutions were expected to impact protein function. Classical and newly developed tests of diversity provide strong support for balancing selection operating on TLR3 and TLR8, and purifying selection acting on TLR10. An investigation of the persistence and continuity of linkage disequilibrium (r2≥0.50) between adjacent variable sites also supported the presence of selection acting on TLR3 and TLR8. A case-control study employing validated variants from bovine TLR genes recognizing bacterial ligands revealed six SNPs potentially eliciting small effects on susceptibility to Mycobacterium avium spp paratuberculosis infection in dairy cattle. The results of this study will broadly impact domestic cattle research by providing the necessary foundation to explore several
Detecting local haplotype sharing and haplotype association
USDA-ARS?s Scientific Manuscript database
A novel haplotype association method is presented, and its power is demonstrated. Relying on a statistical model for linkage disequilibrium (LD), the method first infers ancestral haplotypes and their loadings at each marker for each individual. The loadings are then used to quantify local haplotype...
The CRHR1 Gene, Trauma Exposure, and Alcoholism Risk: A Test of G × E Effects
Ray, Lara A.; Sehl, Mary; Bujarski, Spencer; Hutchison, Kent; Blaine, Sara; Enoch, Mary-Anne
2014-01-01
The corticotropin-releasing hormone type I receptor (CRHR1) gene has been implicated in the liability for neuropsychiatric disorders, particularly under conditions of stress. Based on the hypothesized effects of CRHR1 variation on stress reactivity, measures of adulthood traumatic stress exposure were analyzed for their interaction with CRHR1 haplotypes and SNPs in predicting the risk for alcoholism. Phenotypic data on 2,533 non-related Caucasian individuals (1167 alcoholics and 1366 controls) were culled from the publically available Study of Addiction: Genetics and Environment (SAGE) genome-wide association study (GWAS). Genotypes were available for 19 tag SNPs. Logistic regression models examined the interaction between CRHR1 haplotypes / SNPs and adulthood traumatic stress exposure in predicting alcoholism risk. Two haplotype blocks spanned CRHR1. Haplotype analyses identified one haplotype in the proximal block 1 (p = 0.029) and two haplotypes in the distal block 2 (p = 0.026, 0.042) that showed nominally significant (corrected p < .025) genotype × traumatic stress interactive effects on the likelihood of developing alcoholism. The block 1 haplotype effect was driven by SNPs rs110402 (p = 0.019) and rs242924 (p = 0.019). In block 2, rs17689966 (p = 0.018) showed significant, and rs173365 (p = 0.026) showed nominally significant, gene × environment (G × E) effects on alcoholism status. This study extends the literature on the interplay between CRHR1 variation and alcoholism, in the context of exposure to traumatic stress. These findings are consistent with the hypothesized role of the extra hypothalamic CRF system dysregulation in the initiation and maintenance of alcoholism. Molecular and experimental studies are needed to more fully understand the mechanisms of risk and protection conferred by genetic variation at the identified loci. PMID:23473364
The CRHR1 gene, trauma exposure, and alcoholism risk: a test of G × E effects.
Ray, L A; Sehl, M; Bujarski, S; Hutchison, K; Blaine, S; Enoch, M-A
2013-06-01
The corticotropin-releasing hormone type I receptor (CRHR1) gene has been implicated in the liability for neuropsychiatric disorders, particularly under conditions of stress. On the basis of the hypothesized effects of CRHR1 variation on stress reactivity, measures of adulthood traumatic stress exposure were analyzed for their interaction with CRHR1 haplotypes and single-nucleotide polymorphisms (SNPs) in predicting the risk for alcoholism. Phenotypic data on 2533 non-related Caucasian individuals (1167 alcoholics and 1366 controls) were culled from the publically available Study of Addiction: Genetics and Environment genome-wide association study. Genotypes were available for 19 tag SNPs. Logistic regression models examined the interaction between CRHR1 haplotypes/SNPs and adulthood traumatic stress exposure in predicting alcoholism risk. Two haplotype blocks spanned CRHR1. Haplotype analyses identified one haplotype in the proximal block 1 (P = 0.029) and two haplotypes in the distal block 2 (P = 0.026, 0.042) that showed nominally significant (corrected P < 0.025) genotype × traumatic stress interactive effects on the likelihood of developing alcoholism. The block 1 haplotype effect was driven by SNPs rs110402 (P = 0.019) and rs242924 (P = 0.019). In block 2, rs17689966 (P = 0.018) showed significant and rs173365 (P = 0.026) showed nominally significant, gene × environment (G × E) effects on alcoholism status. This study extends the literature on the interplay between CRHR1 variation and alcoholism, in the context of exposure to traumatic stress. These findings are consistent with the hypothesized role of the extra hypothalamic corticotropin-releasing factor system dysregulation in the initiation and maintenance of alcoholism. Molecular and experimental studies are needed to more fully understand the mechanisms of risk and protection conferred by genetic variation at the identified loci. © 2013 John Wiley & Sons Ltd and International Behavioural and Neural
Yin, Honglei; Zhang, Yuzhen; Hua, Linlin; Li, Jinfeng; Zeng, Zhilei; Yang, Xiaopeng; Gong, Bin; Geng, Shuang; Liu, Yajun; Zhang, Hui; Liu, Yanqiu; Zhao, Jing; Wang, Yunliang
2017-01-01
Aims To investigate the impact of Interleukin-16 (IL- 16) and Adiponectin (ANP) gene single nucleotide polymorphisms (SNPs), gene- gene interactions and haplotype on late-onset Alzheimer’s disease (LOAD) risk. Methods Hardy-Weinberg equilibrium (HWE), haplotype and pairwise linkage disequilibrium (LD) analysis were investigated by using SNPstats (available online at http://bioinfo.iconcologia.net/SNPstats). Generalized multifactor dimensionality reduction (GMDR) was used to examine interaction among 4 SNPs, odds ratio (OR) and 95% confident interval (95%CI) were calculated by logistic regression model. Results LOAD risk was significantly higher in carriers of rs266729- G allele than those with CC genotype (CG+ GG versus CC), OR (95%CI) =1.61 (1.26-1.96), and higher in carriers of rs1501299- T allele, OR (95%CI) = 1.62 (1.32-2.12), lower in carriers of rs4072111- T allele, adjusted OR (95%CI) =0.65 (0.44-0.93). We also found a significant gene- gene interaction between rs266729 and rs4072111. Participants with CG or GG of rs266729 and CC of rs4072111 genotype have the highest LOAD risk, OR (95%CI) = 2.62 (1.64 -3.58). Haplotype containing the rs266729- G and rs1501299- T alleles were associated with increased LOAD risk, OR (95%CI)= 1.83 (1.32- 2.43), and haplotype containing the rs1131445- C and rs4072111- T alleles were associated with decreased LOAD risk, OR (95%CI)= 0.53 (0.18- 0.95). Conclusions We concluded that rs266729 and rs1501299 minor alleles were associated with increased LOAD risk, but rs4072111 minor allele was associated with decreased LOAD risk. We also found that interaction involving rs266729 and rs4072111, and haplotype combinations were associated with LOAD risk. PMID:29108295
Wang, Guiling; Sun, Jing
2017-01-01
This study was aimed to explore the interaction between environment and CD28/B7 pathway to provide the potential epidemiology for prevention and treatment of recurrent spontaneous abortion (RSA). The retrospective study included 630 RSA cases and 1320 healthy women during their middle and late prenatal care. Their living environment was investigated, and the influence of environmental factors on pregnancy abortion was analyzed. The genomic DNAs were extracted from the study subjects, and the polymorphisms of CD28 and B7 were analyzed. Finally, the interaction of gene and environment on RSA was analyzed with the logistic regression analyses. The multi-variate regression analysis indicated that vitamin supplement, intake of fresh fruits or vegetables, night shift, staying up late, history miscarriage, as well as history induced abortion were, independently, risk factors for RSA (all P< 0.05). Moreover, rs3116496 (T>C), rs3181098 (G>A) and rs3181100 (G>C) of CD28, rs1915087 (C>T) of B7-2, as well as rs6804441 (A>G) and rs41271391 (G>T) of B7-1 were correlated with modified RSA risk (all P< 0.05). The haplotypes TGT and TAG could also regulate the risk of RSA (both P< 0.05). The synthetic influences of the aforementioned SNPs and environmental factors could also significantly affect the susceptibility to RSA (all P< 0.05). The interaction of environment and SNPs of CD28/B7 pathway on RSA risk was distinct from CD28/B7 pathway or environment alone. © 2017 The Author(s). Published by S. Karger AG, Basel.
The Role of Osteopontin (OPN/SPP1) Haplotypes in the Susceptibility to Crohn's Disease
Bayrle, Corinna; Wetzke, Martin; Fries, Christoph; Tillack, Cornelia; Olszak, Torsten; Beigel, Florian; Steib, Christian; Friedrich, Matthias; Diegelmann, Julia; Czamara, Darina; Brand, Stephan
2011-01-01
Background Osteopontin represents a multifunctional molecule playing a pivotal role in chronic inflammatory and autoimmune diseases. Its expression is increased in inflammatory bowel disease (IBD). The aim of our study was to analyze the association of osteopontin (OPN/SPP1) gene variants in a large cohort of IBD patients. Methodology/Principal Findings Genomic DNA from 2819 Caucasian individuals (n = 841 patients with Crohn's disease (CD), n = 473 patients with ulcerative colitis (UC), and n = 1505 healthy unrelated controls) was analyzed for nine OPN SNPs (rs2728127, rs2853744, rs11730582, rs11739060, rs28357094, rs4754 = p.Asp80Asp, rs1126616 = p.Ala236Ala, rs1126772 and rs9138). Considering the important role of osteopontin in Th17-mediated diseases, we performed analysis for epistasis with IBD-associated IL23R variants and analyzed serum levels of the Th17 cytokine IL-22. For four OPN SNPs (rs4754, rs1126616, rs1126772 and rs9138), we observed significantly different distributions between male and female CD patients. rs4754 was protective in male CD patients (p = 0.0004, OR = 0.69). None of the other investigated OPN SNPs was associated with CD or UC susceptibility. However, several OPN haplotypes showed significant associations with CD susceptibility. The strongest association was found for a haplotype consisting of the 8 OPN SNPs rs2728127-rs2853744-rs11730582-rs11439060-rs28357094-rs112661-rs1126772-rs9138 (omnibus p-value = 2.07×10−8). Overall, the mean IL-22 secretion in the combined group of OPN minor allele carriers with CD was significantly lower than that of CD patients with OPN wildtype alleles (p = 3.66×10−5). There was evidence for weak epistasis between the OPN SNP rs28357094 with the IL23R SNP rs10489629 (p = 4.18×10−2) and between OPN SNP rs1126616 and IL23R SNP rs2201841 (p = 4.18×10−2) but none of these associations remained significant after Bonferroni correction. Conclusions
Schlebusch, Carina M; Soodyall, Himlya
2012-12-01
The San and Khoe people currently represent remnant groups of a much larger and widely distributed population of hunter-gatherers and pastoralists who had exclusive occupation of southern Africa before the arrival of Bantu-speaking groups in the past 1,200 years and sea-borne immigrants within the last 350 years. Genetic studies [mitochondrial deoxyribonucleic acid (DNA) and Y-chromosome] conducted on San and Khoe groups revealed that they harbor some of the most divergent lineages found in living peoples throughout the world. Recently, high-density, autosomal, single-nucleotide polymorphism (SNP)-array studies confirmed the early divergence of Khoe-San population groups from all other human populations. The present study made use of 220 autosomal SNP markers (in the format of both haplotypes and genotypes) to examine the population structure of various San and Khoe groups and their relationship to other neighboring groups. Whereas analyses based on the genotypic SNP data only supported the division of the included populations into three main groups-Khoe-San, Bantu-speakers, and non-African populations-haplotype analyses revealed finer structure within Khoe-San populations. By the use of only 44 short SNP haplotypes (compiled from a total of 220 SNPs), most of the Khoe-San groups could be resolved as separate groups by applying STRUCTURE analyses. Therefore, by carefully selecting a few SNPs and combining them into haplotypes, we were able to achieve the same level of population distinction that was achieved previously in high-density SNP studies on the same population groups. Using haplotypes proved to be a very efficient and cost-effective way to study population structure. Copyright © 2013 Wayne State University Press, Detroit, Michigan 48201-1309.
Brahe, Lena K; Ängquist, Lars; Larsen, Lesli H; Vimaleswaran, Karani S; Hager, Jörg; Viguerie, Nathalie; Loos, Ruth J F; Handjieva-Darlenska, Teodora; Jebb, Susan A; Hlavaty, Petr; Larsen, Thomas M; Martinez, J Alfredo; Papadaki, Angeliki; Pfeiffer, Andreas F H; van Baak, Marleen A; Sørensen, Thorkild I A; Holst, Claus; Langin, Dominique; Astrup, Arne; Saris, Wim H M
2013-09-14
Blood lipid response to a given dietary intervention could be determined by the effect of diet, gene variants or gene-diet interactions. The objective of the present study was to investigate whether variants in presumed nutrient-sensitive genes involved in lipid metabolism modified lipid profile after weight loss and in response to a given diet, among overweight European adults participating in the Diet Obesity and Genes study. By multiple linear regressions, 240 SNPs in twenty-four candidate genes were investigated for SNP main and SNP-diet interaction effects on total cholesterol, LDL-cholesterol, HDL-cholesterol and TAG after an 8-week low-energy diet (only main effect) ,and a 6-month ad libitum weight maintenance diet, with different contents of dietary protein or glycaemic index. After adjusting for multiple testing, a SNP-dietary protein interaction effect on TAG was identified for lipin 1 (LPIN1) rs4315495, with a decrease in TAG of 20.26 mmol/l per A-allele/protein unit (95% CI 20.38, 20.14, P=0.000043). In conclusion, we investigated SNP-diet interactions for blood lipid profiles for 240 SNPs in twenty-four candidate genes, selected for their involvement in lipid metabolism pathways, and identified one significant interaction between LPIN1 rs4315495 and dietary protein for TAG concentration.
Pemberton, T J; Jakobsson, M; Conrad, D F; Coop, G; Wall, J D; Pritchard, J K; Patel, P I; Rosenberg, N A
2008-07-01
When performing association studies in populations that have not been the focus of large-scale investigations of haplotype variation, it is often helpful to rely on genomic databases in other populations for study design and analysis - such as in the selection of tag SNPs and in the imputation of missing genotypes. One way of improving the use of these databases is to rely on a mixture of database samples that is similar to the population of interest, rather than using the single most similar database sample. We demonstrate the effectiveness of the mixture approach in the application of African, European, and East Asian HapMap samples for tag SNP selection in populations from India, a genetically intermediate region underrepresented in genomic studies of haplotype variation.
Association of ORAI1 Haplotypes with the Risk of HLA-B27 Positive Ankylosing Spondylitis
Wei, James Cheng-Chung; Yen, Jeng-Hsien; Juo, Suh-Hang Hank; Chen, Wei-Chiao; Wang, Yu-Shiuan; Chiu, Yi-Ching; Hsieh, Tusty-Jiuan; Guo, Yuh-Cherng; Huang, Chun-Huang; Wong, Ruey-Hong; Wang, Hui-Po; Tsai, Ke-Li; Wu, Yang-Chang; Chang, Hsueh-Wei; Hsi, Edward; Chang, Wei-Pin; Chang, Wei-Chiao
2011-01-01
Ankylosing spondylitis (AS) is a chronic inflammation of the sacroiliac joints, spine and peripheral joints. The aetiology of ankylosing spondylitis is still unclear. Previous studies have indicated that genetics factors such as human leukocyte antigen HLA-B27 associates to AS susceptibility. We carried out a case-control study to determine whether the genetic polymorphisms of ORAI1 gene, a major component of store-operated calcium channels that involved the regulation of immune system, is a susceptibility factor to AS in a Taiwanese population. We enrolled 361 AS patients fulfilled the modified New York criteria and 379 controls from community. Five tagging single nucleotides polymorphisms (tSNPs) at ORAI1 were selected from the data of Han Chinese population in HapMap project. Clinical statuses of AS were assessed by the Bath Ankylosing Spondylitis Disease Activity Index (BASDAI), Bath Ankylosing Spondylitis Functional Index (BASFI), and Bath Ankylosing Spondylitis Global Index (BAS-G). Our results indicated that subjects carrying the minor allele homozygote (CC) of the promoter SNP rs12313273 or TT homozygote of the SNP rs7135617 had an increased risk of HLA-B27 positive AS. The minor allele C of 3′UTR SNP rs712853 exerted a protective effect to HLA-B27 positive AS. Furthermore, the rs12313273/rs7135617 pairwise allele analysis found that C-G (OR 1.69, 95% CI 1.27, 2.25; p = 0.0003) and T-T (OR 1.75, 95% CI 1.36, 2.27; p<0.0001) haplotypes had a significantly association with the risk of HLA-B27-positive AS in comparison with the T-G carriers. This is the first study that indicate haplotypes of ORAI1 (rs12313273 and rs7135617) are associated with the risk of HLA-B27 positive AS. PMID:21674042
Investigation of extended Y chromosome STR haplotypes in Sardinia.
Lacerenza, D; Aneli, S; Di Gaetano, C; Critelli, R; Piazza, A; Matullo, G; Culigioni, C; Robledo, R; Robino, C; Calò, C
2017-03-01
Y-chromosomal variation of selected single nucleotide polymorphisms (SNPs) and 32 short tandem repeat (STR) loci was evaluated in Sardinia in three open population groups (Northern Sardinia, n=40; Central Sardinia, n=56; Southern Sardinia, n=91) and three isolates (Desulo, n=34; Benetutti, n=45, Carloforte, n=42). The tested Y-STRs consisted of Yfiler ® Plus markers and the seven rapidly mutating (RM) loci not included in the YFiler ® Plus kit (DYF399S1, DYF403S1ab, DYF404S1, DYS526ab, DYS547, DYS612, and DYS626). As expected, inclusion of additional Y-STR loci increased haplotype diversity (h), though complete differentiation of male lineages was impossible even by means of RM Y-STRs (h=0.99997). Analysis of molecular variance indicated that the three open populations were fairly homogeneous, whereas signs of genetic heterogeneity could be detected when the three isolates were also included in the analysis. Multidimensional scaling analysis showed that, even for extended haplotypes including RM Y-STR markers, Sardinians were clearly differentiated from populations of the Italian peninsula and Sicily. The only exception was represented by the Carloforte sample that, in accordance with its peculiar population history, clustered with Northern/Central Italian populations. The introduction of extended forensic Y-STR panels, including highly variable RM Y-STR markers, is expected to reduce the impact of population structure on haplotype frequency estimations. However, our results show that the availability of geographically detailed reference databases is still important for the assessment of the evidential value of a Y-haplotype match. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Mapping the genetic diversity of HLA haplotypes in the Japanese populations
Saw, Woei-Yuh; Liu, Xuanyao; Khor, Chiea-Chuen; Takeuchi, Fumihiko; Katsuya, Tomohiro; Kimura, Ryosuke; Nabika, Toru; Ohkubo, Takayoshi; Tabara, Yasuharu; Yamamoto, Ken; Yokota, Mitsuhiro; Akiyama, Koichi; Asano, Hiroyuki; Asayama, Kei; Haga, Toshikazu; Hara, Azusa; Hirose, Takuo; Hosaka, Miki; Ichihara, Sahoko; Imai, Yutaka; Inoue, Ryusuke; Ishiguro, Aya; Isomura, Minoru; Isono, Masato; Kamide, Kei; Kato, Norihiro; Katsuya, Tomohiro; Kikuya, Masahiro; Kohara, Katsuhiko; Matsubara, Tatsuaki; Matsuda, Ayako; Metoki, Hirohito; Miki, Tetsuro; Murakami, Keiko; Nabika, Toru; Nakatochi, Masahiro; Ogihara, Toshio; Ohnaka, Keizo; Ohkubo, Takayoshi; Rakugi, Hiromi; Satoh, Michihiro; Shiwaku, Kunihiro; Sugimoto, Ken; Tabara, Yasuharu; Takami, Yoichi; Takayanagi, Ryoichi; Takeuchi, Fumihiko; Tsubota-Utsugi, Megumi; Yamamoto, Ken; Yamamoto, Koichi; Yamasaki, Masayuki; Yasui, Daisaku; Yokota, Mitsuhiro; Teo, Yik-Ying; Kato, Norihiro
2015-01-01
Japan has often been viewed as an Asian country that possesses a genetically homogenous community. The basis for partitioning the country into prefectures has largely been geographical, although cultural and linguistic differences still exist between some of the districts/prefectures, especially between Okinawa and the mainland prefectures. The Major Histocompatibility Complex (MHC) region has consistently emerged as the most polymorphic region in the human genome, harbouring numerous biologically important variants; nevertheless the presence of population-specific long haplotypes hinders the imputation of SNPs and classical HLA alleles. Here, we examined the extent of genetic variation at the MHC between eight Japanese populations sampled from Okinawa, and six other prefectures located in or close to the mainland of Japan, specifically focusing at the haplotypes observed within each population, and what the impact of any variation has on imputation. Our results indicated that Okinawa was genetically farther to the mainland Japanese than were Gujarati Indians from Tamil Indians, while the mainland Japanese from six prefectures were more homogeneous than between northern and southern Han Chinese. The distribution of haplotypes across Japan was similar, although imputation was most accurate for Okinawa and several mainland prefectures when population-specific panels were used as reference. PMID:26648100
Sodeland, Marte; Grove, Harald; Kent, Matthew; Taylor, Simon; Svendsen, Morten; Hayes, Ben J; Lien, Sigbjørn
2011-08-11
Previous fine mapping studies in Norwegian Red cattle (NRC) in the region 86-90.4 Mb on Bos taurus chromosome 6 (BTA6) has revealed a quantitative trait locus (QTL) for protein yield (PY) around 88 Mb and a QTL for clinical mastitis (CM) around 90 Mb. The close proximity of these QTLs may partly explain the unfavorable genetic correlation between these two traits in NRC. A long range haplotype covering this region was introduced into the NRC population through the importation of a Holstein-Friesian bull (1606 Frasse) from Sweden in the 1970s. It has been suggested that this haplotype has a favorable effect on milk protein content but an unfavorable effect on mastitis susceptibility. Selective breeding for milk production traits is likely to have increased the frequency of this haplotype in the NRC population. Association mapping for PY and CM in NRC was performed using genotypes from 556 SNPs throughout the region 86-97 Mb on BTA6 and daughter-yield-deviations (DYDs) from 2601 bulls made available from the Norwegian dairy herd recording system. Highest test scores for PY were found for single-nucleotide polymorphisms (SNPs) within and surrounding the genes CSN2 and CSN1S2, coding for the β-casein and α(S2)-casein proteins. High coverage re-sequencing by high throughput sequencing technology enabled molecular characterization of a long range haplotype from 1606 Frasse encompassing these two genes. Haplotype analysis of a large number of descendants from this bull indicated that the haplotype was not markedly disrupted by recombination in this region. The haplotype was associated with both increased milk protein content and increased susceptibility to mastitis, which might explain parts of the observed genetic correlation between PY and CM in NRC. Plausible causal polymorphisms affecting PY were detected in the promoter region and in the 5'-flanking UTR of CSN1S2. These polymorphisms could affect transcription or translation of CSN1S2 and thereby affect the amount
Genome sequence, comparative analysis and haplotype structure of the domestic dog.
Lindblad-Toh, Kerstin; Wade, Claire M; Mikkelsen, Tarjei S; Karlsson, Elinor K; Jaffe, David B; Kamal, Michael; Clamp, Michele; Chang, Jean L; Kulbokas, Edward J; Zody, Michael C; Mauceli, Evan; Xie, Xiaohui; Breen, Matthew; Wayne, Robert K; Ostrander, Elaine A; Ponting, Chris P; Galibert, Francis; Smith, Douglas R; DeJong, Pieter J; Kirkness, Ewen; Alvarez, Pablo; Biagi, Tara; Brockman, William; Butler, Jonathan; Chin, Chee-Wye; Cook, April; Cuff, James; Daly, Mark J; DeCaprio, David; Gnerre, Sante; Grabherr, Manfred; Kellis, Manolis; Kleber, Michael; Bardeleben, Carolyne; Goodstadt, Leo; Heger, Andreas; Hitte, Christophe; Kim, Lisa; Koepfli, Klaus-Peter; Parker, Heidi G; Pollinger, John P; Searle, Stephen M J; Sutter, Nathan B; Thomas, Rachael; Webber, Caleb; Baldwin, Jennifer; Abebe, Adal; Abouelleil, Amr; Aftuck, Lynne; Ait-Zahra, Mostafa; Aldredge, Tyler; Allen, Nicole; An, Peter; Anderson, Scott; Antoine, Claudel; Arachchi, Harindra; Aslam, Ali; Ayotte, Laura; Bachantsang, Pasang; Barry, Andrew; Bayul, Tashi; Benamara, Mostafa; Berlin, Aaron; Bessette, Daniel; Blitshteyn, Berta; Bloom, Toby; Blye, Jason; Boguslavskiy, Leonid; Bonnet, Claude; Boukhgalter, Boris; Brown, Adam; Cahill, Patrick; Calixte, Nadia; Camarata, Jody; Cheshatsang, Yama; Chu, Jeffrey; Citroen, Mieke; Collymore, Alville; Cooke, Patrick; Dawoe, Tenzin; Daza, Riza; Decktor, Karin; DeGray, Stuart; Dhargay, Norbu; Dooley, Kimberly; Dooley, Kathleen; Dorje, Passang; Dorjee, Kunsang; Dorris, Lester; Duffey, Noah; Dupes, Alan; Egbiremolen, Osebhajajeme; Elong, Richard; Falk, Jill; Farina, Abderrahim; Faro, Susan; Ferguson, Diallo; Ferreira, Patricia; Fisher, Sheila; FitzGerald, Mike; Foley, Karen; Foley, Chelsea; Franke, Alicia; Friedrich, Dennis; Gage, Diane; Garber, Manuel; Gearin, Gary; Giannoukos, Georgia; Goode, Tina; Goyette, Audra; Graham, Joseph; Grandbois, Edward; Gyaltsen, Kunsang; Hafez, Nabil; Hagopian, Daniel; Hagos, Birhane; Hall, Jennifer; Healy, Claire; Hegarty, Ryan; Honan, Tracey; Horn, Andrea; Houde, Nathan; Hughes, Leanne; Hunnicutt, Leigh; Husby, M; Jester, Benjamin; Jones, Charlien; Kamat, Asha; Kanga, Ben; Kells, Cristyn; Khazanovich, Dmitry; Kieu, Alix Chinh; Kisner, Peter; Kumar, Mayank; Lance, Krista; Landers, Thomas; Lara, Marcia; Lee, William; Leger, Jean-Pierre; Lennon, Niall; Leuper, Lisa; LeVine, Sarah; Liu, Jinlei; Liu, Xiaohong; Lokyitsang, Yeshi; Lokyitsang, Tashi; Lui, Annie; Macdonald, Jan; Major, John; Marabella, Richard; Maru, Kebede; Matthews, Charles; McDonough, Susan; Mehta, Teena; Meldrim, James; Melnikov, Alexandre; Meneus, Louis; Mihalev, Atanas; Mihova, Tanya; Miller, Karen; Mittelman, Rachel; Mlenga, Valentine; Mulrain, Leonidas; Munson, Glen; Navidi, Adam; Naylor, Jerome; Nguyen, Tuyen; Nguyen, Nga; Nguyen, Cindy; Nguyen, Thu; Nicol, Robert; Norbu, Nyima; Norbu, Choe; Novod, Nathaniel; Nyima, Tenchoe; Olandt, Peter; O'Neill, Barry; O'Neill, Keith; Osman, Sahal; Oyono, Lucien; Patti, Christopher; Perrin, Danielle; Phunkhang, Pema; Pierre, Fritz; Priest, Margaret; Rachupka, Anthony; Raghuraman, Sujaa; Rameau, Rayale; Ray, Verneda; Raymond, Christina; Rege, Filip; Rise, Cecil; Rogers, Julie; Rogov, Peter; Sahalie, Julie; Settipalli, Sampath; Sharpe, Theodore; Shea, Terrance; Sheehan, Mechele; Sherpa, Ngawang; Shi, Jianying; Shih, Diana; Sloan, Jessie; Smith, Cherylyn; Sparrow, Todd; Stalker, John; Stange-Thomann, Nicole; Stavropoulos, Sharon; Stone, Catherine; Stone, Sabrina; Sykes, Sean; Tchuinga, Pierre; Tenzing, Pema; Tesfaye, Senait; Thoulutsang, Dawa; Thoulutsang, Yama; Topham, Kerri; Topping, Ira; Tsamla, Tsamla; Vassiliev, Helen; Venkataraman, Vijay; Vo, Andy; Wangchuk, Tsering; Wangdi, Tsering; Weiand, Michael; Wilkinson, Jane; Wilson, Adam; Yadav, Shailendra; Yang, Shuli; Yang, Xiaoping; Young, Geneva; Yu, Qing; Zainoun, Joanne; Zembek, Lisa; Zimmer, Andrew; Lander, Eric S
2005-12-08
Here we report a high-quality draft genome sequence of the domestic dog (Canis familiaris), together with a dense map of single nucleotide polymorphisms (SNPs) across breeds. The dog is of particular interest because it provides important evolutionary information and because existing breeds show great phenotypic diversity for morphological, physiological and behavioural traits. We use sequence comparison with the primate and rodent lineages to shed light on the structure and evolution of genomes and genes. Notably, the majority of the most highly conserved non-coding sequences in mammalian genomes are clustered near a small subset of genes with important roles in development. Analysis of SNPs reveals long-range haplotypes across the entire dog genome, and defines the nature of genetic diversity within and across breeds. The current SNP map now makes it possible for genome-wide association studies to identify genes responsible for diseases and traits, with important consequences for human and companion animal health.
2012-01-01
Background Evidence of the genetic association between CD36 candidate gene and the risk of metabolic syndrome and its components has been inconsistent. This case–control study assessed the haplotype-tagged SNPs from CD36 on the risk of metabolic syndrome and components. Methods and results We recruited 1,000 cases and age, gender-matched controls were randomly selected from the participants with metabolic syndrome defined by International Diabetes Federation. Overall, the haplotype tagged SNPs of CD36 gene were not related to the risk of metabolic syndrome. For individuals with normal lipid levels, several SNPs were significantly associated with the triglycerides and HDL-cholesterol levels: Subjects with rs3211848 homozygote had a higher triglyceride level (99.16 ± 2.61 mg/dL), compared with non-carriers (89.27 ± 1.45 mg/dL, P = 0.001). In addition, compared with non-carriers, individuals with rs1054516 heterozygous and homozygous genotypes had a significantly lower HDL-cholesterol (46.6 ± 0.46 mg/dL for non-carrier, 44.6 ± 0.36 mg/dL for heterozygous, and 44.3 ± 0.56 mg/dL for homozygous, P = 0.0008). Conclusion The CD36 gene variants were significantly associated with triglycerides and HDL-cholesterol concentrations among ethnic Chinese in Taiwan. PMID:23249574
Differential distribution of Y-chromosome haplotypes in Swiss and Southern European goat breeds.
Vidal, Oriol; Drögemüller, Cord; Obexer-Ruff, Gabriela; Reber, Irene; Jordana, Jordi; Martínez, Amparo; Bâlteanu, Valentin Adrian; Delgado, Juan Vicente; Eghbalsaied, Shahin; Landi, Vincenzo; Goyache, Felix; Traoré, Amadou; Pazzola, Michele; Vacca, Giuseppe Massimo; Badaoui, Bouabid; Pilla, Fabio; D'Andrea, Mariasilvia; Álvarez, Isabel; Capote, Juan; Sharaf, Abdoallah; Pons, Àgueda; Amills, Marcel
2017-11-23
The analysis of Y-chromosome variation has provided valuable clues about the paternal history of domestic animal populations. The main goal of the current work was to characterize Y-chromosome diversity in 31 goat populations from Central Eastern (Switzerland and Romania) and Southern Europe (Spain and Italy) as well as in reference populations from Africa and the Near East. Towards this end, we have genotyped seven single nucleotide polymorphisms (SNPs), mapping to the SRY, ZFY, AMELY and DDX3Y Y-linked loci, in 275 bucks from 31 populations. We have observed a low level of variability in the goat Y-chromosome, with just five haplotypes segregating in the whole set of populations. We have also found that Swiss bucks carry exclusively Y1 haplotypes (Y1A: 24%, Y1B1: 15%, Y1B2: 43% and Y1C: 18%), while in Italian and Spanish bucks Y2A is the most abundant haplotype (77%). Interestingly, in Carpathian goats from Romania the Y2A haplotype is also frequent (42%). The high Y-chromosome differentiation between Swiss and Italian/Spanish breeds might be due to the post-domestication spread of two different Near Eastern genetic stocks through the Danubian and Mediterranean corridors. Historical gene flow between Southern European and Northern African goats might have also contributed to generate such pattern of genetic differentiation.
Haplotypic Analysis of Wellcome Trust Case Control Consortium Data
Browning, Brian L.; Browning, Sharon R.
2008-01-01
We applied a recently developed multilocus association testing method (localized haplotype clustering) to Wellcome Trust Case Control Consortium data (14,000 cases of seven common diseases and 3,000 shared controls genotyped on the Affymetrix 500K array). After rigorous data quality filtering, we identified three disease-associated loci with strong statistical support from localized haplotype cluster tests but with only marginal significance in single marker tests. These loci are chromosomes 10p15.1 with type 1 diabetes (p = 5.1 × 10-9), 12q15 with type 2 diabetes (p = 1.9 × 10-7) and 15q26.2 with hypertension (p = 2.8 × 10-8). We also detected the association of chromosome 9p21.3 with type 2 diabetes (p = 2.8 × 10-8), although this locus did not pass our stringent genotype quality filters. The association of 10p15.1 with type 1 diabetes and 9p21.3 with type 2 diabetes have both been replicated in other studies using independent data sets. Overall, localized haplotype cluster analysis had better success detecting disease associated variants than a previous single-marker analysis of imputed HapMap SNPs. We found that stringent application of quality score thresholds to genotype data substantially reduced false-positive results arising from genotype error. In addition, we demonstrate that it is possible to simultaneously phase 16,000 individuals genotyped on genome-wide data (450K markers) using the Beagle software package. PMID:18224336
Ma, Jennie Z; Beuten, Joke; Payne, Thomas J; Dupont, Randolph T; Elston, Robert C; Li, Ming D
2005-06-15
DOPA decarboxylase (DDC; also known as L-amino acid decarboxylase; AADC) is involved in the synthesis of dopamine, norepinephrine and serotonin. Because the mesolimbic dopaminergic system is implicated in the reinforcing effects of many drugs, including nicotine, the DDC gene is considered a plausible candidate for involvement in the development of vulnerability to nicotine dependence (ND). Further, this gene is located within the 7p11 region that showed a 'suggestive linkage' to ND in our previous genome-wide scan in the Framingham Heart Study population. In the present study, we tested eight single nucleotide polymorphisms (SNPs) within DDC for association with ND, which was assessed by smoking quantity (SQ), the heaviness of smoking index (HSI) and the Fagerstrom test for ND (FTND) score, in a total of 2037 smokers and non-smokers from 602 nuclear families of African- or European-American (AA or EA, respectively) ancestry. Association analysis for individual SNPs using the PBAT-GEE program indicated that SNP rs921451 was significantly associated with two of the three adjusted ND measures in the EA sample (P=0.01-0.04). Haplotype-based association analysis revealed a protective T-G-T-G haplotype for rs921451-rs3735273-rs1451371-rs2060762 in the AA sample, which was significantly associated with all three adjusted ND measures after correction for multiple testing (min Z=-2.78, P=0.006 for HSI). In contrast, we found a high-risk T-G-T-G haplotype for a different SNP combination in the EA sample, rs921451-rs3735273-rs1451371-rs3757472, which showed a significant association after Bonferroni correction with the SQ and FTND score (max Z=2.73, P=0.005 for FTND). In summary, our findings provide the first evidence for the involvement of DDC in the susceptibility to ND and, further, reveal the racial specificity of its impact.
Liu, L B; Wu, C M; Wen, J; Chen, J L; Zheng, M Q; Zhao, G P
2009-03-01
Antibody titers raised for vaccinations against avian influenza (AI) and Newcastle disease (ND) were higher in Chinese Beijing-You (BJY) than in White Leghorn (WL) ( P < 0.001), but there was no breed difference in titers for sheep red blood cells (SRBC). Genotyping by PCR-SSCP identified seven haplotypes in WL and 17 in BJY. After sequencing PCR products (35 and 85, respectively), 43 (WL) and 47 (BJY) single nucleotide polymorphisms (SNPs) were found in the 264 bp of exon 2. In WL chickens, significant associations were found with antibody responses to AI (two SNPs), ND (six SNPs), and SRBC (one SNP), while in BJY there was association with responses to ND (two SNPs) and SRBC (two SNPs), but none with AI. These results indicate that the genomic region bearing exon 2 of the major histocompatibility complex B-F gene has significant effects on antibody responses to SRBC and vaccination against AI and ND. Different SNPs affected antibody titers for each of the antigens and they differed between these very distinct breeds.
Binder, Moritz; Zhang, Ben Y.; Hillman, David W.; Kohli, Rhea; Kohli, Tanvi; Lee, Adam; Kohli, Manish
2016-01-01
Treatment with abiraterone acetate and prednisone (AA/P) prolongs survival in metastatic castration-resistant prostate cancer (mCRPC) patients. We evaluated the genetic variation in CYP17A1 as predictive of response to AA/P. A prospective collection of germline DNA prior to AA/P initiation and follow-up of a mCRPC cohort was performed. Five common single-nucleotide polymorphisms (SNPs) in CYP17A1 identified using a haplotype-based tagging algorithm were genotyped. Clinical outcomes included biochemical response and time to biochemical progression on AA/P. Logistic regression was used to assess the association between tag SNPs and biochemical response. Proportional hazards regression was used to assess the association between tag SNPs and time to biochemical progression. Odds or hazard ratio per minor allele were estimated and p-values below 0.05 were considered statistically significant. Germline DNA was successfully genotyped for four tag SNPs in 87 patients. The median age was 73 years (54–90); the median prostate-specific antigen was 66 ng/dL (0.1–99.9). A single SNP, rs2486758, was associated with lower odds of experiencing a biochemical response (Odds ratio 0.22, 95% confidence interval 0.07–0.63, p = 0.005) and a shorter time to biochemical progression (Hazard ratio 2.23, 95% confidence interval 1.39–3.56, p < 0.001). This tag SNP located in the promoter region of CYP17A1 will need further validation as a predictive biomarker for AA/P therapy. PMID:27409606
Teixeira, Thallita Monteiro; da Silva, Hugo Delleon; Goveia, Rebeca Mota; Ribolla, Paulo Eduardo Martins; Alonso, Diego Peres; Alves, Alessandro Arruda; Melo E Silva, Daniela; Collevatti, Rosane Garcia; Bicudo, Lucilene Arilho; Bérgamo, Nádia Aparecida; de Paula Silveira-Lacerda, Elisângela
2017-12-01
Worldwide, different studies have reported an association of alcohol-use disorder (AUD) with different types of Single Nucleotide Polymorphisms (SNPs) in the genes for aldehyde dehydrogenase (ALDH) and alcohol dehydrogenase (ADH). In Brazil, there is little information about the occurrence of these SNPs in the AUD population and an absence of studies characterizing the population in the Central-West Region of Brazil. Actually, in Brazil, there are more than 4 million people with AUD. Despite the major health hazards of AUD, information on alcohol consumption and its consequences are not well understood. Therefore, it is extremely important to characterize these SNPs for the better understanding of AUD as a genetic disease in the Brazilian population. The present study, unlike other studies in other countries, is done with a subject population that shows a significant amount of racial homogenization. We evaluated the presence of SNPs in the ADH (ADH1B, ADH1C, and ADH4) and ALDH (ALDH2) genes in alcohol users of Goiânia, State of Goiás - Brazil, and then we established a possible relationship with AUD by allelic and genotypic study. This study was conducted with a population of people with AUD (n = 99) from Goiás Alcohol Dependence Recovery Center (GO CEREA) and Psychosocial Care Center for Alcohol and Drugs (CAPS AD), and with a population of people without AUD as controls (n = 100). DNA was extracted from whole-blood samples and the genotyping was performed using TaqMan ® SNP genotyping assays. For characterization and evaluation of SNPs in the population, genotype frequency, allele frequency, haplotype frequency, Hardy-Weinberg equilibrium, and linkage disequilibrium were analyzed. Statistical analyses were calculated by GENEPOP 4.5 and Haploview software. The allele 1 was considered as "wild" (or *1) and allele 2 as mutant (or *2). Significant differences were found for ADH1B*, ADH4*2, and ALDH2*2 SNPs when the genotype and allele frequencies were
Association between Psoriasis and haplotypes of the IgH 3' Regulatory Region 1.
D'Addabbo, Pietro; Serone, Eliseo; Esposito, Maria; Vaccari, Gabriele; Gargioli, Cesare; Frezza, Domenico; Bianchi, Luca
2018-08-30
The association studies of several immune-diseases with the 3' Regulatory Region 1 (3'RR1) increased interest on the role that the region plays in the immune-regulation. The 3'RR1 is a polymorphic region on human chromosome 14q32, acting as a cis-regulative element on the Immunoglobulin constant-gene locus recently considered as super-enhancer. The human 3'RR1 share large sequences with its paralogous 3'RR2, at high level of similarity. Thus, a focused investigation was necessary to discriminate each one of the duplicated components of the two regions and its specific contribution to the immunologic phenotype. One of the duplicated elements is the hs1.2 enhancer. The 3'RR1 alleles of this enhancer were demonstrated to play a role in autoimmune diseases, including Psoriasis. We sequenced a specific region internal to the 3'RR1 in hs1.2 homozygous subjects, to detect SNPs associated to the main alleles of the enhancer. We identified two alternative nine-SNPs haplotypes strictly linked to the allele *1 and *2 of hs1.2, that could be used as markers to further investigate the region and associations to pathology. Finally, we identified two haplotypes, namely E2A1 and E2A2, that strongly support the hypothesis of a relevant effect of the rs35216181 in the onset of Psoriasis when the *2 allele is present. Copyright © 2018 Elsevier B.V. All rights reserved.
Lerer, E; Levi, S; Salomon, S; Darvasi, A; Yirmiya, N; Ebstein, R P
2008-10-01
Evidence both from animal and human studies suggests that common polymorphisms in the oxytocin receptor (OXTR) gene are likely candidates to confer risk for autism spectrum disorders (ASD). In lower mammals, oxytocin is important in a wide range of social behaviors, and recent human studies have shown that administration of oxytocin modulates behavior in both clinical and non-clinical groups. Additionally, two linkage studies and two recent association investigations also underscore a possible role for the OXTR gene in predisposing to ASD. We undertook a comprehensive study of all 18 tagged SNPs across the entire OXTR gene region identified using HapMap data and the Haploview algorithm. Altogether 152 subjects diagnosed with ASDs (that is, DSM IV autistic disorder or pervasive developmental disorder--NOS) from 133 families were genotyped (parents and affected siblings). Both individual SNPs and haplotypes were tested for association using family-based association tests as provided in the UNPHASED set of programs. Significant association with single SNPs and haplotypes (global P-values <0.05, following permutation test adjustment) were observed with ASD. Association was also observed with IQ and the Vineland Adaptive Behavior Scales (VABS). In particular, a five-locus haplotype block (rs237897-rs13316193-rs237889-rs2254298-rs2268494) was significantly associated with ASD (nominal global P=0.000019; adjusted global P=0.009) and a single haplotype (carried by 7% of the population) within that block showed highly significant association (P=0.00005). This is the third association study, in a third ethnic group, showing that SNPs and haplotypes in the OXTR gene confer risk for ASD. The current investigation also shows association with IQ and total VABS scores (as well as the communication, daily living skills and socialization subdomains), suggesting that this gene shapes both cognition and daily living skills that may cross diagnostic boundaries.
Guo, Fei; Zhou, Yishu; Song, He; Zhao, Jinling; Shen, Hongying; Zhao, Bin; Liu, Feng; Jiang, Xianhua
2016-11-01
polymorphisms. Forensic parameters were calculated as >99.999% for combined discrimination power (CDP), 0.999999724 for combined power of exclusion (CPE), 1.390×10 11 for combined likelihood ratio (CLR) of trios, and 2.361×10 6 for CLR of motherless duos. For Y-SNPs, a total of 8 haplotypes were observed with the value of 0.684 for haplotype diversity. As a whole, the HID Identity Panel is a well-performed, robust, reliable and high informative NGS-SNP assay and it can fully meet requirements for individual identification and paternity testing in forensic science. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Gao, Yangchun; Li, Shiguo; Zhan, Aibin
2018-04-01
Invasive species cause huge damages to ecology, environment and economy globally. The comprehensive understanding of invasion mechanisms, particularly genetic bases of micro-evolutionary processes responsible for invasion success, is essential for reducing potential damages caused by invasive species. The golden star tunicate, Botryllus schlosseri, has become a model species in invasion biology, mainly owing to its high invasiveness nature and small well-sequenced genome. However, the genome-wide genetic markers have not been well developed in this highly invasive species, thus limiting the comprehensive understanding of genetic mechanisms of invasion success. Using restriction site-associated DNA (RAD) tag sequencing, here we developed a high-quality resource of 14,119 out of 158,821 SNPs for B. schlosseri. These SNPs were relatively evenly distributed at each chromosome. SNP annotations showed that the majority of SNPs (63.20%) were located at intergenic regions, and 21.51% and 14.58% were located at introns and exons, respectively. In addition, the potential use of the developed SNPs for population genomics studies was primarily assessed, such as the estimate of observed heterozygosity (H O ), expected heterozygosity (H E ), nucleotide diversity (π), Wright's inbreeding coefficient (F IS ) and effective population size (Ne). Our developed SNP resource would provide future studies the genome-wide genetic markers for genetic and genomic investigations, such as genetic bases of micro-evolutionary processes responsible for invasion success.
Stolerman, Elliot S.; Manning, Alisa K.; McAteer, Jarred B.; Dupuis, Josée; Fox, Caroline S.; Cupples, L. Adrienne; Meigs, James B.; Florez, Jose C.
2008-01-01
OBJECTIVE—A recent meta-analysis demonstrated a nominal association of the ectonucleotide pyrophosphatase phosphodiesterase 1 (ENPP1) K→Q missense single nucleotide polymorphism (SNP) at position 121 with type 2 diabetes. We set out to confirm the association of ENPP1 K121Q with hyperglycemia, expand this association to insulin resistance traits, and determine whether the association stems from K121Q or another variant in linkage disequilibrium with it. RESEARCH DESIGN AND METHODS—We characterized the haplotype structure of ENPP1 and selected 39 tag SNPs that captured 96% of common variation in the region (minor allele frequency ≥5%) with an r2 value ≥0.80. We genotyped the SNPs in 2,511 Framingham Heart Study participants and used age- and sex-adjusted linear mixed effects (LME) models to test for association with quantitative metabolic traits. We also examined whether interaction between K121Q and BMI affected glycemic trait levels. RESULTS—The Q allele of K121Q (rs1044498) was associated with increased fasting plasma glucose (FPG), A1C, fasting insulin, and insulin resistance by homeostasis model assessment (HOMA-IR; all P = 0.01–0.006). Two noncoding SNPs (rs7775386 and rs7773477) demonstrated similar associations, but LME models indicated that their effects were not independent from K121Q. We found no association of K121Q with obesity, but interaction models suggested that the effect of the Q allele on FPG and HOMA-IR was stronger in those with a higher BMI (P = 0.008 and 0.01 for interaction, respectively). CONCLUSIONS—The Q allele of ENPP1 K121Q is associated with hyperglycemia and insulin resistance in whites. We found an adiposity-SNP interaction, with a stronger association of K121Q with diabetes-related quantitative traits in people with a higher BMI. PMID:18426862
Li, F; Chen, H; Lei, C Z; Ren, G; Wang, J; Li, Z J; Wang, J Q
2010-01-01
In this study, polymorphism in the exon 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11 of bovine NUCB2 gene was detected by PCR-SSCP and DNA sequencing methods in 686 individuals from three Chinese cattle breeds. Two haplotypes (M and N), three observed genotypes (MM, MN and NN) and two SNPs (NC_007313: g. 27451G>A, NC_007313: g. 27472T>C) were detected. The frequencies of haplotypes M and N in inland Chinese three breeds were 0.531-0.721 and 0.279-0.469 respectively. The studied showed that Nanyang, Jiaxian Red and Qinchuan cattle populations were in Hardy-Weinberg equilibrium at SNPs locus of NUCB2 gene (P > 0.05). Polymorphism of the NUCB2 gene was shown to be associated with growth traits in Qingchuan and Nanyang cattle breed. The linkage of two mutant sites in the bovine NUCB2 gene had significant effects on body length, body weight, heart girth, and average daily gain at 24 months (P < 0.05). Results of this study suggested that the NUCB2-gene-specific SNP may be a useful marker for growth traits in future marker-assisted selection programmes in inland Chinese cattle.
Zhang, N N; Hu, J W; Liu, H H; Xu, H Y; He, H; Li, L
2015-12-29
Tyrosinase, encoded by the TYR gene, is the rate-limiting enzyme in the production of melanin pigment. In this study, plumage color separation was observed in Cherry Valley duck line D and F1 and F2 hybrid generations of Liancheng white ducks. Gene sequencing and bioinformatic analysis were applied to the 5'-regulatory region of TYR, to explore the connection between TYR sequence variation and duck plumage color. Four SNPs were found in the 5'-regulatory region. The SNPs were in tight linkage and formed three haplotypes. However, the genotype distribution in groups with different plumage color was not significantly different, and there were no changes in the transcription factor binding sites between the different genotypes. In conclusion, these SNP variations may not cause the differences in feather color observed in this test group.
Kujur, Alice; Upadhyaya, Hari D.; Shree, Tanima; Bajaj, Deepak; Das, Shouvik; Saxena, Maneesha S.; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. L.; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.
2015-01-01
We discovered 26785 and 16573 high-quality SNPs differentiating two parental genotypes of a RIL mapping population using reference desi and kabuli genome-based GBS assay. Of these, 3625 and 2177 SNPs have been integrated into eight desi and kabuli chromosomes, respectively in order to construct ultra-high density (0.20–0.37 cM) intra-specific chickpea genetic linkage maps. One of these constructed high-resolution genetic map has potential to identify 33 major genomic regions harbouring 35 robust QTLs (PVE: 17.9–39.7%) associated with three agronomic traits, which were mapped within <1 cM mean marker intervals on desi chromosomes. The extended LD (linkage disequilibrium) decay (~15 cM) in chromosomes of genetic maps have encouraged us to use a rapid integrated approach (comparative QTL mapping, QTL-region specific haplotype/LD-based trait association analysis, expression profiling and gene haplotype-based association mapping) rather than a traditional QTL map-based cloning method to narrow-down one major seed weight (SW) robust QTL region. It delineated favourable natural allelic variants and superior haplotype-containing one seed-specific candidate embryo defective gene regulating SW in chickpea. The ultra-high-resolution genetic maps, QTLs/genes and alleles/haplotypes-related genomic information generated and integrated strategy for rapid QTL/gene identification developed have potential to expedite genomics-assisted breeding applications in crop plants, including chickpea for their genetic enhancement. PMID:25942004
2014-01-01
Background Numerous quantitative trait loci (QTL) have been detected in pigs over the past 20 years using microsatellite markers. However, due to the low density of these markers, the accuracy of QTL location has generally been poor. Since 2009, the dense genome coverage provided by the Illumina PorcineSNP60 BeadChip has made it possible to more accurately map QTL using genome-wide association studies (GWAS). Our objective was to perform high-density GWAS in order to identify genomic regions and corresponding haplotypes associated with production traits in a French Large White population of pigs. Methods Animals (385 Large White pigs from 106 sires) were genotyped using the PorcineSNP60 BeadChip and evaluated for 19 traits related to feed intake, growth, carcass composition and meat quality. Of the 64 432 SNPs on the chip, 44 412 were used for GWAS with an animal mixed model that included a regression coefficient for the tested SNPs and a genomic kinship matrix. SNP haplotype effects in QTL regions were then tested for association with phenotypes following phase reconstruction based on the Sscrofa10.2 pig genome assembly. Results Twenty-three QTL regions were identified on autosomes and their effects ranged from 0.25 to 0.75 phenotypic standard deviation units for feed intake and feed efficiency (four QTL), carcass (12 QTL) and meat quality traits (seven QTL). The 10 most significant QTL regions had effects on carcass (chromosomes 7, 10, 16, 17 and 18) and meat quality traits (two regions on chromosome 1 and one region on chromosomes 8, 9 and 13). Thirteen of the 23 QTL regions had not been previously described. A haplotype block of 183 kb on chromosome 1 (six SNPs) was identified and displayed three distinct haplotypes with significant (0.0001 < P < 0.03) associations with all evaluated meat quality traits. Conclusions GWAS analyses with the PorcineSNP60 BeadChip enabled the detection of 23 QTL regions that affect feed consumption, carcass and meat
Identification of single nucleotide polymorphism in ginger using expressed sequence tags
Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J
2009-01-01
Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184
Wu, Pingsheng; Larkin, Emma K; Reiss, Sara S; Carroll, Kecia N; Summar, Marshall L; Minton, Patricia A; Woodward, Kimberly B; Liu, Zhouwen; Islam, Jessica Y; Hartert, Tina V; Moore, Paul E
2015-09-14
Despite the significant interest in β2-Adrenergic receptor (ADRB2) polymorphisms related to asthma, whether ADRB2 genetic variants are similarly associated with acute respiratory tract infections have not been studied. We hypothesized that genetic variants in ADRB2 associated with a response to asthma therapy during an asthma exacerbation were also associated with severity of acute respiratory tract infections. To test this hypothesis, we genotyped 5 common polymorphisms in the promoter region and coding block of the ADRB2 gene (loci -2387, -2274, -1343, +46, and +79) from 374 Caucasian and African American term infants who were enrolled at the time of acute respiratory illness over four respiratory viral seasons. Severity of respiratory tract infections was measured using a bronchiolitis severity score (BSS; range = 0-12, clinically significant difference = 0.5) with a higher score indicating more severe disease. We assigned the promoter, coding and combined promoter and coding haplotypes to the unphased genotype data. The associations between each of these five single-nucleotide polymorphisms (SNPs) as well as the haplotypes and infant BSS were analyzed using nonparametric univariate analysis and multivariable proportional odds model separately in Caucasians and African Americans. There was no significant association between infant BSS and each of the SNPs in both Caucasians and African Americans. However, promoter haplotype CCA was associated with a decreased BSS in African Americans in a dose dependent manner. The median (interquartile range) BSS of infants with no copies of the CCA haplotype, one copy, and two copies of the CCA haplotype were 5.5 (2.0, 8.0), 4.0 (1.0, 7.5), and 3.0 (1.0, 4.0), respectively. This dose dependent relationship persisted after adjusting for infant age, gender, daycare exposure, secondhand smoke exposure, prior history of breastfeeding, siblings at home, and enrollment season (adjusted odds ratio: 0.59, 95% confidence
An omnibus test for family-based association studies with multiple SNPs and multiple phenotypes.
Lasky-Su, Jessica; Murphy, Amy; McQueen, Matthew B; Weiss, Scott; Lange, Christoph
2010-06-01
We propose an omnibus family-based association test (MFBAT) that can be applied to multiple markers and multiple phenotypes and that has only one degree of freedom. The proposed test statistic extends current FBAT methodology to incorporate multiple markers as well as multiple phenotypes. Using simulation studies, power estimates for the proposed methodology are compared with the standard methodologies. On the basis of these simulations, we find that MFBAT substantially outperforms other methods, including haplotypic approaches and doing multiple tests with single single-nucleotide polymorphisms (SNPs) and single phenotypes. The practical relevance of the approach is illustrated by an application to asthma in which SNP/phenotype combinations are identified and reach overall significance that would not have been identified using other approaches. This methodology is directly applicable to cases in which there are multiple SNPs, such as candidate gene studies, cases in which there are multiple phenotypes, such as expression data, and cases in which there are multiple phenotypes and genotypes, such as genome-wide association studies that incorporate expression profiles as phenotypes. This program is available in the PBAT analysis package.
TagDigger: user-friendly extraction of read counts from GBS and RAD-seq data.
Clark, Lindsay V; Sacks, Erik J
2016-01-01
In genotyping-by-sequencing (GBS) and restriction site-associated DNA sequencing (RAD-seq), read depth is important for assessing the quality of genotype calls and estimating allele dosage in polyploids. However, existing pipelines for GBS and RAD-seq do not provide read counts in formats that are both accurate and easy to access. Additionally, although existing pipelines allow previously-mined SNPs to be genotyped on new samples, they do not allow the user to manually specify a subset of loci to examine. Pipelines that do not use a reference genome assign arbitrary names to SNPs, making meta-analysis across projects difficult. We created the software TagDigger, which includes three programs for analyzing GBS and RAD-seq data. The first script, tagdigger_interactive.py, rapidly extracts read counts and genotypes from FASTQ files using user-supplied sets of barcodes and tags. Input and output is in CSV format so that it can be opened by spreadsheet software. Tag sequences can also be imported from the Stacks, TASSEL-GBSv2, TASSEL-UNEAK, or pyRAD pipelines, and a separate file can be imported listing the names of markers to retain. A second script, tag_manager.py, consolidates marker names and sequences across multiple projects. A third script, barcode_splitter.py, assists with preparing FASTQ data for deposit in a public archive by splitting FASTQ files by barcode and generating MD5 checksums for the resulting files. TagDigger is open-source and freely available software written in Python 3. It uses a scalable, rapid search algorithm that can process over 100 million FASTQ reads per hour. TagDigger will run on a laptop with any operating system, does not consume hard drive space with intermediate files, and does not require programming skill to use.
Han, Xia; Liu, Lili; Niu, Jiamin; Yang, Jun; Zhang, Zengtang; Zhang, Zhiqiang
2015-01-01
Our aim was to investigate the association between single nucleotide polymorphisms (SNPs) of vascular endothelial growth factor (VEGF) and coronary heart disease (CHD) susceptibility in Chinese Han population. 144 CHD patients and 150 healthy individuals were enrolled in the study. Three SNPs (936C/T, -460T/C and -634G/C) of VEGF were chose and then were genotyped with Sequenom time-of-flight mass spectrometry (TOFMS). Odds ratio (OR) with 95% confidence interval (CI) were used to evaluate the association of genotypes and haplotypes and CHD susceptibility. The frequencies of -460T/C CC genotype (13.6%) was found higher in the case group than that of control group (6.7%), which indicated that CC genotype was a risk factor for CHD (OR=2.50, 95% CI=1.10-5.68). Correspondently, the C allele appeared to increase the risk of CHD (OR=1.54, 95% CI=1.07-2.22). For -634G/C polymorphism, the risk of the CC genotype carrier for CHD increased 2.24 fold compared to the wild genotype. Moreover, -634G/CC allele was significantly associated with CHD susceptibility (OR=1.65, 95% CI=1.15-2.36). In addition, +936C/T CT genotype and C allele appeared to be a genetic-susceptibility factors for CHD (OR=2.43, 95% CI=1.44-4.10; OR=1.95, 95% CI=1.26-3.02). The haplotype analysis showed that T-C-T, C-C-C and C-G-C haplotypes all could increase the risk for CHD (OR: 2.43, 2.77 and 2.33). we concluded VEGF polymorphisms were associated with CHD susceptibility. Moreover, the haplotypes of T-C-T, C-C-C and C-G-C all could increase the risk for CHD.
Wu, Zhikun; Wang, Bo; Chen, Xun; Wu, Jiangsheng; King, Graham J; Xiao, Yingjie; Liu, Kede
2016-01-01
High-density genetic markers are the prerequisite for understanding linkage disequilibrium (LD) and genome-wide association studies (GWASs) of complex traits in crops. To evaluate the LD pattern in oilseed rape, we sequenced a previous association panel containing 189 B. napus inbred lines using double-digested restriction-site associated DNA (ddRAD) and genotyped 19,327 RAD tags. A total of 15,921 RAD tags were assigned to a published genetic linkage map and the majority (71.1%) of these tags was uniquely mapped to the draft reference genome "Darmor-bzh." The distance of LD decay was 1,214 kb across the genome at the background level (r2 = 0.26), with the distances of LD decay being 405 kb and 2,111 kb in the A and C subgenomes, respectively. A total of 361 haplotype blocks with length > 100 kb were identified in the entire genome. The association panel could be classified into two groups, P1 and P2, which are essentially consistent with the geographical origins of varieties. A large number of group-specific haplotypes were identified, reflecting that varieties in the P1 and P2 groups experienced distinct selection in breeding programs to adapt their different growth habitats. GWAS repeatedly detected two loci significantly associated with oil content of seeds based on the developed SNPs, suggesting that the high-density SNPs were useful for understanding the genetic determinants of complex traits in GWAS.
Patel, Alpa V; Cheng, Iona; Canzian, Federico; Le Marchand, Loïc; Thun, Michael J; Berg, Christine D; Buring, Julie; Calle, Eugenia E; Chanock, Stephen; Clavel-Chapelon, Francoise; Cox, David G; Dorronsoro, Miren; Dossus, Laure; Haiman, Christopher A; Hankinson, Susan E; Henderson, Brian E; Hoover, Robert; Hunter, David J; Kaaks, Rudolf; Kolonel, Laurence N; Kraft, Peter; Linseisen, Jakob; Lund, Eiliv; Manjer, Jonas; McCarty, Catherine; Peeters, Petra H M; Pike, Malcolm C; Pollak, Michael; Riboli, Elio; Stram, Daniel O; Tjonneland, Anne; Travis, Ruth C; Trichopoulos, Dimitrios; Tumino, Rosario; Yeager, Meredith; Ziegler, Regina G; Feigelson, Heather Spencer
2008-07-02
IGF-1 has been shown to promote proliferation of normal epithelial breast cells, and the IGF pathway has also been linked to mammary carcinogenesis in animal models. We comprehensively examined the association between common genetic variation in the IGF1, IGFBP1, and IGFBP3 genes in relation to circulating IGF-I and IGFBP-3 levels and breast cancer risk within the NCI Breast and Prostate Cancer Cohort Consortium (BPC3). This analysis included 6,912 breast cancer cases and 8,891 matched controls (n = 6,410 for circulating IGF-I and 6,275 for circulating IGFBP-3 analyses) comprised primarily of Caucasian women drawn from six large cohorts. Linkage disequilibrium and haplotype patterns were characterized in the regions surrounding IGF1 and the genes coding for two of its binding proteins, IGFBP1 and IGFBP3. In total, thirty haplotype-tagging single nucleotide polymorphisms (htSNP) were selected to provide high coverage of common haplotypes; the haplotype structure was defined across four haplotype blocks for IGF1 and three for IGFBP1 and IGFBP3. Specific IGF1 SNPs individually accounted for up to 5% change in circulating IGF-I levels and individual IGFBP3 SNPs were associated up to 12% change in circulating IGFBP-3 levels, but no associations were observed between these polymorphisms and breast cancer risk. Logistic regression analyses found no associations between breast cancer and any htSNPs or haplotypes in IGF1, IGFBP1, or IGFBP3. No effect modification was observed in analyses stratified by menopausal status, family history of breast cancer, body mass index, or postmenopausal hormone therapy, or for analyses stratified by stage at diagnosis or hormone receptor status. In summary, the impact of genetic variation in IGF1 and IGFBP3 on circulating IGF levels does not appear to substantially influence breast cancer risk substantially among primarily Caucasian postmenopausal women.
An unusual haplotype structure on human chromosome 8p23 derived from the inversion polymorphism.
Deng, Libin; Zhang, Yuezheng; Kang, Jian; Liu, Tao; Zhao, Hongbin; Gao, Yang; Li, Chaohua; Pan, Hao; Tang, Xiaoli; Wang, Dunmei; Niu, Tianhua; Yang, Huanming; Zeng, Changqing
2008-10-01
Chromosomal inversion is an important type of genomic variations involved in both evolution and disease pathogenesis. Here, we describe the refined genetic structure of a 3.8-Mb inversion polymorphism at chromosome 8p23. Using HapMap data of 1,073 SNPs generated from 209 unrelated samples from CEPH-Utah residents with ancestry from northern and western Europe (CEU); Yoruba in Ibadan, Nigeria (YRI); and Asian (ASN) samples, which were comprised of Han Chinese from Beijing, China (CHB) and Japanese from Tokyo, Japan (JPT)-we successfully deduced the inversion orientations of all their 418 haplotypes. In particular, distinct haplotype subgroups were identified based on principal component analysis (PCA). Such genetic substructures were consistent with clustering patterns based on neighbor-joining tree reconstruction, which revealed a total of four haplotype clades across all samples. Metaphase fluorescence in situ hybridization (FISH) in a subset of 10 HapMap samples verified their inversion orientations predicted by PCA or phylogenetic tree reconstruction. Positioning of the outgroup haplotype within one of YRI clades suggested that Human NCBI Build 36-inverted order is most likely the ancestral orientation. Furthermore, the population differentiation test and the relative extended haplotype homozygosity (REHH) analysis in this region discovered multiple selection signals, also in a population-specific manner. A positive selection signal was detected at XKR6 in the ASN population. These results revealed the correlation of inversion polymorphisms to population-specific genetic structures, and various selection patterns as possible mechanisms for the maintenance of a large chromosomal rearrangement at 8p23 region during evolution. In addition, our study also showed that haplotype-based clustering methods, such as PCA, can be applied in scanning for cryptic inversion polymorphisms at a genome-wide scale.
Very long haplotype tracts characterized at high resolution from HLA homozygous cell lines
Norman, Paul J.; Norberg, Steve; Nemat-Gorgani, Neda; Royce, Thomas; Hollenbach, Jill A.; Won, Melissa Shults; Guethlein, Lisbeth A.; Gunderson, Kevin L.; Ronaghi, Mostafa; Parham, Peter
2015-01-01
The HLA region of chromosome 6 contains the most polymorphic genes in humans. Spanning ~5Mbp the densely packed region encompasses approximately 175 expressed genes including the highly polymorphic HLA class I and II loci. Most of the other genes and functional elements are also polymorphic, and many of them are directly implicated in immune function or immune-related disease. For these reasons this complex genomic region is subject to intense scrutiny by researchers with the common goal of aiding further understanding and diagnoses of multiple immune-related diseases and syndromes. To aid assay development and characterization of the classical loci, a panel of cell lines partially or fully homozygous for HLA class I and II was assembled over time by the International Histocompatibility Working Group (IHWG). Containing a minimum of 88 unique HLA haplotypes, we show this panel represents a significant proportion of European HLA allelic and haplotype diversity (60–95%). Using a high-density whole genome array that includes 13,331 HLA region SNPs, we analyzed 99 IHWG cells to map the coordinates of the homozygous tracts at a fine scale. The mean homozygous tract length within chromosome 6 from these individuals is 21Mbp. Within HLA the mean haplotype length is 4.3Mbp, and 65% of the cell lines were shown to be homozygous throughout the entire region. In addition, four cell lines are homozygous throughout the complex KIR region of chromosome 19 (~250kbp). The data we describe will provide a valuable resource for characterizing haplotypes, designing and refining imputation algorithms and developing assay controls. PMID:26198775
Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei
2018-01-01
DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.
Pereira, Rinaldo Wellerson; Pena, Sérgio D J
2006-01-01
We studied five microsatellites (DXS995, DXS8076, DXS8114, DXS1002 and DXS1050) located in a region of very low recombination rate in the long arm of the human X chromosome (Xq13.3-Xq21.3). No recombination was seen in 291 meioses in CEPH families. To test whether haplotypes composed of the five microsatellites could differentiate among distinct human continental populations, we studied an international panel containing 72 males from Africa, Europe, Asia and the America. Haplotypic diversity was very high within these groups and no haplotypes were shared among them. This led to the hope that we might be able to identify continent-specific lineages. However, in a median joining network there was no clear discrimination of the different continental groups. We then tested whether we could identify X chromosomal lineages from different continental origins in Brazilians. We typed 180 white Brazilians from four different geographical regions and examined their proportions of haplotype sharing with Africans, Asians, Europeans and Amerindians. No phylogeographical patterns emerged from the data. Moreover, there were several instances of the same haplotype being shared by many (and in one instance all) groups, suggesting that recombination might be occurring. We thus studied pairwise the level of linkage disequilibrium (LD) between the microsatellites. No detectable linkage disequilibrium between the most external loci DXS995 and DXS1050 was observed. Thus, even though recombination may be absent on short time spans, as seen in the CEPH pedigrees, on a long term basis it occurs often enough to dissipate all linkage disequilibrium. On the other hand, we observed very strong linkage disequilibrium between the pairs DXS995/DXS8076 and DXS1002/DXS8114, raising the possibility of resequencing the segment between them to identify single nucleotide polymorphisms (SNPs) in their intervals. The combination of X-linked microsatellites and SNPs in strong linkage disequilibrium might
Hansen, Rikke D; Sørensen, Mette; Tjønneland, Anne; Overvad, Kim; Wallin, Håkan; Raaschou-Nielsen, Ole; Vogel, Ulla
2008-02-20
Single nucleotide polymorphisms (SNPs) are the most frequent type of genetic variation in the human genome, and are of interest for the study of susceptibility to and protection from diseases. The haplotype at chromosome 19q13.2-3 encompassing the three SNPs ASE-1 G-21A, RAI IVS1 A4364G and ERCC1 Asn118Asn have been associated with risk of breast cancer and lung cancer. Haplotype carriers are defined as the homozygous carriers of RAI IVS1 A4364GA, ERCC1 Asn118AsnT and ASE-1 G-21AG. We aimed to evaluate whether the three polymorphisms and the haplotype are associated to risk of colorectal cancer, and investigated gene-environment associations between the polymorphisms and the haplotype and smoking status at enrolment, smoking duration, average smoking intensity and alcohol consumption, respectively, in relation to risk of colorectal cancer. Associations between the three individual polymorphisms, the haplotype and risk of colorectal cancer were examined, as well as gene-environment interaction, in a Danish case-cohort study including 405 cases and a comparison group of 810 persons. Incidence rate ratio (IRR) were estimated by the Cox proportional hazards model stratified according to gender, and two-sided 95% confidence intervals (CI) and p-values were calculated based on robust estimates of the variance-covariance matrix and Wald's test of the Cox regression parameter. No consistent associations between the three individual polymorphisms, the haplotype and risk of colorectal cancer were found. No statistically significant interactions between the genotypes and the lifestyle exposures smoking or alcohol consumption were observed. Our results suggest that the ASE-1 G-21A, RAI IVS1 A4364G and ERCC1 Asn118Asn polymorphisms and the previously identified haplotype are not associated with risk of colorectal cancer. We found no evidence of gene-environment interaction between the three polymorphisms and the haplotype and smoking intensity and alcohol consumption
Yamamoto, Toshio; Nagasaki, Hideki; Yonemaru, Jun-ichi; Ebana, Kaworu; Nakajima, Maiko; Shibaya, Taeko; Yano, Masahiro
2010-04-27
To create useful gene combinations in crop breeding, it is necessary to clarify the dynamics of the genome composition created by breeding practices. A large quantity of single-nucleotide polymorphism (SNP) data is required to permit discrimination of chromosome segments among modern cultivars, which are genetically related. Here, we used a high-throughput sequencer to conduct whole-genome sequencing of an elite Japanese rice cultivar, Koshihikari, which is closely related to Nipponbare, whose genome sequencing has been completed. Then we designed a high-throughput typing array based on the SNP information by comparison of the two sequences. Finally, we applied this array to analyze historical representative rice cultivars to understand the dynamics of their genome composition. The total 5.89-Gb sequence for Koshihikari, equivalent to 15.7 x the entire rice genome, was mapped using the Pseudomolecules 4.0 database for Nipponbare. The resultant Koshihikari genome sequence corresponded to 80.1% of the Nipponbare sequence and led to the identification of 67,051 SNPs. A high-throughput typing array consisting of 1917 SNP sites distributed throughout the genome was designed to genotype 151 representative Japanese cultivars that have been grown during the past 150 years. We could identify the ancestral origin of the pedigree haplotypes in 60.9% of the Koshihikari genome and 18 consensus haplotype blocks which are inherited from traditional landraces to current improved varieties. Moreover, it was predicted that modern breeding practices have generally decreased genetic diversity Detection of genome-wide SNPs by both high-throughput sequencer and typing array made it possible to evaluate genomic composition of genetically related rice varieties. With the aid of their pedigree information, we clarified the dynamics of chromosome recombination during the historical rice breeding process. We also found several genomic regions decreasing genetic diversity which might be
Wujcicka, Wioletta Izabela; Wilczyński, Jan Szczęsny; Nowakowska, Dorota Ewa
2017-05-01
The study was aimed to estimate the role and prevalence rates of genotypes, haplotypes, and alleles, located within the single-nucleotide polymorphisms (SNPs) of interleukin (IL) 1A, IL1B, and IL6 genes, in the occurrence and development of human cytomegalovirus (HCMV) infection among pregnant women. A research was conducted in 129 pregnant women, out of whom, 65 were HCMV infected and 64 were age-matched control uninfected individuals. HCMV DNA was quantitated for UL55 gene by the real-time Q PCR in the body fluids. The genotypic statuses within the SNPs were determined by nested PCR-RFLP assays and confirmed, by sequencing for randomly selected representative PCR products. A relationship between the genotypes and alleles, as well as haplotypes and multiple variants in the studied polymorphisms, and the occurrence of HCMV infection in pregnant women, was determined using a logistic regression model. TT genotype within IL1A polymorphism significantly decreased the risk of HCMV infection (OR 0.32, 95% CI 0.09-1.05; p ≤ 0.050). Considering IL6 SNP, the prevalence rate of GC genotype was significantly decreased among the HCMV infected, compared to the uninfected control individuals (OR 0.45, 95% CI 0.21-0.99; p ≤ 0.050). Moreover, CC homozygotic status in IL6 SNP, found in pregnant women, significantly decreased the risk of congenital infection with HCMV in their offsprings (OR 0.12; p ≤ 0.050). In multiple SNP analysis, TC haplotype within the IL1 polymorphisms significantly decreased the risk of the infection in pregnant women (OR 0.38 95% CI 0.15-0.96; p ≤ 0.050). In addition, TTG complex variants for all the studied polymorphisms and TG variants for IL1B and IL6 SNPs were significantly more prevalent among the infected offsprings with symptomatic congenital cytomegaly than among the asymptomatic cases (p ≤ 0.050). In conclusion, the analyzed IL1A -889 C>T, IL1B +3954 C>T, and IL6 -174 G>C polymorphisms may be associated with the
HLA Type Inference via Haplotypes Identical by Descent
NASA Astrophysics Data System (ADS)
Setty, Manu N.; Gusev, Alexander; Pe'Er, Itsik
The Human Leukocyte Antigen (HLA) genes play a major role in adaptive immune response and are used to differentiate self antigens from non self ones. HLA genes are hyper variable with nearly every locus harboring over a dozen alleles. This variation plays an important role in susceptibility to multiple autoimmune diseases and needs to be matched on for organ transplantation. Unfortunately, HLA typing by serological methods is time consuming and expensive compared to high throughput Single Nucleotide Polymorphism (SNP) data. We present a new computational method to infer per-locus HLA types using shared segments Identical By Descent (IBD), inferred from SNP genotype data. IBD information is modeled as graph where shared haplotypes are explored among clusters of individuals with known and unknown HLA types to identify the latter. We analyze performance of the method in a previously typed subset of the HapMap population, achieving accuracy of 96% in HLA-A, 94% in HLA-B, 95% in HLA-C, 77% in HLA-DR1, 93% in HLA-DQA1 and 90% in HLA-DQB1 genes. We compare our method to a tag SNP based approach and demonstrate higher sensitivity and specificity. Our method demonstrates the power of using shared haplotype segments for large-scale imputation at the HLA locus.
Fine Mapping and Functional Analysis of the Multiple Sclerosis Risk Gene CD6
Swaminathan, Bhairavi; Cuapio, Angélica; Alloza, Iraide; Matesanz, Fuencisla; Alcina, Antonio; García-Barcina, Maria; Fedetz, Maria; Fernández, Óscar; Lucas, Miguel; Órpez, Teresa; Pinto-Medel, Mª Jesus; Otaegui, David; Olascoaga, Javier; Urcelay, Elena; Ortiz, Miguel A.; Arroyo, Rafael; Oksenberg, Jorge R.; Antigüedad, Alfredo; Tolosa, Eva; Vandenbroeck, Koen
2013-01-01
CD6 has recently been identified and validated as risk gene for multiple sclerosis (MS), based on the association of a single nucleotide polymorphism (SNP), rs17824933, located in intron 1. CD6 is a cell surface scavenger receptor involved in T-cell activation and proliferation, as well as in thymocyte differentiation. In this study, we performed a haptag SNP screen of the CD6 gene locus using a total of thirteen tagging SNPs, of which three were non-synonymous SNPs, and replicated the recently reported GWAS SNP rs650258 in a Spanish-Basque collection of 814 controls and 823 cases. Validation of the six most strongly associated SNPs was performed in an independent collection of 2265 MS patients and 2600 healthy controls. We identified association of haplotypes composed of two non-synonymous SNPs [rs11230563 (R225W) and rs2074225 (A257V)] in the 2nd SRCR domain with susceptibility to MS (P max(T) permutation = 1×10−4). The effect of these haplotypes on CD6 surface expression and cytokine secretion was also tested. The analysis showed significantly different CD6 expression patterns in the distinct cell subsets, i.e. – CD4+ naïve cells, P = 0.0001; CD8+ naïve cells, P<0.0001; CD4+ and CD8+ central memory cells, P = 0.01 and 0.05, respectively; and natural killer T (NKT) cells, P = 0.02; with the protective haplotype (RA) showing higher expression of CD6. However, no significant changes were observed in natural killer (NK) cells, effector memory and terminally differentiated effector memory T cells. Our findings reveal that this new MS-associated CD6 risk haplotype significantly modifies expression of CD6 on CD4+ and CD8+ T cells. PMID:23638056
Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.
2013-01-01
Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145
Takeda, Kazuki; Kou, Ikuyo; Kawakami, Noriaki; Iida, Aritoshi; Nakajima, Masahiro; Ogura, Yoji; Imagawa, Eri; Miyake, Noriko; Matsumoto, Naomichi; Yasuhiko, Yukuto; Sudo, Hideki; Kotani, Toshiaki; Nakamura, Masaya; Matsumoto, Morio; Watanabe, Kota; Ikegawa, Shiro
2017-03-01
Congenital scoliosis (CS) occurs as a result of vertebral malformations and has an incidence of 0.5-1/1,000 births. Recently, TBX6 on chromosome 16p11.2 was reported as a disease gene for CS; about 10% of Chinese CS patients were compound heterozygotes for rare null mutations and a common haplotype defined by three SNPs in TBX6. All patients had hemivertebrae. We recruited 94 Japanese CS patients, investigated the TBX6 locus for both mutations and the risk haplotype, examined transcriptional activities of mutant TBX6 in vitro, and evaluated clinical and radiographic features. We identified TBX6 null mutations in nine patients, including a missense mutation that had a loss of function in vitro. All had the risk haplotype in the opposite allele. One of the mutations showed dominant negative effect. Although all Chinese patients had one or more hemivertebrae, two Japanese patients did not have hemivertebra. The compound heterozygosity of null mutations and the common risk haplotype in TBX6 also causes CS in Japanese patients with similar incidence. Hemivertebra was not a specific type of spinal malformation in TBX6-associated CS (TACS). A heterozygous TBX6 loss-of-function mutation has been reported in a family with autosomal-dominant spondylocostal dysostosis, but it may represent a spectrum of the same disease with TACS. © 2017 WILEY PERIODICALS, INC.
Machiela, Mitchell J; Chanock, Stephen J
2015-11-01
Assessing linkage disequilibrium (LD) across ancestral populations is a powerful approach for investigating population-specific genetic structure as well as functionally mapping regions of disease susceptibility. Here, we present LDlink, a web-based collection of bioinformatic modules that query single nucleotide polymorphisms (SNPs) in population groups of interest to generate haplotype tables and interactive plots. Modules are designed with an emphasis on ease of use, query flexibility, and interactive visualization of results. Phase 3 haplotype data from the 1000 Genomes Project are referenced for calculating pairwise metrics of LD, searching for proxies in high LD, and enumerating all observed haplotypes. LDlink is tailored for investigators interested in mapping common and uncommon disease susceptibility loci by focusing on output linking correlated alleles and highlighting putative functional variants. LDlink is a free and publically available web tool which can be accessed at http://analysistools.nci.nih.gov/LDlink/. mitchell.machiela@nih.gov. Published by Oxford University Press 2015. This work is written by US Government employees and is in the public domain in the US.
Identification, validation and high-throughput genotyping of transcribed gene SNPs in cassava.
Ferguson, Morag E; Hearne, Sarah J; Close, Timothy J; Wanamaker, Steve; Moskal, William A; Town, Christopher D; de Young, Joe; Marri, Pradeep Reddy; Rabbi, Ismail Yusuf; de Villiers, Etienne P
2012-03-01
The availability of genomic resources can facilitate progress in plant breeding through the application of advanced molecular technologies for crop improvement. This is particularly important in the case of less researched crops such as cassava, a staple and food security crop for more than 800 million people. Here, expressed sequence tags (ESTs) were generated from five drought stressed and well-watered cassava varieties. Two cDNA libraries were developed: one from root tissue (CASR), the other from leaf, stem and stem meristem tissue (CASL). Sequencing generated 706 contigs and 3,430 singletons. These sequences were combined with those from two other EST sequencing initiatives and filtered based on the sequence quality. Quality sequences were aligned using CAP3 and embedded in a Windows browser called HarvEST:Cassava which is made available. HarvEST:Cassava consists of a Unigene set of 22,903 quality sequences. A total of 2,954 putative SNPs were identified. Of these 1,536 SNPs from 1,170 contigs and 53 cassava genotypes were selected for SNP validation using Illumina's GoldenGate assay. As a result 1,190 SNPs were validated technically and biologically. The location of validated SNPs on scaffolds of the cassava genome sequence (v.4.1) is provided. A diversity assessment of 53 cassava varieties reveals some sub-structure based on the geographical origin, greater diversity in the Americas as opposed to Africa, and similar levels of diversity in West Africa and southern, eastern and central Africa. The resources presented allow for improved genetic dissection of economically important traits and the application of modern genomics-based approaches to cassava breeding and conservation.
Papasavva, Thessalia; van IJcken, Wilfred F J; Kockx, Christel E M; van den Hout, Mirjam C G N; Kountouris, Petros; Kythreotis, Loukas; Kalogirou, Eleni; Grosveld, Frank G; Kleanthous, Marina
2013-01-01
β-Thalassaemia is one of the most common autosomal recessive single-gene disorder worldwide, with a carrier frequency of 12% in Cyprus. Prenatal tests for at risk pregnancies use invasive methods and development of a non-invasive prenatal diagnostic (NIPD) method is of paramount importance to prevent unnecessary risks inherent to invasive methods. Here, we describe such a method by assessing a modified version of next generation sequencing (NGS) using the Illumina platform, called ‘targeted sequencing', based on the detection of paternally inherited fetal alleles in maternal plasma. We selected four single-nucleotide polymorphisms (SNPs) located in the β-globin locus with a high degree of heterozygosity in the Cypriot population. Spiked genomic samples were used to determine the specificity of the platform. We could detect the minor alleles in the expected ratio, showing the specificity of the platform. We then developed a multiplexed format for the selected SNPs and analysed ten maternal plasma samples from pregnancies at risk. The presence or absence of the paternal mutant allele was correctly determined in 27 out of 34 samples analysed. With haplotype analysis, NIPD was possible on eight out of ten families. This is the first study carried out for the NIPD of β-thalassaemia using targeted NGS and haplotype analysis. Preliminary results show that NGS is effective in detecting paternally inherited alleles in the maternal plasma. PMID:23572027
Efficient algorithms for polyploid haplotype phasing.
He, Dan; Saha, Subrata; Finkers, Richard; Parida, Laxmi
2018-05-09
Inference of haplotypes, or the sequence of alleles along the same chromosomes, is a fundamental problem in genetics and is a key component for many analyses including admixture mapping, identifying regions of identity by descent and imputation. Haplotype phasing based on sequencing reads has attracted lots of attentions. Diploid haplotype phasing where the two haplotypes are complimentary have been studied extensively. In this work, we focused on Polyploid haplotype phasing where we aim to phase more than two haplotypes at the same time from sequencing data. The problem is much more complicated as the search space becomes much larger and the haplotypes do not need to be complimentary any more. We proposed two algorithms, (1) Poly-Harsh, a Gibbs Sampling based algorithm which alternatively samples haplotypes and the read assignments to minimize the mismatches between the reads and the phased haplotypes, (2) An efficient algorithm to concatenate haplotype blocks into contiguous haplotypes. Our experiments showed that our method is able to improve the quality of the phased haplotypes over the state-of-the-art methods. To our knowledge, our algorithm for haplotype blocks concatenation is the first algorithm that leverages the shared information across multiple individuals to construct contiguous haplotypes. Our experiments showed that it is both efficient and effective.
Role of MMP-3 and MMP-9 and their haplotypes in risk of bladder cancer in North Indian cohort.
Srivastava, Priyanka; Mandhani, Anil; Kapoor, Rakesh; Mittal, Rama D
2010-11-01
Matrix metalloproteinases (MMPs) play critical roles in cancer development and progression. Nonsynonymous single nucleotide polymorphisms (SNPs) in functional domain of MMP-3 and MMP-9 contribute appreciably to cancer predisposition and aggression. To test this proposition we examined whether six SNPs of the MMP-3 and MMP-9 genes are associated with risk of bladder cancer (BC) in a North Indian population. Six SNPs of MMP-3 and MMP-9 were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) in a case-control study including 200 BC patients and 200 age/gender/ethnicity-matched controls. Increased risk for BC susceptibility was observed in MMP-3 (1171) 5A/5A [P = 0.022; odds ratio (OR), 3.46; 95% confidence interval (CI), 1.20-9.98], MMP-9 (Q279R) QQ (P = 0.048; OR, 1.92; 95%CI, 1.01-3.66), MMP-9 (P574R) PR (P < 0.001; OR, 2.62; 95%CI, 1.71-4.03) and PR + RR (P < 0.001; OR, 2.59; 95%CI, 1.72-3.91) genotypes, and in R allele (P < 0.001; OR, 2.05; 95%CI, 1.47-2.85). Furthermore, significant association between MMP-9 Q279R, P574R polymorphism and smoking was observed in BC risk. Haplotype analysis too revealed significant association with 5A-A-G of MMP-3 haplotype (P = 0.022; OR, 1.99; 95%CI, 1.11-3.60) and with R-R (P = 0.001; OR, 2.00; 95%CI, 1.35-2.97) and Q-R (P < 0.001; OR, 2.97; 95%CI, 1.65-5.37) of MMP-9 haplotype. Genotype 5A/6A of MMP-3-1171 showed borderline risk and high recurrence-free survival in Bacillus Calmette-Guérin (BCG)-treated non-muscle-invasive BC (NMIBC) patients (log-rank P = 0.025). Our data suggested that MMP-3-1171 5A/5A and MMP-9 (Q279R) QQ, MMP-9 (P574R) PR, PR + RR, and R allele are associated with high risk of BC.
Y chromosome haplotype diversity of domestic sheep (Ovis aries) in northern Eurasia.
Zhang, Min; Peng, Wei-Feng; Yang, Guang-Li; Lv, Feng-Hua; Liu, Ming-Jun; Li, Wen-Rong; Liu, Yong-Gang; Li, Jin-Quan; Wang, Feng; Shen, Zhi-Qiang; Zhao, Sheng-Guo; Hehua, Eer; Marzanov, Nurbiy; Murawski, Maziek; Kantanen, Juha; Li, Meng-Hua
2014-12-01
Variation in two SNPs and one microsatellite on the Y chromosome was analyzed in a total of 663 rams representing 59 breeds from a large geographic range in northern Eurasia. SNPA-oY1 showed the highest allele frequency (91.55%) across the breeds, whereas SNPG-oY1 was present in only 56 samples. Combined genotypes established seven haplotypes (H4, H5, H6, H7, H8, H12 and H19). H6 dominated in northern Eurasia, and H8 showed the second-highest frequency. H4, which had been earlier reported to be absent in European breeds, was detected in one European breed (Swiniarka), whereas H7, which had been previously identified to be unique to European breeds, was present in two Chinese breeds (Ninglang Black and Large-tailed Han), one Buryatian (Transbaikal Finewool) and two Russian breeds (North Caucasus Mutton-Wool and Kuibyshev). H12, which had been detected only in Turkish breeds, was also found in Chinese breeds in this work. An overall low level of haplotype diversity (median h = 0.1288) was observed across the breeds with relatively higher median values in breeds from the regions neighboring the Near Eastern domestication center of sheep. H6 is the dominant haplotype in northwestern and eastern China, in which the haplotype distribution could be explained by the historical translocations of the H4 and H8 Y chromosomes to China via the Mongol invasions followed by expansions to northwestern and eastern China. Our findings extend previous results of sheep Y chromosomal genetic variability and indicate probably recent paternal gene flows between sheep breeds from distinct major geographic regions. © 2014 Stichting International Foundation for Animal Genetics.
Variation analysis and gene annotation of eight MHC haplotypes: The MHC Haplotype Project
Horton, Roger; Gibson, Richard; Coggill, Penny; Miretti, Marcos; Allcock, Richard J.; Almeida, Jeff; Forbes, Simon; Gilbert, James G. R.; Halls, Karen; Harrow, Jennifer L.; Hart, Elizabeth; Howe, Kevin; Jackson, David K.; Palmer, Sophie; Roberts, Anne N.; Sims, Sarah; Stewart, C. Andrew; Traherne, James A.; Trevanion, Steve; Wilming, Laurens; Rogers, Jane; de Jong, Pieter J.; Elliott, John F.; Sawcer, Stephen; Todd, John A.; Trowsdale, John
2008-01-01
The human major histocompatibility complex (MHC) is contained within about 4 Mb on the short arm of chromosome 6 and is recognised as the most variable region in the human genome. The primary aim of the MHC Haplotype Project was to provide a comprehensively annotated reference sequence of a single, human leukocyte antigen-homozygous MHC haplotype and to use it as a basis against which variations could be assessed from seven other similarly homozygous cell lines, representative of the most common MHC haplotypes in the European population. Comparison of the haplotype sequences, including four haplotypes not previously analysed, resulted in the identification of >44,000 variations, both substitutions and indels (insertions and deletions), which have been submitted to the dbSNP database. The gene annotation uncovered haplotype-specific differences and confirmed the presence of more than 300 loci, including over 160 protein-coding genes. Combined analysis of the variation and annotation datasets revealed 122 gene loci with coding substitutions of which 97 were non-synonymous. The haplotype (A3-B7-DR15; PGF cell line) designated as the new MHC reference sequence, has been incorporated into the human genome assembly (NCBI35 and subsequent builds), and constitutes the largest single-haplotype sequence of the human genome to date. The extensive variation and annotation data derived from the analysis of seven further haplotypes have been made publicly available and provide a framework and resource for future association studies of all MHC-associated diseases and transplant medicine. PMID:18193213
Fine mapping of chromosome 15q25.1 lung cancer susceptibility in African-Americans.
Hansen, Helen M; Xiao, Yuanyuan; Rice, Terri; Bracci, Paige M; Wrensch, Margaret R; Sison, Jennette D; Chang, Jeffery S; Smirnov, Ivan V; Patoka, Joseph; Seldin, Michael F; Quesenberry, Charles P; Kelsey, Karl T; Wiencke, John K
2010-09-15
Several genome-wide association studies identified the chr15q25.1 region, which includes three nicotinic cholinergic receptor genes (CHRNA5-B4) and the cell proliferation gene (PSMA4), for its association with lung cancer risk in Caucasians. A haplotype and its tagging single nucleotide polymorphisms (SNPs) encompassing six genes from IREB2 to CHRNB4 were most strongly associated with lung cancer risk (OR = 1.3; P < 10(-20)). In order to narrow the region of association and identify potential causal variations, we performed a fine-mapping study using 77 SNPs in a 194 kb segment of the 15q25.1 region in a sample of 448 African-American lung cancer cases and 611 controls. Four regions, two SNPs and two distinct haplotypes from sliding window analyses, were associated with lung cancer. CHRNA5 rs17486278 G had OR = 1.28, 95% CI 1.07-1.54 and P = 0.008, whereas CHRNB4 rs7178270 G had OR = 0.78, 95% CI 0.66-0.94 and P = 0.008 for lung cancer risk. Lung cancer associations remained significant after pack-year adjustment. Rs7178270 decreased lung cancer risk in women but not in men; gender interaction P = 0.009. For two SNPs (rs7168796 A/G and rs7164594 A/G) upstream of PSMA4, lung cancer risks for people with haplotypes GG and AA were reduced compared with those with AG (OR = 0.56, 95% CI 0.38-0.82; P = 0.003 and OR = 0.73, 95% CI 0.59-0.90, P = 0.004, respectively). A four-SNP haplotype spanning CHRNA5 (rs11637635 C, rs17408276 T, rs16969968 G) and CHRNA3 (rs578776 G) was associated with increased lung cancer risk (P = 0.002). The identified regions contain SNPs predicted to affect gene regulation. There are multiple lung cancer risk loci in the 15q25.1 region in African-Americans.
Wang, Danxin; Poi, Ming J.; Sun, Xiaochun; Gaedigk, Andrea; Leeder, J. Steven; Sadee, Wolfgang
2014-01-01
Cytochrome P450 2D6 (CYP2D6) is involved in the metabolism of 25% of clinically used drugs. Genetic polymorphisms cause substantial variation in CYP2D6 activity and serve as biomarkers guiding drug therapy. However, genotype–phenotype relationships remain ambiguous except for poor metabolizers carrying null alleles, suggesting the presence of yet unknown genetic variants. Searching for regulatory CYP2D6 polymorphisms, we find that a SNP defining the CYP2D6*2 allele, rs16947 [R296C, 17–60% minor allele frequency (MAF)], previously thought to convey normal activity, alters exon 6 splicing, thereby reducing CYP2D6 expression at least 2-fold. In addition, two completely linked SNPs (rs5758550/rs133333, MAF 13–42%) increase CYP2D6 transcription more than 2-fold, located in a distant downstream enhancer region (>100 kb) that interacts with the CYP2D6 promoter. In high linkage disequilibrium (LD) with each other, rs16947 and the enhancer SNPs form haplotypes that affect CYP2D6 enzyme activity in vivo. In a pediatric cohort of 164 individuals, rs16947 alone (minor haplotype frequency 28%) was associated with reduced CYP2D6 metabolic activity (measured as dextromethorphan/metabolite ratios), whereas rs5758550/rs133333 alone (frequency 3%) resulted in increased CYP2D6 activity, while haplotypes containing both rs16947 and rs5758550/rs133333 were similar to the wild-type. Other alleles used in biomarker panels carrying these variants such as CYP2D6*41 require re-evaluation of independent effects on CYP2D6 activity. The occurrence of two regulatory variants of high frequency and in high LD, residing on a long haplotype, highlights the importance of gene architecture, likely shaped by evolutionary selection pressures, in determining activity of encoded proteins. PMID:23985325
Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR.
Tyson, Jess; Armour, John A L
2012-12-11
Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.
Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR
2012-01-01
Background Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. Results In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. Conclusion This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example. PMID:23231411
Vázquez-Villamar, M; Palafox-Sánchez, C A; Hernández-Bello, J; Muñoz-Valle, J F; Valle, Y; Cruz, A; Alatorre-Meza, A I; Oregon-Romero, E
2016-11-03
Interleukin 10 (IL-10) is an immunoregulatory cytokine with multiple roles in the immune system. Three single nucleotide polymorphisms at positions -1082 (A>G), -819 (C>T), and -592 (C>A) in the promoter region of the IL10 gene are believed to be associated with different inflammatory, infectious, and autoimmune diseases. These polymorphisms exhibit a strong linkage disequilibrium (LD) and form three principal haplotypes (GCC, ACC, and ATA). The GCC and ATA haplotypes have been associated with high and low levels of IL-10 production, respectively. The aim of this study was to establish the allele and haplotype frequencies of the IL10 polymorphisms in Mestizos from western Mexico. SNPs were analyzed in 340 healthy unrelated Mestizos from western Mexico by polymerase chain reaction-restriction fragment length polymorphism. The studied population presented significant differences, in the distribution of IL10 polymorphisms, from the Asian, African, and European populations. We also observed a strong LD within -1082 A>G, -819 C>T, and -592 C>A (100% pc = 7.735 x 10 -18 ). The haplotypes ACC (45.4%), ATA (22.0%), GTA (14.9%), and GCC (13.9%) were most frequently observed in this population. The haplotype frequencies, however, differed from those reported previously in Mestizos from central Mexico, Asians, Africans, and European Caucasians, suggesting a differential gene flow in the Mexican Mestizo population. This could account for the genetic variability between Mexicans and populations of other ethnicities. The study of these polymorphisms and their haplotypes could help in expanding our knowledge to design future disease-risk studies on the western Mexican population.
Roussos, Panos; Giakoumaki, Stella G; Bitsios, Panos
2009-06-15
Significant associations have been shown for haplotypes comprising three PRODH single nucleotide polymorphisms (SNPs; 1945T/C, 1766A/G, 1852G/A) located in the 3' region of the gene, suggesting a role of these variants in the etiopathogenesis of schizophrenia. We assessed the relationship between these high-risk PRODH polymorphisms and schizophrenia-related endophenotypes in a large and highly homogeneous cohort of healthy males. Participants (n = 217) were tested in prepulse inhibition (PPI), verbal and working memory, trait anxiety and schizotypy. The QTPHASE from the UNPHASED package was used for the association analysis of each SNP or haplotype data. This procedure revealed significant phenotypic impact of the risk CGA haplotype. Subjects were then divided in two groups; levels of PPI, anxiety, and schizotypy, verbal and working memory were compared with analysis of variance. CGA carriers (n = 32) exhibited attenuated PPI (p < .001) and verbal memory (p < .001) and higher anxiety (p < .004) and schizotypy (p < .008) compared with the noncarriers (n = 185). There were no differences in baseline startle, demographics, and working memory. The main significant correlations were schizotypy x PPI [85-dB, 120-msec trials] in the carriers and schizotypy x anxiety in the entire group and the noncarriers but not the carriers group. Our results strongly support PPI as a valid schizophrenia endophenotype and highlight the importance of examining the role of risk haplotypes on multiple endophenotypes and have implications for understanding the continuum from normality to psychosis, transitional states, and the genetics of schizophrenia-related traits.
Michita, Rafael Tomoya; Zambra, Francis Maria Báo; Fraga, Lucas Rosa; Sanseverino, Maria Teresa Vieira; Callegari-Jacques, Sidia Maria; Vianna, Priscila; Chies, José Artur Bogo
2016-10-01
HLA-G is a molecule essential to the maintenance of the maternal-fetal interface tolerance, thus contributing to a healthy pregnancy. Here we investigate the role of HLA-G single nucleotide polymorphisms (SNPs) and whether a specific HLA-G haplotype influence or not recurrent pregnancy loss (RPL) risk. A total of 296 DNA samples from RPL (N=140) and controls (N=156) were evaluated. The HLA-G 3'UTR region was sequenced and eight major SNPs were evaluated (14pb insertion/deletion, +3003T/C, +3010C/G, +3027C/A, +3035C/T, +3142G/C, +3187A/G, +3196C/G). A high linkage disequilibrium (LD) among all pairs and a perfect LD between +3010C/G and +3142G/A (D'=1.0, r(2)=1.0) were observed. Our data showed an increased risk to +3010CC genotype carriers in comparison with control [odds ratio (OR) 2.05 95% confidence interval (CI) 1.05-4.00, p=0.035] and to a decreased risk of RPL in +3142CC genotype carriers (OR=0.49 95%CI 0.25-0.95, p=0.035) and +3187AG genotype carriers (OR=0.58 95%CI 0.35-0.94, p=0.029). A total of eight haplotypes were observed in the sample, being UTR-1 and UTR-2 the most represented. An association between UTR-1 haplotype carriers with a reduced risk of both RPL and secondary RPL was observed. Our results indicate that the HLA-G 3'UTR plays important roles in RPL and might be an important marker of susceptibility to this, and possible to other, pregnancy disorders. Copyright © 2016. Published by Elsevier Inc.
Wang, Ben-Gang; Xu, Qian; Lv, Zhi; Fang, Xin-Xin; Ding, Han-Xi; Wen, Jing; Yuan, Yuan
2018-01-01
AIM To evaluate the association of 12 tag single nucleotide polymorphisms (tagSNPs) in three onco-long non-coding RNA (lncRNA) genes (HOTTIP, CCAT2, MALAT1) with the risk and prognosis of hepatocellular cancer (HCC). METHODS Twelve tagSNPs covering the three onco-lncRNAs were genotyped by the KASP method in a total of 1338 samples, including 521 HCC patients and frequency-matched 817 controls. The samples were obtained from an unrelated Chinese population at the First Hospital of China Medical University from 2012-2015. The expression quantitative trait loci (eQTL) analyses were conducted to explore further the potential function of the promising SNPs. RESULTS Three SNPs in HOTTIP, one promoter SNP in MALAT1, and one haplotype of HOTTIP were associated with HCC risk. The HOTTIP rs17501292, rs2067087, and rs17427960 SNPs were increased to 1.55-, 1.20-, and 1.18-fold HCC risk under allelic models (P = 0.012, 0.017 and 0.049, respectively). MALAT1 rs4102217 SNP was increased to a 1.32-fold HCC risk under dominant models (P = 0.028). In addition, the two-way interaction of HOTTIP rs17501292-MALAT1 rs619586 polymorphisms showed a decreased effect on HCC risk (Pinteraction = 0.028, OR = 0.30) and epistasis with each other. HOTTIP rs3807598 variant genotype showed significantly longer survival time in HBV negative subgroup (P = 0.049, HR = 0.12), and MALAT1 rs591291 showed significantly better prognosis in female and HBV negative subgroups (P = 0.022, HR = 0.37; P = 0.042, HR = 0.25, respectively). In the study, no significant effect was observed in eQTL analysis. CONCLUSION Specific lncRNA (HOTTIP and MALAT1) SNPs have potential to be biomarkers for HCC risk and prognosis. PMID:29930469
Glatt, SJ; Faraone, SV; Lasky-Su, JA; Kanazawa, T; Hwu, H-G; Tsuang, MT
2009-01-01
The gene that codes for dopamine receptor D2 (DRD2 on chromosome 11q23) has long been a prime functional and positional candidate risk gene for schizophrenia. Collectively, prior case–control studies found a reliable effect of the Ser311Cys DRD2 polymorphism (rs1801028) on risk for schizophrenia, but few other polymorphisms in the gene had ever been evaluated and no adequately powered family-based association study has been performed to date. Our objective was to test 21 haplotype-tagging and all three known nonsynonymous single-nucleotide polymorphisms (SNPs) in DRD2 for association with schizophrenia in a family-based study of 2408 Han Chinese, including 1214 affected individuals from 616 families. We did not find a significant effect of rs1801028, but we did find significant evidence for association of schizophrenia with two multi-marker haplotypes spanning blocks of strong linkage disequilibrium (LD) and nine individual SNPs (Ps < 0.05). Importantly, two SNPs (rs1079727 and rs2283265) and both multi-marker haplotypes spanning entire LD blocks (including one that contained rs1801028) remained significant after correcting for multiple testing. These results further add to the body of data implicating DRD2 as a schizophrenia risk gene; however, a causal variant(s) in DRD2 remains to be elucidated by further fine mapping of the gene, with particular attention given to the area surrounding the third through fifth exons. PMID:18332877
Blanco, Rafael; Colombo, Alicia; Pardo, Rosa; Suazo, José
2017-04-01
Non-syndromic cleft lip with or without cleft palate (NSCL/P) is the most common craniofacial birth defect in humans, the etiology of which can be dependent on the interactions of multiple genes. We previously reported haplotype associations for polymorphic variants of interferon regulatory factor 6 (IRF6), msh homeobox 1 (MSX1), bone morphogenetic protein 4 (BMP4), and transforming growth factor beta 3 (TGFB3) in Chile. Here, we analyzed the haplotype-based gene-gene interaction for markers of these genes and NSCL/P risk in the Chilean population. We genotyped 15 single nucleoptide polymorphisms (SNPs) in 152 Chilean patients and 164 controls. Linkage disequilibrium (LD) blocks were determined using the Haploview software, and phase reconstruction was performed by the Phase program. Haplotype-based interactions were evaluated using the multifactor dimensionality reduction (MDR) method. We detected two LD blocks composed of two SNPs from BMP4 (Block 1) and three SNPs from IRF6 (Block 2). Although MDR showed no statistical significance for the global interaction model involving these blocks, we found four combinations conferring a statistically significantly increased NSCL/P risk (Block 1-Block 2): T-T/T-G C-G-T/G-A-T; T-T/T-G C-G-C/C-G-C; T-T/T-G G-A-T/G-A-T; and T-T/C-G G-A-T/G-A-T. These findings may reflect the presence of a genomic region containing potential causal variants interacting in the etiology of NSCL/P and may contribute to disentangling the complex etiology of this birth defect. © 2017 Eur J Oral Sci.
Kim, Kyung-Seon; Kim, Ghi-Su; Hwang, Joo-Yeon; Lee, Hye-Ja; Park, Mi-Hyun; Kim, Kwang-joong; Jung, Jongsun; Cha, Hyo-Soung; Shin, Hyoung Doo; Kang, Jong-Ho; Park, Eui Kyun; Kim, Tae-Ho; Hong, Jung-Min; Koh, Jung-Min; Oh, Bermseok; Kimm, Kuchan; Kim, Shin-Yoon; Lee, Jong-Young
2007-01-01
Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs) that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63%) had been previously identified and 331 (37%) were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less) of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF) > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an analysis of genetic
Population-specific variation in haplotype composition and heterozygosity at the POLB locus.
Yamtich, Jennifer; Speed, William C; Straka, Eva; Kidd, Judith R; Sweasy, Joann B; Kidd, Kenneth K
2009-05-01
DNA polymerase beta plays a central role in base excision repair (BER), which removes large numbers of endogenous DNA lesions from each cell on a daily basis. Little is currently known about germline polymorphisms within the POLB locus, making it difficult to study the association of variants at this locus with human diseases such as cancer. Yet, approximately thirty percent of human tumor types show variants of DNA polymerase beta. We have assessed the global frequency distributions of coding and common non-coding SNPs in and flanking the POLB gene for a total of 14 sites typed in approximately 2400 individuals from anthropologically defined human populations worldwide. We have found a marked difference between haplotype frequencies in African populations and in non-African populations.
Yokoyama, Jennifer S.; Karch, Celeste M.; Fan, Chun C.; Bonham, Luke W.; Kouri, Naomi; Ross, Owen A.; Rademakers, Rosa; Kim, Jungsu; Wang, Yunpeng; Höglinger, Günter U.; Muller, Ulrich; Ferrari, Raffaele; Hardy, John; Momeni, Parastoo; Sugrue, Leo P.; Hess, Christopher P.; Barkovich, A. James; Boxer, Adam L.; Seeley, William W.; Rabinovici, Gil D.; Rosen, Howard J.; Miller, Bruce L.; Schmansky, Nicholas J.; Fischl, Bruce; Hyman, Bradley T.; Dickson, Dennis W.; Schellenberg, Gerard D.; Andreassen, Ole A.; Dale, Anders M.; Desikan, Rahul S.
2017-01-01
Corticobasal degeneration (CBD), progressive supranuclear palsy (PSP) and a subset of frontotemporal dementia (FTD) are neurodegenerative disorders characterized by tau inclusions in neurons and glia (tauopathies). Although clinical, pathological and genetic evidence suggests overlapping pathobiology between CBD, PSP, and FTD, the relationship between these disorders is still not well understood. Using summary statistics (odds ratios and p-values) from large genome-wide association studies (total n = 14,286 cases and controls) and recently established genetic methods, we investigated the genetic overlap between CBD and PSP and CBD and FTD. We found up to 800-fold enrichment of genetic risk in CBD across different levels of significance for PSP or FTD. In addition to NSF (tagging the MAPT H1 haplotype), we observed that SNPs in or near MOBP, CXCR4, EGFR, and GLDC showed significant genetic overlap between CBD and PSP, whereas only SNPs tagging the MAPT haplotype overlapped between CBD and FTD. The risk alleles of the shared SNPs were associated with expression changes in cis-genes. Evaluating transcriptome levels across adult human brains, we found a unique neuroanatomic gene expression signature for each of the five overlapping gene loci (omnibus ANOVA p < 2.0 × 10−16). Functionally, we found that these shared risk genes were associated with protein interaction and gene co-expression networks and showed enrichment for several neurodevelopmental pathways. Our findings suggest: i) novel genetic overlap between CBD and PSP beyond the MAPT locus; ii) strong ties between CBD and FTD through the MAPT clade, and; iii) unique combinations of overlapping genes that may, in part, influence selective regional or neuronal vulnerability observed in specific tauopathies. PMID:28271184
Hardi, Hanaa; Melki, Rahma; Boughaleb, Zouhour; El Harroudi, Tijani; Aissaoui, Souria; Boukhatem, Noureddine
2018-03-15
Genetic determinants of breast cancer (BC) remained largely unknown in the majority of Moroccan patients. The purpose of this study was to explore the association of ERCC2 and MTHFR polymorphisms with genetic susceptibility to breast cancer in Moroccan population. We genotyped ERCC2 polymorphisms (rs1799793 (G934A) and rs13181 (A2251C)) and MTHFR polymorphisms (rs1801133 (C677T) and rs1801131 (A1298C)) using TaqMan SNP Genotyping Assays. Genotypes were compared in 151 BC cases and 156 population-matched controls. Allelic, genotypic and haplotype associations with the risk and clinicopathological features of BC were assessed using logistic regression analyses. ERCC2-rs1799793-AA genotype was associated with high risk of BC compared to wild type genotype (recessive model: OR: 2.90, 95% CI: 1.34-6.26, p = 0.0069) even after Bonferroni correction (p < 0,0125). MTHFR rs1801133-TT genotype was associated with increased risk of BC (recessive model, OR: 2.49, 95% CI: 1.17-5.29, p = 0.017) but the association turned insignificant after Bonferroni correction. For the rest of SNPs, no statistical associations to BC risk were detected. Significant association with clinical features was detected for MTHFR-rs1801133-TC genotype with early age at diagnosis and familial BC. Following Bonferroni correction, only association with familial BC remained significant. MTHFR-rs1801131-CC genotype was associated with sporadic BC. ERCC2-rs1799793-AA genotype correlated with ER+ and PR+ breast cancer. ERCC2-rs13181-CA genotype was significantly associated large tumors (T ≥ 3) in BC patients. None of these associations passed Bonferroni correction. Haplotype analysis showed that ERCC2 A-C haplotype was significantly associated with increased BC risk (OR: 3.71, 95% CI: 1.7-8.12, p = 0.0002 and p = 0.0008 before and after Bonferroni correction, respectively) and positive expression of ER and PR in BC patients. ERCC2 G-C haplotype was correlated with PR negative and
Lee, Joseph H; Gurney, Susan; Pang, Deborah; Temkin, Alexis; Park, Naeun; Janicki, Sarah C; Zigman, Warren B; Silverman, Wayne; Tycko, Benjamin; Schupf, Nicole
2012-01-01
Background/Aims. Genetic variants that affect estrogen activity may influence the risk of Alzheimer's disease (AD). In women with Down syndrome, we examined the relation of polymorphisms in hydroxysteroid-17beta-dehydrogenase (HSD17B1) to age at onset and risk of AD. HSD17B1 encodes the enzyme 17β-hydroxysteroid dehydrogenase (HSD1), which catalyzes the conversion of estrone to estradiol. Methods. Two hundred and thirty-eight women with DS, nondemented at baseline, 31-78 years of age, were followed at 14-18-month intervals for 4.5 years. Women were genotyped for 5 haplotype-tagging single-nucleotide polymorphisms (SNPs) in the HSD17B1 gene region, and their association with incident AD was examined. Results. Age at onset was earlier, and risk of AD was elevated from two- to threefold among women homozygous for the minor allele at 3 SNPs in intron 4 (rs676387), exon 6 (rs605059), and exon 4 in COASY (rs598126). Carriers of the haplotype TCC, based on the risk alleles for these three SNPs, had an almost twofold increased risk of developing AD (hazard ratio = 1.8, 95% CI, 1.1-3.1). Conclusion. These findings support experimental and clinical studies of the neuroprotective role of estrogen.
Type 2 Diabetes Risk Allele Loci in the Qatari Population
Abi Khalil, Charbel; Fakhro, Khalid A.; Robay, Amal; Ramstetter, Monica D.; Al-Azwani, Iman K.; Malek, Joel A.; Zirie, Mahmoud; Jayyousi, Amin; Badii, Ramin; Al-Nabet Al-Marri, Ajayeb; Chiuchiolo, Maria J.; Al-Shakaki, Alya; Chidiac, Omar; Gharbiah, Maey; Bener, Abdulbari; Stadler, Dora; Hackett, Neil R.; Mezey, Jason G.; Crystal, Ronald G.
2016-01-01
Background The prevalence of type 2 diabetes (T2D) is increasing in the Middle East. However, the genetic risk factors for T2D in the Middle Eastern populations are not known, as the majority of studies of genetic risk for T2D are in Europeans and Asians. Methods All subjects were ≥3 generation Qataris. Cases with T2D (n = 1,124) and controls (n = 590) were randomly recruited and assigned to the 3 known Qatari genetic subpopulations [Bedouin (Q1), Persian/South Asian (Q2) and African (Q3)]. Subjects underwent genotyping for 37 single nucleotide polymorphisms (SNPs) in 29 genes known to be associated with T2D in Europeans and/or Asian populations, and an additional 27 tag SNPs related to these susceptibility loci. Pre-study power analysis suggested that with the known incidence of T2D in adult Qataris (22%), the study population size would be sufficient to detect significant differences if the SNPs were risk factors among Qataris, assuming that the odds ratio (OR) for T2D SNPs in Qatari’s is greater than or equal to the SNP with highest known OR in other populations. Results Haplotype analysis demonstrated that Qatari haplotypes in the region of known T2D risk alleles in Q1 and Q2 genetic subpopulations were similar to European haplotypes. After Benjamini-Hochberg adjustment for multiple testing, only two SNPs (rs7903146 and rs4506565), both associated with transcription factor 7-like 2 (TCF7L2), achieved statistical significance in the whole study population. When T2D subjects and control subjects were assigned to the known 3 Qatari subpopulations, and analyzed individually and with the Q1 and Q2 genetic subpopulations combined, one of these SNPs (rs4506565) was also significant in the admixed group. No other SNPs associated with T2D in all Qataris or individual genetic subpopulations. Conclusions With the caveats of the power analysis, the European/Asian T2D SNPs do not contribute significantly to the high prevalence of T2D in the Qatari population, suggesting
Jia, Guanqing; Huang, Xuehui; Zhi, Hui; Zhao, Yan; Zhao, Qiang; Li, Wenjun; Chai, Yang; Yang, Lifang; Liu, Kunyan; Lu, Hengyun; Zhu, Chuanrang; Lu, Yiqi; Zhou, Congcong; Fan, Danlin; Weng, Qijun; Guo, Yunli; Huang, Tao; Zhang, Lei; Lu, Tingting; Feng, Qi; Hao, Hangfei; Liu, Hongkuan; Lu, Ping; Zhang, Ning; Li, Yuhui; Guo, Erhu; Wang, Shujun; Wang, Suying; Liu, Jinrong; Zhang, Wenfei; Chen, Guoqiu; Zhang, Baojin; Li, Wei; Wang, Yongfang; Li, Haiquan; Zhao, Baohua; Li, Jiayang; Diao, Xianmin; Han, Bin
2013-08-01
Foxtail millet (Setaria italica) is an important grain crop that is grown in arid regions. Here we sequenced 916 diverse foxtail millet varieties, identified 2.58 million SNPs and used 0.8 million common SNPs to construct a haplotype map of the foxtail millet genome. We classified the foxtail millet varieties into two divergent groups that are strongly correlated with early and late flowering times. We phenotyped the 916 varieties under five different environments and identified 512 loci associated with 47 agronomic traits by genome-wide association studies. We performed a de novo assembly of deeply sequenced genomes of a Setaria viridis accession (the wild progenitor of S. italica) and an S. italica variety and identified complex interspecies and intraspecies variants. We also identified 36 selective sweeps that seem to have occurred during modern breeding. This study provides fundamental resources for genetics research and genetic improvement in foxtail millet.
Aoyama, N; Takahashi, N; Saito, S; Maeno, N; Ishihara, R; Ji, X; Miura, H; Ikeda, M; Suzuki, T; Kitajima, T; Yamanouchi, Y; Kinoshita, Y; Yoshida, K; Iwata, N; Inada, T; Ozaki, N
2006-06-01
Several lines of evidence suggest that metabolic changes in the kynurenic acid (KYNA) pathway are related to the etiology of schizophrenia. The inhibitor of kynurenine 3-monooxygenase (KMO) is known to increase KYNA levels, and the KMO gene is located in the chromosome region associated with schizophrenia, 1q42-q44. Single-marker and haplotype analyses for 6-tag single nucleotide polymorphisms (SNPs) of KMO were performed (cases = 465, controls = 440). Significant association of rs2275163 with schizophrenia was observed by single-marker comparisons (P = 0.032) and haplotype analysis including this SNP (P = 0.0049). Significant association of rs2275163 and haplotype was not replicated using a second, independent set of samples (cases = 480, controls = 448) (P = 0.706 and P = 0.689, respectively). These results suggest that the KMO is unlikely to be related to the development of schizophrenia in Japanese.
Exploring and Harnessing Haplotype Diversity to Improve Yield Stability in Crops.
Qian, Lunwen; Hickey, Lee T; Stahl, Andreas; Werner, Christian R; Hayes, Ben; Snowdon, Rod J; Voss-Fels, Kai P
2017-01-01
In order to meet future food, feed, fiber, and bioenergy demands, global yields of all major crops need to be increased significantly. At the same time, the increasing frequency of extreme weather events such as heat and drought necessitates improvements in the environmental resilience of modern crop cultivars. Achieving sustainably increase yields implies rapid improvement of quantitative traits with a very complex genetic architecture and strong environmental interaction. Latest advances in genome analysis technologies today provide molecular information at an ultrahigh resolution, revolutionizing crop genomic research, and paving the way for advanced quantitative genetic approaches. These include highly detailed assessment of population structure and genotypic diversity, facilitating the identification of selective sweeps and signatures of directional selection, dissection of genetic variants that underlie important agronomic traits, and genomic selection (GS) strategies that not only consider major-effect genes. Single-nucleotide polymorphism (SNP) markers today represent the genotyping system of choice for crop genetic studies because they occur abundantly in plant genomes and are easy to detect. SNPs are typically biallelic, however, hence their information content compared to multiallelic markers is low, limiting the resolution at which SNP-trait relationships can be delineated. An efficient way to overcome this limitation is to construct haplotypes based on linkage disequilibrium, one of the most important features influencing genetic analyses of crop genomes. Here, we give an overview of the latest advances in genomics-based haplotype analyses in crops, highlighting their importance in the context of polyploidy and genome evolution, linkage drag, and co-selection. We provide examples of how haplotype analyses can complement well-established quantitative genetics frameworks, such as quantitative trait analysis and GS, ultimately providing an effective tool
Peters, Bart D; Voineskos, Aristotle N; Szeszko, Philip R; Lett, Tristram A; DeRosse, Pamela; Guha, Saurav; Karlsgodt, Katherine H; Ikuta, Toshikazu; Felsky, Daniel; John, Majnu; Rotenberg, David J; Kennedy, James L; Lencz, Todd; Malhotra, Anil K
2014-04-30
The genetic and molecular pathways driving human brain white matter (WM) development are only beginning to be discovered. Long chain polyunsaturated fatty acids (LC-PUFAs) have been implicated in myelination in animal models and humans. The biosynthesis of LC-PUFAs is regulated by the fatty acid desaturase (FADS) genes, of which a human-specific haplotype is strongly associated with ω-3 and ω-6 LC-PUFA concentrations in blood. To investigate the relationship between LC-PUFA synthesis and human brain WM development, we examined whether this FADS haplotype is associated with age-related WM differences across the life span in healthy individuals 9-86 years of age (n = 207). Diffusion tensor imaging was performed to measure fractional anisotropy (FA), a putative measure of myelination, of the cerebral WM tracts. FADS haplotype status was determined with a single nucleotide polymorphism (rs174583) that tags this haplotype. Overall, normal age-related WM differences were observed, including higher FA values in early adulthood compared with childhood, followed by lower FA values across older age ranges. However, individuals homozygous for the minor allele (associated with lower LC-PUFA concentrations) did not display these normal age-related WM differences (significant age × genotype interactions, p(corrected) < 0.05). These findings suggest that LC-PUFAs are involved in human brain WM development from childhood into adulthood. This haplotype and LC-PUFAs may play a role in myelin-related disorders of neurodevelopmental origin.
TUMOR HAPLOTYPE ASSEMBLY ALGORITHMS FOR CANCER GENOMICS
AGUIAR, DEREK; WONG, WENDY S.W.; ISTRAIL, SORIN
2014-01-01
The growing availability of inexpensive high-throughput sequence data is enabling researchers to sequence tumor populations within a single individual at high coverage. But, cancer genome sequence evolution and mutational phenomena like driver mutations and gene fusions are difficult to investigate without first reconstructing tumor haplotype sequences. Haplotype assembly of single individual tumor populations is an exceedingly difficult task complicated by tumor haplotype heterogeneity, tumor or normal cell sequence contamination, polyploidy, and complex patterns of variation. While computational and experimental haplotype phasing of diploid genomes has seen much progress in recent years, haplotype assembly in cancer genomes remains uncharted territory. In this work, we describe HapCompass-Tumor a computational modeling and algorithmic framework for haplotype assembly of copy number variable cancer genomes containing haplotypes at different frequencies and complex variation. We extend our polyploid haplotype assembly model and present novel algorithms for (1) complex variations, including copy number changes, as varying numbers of disjoint paths in an associated graph, (2) variable haplotype frequencies and contamination, and (3) computation of tumor haplotypes using simple cycles of the compass graph which constrain the space of haplotype assembly solutions. The model and algorithm are implemented in the software package HapCompass-Tumor which is available for download from http://www.brown.edu/Research/Istrail_Lab/. PMID:24297529
Siebert, Lydia; Headrick, Susan; Lewis, Mark; Gillespie, Barbara; Young, Charlie; Wojakiewicz, Leszek; Kerro-Dego, Oudessa; Prado, Maria E; Almeida, Raul; Oliver, Stephen P; Pighetti, Gina M
2017-08-01
Mastitis, an inflammation of the mammary gland, costs the dairy industry billions of dollars in lost revenues annually. The prevalence and costs associated with mastitis has made genetic selection methods a target for research. Previous research has identified amino acid changes at positions 122, 207, 245, 327, and 332 in the IL8 receptor, CXCR1, that result in three dominant amino acid haplotypes: VWHKH, VWHRR, and AWQRR. We hypothesize different haplotype combinations influence a cow's resistance, strength, and duration of response to mastitis. To test this, Holstein dairy cows (n=40) were intramammarily challenged with Streptococcus uberis within 3 d post-calving. All cows developed mastitis based on isolation of S. uberis from the challenged quarter at least twice. All cows with the VWHRR x VWHRR (n=5) and AWQRR x VWHRR (n=6) haplotype combinations required antibiotic therapy due to clinical signs of mastitis and tended (P=0.08) to be different from cows with a VWHRR x VWHKH (n=6) haplotype combination where only 33.3% required antibiotic therapy. Cows with a VWHRR homozygous haplotype combination displayed significantly higher responses to challenge indicated by elevated S. uberis counts (4340±5,521.9CFU/mL; P=0.01), mammary scores (1.1±0.18; P=0.03), milk scores (0.9±0.17; P=0.002), and SCC (1,010,832±489,993cells/mL; P=0.03). Contrastingly, AWQRR x VWHRR cows had significantly lower S. uberis counts (15.3±16.46CFU/mL; P=0.01), mammary scores (0.3±0.16; P=0.03), milk scores (0±0.15; P=0.002), and SCC (239,261±92,264.3cells/mL; P=0.03). Cows of the VWHKH x VWHRR haplotype combination displayed responses to challenge statistically comparable to other haplotype combinations, but appeared to have an earlier peak in SCC in comparison to all other haplotype combinations. Haplotype combination did not influence milk yield (P=0.6). Our results suggest using combinations of the SNPs within the CXCR1 gene gives a better indication of a cow's ability to combat S
Pelov, Ilana; Teltsh, Omri; Greenbaum, Lior; Rigbi, Amihai; Kanyas-Sarner, Kyra; Lerer, Bernard; Lombroso, Paul; Kohn, Yoav
2013-01-01
Objective STriatal-Enriched protein tyrosine Phosphatase (STEP) is a brain-specific member of the PTP family that has been implicated in learning and memory. In this study, we examined the association of the PTPN5 (protein-tyrosine-phosphatase non-receptor 5) gene, which encodes for STEP, with both schizophrenia and cognitive functioning in the Israeli Jewish population. Methods A 868 subjects schizophrenia (SZ) case-control study was performed (286 cases and 582 controls). Eleven STEP tagging SNPs were selected, and single markers and haplotypes association analyses were performed. A cognitive variability study included 437 healthy females who completed a computerized cognitive battery. We performed univariate associations between the SNPs and cognitive performance. The possible functional role of these variants was examined by studying their association with gene expression levels in the brain. Results In the SZ study, we found nominal association in the whole sample between rs4075664 and SZ. SZ males showed a more significant association for 3 SNPs (rs4075664, rs2278732, rs4757710). Haplotypes of the studied SNPs were associated with SZ both in the overall sample and within the male sub-sample. Expression analysis provided some support for the effects of the associated SNPs on PTPN5 expression level. The cognitive variability study showed positive associations between PTPN5 SNPs and different cognitive subtests. Principal component analysis demonstrated an “Attention Index” neurocognitive component that was associated with two SNP pairs (rs10832983*rs10766504 and rs7932938*rs4757718). Conclusion The results imply a model in which PTPN5 may play a role in normal cognitive functioning and contributes to aspects of the neuropathology of schizophrenia. PMID:22555153
Apolipoprotein A-V: a potential modulator of plasma triglyceride levels in Turks.
Hodoglugil, Ugur; Tanyolaç, Sinan; Williamson, David W; Huang, Yadong; Mahley, Robert W
2006-01-01
The apolipoprotein A-V gene (APOA5) plays an important role in determining plasma triglyceride levels. We studied the effects of APOA5 polymorphisms on plasma triglyceride levels in Turks, a population with low levels of HDL cholesterol and a high prevalence of coronary artery disease. We found 15 polymorphisms, three of which were novel. Seven haplotype-tagging single nucleotide polymorphisms (SNPs) were chosen and genotyped in approximately 3,000 subjects. The rare alleles of the -1464T>C, -1131T>C, S19W, and 1259T>C SNPs were significantly associated with increased triglyceride levels (19-86 mg/dl; P < 0.05) and had clear gene-dose effects. Haplotype analysis of the nine common APOA5 haplotypes revealed significant effects on triglyceride levels (P < 0.001). Detailed analysis of haplotypes clearly showed that the -1464T>C polymorphism had no effect by itself but was a marker for the -1131T>C, S19W, and 1259T>C polymorphisms. The -1131T>C and 1259T>C polymorphisms were in a strong but incomplete linkage disequilibrium and appeared to have independent effects. Thus, the APOA5 -1131T>C, S19W, and 1259T>C rare alleles were associated with significant increases in plasma triglyceride levels. At least one of these alleles was present in approximately 40% of the Turks. Similar associations were observed for -1131T>C and S19W in white Americans living in San Francisco, California.
CYP3A4 and CYP3A5 genotyping by Pyrosequencing
Garsa, Adam A; McLeod, Howard L; Marsh, Sharon
2005-01-01
Background Human cytochrome P450 3A enzymes, particularly CYP3A4 and CYP3A5, play an important role in drug metabolism. CYP3A expression exhibits substantial interindividual variation, much of which may result from genetic variation. This study describes Pyrosequencing assays for key SNPs in CYP3A4 (CYP3A4*1B, CYP3A4*2, and CYP3A4*3) and CYP3A5 (CYP3A5*3C and CYP3A5*6). Methods Genotyping of 95 healthy European and 95 healthy African volunteers was performed using Pyrosequencing. Linkage disequilibrium, haplotype inference, Hardy-Weinberg equilibrium, and tag SNPs were also determined for these samples. Results CYP3A4*1B allele frequencies were 4% in Europeans and 82% in Africans. The CYP3A4*2 allele was found in neither population sample. CYP3A4*3 had an allele frequency of 2% in Europeans and 0% in Africans. The frequency of CYP3A5*3C was 94% in Europeans and 12% in Africans. No CYP3A5*6 variants were found in the European samples, but this allele had a frequency of 16% in the African samples. Allele frequencies and haplotypes show interethnic variation, highlighting the need to analyze clinically relevant SNPs and haplotypes in a variety of ethnic groups. Conclusion Pyrosequencing is a versatile technique that could improve the efficiency of SNP analysis for pharmacogenomic research with the ultimate goal of pre-screening patients for individual therapy selection. PMID:15882469
Talbert, Matthew E; Langefeld, Carl D; Ziegler, Julie; Mychaleckyj, Josyf C; Haffner, Steven M; Norris, Jill M; Bowden, Donald W
2009-01-01
The SOCS3 gene product participates in the feedback inhibition of a range of cytokine signals. Most notably, SOCS3 inhibits the functioning of leptin and downstream steps in insulin signaling after being expressed by terminal transcription factors, such as STAT3 and c-fos. The SOCS3 gene is located in the chromosome region 17q24–17q25, previously linked to body mass index (BMI), visceral adipose tissue (VAT), and waist circumference (WAIST) in Hispanic families in the Insulin Resistance Atherosclerosis Family Study (IRASFS). A high density map of 1536 single nucleotide polymorphisms (SNPs) was constructed to cover a portion of the 17q linkage interval in DNA samples from 1425 Hispanic subjects from 90 extended families in IRASFS. Analysis of this dense SNP map data revealed evidence of association of rs9914220 (located 10 kb 5’ of the SOCS3 gene) with BMI, VAT, and WAIST (P-value ranging from 0 003 to 0.017). Using a tagging SNP approach, rs9914220 and 22 additional SOCS3 SNPs were genotyped for genetic association analysis with measures of adiposity and glucose homeostasis. The adiposity phenotypes utilized in association analyses included BMI, WAIST, waist to hip ratio (WHR), subcutaneous adipose tissue (SAT), VAT, and visceral to subcutaneous ratio (VSR). Linkage disequilibrium (LD) calculations revealed three haplotype blocks near SOCS3. Haplotype Block 1 (5’ of SOCS3) contained SNPs consistently associated with BMI, WAIST, WHR, and VAT (P-values ranging from 2.00x10−4 to .036). Haplotype Block 3 contained single-SNPs that were associated with most adiposity traits except for VSR (P-values ranging from 0.002 to 0.047). When trait associated SNPs were included in linkage analyses as covariates, a reduction of VAT LOD score from 1.26 to .76 above the SOCS3 locus (110 cM) was observed. Multi-SNP haplotype testing using the quantitative pedigree disequilibrium test (QPDT) was broadly consistent with the single-SNP associations. In conclusion, these results
Zavarella, S; Petrone, A; Zampetti, S; Gueorguiev, M; Spoletini, M; Mein, C A; Leto, G; Korbonits, M; Buzzetti, R
2008-04-01
Previous studies suggested that polymorphisms in the coding region of the preproghrelin were involved in the etiology of obesity and might modulate glucose-induced insulin secretion. We evaluated the association of a new variation, -604C>T, in the promoter region of the ghrelin gene, of Leu72Met (247C>A) and of Gln90Leu (265A>T), all haplotype-tagging single nucleotide polymorphisms (SNPs), with measures of insulin sensitivity in 1420 adult individuals. The three SNPs were genotyped using ABI PRISM 7900 HT Sequence Detection System. We used multiple linear regression analysis for quantitative traits and THESIAS software for haplotype analysis. We observed a protective effect exerted by Met72 variant of Leu72Met SNP on insulin resistance parameters; a significant decreasing trend from Leu/Leu to Leu/Met and to Met/Met homozygous subjects in triglycerides, fasting insulin levels and HOMA-IR index (P=0.02, 0.01 and 0.003, respectively), and, consistently, an increase in ghrelin levels (P=0.003) was found. A significant decrease from CC to TC and to TT genotypes in insulin levels and HOMA-IR index was also detected (P=0.00l for both), but only in subjects homozygous for Leu72, where the protective effect of Met72 was not present. The haplotype analysis results supported the data obtained by the evaluation of each single SNP, showing the highest value of insulin levels and HOMA-IR index in the -604(c)247(c) haplotype intermediate value in -604(T)247(C) and lowest value in -604(C)247(A). Our observations suggest a protective role of the Met72 variant and of -604 T allele in modulating insulin resistance. These SNPs or an unknown functional variant in linkage disequilibrium could increase ghrelin levels and probably insulin sensitivity.
Song, Yiqing; Hsu, Yi-Hsiang; Niu, Tianhua; Manson, Joann E; Buring, Julie E; Liu, Simin
2009-01-17
Ion channel transient receptor potential membrane melastatin 6 and 7 (TRPM6 and TRPM7) play a central role in magnesium homeostasis, which is critical for maintaining glucose and insulin metabolism. However, it is unclear whether common genetic variation in TRPM6 and TRPM7 contributes to risk of type 2 diabetes. We conducted a nested case-control study in the Women's Health Study. During a median of 10 years of follow-up, 359 incident diabetes cases were diagnosed and matched by age and ethnicity with 359 controls. We analyzed 20 haplotype-tagging single nucleotide polymorphisms (SNPs) in TRPM6 and 5 common SNPs in TRPM7 for their association with diabetes risk. Overall, there was no robust and significant association between any single SNP and diabetes risk. Neither was there any evidence of association between common TRPM6 and TRPM7 haplotypes and diabetes risk. Our haplotype analyses suggested a significant risk of type 2 diabetes among carriers of both the rare alleles from two non-synomous SNPs in TRPM6 (Val1393Ile in exon 26 [rs3750425] and Lys1584Glu in exon 27 [rs2274924]) when their magnesium intake was lower than 250 mg per day. Compared with non-carriers, women who were carriers of the haplotype 1393Ile-1584Glu had an increased risk of type 2 diabetes (OR, 4.92, 95% CI, 1.05-23.0) only when they had low magnesium intake (<250 mg/day). Our results provide suggestive evidence that two common non-synonymous TRPM6 coding region variants, Ile1393Val and Lys1584Glu polymorphisms, might confer susceptibility to type 2 diabetes in women with low magnesium intake. Further replication in large-scale studies is warranted.
Shatwan, Israa M; Winther, Kristian Hillert; Ellahi, Basma; Elwood, Peter; Ben-Shlomo, Yoav; Givens, Ian; Rayman, Margaret P; Lovegrove, Julie A; Vimaleswaran, Karani S
2018-04-30
Several candidate genes have been identified in relation to lipid metabolism, and among these, lipoprotein lipase (LPL) and apolipoprotein E (APOE) gene polymorphisms are major sources of genetically determined variation in lipid concentrations. This study investigated the association of two single nucleotide polymorphisms (SNPs) at LPL, seven tagging SNPs at the APOE gene, and a common APOE haplotype (two SNPs) with blood lipids, and examined the interaction of these SNPs with dietary factors. The population studied for this investigation included 660 individuals from the Prevention of Cancer by Intervention with Selenium (PRECISE) study who supplied baseline data. The findings of the PRECISE study were further replicated using 1238 individuals from the Caerphilly Prospective cohort (CaPS). Dietary intake was assessed using a validated food-frequency questionnaire (FFQ) in PRECISE and a validated semi-quantitative FFQ in the CaPS. Interaction analyses were performed by including the interaction term in the linear regression model adjusted for age, body mass index, sex and country. There was no association between dietary factors and blood lipids after Bonferroni correction and adjustment for confounding factors in either cohort. In the PRECISE study, after correction for multiple testing, there was a statistically significant association of the APOE haplotype (rs7412 and rs429358; E2, E3, and E4) and APOE tagSNP rs445925 with total cholesterol (P = 4 × 10 - 4 and P = 0.003, respectively). Carriers of the E2 allele had lower total cholesterol concentration (5.54 ± 0.97 mmol/L) than those with the E3 (5.98 ± 1.05 mmol/L) (P = 0.001) and E4 (6.09 ± 1.06 mmol/L) (P = 2 × 10 - 4 ) alleles. The association of APOE haplotype (E2, E3, and E4) and APOE SNP rs445925 with total cholesterol (P = 2 × 10 - 6 and P = 3 × 10 - 4 , respectively) was further replicated in the CaPS. Additionally, significant
Ito, Yoshihito; Yamada, Shinnosuke; Takahashi, Nagahide; Saito, Shinichi; Yoshimi, Akira; Inada, Toshiya; Noda, Yukihiro; Ozaki, Norio
2008-10-05
NRG1-ERBB signaling influences the risk for schizophrenia pathology. A recent study has reported that MAGI1, MAGI2, and protein tyrosine phosphatase, receptor-type, Z polypeptide 1 (PTPRZ1; located on 7q31.3) gene products regulate the NRG1-ERBB4 signaling pathway, and PTPRZ1 is associated with schizophrenia in a Caucasian population. By applying a gene-based association concept, we analyzed any association between PTPRZ1 tagging SNPs and schizophrenia in the Japanese population (576 schizophrenics and 768 controls). After linkage disequilibrium analysis, 29 single nucleotide polymorphisms (SNPs) were genotyped using a 5'-exonuclease allelic discrimination assay. We found a significant association of one tagging SNP in a genotype-wise analysis (P = 0.007); however, this might be resulted from type I error due to multiple testing (P = 0.17 after SNPSpD correction). No association was observed between schizophrenic patients and controls in either allelic, genotypic, or haplotypic analyses. Our results therefore suggest that PTPRZ1 is unlikely to be related to the development of schizophrenia in the Japanese population.
Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin
2007-08-10
The sickle (betas) mutation in the beta-globin gene (HBB) occurs on five "classical" betas haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the betas allele - a consequence of protection from severe malarial infection afforded by heterozygotes - has been associated with a high degree of extended haplotype similarity. The relationship between classical betas haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical betas haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). The most common betas sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the betas mutation. Two different classical betas haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of betas haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle
Functional characterization of SNPs in CHRNA3/B4 intergenic region associated with drug behaviors
Flora, Amber V; Zambrano, Cristian A; Gallego, Xavier; Miyamoto, Jill H; Johnson, Krista A; Cowan, Katelyn A; Stitzel, Jerry A; Ehringer, Marissa A
2013-01-01
The cluster of human neuronal nicotinic receptor genes (CHRNA5/A3/B4) (15q25.1) has been associated with a variety of smoking and drug-related behaviors, as well as risk for lung cancer. CHRNA3/B4 intergenic single nucleotide polymorphisms (SNPs) rs1948 and rs8023462 have been associated with early initiation of alcohol and tobacco use, and rs6495309 has been associated with nicotine dependence and risk for lung cancer. An in vitro luciferase expression assay was used to determine whether these SNPs and surrounding sequences contribute to differences in gene expression using cell lines either expressing proteins characteristic of neuronal tissue or derived from lung cancers. Electrophoretic mobility shift assays (EMSAs) were performed to investigate whether nuclear proteins from these cell lines bind SNP alleles differentially. Results from expression assays were dependent on cell culture type and haplotype. EMSAs indicated that rs8023462 and rs6495309 bind nuclear proteins in an allele-specific way. Additionally, GATA transcription factors appeared to bind rs8023462 only when the minor/risk allele was present. Much work has been done to describe the rat Chrnb4/a3 intergenic region, but few studies have examined the human intergenic region effects on expression; therefore, these studies greatly aid human genetic research as it relates to observed nicotine phenotypes, lung cancer risk and potential underlying genetic mechanisms. Data from these experiments support the hypothesis that SNPs associated with human addiction-related phenotypes and lung cancer risk can affect gene expression, and are potential therapeutic targets. Additionally, this is the first evidence that rs8023462 interacts with GATA transcription factors to influence gene expression. PMID:23872218
Sakai, Satoki
2016-08-01
I developed a gametophytic self-incompatibility (SI) model to study the conditions leading to diversification in SI haplotypes. In the model, the SI system is assumed to be incomplete, and the pollen expressing a given specificity is not fully rejected by the pistils expressing the same specificity. I also assumed that mutations can occur that enhance the rejection of pollen by pistils with the same haplotype variant and reduce rejection by pistils with other variants in the same haplotype. I found that if such mutations occur, the new haplotypes (mutant variants) can stably coexist with the ancestral haplotype in which the mutant arose. This is because pollen bearing the new haplotype is most strongly rejected by pistils bearing the same new haplotype among the pistils in the population; hence, negative frequency-dependent selection prevents their fixation. I also performed simulations and found that the nearly complete SI system evolves from completely self-compatible populations and that SI haplotypes can increase to about 40-50 within a few thousand generations. On the basis of my findings, I propose that diversification of SI haplotypes occurred during the evolution of SI from self-compatibility.
Novel SNPs of WNK1 and AKR1C3 are associated with preeclampsia.
Sun, Cheng-Juan; Li, Lin; Li, Xueyan; Zhang, Wei-Yuan; Liu, Xiao-Wei
2018-08-20
Preeclampsia is a hypertensive disorder of pregnancy and is one of the most common causes of poor perinatal outcomes. Preeclampsia increases the risk of hypertension in the future. Variants of WNK1 (lysine deficient protein kinase 1), ADRB2 (β2 adrenergic receptor), NEDD4L (ubiquitin-protein ligase NEDD4-like), KLK1 (kallikrein 1) contribute to hypertension, and AKR1C3 (aldo-keto reductase family1 member C3), is associated with preeclampsia. The association of single nucleotide polymorphisms (SNPs) in these five candidate preeclampsia susceptibility genes and the related traits in Chinese individuals were investigated. In this study, 13 SNPs of the five genes were genotyped in 276 preeclampsia patients and 229 age- and area-matched normal pregnancies in women of Chinese Northern Han origin. The 95% confidence interval (CI) and odds ratio (OR) were estimated by binary logistic regression. No obvious linkage disequilibrium or haplotypes were observed among these SNPs. Those with GG genotype and allele G of AKR1C3 (rs10508293) had a decreased risk of preeclampsia (adjusted OR = 3.011, 95% CI = 1.758-5.159, and adjusted OR = 1.745, 95% CI = 1.349-2.257, respectively). The AA genotype and allele A of WNK1 (rs1468326) were significantly associated with an increased risk in preeclampsia (adjusted OR = 2.307, 95% CI = 1.206-3.443, and adjusted OR = 1.663, 95% CI = 1.283-2.157, respectively). The findings indicate that the GG genotype of AKR1C3 rs10508293 is associated with decreased risk for preeclampsia and the AA genotype of WNK1 rs1468326 are related with an increased risk for preeclampsia. Copyright © 2018 Elsevier B.V. All rights reserved.
Yan, Weili; Zhang, Yuanming; Shan, Zimei; Wang, Qian; Huang, Yongdi; Wang, Chenchen; Yan, Kai
2011-12-01
Polymorphisms of REN, AGTR1 and AGTR2 may be associated with responses of renin-angiotensin-aldosterone system (RAAS) activity phenotypes to angiotensin-converting enzyme inhibitor (ACEI) antihypertensive treatment. A total of 400 first diagnosed Kazak hypertensives were randomly allocated to two groups and received a 3-week course of either captopril and atenolol as monotherapy under double blinding. Genotype-phenotype association analyses were performed by covariance analyses between baseline level and responses of blood pressure, renin, angiotensin II and aldosterone concentrations with tagging single nucleotide polymorphisms (SNPs) in REN, AGTR1 and AGTR2 genes. A false discovery rate method was used to adjust multiple testing. After adjustment for multiple testing, we found that the G allele of rs6676670 (T/G) in intron 1 of REN was significantly associated with higher baseline aldosterone concentrations (p < 0.0001, explained variance (EV) = 2.3%). Significant associations after adjustments were also found between the A allele of rs2887284, with higher baseline renin activity (p = 0.022, EV = 1.0%), higher responses of renin (p = 0.018 EV = 5.4%), and higher responses of angiotensin II (p = 0.0255, EV = 3.13%) to the treatment of ACEI. The carriers of the A allele of rs2887284 appeared to be more sensitive to the ACEI treatment. rs2887284 in intron 9 of REN is associated with the response of renin and angiotensin II levels to ACEI treatment.
Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin
2007-01-01
Background The sickle (βs) mutation in the beta-globin gene (HBB) occurs on five "classical" βs haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the βs allele – a consequence of protection from severe malarial infection afforded by heterozygotes – has been associated with a high degree of extended haplotype similarity. The relationship between classical βs haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical βs haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). Results The most common βs sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the βs mutation. Conclusion Two different classical βs haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of βs haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence
Tellechea, M L; Steinhardt, A Penas; Rodriguez, G; Taverna, M J; Poskus, E; Frechtel, G
2013-05-01
Specific Suppressor of Cytokine Signaling (SOCS) members, such as SOCS7, may play a role in the development of insulin resistance (IR) owing to their ability to inhibit insulin signaling pathways. The objective was to explore the association between common variants and related haplotypes in SOCS7 gene and metabolic traits related to obesity, lipid metabolism and IR. 780 unrelated men were included in a cross-sectional study. We selected three tagged SNPs that capture 100% of SNPs with minor allele frequency ≥ 0.10. Analyses were done separately for each SNP and followed up by haplotype analysis. rs8074124C was associated with both obesity (p = 0.005) and abdominal obesity (p = 0.002) and allele C carriers showed, in comparison with TT carriers, lower BMI (p = 0.001) and waist circumference (p = 0.001). rs8074124CC- carriers showed lower fasting insulin (p = 0.017) and HOMA-IR (p = 0.018) than allele T carriers. rs12051836C was associated with hypertriglyceridemia (p = 0.009) and hypertriglyceridemic waist (p = 0.006). rs12051836CC- carriers showed lower fasting insulin (p = 0.043) and HOMA-IR (p = 0.042). Haplotype-based association analysis (rs8074124 and rs12051836 in that order) showed associations with lipid and obesity -related phenotypes, consistent with single locus analysis. Haplotype analysis also revealed association between haplotype CT and both decreased HDL-C (p = 0.026) and HDL-C (p = 0.014) as a continuous variable. We found, for the first time, significant associations between SOCS7 common variants and related haplotypes and obesity, IR and lipid metabolism disorders. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.
Nahajevszky, Sarolta; Andrikovics, Hajnalka; Batai, Arpad; Adam, Emma; Bors, Andras; Csomor, Judit; Gopcsa, Laszlo; Koszarska, Magdalena; Kozma, Andras; Lovas, Nora; Lueff, Sandor; Matrai, Zoltan; Meggyesi, Nora; Sinko, Janos; Sipos, Andrea; Varkonyi, Andrea; Fekete, Sandor; Tordai, Attila; Masszi, Tamas
2011-01-01
Background Prognostic risk stratification according to acquired or inherited genetic alterations has received increasing attention in acute myeloid leukemia in recent years. A germline Janus kinase 2 haplotype designated as the 46/1 haplotype has been reported to be associated with an inherited predisposition to myeloproliferative neoplasms, and also to acute myeloid leukemia with normal karyotype. The aim of this study was to assess the prognostic impact of the 46/1 haplotype on disease characteristics and treatment outcome in acute myeloid leukemia. Design and Methods Janus kinase 2 rs12343867 single nucleotide polymorphism tagging the 46/1 haplotype was genotyped by LightCycler technology applying melting curve analysis with the hybridization probe detection format in 176 patients with acute myeloid leukemia under 60 years diagnosed consecutively and treated with curative intent. Results The morphological subtype of acute myeloid leukemia with maturation was less frequent among 46/1 carriers than among non-carriers (5.6% versus 17.2%, P=0.018, cytogenetically normal subgroup: 4.3% versus 20.6%, P=0.031), while the morphological distribution shifted towards the myelomonocytoid form in 46/1 haplotype carriers (28.1% versus 14.9%, P=0.044, cytogenetically normal subgroup: 34.0% versus 11.8%, P=0.035). In cytogenetically normal cases of acute myeloid leukemia, the 46/1 carriers had a considerably lower remission rate (78.7% versus 94.1%, P=0.064) and more deaths in remission or in aplasia caused by infections (46.8% versus 23.5%, P=0.038), resulting in the 46/1 carriers having shorter disease-free survival and overall survival compared to the 46/1 non-carriers. In multivariate analysis, the 46/1 haplotype was an independent adverse prognostic factor for disease-free survival (P=0.024) and overall survival (P=0.024) in patients with a normal karyotype. Janus kinase 2 46/1 haplotype had no impact on prognosis in the subgroup with abnormal karyotype. Conclusions Janus
Dong, Chaoling; Ptacek, Travis S; Redden, David T; Zhang, Kui; Brown, Elizabeth E.; Edberg, Jeffrey C.; McGwin, Gerald; Alarcón, Graciela S.; Ramsey-Goldman, Rosalind; Reveille, John D.; Vilá, Luis M.; Petri, Michelle; Qin, Aijian; Wu, Jianming; Kimberly, Robert P.
2014-01-01
Objective To investigate whether the FcγRIIIa-66R/H/L polymorphism influences net effective receptor function and to assess if the FCGR3A combined genotypes formed by FcγRIIIa-66R/H/L and FcγRIIIa-176F/V as well as copy number variation (CNV) confer risk for development of SLE and lupus nephritis. Methods FcγRIIIa variants, expressed on A20 IIA1.6 cells, were used in flow cytometry-based human IgG binding assays. FCGR3A SNP and CNV genotypes were determined by Pyrosequencing methodology in a cohort of 1728 SLE patients and 2404 healthy controls. Results The FcγRIIIa-66L/H/R (rs10127939) polymorphism influences ligand binding capacity in the context of the FcγRIIIa-176V (rs396991) allele. The low binding FcγRIIIa-176F allele was associated with SLE nephritis (p = 0.0609) in African Americans but not in European Americans (p > 0.10). Nephritis among African American SLE subjects was associated with FcγRIIIa low binding haplotypes containing the 66R/H/L and 176F variants (p = 0.03) and with low binding genotype combinations (p = 0.002). No association was observed in European American SLE patients. The distribution of FCGR3A CNV was not significantly different between controls and SLE patients with or without nephritis. Conclusion FcγRIIIa-66R/H/L influences ligand binding. The low binding haplotypes formed by 66R/H/L and 176F confer enhanced risk for lupus nephritis in African Americans. FCGR3A CNVs are not associated with SLE or SLE nephritis in either African Americans or European Americans. PMID:24782186
Crespi, Bernard; Read, Silven; Hurd, Peter
2017-10-01
We genotyped a healthy population for three haplotype-tagging FOXP2 SNPs, and tested for associations of these SNPs with strength of handedness and questionnaire-based metrics of inner speech characteristics (ISP) and speech fluency (FLU), as derived from the Schizotypal Personality Questionnaire-BR. Levels of mixed-handedness were positively correlated with ISP and FLU, supporting prior work on these two domains. Genotype for rs7799109, a SNP previously linked with lateralization of left frontal regions underlying language, was associated with degree of mixed handedness and with scores for ISP and FLU phenotypes. Genotype of rs1456031, which has previously been linked with auditory hallucinations, was also associated with ISP phenotypes. These results provide evidence that FOXP2 SNPs influence aspects of human inner speech and fluency that are related to lateralized phenotypes, and suggest that the evolution of human language, as mediated by the adaptive evolution of FOXP2, involved features of inner speech. Copyright © 2017 Elsevier Inc. All rights reserved.
COLE-TOBIAN, JENNIFER L.; ZIMMERMAN, PETER A.; KING, CHRISTOPHER L.
2013-01-01
Individuals living in malaria endemic areas are often infected with multiple parasite clones. Currently used single nucleotide polymorphism (SNP) genotyping methods for malaria parasites are cumbersome; furthermore, few methods currently exist that can rapidly determine the most abundant clone in these complex infections. Here we describe an oligonucleotide ligation assay (OLA) to distinguish SNPs in the Plasmodium vivax Duffy binding protein gene (Pvdbp) at 14 polymorphic residues simultaneously. Allele abundance is determined by the highest mean fluorescent intensity of each allele. Using mixtures of plasmids encoding known haplotypes of the Pvdbp, single clones of P. vivax parasites from infected Aotus monkeys, and well-defined mixed infections from field samples, we were able to identify the predominant Pvdbp genotype with > 93% accuracy when the dominant clone is twice as abundant as a lesser genotype and > 97% of the time if the ratio was 5:1 or greater. Thus, the OLA can accurately, reproducibly, and rapidly determine the predominant parasite haplotype in complex blood stage infections. PMID:17255222
Pavy, Nathalie; Parsons, Lee S; Paule, Charles; MacKay, John; Bousquet, Jean
2006-01-01
Background High-throughput genotyping technologies represent a highly efficient way to accelerate genetic mapping and enable association studies. As a first step toward this goal, we aimed to develop a resource of candidate Single Nucleotide Polymorphisms (SNP) in white spruce (Picea glauca [Moench] Voss), a softwood tree of major economic importance. Results A white spruce SNP resource encompassing 12,264 SNPs was constructed from a set of 6,459 contigs derived from Expressed Sequence Tags (EST) and by using the bayesian-based statistical software PolyBayes. Several parameters influencing the SNP prediction were analysed including the a priori expected polymorphism, the probability score (PSNP), and the contig depth and length. SNP detection in 3' and 5' reads from the same clones revealed a level of inconsistency between overlapping sequences as low as 1%. A subset of 245 predicted SNPs were verified through the independent resequencing of genomic DNA of a genotype also used to prepare cDNA libraries. The validation rate reached a maximum of 85% for SNPs predicted with either PSNP ≥ 0.95 or ≥ 0.99. A total of 9,310 SNPs were detected by using PSNP ≥ 0.95 as a criterion. The SNPs were distributed among 3,590 contigs encompassing an array of broad functional categories, with an overall frequency of 1 SNP per 700 nucleotide sites. Experimental and statistical approaches were used to evaluate the proportion of paralogous SNPs, with estimates in the range of 8 to 12%. The 3,789 coding SNPs identified through coding region annotation and ORF prediction, were distributed into 39% nonsynonymous and 61% synonymous substitutions. Overall, there were 0.9 SNP per 1,000 nonsynonymous sites and 5.2 SNPs per 1,000 synonymous sites, for a genome-wide nonsynonymous to synonymous substitution rate ratio (Ka/Ks) of 0.17. Conclusion We integrated the SNP data in the ForestTreeDB database along with functional annotations to provide a tool facilitating the choice of candidate
Xia, Xiaojun; Duan, Yun; Cui, Jie; Jiang, Junfeng; Lin, Li; Peng, Xiaojuan; Wang, YuHong; Guo, Bingtao; Liu, Shouhai; Lei, Xudong
2017-08-01
The aim of this study was to investigate the association of methylenetetrahydrofolate reductase (MTHFR) gene polymorphism and additional gene-gene interaction with acute lymphoblastic leukemia (ALL) risk. Logistic regression was performed to investigate the association between two single nucleotide polymorphisms (SNPs) within MTHFR gene and ALL risk and additional gene-gene interaction between rs1801133 and rs1801131. The minor allele of rs1801133 and rs1801131 is associated with decreased ALL risk, OR (95% CI) were 0.61 (0.38-0.89), and 0.68 (0.50-0.96), respectively. We also found a significantly interaction between the two SNPs, participants with rs1801133 - CT or TT and rs1801131 - AC or CC genotype have the lowest ALL risk, compared with participants with rs1801133 - CC and rs1801131 - AA genotype, OR (95% CI) was 0.32 (0.12-0.63). We did not find any haplotype between the rs1801133 and rs1801131 associated with ALL risk. rs1801133 and rs1801131 within MTHFR gene and their interaction were both associated with ALL risk in Chinese children.
Haplotyping for disease association: a combinatorial approach.
Lancia, Giuseppe; Ravi, R; Rizzi, Romeo
2008-01-01
We consider a combinatorial problem derived from haplotyping a population with respect to a genetic disease, either recessive or dominant. Given a set of individuals, partitioned into healthy and diseased, and the corresponding sets of genotypes, we want to infer "bad'' and "good'' haplotypes to account for these genotypes and for the disease. Assume e.g. the disease is recessive. Then, the resolving haplotypes must consist of bad and good haplotypes, so that (i) each genotype belonging to a diseased individual is explained by a pair of bad haplotypes and (ii) each genotype belonging to a healthy individual is explained by a pair of haplotypes of which at least one is good. We prove that the associated decision problem is NP-complete. However, we also prove that there is a simple solution, provided the data satisfy a very weak requirement.
Chen, N B; Ma, Y; Yang, T; Lin, F; Fu, W W; Xu, Y J; Li, F; Li, J Y; Gao, S X
2015-08-01
Angiopoietin-like protein 3 (ANGPTL3) is a secreted protein that regulates lipid, glucose and energy metabolism. This study was conducted to better understand the effect of ANGPTL3 on important economic traits in cattle. First, transcript profiles for ANGPTL3 were measured in nine different Jiaxian cattle tissues. Second, polymorphisms were identified in the complete coding region and promoter region of the bovine ANGPTL3 gene in 707 cattle samples. Finally, an association study was carried out utilizing these single nucleotide polymorphisms (SNPs) to determine the effect of these SNPs on the growth and meat quality traits. Quantitative real-time PCR analysis showed that ANGPTL3 was mainly expressed in the liver. The promoter of the bovine ANGPTL3 contained several putative transcription factor binding sites (SF1, HNF-1, LXRα, NFκβ, HNF-3 and C/EBP). In total, four SNPs of the bovine ANGPTL3 gene were identified by direct sequencing. SNP1 (rs469906272: g.-38T>C) was identified in the promoter, SNP2 (rs451104723:g.104A>T) and SNP3 (rs482516226: g.509A>G) were identified in exon 1, and SNP4 (rs477165942: g.8661T>C) was identified in exon 6. Changes in predicted protein structures due to non-synonymous SNPs were analyzed. Haplotype frequencies and linkage disequilibrium were also investigated. Analysis of four SNPs in cattle from different native Chinese breeds (Nanyang (NY) and Jiaxian (JX)) and commercial breeds (Angus (AG), Hereford (HF), Limousin (LM), Luxi (LX), Simmental (ST) and Jinnan (JN)) revealed a significant association with growth traits (including: BW and hipbone width) and meat quality traits (including: Warner-Bratzler shear force and ribeye area). Therefore, implementation of these four mutations in selection indices in the beef industry may be beneficial in selecting individuals with superior growth and meat quality traits.
Baker, Peter R.; Baschal, Erin E.; Fain, Pam R.; Triolo, Taylor M.; Nanduri, Priyaanka; Siebert, Janet C.; Armstrong, Taylor K.; Babu, Sunanda R.; Rewers, Marian J.; Gottlieb, Peter A.; Barker, Jennifer M.; Eisenbarth, George S.
2010-01-01
Context: Multiple autoimmune disorders (e.g. Addison’s disease, type 1 diabetes, celiac disease) are associated with HLA-DR3, but it is likely that alleles of additional genes in linkage disequilibrium with HLA-DRB1 contribute to disease. Objective: The objective of the study was to characterize major histocompatability complex (MHC) haplotypes conferring extreme risk for autoimmune Addison’s disease (AD). Design, Setting, and Participants: Eighty-six 21-hydroxylase autoantibody-positive, nonautoimmune polyendocrine syndrome type 1, Caucasian individuals collected from 1992 to 2009 with clinical AD from 68 families (12 multiplex and 56 simplex) were genotyped for HLA-DRB1, HLA-DQB1, MICA, HLA-B, and HLA-A as well as high density MHC single-nucleotide polymorphism (SNP) analysis for 34. Main Outcome Measures: AD and genotype were measured. Result: Ninety-seven percent of the multiplex individuals had both HLA-DR3 and HLA-B8 vs. 60% of simplex AD patients (P = 9.72 × 10−4) and 13% of general population controls (P = 3.00 × 10−19). The genotype DR3/DR4 with B8 was present in 85% of AD multiplex patients, 24% of simplex patients, and 1.5% of control individuals (P = 4.92 × 10−191). The DR3-B8 haplotype of AD patients had HLA-A1 less often (47%) than controls (81%, P = 7.00 × 10−5) and type 1 diabetes patients (73%, P = 1.93 × 10−3). Analysis of 1228 SNPs across the MHC for individuals with AD revealed a shorter conserved haplotype (3.8) with the loss of the extended conserved 3.8.1 haplotype approximately halfway between HLA-B and HLA-A. Conclusion: Extreme risk for AD, especially in multiplex families, is associated with haplotypic DR3 variants, in particular a portion (3.8) but not all of the conserved 3.8.1 haplotype. PMID:20631027
Fornage, Myriam; Mosley, Thomas H; Jack, Clifford R; de Andrade, Mariza; Kardia, Sharon L R; Boerwinkle, Eric; Turner, Stephen T
2007-01-01
Susceptibility to ischemic damage to the subcortical white matter of the brain has a strong genetic basis. Dysregulation of matrix metalloproteinases (MMPs) contributes to loss of cerebrovascular integrity and white matter injury. We investigated whether sequence variation in the genes encoding MMP3 and MMP9 is associated with variation in leukoaraiosis volume, determined by magnetic resonance imaging, in non-Hispanic whites and African-Americans using family-based association tests. Seven hundred and fifty-six white and 671 African-American individuals from sibships ascertained through two or more siblings with hypertension were genotyped for 7 and 8 haplotype-tagging polymorphisms in the MMP3 and MMP9 genes, respectively. MMP3 sequence variation was significantly associated with variation in leukoaraiosis volume in Whites. Two common haplotypes with opposing relationships to leukoaraiosis volume were identified. MMP9 sequence variation was also significantly associated with variation in leukoaraiosis volume in both African-Americans and Whites. Different haplotypes contributed to these associations in the two racial groups. These findings add to the growing body of evidence from animal models and human clinical studies suggesting a role of MMPs in ischemic white matter injury. They provide the basis for further investigation of the role of these genes in susceptibility and/or progression to clinical disease.
Pariset, Lorraine; Mariotti, Marco; Gargani, Maria; Joost, Stephane; Negrini, Riccardo; Perez, Trinidad; Bruford, Michael; Ajmone Marsan, Paolo; Valentini, Alessio
2011-01-01
We employed mtDNA and nuclear SNPs to investigate the genetic diversity of sheep breeds of three countries of the Mediterranean basin: Albania, Greece, and Italy. In total, 154 unique mtDNA haplotypes were detected by means of D-loop sequence analysis. The major nucleotide diversity was observed in Albania. We identified haplogroups, A, B, and C in Albanian and Greek samples, while Italian individuals clustered in groups A and B. In general, the data show a pattern reflecting old migrations that occurred in postneolithic and historical times. PCA analysis on SNP data differentiated breeds with good correspondence to geographical locations. This could reflect geographical isolation, selection operated by local sheep farmers, and different flock management and breed admixture that occurred in the last centuries. PMID:22125424
Factor IX gene haplotypes in Amerindians.
Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S
1997-02-01
We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.
Your Guide to Medicare Special Needs Plans (SNPs)
... Needs Plans Where Are Medicare SNPs Offered? Each year, different types of Medicare SNPs may be available in different parts of the country. Insurance companies decide where they will do business, so Medicare SNPs may not be available in ...
Anderson, Eric C
2012-11-08
Advances in genotyping that allow tens of thousands of individuals to be genotyped at a moderate number of single nucleotide polymorphisms (SNPs) permit parentage inference to be pursued on a very large scale. The intergenerational tagging this capacity allows is revolutionizing the management of cultured organisms (cows, salmon, etc.) and is poised to do the same for scientific studies of natural populations. Currently, however, there are no likelihood-based methods of parentage inference which are implemented in a manner that allows them to quickly handle a very large number of potential parents or parent pairs. Here we introduce an efficient likelihood-based method applicable to the specialized case of cultured organisms in which both parents can be reliably sampled. We develop a Markov chain representation for the cumulative number of Mendelian incompatibilities between an offspring and its putative parents and we exploit it to develop a fast algorithm for simulation-based estimates of statistical confidence in SNP-based assignments of offspring to pairs of parents. The method is implemented in the freely available software SNPPIT. We describe the method in detail, then assess its performance in a large simulation study using known allele frequencies at 96 SNPs from ten hatchery salmon populations. The simulations verify that the method is fast and accurate and that 96 well-chosen SNPs can provide sufficient power to identify the correct pair of parents from amongst millions of candidate pairs.
Kotnik, Barbara Faganel; Jazbec, Janez; Grabar, Petra Bohanec; Rodriguez-Antona, Cristina
2017-01-01
Abstract Background We investigated the clinical relevance of SLC 19A1 genetic variability for high dose methotrexate (HD-MTX) related toxicities in children and adolescents with acute lymphoblastic leukaemia (ALL) and non Hodgkin malignant lymphoma (NHML). Patients and methods Eighty-eight children and adolescents with ALL/NHML were investigated for the influence of SLC 19A1 single nucleotide polymorphisms (SNPs) and haplotypes on HD-MTX induced toxicities. Results Patients with rs2838958 TT genotype had higher probability for mucositis development as compared to carriers of at least one rs2838958 C allele (OR 0.226 (0.071–0.725), p < 0.009). Haplotype TGTTCCG (H4) statistically significantly reduced the risk for the occurrence of adverse events during treatment with HD-MTX (OR 0.143 (0.023–0.852), p = 0.030). Conclusions SLC 19A1 SNP and haplotype analysis could provide additional information in a personalized HD-MTX therapy for children with ALL/NHML in order to achieve better treatment outcome. However further studies are needed to validate the results. PMID:29333125
Sex-specific effect of Pirin gene on bone mineral density in a cohort of 4000 Chinese.
Tang, Nelson L S; Liao, Chen Di; Ching, Jasmine K L; Suen, Eddie W C; Chan, Iris H S; Orwoll, Eric; Ho, Suzanne C; Chan, Frank W K; Kwok, Anthony W L; Kwok, Timothy; Woo, Jean; Leung, Ping Chung
2010-02-01
Osteoporosis is a common condition among elderly. Genetic mapping studies repeatedly located the distal short arms of X-chromosome as the quantitative trait loci (QTL) for BMD in mice. Fine mapping of a syntenic segment on Xp22 in a Caucasian female population suggested a moderate association between lumbar spine (LS) BMD and 2 intronic SNPs in the Pirin (PIR) gene, which encodes an iron-binding nuclear protein. This study aimed to examine genetic variations in the PIR gene by a comprehensive tagging method and its sex-specific effects on BMD and osteoporotic risk. Two thousand men and 2000 women aged 65 or above were recruited from the community. BMDs at the LS, femoral neck, total hip and whole body were measured and followed up at 4-year. Genotyping was performed for tagSNPs of PIR gene including adjacent regions, and the PIR haplotypes were inferred using PHASE program. Analysis by linear regression showed a significant association between SNP rs5935970 and LS-BMD, while haplotype T-T-A was significantly associated with BMD of all measured sites. However, none of such associations were found in men. Linear Mixed Model also confirmed the same sex-specific and site-specific effect for longitudinal BMD changes. In addition to confirming the association between BMDs and the PIR gene, we also revealed that this finding is sex-specific, possibly due to an X-linked effect. This study demonstrated the importance of considering sex and genetic interactions in studies of disease predisposition and complex traits. (c) 2009 Elsevier Inc. All rights reserved.
Detecting structure of haplotypes and local ancestry
USDA-ARS?s Scientific Manuscript database
We present a two-layer hidden Markov model to detect the structure of haplotypes for unrelated individuals. This allows us to model two scales of linkage disequilibrium (one within a group of haplotypes and one between groups), thereby taking advantage of rich haplotype information to infer local an...
Extended Islands of Tractability for Parsimony Haplotyping
NASA Astrophysics Data System (ADS)
Fleischer, Rudolf; Guo, Jiong; Niedermeier, Rolf; Uhlmann, Johannes; Wang, Yihui; Weller, Mathias; Wu, Xi
Parsimony haplotyping is the problem of finding a smallest size set of haplotypes that can explain a given set of genotypes. The problem is NP-hard, and many heuristic and approximation algorithms as well as polynomial-time solvable special cases have been discovered. We propose improved fixed-parameter tractability results with respect to the parameter "size of the target haplotype set" k by presenting an O *(k 4k )-time algorithm. This also applies to the practically important constrained case, where we can only use haplotypes from a given set. Furthermore, we show that the problem becomes polynomial-time solvable if the given set of genotypes is complete, i.e., contains all possible genotypes that can be explained by the set of haplotypes.
Y-SNPs Do Not Indicate Hybridisation between European Aurochs and Domestic Cattle
Bollongino, Ruth; Elsner, Julia; Vigne, Jean-Denis; Burger, Joachim
2008-01-01
Background Previous genetic studies of modern and ancient mitochondrial DNA have confirmed the Near Eastern origin of early European domestic cattle. However, these studies were not able to test whether hybridisation with male aurochs occurred post-domestication. To address this issue, Götherström and colleagues (2005) investigated the frequencies of two Y-chromosomal haplotypes in extant bulls. They found a significant influence of wild aurochs males on domestic populations thus challenging the common view on early domestication and Neolithic stock-rearing. To test their hypothesis, we applied these Y-markers on Neolithic bone specimens from various European archaeological sites. Methods and Findings Here, we have analysed the ancient DNA of 59 Neolithic skeletal samples. After initial molecular sexing, two segregating Y-SNPs were identified in 13 bulls. Strikingly, our results do not support the hypothesis that these markers distinguish European aurochs from domesticated cattle. Conclusions The model of a rapid introduction of domestic cattle into Central Europe without significant crossbreeding with local wild cattle remains unchallenged. PMID:18852900
Haplotype analysis of the 185delAG BRCA1 mutation in ethnically diverse populations
Laitman, Yael; Feng, Bing-Jian; Zamir, Itay M; Weitzel, Jeffrey N; Duncan, Paul; Port, Danielle; Thirthagiri, Eswary; Teo, Soo-Hwang; Evans, Gareth; Latif, Ayse; Newman, William G; Gershoni-Baruch, Ruth; Zidan, Jamal; Shimon-Paluch, Shani; Goldgar, David; Friedman, Eitan
2013-01-01
The 185delAG* BRCA1 mutation is encountered primarily in Jewish Ashkenazi and Iraqi individuals, and sporadically in non-Jews. Previous studies estimated that this is a founder mutation in Jewish mutation carriers that arose before the dispersion of Jews in the Diaspora ∼2500 years ago. The aim of this study was to assess the haplotype in ethnically diverse 185delAG* BRCA1 mutation carriers, and to estimate the age at which the mutation arose. Ethnically diverse Jewish and non-Jewish 185delAG*BRCA1 mutation carriers and their relatives were genotyped using 15 microsatellite markers and three SNPs spanning 12.5 MB, encompassing the BRCA1 gene locus. Estimation of mutation age was based on a subset of 11 markers spanning a region of ∼5 MB, using a previously developed algorithm applying the maximum likelihood method. Overall, 188 participants (154 carriers and 34 noncarriers) from 115 families were included: Ashkenazi, Iraq, Kuchin-Indians, Syria, Turkey, Iran, Tunisia, Bulgaria, non-Jewish English, non-Jewish Malaysian, and Hispanics. Haplotype analysis indicated that the 185delAG mutation arose 750–1500 years ago. In Ashkenazim, it is a founder mutation that arose 61 generations ago, and with a small group of founder mutations was introduced into the Hispanic population (conversos) ∼650 years ago, and into the Iraqi–Jewish community ∼450 years ago. The 185delAG mutation in the non-Jewish populations in Malaysia and the UK arose at least twice independently. We conclude that the 185delAG* BRCA1 mutation resides on a common haplotype among Ashkenazi Jews, and arose about 61 generations ago and arose independently at least twice in non-Jews. PMID:22763381
Zheng, Jie; Rodriguez, Santiago; Laurin, Charles; Baird, Denis; Trela-Larsen, Lea; Erzurumluoglu, Mesut A; Zheng, Yi; White, Jon; Giambartolomei, Claudia; Zabaneh, Delilah; Morris, Richard; Kumari, Meena; Casas, Juan P; Hingorani, Aroon D; Evans, David M; Gaunt, Tom R; Day, Ian N M
2017-01-01
Fine mapping is a widely used approach for identifying the causal variant(s) at disease-associated loci. Standard methods (e.g. multiple regression) require individual level genotypes. Recent fine mapping methods using summary-level data require the pairwise correlation coefficients ([Formula: see text]) of the variants. However, haplotypes rather than pairwise [Formula: see text], are the true biological representation of linkage disequilibrium (LD) among multiple loci. In this article, we present an empirical iterative method, HAPlotype Regional Association analysis Program (HAPRAP), that enables fine mapping using summary statistics and haplotype information from an individual-level reference panel. Simulations with individual-level genotypes show that the results of HAPRAP and multiple regression are highly consistent. In simulation with summary-level data, we demonstrate that HAPRAP is less sensitive to poor LD estimates. In a parametric simulation using Genetic Investigation of ANthropometric Traits height data, HAPRAP performs well with a small training sample size (N < 2000) while other methods become suboptimal. Moreover, HAPRAP's performance is not affected substantially by single nucleotide polymorphisms (SNPs) with low minor allele frequencies. We applied the method to existing quantitative trait and binary outcome meta-analyses (human height, QTc interval and gallbladder disease); all previous reported association signals were replicated and two additional variants were independently associated with human height. Due to the growing availability of summary level data, the value of HAPRAP is likely to increase markedly for future analyses (e.g. functional prediction and identification of instruments for Mendelian randomization). The HAPRAP package and documentation are available at http://apps.biocompute.org.uk/haprap/ CONTACT: : jie.zheng@bristol.ac.uk or tom.gaunt@bristol.ac.ukSupplementary information: Supplementary data are available at
Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi
2012-01-01
We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.
Influences of APOA5 Variants on Plasma Triglyceride Levels in Uyghur Population
Wang, Yi; Wu, Di; Jin, Li; Wang, Xiaofeng
2014-01-01
Objective Single nucleotide polymorphisms (SNPs) in apolipoprotein A5 (APOA5) gene are associated with triglyceride (TG) levels. However, the minor allele frequencies and linkage disequilibriums (LDs) of the SNPs in addition to their effects on TG levels vary greatly between Caucasians and East Asians. The distributions of the SNPs/haplotypes and their associations with TG levels in Uyghur population, an admixture population of Caucasians and East Asians, have not been reported to date. Here, we performed a cross-sectional study to address these. Methods Genotyping of four SNPs in APOA5 (rs662799, rs3135506, rs2075291, and rs2266788) was performed in 1174 unrelated Uyghur subjects. SNP/haplotype and TG association analyses were conducted. Results The frequencies of the SNPs in Uyghurs were in between those in Caucasians and East Asians. The LD between rs662799 and rs2266788 in Uyghurs was stronger than that in East Asians but weaker than that in Caucasians, and the four SNPs resulted in four haplotypes (TGGT, CGGC, TCGT, and CGTT arranged in the order of rs662799, rs3135506, rs2075291, and rs2266788) representing 99.2% of the population. All the four SNPs were significantly associated with TG levels. Compared with non-carriers, carriers of rs662799-C, rs3135506-C, rs2075291-T, and rs2266788-C alleles had 16.0%, 15.1%, 17.1%, and 12.4% higher TG levels, respectively. When haplotype TGGT was defined as the reference, the haplotypes CGGC, TCGT, and CGTT resulted in 16.1%, 19.0%, and 19.8% higher TG levels, respectively. The proportions of variance in TG explained by APOA5 locus were 2.5%, 0.3%, 0.4%, and 1.9% for single SNP rs662799, rs3135506, rs2075291, and rs2266788, respectively, and 3.0% for the haplotypes constructed by them. Conclusions The association profiles between the SNPs and haplotypes at APOA5 locus and TG levels in this admixture population differed from those in Caucasians and East Asians. The functions of these SNPs and haplotypes need to be
Zhao, Hui; Wu, Xuan; Dong, Chun-Ling; Wang, Bi-Ying; Zhao, Jiao; Cao, Xian-E
2017-08-01
This study was designed to investigate the association between single nucleotide polymorphisms (SNPs) of the β2-adrenergic receptor (ADRB2) gene and the risk of chronic obstructive pulmonary disease (COPD) in a Chinese population. From January 2010 to October 2014, 261 COPD patients were selected as the case group and 239 healthy subjects were selected as the control group. Pulmonary function tests were performed to detect forced vital capacity (FVC), 1-s forced expiratory volume (FEV 1 ), and FEV 1 /FVC (%). rs1042711, rs1042714, and rs1042718 were selected as tagSNPs of the ADRB2 gene from the HapMap database in accordance with previous studies. The ADRB2 genotypes were established by real-time polymerase chain reaction assays using TaqMan-labeled probes. The relationships between the ADRB2 polymorphisms and COPD risk were estimated using logistic regression analyses. The frequency of the genotypes and alleles of rs1042711 in ADRB2 showed a significant difference between the COPD and control groups (p < 0.05); compared with the CC genotype, the non-CC genotypes showed an increased COPD risk (p = 0.002). Compared with the CC haplotype, the TG haplotype increased COPD risk, while the CG haplotype reduced COPD risk for normal individuals. Compared with the CC genotype, the TT genotype showed significantly lower FEV 1 and FEV 1 /FVC (p = 0.022, p = 0.0191, respectively). Both the TC and TG haplotypes showed lower FEV 1 and FEV 1 /FVC in comparison with the CC haplotype (both p < 0.05). The results of logistic regression analysis showed that rs1042711 of ADRB2 and smoking history were associated with COPD risk (both p < 0.05). It is indicated that the TT genotype of rs1042711 and smoking pack years are both risk factors for COPD.
Simčič, Mojca; Smetko, Anamarija; Sölkner, Johann; Seichter, Doris; Gorjanc, Gregor; Kompan, Dragomir; Medugorac, Ivica
2015-01-01
The aim of this study was to obtain unbiased estimates of the diversity parameters, the population history, and the degree of admixture in Cika cattle which represents the local admixed breeds at risk of extinction undergoing challenging conservation programs. Genetic analyses were performed on the genome-wide Single Nucleotide Polymorphism (SNP) Illumina Bovine SNP50 array data of 76 Cika animals and 531 animals from 14 reference populations. To obtain unbiased estimates we used short haplotypes spanning four markers instead of single SNPs to avoid an ascertainment bias of the BovineSNP50 array. Genome-wide haplotypes combined with partial pedigree and type trait classification show the potential to improve identification of purebred animals with a low degree of admixture. Phylogenetic analyses demonstrated unique genetic identity of Cika animals. Genetic distance matrix presented by rooted Neighbour-Net suggested long and broad phylogenetic connection between Cika and Pinzgauer. Unsupervised clustering performed by the admixture analysis and two-dimensional presentation of the genetic distances between individuals also suggest Cika is a distinct breed despite being similar in appearance to Pinzgauer. Animals identified as the most purebred could be used as a nucleus for a recovery of the native genetic background in the current admixed population. The results show that local well-adapted strains, which have never been intensively managed and differentiated into specific breeds, exhibit large haplotype diversity. They suggest a conservation and recovery approach that does not rely exclusively on the search for the original native genetic background but rather on the identification and removal of common introgressed haplotypes would be more powerful. Successful implementation of such an approach should be based on combining phenotype, pedigree, and genome-wide haplotype data of the breed of interest and a spectrum of reference breeds which potentially have had
Chung, Chia-Min; Wang, Ruey-Yun; Fann, Cathy S. J.; Chen, Jaw-Wen; Jong, Yuh-Shiun; Jou, Yuh-Shan; Yang, Hsin-Chou; Kang, Chih-Sen; Chen, Chien-Chung; Chang, Huan-Cheng; Pan, Wen-Harn
2013-01-01
Angiotensin-converting enzyme (ACE) has been implicated in multiple biological system, particularly cardiovascular diseases. However, findings associating ACE insertion/deletion polymorphism with hypertension or other related traits are inconsistent. Therefore, in a two-stage approach, we aimed to fine-map ACE in order to narrow-down the function-specific locations. We genotyped 31 single nucleotide polymorphisms (SNPs) of ACE from 1168 individuals from 305 young-onset (age ≤40) hypertension pedigrees, and found four linkage disequilibrium (LD) blocks. A tag-SNP, rs1800764 on LD block 2, upstream of and near the ACE promoter, was significantly associated with young-onset hypertension (p = 0.04). Tag-SNPs on all LD blocks were significantly associated with ACE activity (p-value: 10–16 to <10–33). The two regions most associated with ACE activity were found between exon13 and intron18 and between intron 20 and 3′UTR, as revealed by measured haplotype analysis. These two major QTLs of ACE activity and the moderate effect variant upstream of ACE promoter for young-onset hypertension were replicated by another independent association study with 842 subjects. PMID:23469169
Valdisser, Paula Arielle M R; Pappas, Georgios J; de Menezes, Ivandilson P P; Müller, Bárbara S F; Pereira, Wendell J; Narciso, Marcelo G; Brondani, Claudio; Souza, Thiago L P O; Borba, Tereza C O; Vianello, Rosana P
2016-06-01
Researchers have made great advances into the development and application of genomic approaches for common beans, creating opportunities to driving more real and applicable strategies for sustainable management of the genetic resource towards plant breeding. This work provides useful polymorphic single-nucleotide polymorphisms (SNPs) for high-throughput common bean genotyping developed by RAD (restriction site-associated DNA) sequencing. The RAD tags were generated from DNA pooled from 12 common bean genotypes, including breeding lines of different gene pools and market classes. The aligned sequences identified 23,748 putative RAD-SNPs, of which 3357 were adequate for genotyping; 1032 RAD-SNPs with the highest ADT (assay design tool) score are presented in this article. The RAD-SNPs were structurally annotated in different coding (47.00 %) and non-coding (53.00 %) sequence components of genes. A subset of 384 RAD-SNPs with broad genome distribution was used to genotype a diverse panel of 95 common bean germplasms and revealed a successful amplification rate of 96.6 %, showing 73 % of polymorphic SNPs within the Andean group and 83 % in the Mesoamerican group. A slightly increased He (0.161, n = 21) value was estimated for the Andean gene pool, compared to the Mesoamerican group (0.156, n = 74). For the linkage disequilibrium (LD) analysis, from a group of 580 SNPs (289 RAD-SNPs and 291 BARC-SNPs) genotyped for the same set of genotypes, 70.2 % were in LD, decreasing to 0.10 %in the Andean group and 0.77 % in the Mesoamerican group. Haplotype patterns spanning 310 Mb of the genome (60 %) were characterized in samples from different origins. However, the haplotype frameworks were under-represented for the Andean (7.85 %) and Mesoamerican (5.55 %) gene pools separately. In conclusion, RAD sequencing allowed the discovery of hundreds of useful SNPs for broad genetic analysis of common bean germplasm. From now, this approach provides an excellent panel
Family-Based Association Testing of OCD-Associated SNPs of SLC1A1 in an Autism Sample
Brune, Camille W.; Kim, Soo-Jeong; Hanna, Gregory L.; Courchesne, Eric; Lord, Catherine; Leventhal, Bennett L.; Cook, Edwin H.
2009-01-01
Reports identified the neuronal glutamate transporter gene, SLC1A1 (OMIM 133550, chromosome 9p24), as a positional and functional candidate gene for obsessive–compulsive disorder (OCD). The presence of obsessions and compulsions similar to OCD in autism, the identification of this region in a genome-wide linkage analysis of individuals with autism spectrum disorders (ASDs), and the hypothesized role of glutamate in ASDs make SLC1A1 a candidate gene for ASD as well. To test for association between SLC1A1 and autism, we typed three single nucleotide polymorphisms (SNPs, rs301430, rs301979, rs301434) previously associated with OCD in 86 strictly defined trios with autism. Family-Based Association Tests (FBAT) with additive and recessive models were used to check for association. Additionally, an rs301430–rs301979 haplotype identified for OCD was investigated. FBAT revealed nominally significant association between autism and one SNP under a recessive model. The G allele of rs301979 was undertransmitted (equivalent to overtransmission of the C allele under a dominant model) to individuals with autism (Z = −2.47, P = 0.01). The G allele was also undertransmitted in the T–G haplotype under the recessive model (Z = −2.41, P = 0.02). Both findings were also observed in the male-only sample. However, they did not withstand correction for multiple comparisons. PMID:19360657
Reconstruction of Haplotype-Blocks Selected during Experimental Evolution.
Franssen, Susanne U; Barton, Nicholas H; Schlötterer, Christian
2017-01-01
The genetic analysis of experimentally evolving populations typically relies on short reads from pooled individuals (Pool-Seq). While this method provides reliable allele frequency estimates, the underlying haplotype structure remains poorly characterized. With small population sizes and adaptive variants that start from low frequencies, the interpretation of selection signatures in most Evolve and Resequencing studies remains challenging. To facilitate the characterization of selection targets, we propose a new approach that reconstructs selected haplotypes from replicated time series, using Pool-Seq data. We identify selected haplotypes through the correlated frequencies of alleles carried by them. Computer simulations indicate that selected haplotype-blocks of several Mb can be reconstructed with high confidence and low error rates, even when allele frequencies change only by 20% across three replicates. Applying this method to real data from D. melanogaster populations adapting to a hot environment, we identify a selected haplotype-block of 6.93 Mb. We confirm the presence of this haplotype-block in evolved populations by experimental haplotyping, demonstrating the power and accuracy of our haplotype reconstruction from Pool-Seq data. We propose that the combination of allele frequency estimates with haplotype information will provide the key to understanding the dynamics of adaptive alleles. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
González-Enríquez, G V; Torres-Mendoza, B M; Márquez-Pedroza, J; Macías-Islas, M A; Ortiz, G G; Cruz-Ramos, J A
2018-02-03
The HLA-DRB1*15:01 allele has a demonstrated risk for the development of multiple sclerosis (MS) in most populations around the world. The single nucleotide polymorphism (SNP) rs3129934 is found in linkage disequilibrium with the risk haplotype formed by the HLA-DRB1*15:01 and HLA-DQB1*06:02 alleles, and it is considered a reliable marker of the presence of this haplotype. Native Americans have a null or low prevalence of MS. In this study, we sought to identify the frequency of rs3129934 in the Wixárika ethnic group as well as in Mestizo (mixed race) patients with MS and in controls from western Mexico. Through real-time polymerase chain reaction (PCR) using TaqMan probes, we analyzed the allele and genotype frequencies of rs3129934 in Mestizo individuals with and without MS and in 73 Wixárika subjects from the state of Jalisco, Mexico. The Wixárika subjects were homozygote for the C allele of rs3129934. The allele and genotype frequency in Mestizos with MS was similar to that of other MS populations with Caucasian ancestry. The absence of the T risk allele rs3129934 (associated with the haplotype HLA-DRB1*15:01, HLA-DQ1*06:02) in this sample of Wixárika subjects is consistent with the unreported MS in this Amerindian group, related to absence of such paramount genetic risk factor.
Analysis of pharmacogenetic traits in two distinct South African populations
2011-01-01
Our knowledge of pharmacogenetic variability in diverse populations is scarce, especially in sub-Saharan Africa. To bridge this gap in knowledge, we characterised population frequencies of clinically relevant pharmacogenetic traits in two distinct South African population groups. We genotyped 211 tagging single nucleotide polymorphisms (tagSNPs) in 12 genes that influence antiretroviral drug disposition, in 176 South African individuals belonging to two distinct population groups residing in the Western Cape: the Xhosa (n = 109) and Cape Mixed Ancestry (CMA) (n = 67) groups. The minor allele frequencies (MAFs) of eight tagSNPs in six genes (those encoding the ATP binding cassette sub-family B, member 1 [ABCB1], four members of the cytochrome P450 family [CYP2A7P1, CYP2C18, CYP3A4, CYP3A5] and UDP-glucuronosyltransferase 1 [UGT1A1]) were significantly different between the Xhosa and CMA populations (Bonferroni p < 0.05). Twenty-seven haplotypes were inferred in four genes (CYP2C18, CYP3A4, the gene encoding solute carrier family 22 member 6 [SLC22A6] and UGT1A1) between the two South African populations. Characterising the Xhosa and CMA population frequencies of variant alleles important for drug transport and metabolism can help to establish the clinical relevance of pharmacogenetic testing in these populations. PMID:21712189
2011-01-01
Background Disrupted-in-Schizophrenia 1 (DISC1) gene is one of the most promising candidate genes for major mental disorders. In a previous study, a Finnish group demonstrated that DISC1 polymorphisms were associated with autism and Asperger syndrome. However, the results were not replicated in Korean population. To determine whether DISC1 is associated with autism in Chinese Han population, we performed a family-based association study between DISC1 polymorphisms and autism. Methods We genotyped seven tag single nucleotide polymorphisms (SNPs) in DISC1, spanning 338 kb, in 367 autism trios (singleton and their biological parents) including 1,101 individuals. Single SNP association and haplotype association analysis were performed using the family-based association test (FBAT) and Haploview software. Results We found three SNPs showed significant associations with autism (rs4366301: G > C, Z = 2.872, p = 0.004; rs11585959: T > C, Z = 2.199, p = 0.028; rs6668845: A > G, Z = 2.326, p = 0.02). After the Bonferroni correction, SNP rs4366301, which located in the first intron of DISC1, remained significant. When haplotype were constructed with two-markers, three haplotypes displayed significant association with autism. These results were still significant after using the permutation method to obtain empirical p values. Conclusions Our study provided evidence that the DISC1 may be the susceptibility gene of autism. It suggested DISC1 might play a role in the pathogenesis of autism. PMID:21569632
Namjou, Bahram; Sestak, Andrea L.; Armstrong, Don L.; Zidovetzki, Raphael; Kelly, Jennifer A.; Jacob, Noam; Ciobanu, Voicu; Kaufman, Kenneth M.; Ojwang, Joshua O.; Ziegler, Julie; Quismorio, Francesco; Reiff, Andreas; Myones, Barry L.; Guthridge, Joel M.; Nath, Swapan K.; Bruner, Gail R.; Mehrian-Shai, Ruth; Silverman, Earl; Klein-Gitelman, Marisa; McCurdy, Deborah; Wagner-Weiner, Linda; Nocton, James J.; Putterman, Chaim; Bae, Sang-Cheol; Kim, Yun Jung; Petri, Michelle; Reveille, John D.; Vyse, Timothy J.; Gilkeson, Gary S.; Kamen, Diane L.; Alarcón-Riquelme, Marta E.; Gaffney, Patrick M.; Moser, Kathy L; Merrill, Joan T.; Scofield, R. Hal; James, Judith A.; Langefeld, Carl D.; Harley, John B.; Jacob, Chaim O.
2009-01-01
Objective Systemic lupus erythematosus (SLE) is the prototypic systemic autoimmune disorder with complex etiology and a strong genetic component. Recently, gene products involved in the interferon pathway have been under intense investigation in SLE pathogenesis. STAT1 and STAT4 are transcription factors that play key roles in the interferon and Th1 signaling pathways, making them attractive candidates for SLE susceptibility. Methods Fifty-six single-nucleotide polymorphisms (SNPs) across STAT1 and STAT4 genes on chromosome 2 were genotyped using Illumina platform as a part of extensive association study in a large collection of 9923 lupus cases and controls from different racial groups. DNA from patients and controls was obtained from peripheral blood. Principal component analyses and population based case-control association analyses were performed and the p values, FDR q values and Odds ratios with 95% confidence intervals (95% CIs) were calculated. Results We observed strong genetic associations with SLE and multiple SNPs located within the STAT4 gene in different ethnicities (Fisher combined p= 7.02×10−25). In addition to strong confirmation of the association in the 3rd intronic region of this gene reported previously, we identified additional haplotypic association across STAT4 gene and in particular a common risk haplotype that is found in multiple racial groups. In contrast, only a relatively weak suggestive association was observed with STAT1, probably due to the proximity to STAT4. Conclusion Our findings indicate that the STAT4 gene is likely to be a crucial component in SLE pathogenesis among multiple racial groups. The functional effects of this association, when revealed, might improve our understanding of the disease and provide new therapeutic targets. PMID:19333953
Chagas, Bárbara Simas; Lima, Rita de Cássia Pereira de; Paiva Júnior, Sérgio de Sá Leitão; Silva, Ruany Cristyne de Oliveira; Cordeiro, Marcelo Nazário; Silva Neto, Jacinto da Costa; Batista, Marcus Vinicius de Aragão; Silva, Anna Jéssica Duarte; Gurgel, Ana Pavla Almeida Diniz; Freitas, Antonio Carlos de
2018-06-20
Human papillomavirus (HPV) is responsible for high-grade cervical lesions and cervical cancer. The inflammation plays a key role in cervical cancer progression. In this context, studies propose an association between TNFα and IL10 SNPs and susceptibility to HPV infection. The present work aimed to investigate the possible association between IL10 and TNFα promoter polymorphisms and HPV infection in the cervical carcinogenesis risk in women from Brazil. A total of 654 samples was evaluated in this study. HPV detection was performed by PCR and HPV genotyping was performed by PCR and sequencing of positive MY09/11 PCR product. Genotyping of IL10 SNPs (rs1800871 and rs1800896) was performed by High Resolution Melt analysis. Genotyping of TNFα SNP (rs1800629) was performed by fluorogenic allele-specific probes. The distribution of TNF-308 (rs1800629) allelic (p = 0.03) and genotype (p = 0.03) frequencies and HPV-58 infection has showed a statistically significant difference between case and control groups for the assessed TNFα polymorphism. When it comes to TNFα (rs1800629) allelic and genotypic distribution and HPVs 18 and 31 infections, no statistically significant differences between case and control groups were observed for the studied TNFα polymorphism. The allelic and genotypic distribution of IL10-819 (rs1800871) and IL10-1082 (rs1800896) and HPV infection (HPVs 58, 18 and 31) has showed no statistically significant differences between case and control groups for the assessed IL10 polymorphisms. Furthermore, it was observed that haplotypes were associated with an increased cervical cancer risk in HPVs 16, 18 and 58-positive women. It was observed that women carrying the GTA and ATG haplotypes had 3.85 and 17.99-fold, respectively, increased cervical cancer susceptibility when infected by HPV-58. In women infected with HPV-16 and HPV-18, statistically significant results in women carrying the GTA and ATA haplotypes was observed. They had a 2.32 and 3
Philippi, Anne; Tores, Frédéric; Carayol, Jérome; Rousseau, Francis; Letexier, Mélanie; Roschmann, Elke; Lindenbaum, Pierre; Benajjou, Abdel; Fontaine, Karine; Vazart, Céline; Gesnouin, Philippe; Brooks, Peter; Hager, Jörg
2007-01-01
Background Autism is a complex, heterogeneous, behaviorally-defined disorder characterized by disruptions of the nervous system and of other systems such as the pituitary-hypothalamic axis. In a previous genome wide screen, we reported linkage of autism with a 1.2 Megabase interval on chromosome 5q31. For the current study, we hypothesized that 3 of the genes in this region could be involved in the development of autism: 1) paired-like homeodomain transcription factor 1 (PITX1), which is a key regulator of hormones within the pituitary-hypothalamic axis, 2) neurogenin 1, a transcription factor involved in neurogenesis, and 3) histone family member Y (H2AFY), which is involved in X-chromosome inactivation in females and could explain the 4:1 male:female gender distortion present in autism. Methods A total of 276 families from the Autism Genetic Resource Exchange (AGRE) repository composed of 1086 individuals including 530 affected children were included in the study. Single nucleotide polymorphisms tagging the three candidate genes were genotyped on the initial linkage sample of 116 families. A second step of analysis was performed using tightly linked SNPs covering the PITX1 gene. Association was evaluated using the FBAT software version 1.7.3 for single SNP analysis and the HBAT command from the same package for haplotype analysis respectively. Results Association between SNPs and autism was only detected for PITX1. Haplotype analysis within PITX1 showed evidence for overtransmission of the A-C haplotype of markers rs11959298 – rs6596189 (p = 0.0004). Individuals homozygous or heterozygous for the A-C haplotype risk allele were 2.54 and 1.59 fold more likely to be autistic than individuals who were not carrying the allele, respectively. Conclusion Strong and consistent association was observed between a 2 SNPs within PITX1 and autism. Our data suggest that PITX1, a key regulator of hormones within the pituitary-hypothalamic axis, may be implicated in the
Philippi, Anne; Tores, Frédéric; Carayol, Jérome; Rousseau, Francis; Letexier, Mélanie; Roschmann, Elke; Lindenbaum, Pierre; Benajjou, Abdel; Fontaine, Karine; Vazart, Céline; Gesnouin, Philippe; Brooks, Peter; Hager, Jörg
2007-12-06
Autism is a complex, heterogeneous, behaviorally-defined disorder characterized by disruptions of the nervous system and of other systems such as the pituitary-hypothalamic axis. In a previous genome wide screen, we reported linkage of autism with a 1.2 Megabase interval on chromosome 5q31. For the current study, we hypothesized that 3 of the genes in this region could be involved in the development of autism: 1) paired-like homeodomain transcription factor 1 (PITX1), which is a key regulator of hormones within the pituitary-hypothalamic axis, 2) neurogenin 1, a transcription factor involved in neurogenesis, and 3) histone family member Y (H2AFY), which is involved in X-chromosome inactivation in females and could explain the 4:1 male:female gender distortion present in autism. A total of 276 families from the Autism Genetic Resource Exchange (AGRE) repository composed of 1086 individuals including 530 affected children were included in the study. Single nucleotide polymorphisms tagging the three candidate genes were genotyped on the initial linkage sample of 116 families. A second step of analysis was performed using tightly linked SNPs covering the PITX1 gene. Association was evaluated using the FBAT software version 1.7.3 for single SNP analysis and the HBAT command from the same package for haplotype analysis respectively. Association between SNPs and autism was only detected for PITX1. Haplotype analysis within PITX1 showed evidence for overtransmission of the A-C haplotype of markers rs11959298 - rs6596189 (p = 0.0004). Individuals homozygous or heterozygous for the A-C haplotype risk allele were 2.54 and 1.59 fold more likely to be autistic than individuals who were not carrying the allele, respectively. Strong and consistent association was observed between a 2 SNPs within PITX1 and autism. Our data suggest that PITX1, a key regulator of hormones within the pituitary-hypothalamic axis, may be implicated in the etiology of autism.
Genetic association of FOXO1A and FOXO3A with longevity trait in Han Chinese populations
Li, Yang; Wang, Wen-Jing; Cao, Huiqing; Lu, Jiehua; Wu, Chong; Hu, Fang-Yuan; Guo, Jian; Zhao, Ling; Yang, Fan; Zhang, Yi-Xin; Li, Wei; Zheng, Gu-Yan; Cui, Hanbin; Chen, Xiaomin; Zhu, Zhiming; He, Hongbo; Dong, Birong; Mo, Xianming; Zeng, Yi; Tian, Xiao-Li
2009-01-01
FOXO1A and FOXO3A are two members of the FoxO family. FOXO3A has recently been linked to human longevity in Japanese, German and Italian populations. Here we tested the genetic contribution of FOXO1A and FOXO3A to the longevity phenotype in Han Chinese population. Six tagging SNPs from FOXO1A and FOXO3A were selected and genotyped in 1817 centenarians and younger individuals. Two SNPs of FOXO1A were found to be associated with longevity in women (P = 0.01–0.005), whereas all three SNPs of FOXO3A were associated with longevity in both genders (P = 0.005–0.001). One SNP from FOXO1A was found not to be associated with longevity. In haplotype association tests, the OR (95% CI) for haplotypes TTG and CCG of FOXO1A in association with female longevity were 0.72 (0.58–0.90) and 1.38 (1.08–1.76), P = 0.0033 and 0.0063, respectively. The haplotypes of FOXO3A were associated with longevity in men [GTC: OR (95% CI) = 0.67 (0.51–0.86), P = 0.0014; CGT: OR (95% CI) = 1.48 (1.12–1.94), P = 0.0035] and in women [GTC: OR (95% CI) = 0.75 (0.60–0.94), P = 0.0094; CGT: OR (95% CI) = 1.47 (1.16–1.86), P = 0.0009]. The haplotype association tests were validated by permutation analysis. The association of FOXO1A with female longevity was replicated in 700 centenarians and younger individuals that were sampled geographically different from the original population. Thus, we demonstrate that, unlike FOXO3A, FOXO1A is more closely associated with human female longevity, suggesting that the genetic contribution to longevity trait may be affected by genders. PMID:19793722
Álvarez, Isabel; Pérez-Pardal, Lucía; Traoré, Amadou; Fernández, Iván; Goyache, Félix
2016-08-01
A panel of 81 Asian, African and European cattle (Bos taurus and B. indicus) was analysed for the whole sequence of the CXCR4 gene (3844bp), a strong candidate for cattle trypanotolerance. Thirty-one polymorphic sites identified gave 31 different haplotypes. Neutrality tests rejected the hypothesis of either positive or purifying selection. Bayesian phylogenetic tree showed differentiation of haplotypes into two clades gathering genetic variability predating domestication. Related with clades definition, linkage disequilibrium analyses suggested the existence of one only linkage block on the CXCR4 gene. Two tag SNPs identified on exon 2 captured 50% of variability. Whatever the analysis carried out, no clear separation between cattle groups was identified. Most haplotypes identified in West African taurine cattle were also found in European cattle and in Asian and West African zebu. West African taurine samples did not carry unique variants on the CXCR4 gene sequence. The current analysis failed in identifying a causal mutation on the CXCR4 gene underlying a previously reported QTL for cattle trypanotolerance on BTA2. Copyright © 2016 Elsevier B.V. All rights reserved.
Park, Joonhong; Kim, Myungshin; Jang, Woori; Chae, Hyojin; Kim, Yonggoo; Chung, Nack-Gyun; Lee, Jae-Wook; Cho, Bin; Jeong, Dae-Chul; Park, In Yang; Park, Mi Sun
2015-05-01
A common ancestral haplotype is strongly suggested in the Korean and Japanese patients with Fanconi anemia (FA), because common mutations have been frequently found: c.2546delC and c.3720_3724delAAACA of FANCA; c.307+1G>C, c.1066C>T, and c.1589_1591delATA of FANCG. Our aim in this study was to investigate the origin of these common mutations of FANCA and FANCG. We genotyped 13 FA patients consisting of five FA-A patients and eight FA-G patients from the Korean FA population. Microsatellite markers used for haplotype analysis included four CA repeat markers which are closely linked with FANCA and eight CA repeat markers which are contiguous with FANCG. As a result, Korean FA-A patients carrying c.2546delC or c.3720_3724delAAACA did not share the same haplotypes. However, three unique haplotypes carrying c.307+1G>C, c.1066C > T, or c.1589_1591delATA, that consisted of eight polymorphic loci covering a flanking region were strongly associated with Korean FA-G, consistent with founder haplotypes reported previously in the Japanese FA-G population. Our finding confirmed the common ancestral haplotypes on the origins of the East Asian FA-G patients, which will improve our understanding of the molecular population genetics of FA-G. To the best of our knowledge, this is the first report on the association between disease-linked mutations and common ancestral haplotypes in the Korean FA population. © 2015 John Wiley & Sons Ltd/University College London.
Haapalainen, Minna L; Wang, Jinhui; Latvala, Satu; Lehtonen, Mikko T; Pirhonen, Minna; Nissinen, Anne I
2018-03-30
'Candidatus Liberibacter solanacearum' (CLso) haplotype C is associated with disease in carrots and transmitted by the carrot psyllid Trioza apicalis. To identify possible other sources and vectors of this pathogen in Finland, samples were taken of wild plants within and near the carrot fields, the psyllids feeding on these plants, parsnips growing next to carrots, and carrot seeds. For analyzing the genotype of the CLso positive samples, a multi-locus sequence typing (MLST) scheme was developed. CLso haplotype C was detected in 11% of the Trioza anthrisci samples, in 35% of the Anthriscus sylvestris plants with discoloration, and in parsnips showing leaf discoloration. MLST revealed that the CLso in T. anthrisci and most A. sylvestris plants represent different strains than the bacteria found in T. apicalis and the cultivated plants. CLso haplotype D was detected in two of the 34 carrot seed lots tested, but was not detected in the plants grown from these seeds. Phylogenetic analysis by UPGMA clustering suggested that the haplotype D is more closely related to the haplotype A than to C. A novel, sixth haplotype of CLso, most closely related to A and D, was found in the psyllid Trioza urticae and stinging nettle (Urtica dioica, Urticaceae), and named as haplotype U.
2013-01-01
Background Recent studies supported associations between four NMDA-receptor-mediated signalling genes (D-amino acid oxidase, DAO; D-amino acid oxidase activator, DAOA; protein phosphatase 3 catalytic subunit gamma isoform, PPP3CC; dystrobrevin-binding protein 1, DTNBP1) and schizophrenia susceptibility, even though with contrasting results. Methods In an attempt to replicate these findings for the first time in an Italian population, a panel of 32 tagSNPs was analysed in a representative case-control sample involving 879 subjects. Results An association in the allele frequency was observed for the estimated PPP3CC CAG triplotype in the SNP window rs4872499 T/C-rs11780915 A/G-rs13271367 G/A (pcorrect = 0.001). Similarly, the clustered genotype frequencies of the estimated/phased CAG triplotype differed between cases and controls (p = 0.004), with the carriers having a higher frequency in the control population (p = 0.002, odd ratio OR = 0.59, 95% confident interval CI: 0.43-0.82). Following the phenotypic dissection strategy, the analysis of single SNPs evidenced a protective effect in males of rs11780915 and rs13271367 in PPP3CC gene (pcorrect = 0.02, pcorrect = 0.04 respectively). Moreover the estimated/phased GT diplotype (rs2070586A/G-rs3741775G/T) carriers of the DAO gene were more highly represented in female controls (p = 0.017, OR = 0.58, 95% CI: 0.37-0.90), as were the estimated/phased CAG triplotype carriers of the PPP3CC gene in females (p = 0.01, OR = 0.53, 95% CI: 0.32-0.87). In addition, we performed an interaction analysis, and a 66% (p = 0.003, OR = 0.34, 95% CI: 0.17-0.70) lower risk of developing schizophrenia for female (CAG + GT) carriers versus non-CAG or -GT carriers was observed. For DTNBP1, we found a protective effect in males for the rs6459409 (pcorrect = 0.02) and the estimated/phased CT diplotype (rs6459409-rs9476886) carriers (p = 3x10-4, OR = 0.46, 95% CI: 0.30-0.70). In
The Population Genomics of Repeated Evolution in the Blind Cavefish Astyanax mexicanus
Bradic, Martina; Teotónio, Henrique; Borowsky, Richard L.
2013-01-01
Distinct populations of Astyanax mexicanus cavefish offer striking examples of repeatable convergence or parallelism in their independent evolutions from surface to cave phenotypes. However, the extent to which the repeatability of evolution occurred at the genetic level remains poorly understood. To address this, we first characterized the genetic diversity of 518 single-nucleotide polymorphisms (SNPs), obtained through RAD tag sequencing and distributed throughout the genome, in seven cave and three groups of surface populations. The cave populations represented two distinct lineages (old and new). Thirty-one SNPs were significantly differentiated between surface and old cave populations, two SNPs were differentiated between surface and new cave populations, and 44 SNPs were significantly differentiated in both old and new cave populations. In addition, we determined whether these SNPs map to the same locations of previously described quantitative trait loci (QTL) between surface and cave populations. A total of 25 differentiated SNPs co-map with several QTL, such as one containing a fibroblast growth factor gene (Fgf8) involved in eye development and lens size. Further, the identity of many SNPs that co-mapped with QTL was the same in independently derived cave populations. These conclusions were further confirmed by haplotype analyses of SNPs within QTL regions. Our findings indicate that the repeatability of evolution at the genetic level is substantial, suggesting that ancestral standing genetic variation significantly contributed to the population genetic variability used in adaptation to the cave environment. PMID:23927992
Xiao, W-J; He, J-W; Zhang, H; Hu, W-W; Gu, J-M; Yue, H; Gao, G; Yu, J-B; Wang, C; Ke, Y-H; Fu, W-Z; Zhang, Z-L
2011-03-01
Arachidonate 12-lipoxygenase (ALOX12) is a member of the lipoxygenase superfamily, which catalyzes the incorporation of molecular oxygen into polyunsaturated fatty acids. The products of ALOX12 reactions serve as endogenous ligands for peroxisome proliferator-activated receptor γ (PPARG). The activation of the PPARG pathway in marrow-derived mesenchymal progenitors stimulates adipogenesis and inhibits osteoblastogenesis. Our objective was to determine whether polymorphisms in the ALOX12 gene were associated with variations in peak bone mineral density (BMD) and obesity phenotypes in young Chinese men. All six tagging single-nucleotide polymorphisms (SNPs) in the ALOX12 gene were genotyped in a total of 1215 subjects from 400 Chinese nuclear families by allele-specific polymerase chain reaction. The BMD at the lumbar spine and hip, total fat mass (TFM) and total lean mass (TLM) were measured using dual-energy X-ray absorptiometry. The pairwise linkage disequilibrium among SNPs was measured, and the haplotype blocks were inferred. Both the individual SNP markers and the haplotypes were tested for an association with the peak BMD, body mass index, TFM, TLM and percentage fat mass (PFM) using the quantitative transmission disequilibrium test (QTDT). Using the QTDT, significant within-family association was found between the rs2073438 polymorphism in the ALOX12 gene and the TFM and PFM (P=0.007 and 0.012, respectively). Haplotype analyses were combined with our individual SNP results and remained significant even after correction for multiple testing. However, we failed to find significant within-family associations between ALOX12 SNPs and the BMD at any bone site in young Chinese men. Our present results suggest that the rs2073438 polymorphism of ALOX12 contributes to the variation of obesity phenotypes in young Chinese men, although we failed to replicate the association with the peak BMD variation in this sample. Further independent studies are needed to confirm our
Huebner, Claudia; Ferguson, Lynnette R; Han, Dug Yeo; Philpott, Martin; Barclay, Murray L; Gearry, Richard B; McCulloch, Alan; Demmers, Pieter S; Browning, Brian L
2009-01-01
Background The nucleotide-binding oligomerization domain containing 1 (NOD1) gene encodes a pattern recognition receptor that senses pathogens, leading to downstream responses characteristic of innate immunity. We investigated the role of NOD1 single nucleotide polymorphisms (SNPs) on IBD risk in a New Zealand Caucasian population, and studied Nod1 expression in response to bacterial invasion in the Caco2 cell line. Findings DNA samples from 388 Crohn's disease (CD), 405 ulcerative colitis (UC), 27 indeterminate colitis patients and 201 randomly selected controls, from Canterbury, New Zealand were screened for 3 common SNPs in NOD1, using the MassARRAY® iPLEX Gold assay. Transcriptional activation of the protein produced by NOD1 (Nod1) was studied after infection of Caco2 cells with Escherichia coli LF82. Carrying the rs2075818 G allele decreased the risk of CD (OR = 0.66, 95% CI = 0.50–0.88, p < 0.002) but not UC. There was an increased frequency of the three SNP (rs2075818, rs2075822, rs2907748) haplotype, CTG (p = 0.004) and a decreased frequency of the GTG haplotype (p = 0.02).in CD. The rs2075822 CT or TT genotypes were at an increased frequency (genotype p value = 0.02), while the rs2907748 AA or AG genotypes showed decreased frequencies in UC (p = 0.04), but not in CD. Functional assays showed that Nod1 is produced 6 hours after bacterial invasion of the Caco2 cell line. Conclusion The NOD1 gene is important in signalling invasion of colonic cells by pathogenic bacteria, indicative of its' key role in innate immunity. Carrying specific SNPs in this gene significantly modifies the risk of CD and/or UC in a New Zealand Caucasian population. PMID:19327158
Kuhn, Alexandre; Ong, Yao Min; Cheng, Ching-Yu; Wong, Tien Yin; Quake, Stephen R; Burkholder, William F
2014-06-03
Insertions of the human-specific subfamily of LINE-1 (L1) retrotransposon are highly polymorphic across individuals and can critically influence the human transcriptome. We hypothesized that L1 insertions could represent genetic variants determining important human phenotypic traits, and performed an integrated analysis of L1 elements and single nucleotide polymorphisms (SNPs) in several human populations. We found that a large fraction of L1s were in high linkage disequilibrium with their surrounding genomic regions and that they were well tagged by SNPs. However, L1 variants were only partially captured by SNPs on standard SNP arrays, so that their potential phenotypic impact would be frequently missed by SNP array-based genome-wide association studies. We next identified potential phenotypic effects of L1s by looking for signatures of natural selection linked to L1 insertions; significant extended haplotype homozygosity was detected around several L1 insertions. This finding suggests that some of these L1 insertions may have been the target of recent positive selection.
Klitz, W; Maiers, M; Spellman, S; Baxter-Lowe, L A; Schmeckpeper, B; Williams, T M; Fernandez-Viña, M
2003-10-01
A collaborative study involving a large sample of European Americans was typed for the histocompatibility loci of the HLA DR-DQ region and subjected to intensive typing validation measures in order to accurately determine haplotype composition and frequency. The resulting tables have immediate application to HLA typing and allogeneic transplantation. The loci within the DR-DQ region are especially valuable for such an undertaking because of their tight linkage and high linkage disequilibrium. The 3798 haplotypes, derived from 1899 unrelated individuals, had a total of 75 distinct DRB1-DQA1-DQB1 haplotypes. The frequency distribution of the haplotypes was right skewed with haplotypes occurring at a frequency of less than 1% numbering 59 and yet constituting less than 12% of the total sample. Given DRB1 typing, it was possible to infer the exact DQA1 and DQB1 composition of a haplotype with high confidence (>90% likelihood) in 21 of the 35 high-resolution DRB1 alleles present in the sample. Of the DRB1 alleles without high reliability for DQ haplotype inference, only *0401, *0701 and *1302 were common, the remaining 11 DRB1 alleles constituting less than 5% of the total sample. This approach failed for the 13 serologically equivalent DR alleles in which only 33% of DQ haplotypes could be reliably inferred. The 36 DQA1-DQB1 haplotypes present in the total sample conformed to the known pattern of permissible heterodimers. Four DQA1-DQB1 haplotypes, all rare, are reported here for the first time. The haplotype frequency tables are suitable as a reference standard for HLA typing of the DR and DQ loci in European Americans.
Černý, Viktor; Carracedo, Ángel
2011-01-01
Background Located in the Sudan belt, the Chad Basin forms a remarkable ecosystem, where several unique agricultural and pastoral techniques have been developed. Both from an archaeological and a genetic point of view, this region has been interpreted to be the center of a bidirectional corridor connecting West and East Africa, as well as a meeting point for populations coming from North Africa through the Saharan desert. Methodology/Principal Findings Samples from twelve ethnic groups from the Chad Basin (n = 542) have been high-throughput genotyped for 230 coding region mitochondrial DNA (mtDNA) Single Nucleotide Polymorphisms (mtSNPs) using Matrix-Assisted Laser Desorption/Ionization Time-Of-Flight (MALDI-TOF) mass spectrometry. This set of mtSNPs allowed for much better phylogenetic resolution than previous studies of this geographic region, enabling new insights into its population history. Notable haplogroup (hg) heterogeneity has been observed in the Chad Basin mirroring the different demographic histories of these ethnic groups. As estimated using a Bayesian framework, nomadic populations showed negative growth which was not always correlated to their estimated effective population sizes. Nomads also showed lower diversity values than sedentary groups. Conclusions/Significance Compared to sedentary population, nomads showed signals of stronger genetic drift occurring in their ancestral populations. These populations, however, retained more haplotype diversity in their hypervariable segments I (HVS-I), but not their mtSNPs, suggesting a more ancestral ethnogenesis. Whereas the nomadic population showed a higher Mediterranean influence signaled mainly by sub-lineages of M1, R0, U6, and U5, the other populations showed a more consistent sub-Saharan pattern. Although lifestyle may have an influence on diversity patterns and hg composition, analysis of molecular variance has not identified these differences. The present study indicates that analysis of mtSNPs
Al-Daghri, Nasser M; Mohammed, Abdul Khader; Al-Attas, Omar S; Amer, Osama E; Clerici, Mario; Alenad, Amal; Alokail, Majed S
2016-03-11
Irisin is a recently identified myokine that plays an important role in preventing obesity and insulin resistance. We investigated whether the common FNDC5 (irisin precursor) gene variants influence susceptibility to obesity and type 2 diabetes (T2D) and verified the impact of FNDC5 gene variants on serum irisin levels, glucose and lipid metabolism in a Saudi population. Genomic DNA from 814 (394 T2DM and 414 controls) subjects were genotyped for the five common SNPs (rs3480A/G, rs1746661G/T, rs1298190A/G, rs726344A/G and rs1570569G/T) of the FNDC5 gene using the TaqMan genotyping assay. Biochemical parameters and hematic concentrations of irisin and insulin as well as anthropometric indices were collected. Serum irisin levels were higher in T2DM patients compared to controls (p < 0.0001). Analyses of FNDC5 SNPs showed that: 1) The rs3480 GG associates with decreased risk of obesity (p = 0.005; odds ratio: 0.48) and lower body mass index (BMI) values (p = 0.03). In addition, GGAAG was identified as the protective haplotype against risk of obesity (p = 0.001; odds ratio: 0.23). 2) The rs1746661 G allele associates with higher triglyceride (TG) levels (p = 0.019). 3) The rs157069 TT genotype associates with higher fasting insulin (p = 0.029) and HOMA-IR (p = 0.002) as well as with lower circulating irisin levels (p = 0.016). SNPs in FNDC5 gene correlates with obesity and glucose-lipid metabolism possibly because they modulate the serum levels of irisin.
The effect of using genealogy-based haplotypes for genomic prediction.
Edriss, Vahid; Fernando, Rohan L; Su, Guosheng; Lund, Mogens S; Guldbrandtsen, Bernt
2013-03-06
Genomic prediction uses two sources of information: linkage disequilibrium between markers and quantitative trait loci, and additive genetic relationships between individuals. One way to increase the accuracy of genomic prediction is to capture more linkage disequilibrium by regression on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (π) of the haplotype covariates had zero effect, i.e. a Bayesian mixture method. About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some cases, decreased the bias of prediction. With the Bayesian method, accuracy of prediction was less sensitive to parameter π when fitting haplotypes compared to fitting markers. Use of haplotypes based on genealogy can slightly increase the accuracy of genomic prediction. Improved methods to cluster the haplotypes constructed from local genealogy could lead to additional gains in accuracy.
Sato, Youichi; Tajima, Atsushi; Tsunematsu, Kouki; Nozawa, Shiari; Yoshiike, Miki; Koh, Eitetsue; Kanaya, Jiro; Namiki, Mikio; Matsumiya, Kiyomi; Tsujimura, Akira; Komatsu, Kiyoshi; Itoh, Naoki; Eguchi, Jiro; Imoto, Issei; Yamauchi, Aiko; Iwamoto, Teruaki
2015-06-01
Are the four candidate loci (rs7867029, rs12870438, rs7174015 and rs724078) for human male fertility traits, identified in a genome-wide association study (GWAS) of a Hutterite population in the USA, associated with semen quality traits in a Japanese population? The four single nucleotide polymorphisms (SNPs) rs7867029, rs12870438, rs7174015 and rs724078 have no association with semen parameters in a meta-analysis of two Japanese male cohorts. Four (rs7867029, rs12870438, rs7174015 and rs724078) of the SNPs associated with family size or birth rate in the GWAS of a Hutterite population in the USA were associated with semen parameters in ethnically diverse men from Chicago, USA. This is a replication study in a total of 2015 Japanese subjects, including 791 fertile men and 1224 young men from the general population. We performed a replication study in two cohorts to assess whether the SNPs rs7867029, rs12870438, rs7174015 and rs724078 are associated with sperm concentration, semen volume, total sperm numbers, total motile sperm numbers or sperm motility. The rs12870438 SNP was detected by restriction fragment length polymorphism PCR while rs7174015, rs724078 and rs7867029 SNPs were genotyped using TaqMan probes. This study indicated that none of the four SNPs rs7867029, rs12870438, rs7174015 and rs724078 displayed a significant association with semen parameters in the meta-analysis of two Japanese male cohorts. Only four SNPs identified in the Hutterite GWAS were examined for associations with semen quality traits in a Japanese population. In addition, the linkage disequilibrium structures around the testing markers were different between ethnic groups. Locus mapping studies using a set of tagging SNPs across the loci will be necessary in populations with larger sample sizes in order to understand the contribution of specific genes to semen quality. This study was supported in part by the Ministry of Health and Welfare of Japan (1013201) (to T.I.), Grant-in-Aids for
iXora: exact haplotype inferencing and trait association.
Utro, Filippo; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar E; Royaert, Stefan; Schnell, Raymond J; Motamayor, Juan Carlos; Kuhn, David N; Parida, Laxmi
2013-06-06
We address the task of extracting accurate haplotypes from genotype data of individuals of large F1 populations for mapping studies. While methods for inferring parental haplotype assignments on large F1 populations exist in theory, these approaches do not work in practice at high levels of accuracy. We have designed iXora (Identifying crossovers and recombining alleles), a robust method for extracting reliable haplotypes of a mapping population, as well as parental haplotypes, that runs in linear time. Each allele in the progeny is assigned not just to a parent, but more precisely to a haplotype inherited from the parent. iXora shows an improvement of at least 15% in accuracy over similar systems in literature. Furthermore, iXora provides an easy-to-use, comprehensive environment for association studies and hypothesis checking in populations of related individuals. iXora provides detailed resolution in parental inheritance, along with the capability of handling very large populations, which allows for accurate haplotype extraction and trait association. iXora is available for non-commercial use from http://researcher.ibm.com/project/3430.
Ancestral Asian source(s) of new world Y-chromosome founder haplotypes.
Karafet, T M; Zegura, S L; Posukh, O; Osipova, L; Bergen, A; Long, J; Goldman, D; Klitz, W; Harihara, S; de Knijff, P; Wiebe, V; Griffiths, R C; Templeton, A R; Hammer, M F
1999-01-01
Haplotypes constructed from Y-chromosome markers were used to trace the origins of Native Americans. Our sample consisted of 2,198 males from 60 global populations, including 19 Native American and 15 indigenous North Asian groups. A set of 12 biallelic polymorphisms gave rise to 14 unique Y-chromosome haplotypes that were unevenly distributed among the populations. Combining multiallelic variation at two Y-linked microsatellites (DYS19 and DXYS156Y) with the unique haplotypes results in a total of 95 combination haplotypes. Contra previous findings based on Y- chromosome data, our new results suggest the possibility of more than one Native American paternal founder haplotype. We postulate that, of the nine unique haplotypes found in Native Americans, haplotypes 1C and 1F are the best candidates for major New World founder haplotypes, whereas haplotypes 1B, 1I, and 1U may either be founder haplotypes and/or have arrived in the New World via recent admixture. Two of the other four haplotypes (YAP+ haplotypes 4 and 5) are probably present because of post-Columbian admixture, whereas haplotype 1G may have originated in the New World, and the Old World source of the final New World haplotype (1D) remains unresolved. The contrasting distribution patterns of the two major candidate founder haplotypes in Asia and the New World, as well as the results of a nested cladistic analysis, suggest the possibility of more than one paternal migration from the general region of Lake Baikal to the Americas. PMID:10053017
A periodic pattern of SNPs in the human genome
Madsen, Bo Eskerod; Villesen, Palle; Wiuf, Carsten
2007-01-01
By surveying a filtered, high-quality set of SNPs in the human genome, we have found that SNPs positioned 1, 2, 4, 6, or 8 bp apart are more frequent than SNPs positioned 3, 5, 7, or 9 bp apart. The observed pattern is not restricted to genomic regions that are known to cause sequencing or alignment errors, for example, transposable elements (SINE, LINE, and LTR), tandem repeats, and large duplicated regions. However, we found that the pattern is almost entirely confined to what we define as “periodic DNA.” Periodic DNA is a genomic region with a high degree of periodicity in nucleotide usage. It turned out that periodic DNA is mainly small regions (average length 16.9 bp), widely distributed in the genome. Furthermore, periodic DNA has a 1.8 times higher SNP density than the rest of the genome and SNPs inside periodic DNA have a significantly higher genotyping error rate than SNPs outside periodic DNA. Our results suggest that not all SNPs in the human genome are created by independent single nucleotide mutations, and that care should be taken in analysis of SNPs from periodic DNA. The latter may have important consequences for SNP and association studies. PMID:17673700
Tight Junction Defects in Atopic Dermatitis
De Benedetto, Anna; Rafaels, Nicholas M.; McGirt, Laura Y.; Ivanov, Andrei I.; Georas, Steve N.; Cheadle, Chris; Berger, Alan E.; Zhang, Kunzhong; Vidyasagar, Sadasivan; Yoshida, Takeshi; Boguniewicz, Mark; Hata, Tissa; Schneider, Lynda C.; Hanifin, Jon M.; Gallo, Richard L.; Novak, Natalija; Weidinger, Stephan; Beaty, Terri H.; Leung, Donald Y.; Barnes, Kathleen C.; Beck, Lisa A.
2010-01-01
Background Atopic dermatitis (AD) is characterized by dry skin and a hyperreactive immune response to allergens, two cardinal features that are caused in part by epidermal barrier defects. Tight junctions (TJ) reside immediately below the stratum corneum and regulate the selective permeability of the paracellular pathway. Objective We evaluated the expression/function of the TJ protein, claudin-1 in epithelium from AD and nonatopic (NA) subjects and screened two American populations for SNPs in CLDN1. Methods Expression profiles of nonlesional epithelium from extrinsic AD, NA and psoriasis subjects were generated using Illumina’s BeadChips. Dysregulated intercellular proteins were validated by tissue staining and qPCR. Bioelectric properties of epithelium were measured in Ussing chambers. Functional relevance of claudin-1 was assessed using a knockdown approach in primary human keratinocytes (PHK). Twenty seven haplotype-tagging SNPs in CLDN1 were screened in two independent AD populations. Results We observed strikingly reduced expression of the TJ proteins claudin-1 and -23 only in AD, which were validated at the mRNA and protein levels. Claudin-1 expression inversely correlated with Th2 biomarkers. We observed a remarkable impairment of the bioelectric barrier function in AD epidermis. In vitro, we confirmed that silencing claudin-1 expression in human keratinocytes diminishes TJ function while enhancing keratinocyte proliferation. Finally, CLDN1 haplotype-tagging single nucleotide polymorphisms revealed associations with AD in two North American populations. Conclusion Taken together, these data suggest that an impaired epidermal TJ is a novel feature of skin barrier dysfunction and immune dysregulation observed in AD, and that CLDN1 may be a new susceptibility gene in this disease. PMID:21163515
Mitochondrial haplotype variation and phylogeography of Iberian brown trout populations.
MacHordom, A; Suárez, J; Almodóvar, A; Bautista, J M
2000-09-01
The biogeographical distribution of brown trout mitochondrial DNA haplotypes throughout the Iberian Peninsula was established by polymerase chain reaction-restriction fragment polymorphism analysis. The study of 507 specimens from 58 localities representing eight widely separated Atlantic-slope (north and west Iberian coasts) and six Mediterranean drainage systems served to identify five main groups of mitochondrial haplotypes: (i) haplotypes corresponding to non-native, hatchery-reared brown trout that were widely distributed but also found in wild populations of northern Spain (Cantabrian slope); (ii) a widespread Atlantic haplotype group; (iii) a haplotype restricted to the Duero Basin; (iv) a haplotype shown by southern Iberian populations; and (v) a Mediterranean haplotype. The Iberian distribution of these haplotypes reflects both the current fishery management policy of introducing non-native brown trout, and Messinian palaeobiogeography. Our findings complement and extend previous allozyme studies on Iberian brown trout and improve present knowledge of glacial refugia and postglacial movement of brown trout lineages.
Haplotype-Based Association Analysis via Variance-Components Score Test
Tzeng, Jung-Ying ; Zhang, Daowen
2007-01-01
Haplotypes provide a more informative format of polymorphisms for genetic association analysis than do individual single-nucleotide polymorphisms. However, the practical efficacy of haplotype-based association analysis is challenged by a trade-off between the benefits of modeling abundant variation and the cost of the extra degrees of freedom. To reduce the degrees of freedom, several strategies have been considered in the literature. They include (1) clustering evolutionarily close haplotypes, (2) modeling the level of haplotype sharing, and (3) smoothing haplotype effects by introducing a correlation structure for haplotype effects and studying the variance components (VC) for association. Although the first two strategies enjoy a fair extent of power gain, empirical evidence showed that VC methods may exhibit only similar or less power than the standard haplotype regression method, even in cases of many haplotypes. In this study, we report possible reasons that cause the underpowered phenomenon and show how the power of the VC strategy can be improved. We construct a score test based on the restricted maximum likelihood or the marginal likelihood function of the VC and identify its nontypical limiting distribution. Through simulation, we demonstrate the validity of the test and investigate the power performance of the VC approach and that of the standard haplotype regression approach. With suitable choices for the correlation structure, the proposed method can be directly applied to unphased genotypic data. Our method is applicable to a wide-ranging class of models and is computationally efficient and easy to implement. The broad coverage and the fast and easy implementation of this method make the VC strategy an effective tool for haplotype analysis, even in modern genomewide association studies. PMID:17924336
Gourraud, P A; Karaouni, A; Woo, J M; Schmidt, T; Oksenberg, J R; Hecht, F M; Liegler, T J; Barbour, J D
2011-03-01
We examined single nucleotide polymorphisms (SNP) in the APOBEC3 locus on chromosome 22, paired with population sequences of pro-viral human immunodeficiency virus-1 (HIV-1) vif from peripheral blood mononuclear cells, from 96 recently HIV-1-infected treatment-naive adults. We found evidence for the existence of an APOBEC3H linkage disequilibrium (LD) block associated with variation in GA → AA, or APOBEC3F/H signature, sequence changes in pro-viral HIV-1 vif sequence (top 10 significant SNPs with a significant p = 4.8 × 10(-3)). We identified a common five position risk haplotype distal to APOBEC3H (A3Hrh). These markers were in high LD (D' = 1; r(2) = 0.98) to a previously described A3H "RED" haplotype containing a variant (E121) with enhanced susceptibility to HIV-1 Vif. This association was confirmed by a haplotype analysis. Homozygote carriers of the A3Hrh had lower GA->AA (A3F/H) sequence editing upon pro-viral HIV-1 vif sequence (p = 0.01), and lower HIV-1 RNA levels over time during early, untreated HIV-1 infection, (p = 0.015 mixed effects model). This effect may be due to enhanced susceptibility of A3H forms to HIV-1 Vif mediated viral suppression of sequence editing activity, slowing viral diversification and escape from immune responses. Copyright © 2011 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
The effect of using genealogy-based haplotypes for genomic prediction
2013-01-01
Background Genomic prediction uses two sources of information: linkage disequilibrium between markers and quantitative trait loci, and additive genetic relationships between individuals. One way to increase the accuracy of genomic prediction is to capture more linkage disequilibrium by regression on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. Methods A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (π) of the haplotype covariates had zero effect, i.e. a Bayesian mixture method. Results About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some cases, decreased the bias of prediction. With the Bayesian method, accuracy of prediction was less sensitive to parameter π when fitting haplotypes compared to fitting markers. Conclusions Use of haplotypes based on genealogy can slightly increase the accuracy of genomic prediction. Improved methods to cluster the haplotypes constructed from local genealogy could lead to additional gains in accuracy. PMID:23496971
Genome-wide scan for commons SNPs affecting bovine leukemia virus infection level in dairy cattle.
Carignano, Hugo A; Roldan, Dana L; Beribe, María J; Raschia, María A; Amadio, Ariel; Nani, Juan P; Gutierrez, Gerónimo; Alvarez, Irene; Trono, Karina; Poli, Mario A; Miretti, Marcos M
2018-02-13
Bovine leukemia virus (BLV) infection is omnipresent in dairy herds causing direct economic losses due to trade restrictions and lymphosarcoma-related deaths. Milk production drops and increase in the culling rate are also relevant and usually neglected. The BLV provirus persists throughout a lifetime and an inter-individual variation is observed in the level of infection (LI) in vivo. High LI is strongly correlated with disease progression and BLV transmission among herd mates. In a context of high prevalence, classical control strategies are economically prohibitive. Alternatively, host genomics studies aiming to dissect loci associated with LI are potentially useful tools for genetic selection programs tending to abrogate the viral spreading. The LI was measured through the proviral load (PVL) set-point and white blood cells (WBC) counts. The goals of this work were to gain insight into the contribution of SNPs (bovine 50KSNP panel) on LI variability and to identify genomics regions underlying this trait. We quantified anti-p24 response and total leukocytes count in peripheral blood from 1800 cows and used these to select 800 individuals with extreme phenotypes in WBCs and PVL. Two case-control genomic association studies using linear mixed models (LMMs) considering population stratification were performed. The proportion of the variance captured by all QC-passed SNPs represented 0.63 (SE ± 0.14) of the phenotypic variance for PVL and 0.56 (SE ± 0.15) for WBCs. Overall, significant associations (Bonferroni's corrected -log 10 p > 5.94) were shared for both phenotypes by 24 SNPs within the Bovine MHC. Founder haplotypes were used to measure the linkage disequilibrium (LD) extent (r 2 = 0.22 ± 0.27 at inter-SNP distance of 25-50 kb). The SNPs and LD blocks indicated genes potentially associated with LI in infected cows: i.e. relevant immune response related genes (DQA1, DRB3, BOLA-A, LTA, LTB, TNF, IER3, GRP111, CRISP1), several genes
MHC Class II haplotypes of Colombian Amerindian tribes
Yunis, Juan J.; Yunis, Edmond J.; Yunis, Emilio
2013-01-01
We analyzed 1041 individuals belonging to 17 Amerindian tribes of Colombia, Chimila, Bari and Tunebo (Chibcha linguistic family), Embera, Waunana (Choco linguistic family), Puinave and Nukak (Maku-Puinave linguistic families), Cubeo, Guanano, Tucano, Desano and Piratapuyo (Tukano linguistic family), Guahibo and Guayabero (Guayabero Linguistic Family), Curripaco and Piapoco (Arawak linguistic family) and Yucpa (Karib linguistic family). for MHC class II haplotypes (HLA-DRB1, DQA1, DQB1). Approximately 90% of the MHC class II haplotypes found among these tribes are haplotypes frequently encountered in other Amerindian tribes. Nonetheless, striking differences were observed among Chibcha and non-Chibcha speaking tribes. The DRB1*04:04, DRB1*04:11, DRB1*09:01 carrying haplotypes were frequently found among non-Chibcha speaking tribes, while the DRB1*04:07 haplotype showed significant frequencies among Chibcha speaking tribes, and only marginal frequencies among non-Chibcha speaking tribes. Our results suggest that the differences in MHC class II haplotype frequency found among Chibcha and non-Chibcha speaking tribes could be due to genetic differentiation in Mesoamerica of the ancestral Amerindian population into Chibcha and non-Chibcha speaking populations before they entered into South America. PMID:23885196
Sparse Tensor Decomposition for Haplotype Assembly of Diploids and Polyploids.
Hashemi, Abolfazl; Zhu, Banghua; Vikalo, Haris
2018-03-21
Haplotype assembly is the task of reconstructing haplotypes of an individual from a mixture of sequenced chromosome fragments. Haplotype information enables studies of the effects of genetic variations on an organism's phenotype. Most of the mathematical formulations of haplotype assembly are known to be NP-hard and haplotype assembly becomes even more challenging as the sequencing technology advances and the length of the paired-end reads and inserts increases. Assembly of haplotypes polyploid organisms is considerably more difficult than in the case of diploids. Hence, scalable and accurate schemes with provable performance are desired for haplotype assembly of both diploid and polyploid organisms. We propose a framework that formulates haplotype assembly from sequencing data as a sparse tensor decomposition. We cast the problem as that of decomposing a tensor having special structural constraints and missing a large fraction of its entries into a product of two factors, U and [Formula: see text]; tensor [Formula: see text] reveals haplotype information while U is a sparse matrix encoding the origin of erroneous sequencing reads. An algorithm, AltHap, which reconstructs haplotypes of either diploid or polyploid organisms by iteratively solving this decomposition problem is proposed. The performance and convergence properties of AltHap are theoretically analyzed and, in doing so, guarantees on the achievable minimum error correction scores and correct phasing rate are established. The developed framework is applicable to diploid, biallelic and polyallelic polyploid species. The code for AltHap is freely available from https://github.com/realabolfazl/AltHap . AltHap was tested in a number of different scenarios and was shown to compare favorably to state-of-the-art methods in applications to haplotype assembly of diploids, and significantly outperforms existing techniques when applied to haplotype assembly of polyploids.
Extended diversity analysis of cultivated grapevine Vitis vinifera with 10K genome-wide SNPs.
Laucou, Valérie; Launay, Amandine; Bacilieri, Roberto; Lacombe, Thierry; Adam-Blondon, Anne-Françoise; Bérard, Aurélie; Chauveau, Aurélie; de Andrés, Maria Teresa; Hausmann, Ludger; Ibáñez, Javier; Le Paslier, Marie-Christine; Maghradze, David; Martinez-Zapater, José Miguel; Maul, Erika; Ponnaiah, Maharajah; Töpfer, Reinhard; Péros, Jean-Pierre; Boursiquot, Jean-Michel
2018-01-01
Grapevine is a very important crop species that is mainly cultivated worldwide for fruits, wine and juice. Identification of the genetic bases of performance traits through association mapping studies requires a precise knowledge of the available diversity and how this diversity is structured and varies across the whole genome. An 18k SNP genotyping array was evaluated on a panel of Vitis vinifera cultivars and we obtained a data set with no missing values for a total of 10207 SNPs and 783 different genotypes. The average inter-SNP spacing was ~47 kbp, the mean minor allele frequency (MAF) was 0.23 and the genetic diversity in the sample was high (He = 0.32). Fourteen SNPs, chosen from those with the highest MAF values, were sufficient to identify each genotype in the sample. Parentage analysis revealed 118 full parentages and 490 parent-offspring duos, thus confirming the close pedigree relationships within the cultivated grapevine. Structure analyses also confirmed the main divisions due to an eastern-western gradient and human usage (table vs. wine). Using a multivariate approach, we refined the structure and identified a total of eight clusters. Both the genetic diversity (He, 0.26-0.32) and linkage disequilibrium (LD, 28.8-58.2 kbp) varied between clusters. Despite the short span LD, we also identified some non-recombining haplotype blocks that may complicate association mapping. Finally, we performed a genome-wide association study that confirmed previous works and also identified new regions for important performance traits such as acidity. Taken together, all the results contribute to a better knowledge of the genetics of the cultivated grapevine.
Extended diversity analysis of cultivated grapevine Vitis vinifera with 10K genome-wide SNPs
Launay, Amandine; Bacilieri, Roberto; Lacombe, Thierry; Adam-Blondon, Anne-Françoise; Bérard, Aurélie; Chauveau, Aurélie; de Andrés, Maria Teresa; Maghradze, David; Maul, Erika; Ponnaiah, Maharajah; Töpfer, Reinhard; Péros, Jean-Pierre; Boursiquot, Jean-Michel
2018-01-01
Grapevine is a very important crop species that is mainly cultivated worldwide for fruits, wine and juice. Identification of the genetic bases of performance traits through association mapping studies requires a precise knowledge of the available diversity and how this diversity is structured and varies across the whole genome. An 18k SNP genotyping array was evaluated on a panel of Vitis vinifera cultivars and we obtained a data set with no missing values for a total of 10207 SNPs and 783 different genotypes. The average inter-SNP spacing was ~47 kbp, the mean minor allele frequency (MAF) was 0.23 and the genetic diversity in the sample was high (He = 0.32). Fourteen SNPs, chosen from those with the highest MAF values, were sufficient to identify each genotype in the sample. Parentage analysis revealed 118 full parentages and 490 parent-offspring duos, thus confirming the close pedigree relationships within the cultivated grapevine. Structure analyses also confirmed the main divisions due to an eastern-western gradient and human usage (table vs. wine). Using a multivariate approach, we refined the structure and identified a total of eight clusters. Both the genetic diversity (He, 0.26–0.32) and linkage disequilibrium (LD, 28.8–58.2 kbp) varied between clusters. Despite the short span LD, we also identified some non-recombining haplotype blocks that may complicate association mapping. Finally, we performed a genome-wide association study that confirmed previous works and also identified new regions for important performance traits such as acidity. Taken together, all the results contribute to a better knowledge of the genetics of the cultivated grapevine. PMID:29420602
Radio tag retention and tag-related mortality among adult sockeye salmon
Ramstad, Kristina M.; Woody, Carol Ann
2003-01-01
Tag retention and tag-related mortality are concerns for any tagging study but are rarely estimated. We assessed retention and mortality rates for esophageal radio tag implants in adult sockeye salmon Oncorhynchus nerka. Migrating sockeye salmon captured at the outlet of Lake Clark, Alaska, were implanted with one of four different radio tags (14.5 × 43 mm (diameter × length), 14.5 × 49 mm, 16 × 46 mm, and 19 × 51 mm). Fish were observed for 15 to 35 d after tagging to determine retention and mortality rates. The overall tag retention rate was high (0.98; 95% confidence interval (CI), 0.92-1.00; minimum, 33 d), with one loss of a 19-mm × 51- mm tag. Mortality of tagged sockeye salmon (0.02; 95% CI, 0-0.08) was similar to that of untagged controls (0.03 (0-0.15)). Sockeye salmon with body lengths (mid-eye to tail fork) of 585-649 mm retained tags as large as 19 × 51 mm and those with body lengths of 499-628 mm retained tags as small as 14.5 × 43 mm for a minimum of 33 d with no increase in mortality. The tags used in this study represent a suite of radio tags that vary in size, operational life, and cost but that are effective in tracking adult anadromous salmon with little tag loss or increase in fish mortality.
Zohra, Rozi; Song, M S; Iliham, Nizam; Dolikun, Mamatyusupu
2016-08-16
To investigate the characterizations of genetic recombination hotspots and linkage disequilibrium (LD) patterns in peroxisome proliferative activated receptor gamma (PPARG) gene in Kirgiz and Uyghur ethnic groups. Blood samples were collected from 100 Kirgiz (50 healthy controls and 50 patients with type 2 diabetes mellitus) residents in Halajun County, Artux City, Kizilsu Kirgiz Autonomous Prefecture, Xinjiang in August 2013, and 50 healthy Uyghur residents in Hotan Prefecture of Xinjiang Uygur Autonomous Region in May 2012.Thirty-one tagSNPs in PPARG gene were genotyped using Matrix-Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry (MALDI-TOF-MS) method.The recombination hotspots and LD patterns within the PPARG gene were estimated by analyzing the SNP genotying data using the Hotspot Fisher program and Haploview software, respectively. Eighteen tagSNPs (rs1151999, rs1175540, rs1875796, rs1899951, rs2292101, rs2921190, rs2938397, rs2959272, rs2959273, rs2972162, rs3856806, rs4135247, rs4135275, rs709151, rs4135354, rs6805419, rs17036700 and rs4135304) were same with relatively higher recombination rates between the patients with type 2 diabetes mellitus (T2DM) and healthy controls of Kirgiz ethnic group, and healthy controls of Uyghur ethnic group.Five haplotype blocks with LD coefficient D' value of 1, indicating no genetic recombination occurred within the region, were observed in the healthy controls of Kirgiz ethnic groups, whereas five haplotype blocks with LD coefficient D' value less than 1 were observed in the Kirgiz patients with T2DM, indicating historical recombination events occurred within the region.Four haplotype blocks with LD coefficient D' value of 1 were observed in the Uyghur healthy controls, indicating no genetic recombination occurred within the region.There were significantly different recombination hotspot profiles between the Kirgiz, Uyghur, Utah residents with Northern and Western European ancestry (CEU), Yoruban in
Singapore Genome Variation Project: a haplotype map of three Southeast Asian populations.
Teo, Yik-Ying; Sim, Xueling; Ong, Rick T H; Tan, Adrian K S; Chen, Jieming; Tantoso, Erwin; Small, Kerrin S; Ku, Chee-Seng; Lee, Edmund J D; Seielstad, Mark; Chia, Kee-Seng
2009-11-01
The Singapore Genome Variation Project (SGVP) provides a publicly available resource of 1.6 million single nucleotide polymorphisms (SNPs) genotyped in 268 individuals from the Chinese, Malay, and Indian population groups in Southeast Asia. This online database catalogs information and summaries on genotype and phased haplotype data, including allele frequencies, assessment of linkage disequilibrium (LD), and recombination rates in a format similar to the International HapMap Project. Here, we introduce this resource and describe the analysis of human genomic variation upon agglomerating data from the HapMap and the Human Genome Diversity Project, providing useful insights into the population structure of the three major population groups in Asia. In addition, this resource also surveyed across the genome for variation in regional patterns of LD between the HapMap and SGVP populations, and for signatures of positive natural selection using two well-established metrics: iHS and XP-EHH. The raw and processed genetic data, together with all population genetic summaries, are publicly available for download and browsing through a web browser modeled with the Generic Genome Browser.
Singapore Genome Variation Project: A haplotype map of three Southeast Asian populations
Teo, Yik-Ying; Sim, Xueling; Ong, Rick T.H.; Tan, Adrian K.S.; Chen, Jieming; Tantoso, Erwin; Small, Kerrin S.; Ku, Chee-Seng; Lee, Edmund J.D.; Seielstad, Mark; Chia, Kee-Seng
2009-01-01
The Singapore Genome Variation Project (SGVP) provides a publicly available resource of 1.6 million single nucleotide polymorphisms (SNPs) genotyped in 268 individuals from the Chinese, Malay, and Indian population groups in Southeast Asia. This online database catalogs information and summaries on genotype and phased haplotype data, including allele frequencies, assessment of linkage disequilibrium (LD), and recombination rates in a format similar to the International HapMap Project. Here, we introduce this resource and describe the analysis of human genomic variation upon agglomerating data from the HapMap and the Human Genome Diversity Project, providing useful insights into the population structure of the three major population groups in Asia. In addition, this resource also surveyed across the genome for variation in regional patterns of LD between the HapMap and SGVP populations, and for signatures of positive natural selection using two well-established metrics: iHS and XP-EHH. The raw and processed genetic data, together with all population genetic summaries, are publicly available for download and browsing through a web browser modeled with the Generic Genome Browser. PMID:19700652
Tibély, Gergely; Pollner, Péter; Vicsek, Tamás; Palla, Gergely
2013-01-01
Tagging items with descriptive annotations or keywords is a very natural way to compress and highlight information about the properties of the given entity. Over the years several methods have been proposed for extracting a hierarchy between the tags for systems with a "flat", egalitarian organization of the tags, which is very common when the tags correspond to free words given by numerous independent people. Here we present a complete framework for automated tag hierarchy extraction based on tag occurrence statistics. Along with proposing new algorithms, we are also introducing different quality measures enabling the detailed comparison of competing approaches from different aspects. Furthermore, we set up a synthetic, computer generated benchmark providing a versatile tool for testing, with a couple of tunable parameters capable of generating a wide range of test beds. Beside the computer generated input we also use real data in our studies, including a biological example with a pre-defined hierarchy between the tags. The encouraging similarity between the pre-defined and reconstructed hierarchy, as well as the seemingly meaningful hierarchies obtained for other real systems indicate that tag hierarchy extraction is a very promising direction for further research with a great potential for practical applications. Tags have become very prevalent nowadays in various online platforms ranging from blogs through scientific publications to protein databases. Furthermore, tagging systems dedicated for voluntary tagging of photos, films, books, etc. with free words are also becoming popular. The emerging large collections of tags associated with different objects are often referred to as folksonomies, highlighting their collaborative origin and the "flat" organization of the tags opposed to traditional hierarchical categorization. Adding a tag hierarchy corresponding to a given folksonomy can very effectively help narrowing or broadening the scope of search. Moreover
Tibély, Gergely; Pollner, Péter; Vicsek, Tamás; Palla, Gergely
2013-01-01
Tagging items with descriptive annotations or keywords is a very natural way to compress and highlight information about the properties of the given entity. Over the years several methods have been proposed for extracting a hierarchy between the tags for systems with a "flat", egalitarian organization of the tags, which is very common when the tags correspond to free words given by numerous independent people. Here we present a complete framework for automated tag hierarchy extraction based on tag occurrence statistics. Along with proposing new algorithms, we are also introducing different quality measures enabling the detailed comparison of competing approaches from different aspects. Furthermore, we set up a synthetic, computer generated benchmark providing a versatile tool for testing, with a couple of tunable parameters capable of generating a wide range of test beds. Beside the computer generated input we also use real data in our studies, including a biological example with a pre-defined hierarchy between the tags. The encouraging similarity between the pre-defined and reconstructed hierarchy, as well as the seemingly meaningful hierarchies obtained for other real systems indicate that tag hierarchy extraction is a very promising direction for further research with a great potential for practical applications. Tags have become very prevalent nowadays in various online platforms ranging from blogs through scientific publications to protein databases. Furthermore, tagging systems dedicated for voluntary tagging of photos, films, books, etc. with free words are also becoming popular. The emerging large collections of tags associated with different objects are often referred to as folksonomies, highlighting their collaborative origin and the “flat” organization of the tags opposed to traditional hierarchical categorization. Adding a tag hierarchy corresponding to a given folksonomy can very effectively help narrowing or broadening the scope of search
Dissimilarity based Partial Least Squares (DPLS) for genomic prediction from SNPs.
Singh, Priyanka; Engel, Jasper; Jansen, Jeroen; de Haan, Jorn; Buydens, Lutgarde Maria Celina
2016-05-04
Genomic prediction (GP) allows breeders to select plants and animals based on their breeding potential for desirable traits, without lengthy and expensive field trials or progeny testing. We have proposed to use Dissimilarity-based Partial Least Squares (DPLS) for GP. As a case study, we use the DPLS approach to predict Bacterial wilt (BW) in tomatoes using SNPs as predictors. The DPLS approach was compared with the Genomic Best-Linear Unbiased Prediction (GBLUP) and single-SNP regression with SNP as a fixed effect to assess the performance of DPLS. Eight genomic distance measures were used to quantify relationships between the tomato accessions from the SNPs. Subsequently, each of these distance measures was used to predict the BW using the DPLS prediction model. The DPLS model was found to be robust to the choice of distance measures; similar prediction performances were obtained for each distance measure. DPLS greatly outperformed the single-SNP regression approach, showing that BW is a comprehensive trait dependent on several loci. Next, the performance of the DPLS model was compared to that of GBLUP. Although GBLUP and DPLS are conceptually very different, the prediction quality (PQ) measured by DPLS models were similar to the prediction statistics obtained from GBLUP. A considerable advantage of DPLS is that the genotype-phenotype relationship can easily be visualized in a 2-D scatter plot. This so-called score-plot provides breeders an insight to select candidates for their future breeding program. DPLS is a highly appropriate method for GP. The model prediction performance was similar to the GBLUP and far better than the single-SNP approach. The proposed method can be used in combination with a wide range of genomic dissimilarity measures and genotype representations such as allele-count, haplotypes or allele-intensity values. Additionally, the data can be insightfully visualized by the DPLS model, allowing for selection of desirable candidates from the
ERIC Educational Resources Information Center
Current: The Journal of Marine Education, 1998
1998-01-01
In this group activity, children learn about the purpose of tagging and how scientists tag a shark. Using a cut-out of a shark, students identify, measure, record data, read coordinates, and tag a shark. Includes introductory information about the purpose of tagging and the procedure, a data sheet showing original tagging data from Tampa Bay, and…
The role of the JAK2 GGCC haplotype and the TET2 gene in familial myeloproliferative neoplasms
Olcaydu, Damla; Rumi, Elisa; Harutyunyan, Ashot; Passamonti, Francesco; Pietra, Daniela; Pascutto, Cristiana; Berg, Tiina; Jäger, Roland; Hammond, Emma; Cazzola, Mario; Kralovics, Robert
2011-01-01
Background Myeloproliferative neoplasms constitute a group of diverse chronic myeloid malignancies that share pathogenic features such as acquired mutations in the JAK2, TET2, CBL and MPL genes. There are recent reports that a JAK2 gene haplotype (GGCC or 46/1) confers susceptibility to JAK2 mutation-positive myeloproliferative neoplasms. The aim of this study was to examine the role of the JAK2 GGCC haplotype and germline mutations of TET2, CBL and MPL in familial myeloproliferative neoplasms. Design and Methods We investigated patients with familial (n=88) or sporadic (n=684) myeloproliferative neoplasms, and a control population (n=203) from the same demographic area in Italy. Association analysis was performed using tagged single nucleotide polymorphisms (rs10974944 and rs12343867) of the JAK2 haplotype. Sequence analysis of TET2, CBL and MPL was conducted in the 88 patients with familial myeloproliferative neoplasms. Results Association analysis revealed no difference in haplotype frequency between familial and sporadic cases of myeloproliferative neoplasms (P=0.6529). No germline mutations in TET2, CBL or MPL that segregate with the disease phenotype were identified. As we observed variability in somatic mutations in the affected members of a pedigree with myeloproliferative neoplasms, we postulated that somatic mutagenesis is increased in familial myeloproliferative neoplasms. Accordingly, we compared the incidence of malignant disorders between sporadic and familial patients. Although the overall incidence of malignant disorders did not differ significantly between cases of familial and sporadic myeloproliferative neoplasms, malignancies were more frequent in patients with familial disease aged between 50 to 70 years (P=0.0198) than in patients in the same age range with sporadic myeloproliferative neoplasms. Conclusions We conclude that the JAK2 GGCC haplotype and germline mutations of TET2, CBL or MPL do not explain familial clustering of
Bajaj, Deepak; Das, Shouvik; Upadhyaya, Hari D.; Ranjan, Rajeev; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. Laxmipathi; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.
2015-01-01
The study identified 9045 high-quality SNPs employing both genome-wide GBS- and candidate gene-based SNP genotyping assays in 172, including 93 cultivated (desi and kabuli) and 79 wild chickpea accessions. The GWAS in a structured population of 93 sequenced accessions detected 15 major genomic loci exhibiting significant association with seed coat color. Five seed color-associated major genomic loci underlying robust QTLs mapped on a high-density intra-specific genetic linkage map were validated by QTL mapping. The integration of association and QTL mapping with gene haplotype-specific LD mapping and transcript profiling identified novel allelic variants (non-synonymous SNPs) and haplotypes in a MATE secondary transporter gene regulating light/yellow brown and beige seed coat color differentiation in chickpea. The down-regulation and decreased transcript expression of beige seed coat color-associated MATE gene haplotype was correlated with reduced proanthocyanidins accumulation in the mature seed coats of beige than light/yellow brown seed colored desi and kabuli accessions for their coloration/pigmentation. This seed color-regulating MATE gene revealed strong purifying selection pressure primarily in LB/YB seed colored desi and wild Cicer reticulatum accessions compared with the BE seed colored kabuli accessions. The functionally relevant molecular tags identified have potential to decipher the complex transcriptional regulatory gene function of seed coat coloration and for understanding the selective sweep-based seed color trait evolutionary pattern in cultivated and wild accessions during chickpea domestication. The genome-wide integrated approach employed will expedite marker-assisted genetic enhancement for developing cultivars with desirable seed coat color types in chickpea. PMID:26635822
Li, Mei; Zhang, Bei; Li, Chuang; Liu, Jielin; Liu, Ya; Sun, Dongdong; Ma, Hanying; Wen, Shaojun
2016-01-01
Mitofusion-2 (Mfn2) played an important role in regulating vascular smooth muscle cells proliferation, insulin resistance and endoplasmic reticulum stress, which were found to be involved in the development of hypertension. So we inferred that the Mfn2 gene may participate in the pathogenesis of hypertension. The aim of this study was to determine whether common single nucleotide polymorphisms (SNPs) in Mfn2 gene were associated with essential hypertension (EH) in northern Han Chinese. We genotyped 6 tagging SNPs of Mfn2 gene (rs2336384, rs2295281, rs17037564, rs2236057, rs2236058 and rs3766741) with the TaqMan assay in 626 hypertensive patients and 618 controls. Logistic regression analysis indicated that CC+CA genotype of rs2336384 and AA+AG genotype of rs2236057 were significantly associated with increased risk of EH (OR=1.617, P=0.005; OR=1.418, P=0.031, respectively). GG genotype of rs2236058 and GG+CG genotype of rs3766741 were found to be significantly associated with decreased risk of EH (OR=0.662, P=0.023; OR=0.639, P=0.024).When stratified by gender, for rs2336384, rs2236057 and rs2236058, significant association was observed in males, but not in females. Haplotype analysis indicated that the CCAACC haplotype was positively correlated with EH and there was a negative correlation between ACAGGG haplotype and EH. This study demonstrated that Mfn2 gene polymorphisms were associated with essential hypertension in northern Han Chinese population, especially in male subjects.
Li, Mei; Zhang, Bei; Li, Chuang; Liu, Jielin; Liu, Ya; Sun, Dongdong; Ma, Hanying; Wen, Shaojun
2016-01-01
Background: Mitofusion-2 (Mfn2) played an important role in regulating vascular smooth muscle cells proliferation, insulin resistance and endoplasmic reticulum stress, which were found to be involved in the development of hypertension. So we inferred that the Mfn2 gene may participate in the pathogenesis of hypertension. The aim of this study was to determine whether common single nucleotide polymorphisms (SNPs) in Mfn2 gene were associated with essential hypertension (EH) in northern Han Chinese. Methods: We genotyped 6 tagging SNPs of Mfn2 gene (rs2336384, rs2295281, rs17037564, rs2236057, rs2236058 and rs3766741) with the TaqMan assay in 626 hypertensive patients and 618 controls. Results: Logistic regression analysis indicated that CC+CA genotype of rs2336384 and AA+AG genotype of rs2236057 were significantly associated with increased risk of EH (OR=1.617, P=0.005; OR=1.418, P=0.031, respectively). GG genotype of rs2236058 and GG+CG genotype of rs3766741 were found to be significantly associated with decreased risk of EH (OR=0.662, P=0.023; OR=0.639, P=0.024).When stratified by gender, for rs2336384, rs2236057 and rs2236058, significant association was observed in males, but not in females. Haplotype analysis indicated that the CCAACC haplotype was positively correlated with EH and there was a negative correlation between ACAGGG haplotype and EH. Conclusions: This study demonstrated that Mfn2 gene polymorphisms were associated with essential hypertension in northern Han Chinese population, especially in male subjects. PMID:26816493
Quantum tagging for tags containing secret classical data
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kent, Adrian
Various authors have considered schemes for quantum tagging, that is, authenticating the classical location of a classical tagging device by sending and receiving quantum signals from suitably located distant sites, in an environment controlled by an adversary whose quantum information processing and transmitting power is potentially unbounded. All of the schemes proposed elsewhere in the literature assume that the adversary is able to inspect the interior of the tagging device. All of these schemes have been shown to be breakable if the adversary has unbounded predistributed entanglement. We consider here the case in which the tagging device contains a finitemore » key string shared with distant sites but kept secret from the adversary, and show this allows the location of the tagging device to be authenticated securely and indefinitely. Our protocol relies on quantum key distribution between the tagging device and at least one distant site, and demonstrates a new practical application of quantum key distribution. It also illustrates that the attainable security in position-based cryptography can depend crucially on apparently subtle details in the security scenario considered.« less
Cheng, Hong-Qiu; Huang, En-Min; Xu, Ming-Yan; Shu, Shen-You
2012-01-01
The poliovirus receptor related-1 (PVRL1) gene encodes nectin-1, a cell–cell adhesion molecule (OMIM #600644), and is mutated in the cleft lip with or without cleft palate/ectodermal dysplasia-1 syndrome (CLPED1, OMIM #225000). In addition, PVRL1 mutations have been associated with nonsyndromic cleft lip with or without a cleft palate (NSCL/P) in studies of multiethnic samples. To investigate the possible involvement of this gene in southern Han Chinese NSCL/P patients, we performed (i) a case–control association study, and (ii) a resequencing study. A set of 470 patients with NSCL/P and 693 controls were recruited, and a total of 45 tagging single-nucleotide polymorphisms (SNPs) were genotyped by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. In the resequencing study, the coding regions of the PVRL1 α isoform were direct sequenced in 45 trios from multiply affected families. One (rs7128327) of the 45 tested SNPs showed a trend toward statistical significance in the genotypic-level chi-square test (p=0.009567). However, this result did not withstand correction for multiple testing. Likewise, sliding window haplotype analyses consisting of two, three, or four SNPs failed to detect any positive association. Resequencing analysis also failed to identify any novel rare sequence variants. In conclusion, the present study provided no support for the hypothesis that common or rare variants in PVRL1 play a significant role in NSCL/P development in the southern Han Chinese population. This is the first study that has used tagging SNPs covering all the coding and noncoding regions to search for common NSCL/P-associated mutations of PVRL1. PMID:22455396
Patil, Gunvant; Do, Tuyen; Vuong, Tri D.; Valliyodan, Babu; Lee, Jeong-Dong; Chaudhary, Juhi; Shannon, J. Grover; Nguyen, Henry T.
2016-01-01
Soil salinity is a limiting factor of crop yield. The soybean is sensitive to soil salinity, and a dominant gene, Glyma03g32900 is primarily responsible for salt-tolerance. The identification of high throughput and robust markers as well as the deployment of salt-tolerant cultivars are effective approaches to minimize yield loss under saline conditions. We utilized high quality (15x) whole-genome resequencing (WGRS) on 106 diverse soybean lines and identified three major structural variants and allelic variation in the promoter and genic regions of the GmCHX1 gene. The discovery of single nucleotide polymorphisms (SNPs) associated with structural variants facilitated the design of six KASPar assays. Additionally, haplotype analysis and pedigree tracking of 93 U.S. ancestral lines were performed using publically available WGRS datasets. Identified SNP markers were validated, and a strong correlation was observed between the genotype and salt treatment phenotype (leaf scorch, chlorophyll content and Na+ accumulation) using a panel of 104 soybean lines and, an interspecific bi-parental population (F8) from PI483463 x Hutcheson. These markers precisely identified salt-tolerant/sensitive genotypes (>91%), and different structural-variants (>98%). These SNP assays, supported by accurate phenotyping, haplotype analyses and pedigree tracking information, will accelerate marker-assisted selection programs to enhance the development of salt-tolerant soybean cultivars. PMID:26781337
Dereeper, Alexis; Nicolas, Stéphane; Le Cunff, Loïc; Bacilieri, Roberto; Doligez, Agnès; Peros, Jean-Pierre; Ruiz, Manuel; This, Patrice
2011-05-05
High-throughput re-sequencing, new genotyping technologies and the availability of reference genomes allow the extensive characterization of Single Nucleotide Polymorphisms (SNPs) and insertion/deletion events (indels) in many plant species. The rapidly increasing amount of re-sequencing and genotyping data generated by large-scale genetic diversity projects requires the development of integrated bioinformatics tools able to efficiently manage, analyze, and combine these genetic data with genome structure and external data. In this context, we developed SNiPlay, a flexible, user-friendly and integrative web-based tool dedicated to polymorphism discovery and analysis. It integrates:1) a pipeline, freely accessible through the internet, combining existing softwares with new tools to detect SNPs and to compute different types of statistical indices and graphical layouts for SNP data. From standard sequence alignments, genotyping data or Sanger sequencing traces given as input, SNiPlay detects SNPs and indels events and outputs submission files for the design of Illumina's SNP chips. Subsequently, it sends sequences and genotyping data into a series of modules in charge of various processes: physical mapping to a reference genome, annotation (genomic position, intron/exon location, synonymous/non-synonymous substitutions), SNP frequency determination in user-defined groups, haplotype reconstruction and network, linkage disequilibrium evaluation, and diversity analysis (Pi, Watterson's Theta, Tajima's D).Furthermore, the pipeline allows the use of external data (such as phenotype, geographic origin, taxa, stratification) to define groups and compare statistical indices.2) a database storing polymorphisms, genotyping data and grapevine sequences released by public and private projects. It allows the user to retrieve SNPs using various filters (such as genomic position, missing data, polymorphism type, allele frequency), to compare SNP patterns between populations, and to
Gao, Su-Qing; Cheng, Xi; Li, Qian; Li, Yu-Zhu; Deng, Zhi-Hui
2009-06-01
This study was aimed to discover the novel HLA recombination haplotypes and investigate the distribution of haplotypes in Chinese Han population. Based on the HLA-A, B, DRB1 typing results of 179 family members, 791 haplotypes were assigned by the mode of inheritance. The results showed that a total of 4 novel recombinant haplotypes in HLA-DRB1 locus region were observed in 4 families, which ratio of paternal to maternal chromosomes was 3:1. The recombination ratio between HLA-DRB1 and HLA-A or B loci was 0.92% (4/433). There were a total of 362 kinds of HLA-A, -B, -DRB1 haplotypes to be confirmed in Chinese Han partial population. A33-B58-DR17, A2-B46-DR9, A30-B13-DR7, A11-B13-DR15, A11-B75-DR12 and A2-B46-DR14 were the most common haplotypes that was consistent with the distribution of HLA alleles in unrelated donors. There were A1-B63-DR12, A29-B46-DR15, A1-B61-DR10, A34-B35-DR9, A29-B54-DR4, A23-B13-DR16 and A34-B62-DR15 haplotypes and so on, which were rare haplotypes not yet reported in Chinese. It is concluded that the HLA-A-B-DRB1 haplotypes would be confirmed by analysis of their family pedigree. The results obtained in this study are basic data for study of Chinese anthropology, organ transplantation and disease correlation analysis.
Pathirana, Indunil N; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi
2011-06-01
Differences in the distribution of single nucleotide polymorphisms (SNPs) and haplotypes in the estrogen receptor α gene (ESR1) were examined in Miniature Dachshunds (n = 48), Chihuahuas (n = 20) and Toy Poodles (n = 18). Five DNA fragments located in the 40-kb region at the 3' end of ESR1 were amplified by polymerase chain reaction and were directly sequenced. We compared allele, genotype and estimated haplotype frequencies at each SNP in the 3' end of ESR1 for these three breeds of small dog. The frequency of the major allele and the genotype frequency of the major allele homozygotes, were significantly higher in Toy Poodles for five SNPs (SNP #5, #14-17) than in Miniature Dachshunds, and significantly higher in Toy Poodles than Chihuahuas for three SNPs (SNP #15-17). A common haplotype block was identified in an approximately 20-kb region encompassing four SNPs (SNPs # 14-17). The frequencies of the most abundant estimated haplotype (GTTG) and GTTG homozygotes were significantly higher in Toy Poodles than in the other two breeds. These results imply that homozygosity for the allele, genotype and haplotype distribution within the block at the 3' end of ESR1 is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas. © 2011 The Authors; Animal Science Journal © 2011 Japanese Society of Animal Science.
Alpha-globin gene haplotypes in South American Indians.
Zago, M A; Melo Santos, E J; Clegg, J B; Guerreiro, J F; Martinson, J J; Norwich, J; Figueiredo, M S
1995-08-01
The haplotypes of the alpha-globin gene cluster were determined for 99 Indians from the Brazilian Amazon region who belong to 5 tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Three predominant haplotypes were identified: Ia (present in 38.9% of chromosomes), IIIa (25.8%), and IIe (22.1%). The only alpha-globin gene rearrangement detected was alpha alpha alpha 3.7 I gene triplication associated with haplotype IIIa, found in high frequencies (5.6% and 10.6%) in two tribes and absent in the others. alpha-Globin gene deletions that cause alpha-thalassemia were not seen, supporting the argument that malaria was absent in these populations until recently. The heterogeneous distribution of alpha-globin gene haplotypes and rearrangements among the different tribes differs markedly from the homogeneous distribution of beta-globin gene cluster haplotypes and reflects the action of various genetic mechanisms (genetic drift, founder effect, consanguinity) on small isolated population groups with a complicated history of divergence-fusion events. The alpha-globin gene haplotype distribution has some similarities to distributions observed in Southeast Asian and Pacific Island populations, indicating that these populations have considerable genetic affinities. However, the absence of several features of the alpha-globin gene cluster that are consistently present among the Pacific Islanders suggests that the similarity of haplotypes between Brazilian Indians and people from Polynesia, Micronesia, and Melanesia is more likely to result of ancient common ancestry rather than the consequence of recent direct genetic contribution through immigration.
Chai, Wei; Lian, Zijian; Chen, Chao; Liu, Jingyi; Shi, Lewis L; Wang, Yan
2013-01-01
Susceptibility to ankylosing spondylitis (AS) is largely genetically determined. JARID1A, JMY and PTGER4 have recently been found to be associated with AS in patients of western European descent. We aim to examine the influence of JARID1A, JMY, and PTGER4 polymorphisms on the susceptibility to and the severity of ankylosing spondylitis in Chinese ethnic majority Han population. This work can lead the clinical doctors to intervene earlier. Blood samples were drawn from 396 AS patients and 404 unrelated healthy controls. Both the AS patients and the controls are Han Chinese. The AS patients are classified based on the severity of the disease. Thirteen tag single nucleotide polymorphisms (tagSNPs) in JARID1A, JMY and PTGER4 are selected and genotyped. Frequencies of different genotypes and alleles are analyzed among the different severity AS patients and the controls. The rs2284336 SNP in JARID1A, the rs16876619 and rs16876657 SNPs in JMY are associated with susceptibility of AS. The rs11062357 SNP in JARID1A, the rs2607142 SNP in JMY and rs10440635 in PTGER4 are related to severity of AS. Haplotype analyses indicate PTGER4 is related to susceptibility to AS; JARID1A and JMY are related to severity of AS.
HapMap-based study of CIP2A gene polymorphisms and HCC susceptibility
LI, YUCHUN; WANG, KAIJUAN; DAI, LIPING; WANG, PENG; SONG, CHUNHUA; SHI, JIANXIANG; REN, PENGFEI; YE, HUA; ZHANG, JIANYING
2012-01-01
CIP2A is a human oncoprotein that inhibits PP2A and stabilizes c-myc in human malignancies. Autoantibodies to CIP2A protein have been reported to be present in higher levels in sera from patients with hepatocellular carcinoma (HCC) than in sera of healthy individuals. The CIP2A gene has been demonstrated as a potential cancer susceptibility gene. To elucidate whether common CIP2A variants are associated with HCC susceptibility, we conducted a case-control study comprising 233 cases of HCC and 280 controls matched on age, gender and ethnicity in the Chinese Han population. Two haplotype-tagging single nucleotide polymorphisms (htSNPs) (rs2278911 and rs4855656) from the HapMap database were analyzed, which provide an almost complete coverage of the genetic variations in the CIP2A gene. We found that neither of these htSNPs and haplotypes were associated with the risk of HCC. However, an interaction was observed between hepatitis virus B and C infection (HBV and HCV) and the C carriers (TC or CC) of rs2278911 on HCC risk (OR=12.35; 95% CI, 4.93–19.87). No such association was found for rs4855656. Our study also demonstrated that two htSNPs (rs2278911 and rs4855656) in the CIP2A gene are not associated with the risk of HCC. HBV and HCV infection was found to exert a synergistic effect on the risk of HCC in individuals with the C carriers (TC or CC) of rs2278911 in the Chinese Han population. PMID:22844383
Yue, Hua; He, Jin-wei; Zhang, Hao; Wang, Chun; Hu, Wei-wei; Gu, Jie-mei; Ke, Yao-hua; Fu, Wen-zhen; Hu, Yun-qiu; Li, Miao; Liu, Yu-juan; Wu, Song-hua; Zhang, Zhen-lin
2012-05-01
Myostatin gene is a member of the transforming growth factor-β (TGF-β) family that negatively regulates skeletal muscle growth. Genetic polymorphisms in Myostatin were found to be associated with the peak bone mineral density (BMD) in Chinese women. The purpose of this study was to investigate whether myostatin played a role in the normal variation in peak BMD, lean mass (LM), and fat mass (FM) of Chinese men. Four hundred male-offspring nuclear families of Chinese Han ethnic group were recruited. Anthropometric measurements, including the peak BMD, body LM and FM were measured using dual-energy X-ray absorptiometry (DXA). The single nucleotide polymorphisms (SNPs) studied were tag-SNPs selected by sequencing. Both rs2293284 and +2278GA were genotyped using TaqMan assay, and rs3791783 was genotyped with PCR-restriction fragment length polymorphism (RFLP) analysis. The associations of the SNPs with anthropometric variations were analyzed using the quantitative transmission disequilibrium test (QTDT). Using QTDT to detect within-family associations, neither single SNP nor haplotype was found to be associated with peak BMD at any bone site. However, rs3791783 was found to be significantly associated with fat mass of the trunk (P<0.001). Moreover, for within-family associations, haplotypes AGG, AAA, and TGG were found to be significantly associated with the trunk fat mass (all P<0.001). Our results suggest that genetic variation within myostatin may play a role in regulating the variation in fat mass in Chinese males. Additionally, the myostatin gene may be a candidate that determines body fat mass in Chinese men.
Vega, Jorge A; Villegas-Ospina, Simón; Aguilar-Jiménez, Wbeimar; Rugeles, María T; Bedoya, Gabriel; Zapata, Wildeman
2017-06-01
Variants in genes encoding for HIV-1 co-receptors and their natural ligands have been individually associated to natural resistance to HIV-1 infection. However, the simultaneous presence of these variants has been poorly studied. To evaluate the association of single and multilocus haplotypes in genes coding for the viral co-receptors CCR5 and CCR2, and their ligands CCL3 and CCL5, with resistance or susceptibility to HIV-1 infection. Nine variants in CCR5-CCR2, two SNPs in CCL3 and two in CCL5 were genotyped by PCR-RFLP in 35 seropositive (cases) and 49 HIV-1-exposed seronegative Colombian individuals (controls). Haplotypes were inferred using the Arlequin software, and their frequency in individual or combined loci was compared between cases and controls by the chi-square test. A p' value ;0.05 after Bonferroni correction was considered significant. Homozygosis of the human haplogroup (HH) E was absent in controls and frequent in cases, showing a tendency to susceptibility. The haplotypes C-C and T-T in CCL3 were associated with susceptibility (p'=0.016) and resistance (p';0.0001) to HIV-1 infection, respectively. Finally, in multilocus analysis, the haplotype combinations formed by HHC in CCR5-CCR2, T-T in CCL3 and G-C in CCL5 were associated with resistance (p'=0.006). Our results suggest that specific combinations of variants in genes from the same signaling pathway can define an HIV-1 resistant phenotype. Despite our small sample size, our statistically significant associations suggest strong effects; however, these results should be further validated in larger cohorts.
Pathirana, Indunil Nishantha; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Kida, Kayoko; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi
2010-08-01
This study was performed to examine the distribution of single nucleotide polymorphisms (SNPs) and estimated haplotypes in the canine estrogen receptor (ER) alpha gene (ESR1) and the association of them with different phenotypes of cryptorchidism (CO) in Miniature Dachshunds and Chihuahuas. Forty CO and 68 normal dogs were used, and CO was classified into unilateral (UCO; n=33) and bilateral CO (BCO; n=5) or into abdominal (ACO; n=16) and inguinal CO (ICO; n=22). Thirteen DNA fragments located in the 70-kb region at the 3' end of ESR1 were amplified by PCR and sequenced to examine 13 SNPs (#1-#13) reported in a canine SNP database. Ten SNPs (#1-#4, #7, #8, #10-#13) were not polymorphic, and 5 new SNPs (#14-#18) were discovered. A common haplotype block in normal, CO and CO phenotypes was identified for an approximately 20-kb region encompassing 4 SNPs (#14-#17). Allele, genotype and haplotype frequencies in CO without classification by phenotype and also in UCO, ACO and ICO phenotypes were not statistically different from the normal group. Significant differences in genotype frequencies and homozygosity for the estimated GTTG haplotype within the block were observed in BCO compared with the normal group, although the number of BCO animals was small. Our results demonstrate that the examined SNPs and haplotypes in the 3' end of canine ESR1 are not associated with unilateral, abdominal and inguinal CO phenotypes and CO per se in Miniature Dachshunds and Chihuahuas. Further studies are necessary to suggest a clear association between the ESR1 SNPs and bilateral CO in dogs.
Capturing haplotypes in germplasm core collections
USDA-ARS?s Scientific Manuscript database
Genomewide data sets of single nucleotide polymorphisms (SNPs) offer great potential to improve ex situ conservation. Two factors impede their use for producing core collections. First, due to the large number of SNPs, the assembly of collections that maximize diversity may be intractable using ex...
Weedon, Michael N; Clark, Vanessa J; Qian, Yudong; Ben-Shlomo, Yoav; Timpson, Nicholas; Ebrahim, Shah; Lawlor, Debbie A; Pembrey, Marcus E; Ring, Susan; Wilkin, Terry J; Voss, Linda D; Jeffery, Alison N; Metcalf, Brad; Ferrucci, Luigi; Corsi, Anna Maria; Murray, Anna; Melzer, David; Knight, Bridget; Shields, Bev; Smith, George Davey; Hattersley, Andrew T; Di Rienzo, Anna; Frayling, Tim M
2006-12-01
Fasting glucose is associated with future risk of type 2 diabetes and ischemic heart disease and is tightly regulated despite considerable variation in quantity, type, and timing of food intake. In pregnancy, maternal fasting glucose concentration is an important determinant of offspring birth weight. The key determinant of fasting glucose is the enzyme glucokinase (GCK). Rare mutations of GCK cause fasting hyperglycemia and alter birth weight. The extent to which common variation of GCK explains normal variation of fasting glucose and birth weight is not known. We aimed to comprehensively define the role of variation of GCK in determination of fasting glucose and birth weight, using a tagging SNP (tSNP) approach and studying 19,806 subjects from six population-based studies. Using 22 tSNPs, we showed that the variant rs1799884 is associated with fasting glucose at all ages in the normal population and exceeded genomewide levels of significance (P=10-9). rs3757840 was also highly significantly associated with fasting glucose (P=8x10-7), but haplotype analysis revealed that this is explained by linkage disequilibrium (r2=0.2) with rs1799884. A maternal A allele at rs1799884 was associated with a 32-g (95% confidence interval 11-53 g) increase in offspring birth weight (P=.002). Genetic variation influencing birth weight may have conferred a selective advantage in human populations. We performed extensive population-genetics analyses to look for evidence of recent positive natural selection on patterns of GCK variation. However, we found no strong signature of positive selection. In conclusion, a comprehensive analysis of common variation of the glucokinase gene shows that this is the first gene to be reproducibly associated with fasting glucose and fetal growth.
Haplotype Reconstruction in Large Pedigrees with Many Untyped Individuals
NASA Astrophysics Data System (ADS)
Li, Xin; Li, Jing
Haplotypes, as they specify the linkage patterns between dispersed genetic variations, provide important information for understanding the genetics of human traits. However haplotypes are not directly available from current genotyping platforms, and hence there are extensive investigations of computational methods to recover such information. Two major computational challenges arising in current family-based disease studies are large family sizes and many ungenotyped family members. Traditional haplotyping methods can neither handle large families nor families with missing members. In this paper, we propose a method which addresses these issues by integrating multiple novel techniques. The method consists of three major components: pairwise identical-bydescent (IBD) inference, global IBD reconstruction and haplotype restoring. By reconstructing the global IBD of a family from pairwise IBD and then restoring the haplotypes based on the inferred IBD, this method can scale to large pedigrees, and more importantly it can handle families with missing members. Compared with existing methods, this method demonstrates much higher power to recover haplotype information, especially in families with many untyped individuals.
Comparative Performance of Acoustic-tagged and PIT-tagged Juvenile Salmonids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hockersmith, Eric E.; Brown, Richard S.; Liedtke, Theresa L.
2008-02-01
Numerous research tools and technologies are currently being used to evaluate fish passage and survival to determine the impacts of the Federal Columbia River Power System (FCRPS) on endangered and threatened juvenile salmonids, including PIT tags, balloon tags, hydroacoustic evaluations, radio telemetry, and acoustic telemetry. Each has advantages and disadvantages, but options are restricted in some situations because of limited capabilities of a specific technology, lack of detection capability downstream, or availability of adequate numbers of fish. However, there remains concern about the comparative effects of the tag or the tagging procedure on fish performance. The recently developed Juvenile Salmonidmore » Acoustic Telemetry System (JSATS) acoustic transmitter is the smallest active acoustic tag currently available. The goal of this study was to determine whether fish tagged with the JSATS acoustic-telemetry tag can provide unbiased estimates of passage behavior and survival within the performance life of the tag. We conducted both field and laboratory studies to assess tag effects. For the field evaluation we released a total of 996 acoustic-tagged fish in conjunction with 21,026 PIT-tagged fish into the tailrace of Lower Granite Dam on 6 and 13 May. Travel times between release and downstream dams were not significantly different for the majority of the reaches between acoustic-tagged and PIT-tagged fish. In addition to the field evaluation, a series of laboratory experiments were conducted to determine if growth and survival of juvenile Chinook salmon surgically implanted with acoustic transmitters is different than untagged or PIT tagged juvenile Chinook salmon. Only yearling fish with integrated and non-integrated transmitters experienced mortalities, and these were low (<4.5%). Mortality among sub-yearling control and PIT-tag treatments ranged up to 7.7% while integrated and non-integrated treatments had slightly higher rates (up to 8.3% and 7
A parsimonious tree-grow method for haplotype inference.
Li, Zhenping; Zhou, Wenfeng; Zhang, Xiang-Sun; Chen, Luonan
2005-09-01
Haplotype information has become increasingly important in analyzing fine-scale molecular genetics data, such as disease genes mapping and drug design. Parsimony haplotyping is one of haplotyping problems belonging to NP-hard class. In this paper, we aim to develop a novel algorithm for the haplotype inference problem with the parsimony criterion, based on a parsimonious tree-grow method (PTG). PTG is a heuristic algorithm that can find the minimum number of distinct haplotypes based on the criterion of keeping all genotypes resolved during tree-grow process. In addition, a block-partitioning method is also proposed to improve the computational efficiency. We show that the proposed approach is not only effective with a high accuracy, but also very efficient with the computational complexity in the order of O(m2n) time for n single nucleotide polymorphism sites in m individual genotypes. The software is available upon request from the authors, or from http://zhangroup.aporc.org/bioinfo/ptg/ chen@elec.osaka-sandai.ac.jp Supporting materials is available from http://zhangroup.aporc.org/bioinfo/ptg/bti572supplementary.pdf
In Vivo Characterization of Human APOA5 Haplotypes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahituv, Nadav; Akiyama, Jennifer; Chapman-Helleboid, Audrey
2006-10-01
Increased plasma triglycerides concentrations are an independent risk factor for cardiovascular disease. Numerous studies support a reproducible genetic association between two minor haplotypes in the human apolipoprotein A5 gene (APOA5) and increased plasma triglyceride concentrations. We thus sought to investigate the effect of these minor haplotypes (APOA5*2 and APOA5*3) on ApoAV plasma levels through the precise insertion of single-copy intact APOA5 haplotypes at a targeted location in the mouse genome. While we found no difference in the amount of human plasma ApoAV in mice containing the common APOA5*1 and minor APOA5*2 haplotype, the introduction of the single APOA5*3 defining allelemore » (19W) resulted in 3-fold lower ApoAV plasma levels consistent with existing genetic association studies. These results indicate that S19W polymorphism is likely to be functional and explain the strong association of this variant with plasma triglycerides supporting the value of sensitive in vivo assays to define the functional nature of human haplotypes.« less
Examining ERBB2 as a candidate gene for susceptibility to leprosy (Hansen’s disease) in Brazil
Araújo, Sérgio Ricardo Fernandes; Jamieson, Sarra Elisabeth; Dupnik, Kathryn Margaret; Monteiro, Glória Regina; Nobre, Maurício Lisboa; Dias, Márcia Sousa; Trindade, Pedro Bezerra; Queiroz, Maria do Carmo Palmeira; Gomes, Carlos Eduardo Maia; Blackwell, Jenefer Mary; Jeronimo, Selma Maria Bezerra
2014-01-01
Leprosy remains prevalent in Brazil. ErbB2 is a receptor for leprosy bacilli entering Schwann cells, which mediates Mycobacterium leprae-induced demyelination and the ERBB2 gene lies within a leprosy susceptibility locus on chromosome 17q11-q21. To determine whether polymorphisms at the ERBB2 locus contribute to this linkage peak, three haplotype tagging single nucleotide polymorphisms (tag-SNPs) (rs2517956, rs2952156, rs1058808) were genotyped in 72 families (208 cases; 372 individuals) from the state of Pará (PA). All three tag-SNPs were associated with leprosy per se [best SNP rs2517959 odds ratio (OR) = 2.22; 95% confidence interval (CI) 1.37-3.59; p = 0.001]. Lepromatous (LL) (OR = 3.25; 95% CI 1.37-7.70; p = 0.007) and tuberculoid (TT) (OR = 1.79; 95% CI 1.04-3.05; p = 0.034) leprosy both contributed to the association, which is consistent with the previous linkage to chromosome 17q11-q21 in the population from PA and supports the functional role of ErbB2 in disease pathogenesis. To attempt to replicate these findings, six SNPs (rs2517955, rs2517956, rs1810132, rs2952156, rs1801200, rs1058808) were genotyped in a population-based sample of 570 leprosy cases and 370 controls from the state of Rio Grande do Norte (RN) and the results were analysed using logistic regression analysis. However, none of the associations were replicated in the RN sample, whether analysed for leprosy per se, LL leprosy, TT leprosy, erythema nodosum leprosum or reversal reaction conditions. The role of polymorphisms at ERBB2 in controlling susceptibility to leprosy in Brazil therefore remains unclear. PMID:24676663
Israel, Salomon; Lerer, Elad; Shalev, Idan; Uzefovsky, Florina; Riebold, Mathias; Laiba, Efrat; Bachner-Melman, Rachel; Maril, Anat; Bornstein, Gary; Knafo, Ariel; Ebstein, Richard P.
2009-01-01
Background Economic games observe social decision making in the laboratory that involves real money payoffs. Previously we have shown that allocation of funds in the Dictator Game (DG), a paradigm that illustrates costly altruistic behavior, is partially determined by promoter-region repeat region variants in the arginine vasopressin 1a receptor gene (AVPR1a). In the current investigation, the gene encoding the related oxytocin receptor (OXTR) was tested for association with the DG and a related paradigm, the Social Values Orientation (SVO) task. Methodology/Principal Findings Association (101 male and 102 female students) using a robust-family based test between 15 single tagging SNPs (htSNPs) across the OXTR was demonstrated with both the DG and SVO. Three htSNPs across the gene region showed significant association with both of the two games. The most significant association was observed with rs1042778 (p = 0.001). Haplotype analysis also showed significant associations for both DG and SVO. Following permutation test adjustment, significance was observed for 2–5 locus haplotypes (p<0.05). A second sample of 98 female subjects was subsequently and independently recruited to play the dictator game and was genotyped for the three significant SNPs found in the first sample. The rs1042778 SNP was shown to be significant for the second sample as well (p = 0.004, Fisher's exact test). Conclusions The demonstration that genetic polymorphisms for the OXTR are associated with human prosocial decision making converges with a large body of animal research showing that oxytocin is an important social hormone across vertebrates including Homo sapiens. Individual differences in prosocial behavior have been shown by twin studies to have a substantial genetic basis and the current investigation demonstrates that common variants in the oxytocin receptor gene, an important element of mammalian social circuitry, underlie such individual differences. PMID:19461999
Engineer, Neelam; Darwin, Lucy; Nishigandh, Deole; Ngianga-Bakwin, Kandala; Smith, Steve C; Grammatopoulos, Dimitris K
2013-09-01
Women with postnatal depression (PND) appear to have abnormal hypothalamic pituitary adrenal (HPA) axis responses to stress, which might involve a genetic variability component. We investigated association of genetic variants in the glucocorticoid receptor (GR, NR3C1) and corticotropin releasing hormone receptor 1 (CRHR1) genes with increased risk for PND. Two hundred pregnant women were recruited prospectively and PND risk was assessed by the Edinburgh Postnatal Depression Scale (EPDS) during pregnancy and again 2-8 weeks post-natally (CW-GAPND study). The BclI and ER22/23EK single nucleotide polymorphisms (SNPs) of the GR and the haplotype-tagged rs1876828, rs242939 and rs242941 SNPs of the CRHR1 associated with genetic risk to depressive disorders were genotyped. A cut-off score of 10 was used to detect increased risk of PND. Association analysis was carried out in 140 patients that completed the study protocol. The BclI and rs242939 SNPs were over-represented in women with postnatal EPDS score ≥10 with significant allele association (p = 0.011 and <0.001, respectively) and risk ratios of 2.9 (95% CI: 1.2-6.9) for BclI, 4.9 (2-12) for rs242939 and 5.48 (2.13-14.10) for both. The rs242939 SNP was also associated with increased EPDS values during pregnancy. Moreover, the G-G-T haplotype of the CRHR1 was significantly over-represented in patients with high EPDS scores, with risk ratio of 3.22 (95% CI: 1.91-5.42). This is the first evidence that specific SNPs of genes involved in 'stress' responses might contribute in the genetics of high-risk for depression during pregnancy and postpartum. Copyright © 2013 Elsevier Ltd. All rights reserved.
Detecting disease-predisposing variants: the haplotype method.
Valdes, A M; Thomson, G
1997-01-01
For many HLA-associated diseases, multiple alleles-- and, in some cases, multiple loci--have been suggested as the causative agents. The haplotype method for identifying disease-predisposing amino acids in a genetic region is a stratification analysis. We show that, for each haplotype combination containing all the amino acid sites involved in the disease process, the relative frequencies of amino acid variants at sites not involved in disease but in linkage disequilibrium with the disease-predisposing sites are expected to be the same in patients and controls. The haplotype method is robust to mode of inheritance and penetrance of the disease and can be used to determine unequivocally whether all amino acid sites involved in the disease have not been identified. Using a resampling technique, we developed a statistical test that takes account of the nonindependence of the sites sampled. Further, when multiple sites in the genetic region are involved in disease, the test statistic gives a closer fit to the null expectation when some--compared with none--of the true predisposing factors are included in the haplotype analysis. Although the haplotype method cannot distinguish between very highly correlated sites in one population, ethnic comparisons may help identify the true predisposing factors. The haplotype method was applied to insulin-dependent diabetes mellitus (IDDM) HLA class II DQA1-DQB1 data from Caucasian, African, and Japanese populations. Our results indicate that the combination DQA1#52 (Arg predisposing) DQB1#57 (Asp protective), which has been proposed as an important IDDM agent, does not include all the predisposing elements. With rheumatoid arthritis HLA class II DRB1 data, the results were consistent with the shared-epitope hypothesis. PMID:9042931
NASA Astrophysics Data System (ADS)
Tibély, Gergely; Pollner, Péter; Vicsek, Tamás; Palla, Gergely
2012-05-01
Due to the increasing popularity of collaborative tagging systems, the research on tagged networks, hypergraphs, ontologies, folksonomies and other related concepts is becoming an important interdisciplinary area with great potential and relevance for practical applications. In most collaborative tagging systems the tagging by the users is completely ‘flat’, while in some cases they are allowed to define a shallow hierarchy for their own tags. However, usually no overall hierarchical organization of the tags is given, and one of the interesting challenges of this area is to provide an algorithm generating the ontology of the tags from the available data. In contrast, there are also other types of tagged networks available for research, where the tags are already organized into a directed acyclic graph (DAG), encapsulating the ‘is a sub-category of’ type of hierarchy between each other. In this paper, we study how this DAG affects the statistical distribution of tags on the nodes marked by the tags in various real networks. The motivation for this research was the fact that understanding the tagging based on a known hierarchy can help in revealing the hidden hierarchy of tags in collaborative tagging systems. We analyse the relation between the tag-frequency and the position of the tag in the DAG in two large sub-networks of the English Wikipedia and a protein-protein interaction network. We also study the tag co-occurrence statistics by introducing a two-dimensional (2D) tag-distance distribution preserving both the difference in the levels and the absolute distance in the DAG for the co-occurring pairs of tags. Our most interesting finding is that the local relevance of tags in the DAG (i.e. their rank or significance as characterized by, e.g., the length of the branches starting from them) is much more important than their global distance from the root. Furthermore, we also introduce a simple tagging model based on random walks on the DAG, capable of
Influence of ghrelin gene polymorphisms on hypertension and atherosclerotic disease.
Berthold, Heiner K; Giannakidou, Eleni; Krone, Wilhelm; Trégouët, David-Alexandre; Gouni-Berthold, Ioanna
2010-02-01
Ghrelin is involved in several metabolic and cardiovascular processes. Recent evidence suggests its involvement in blood pressure regulation and hypertension. The aim of the study was to determine associations of single-nucleotide polymorphisms (SNPs) and haplotypes of the ghrelin gene (GHRL) with hypertension and atherosclerotic disease. Six GHRL SNPs (rs27647, rs26802, rs34911341, rs696217, rs4684677 and a -473G/A (with no assigned rsID)) were investigated in a sample of 1143 hypertensive subjects and 1489 controls of Caucasian origin. Both single-locus and haplotype association analyses were performed. In single-locus analyses, only the non-synonymous rs34911341 was associated with hypertension (odds ratio (OR)=1.95 (95% confidence interval (CI): 1.26-3.02), P=0.003). Six common haplotypes with frequency >1% were inferred from the studied GHRL SNPs, and their frequency distribution was significantly different between hypertensive subjects and controls (chi(2)=12.96 with 5 d.f. (degree of freedom), P=0.024). The effect of rs26802 was found to be significantly (P=0.017) modulated by other GHRL SNPs, as its C allele conferred either an increased risk (OR=1.30 (1.08-1.57), P=0.005) or a decreased risk (OR=0.50 (0.23-1.06), P=0.07) of hypertension according to the two different haplotypes on which it can be found. No association of GHRL SNPs or haplotypes with atherosclerotic disease was observed. In conclusion, we observed statistical evidence for association between GHRL SNPs and risk of hypertension.
GESPA: classifying nsSNPs to predict disease association.
Khurana, Jay K; Reeder, Jay E; Shrimpton, Antony E; Thakar, Juilee
2015-07-25
Non-synonymous single nucleotide polymorphisms (nsSNPs) are the most common DNA sequence variation associated with disease in humans. Thus determining the clinical significance of each nsSNP is of great importance. Potential detrimental nsSNPs may be identified by genetic association studies or by functional analysis in the laboratory, both of which are expensive and time consuming. Existing computational methods lack accuracy and features to facilitate nsSNP classification for clinical use. We developed the GESPA (GEnomic Single nucleotide Polymorphism Analyzer) program to predict the pathogenicity and disease phenotype of nsSNPs. GESPA is a user-friendly software package for classifying disease association of nsSNPs. It allows flexibility in acceptable input formats and predicts the pathogenicity of a given nsSNP by assessing the conservation of amino acids in orthologs and paralogs and supplementing this information with data from medical literature. The development and testing of GESPA was performed using the humsavar, ClinVar and humvar datasets. Additionally, GESPA also predicts the disease phenotype associated with a nsSNP with high accuracy, a feature unavailable in existing software. GESPA's overall accuracy exceeds existing computational methods for predicting nsSNP pathogenicity. The usability of GESPA is enhanced by fast SQL-based cloud storage and retrieval of data. GESPA is a novel bioinformatics tool to determine the pathogenicity and phenotypes of nsSNPs. We anticipate that GESPA will become a useful clinical framework for predicting the disease association of nsSNPs. The program, executable jar file, source code, GPL 3.0 license, user guide, and test data with instructions are available at http://sourceforge.net/projects/gespa.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohrenweiser, H W; Han, J; Hankinson, S E
2004-01-15
The XRCC1 protein is involved in the base excision repair pathway through interactions with other proteins. Polymorphisms in the XRCC1 gene may lead to variation in repair proficiency and confer inherited predisposition to cancer. We prospectively assessed the associations between polymorphisms and haplotypes in XRCC1 and breast cancer risk in a nested case-control study within the Nurses' Health Study (incident cases, n 1004; controls, n 1385). We further investigated gene-environment interactions between the XRCC1 variations and plasma carotenoids on breast cancer risk. We genotyped four haplotype-tagging single nucleotide polymorphisms Arg {sup 194}Trp, C26602T, Arg{sup 399}Gln, and Gln{sup 632}Gln in themore » XRCC1 gene. Five common haplotypes accounted for 99% of the chromosomes in the present study population of mostly Caucasian women. We observed a marginally significant reduction in the risk of breast cancer among {sup 194}Trp carriers. As compared with no-carriers, women with at least one {sup 194}Trp allele had a multivariate odds ratio of 0.79 (95% of the confidence interval, 0.60 -1.04). The inferred haplotype harboring the {sup 194}Trp allele was more common in controls than in cases (6.6 versus 5.3%, P 0.07). We observed that the Arg {sup 194}Trp modified the inverse associations of plasma -carotene level (P, ordinal test for interaction 0.02) and plasma -carotene level (P, ordinal test for interaction 0.003) with breast cancer risk. No suggestion of an interaction was observed between the Arg {sup 194}Trp and cigarette smoking. Our results suggest an inverse association between XRCC1 {sup 194}Trp allele and breast cancer risk. The findings of the effect modification of the Arg {sup 194}Trp on the relations of plasma -and -carotene levels with breast cancer risk suggest a potential protective effect of carotenoids in breast carcinogenesis by preventing oxidative DNA damage.« less
Identification of SNPs associated with variola virus virulence.
Hoen, Anne Gatewood; Gardner, Shea N; Moore, Jason H
2013-02-14
Decades after the eradication of smallpox, its etiological agent, variola virus (VARV), remains a threat as a potential bioweapon. Outbreaks of smallpox around the time of the global eradication effort exhibited variable case fatality rates (CFRs), likely attributable in part to complex viral genetic determinants of smallpox virulence. We aimed to identify genome-wide single nucleotide polymorphisms associated with CFR. We evaluated unadjusted and outbreak geographic location-adjusted models of single SNPs and two- and three-way interactions between SNPs. Using the data mining approach multifactor dimensionality reduction (MDR), we identified five VARV SNPs in models significantly associated with CFR. The top performing unadjusted model and adjusted models both revealed the same two-way gene-gene interaction. We discuss the biological plausibility of the influence of the SNPs identified these and other significant models on the strain-specific virulence of VARV. We have identified genetic loci in the VARV genome that are statistically associated with VARV virulence as measured by CFR. While our ability to infer a causal relationship between the specific SNPs identified in our analysis and VARV virulence is limited, our results suggest that smallpox severity is in part associated with VARV strain variation and that VARV virulence may be determined by multiple genetic loci. This study represents the first application of MDR to the identification of pathogen gene-gene interactions for predicting infectious disease outbreak severity.
regSNPs: a strategy for prioritizing regulatory single nucleotide substitutions
Teng, Mingxiang; Ichikawa, Shoji; Padgett, Leah R.; Wang, Yadong; Mort, Matthew; Cooper, David N.; Koller, Daniel L.; Foroud, Tatiana; Edenberg, Howard J.; Econs, Michael J.; Liu, Yunlong
2012-01-01
Motivation: One of the fundamental questions in genetics study is to identify functional DNA variants that are responsible to a disease or phenotype of interest. Results from large-scale genetics studies, such as genome-wide association studies (GWAS), and the availability of high-throughput sequencing technologies provide opportunities in identifying causal variants. Despite the technical advances, informatics methodologies need to be developed to prioritize thousands of variants for potential causative effects. Results: We present regSNPs, an informatics strategy that integrates several established bioinformatics tools, for prioritizing regulatory SNPs, i.e. the SNPs in the promoter regions that potentially affect phenotype through changing transcription of downstream genes. Comparing to existing tools, regSNPs has two distinct features. It considers degenerative features of binding motifs by calculating the differences on the binding affinity caused by the candidate variants and integrates potential phenotypic effects of various transcription factors. When tested by using the disease-causing variants documented in the Human Gene Mutation Database, regSNPs showed mixed performance on various diseases. regSNPs predicted three SNPs that can potentially affect bone density in a region detected in an earlier linkage study. Potential effects of one of the variants were validated using luciferase reporter assay. Contact: yunliu@iupui.edu Supplementary information: Supplementary data are available at Bioinformatics online PMID:22611130
NASA Astrophysics Data System (ADS)
Griggs, Steven P.; Mark, Martin B.; Feldman, Barry J.
2004-07-01
The goal of the DARPA Dynamic Optical Tags (DOTs) program is to develop a small, robust, persistent, 2-way tagging, tracking and locating device that also supports communications at data rates greater than 100 kbps and can be interrogated at significant range. These tags will allow for two-way data exchange and tagging operations in friendly and denied areas. The DOTs will be passive and non-RF. To accomplish this, the DOTs program will develop small, thin, retro-reflecting modulators. The tags will operate for long periods of time (greater than two months) in real-world environmental conditions (-40° to +70° C) and allow for a wide interrogation angle (+/-60°). The tags will be passive (in the sleep mode) for most of the time and only become active when interrogated by a laser with the correct code. Once correctly interrogated, the tags will begin to modulate and retro-reflect the incoming beam. The program will also develop two tag specific transceiver systems that are eye-safe, employ automated scanning algorithms, and are capable of short search and interrogate times.
HaploForge: a comprehensive pedigree drawing and haplotype visualization web application.
Tekman, Mehmet; Medlar, Alan; Mozere, Monika; Kleta, Robert; Stanescu, Horia
2017-12-15
Haplotype reconstruction is an important tool for understanding the aetiology of human disease. Haplotyping infers the most likely phase of observed genotypes conditional on constraints imposed by the genotypes of other pedigree members. The results of haplotype reconstruction, when visualized appropriately, show which alleles are identical by descent despite the presence of untyped individuals. When used in concert with linkage analysis, haplotyping can help delineate a locus of interest and provide a succinct explanation for the transmission of the trait locus. Unfortunately, the design choices made by existing haplotype visualization programs do not scale to large numbers of markers. Indeed, following haplotypes from generation to generation requires excessive scrolling back and forth. In addition, the most widely used program for haplotype visualization produces inconsistent recombination artefacts for the X chromosome. To resolve these issues, we developed HaploForge, a novel web application for haplotype visualization and pedigree drawing. HaploForge takes advantage of HTML5 to be fast, portable and avoid the need for local installation. It can accurately visualize autosomal and X-linked haplotypes from both outbred and consanguineous pedigrees. Haplotypes are coloured based on identity by descent using a novel A* search algorithm and we provide a flexible viewing mode to aid visual inspection. HaploForge can currently process haplotype reconstruction output from Allegro, GeneHunter, Merlin and Simwalk. HaploForge is licensed under GPLv3 and is hosted and maintained via GitHub. https://github.com/mtekman/haploforge. r.kleta@ucl.ac.uk. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Development of a spreadsheet for SNPs typing using Microsoft EXCEL.
Hashiyada, Masaki; Itakura, Yukio; Takahashi, Shirushi; Sakai, Jun; Funayama, Masato
2009-04-01
Single-nucleotide polymorphisms (SNPs) have some characteristics that make them very appropriate for forensic studies and applications. In our institute, SNPs typings were performed by the TaqMan SNP Genotyping Assays using the ABI PRISM 7500 FAST Real-Time PCR System (AppliedBiosystems) and Sequence Detection Software ver.1.4 (AppliedBiosystem). The TaqMan method was desired two positive control (Allele1 and 2) and one negative control to analyze each SNP locus. Therefore, it can be analyzed up to 24 loci of a person on a 96-well-plate at the same time. If SNPs analysis is expected to apply to biometrics authentication, 48 and over loci are required to identify a person. In this study, we designed a spreadsheet package using Microsoft EXCEL, and population data were used from our 120 SNPs population studies. On the spreadsheet, we defined SNP types using 'template files' instead of positive and negative controls. "Template files" consisted of the results of 94 unknown samples and two negative controls of each of 120 SNPs loci we had previously studied. By the use of the files, the spreadsheet could analyze 96 SNPs on a 96-wells-plate simultaneously.
Okpechi, Ikechi G.; Rayner, Brian L.; van der Merwe, Lize; Mayosi, Bongani M.; Adeyemo, Adebowale; Tiffin, Nicki; Ramesar, Rajkumar
2010-01-01
Background Chronic kidney disease (CKD) is a significant public health problem that leads to end-stage renal disease (ESRD) with as many as 2 million people predicted to need therapy worldwide by 2010. Obesity is a risk factor for CKD and leptin, the obesity hormone, correlates with body fat mass and markers of renal function. A number of clinical and experimental studies have suggested a link between serum leptin and kidney disease. We hypothesised that variants in the leptin gene (LEP) may be associated with markers of CKD in indigenous black Africans. Methodology/Principal Findings Black South Africans of Xhosa (distinct cultural Bantu-speaking population) descent were recruited for the study and four common polymorphisms of the LEP (rs7799039, rs791620, rs2167270 and STS-U43653 [ENSSNP5824596]) were analysed for genotype and haplotype association with urine albumin-to-creatinine ratio (UACR), estimated glomerular filtration rate (eGFR), Serum creatinine (Scr) and serum leptin level. In one of the four single nucleotide polymorphisms (SNPs) we examined, an association with the renal phenotypes was observed. Hypertensive subjects with the T allele (CT genotype) of the ENSSNP5824596 SNP had a significantly higher eGFR (p = 0.0141), and significantly lower Scr (p = 0.0137). This was confirmed by haplotype analysis. Also, the haplotype GAAC had a modest effect on urine albumin-to-creatinine ratio in normotensive subjects (p = 0.0482). Conclusions/Significance These results suggest that genetic variations of the LEP may be associated with phenotypes that are markers of CKD in black Africans. PMID:20140086
Outcomes of methotrexate therapy for psoriasis and relationship to genetic polymorphisms.
Warren, R B; Smith, R L; Campalani, E; Eyre, S; Smith, C H; Barker, J N W N; Worthington, J; Griffiths, C E M
2009-02-01
The use of methotrexate is limited by interindividual variability in response. Previous studies in patients with either rheumatoid arthritis or psoriasis suggest that genetic variation across the methotrexate metabolic pathway might enable prediction of both efficacy and toxicity of the drug. To assess if single nucleotide polymorphisms (SNPs) across four genes that are relevant to methotrexate metabolism [folypolyglutamate synthase (FPGS), gamma-glutamyl hydrolase (GGH), methylenetetrahydrofolate reductase (MTHFR) and 5-aminoimidazole-4-carboxamide ribonucleotide transformylase (ATIC)] are related to treatment outcomes in patients with psoriasis. DNA was collected from 374 patients with psoriasis who had been treated with methotrexate. Data were available on individual outcomes to therapy, namely efficacy and toxicity. Haplotype-tagging SNPs (r(2) > 0.8) for the four genes with a minor allele frequency of > 5% were selected from the HAPMAP phase II data. Genotyping was undertaken using the MassARRAY spectrometric method (Sequenom). There were no significant associations detected between clinical outcomes in patients with psoriasis treated with methotrexate and SNPs in the four genes investigated. Genetic variation in four key genes relevant to the intracellular metabolism of methotrexate does not appear to predict response to methotrexate therapy in patients with psoriasis.
Population differentiation in allele frequencies of obesity-associated SNPs.
Mao, Linyong; Fang, Yayin; Campbell, Michael; Southerland, William M
2017-11-10
Obesity is emerging as a global health problem, with more than one-third of the world's adult population being overweight or obese. In this study, we investigated worldwide population differentiation in allele frequencies of obesity-associated SNPs (single nucleotide polymorphisms). We collected a total of 225 obesity-associated SNPs from a public database. Their population-level allele frequencies were derived based on the genotype data from 1000 Genomes Project (phase 3). We used hypergeometric model to assess whether the effect allele at a given SNP is significantly enriched or depleted in each of the 26 populations surveyed in the 1000 Genomes Project with respect to the overall pooled population. Our results indicate that 195 out of 225 SNPs (86.7%) possess effect alleles significantly enriched or depleted in at least one of the 26 populations. Populations within the same continental group exhibit similar allele enrichment/depletion patterns whereas inter-continental populations show distinct patterns. Among the 225 SNPs, 15 SNPs cluster in the first intron region of the FTO gene, which is a major gene associated with body-mass index (BMI) and fat mass. African populations exhibit much smaller blocks of LD (linkage disequilibrium) among these15 SNPs while European and Asian populations have larger blocks. To estimate the cumulative effect of all variants associated with obesity, we developed the personal composite genetic risk score for obesity. Our results indicate that the East Asian populations have the lowest averages of the composite risk scores, whereas three European populations have the highest averages. In addition, the population-level average of composite genetic risk scores is significantly correlated (R 2 = 0.35, P = 0.0060) with obesity prevalence. We have detected substantial population differentiation in allele frequencies of obesity-associated SNPs. The results will help elucidate the genetic basis which may contribute to population
A new mathematical modeling for pure parsimony haplotyping problem.
Feizabadi, R; Bagherian, M; Vaziri, H R; Salahi, M
2016-11-01
Pure parsimony haplotyping (PPH) problem is important in bioinformatics because rational haplotyping inference plays important roles in analysis of genetic data, mapping complex genetic diseases such as Alzheimer's disease, heart disorders and etc. Haplotypes and genotypes are m-length sequences. Although several integer programing models have already been presented for PPH problem, its NP-hardness characteristic resulted in ineffectiveness of those models facing the real instances especially instances with many heterozygous sites. In this paper, we assign a corresponding number to each haplotype and genotype and based on those numbers, we set a mixed integer programing model. Using numbers, instead of sequences, would lead to less complexity of the new model in comparison with previous models in a way that there are neither constraints nor variables corresponding to heterozygous nucleotide sites in it. Experimental results approve the efficiency of the new model in producing better solution in comparison to two state-of-the art haplotyping approaches. Copyright © 2016 Elsevier Inc. All rights reserved.
A laboratory evaluation of tagging-related mortality and tag loss in juvenile humpback chub
Ward, David L.; Persons, William R.; Young, Kirk; Stone, Dennis M.; Van Haverbeke, Randy; Knight, William R.
2015-01-01
We quantified tag retention, survival, and growth in juvenile, captive-reared Humpback Chub Gila cypha marked with three different tag types: (1) Biomark 12.5-mm, 134.2-kHz, full duplex PIT tags injected into the body cavity with a 12-gauge needle; (2) Biomark 8.4-mm, 134.2-kHz, full duplex PIT tags injected with a 16-gauge needle; and (3) Northwest Marine Technology visible implant elastomer (VIE) tags injected under the skin with a 29-gauge needle. Estimates of tag loss, tagging-induced mortality, and growth were evaluated for 60 d with each tag type for four different size-groups of fish: 40–49 mm, 50–59 mm, 60–69 mm, and 70–79 mm TL. Total length was a significant predictor of the probability of PIT tag retention and mortality for both 8-mm and 12-mm PIT tags, and the smallest fish had the highest rates of tag loss (12.5–30.0%) and mortality (7.5–20.0%). Humpback Chub of sizes 40–49 mm TL and tagged with VIE tags had no mortality but did have a 17.5% tag loss. Growth rates of all tagged fish were similar to controls. Our data indicate Humpback Chub can be effectively tagged using either 8-mm or 12-mm PIT tags with little tag loss or mortality at sizes as low as 65 mm TL.
Haplotype assembly in polyploid genomes and identical by descent shared tracts.
Aguiar, Derek; Istrail, Sorin
2013-07-01
Genome-wide haplotype reconstruction from sequence data, or haplotype assembly, is at the center of major challenges in molecular biology and life sciences. For complex eukaryotic organisms like humans, the genome is vast and the population samples are growing so rapidly that algorithms processing high-throughput sequencing data must scale favorably in terms of both accuracy and computational efficiency. Furthermore, current models and methodologies for haplotype assembly (i) do not consider individuals sharing haplotypes jointly, which reduces the size and accuracy of assembled haplotypes, and (ii) are unable to model genomes having more than two sets of homologous chromosomes (polyploidy). Polyploid organisms are increasingly becoming the target of many research groups interested in the genomics of disease, phylogenetics, botany and evolution but there is an absence of theory and methods for polyploid haplotype reconstruction. In this work, we present a number of results, extensions and generalizations of compass graphs and our HapCompass framework. We prove the theoretical complexity of two haplotype assembly optimizations, thereby motivating the use of heuristics. Furthermore, we present graph theory-based algorithms for the problem of haplotype assembly using our previously developed HapCompass framework for (i) novel implementations of haplotype assembly optimizations (minimum error correction), (ii) assembly of a pair of individuals sharing a haplotype tract identical by descent and (iii) assembly of polyploid genomes. We evaluate our methods on 1000 Genomes Project, Pacific Biosciences and simulated sequence data. HapCompass is available for download at http://www.brown.edu/Research/Istrail_Lab/. Supplementary data are available at Bioinformatics online.
Identification of SNPs associated with variola virus virulence
2013-01-01
Background Decades after the eradication of smallpox, its etiological agent, variola virus (VARV), remains a threat as a potential bioweapon. Outbreaks of smallpox around the time of the global eradication effort exhibited variable case fatality rates (CFRs), likely attributable in part to complex viral genetic determinants of smallpox virulence. We aimed to identify genome-wide single nucleotide polymorphisms associated with CFR. We evaluated unadjusted and outbreak geographic location-adjusted models of single SNPs and two- and three-way interactions between SNPs. Findings Using the data mining approach multifactor dimensionality reduction (MDR), we identified five VARV SNPs in models significantly associated with CFR. The top performing unadjusted model and adjusted models both revealed the same two-way gene-gene interaction. We discuss the biological plausibility of the influence of the SNPs identified these and other significant models on the strain-specific virulence of VARV. Conclusions We have identified genetic loci in the VARV genome that are statistically associated with VARV virulence as measured by CFR. While our ability to infer a causal relationship between the specific SNPs identified in our analysis and VARV virulence is limited, our results suggest that smallpox severity is in part associated with VARV strain variation and that VARV virulence may be determined by multiple genetic loci. This study represents the first application of MDR to the identification of pathogen gene-gene interactions for predicting infectious disease outbreak severity. PMID:23410064
Hooton, Henri; Dubern, Beatrice; Henegar, Corneliu; Paternoster, Lavinia; Nohr, Ellen A; Alili, Rohia; Rousseau, Francis; Pelloux, Veronique; Galan, Pilar; Hercberg, Serge; Arner, Peter; Sørensen, Thorkild I A; Clément, Karine
2011-01-01
Cystatin C, a protein coded by CST3 gene, is implicated in adipose tissue biology. Our hypothesis is that common variants in CST3 gene could play a role in the development of corpulence during lifetime. Two tag SNPs were selected to capture all SNPs in the CST3 region. We first investigated the association of the two tag SNPs individually and combined into haplotypes with corpulence related phenotypes in 4,288 French subjects (BMI = 24.31 ( 3.74 kg/m²). Significant findings were replicated in five independent populations--790 Danish lean men (BMI = 24.63 ( 2.30 kg/m²), 672 Danish obese men (BMI = 33.23 ( 2.34 kg/m²), 763 Swedish women (BMI = 21.73 ( 2.87 kg/m²), 1,848 Danish lean women (BMI = 22.66 ( 2.85 kg/m²) and 2,061 Danish obese women (BMI = 37.01 ( 3.59 kg/m²). Rs2424577 was associated with BMI in three independent populations--G/G carriers were less corpulent than A/A carriers in the French individuals (p = 0.045) and in the Danish lean men (p = 0.021), and they were more corpulent in the group of Swedish women (p = 0.004). This phenomenon has been described as a flip-flop phenomenon, probably caused by a multilocus effect. CST3 rs2424577 is associated with BMI in a complex fashion. This association is probably caused by the interaction between several functional variants. Copyright © 2011 S. Karger AG, Basel.
Das, Manuj K; Chetry, Sumi; Kalita, Mohan C; Dutta, Prafulla
2016-12-01
North-east region of India has consistent role in the spread of multi drug resistant Plasmodium (P.) falciparum to other parts of Southeast Asia. After rapid clinical treatment failure of Artemisinin based combination therapy-Sulphadoxine/Pyrimethamine (ACT-SP) chemoprophylaxis, Artemether-Lumefantrine (ACT-AL) combination therapy was introduced in the year 2012 in this region for the treatment of uncomplicated P. falciparum malaria. In a DNA sequencing based polymorphism analysis, seven codons of P. falciparum dihydropteroate synthetase ( Pf dhps) gene were screened in a total of 127 P. falciparum isolates collected from Assam, Arunachal Pradesh and Tripura of North-east India during the year 2014 and 2015 to document current sulfadoxine resistant haplotypes. Sequences were analyzed to rearrange both nucleotide and protein haplotypes. Molecular diversity indices were analyzed in DNA Sequence Polymorphism software (DnaSP) on the basis of Pf dhps gene sequences. Disappearance from selective neutrality was assessed based on the ratio of non-synonomous to synonomous nucleotide substitutions [dN/dS ratio]. Moreover, two-tailed Z test was performed in search of the significance for probability of rejecting null hypothesis of strict neutrality [dN = dS]. Presence of mutant P. falciparum multidrug resistance protein1 ( Pf mdr1) was also checked in those isolates that were present with new Pf dhps haplotypes. Phylogenetic relationship based on Pf dhps gene was reconstructed in Molecular Evolutionary Genetics Analysis (MEGA). Among eight different sulfadoxine resistant haplotypes found, IS GNG A haplotype was documented in a total of five isolates from Tripura with association of a new mutant M538 R allele. Sequence analysis of Pf mdr1 gene in these five isolates came to notice that not all but only one isolate was mutant at codon 86 (N86 Y ; Y YSND) in the multidrug resistance protein. Molecular diversity based on Pf dhps haplotypes revealed that P. falciparum
Assessment of PIT tag retention and post-tagging survival in metamorphosing juvenile Sea Lamprey
Simard, Lee G.; Sotola, V. Alex; Marsden, J. Ellen; Miehls, Scott M.
2017-01-01
Background: Passive integrated transponder (PIT) tags have been used to document and monitor the movement or behavior of numerous species of fishes. Data on short-term and long-term survival and tag retention are needed before initiating studies using PIT tags on a new species or life stage. We evaluated the survival and tag retention of 153 metamorphosing juvenile Sea Lamprey Petromyzon marinus tagged with 12 mm PIT tags on three occasions using a simple surgical procedure. Results: Tag retention was 100% and 98.6% at 24 h and 28-105 d post-tagging. Of the lamprey that retained their tags, 87.3% had incisions sufficiently healed to prevent further loss. Survival was 100% and 92.7% at 24 h and 41-118 d post-tagging with no significant difference in survival between tagged and untagged control lamprey. Of the 11 lamprey that died, four had symptoms that indicated their death was directly related to tagging. Survival was positively correlated with Sea Lamprey length. Conclusions: Given the overall high level of survival and tag retention in this study, future studies can utilize 12 mm PIT tags to monitor metamorphosing juvenile Sea Lamprey movement and migration patterns.
Meadows, J R S; Kijas, J W
2009-02-01
The male-specific region of the ovine Y chromosome (MSY) remains poorly characterized, yet sequence variants from this region have the potential to reveal the wild progenitor of domestic sheep or examples of domestic and wild paternal introgression. The 5' promoter region of the sex-determining gene SRY was re-sequenced using a subset of wild sheep including bighorn (Ovis canadensis), thinhorn (Ovis dalli spp.), urial (Ovis vignei), argali (Ovis ammon), mouflon (Ovis musimon) and domestic sheep (Ovis aries). Seven novel SNPs (oY2-oY8) were revealed; these were polymorphic between but not within species. Re-sequencing and fragment analysis was applied to the MSY microsatellite SRYM18. It contains a complex compound repeat structure and sequencing of three novel size fragments revealed that a pentanucleotide element remained fixed, whilst a dinucleotide element displayed variability within species. Comparison of the sequence between species revealed that urial and argali sheep grouped more closely to the mouflon and domestic breeds than the pachyceriforms (bighorn and thinhorn). SNP and microsatellite data were combined to define six previously undetected haplotypes. Analysis revealed the mouflon as the only species to share a haplotype with domestic sheep, consistent with its status as a feral domesticate that has undergone male-mediated exchange with domestic animals. A comparison of the remaining wild species and domestic sheep revealed that O. aries is free from signatures of wild sheep introgression.
Kawamura, Yoshiya; Liu, Xiaoxi; Akiyama, Tsuyoshi; Shimada, Takafumi; Otowa, Takeshi; Sakai, Yoshie; Kakiuchi, Chihiro; Umekage, Tadashi; Sasaki, Tsukasa; Akiskal, Hagop S
2010-12-01
Oxytocin is associated with social interaction, trust, and affectivity. Affective temperaments are traits based on Kraepelin's typological definition of the "fundamental states" of manic-depressive illness. These states can be measured by the Temperament Evaluation of Memphis, Pisa, Paris and San Diego-Autoquestionnaire version (TEMPS-A). The objective of this study is to assess the association between oxytocin receptor gene (OXTR) polymorphisms and affective temperaments. Participants consisted of 493 genetically unrelated, non-clinical Japanese subjects (307 males and 186 females). The Mini-International Neuropsychiatric Interview (MINI) was used to screen and exclude those who had a lifetime diagnosis of schizophrenia or other psychotic disorders. Fifteen OXTR tag single nucleotide polymorphisms (SNPs) were genotyped using TaqMan® or direct sequencing. The Haploview 4.1. software determined the haplotype block structure. Haplotype-based quantitative trait association analysis with Bonferroni correction using PLINK 1.06 software was used to assess the association between haplotypes and the following affective temperaments: depressive, cyclothymic, hyperthymic, irritable, and anxious. Two haplotype blocks were identified on the OXTR. The depressive temperament was significantly associated with the most frequent haplotype GGGTGTC (rs11131149/rs2243370/rs2243369/rs13316193/rs2254298/rs2268493/rs2268491) (corrected P<0.05). This study consisted of participants from a corporation and the effect sizes were small. The findings suggest that an OXTR haplotype is associated with a discrete depressive temperament. Clarification of the biological basis of this temperamental trait may help to elucidate the pathophysiology of depressive disorder. Copyright © 2010 Elsevier B.V. All rights reserved.
Au, Anthony; Aziz Baba, Abdul; Goh, Ai Sim; Wahid Fadilah, S Abdul; Teh, Alan; Rosline, Hassan; Ankathil, Ravindran
2014-04-01
The introduction and success of imatinib mesylate (IM) has become a paradigm shift in chronic myeloid leukemia (CML) treatment. However, the high efficacy of IM has been hampered by the issue of clinical resistance that might due to pharmacogenetic variability. In the current study, the contribution of three common single nucleotide polymorphisms (SNPs) of ABCB1 (T1236C, G2677T/A and C3435T) and two SNPs of ABCG2 (G34A and C421A) genes in mediating resistance and/or good response among 215 CML patients on IM therapy were investigated. Among these patients, the frequency distribution of ABCG2 421 CC, CA and AA genotypes were significantly different between IM good response and resistant groups (P=0.01). Resistance was significantly associated with patients who had homozygous ABCB1 1236 CC genotype with OR 2.79 (95%CI: 1.217-6.374, P=0.01). For ABCB1 G2677T/A polymorphism, a better complete cytogenetic remission was observed for patients with variant TT/AT/AA genotype, compared to other genotype groups (OR=0.48, 95%CI: 0.239-0.957, P=0.03). Haplotype analysis revealed that ABCB1 haplotypes (C1236G2677C3435) was statistically linked to higher risk to IM resistance (25.8% vs. 17.4%, P=0.04), while ABCG2 diplotype A34A421 was significantly correlated with IM good response (9.1% vs. 3.9%, P=0.03). In addition, genotypic variant in ABCG2 421C>A was associated with a major molecular response (MMR) (OR=2.20, 95%CI: 1.273-3.811, P=0.004), whereas ABCB1 2677G>T/A variant was associated with a significantly lower molecular response (OR=0.49, 95%CI: 0.248-0.974, P=0.04). However, there was no significant correlation of these SNPs with IM intolerance and IM induced hepatotoxicity. Our results suggest the usefulness of genotyping of these single nucleotide polymorphisms in predicting IM response among CML patients. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Localization of Allotetraploid Gossypium SNPs Using Physical Mapping Resources
USDA-ARS?s Scientific Manuscript database
Recent efforts in Gossypium SNP development have produced thousands of putative SNPs for G. barbadense, G. mustelinum, and G. tomentosum relative to G. hirsutum. Here we report on current efforts to localize putative SNPs using physical mapping resources. Recent advances in physical mapping resour...
Zou, Linhu; Liu, Baozhong
2015-04-01
Serum amyloid A (SAA), an acute response protein as well as an apolipoprotein, is considered to play crucial roles in both innate immunity and lipid metabolism. In this study, a SAA gene (MmSAA) was identified in the clam Meretrix meretrix. The full length DNA of MmSAA was 1407bp, consisting of three exons and two introns. The distribution of MmSAA in clam tissues was examined with the highest expression in hepatopancreas. In response to the Vibrio parahaemolyticus challenge, MmSAA mRNA showed significantly higher expression at 24 h post-challenge in experimental clams (P < 0.05). Forty-eight single nucleotide polymorphisms (SNPs) in the DNA partial sequence of MmSAA were discovered and examined for their association with Vibrio-resistance and growth traits, respectively. The single SNP association analysis indicated that five single SNPs (g.42, g.72, g.82, g.147 and g.165) were significantly associated with Vibrio-resistance (P < 0.05). Haplotype analysis produced additional support for association with the Chi-square values 6.393 (P = 0.012). Among the five selected SNPs, the effect of a missense mutation (g.82, A → G) was detected by site-directed mutagenesis with fusion expression of protein assay, and the result showed that the recombinant plasmids containing wild-type pET30a-MmSAA had more inhibition effect than the mutant ones on the growth rate of the host bacteria. In addition, four growth traits of the clams in 09G3SPSB population were recorded and the SNP g.176 was found to be significantly associated with the growth traits with the Global score value 0.790 (P = 0.015). Our findings suggested that common genetic variation in MmSAA might contribute to the risk of susceptibility to Vibrio infection and might be associated with the growth traits in the clams M. meretrix, and more works are still needed to validate these SNPs as potential markers for actual selective breeding. Copyright © 2015 Elsevier Ltd. All rights reserved.
Mineralocorticoid receptor haplotype, oral contraceptives and emotional information processing.
Hamstra, D A; de Kloet, E R; van Hemert, A M; de Rijk, R H; Van der Does, A J W
2015-02-12
Oral contraceptives (OCs) affect mood in some women and may have more subtle effects on emotional information processing in many more users. Female carriers of mineralocorticoid receptor (MR) haplotype 2 have been shown to be more optimistic and less vulnerable to depression. To investigate the effects of oral contraceptives on emotional information processing and a possible moderating effect of MR haplotype. Cross-sectional study in 85 healthy premenopausal women of West-European descent. We found significant main effects of oral contraceptives on facial expression recognition, emotional memory and decision-making. Furthermore, carriers of MR haplotype 1 or 3 were sensitive to the impact of OCs on the recognition of sad and fearful faces and on emotional memory, whereas MR haplotype 2 carriers were not. Different compounds of OCs were included. No hormonal measures were taken. Most naturally cycling participants were assessed in the luteal phase of their menstrual cycle. Carriers of MR haplotype 2 may be less sensitive to depressogenic side-effects of OCs. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Genetic variants of CD209 associated with Kawasaki disease susceptibility.
Kuo, Ho-Chang; Huang, Ying-Hsien; Chien, Shu-Chen; Yu, Hong-Ren; Hsieh, Kai-Sheng; Hsu, Yu-Wen; Chang, Wei-Chiao
2014-01-01
Kawasaki disease (KD) is a systemic vasculitis with unknown etiology mainly affecting children in Asian countries. Dendritic cell-specific intercellular adhesion molecule-3 grabbing non-integrin (DC-SIGN, CD209) in humans was showed to trigger an anti-inflammatory cascade and associated with KD susceptibility. This study was conducted to investigate the association between genetic polymorphisms of CD209 and the risk KD. A total of 948 subjects (381 KD and 567 controls) were recruited. Nine tagging SNPs (rs8112310, rs4804800, rs11465421, rs1544766, rs4804801, rs2287886, rs735239, rs735240, rs4804804) were selected for TaqMan allelic discrimination assay. Clinical phenotypes, coronary artery lesions (CAL) and intravenous immunoglobulin (IVIG) treatment outcomes were collected for analysis. Significant associations were found between CD209 polymorphisms (rs4804800, rs2287886, rs735240) and the risk of KD. Haplotype analysis for CD209 polymorphisms showed that A/A/G haplotype (P = 0.0002, OR = 1.61) and G/A/G haplotype (P = 0.0365, OR = 1.52) had higher risk of KD as compared with G/G/A haplotype in rs2287886/rs735239/rs735240 pairwise allele analysis. There were no significant association in KD with regards to CAL formation and IVIG treatment responses. CD209 polymorphisms were responsible for the susceptibility of KD, but not CAL formation and IVIG treatment responsiveness.
Peng, Xian-E; Wu, Yun-Li; Lin, Shao-Wei; Lu, Qing-Qing; Hu, Zhi-Jian; Lin, Xu
2012-01-01
We investigated the possible association between genetic variants in the Patatin like phospholipase-3 (PNPLA3) gene and nonalcoholic fatty liver disease (NAFLD) in a Han Chinese population. We evaluated twelve tagging single-nucleotide polymorphisms (tSNPs) of the PNPLA3 gene in a frequency matched case-control study from Fuzhou city of China (553 cases, 553 controls). In the multivariate logistic regression analysis, the rs738409 GG or GC, and rs139051 TT genotypes were found to be associated with increased risk of NAFLD, and a significant trend of increased risk with increasing numbers of risk genotype was observed in the cumulative effect analysis of these single nucleotide polymorphisms. Furthermore, haplotype association analysis showed that, compared with the most common haplotype, the CAAGAATGCGTG and CGAAGGTGTCCG haplotypes conferred a statistically significant increased risk for NAFLD, while the CGGGAACCCGCG haplotype decreased the risk of NAFLD. Moreover, rs738409 C>G appeared to have a multiplicative joint effect with tea drinking (P<0.005) and an additive joint effect with obesity (Interaction contrast ratio (ICR) = 2.31, 95% CI: 0.7-8.86), hypertriglyceridemia (ICR = 3.07, 95% CI: 0.98-5.09) or hypertension (ICR = 1.74, 95% CI: 0.52-3.12). Our data suggests that PNPLA3 genetic polymorphisms might influence the susceptibility to NAFLD development independently or jointly in Han Chinese.
Ultraaccurate genome sequencing and haplotyping of single human cells.
Chu, Wai Keung; Edge, Peter; Lee, Ho Suk; Bansal, Vikas; Bafna, Vineet; Huang, Xiaohua; Zhang, Kun
2017-11-21
Accurate detection of variants and long-range haplotypes in genomes of single human cells remains very challenging. Common approaches require extensive in vitro amplification of genomes of individual cells using DNA polymerases and high-throughput short-read DNA sequencing. These approaches have two notable drawbacks. First, polymerase replication errors could generate tens of thousands of false-positive calls per genome. Second, relatively short sequence reads contain little to no haplotype information. Here we report a method, which is dubbed SISSOR (single-stranded sequencing using microfluidic reactors), for accurate single-cell genome sequencing and haplotyping. A microfluidic processor is used to separate the Watson and Crick strands of the double-stranded chromosomal DNA in a single cell and to randomly partition megabase-size DNA strands into multiple nanoliter compartments for amplification and construction of barcoded libraries for sequencing. The separation and partitioning of large single-stranded DNA fragments of the homologous chromosome pairs allows for the independent sequencing of each of the complementary and homologous strands. This enables the assembly of long haplotypes and reduction of sequence errors by using the redundant sequence information and haplotype-based error removal. We demonstrated the ability to sequence single-cell genomes with error rates as low as 10 -8 and average 500-kb-long DNA fragments that can be assembled into haplotype contigs with N50 greater than 7 Mb. The performance could be further improved with more uniform amplification and more accurate sequence alignment. The ability to obtain accurate genome sequences and haplotype information from single cells will enable applications of genome sequencing for diverse clinical needs. Copyright © 2017 the Author(s). Published by PNAS.
Impact of SNPs on Protein Phosphorylation Status in Rice (Oryza sativa L.).
Lin, Shoukai; Chen, Lijuan; Tao, Huan; Huang, Jian; Xu, Chaoqun; Li, Lin; Ma, Shiwei; Tian, Tian; Liu, Wei; Xue, Lichun; Ai, Yufang; He, Huaqin
2016-11-11
Single nucleotide polymorphisms (SNPs) are widely used in functional genomics and genetics research work. The high-quality sequence of rice genome has provided a genome-wide SNP and proteome resource. However, the impact of SNPs on protein phosphorylation status in rice is not fully understood. In this paper, we firstly updated rice SNP resource based on the new rice genome Ver. 7.0, then systematically analyzed the potential impact of Non-synonymous SNPs (nsSNPs) on the protein phosphorylation status. There were 3,897,312 SNPs in Ver. 7.0 rice genome, among which 9.9% was nsSNPs. Whilst, a total 2,508,261 phosphorylated sites were predicted in rice proteome. Interestingly, we observed that 150,197 (39.1%) nsSNPs could influence protein phosphorylation status, among which 52.2% might induce changes of protein kinase (PK) types for adjacent phosphorylation sites. We constructed a database, SNP_rice, to deposit the updated rice SNP resource and phosSNPs information. It was freely available to academic researchers at http://bioinformatics.fafu.edu.cn. As a case study, we detected five nsSNPs that potentially influenced heterotrimeric G proteins phosphorylation status in rice, indicating that genetic polymorphisms showed impact on the signal transduction by influencing the phosphorylation status of heterotrimeric G proteins. The results in this work could be a useful resource for future experimental identification and provide interesting information for better rice breeding.
Screening and Evaluation of Deleterious SNPs in APOE Gene of Alzheimer's Disease.
Masoodi, Tariq Ahmad; Al Shammari, Sulaiman A; Al-Muammar, May N; Alhamdan, Adel A
2012-01-01
Introduction. Apolipoprotein E (APOE) is an important risk factor for Alzheimer's disease (AD) and is present in 30-50% of patients who develop late-onset AD. Several single-nucleotide polymorphisms (SNPs) are present in APOE gene which act as the biomarkers for exploring the genetic basis of this disease. The objective of this study is to identify deleterious nsSNPs associated with APOE gene. Methods. The SNPs were retrieved from dbSNP. Using I-Mutant, protein stability change was calculated. The potentially functional nonsynonymous (ns) SNPs and their effect on protein was predicted by PolyPhen and SIFT, respectively. FASTSNP was used for functional analysis and estimation of risk score. The functional impact on the APOE protein was evaluated by using Swiss PDB viewer and NOMAD-Ref server. Results. Six nsSNPs were found to be least stable by I-Mutant 2.0 with DDG value of >-1.0. Four nsSNPs showed a highly deleterious tolerance index score of 0.00. Nine nsSNPs were found to be probably damaging with position-specific independent counts (PSICs) score of ≥2.0. Seven nsSNPs were found to be highly polymorphic with a risk score of 3-4. The total energies and root-mean-square deviation (RMSD) values were higher for three mutant-type structures compared to the native modeled structure. Conclusion. We concluded that three nsSNPs, namely, rs11542041, rs11542040, and rs11542034, to be potentially functional polymorphic.
Haplotype Phasing and Inheritance of Copy Number Variants in Nuclear Families
Palta, Priit; Kaplinski, Lauris; Nagirnaja, Liina; Veidenberg, Andres; Möls, Märt; Nelis, Mari; Esko, Tõnu; Metspalu, Andres; Laan, Maris; Remm, Maido
2015-01-01
DNA copy number variants (CNVs) that alter the copy number of a particular DNA segment in the genome play an important role in human phenotypic variability and disease susceptibility. A number of CNVs overlapping with genes have been shown to confer risk to a variety of human diseases thus highlighting the relevance of addressing the variability of CNVs at a higher resolution. So far, it has not been possible to deterministically infer the allelic composition of different haplotypes present within the CNV regions. We have developed a novel computational method, called PiCNV, which enables to resolve the haplotype sequence composition within CNV regions in nuclear families based on SNP genotyping microarray data. The algorithm allows to i) phase normal and CNV-carrying haplotypes in the copy number variable regions, ii) resolve the allelic copies of rearranged DNA sequence within the haplotypes and iii) infer the heritability of identified haplotypes in trios or larger nuclear families. To our knowledge this is the first program available that can deterministically phase null, mono-, di-, tri- and tetraploid genotypes in CNV loci. We applied our method to study the composition and inheritance of haplotypes in CNV regions of 30 HapMap Yoruban trios and 34 Estonian families. For 93.6% of the CNV loci, PiCNV enabled to unambiguously phase normal and CNV-carrying haplotypes and follow their transmission in the corresponding families. Furthermore, allelic composition analysis identified the co-occurrence of alternative allelic copies within 66.7% of haplotypes carrying copy number gains. We also observed less frequent transmission of CNV-carrying haplotypes from parents to children compared to normal haplotypes and identified an emergence of several de novo deletions and duplications in the offspring. PMID:25853576
Haplotype phasing and inheritance of copy number variants in nuclear families.
Palta, Priit; Kaplinski, Lauris; Nagirnaja, Liina; Veidenberg, Andres; Möls, Märt; Nelis, Mari; Esko, Tõnu; Metspalu, Andres; Laan, Maris; Remm, Maido
2015-01-01
DNA copy number variants (CNVs) that alter the copy number of a particular DNA segment in the genome play an important role in human phenotypic variability and disease susceptibility. A number of CNVs overlapping with genes have been shown to confer risk to a variety of human diseases thus highlighting the relevance of addressing the variability of CNVs at a higher resolution. So far, it has not been possible to deterministically infer the allelic composition of different haplotypes present within the CNV regions. We have developed a novel computational method, called PiCNV, which enables to resolve the haplotype sequence composition within CNV regions in nuclear families based on SNP genotyping microarray data. The algorithm allows to i) phase normal and CNV-carrying haplotypes in the copy number variable regions, ii) resolve the allelic copies of rearranged DNA sequence within the haplotypes and iii) infer the heritability of identified haplotypes in trios or larger nuclear families. To our knowledge this is the first program available that can deterministically phase null, mono-, di-, tri- and tetraploid genotypes in CNV loci. We applied our method to study the composition and inheritance of haplotypes in CNV regions of 30 HapMap Yoruban trios and 34 Estonian families. For 93.6% of the CNV loci, PiCNV enabled to unambiguously phase normal and CNV-carrying haplotypes and follow their transmission in the corresponding families. Furthermore, allelic composition analysis identified the co-occurrence of alternative allelic copies within 66.7% of haplotypes carrying copy number gains. We also observed less frequent transmission of CNV-carrying haplotypes from parents to children compared to normal haplotypes and identified an emergence of several de novo deletions and duplications in the offspring.
McCreary, Brome
2008-01-01
The following video demonstrates a procedure to insert a passive integrated transponder (PIT) tag under the skin of an anuran (frog or toad) for research and monitoring purposes. Typically, a 12.5 mm tag (0.5 in.) is used to uniquely identify individual anurans as smal as 40 mm (1.6 in.) in length from snout to vent. Smaller tags are also available and allow smaller anurans to be tagged. The procedure does not differ for other sizes of tages or other sizes of anurans. Anyone using this procedure should ensure that the tag is small enough to fit easily behind the sacral hump of the anuran, as shown in this video.
Mineralocorticoid receptor haplotype, estradiol, progesterone and emotional information processing.
Hamstra, Danielle A; de Kloet, E Ronald; Quataert, Ina; Jansen, Myrthe; Van der Does, Willem
2017-02-01
Carriers of MR-haplotype 1 and 3 (GA/CG; rs5522 and rs2070951) are more sensitive to the influence of oral contraceptives (OC) and menstrual cycle phase on emotional information processing than MR-haplotype 2 (CA) carriers. We investigated whether this effect is associated with estradiol (E2) and/or progesterone (P4) levels. Healthy MR-genotyped premenopausal women were tested twice in a counterbalanced design. Naturally cycling (NC) women were tested in the early-follicular and mid-luteal phase and OC-users during OC-intake and in the pill-free week. At both sessions E2 and P4 were assessed in saliva. Tests included implicit and explicit positive and negative affect, attentional blink accuracy, emotional memory, emotion recognition, and risky decision-making (gambling). MR-haplotype 2 homozygotes had higher implicit happiness scores than MR-haplotype 2 heterozygotes (p=0.031) and MR-haplotype 1/3 carriers (p<0.001). MR-haplotype 2 homozygotes also had longer reaction times to happy faces in an emotion recognition test than MR-haplotype 1/3 (p=0.001). Practice effects were observed for most measures. The pattern of correlations between information processing and P4 or E2 differed between sessions, as well as the moderating effects of the MR genotype. In the first session the MR-genotype moderated the influence of P4 on implicit anxiety (sr=-0.30; p=0.005): higher P4 was associated with reduction in implicit anxiety, but only in MR-haplotype 2 homozygotes (sr=-0.61; p=0.012). In the second session the MR-genotype moderated the influence of E2 on the recognition of facial expressions of happiness (sr=-0.21; p=0.035): only in MR-haplotype 1/3 higher E2 was correlated with happiness recognition (sr=0.29; p=0.005). In the second session higher E2 and P4 were negatively correlated with accuracy in lag2 trials of the attentional blink task (p<0.001). Thus NC women, compared to OC-users, performed worse on lag 2 trials (p=0.041). The higher implicit happiness scores of MR-haplotype
Development of RAP Tag, a Novel Tagging System for Protein Detection and Purification.
Fujii, Yuki; Kaneko, Mika K; Ogasawara, Satoshi; Yamada, Shinji; Yanaka, Miyuki; Nakamura, Takuro; Saidoh, Noriko; Yoshida, Kanae; Honma, Ryusuke; Kato, Yukinari
2017-04-01
Affinity tag systems, possessing high affinity and specificity, are useful for protein detection and purification. The most suitable tag for a particular purpose should be selected from many available affinity tag systems. In this study, we developed a novel affinity tag called the "RAP tag" system, which comprises a mouse antirat podoplanin monoclonal antibody (clone PMab-2) and the RAP tag (DMVNPGLEDRIE). This system is useful not only for protein detection in Western blotting, flow cytometry, and sandwich enzyme-linked immunosorbent assay, but also for protein purification.
ezTag: tagging biomedical concepts via interactive learning.
Kwon, Dongseop; Kim, Sun; Wei, Chih-Hsuan; Leaman, Robert; Lu, Zhiyong
2018-05-18
Recently, advanced text-mining techniques have been shown to speed up manual data curation by providing human annotators with automated pre-annotations generated by rules or machine learning models. Due to the limited training data available, however, current annotation systems primarily focus only on common concept types such as genes or diseases. To support annotating a wide variety of biological concepts with or without pre-existing training data, we developed ezTag, a web-based annotation tool that allows curators to perform annotation and provide training data with humans in the loop. ezTag supports both abstracts in PubMed and full-text articles in PubMed Central. It also provides lexicon-based concept tagging as well as the state-of-the-art pre-trained taggers such as TaggerOne, GNormPlus and tmVar. ezTag is freely available at http://eztag.bioqrator.org.
Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...
Genomic evolution in domestic cattle: ancestral haplotypes and healthy beef.
Williamson, Joseph F; Steele, Edward J; Lester, Susan; Kalai, Oscar; Millman, John A; Wolrige, Lindsay; Bayard, Dominic; McLure, Craig; Dawkins, Roger L
2011-05-01
We have identified numerous Ancestral Haplotypes encoding a 14-Mb region of Bota C19. Three are frequent in Simmental, Angus and Wagyu and have been conserved since common progenitor populations. Others are more relevant to the differences between these 3 breeds including fat content and distribution in muscle. SREBF1 and Growth Hormone, which have been implicated in the production of healthy beef, are included within these haplotypes. However, we conclude that alleles at these 2 loci are less important than other sequences within the haplotypes. Identification of breeds and hybrids is improved by using haplotypes rather than individual alleles. Copyright © 2010 Elsevier Inc. All rights reserved.
2013-10-01
identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year
Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.
Guerreiro, J F; Figueiredo, M S; Zago, M A
1994-01-01
We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.
Zámbó, Boglárka; Várady, György; Padányi, Rita; Szabó, Edit; Németh, Adrienn; Langó, Tamás; Enyedi, Ágnes; Sarkadi, Balázs
2017-07-01
Plasma membrane Ca 2+ -ATPases are key calcium exporter proteins in most tissues, and PMCA4b is the main calcium transporter in the human red blood cells (RBCs). In order to assess the expression level of PMCA4b, we have developed a flow cytometry and specific antibody binding method to quantitatively detect this protein in the erythrocyte membrane. Interestingly, we found several healthy volunteers showing significantly reduced expression of RBC-PMCA4b. Western blot analysis of isolated RBC membranes confirmed this observation, and indicated that there are no compensatory alterations in other PMCA isoforms. In addition, reduced PMCA4b levels correlated with a lower calcium extrusion capacity in these erythrocytes. When exploring the potential genetic background of the reduced PMCA4b levels, we found no missense mutations in the ATP2B4 coding regions, while a formerly unrecognized minor haplotype in the predicted second promoter region closely correlated with lower erythrocyte PMCA4b protein levels. In recent GWA studies, SNPs in this ATP2B4 haplotype have been linked to reduced mean corpuscular hemoglobin concentrations (MCHC), and to protection against malaria infection. Our data suggest that an altered regulation of gene expression is responsible for the reduced RBC-PMCA4b levels that is probably linked to the development of human disease-related phenotypes. Copyright © 2017 Elsevier Ltd. All rights reserved.
A spatial haplotype copying model with applications to genotype imputation.
Yang, Wen-Yun; Hormozdiari, Farhad; Eskin, Eleazar; Pasaniuc, Bogdan
2015-05-01
Ever since its introduction, the haplotype copy model has proven to be one of the most successful approaches for modeling genetic variation in human populations, with applications ranging from ancestry inference to genotype phasing and imputation. Motivated by coalescent theory, this approach assumes that any chromosome (haplotype) can be modeled as a mosaic of segments copied from a set of chromosomes sampled from the same population. At the core of the model is the assumption that any chromosome from the sample is equally likely to contribute a priori to the copying process. Motivated by recent works that model genetic variation in a geographic continuum, we propose a new spatial-aware haplotype copy model that jointly models geography and the haplotype copying process. We extend hidden Markov models of haplotype diversity such that at any given location, haplotypes that are closest in the genetic-geographic continuum map are a priori more likely to contribute to the copying process than distant ones. Through simulations starting from the 1000 Genomes data, we show that our model achieves superior accuracy in genotype imputation over the standard spatial-unaware haplotype copy model. In addition, we show the utility of our model in selecting a small personalized reference panel for imputation that leads to both improved accuracy as well as to a lower computational runtime than the standard approach. Finally, we show our proposed model can be used to localize individuals on the genetic-geographical map on the basis of their genotype data.
Singh, Kanhaiya; Agrawal, Neeraj K.; Gupta, Sanjeev K.
2013-01-01
The Toll-Like receptor 4 (TLR4) plays an important role in immunity, tissue repair, and regeneration. The objective of the present work was to evaluate the association of TLR4 single nucleotide polymorphisms (SNPs) rs4986790, rs4986791, rs11536858 (merged into rs10759931), rs1927911, and rs1927914 with increased diabetic foot ulcer (DFU) risk in patients with type 2 diabetes mellitus (T2DM). PCR-RFLP was used for genotyping TLR4 SNPs in 125 T2DM patients with DFU and 130 controls. The haplotypes and linkage disequilibrium between the SNPs were determined using Haploview software. Multivariate linear regression (MLR) and artificial neural network (ANN) modeling was done to observe their predictability for the risk of DFU in T2DM patients. Risk genotypes of all SNPs except rs1927914 were significantly associated with DFU. Haplotype ACATC (P value = 9.3E − 5) showed strong association with DFU risk. Two haplotypes ATATC (P value = 0.0119) and ATGTT (P value = 0.0087) were found to be protective against DFU. In conclusion TLR4 SNPs and their haplotypes may increase the risk of impairment of wound healing in T2DM patients. ANN model (83%) is found to be better than the MLR model (76%) and can be used as a tool for the DFU risk assessment in T2DM patients. PMID:23936790
Chen, Chao; Liu, Jingyi; Shi, Lewis L.; Wang, Yan
2013-01-01
Susceptibility to ankylosing spondylitis (AS) is largely genetically determined. JARID1A, JMY and PTGER4 have recently been found to be associated with AS in patients of western European descent. We aim to examine the influence of JARID1A, JMY, and PTGER4 polymorphisms on the susceptibility to and the severity of ankylosing spondylitis in Chinese ethnic majority Han population. This work can lead the clinical doctors to intervene earlier. Blood samples were drawn from 396 AS patients and 404 unrelated healthy controls. Both the AS patients and the controls are Han Chinese. The AS patients are classified based on the severity of the disease. Thirteen tag single nucleotide polymorphisms (tagSNPs) in JARID1A, JMY and PTGER4 are selected and genotyped. Frequencies of different genotypes and alleles are analyzed among the different severity AS patients and the controls. The rs2284336 SNP in JARID1A, the rs16876619 and rs16876657 SNPs in JMY are associated with susceptibility of AS. The rs11062357 SNP in JARID1A, the rs2607142 SNP in JMY and rs10440635 in PTGER4 are related to severity of AS. Haplotype analyses indicate PTGER4 is related to susceptibility to AS; JARID1A and JMY are related to severity of AS. PMID:24069348
Genotyping of 75 SNPs using arrays for individual identification in five population groups.
Hwa, Hsiao-Lin; Wu, Lawrence Shih Hsin; Lin, Chun-Yen; Huang, Tsun-Ying; Yin, Hsiang-I; Tseng, Li-Hui; Lee, James Chun-I
2016-01-01
Single nucleotide polymorphism (SNP) typing offers promise to forensic genetics. Various strategies and panels for analyzing SNP markers for individual identification have been published. However, the best panels with fewer identity SNPs for all major population groups are still under discussion. This study aimed to find more autosomal SNPs with high heterozygosity for individual identification among Asian populations. Ninety-six autosomal SNPs of 502 DNA samples from unrelated individuals of five population groups (208 Taiwanese Han, 83 Filipinos, 62 Thais, 69 Indonesians, and 80 individuals with European, Near Eastern, or South Asian ancestry) were analyzed using arrays in an initial screening, and 75 SNPs (group A, 46 newly selected SNPs; groups B, 29 SNPs based on a previous SNP panel) were selected for further statistical analyses. Some SNPs with high heterozygosity from Asian populations were identified. The combined random match probability of the best 40 and 45 SNPs was between 3.16 × 10(-17) and 7.75 × 10(-17) and between 2.33 × 10(-19) and 7.00 × 10(-19), respectively, in all five populations. These loci offer comparable power to short tandem repeats (STRs) for routine forensic profiling. In this study, we demonstrated the population genetic characteristics and forensic parameters of 75 SNPs with high heterozygosity from five population groups. This SNPs panel can provide valuable genotypic information and can be helpful in forensic casework for individual identification among these populations.
Inferring Alcoholism SNPs and Regulatory Chemical Compounds Based on Ensemble Bayesian Network.
Chen, Huan; Sun, Jiatong; Jiang, Hong; Wang, Xianyue; Wu, Lingxiang; Wu, Wei; Wang, Qh
2017-01-01
The disturbance of consciousness is one of the most common symptoms of those have alcoholism and may cause disability and mortality. Previous studies indicated that several single nucleotide polymorphisms (SNP) increase the susceptibility of alcoholism. In this study, we utilized the Ensemble Bayesian Network (EBN) method to identify causal SNPs of alcoholism based on the verified GAW14 data. We built a Bayesian network combining random process and greedy search by using Genetic Analysis Workshop 14 (GAW14) dataset to establish EBN of SNPs. Then we predicted the association between SNPs and alcoholism by determining Bayes' prior probability. Thirteen out of eighteen SNPs directly connected with alcoholism were found concordance with potential risk regions of alcoholism in OMIM database. As many SNPs were found contributing to alteration on gene expression, known as expression quantitative trait loci (eQTLs), we further sought to identify chemical compounds acting as regulators of alcoholism genes captured by causal SNPs. Chloroprene and valproic acid were identified as the expression regulators for genes C11orf66 and SALL3 which were captured by alcoholism SNPs, respectively. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Mathematical properties and bounds on haplotyping populations by pure parsimony.
Wang, I-Lin; Chang, Chia-Yuan
2011-06-01
Although the haplotype data can be used to analyze the function of DNA, due to the significant efforts required in collecting the haplotype data, usually the genotype data is collected and then the population haplotype inference (PHI) problem is solved to infer haplotype data from genotype data for a population. This paper investigates the PHI problem based on the pure parsimony criterion (HIPP), which seeks the minimum number of distinct haplotypes to infer a given genotype data. We analyze the mathematical structure and properties for the HIPP problem, propose techniques to reduce the given genotype data into an equivalent one of much smaller size, and analyze the relations of genotype data using a compatible graph. Based on the mathematical properties in the compatible graph, we propose a maximal clique heuristic to obtain an upper bound, and a new polynomial-sized integer linear programming formulation to obtain a lower bound for the HIPP problem. Copyright © 2011 Elsevier Inc. All rights reserved.
No association of dynamin binding protein (DNMBP) gene SNPs and Alzheimer's disease.
Minster, Ryan L; DeKosky, Steven T; Kamboh, M Ilyas
2008-10-01
A recent scan of single nucleotide polymorphisms (SNPs) on chromosome 10q found significant association of six correlated SNPs with late-onset Alzheimer's disease (AD) among Japanese. We examined the SNP with the highest statistical significance (rs3740058) in a large Caucasian American case-control cohort and the remaining five SNPs in a smaller subset of cases and controls. We observed no association of statistical significance in either the total sample or the APOE*4 non-carriers for any of the SNPs.
Bin, Ping; Leng, Shuguang; Liang, Xuemiao; Cheng, Juan
2007-11-01
To investigate the association of single nucleotide polymorphisms (SNPs) or haplotypes of aryl hydrocarbon receptor (AHR) gene and chromosomal damage in peripheral blood lymphocytes among coke-oven workers. Eighty-nine coke-oven workers exposed to a high level of polycyclic aromatic hydrocarbons (PAHs) and sixty non-exposed workers were selected as the study subjects. Urinary 1-hydroxypyrene (1-OHPyr) levels were measured as the internal dose of PAHs exposure. The chromosomal damage in peripheral lymphocyte was measured by the cytokinesis-block micronucleus (CBMN) assay. Two SNPs in AHR gene, including rs6960165, rs2282885 were detected by PCR-RFLP. The AHR haplotypes were estimated by Bayesian statistical method with the software of PHASE Version 2.1. The associations between SNPs or haplotypes pairs and CBMN were assessed by analysis of covariance in the coke-oven workers and non-exposed workers. The level of 1-OHPyr among coke-oven workers was significantly higher than that among non-exposed workers (P < 0.01). The CBMN among coke-oven workers was significantly higher than that among non-exposed workers (P < 0.01). After adjusting the age and the level of 1-OHPyr, the different SNPs of AHR gene rs6960165 in coke-oven workers were related to the CBMN frequencies (P = 0.014), but no association between the different SNPs of AHR gene rs2282885 and the rates of CBMN was observed in coke-oven workers (P = 0.586), either in the controls (P = 0.308 and P = 0.415, respectively), the haplotypes in coke-oven workers were significantly related to the rates of CBMN (P = 0.007), while there was no significant association in non-exposed workers (P = 0.768). Our results suggested that SNPs rs6960165 or haplotypes of AHR were associated with the CBMN frequencies in coke-oven workers.
Association of a NOD2 Gene Polymorphism and T-Helper 17 Cells With Presumed Ocular Toxoplasmosis
Dutra, Míriam S.; Béla, Samantha R.; Peixoto-Rangel, Alba L.; Fakiola, Michaela; Cruz, Ariane G.; Gazzinelli, Andrea; Quites, Humberto F.; Bahia-Oliveira, Lilian M. G.; Peixe, Ricardo G.; Campos, Wesley R.; Higino-Rocha, Anna C.; Miller, Nancy E.; Blackwell, Jenefer M.; Antonelli, Lis R.; Gazzinelli, Ricardo T.
2013-01-01
Retinochoroiditis manifests in patients infected with Toxoplasma gondii. Here, we assessed 30 sibships and 89 parent/case trios of presumed ocular toxoplasmosis (POT) to evaluate associations with polymorphisms in the NOD2 gene. Three haplotype-tagging single-nucleotide polymorphisms (tag-SNPs) within the NOD2 gene were genotyped. The family-based association test showed that the tag-SNP rs3135499 is associated with retinochoroiditis (P = .039). We then characterized the cellular immune response of 59 cases of POT and 4 cases of active ocular toxoplasmosis (AOT). We found no differences in levels of interferon γ (IFN-γ) and interleukin 2 produced by T-helper 1 cells when comparing patients with AOT or POT to asymptomatic individuals. Unexpectedly, we found an increased interleukin 17A (IL-17A) production in patients with POT or OAT. In patients with POT or AOT, the main cellular source of IL-17A was CD4+CD45RO+T-bet−IFN-γ− T-helper 17 cells. Altogether, our results suggest that NOD2 influences the production of IL-17A by CD4+ T lymphocytes and might contribute to the development of ocular toxoplasmosis. PMID:23100559
Association of a NOD2 gene polymorphism and T-helper 17 cells with presumed ocular toxoplasmosis.
Dutra, Míriam S; Béla, Samantha R; Peixoto-Rangel, Alba L; Fakiola, Michaela; Cruz, Ariane G; Gazzinelli, Andrea; Quites, Humberto F; Bahia-Oliveira, Lilian M G; Peixe, Ricardo G; Campos, Wesley R; Higino-Rocha, Anna C; Miller, Nancy E; Blackwell, Jenefer M; Antonelli, Lis R; Gazzinelli, Ricardo T
2013-01-01
Retinochoroiditis manifests in patients infected with Toxoplasma gondii. Here, we assessed 30 sibships and 89 parent/case trios of presumed ocular toxoplasmosis (POT) to evaluate associations with polymorphisms in the NOD2 gene. Three haplotype-tagging single-nucleotide polymorphisms (tag-SNPs) within the NOD2 gene were genotyped. The family-based association test showed that the tag-SNP rs3135499 is associated with retinochoroiditis (P = .039). We then characterized the cellular immune response of 59 cases of POT and 4 cases of active ocular toxoplasmosis (AOT). We found no differences in levels of interferon γ (IFN-γ) and interleukin 2 produced by T-helper 1 cells when comparing patients with AOT or POT to asymptomatic individuals. Unexpectedly, we found an increased interleukin 17A (IL-17A) production in patients with POT or OAT. In patients with POT or AOT, the main cellular source of IL-17A was CD4(+)CD45RO(+)T-bet(-)IFN-γ(-) T-helper 17 cells. Altogether, our results suggest that NOD2 influences the production of IL-17A by CD4(+) T lymphocytes and might contribute to the development of ocular toxoplasmosis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Colotelo, Alison; Deters, Kate
2017-05-26
Pacific Northwest National Laboratory has developed a super-small acoustic tracking tag designed just for juvenile lamprey. In this video, PNNL researcher Alison Colotelo describes how she and her colleague Kate Deters inject young lamprey with the PNNL tag.
2012-01-01
Background Polycythemia vera (PV), essential thrombocythemia (ET), and primary myelofibrosis (PMF) are myeloproliferative neoplasms (MPNs) characterized in most cases by a unique somatic mutation, JAK2 V617F. Recent studies revealed that JAK2 V617F occurs more frequently in a specific JAK2 haplotype, named JAK2 46/1 or GGCC haplotype, which is tagged by rs10974944 (C/G) and/or rs12343867 (T/C). This study examined the impact of single nucleotide polymorphisms (SNPs) of the JAK2 locus on MPNs in a Japanese population. Methods We sequenced 24 JAK2 SNPs in Japanese patients with PV. We then genotyped 138 MPN patients (33 PV, 96 ET, and 9 PMF) with known JAK2 mutational status and 107 controls for a novel SNP, in addition to two SNPs known to be part of the 46/1 haplotype (rs10974944 and rs12343867). Associations with risk of MPN were estimated by odds ratios and their 95% confidence intervals using logistic regression. Results A novel locus, rs4495487 (T/C), with a mutated T allele was significantly associated with PV. Similar to rs10974944 and rs12343867, rs4495487 in the JAK2 locus is significantly associated with JAK2-positive MPN. Based on the results of SNP analysis of the three JAK2 locus, we defined the "GCC genotype" as having at least one minor allele in each SNP (G allele in rs10974944, C allele in rs4495487, and C allele in rs12343867). The GCC genotype was associated with increased risk of both JAK2 V617F-positive and JAK2 V617F-negative MPN. In ET patients, leukocyte count and hemoglobin were significantly associated with JAK2 V617F, rather than the GCC genotype. In contrast, none of the JAK2 V617F-negative ET patients without the GCC genotype had thrombosis, and splenomegaly was frequently seen in this subset of ET patients. PV patients without the GCC genotype were significantly associated with high platelet count. Conclusions Our results indicate that the C allele of JAK2 rs4495487, in addition to the 46/1 haplotype, contributes significantly to the
CsSNP: A Web-Based Tool for the Detecting of Comparative Segments SNPs.
Wang, Yi; Wang, Shuangshuang; Zhou, Dongjie; Yang, Shuai; Xu, Yongchao; Yang, Chao; Yang, Long
2016-07-01
SNP (single nucleotide polymorphism) is a popular tool for the study of genetic diversity, evolution, and other areas. Therefore, it is necessary to develop a convenient, utility, robust, rapid, and open source detecting-SNP tool for all researchers. Since the detection of SNPs needs special software and series steps including alignment, detection, analysis and present, the study of SNPs is limited for nonprofessional users. CsSNP (Comparative segments SNP, http://biodb.sdau.edu.cn/cssnp/ ) is a freely available web tool based on the Blat, Blast, and Perl programs to detect comparative segments SNPs and to show the detail information of SNPs. The results are filtered and presented in the statistics figure and a Gbrowse map. This platform contains the reference genomic sequences and coding sequences of 60 plant species, and also provides new opportunities for the users to detect SNPs easily. CsSNP is provided a convenient tool for nonprofessional users to find comparative segments SNPs in their own sequences, and give the users the information and the analysis of SNPs, and display these data in a dynamic map. It provides a new method to detect SNPs and may accelerate related studies.
Haplotypes of the IL10 Gene as Potential Protection Factors in Leprosy Patients
Garcia, Patricia; Alencar, Dayse; Pinto, Pablo; Santos, Ney; Salgado, Claudio; Sortica, Vinicius A.; Hutz, Mara H.; Santos, Sidney
2013-01-01
Leprosy is an infectious disease caused by Mycobacterium leprae characterized by dermatoneurological signs and symptoms that has a large number of new cases worldwide. Several studies have associated interleukin 10 with susceptibility/resistance to several diseases. We investigated haplotypes formed by three single nucleotide polymorphisms (SNPs) located in the IL10 gene (A-1082G, C-819T, and C-592A) in order to better understand the susceptibility to and severity of leprosy in an admixed northern Brazil population, taking into account estimates of interethnic admixture. We observed the genotypes ACC/ACC (P = 0.021, odds ratio [OR] [95% confidence interval (CI)] = 0.290 [0.085 to 0823]) and ACC/GCC (P = 0.003, OR [95% CI] = 0.220 [0.504 to 0.040]) presenting significant results for protection against leprosy development, framed in the profiles of low and medium interleukin production, respectively. Therefore, we suggest that genotypes A-1082G, C-819T, and C-592A formed by interleukin-10 polymorphisms are closely related to protection of the leprosy development in an admixed northern Brazil population, in particular ACC/ACC and ACC/GCC genotypes. PMID:23966553
Origin and Diversification Dynamics of Self-Incompatibility Haplotypes
Gervais, Camille E.; Castric, Vincent; Ressayre, Adrienne; Billiard, Sylvain
2011-01-01
Self-incompatibility (SI) is a genetic system found in some hermaphrodite plants. Recognition of pollen by pistils expressing cognate specificities at two linked genes leads to rejection of self pollen and pollen from close relatives, i.e., to avoidance of self-fertilization and inbred matings, and thus increased outcrossing. These genes generally have many alleles, yet the conditions allowing the evolution of new alleles remain mysterious. Evolutionary changes are clearly necessary in both genes, since any mutation affecting only one of them would result in a nonfunctional self-compatible haplotype. Here, we study diversification at the S-locus (i.e., a stable increase in the total number of SI haplotypes in the population, through the incorporation of new SI haplotypes), both deterministically (by investigating analytically the fate of mutations in an infinite population) and by simulations of finite populations. We show that the conditions allowing diversification are far less stringent in finite populations with recurrent mutations of the pollen and pistil genes, suggesting that diversification is possible in a panmictic population. We find that new SI haplotypes emerge fastest in populations with few SI haplotypes, and we discuss some implications for empirical data on S-alleles. However, allele numbers in our simulations never reach values as high as observed in plants whose SI systems have been studied, and we suggest extensions of our models that may reconcile the theory and data. PMID:21515570
Ancestral inference from haplotypes and mutations.
Griffiths, Robert C; Tavaré, Simon
2018-04-25
We consider inference about the history of a sample of DNA sequences, conditional upon the haplotype counts and the number of segregating sites observed at the present time. After deriving some theoretical results in the coalescent setting, we implement rejection sampling and importance sampling schemes to perform the inference. The importance sampling scheme addresses an extension of the Ewens Sampling Formula for a configuration of haplotypes and the number of segregating sites in the sample. The implementations include both constant and variable population size models. The methods are illustrated by two human Y chromosome datasets. Copyright © 2018. Published by Elsevier Inc.
Tag-to-Tag Interference Suppression Technique Based on Time Division for RFID.
Khadka, Grishma; Hwang, Suk-Seung
2017-01-01
Radio-frequency identification (RFID) is a tracking technology that enables immediate automatic object identification and rapid data sharing for a wide variety of modern applications using radio waves for data transmission from a tag to a reader. RFID is already well established in technical areas, and many companies have developed corresponding standards and measurement techniques. In the construction industry, effective monitoring of materials and equipment is an important task, and RFID helps to improve monitoring and controlling capabilities, in addition to enabling automation for construction projects. However, on construction sites, there are many tagged objects and multiple RFID tags that may interfere with each other's communications. This reduces the reliability and efficiency of the RFID system. In this paper, we propose an anti-collision algorithm for communication between multiple tags and a reader. In order to suppress interference signals from multiple neighboring tags, the proposed algorithm employs the time-division (TD) technique, where tags in the interrogation zone are assigned a specific time slot so that at every instance in time, a reader communicates with tags using the specific time slot. We present representative computer simulation examples to illustrate the performance of the proposed anti-collision technique for multiple RFID tags.
Photon-tagged and B-meson-tagged b-jet production at the LHC
Huang, Jinrui; Kang, Zhong -Bo; Vitev, Ivan; ...
2015-09-18
Tagged jet measurements in high energy hadronic and nuclear reactions provide constraints on the energy and parton flavor origin of the parton shower that recoils against the tagging particle. Such additional insight can be especially beneficial in illuminating the mechanisms of heavy flavor production in proton–proton collisions at the LHC and their modification in the heavy ion environment, which are not fully understood. With this motivation, we present theoretical results for isolated-photon-tagged and B-meson-tagged b-jet production at √s NN = 5.1 TeV for comparison to the upcoming lead–lead data. We find that photon-tagged b-jets exhibit smaller momentum imbalance shift inmore » nuclear matter, and correspondingly smaller energy loss, than photon-tagged light flavor jets. Our results show that B-meson tagging is most effective in ensuring that the dominant fraction of recoiling jets originate from prompt b-quarks. Furthermore, in this channel the large suppression of the cross section is not accompanied by a significant momentum imbalance shift.« less
PWHATSHAP: efficient haplotyping for future generation sequencing.
Bracciali, Andrea; Aldinucci, Marco; Patterson, Murray; Marschall, Tobias; Pisanti, Nadia; Merelli, Ivan; Torquati, Massimo
2016-09-22
Haplotype phasing is an important problem in the analysis of genomics information. Given a set of DNA fragments of an individual, it consists of determining which one of the possible alleles (alternative forms of a gene) each fragment comes from. Haplotype information is relevant to gene regulation, epigenetics, genome-wide association studies, evolutionary and population studies, and the study of mutations. Haplotyping is currently addressed as an optimisation problem aiming at solutions that minimise, for instance, error correction costs, where costs are a measure of the confidence in the accuracy of the information acquired from DNA sequencing. Solutions have typically an exponential computational complexity. WHATSHAP is a recent optimal approach which moves computational complexity from DNA fragment length to fragment overlap, i.e., coverage, and is hence of particular interest when considering sequencing technology's current trends that are producing longer fragments. Given the potential relevance of efficient haplotyping in several analysis pipelines, we have designed and engineered PWHATSHAP, a parallel, high-performance version of WHATSHAP. PWHATSHAP is embedded in a toolkit developed in Python and supports genomics datasets in standard file formats. Building on WHATSHAP, PWHATSHAP exhibits the same complexity exploring a number of possible solutions which is exponential in the coverage of the dataset. The parallel implementation on multi-core architectures allows for a relevant reduction of the execution time for haplotyping, while the provided results enjoy the same high accuracy as that provided by WHATSHAP, which increases with coverage. Due to its structure and management of the large datasets, the parallelisation of WHATSHAP posed demanding technical challenges, which have been addressed exploiting a high-level parallel programming framework. The result, PWHATSHAP, is a freely available toolkit that improves the efficiency of the analysis of genomics
Yang, Shuo; Li, Jia-li; Bi, Hui-chang; Zhou, Shou-ning; Liu, Xiao-man; Zeng, Hang; Hu, Bing-fang; Huang, Min
2016-01-01
This study aims to investigate the function of two SNPs (rs8904C > T and rs696G >A) in 3' untranslated region (3'UTR) of NFKBIA gene by constructing luciferase reporter gene. A patient's genomic DNA with rs8904 CC and rs696 GA genotype was used as the PCR template. Full-length 3'UTR of NFKBIA gene was amplified by different primers. After sequencing validation, these fragments were inserted to the luciferase reporter vector, pGL3-promoter to construct recombinant plasmids containing four kinds of haplotypes, pGL3-rs8904C/rs696G, pGL3-rs8904C/rs696A, pGL3-rs8904T/rs696G and pGL3-rs8904T/rs696A. Then these plasmids were transfected into LS174T cells and the luciferase activity was detected. Compared with pGL3-vector transfected cells (negative control), the luciferase activity of the four kinds of recombinant plasmids was significantly decreased (P < 0.001). For rs696G > A, the luciferase activity of the recombinant plasmids containing A allele (pGL3-rs8904C/rs696A and pGL3-rs8904T/rs696A) was about 45.1% (P < 0.05) and 56.1% (P < 0.001) lower than those containing G allele (pGL3-rs8904C/rs696G and pGL3-rs8904T/rs696G), respectively. For rs8904C > T, there were no significant differences in the luciferase activity between the recombinant plasmids containing T allele and those with C allele. Together, the luciferase reporter gene vectors containing SNPs in NFKBIA gene 3'UTR were constructed successfully and rs696G > A could decrease the luciferase activity while rs8904C >T didn't have much effect on the luciferase activity.
Yates, Christopher M; Sternberg, Michael J E
2013-11-01
Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.
Singh, Kh Dhanachandra; Karthikeyan, Muthusamy
2014-12-01
The renin-angiotensin-aldosterone system (RAAS) plays a key role in the regulation of blood pressure (BP). Mutations on the genes that encode components of the RAAS have played a significant role in genetic susceptibility to hypertension and have been intensively scrutinized. The identification of such probably causal mutations not only provides insight into the RAAS but may also serve as antihypertensive therapeutic targets and diagnostic markers. The methods for analyzing the SNPs from the huge dataset of SNPs, containing both functional and neutral SNPs is challenging by the experimental approach on every SNPs to determine their biological significance. To explore the functional significance of genetic mutation (SNPs), we adopted combined sequence and sequence-structure-based SNP analysis algorithm. Out of 3864 SNPs reported in dbSNP, we found 108 missense SNPs in the coding region and remaining in the non-coding region. In this study, we are reporting only those SNPs in coding region to be deleterious when three or more tools are predicted to be deleterious and which have high RMSD from the native structure. Based on these analyses, we have identified two SNPs of REN gene, eight SNPs of AGT gene, three SNPs of ACE gene, two SNPs of AT1R gene, three SNPs of CYP11B2 gene and three SNPs of CMA1 gene in the coding region were found to be deleterious. Further this type of study will be helpful in reducing the cost and time for identification of potential SNP and also helpful in selecting potential SNP for experimental study out of SNP pool.
Recent Advances in Experimental Whole Genome Haplotyping Methods
Huang, Mengting; Lu, Zuhong
2017-01-01
Haplotype plays a vital role in diverse fields; however, the sequencing technologies cannot resolve haplotype directly. Pioneers demonstrated several approaches to resolve haplotype in the early years, which was extensively reviewed. Since then, numerous methods have been developed recently that have significantly improved phasing performance. Here, we review experimental methods that have emerged mainly over the past five years, and categorize them into five classes according to their maximum scale of contiguity: (i) encapsulation, (ii) 3D structure capture and construction, (iii) compartmentalization, (iv) fluorography, (v) long-read sequencing. Several subsections of certain methods are attached to each class as instances. We also discuss the relative advantages and disadvantages of different classes and make comparisons among representative methods of each class. PMID:28891974
Significant SNPs have limited prediction ability for thyroid cancer
Guo, Shicheng; Wang, Yu-Long; Li, Yi; Jin, Li; Xiong, Momiao; Ji, Qing-Hai; Wang, Jiucun
2014-01-01
Recently, five thyroid cancer significantly associated genetic variants (rs965513, rs944289, rs116909374, rs966423, and rs2439302) have been discovered and validated in two independent GWAS and numerous case–control studies, which were conducted in different populations. We genotyped the above five single nucleotide polymorphisms (SNPs) in Han Chinese populations and performed thyroid cancer-risk predictions with nine machine learning methods. We found that four SNPs were significantly associated with thyroid cancer in Han Chinese population, while no polymorphism was observed for rs116909374. Small familial relative risks (1.02–1.05) and limited power to predict thyroid cancer (AUCs: 0.54–0.60) indicate limited clinical potential. Four significant SNPs have limited prediction ability for thyroid cancer. PMID:24591304
Population-based case-control study of DRD2 gene polymorphisms and alcoholism.
Bhaskar, L V K S; Thangaraj, K; Non, A L; Singh, Lalji; Rao, V R
2010-10-01
Several independent lines of evidence for genetic contributions to vulnerability to alcoholism exist. Dopamine is thought to play a major role in the mechanism of reward and reinforcement in response to alcohol. D2 dopamine receptor (DRD2) gene has been among the stronger candidate genes implicated in alcoholism. In this study, alcohol use was assessed in 196 randomly selected Kota individuals of Nilgiri Hills, South India. Six DRD2 SNPs were assessed in 81 individuals with alcoholism and 151 controls to evaluate the association between single nucleotide polymorphisms (SNPs) and alcoholism. Of the three models (dominant, recessive, and additive) tested for association between alcoholism and DRD2 SNPs, only the additive model shows association for three loci (rs1116313, TaqID, and rs2734835). Of six studied polymorphisms, five are in strong linkage disequilibrium forming onesingle haplotype block. Though the global haplotype analysis with these five SNPs was not significant, haplotype analysis using all six SNPs yielded a global P value of .033, even after adjusting for age. These findings support the importance of dopamine receptor gene polymorphisms in alcoholism. Further studies to replicate these findings in different populations are needed to confirm these results.
De novo assembly of a haplotype-resolved human genome.
Cao, Hongzhi; Wu, Honglong; Luo, Ruibang; Huang, Shujia; Sun, Yuhui; Tong, Xin; Xie, Yinlong; Liu, Binghang; Yang, Hailong; Zheng, Hancheng; Li, Jian; Li, Bo; Wang, Yu; Yang, Fang; Sun, Peng; Liu, Siyang; Gao, Peng; Huang, Haodong; Sun, Jing; Chen, Dan; He, Guangzhu; Huang, Weihua; Huang, Zheng; Li, Yue; Tellier, Laurent C A M; Liu, Xiao; Feng, Qiang; Xu, Xun; Zhang, Xiuqing; Bolund, Lars; Krogh, Anders; Kristiansen, Karsten; Drmanac, Radoje; Drmanac, Snezana; Nielsen, Rasmus; Li, Songgang; Wang, Jian; Yang, Huanming; Li, Yingrui; Wong, Gane Ka-Shu; Wang, Jun
2015-06-01
The human genome is diploid, and knowledge of the variants on each chromosome is important for the interpretation of genomic information. Here we report the assembly of a haplotype-resolved diploid genome without using a reference genome. Our pipeline relies on fosmid pooling together with whole-genome shotgun strategies, based solely on next-generation sequencing and hierarchical assembly methods. We applied our sequencing method to the genome of an Asian individual and generated a 5.15-Gb assembled genome with a haplotype N50 of 484 kb. Our analysis identified previously undetected indels and 7.49 Mb of novel coding sequences that could not be aligned to the human reference genome, which include at least six predicted genes. This haplotype-resolved genome represents the most complete de novo human genome assembly to date. Application of our approach to identify individual haplotype differences should aid in translating genotypes to phenotypes for the development of personalized medicine.
Honey bee-inspired algorithms for SNP haplotype reconstruction problem
NASA Astrophysics Data System (ADS)
PourkamaliAnaraki, Maryam; Sadeghi, Mehdi
2016-03-01
Reconstructing haplotypes from SNP fragments is an important problem in computational biology. There have been a lot of interests in this field because haplotypes have been shown to contain promising data for disease association research. It is proved that haplotype reconstruction in Minimum Error Correction model is an NP-hard problem. Therefore, several methods such as clustering techniques, evolutionary algorithms, neural networks and swarm intelligence approaches have been proposed in order to solve this problem in appropriate time. In this paper, we have focused on various evolutionary clustering techniques and try to find an efficient technique for solving haplotype reconstruction problem. It can be referred from our experiments that the clustering methods relying on the behaviour of honey bee colony in nature, specifically bees algorithm and artificial bee colony methods, are expected to result in more efficient solutions. An application program of the methods is available at the following link. http://www.bioinf.cs.ipm.ir/software/haprs/
Short communication: casein haplotype variability in sicilian dairy goat breeds.
Gigli, I; Maizon, D O; Riggio, V; Sardina, M T; Portolano, B
2008-09-01
In the Mediterranean region, goat milk production is an important economic activity. In the present study, 4 casein genes were genotyped in 5 Sicilian goat breeds to 1) identify casein haplotypes present in the Argentata dell'Etna, Girgentana, Messinese, Derivata di Siria, and Maltese goat breeds; and 2) describe the structure of the Sicilian goat breeds based on casein haplotypes and allele frequencies. In a sample of 540 dairy goats, 67 different haplotypes with frequency >or=0.01 and 27 with frequency >or=0.03 were observed. The most common CSN1S1-CSN2-CSN1S2-CSN3 haplotype for Derivata di Siria and Maltese was FCFB (0.17 and 0.22, respectively), whereas for Argentata dell'Etna, Girgentana and Messinese was ACAB (0.06, 0.23, and 0.10, respectively). According to the haplotype reconstruction, Argentata dell'Etna, Girgentana, and Messinese breeds presented the most favorable haplotype for cheese production, because the casein concentration in milk of these breeds might be greater than that in Derivata di Siria and Maltese breeds. Based on a cluster analysis, the breeds formed 2 main groups: Derivata di Siria, and Maltese in one group, and Argentata dell'Etna and Messinese in the other; the Girgentana breed was between these groups but closer to the latter.
Vinkers, Christiaan H; Joëls, Marian; Milaneschi, Yuri; Gerritsen, Lotte; Kahn, René S; Penninx, Brenda W J H; Boks, Marco P M
2015-04-01
The MR is an important regulator of the hypothalamic-pituitary-adrenal (HPA) axis and a prime target for corticosteroids. There is increasing evidence from both clinical and preclinical studies that the MR has different effects on behavior and mood in males and females. To investigate the hypothesis that the MR sex-dependently influences the relation between childhood maltreatment and depression, we investigated three common and functional MR haplotypes (GA, CA, and CG haplotype, based on rs5522 and rs2070951) in a population-based cohort (N = 665) and an independent clinical cohort from the Netherlands Study of Depression and Anxiety (NESDA) (N = 1639). The CA haplotype sex-dependently moderated the relation between childhood maltreatment and depressive symptoms both in the population-based sample (sex × maltreatment × haplotype: β = -4.07, P = 0.029) and in the clinical sample (sex × maltreatment × haplotype, β = -2.40, P = 0.011). Specifically, female individuals in the population-based sample were protected (β = -4.58, P = 2.0 e(-5)), whereas males in the clinical sample were at increased risk (β = 2.54, P = 0.0022). In line with these results, female GA haplotype carriers displayed increased vulnerability in the population-based sample (β = 4.58, P = 7.5 e(-5)) whereas male CG-carriers showed increased resilience in the clinical sample (β = -2.71, P = 0.016). Consistently, we found a decreased lifetime MDD risk for male GA haplotype carriers following childhood maltreatment but an increased risk for male CA haplotype carriers in the clinical sample. In both samples, sex-dependent effects were observed for GA-GA diplotype carriers. In summary, sex plays an important role in determining whether functional genetic variation in MR is beneficial or detrimental, with an apparent female advantage for the CA haplotype but male advantage for the GA and CG haplotype. These sex-dependent effects of MR on depression susceptibility following childhood
Alcoholism is associated with GALR3 but not two other galanin receptor genes.
Belfer, I; Hipp, H; Bollettino, A; McKnight, C; Evans, C; Virkkunen, M; Albaugh, B; Max, M B; Goldman, D; Enoch, M A
2007-07-01
The neuropeptide galanin is widely expressed in the periphery and the central nervous system and mediates diverse physiological processes and behaviors including alcohol abuse, depression and anxiety. Four genes encoding galanin and its receptors have been identified (GAL, GALR1, GALR2 and GALR3). Recently we found that GAL haplotypes were associated with alcoholism, raising the possibility that genetic variation in GALR1, GALR2 and GALR3 might also alter alcoholism risk. Tag single nucleotide polymorphisms (SNPs) were identified by genotyping SNP panels in controls from five populations. For the association study with alcoholism, six GALR1, four GALR2 and four GALR3 SNPs were genotyped in a large cohort of Finnish alcoholics and non-alcoholics. GALR3 showed a significant association with alcoholism that was driven by one SNP (rs3,091,367). Moreover, the combination of the GALR3 rs3,091,367 risk allele and GAL risk haplotypes led to a modestly increased odds ratio (OR) for alcoholism (2.4) as compared with the effect of either GAL (1.9) or GALR3 alone (1.4). Likewise, the combination of the GALR3 and GAL risk diplotypes led to an increased OR for alcoholism (4.6) as compared with the effect of either GAL (2.0) or GALR3 alone (1.6). There was no effect of GALR1 or GALR2 on alcoholism risk. This evidence suggests that GALR3 mediates the alcoholism-related actions of galanin.
Apalasamy, Yamunah Devi; Rampal, Sanjay; Salim, Agus; Moy, Foong Ming; Su, Tin Tin; Majid, Hazreen Abdul; Bulgiba, Awang; Mohamed, Zahurin
2015-06-01
Single nucleotide polymorphisms (SNP) in the resistin gene (RETN) are linked to obesity and resistin levels in various populations. However, results have been inconsistent. This study aimed to investigate association between polymorphisms in the resistin gene with obesity in a homogenous Malaysian Malay population. This study is also aimed to determine association between resistin levels with certain SNPs and haplotypes of RETN. A total of 631 Malaysian Malay subjects were included in this study and genotyping was carried out using Sequenom MassARRAY. There was no significant difference found in both allelic and genotype frequencies of each of the RETN SNPs between the obese and non-obese groups after Bonferroni correction. RETN rs34861192 and rs3219175 SNPs were significantly associated with log-resistin levels. The GG genotype carriers are found to have higher levels of log-resistin compared to A allele carriers. The RETN haplotypes (CAG, CGA and GA) were significantly associated with resistin levels. However, the haplotypes of the RETN gene were not associated with obesity. Resistin levels were not correlated to metabolic parameters such as body weight, waist circumference, body mass index, and lipid parameters. RETN SNPs and haplotypes are of apparent functional importance in the regulation of resistin levels but are not correlated with obesity and related markers.
Strohmaier, Markus; Körner, Christian; Kern, Roman
2012-12-01
While recent progress has been achieved in understanding the structure and dynamics of social tagging systems, we know little about the underlying user motivations for tagging, and how they influence resulting folksonomies and tags. This paper addresses three issues related to this question. (1) What distinctions of user motivations are identified by previous research, and in what ways are the motivations of users amenable to quantitative analysis? (2) To what extent does tagging motivation vary across different social tagging systems? (3) How does variability in user motivation influence resulting tags and folksonomies? In this paper, we present measures to detect whether a tagger is primarily motivated by categorizing or describing resources, and apply these measures to datasets from seven different tagging systems. Our results show that (a) users' motivation for tagging varies not only across, but also within tagging systems, and that (b) tag agreement among users who are motivated by categorizing resources is significantly lower than among users who are motivated by describing resources . Our findings are relevant for (1) the development of tag-based user interfaces, (2) the analysis of tag semantics and (3) the design of search algorithms for social tagging systems.
Strohmaier, Markus; Körner, Christian; Kern, Roman
2012-01-01
While recent progress has been achieved in understanding the structure and dynamics of social tagging systems, we know little about the underlying user motivations for tagging, and how they influence resulting folksonomies and tags. This paper addresses three issues related to this question. (1) What distinctions of user motivations are identified by previous research, and in what ways are the motivations of users amenable to quantitative analysis? (2) To what extent does tagging motivation vary across different social tagging systems? (3) How does variability in user motivation influence resulting tags and folksonomies? In this paper, we present measures to detect whether a tagger is primarily motivated by categorizing or describing resources, and apply these measures to datasets from seven different tagging systems. Our results show that (a) users’ motivation for tagging varies not only across, but also within tagging systems, and that (b) tag agreement among users who are motivated by categorizing resources is significantly lower than among users who are motivated by describing resources. Our findings are relevant for (1) the development of tag-based user interfaces, (2) the analysis of tag semantics and (3) the design of search algorithms for social tagging systems. PMID:23471473
Tag retention, growth, and survival of red swamp crayfish marked with a visible implant tag
Isely, J.J.; Stockett, P.E.
2001-01-01
Eighty juvenile (means: 42.4 mm total length, 1.6 g) red swamp crayfish Procambarus clarkii were implanted with sequentially numbered visible implant tags and held in the laboratory. Tags were injected transversely into the musculature just beneath the exoskeleton of the third abdominal segment from the cephalothorax; tags were visible upon inspection. An additional 20 crayfish were left untagged and served as controls. After 150 d, tag retention was 80% and all tags were readable. No tagged crayfish died during the study, and no differences in total length or weight were detected between tagged and control crayfish. All individuals molted at least three times during the 150-d study, and some individuals molted up to six times, suggesting that most tags would be permanently retained. The readability in the field without specialized equipment makes the visible implant tag ideal for studies of crayfish ecology, management, and culture.
Fitchi: haplotype genealogy graphs based on the Fitch algorithm.
Matschiner, Michael
2016-04-15
: In population genetics and phylogeography, haplotype genealogy graphs are important tools for the visualization of population structure based on sequence data. In this type of graph, node sizes are often drawn in proportion to haplotype frequencies and edge lengths represent the minimum number of mutations separating adjacent nodes. I here present Fitchi, a new program that produces publication-ready haplotype genealogy graphs based on the Fitch algorithm. http://www.evoinformatics.eu/fitchi.htm : michaelmatschiner@mac.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Ferret: a user-friendly Java tool to extract data from the 1000 Genomes Project.
Limou, Sophie; Taverner, Andrew M; Winkler, Cheryl A
2016-07-15
The 1000 Genomes (1KG) Project provides a near-comprehensive resource on human genetic variation in worldwide reference populations. 1KG variants can be accessed through a browser and through the raw and annotated data that are regularly released on an ftp server. We developed Ferret, a user-friendly Java tool, to easily extract genetic variation information from these large and complex data files. From a locus, gene(s) or SNP(s) of interest, Ferret retrieves genotype data for 1KG SNPs and indels, and computes allelic frequencies for 1KG populations and optionally, for the Exome Sequencing Project populations. By converting the 1KG data into files that can be imported into popular pre-existing tools (e.g. PLINK and HaploView), Ferret offers a straightforward way, even for non-bioinformatics specialists, to manipulate, explore and merge 1KG data with the user's dataset, as well as visualize linkage disequilibrium pattern, infer haplotypes and design tagSNPs. Ferret tool and source code are publicly available at http://limousophie35.github.io/Ferret/ ferret@nih.gov Supplementary data are available at Bioinformatics online. Published by Oxford University Press 2016. This work is written by US Government employees and is in the public domain in the US.
Polymorphism at Expressed DQ and DR Loci in Five Common Equine MHC Haplotypes
Miller, Donald; Tallmadge, Rebecca L.; Binns, Matthew; Zhu, Baoli; Mohamoud, Yasmin Ali; Ahmed, Ayeda; Brooks, Samantha A.; Antczak, Douglas F.
2016-01-01
The polymorphism of Major Histocompatibility Complex (MHC) class II DQ and DR genes in five common Equine Leukocyte Antigen (ELA) haplotypes was determined through sequencing of mRNA transcripts isolated from lymphocytes of eight ELA homozygous horses. Ten expressed MHC class II genes were detected in horses of the ELA-A3 haplotype carried by the donor horses of the equine Bacterial Artificial Chromosome (BAC) library and the reference genome sequence: four DR genes and six DQ genes. The other four ELA haplotypes contained at least eight expressed polymorphic MHC class II loci. Next Generation Sequencing (NGS) of genomic DNA of these four MHC haplotypes revealed stop codons in the DQA3 gene in the ELA-A2, ELA-A5, and ELA-A9 haplotypes. Few NGS reads were obtained for the other MHC class II genes that were not amplified in these horses. The amino acid sequences across haplotypes contained locus-specific residues, and the locus clusters produced by phylogenetic analysis were well supported. The MHC class II alleles within the five tested haplotypes were largely non-overlapping between haplotypes. The complement of equine MHC class II DQ and DR genes appears to be well conserved between haplotypes, in contrast to the recently described variation in class I gene loci between equine MHC haplotypes. The identification of allelic series of equine MHC class II loci will aid comparative studies of mammalian MHC conservation and evolution and may also help to interpret associations between the equine MHC class II region and diseases of the horse. PMID:27889800
Multi-Threaded DNA Tag/Anti-Tag Library Generator for Multi-Core Platforms
2009-05-01
base pair) Watson ‐ Crick strand pairs that bind perfectly within pairs, but poorly across pairs. A variety of DNA strand hybridization metrics...AFRL-RI-RS-TR-2009-131 Final Technical Report May 2009 MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE PLATFORMS...TYPE Final 3. DATES COVERED (From - To) Jun 08 – Feb 09 4. TITLE AND SUBTITLE MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE
Association of HLA haplotype with alopecia areata in Chinese Hans.
Xiao, F-L; Ye, D-Q; Yang, S; Zhou, F-S; Zhou, S-M; Zhu, Y-G; Liang, Y-H; Ren, Y-Q; Zhang, X-J
2006-11-01
Some studies have shown discrepancies in human leucocyte antigen (HLA) associated with alopecia areata (AA) between different ethnic populations. To investigate whether HLA-I, -DQA1 and -DQB1 alleles and the HLA haplotype are associated with AA, and the correlation between the HLA haplotype profile, age of onset and severity of AA in Chinese Hans. The polymerase chain reaction-sequence specific primer (PCR-SSP) method was used to analyse the frequencies of HLA class I, -DQA1 and -DQB1 alleles in 192 patients with AA and 252 controls in Chinese Hans. The linkage disequilibrium was calculated using the 2 x 2 table. The 24 two-locus haplotypes [including A*02-B*18, A*02-B*27, A*02-B*52, A*02-Cw*0704, A*02-DQA1*0104, A*02-DQB1*0604, A*02-DQB1*0606, B*18-Cw*0704, B*18-DQA1*0104, B*18-DQA1*0302, B*18-DQB1*0606, B*27-Cw*0704, B*27-DQA1*0104, B*27-DQA1*0302, B*52-Cw*0704, B*52-DQA1*0104, B*52-DQA1*0302, B52-DQB1*0606, Cw*0704-DQA1*0104, Cw*0704-DQA1*0302, Cw*0704-DQB1*0606, DQA1*0104-DQB1*0604, DQA1*0104-DQB1*0606, DQA1*0302-DQB1*0606 (P<0.05)] were associated with AA, while eight extended haplotypes (A*02-B*18-DQA1*0104, A*02-B*27-DQA1*0104, A*02-B*52-DQA1*0104, A*02-B*52-DQA1*0302, A*02-B*52-DQB1*0606, B*52-Cw*0704-DQA1*0104, B*52-Cw*0704-DQA1*0302, A*02-B*52-DQA1*0302-DQB1*0606) were found to be related to AA in Chinese Hans. Through stratified analysis, we found that the extended haplotype B*52-Cw*0704-DQA1*0302 was related to early onset of AA, and no haplotype was only associated with severe AA. This is the first detailed report to elucidate HLA haplotypes associated with AA and that demonstrates the significant HLA haplotypes in Chinese Hans AA. The haplotype B*52-Cw*0704-DQA1*0302 was identified to be related to early onset of AA. Our results provide some information for future research on predisposing genes in HLA regions in Chinese Hans.
Association of single-nucleotide polymorphisms of the tau gene with late-onset Parkinson disease.
Martin, E R; Scott, W K; Nance, M A; Watts, R L; Hubble, J P; Koller, W C; Lyons, K; Pahwa, R; Stern, M B; Colcher, A; Hiner, B C; Jankovic, J; Ondo, W G; Allen, F H; Goetz, C G; Small, G W; Masterman, D; Mastaglia, F; Laing, N G; Stajich, J M; Ribble, R C; Booze, M W; Rogala, A; Hauser, M A; Zhang, F; Gibson, R A; Middleton, L T; Roses, A D; Haines, J L; Scott, B L; Pericak-Vance, M A; Vance, J M
2001-11-14
The human tau gene, which promotes assembly of neuronal microtubules, has been associated with several rare neurologic diseases that clinically include parkinsonian features. We recently observed linkage in idiopathic Parkinson disease (PD) to a region on chromosome 17q21 that contains the tau gene. These factors make tau a good candidate for investigation as a susceptibility gene for idiopathic PD, the most common form of the disease. To investigate whether the tau gene is involved in idiopathic PD. Among a sample of 1056 individuals from 235 families selected from 13 clinical centers in the United States and Australia and from a family ascertainment core center, we tested 5 single-nucleotide polymorphisms (SNPs) within the tau gene for association with PD, using family-based tests of association. Both affected (n = 426) and unaffected (n = 579) family members were included; 51 individuals had unclear PD status. Analyses were conducted to test individual SNPs and SNP haplotypes within the tau gene. Family-based tests of association, calculated using asymptotic distributions. Analysis of association between the SNPs and PD yielded significant evidence of association for 3 of the 5 SNPs tested: SNP 3, P =.03; SNP 9i, P =.04; and SNP 11, P =.04. The 2 other SNPs did not show evidence of significant association (SNP 9ii, P =.11, and SNP 9iii, P =.87). Strong evidence of association was found with haplotype analysis, with a positive association with one haplotype (P =.009) and a negative association with another haplotype (P =.007). Substantial linkage disequilibrium (P<.001) was detected between 4 of the 5 SNPs (SNPs 3, 9i, 9ii, and 11). This integrated approach of genetic linkage and positional association analyses implicates tau as a susceptibility gene for idiopathic PD.
Association of Single-Nucleotide Polymorphisms of the Tau Gene With Late-Onset Parkinson Disease
Martin, Eden R.; Scott, William K.; Nance, Martha A.; Watts, Ray L.; Hubble, Jean P.; Koller, William C.; Lyons, Kelly; Pahwa, Rajesh; Stern, Matthew B.; Colcher, Amy; Hiner, Bradley C.; Jankovic, Joseph; Ondo, William G.; Allen, Fred H.; Goetz, Christopher G.; Small, Gary W.; Masterman, Donna; Mastaglia, Frank; Laing, Nigel G.; Stajich, Jeffrey M.; Ribble, Robert C.; Booze, Michael W.; Rogala, Allison; Hauser, Michael A.; Zhang, Fengyu; Gibson, Rachel A.; Middleton, Lefkos T.; Roses, Allen D.; Haines, Jonathan L.; Scott, Burton L.; Pericak-Vance, Margaret A.; Vance, Jeffery M.
2013-01-01
Context The human tau gene, which promotes assembly of neuronal microtubules, has been associated with several rare neurologic diseases that clinically include parkinsonian features. We recently observed linkage in idiopathic Parkinson disease (PD) to a region on chromosome 17q21 that contains the tau gene. These factors make tau a good candidate for investigation as a susceptibility gene for idiopathic PD, the most common form of the disease. Objective To investigate whether the tau gene is involved in idiopathic PD. Design, Setting, and Participants Among a sample of 1056 individuals from 235 families selected from 13 clinical centers in the United States and Australia and from a family ascertainment core center, we tested 5 single-nucleotide polymorphisms (SNPs) within the tau gene for association with PD, using family-based tests of association. Both affected (n = 426) and unaffected (n = 579) family members were included; 51 individuals had unclear PD status. Analyses were conducted to test individual SNPs and SNP haplotypes within the tau gene. Main Outcome Measure Family-based tests of association, calculated using asymptotic distributions. Results Analysis of association between the SNPs and PD yielded significant evidence of association for 3 of the 5 SNPs tested: SNP 3, P = .03; SNP 9i, P = .04; and SNP 11, P = .04. The 2 other SNPs did not show evidence of significant association (SNP 9ii, P = .11, and SNP 9iii, P = .87). Strong evidence of association was found with haplotype analysis, with a positive association with one haplotype (P = .009) and a negative association with another haplotype (P = .007). Substantial linkage disequilibrium (P<.001) was detected between 4 of the 5 SNPs (SNPs 3,9i, 9ii, and 11). Conclusions This integrated approach of genetic linkage and positional association analyses implicates tau as a susceptibility gene for idiopathic PD. PMID:11710889
Zhu, Xiao; Kong, Qingming; Xie, Liwei; Chen, Zhihong; Li, Hongmei; Zhu, Zhu; Huang, Yongmei; Lan, Feifei; Luo, Haiqing; Zhan, Jingting; Ding, Hongrong; Lei, Jinli; Xiao, Qin; Fu, Weiming; Fan, Wenguo; Zhang, Jinfang; Luo, Hui
2018-01-01
Previous studies showed that the low expressions of chromodomain-helicase-DNA-binding protein 5 (CHD5) were intensively associated with deteriorative biologic and clinical characteristics as well as outcomes in many tumors. The aim of this study is to determine whether CHD5 single nucleotide polymorphisms (SNPs) contribute to the prognosis of hepatocellular carcima (HCC). The SNPs were selected according to their linkage disequilibrium (LD) in the targeted next-generation sequencing (NGS) and then genotyped with TaqMan probers. We revealed a rare haplotype AG in CHD5 (SNPs: rs12564469-rs9434711) was markedly associated with HCC prognosis. The univariate and multivariate regression analyses revealed the patients with worse overall survival time were those with tumor metastasis and haplotype AG, as well as cirrhosis, poor differentiation and IV-TNM stage. Based on the available public databases, we discovered the significant association between haplotype AG and CHD5 mRNA expressions only existed in Chinese. These data proposed that the potentially genetic haplotype might functionally contribute to HCC prognosis and CHD5 mRNA expressions. PMID:29568352
Jia, Wei-Hua; Pan, Qing-Hua; Qin, Hai-De; Xu, Ya-Fei; Shen, Guo-Ping; Chen, Lina; Chen, Li-Zhen; Feng, Qi-Sheng; Hong, Ming-Huang; Zeng, Yi-Xin; Shugart, Yin Yao
2009-01-01
Nasopharyngeal carcinoma (NPC) is rare in most parts of the world but is more prevalent in Southern China, especially in Guangdong. The cytochrome P450 2E1 (CYP2E1) has been recognized as one of the critically important enzymes involved in oxidizing carcinogens and is probably to be associated with NPC carcinogenesis. To systematically investigate the association between genetic variants in CYP2E1 and NPC risk in Cantonese, two independent studies, a family-based association study and a case–control study, were conducted using the haplotype-tagging single-nucleotide polymorphism approach. A total of 2499 individuals from 546 nuclear families were initially genotyped for the family-based association study. Single-nucleotide polymorphisms (SNPs) rs9418990, rs915908, rs8192780, rs1536826, rs3827688 and one haplotype h2 (CGTGTTAA) were revealed to be significantly associated with the NPC phenotype (P = 0.045–0.003 and P = 0.003, respectively). To follow up the initial study, a case–control study including 755 cases and 755 controls was conducted. Similar results were observed in the case–control study in individuals <46 years of age and had a history of cigarette smoking, with odds ratios (ORs) of specific genotypes ranging from 1.88 to 2.99 corresponding to SNP rs9418990, rs3813865, rs915906, rs2249695, rs8192780, rs1536826, rs3827688 and of haplotypes h2 with OR = 1.65 (P = 0.026), h5 (CCCGTTAA) with OR = 2.58 (P = 0.007). The values of false-positive report probability were <0.015 for six SNPs, suggesting that the reported associations are less probably to be false. This study provides robust evidence for associations between genetic variants of CYP2E1 and NPC risk. PMID:19805575
Fullerton, Stephanie M; Clark, Andrew G; Weiss, Kenneth M; Taylor, Scott L; Stengård, Jari H; Salomaa, Veikko; Boerwinkle, Eric; Nickerson, Deborah A
2002-07-01
A 3.3-kb region, encompassing the APOA2 gene and 2 kb of 5' and 3' flanking DNA, was re-sequenced in a "core" sample of 24 individuals, sampled without regard to the health from each of three populations: African-Americans from Jackson (Miss., USA), Europeans from North Karelia (Finland), and non-Hispanic European-Americans from Rochester, (Minn., USA). Fifteen variable sites were identified (14 SNPs and one multi-allelic microsatellite, all silent), and these sites segregated as 18 sequence haplotypes (or nine, if SNPs only are considered). The haplotype distribution in the core African-American sample was unusual, with a deficit of particular haplotypes compared with those found in the other two samples, and a significantly (P<0.05) low level of nucleotide diversity relative to patterns of polymorphism and divergence at other human loci. Six of the 14 SNPs, whose variation captured the haplotype structure of the core data, were then genotyped by oligonucleotide ligation assay in an additional 2183 individuals from the same three populations (n=843, n=452, and n=888, respectively). All six sites varied in each of the larger "epidemiological" samples, and together, they defined 19 SNP haplotypes, seven with relative frequencies greater than 1% in the total sample; all of these common haplotypes had been identified earlier in the core re-sequencing survey. Here also, the African-American sample showed significantly lower SNP heterozygosity and haplotype diversity than the other two samples. The deficit of polymorphism is consistent with a population-specific non-neutral increase in the relative frequency of several haplotypes in Jackson.
Goddard, Katrina A B; Tromp, Gerard; Romero, Roberto; Olson, Jane M; Lu, Qing; Xu, Zhiying; Parimi, Neeta; Nien, Jyh Kae; Gomez, Ricardo; Behnke, Ernesto; Solari, Margarita; Espinoza, Jimmy; Santolaya, Joaquin; Chaiworapongsa, Tinnakorn; Lenk, Guy M; Volkenant, Kimberly; Anant, Madan Kumar; Salisbury, Benjamin A; Carr, Janet; Lee, Min Soeb; Vovis, Gerald F; Kuivaniemi, Helena
2007-01-01
Pre-eclampsia (PE) affects 5-7% of pregnancies in the US, and is a leading cause of maternal death and perinatal morbidity and mortality worldwide. To identify genes with a role in PE, we conducted a large-scale association study evaluating 775 SNPs in 190 candidate genes selected for a potential role in obstetrical complications. SNP discovery was performed by DNA sequencing, and genotyping was carried out in a high-throughput facility using the MassARRAY(TM) System. Women with PE (n = 394) and their offspring (n = 324) were compared with control women (n = 602) and their offspring (n = 631) from the same hospital-based population. Haplotypes were estimated for each gene using the EM algorithm, and empirical p values were obtained for a logistic regression-based score test, adjusted for significant covariates. An interaction model between maternal and offspring genotypes was also evaluated. The most significant findings for association with PE were COL1A1 (p = 0.0011) and IL1A (p = 0.0014) for the maternal genotype, and PLAUR (p = 0.0008) for the offspring genotype. Common candidate genes for PE, including MTHFR and NOS3, were not significantly associated with PE. For the interaction model, SNPs within IGF1 (p = 0.0035) and IL4R (p = 0.0036) gave the most significant results. This study is one of the most comprehensive genetic association studies of PE to date, including an evaluation of offspring genotypes that have rarely been considered in previous studies. Although we did not identify statistically significant evidence of association for any of the candidate loci evaluated here after adjusting for multiple testing using the false discovery rate, additional compelling evidence exists, including multiple SNPs with nominally significant p values in COL1A1 and the IL1A region, and previous reports of association for IL1A, to support continued interest in these genes as candidates for PE. Identification of the genetic regulators of PE may have broader implications
NASA Astrophysics Data System (ADS)
Schiopu, Paul; Manea, Adrian; Cristea, Ionica; Grosu, Neculai; Vladescu, Marian; Craciun, Anca-Ileana; Craciun, Alexandru
2015-02-01
Minuscule devices, called RFID tags are attached to objects and persons and emit information which positioned readers may capture wirelessly. Many methods of identification have been used, but that of most common is to use a unique serial number for identification of person or object. RFID tags can be characterized as either active or passive [1,2]. Traditional passive tags are typically in "sleep" state until awakened by the reader's emitted field. In passive tags, the reader's field acts to charge the capacitor that powers the badge and this can be a combination of antenna and barcodes obtained with SAW( Surface Acoustic Wave) devices [1,2,3] . The antenna in an RFID tag is a conductive element that permits the tag to exchange data with the reader. The paper contribution are targeted to antenna for passive RFID tags. The electromagnetic field generated by the reader is somehow oriented by the reader antenna and power is induced in the tag only if the orientation of the tag antenna is appropriate. A tag placed orthogonal to the reader yield field will not be read. This is the reason that guided manufacturers to build circular polarized antenna capable of propagating a field that is alternatively polarized on all planes passing on the diffusion axis. Passive RFID tags are operated at the UHF frequencies of 868MHz (Europe) and 915MHz (USA) and at the microwave frequencies of 2,45 GHz and 5,8 GHz . Because the tags are small dimensions, in paper, we present the possibility to use circular polarization microstrip antenna with fractal edge [2].
HLA-G Haplotypes Are Differentially Associated with Asthmatic Features.
Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie
2018-01-01
Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA - G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter
HLA-G Haplotypes Are Differentially Associated with Asthmatic Features
Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie
2018-01-01
Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA-G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter
β3 Integrin Haplotype Influences Gene Regulation and Plasma von Willebrand Factor Activity
Payne, Katie E; Bray, Paul F; Grant, Peter J; Carter, Angela M
2008-01-01
The Leu33Pro polymorphism of the gene encoding β3 integrin (ITGB3) is associated with acute coronary syndromes and influences platelet aggregation. Three common promoter polymorphisms have also been identified. The aims of this study were to (1) investigate the influence of the ITGB3 −400C/A, −425A/C and −468G/A promoter polymorphisms on reporter gene expression and nuclear protein binding and (2) determine genotype and haplotype associations with platelet αIIbβ3 receptor density. Promoter haplotypes were introduced into an ITGB3 promoter-pGL3 construct by site directed mutagenesis and luciferase reporter gene expression analysed in HEL and HMEC-1 cells. Binding of nuclear proteins was assessed by electrophoretic mobility shift assay. The association of ITGB3 haplotype with platelet αIIbβ3 receptor density was determined in 223 subjects. Species conserved motifs were identified in the ITGB3 promoter in the vicinity of the 3 polymorphisms. The GAA, GCC, AAC, AAA and ACC constructs induced ~50% increased luciferase expression relative to the GAC construct in both cell types. Haplotype analysis including Leu33Pro indicated 5 common haplotypes; no associations between ITGB3 haplotypes and receptor density were found. However, the GCC-Pro33 haplotype was associated with significantly higher vWF activity (128.6 [112.1–145.1]%) compared with all other haplotypes (107.1 [101.2–113.0]%, p=0.02). In conclusion, the GCC-Pro33 haplotype was associated with increased vWF activity but not with platelet αIIbβ3 receptor density, which may indicate ITGB3 haplotype influences endothelial function. PMID:18045606
Association of the neuronal cell adhesion molecule (NRCAM) gene variants with autism.
Marui, Tetsuya; Funatogawa, Ikuko; Koishi, Shinko; Yamamoto, Kenji; Matsumoto, Hideo; Hashimoto, Ohiko; Nanba, Eiji; Nishida, Hisami; Sugiyama, Toshiro; Kasai, Kiyoto; Watanabe, Keiichiro; Kano, Yukiko; Sasaki, Tsukasa; Kato, Nobumasa
2009-02-01
Autism is a severe neurodevelopmental disorder of early childhood. Genetic factors play an important role in the aetiology of the disorder. In this study, we considered the NRCAM gene as a candidate gene of autism. This gene is expressed in the central nervous system and located in the 7q region, a susceptibility locus of autism. We conducted a case-control study of 18 single nucleotide polymorphisms (SNPs) within the NRCAM gene for possible association with autism in 170 autistic patients and 214 normal controls in a Japanese population. Seven SNPs in the NRCAM gene were significantly associated with autism, among which rs2300045 indicated the most prominent result (p=0.0009 uncorrected, p=0.017 corrected). In haplotype analyses, several individual haplotypes, including a common NRCAM haplotype C-T-T-C-T-T-G-C for rs3763463, rs1859767, rs1034825, rs2300045, rs2300043, rs2300039, rs722519, and rs2216259, showed a significant association after Bonferroni correction (p=0.0035 uncorrected, p=0.028 corrected). These haplotypes were located in the 5' intron-2 region of the gene. In addition, we also assessed the above mentioned SNPs and haplotypes using the transmission disequilibrium test with 148 trios of autistic families. Haplotype G-T-T-T-T-C-G-C in the same eight SNPs was also associated with autism. In summary, our findings provide evidence for a significant association of NRCAM with autism. Considering the important role of the NRCAM gene in brain development, our results therefore indicated that the NRCAM gene is one of the strong candidate genes for autism.
Genetic Variants of CD209 Associated with Kawasaki Disease Susceptibility
Kuo, Ho-Chang; Huang, Ying-Hsien; Chien, Shu-Chen; Yu, Hong-Ren; Hsieh, Kai-Sheng; Hsu, Yu-Wen; Chang, Wei-Chiao
2014-01-01
Background Kawasaki disease (KD) is a systemic vasculitis with unknown etiology mainly affecting children in Asian countries. Dendritic cell-specific intercellular adhesion molecule-3 grabbing non-integrin (DC-SIGN, CD209) in humans was showed to trigger an anti-inflammatory cascade and associated with KD susceptibility. This study was conducted to investigate the association between genetic polymorphisms of CD209 and the risk KD. Methods A total of 948 subjects (381 KD and 567 controls) were recruited. Nine tagging SNPs (rs8112310, rs4804800, rs11465421, rs1544766, rs4804801, rs2287886, rs735239, rs735240, rs4804804) were selected for TaqMan allelic discrimination assay. Clinical phenotypes, coronary artery lesions (CAL) and intravenous immunoglobulin (IVIG) treatment outcomes were collected for analysis. Results Significant associations were found between CD209 polymorphisms (rs4804800, rs2287886, rs735240) and the risk of KD. Haplotype analysis for CD209 polymorphisms showed that A/A/G haplotype (P = 0.0002, OR = 1.61) and G/A/G haplotype (P = 0.0365, OR = 1.52) had higher risk of KD as compared with G/G/A haplotype in rs2287886/rs735239/rs735240 pairwise allele analysis. There were no significant association in KD with regards to CAL formation and IVIG treatment responses. Conclusion CD209 polymorphisms were responsible for the susceptibility of KD, but not CAL formation and IVIG treatment responsiveness. PMID:25148534
Genetic Variants in PNPLA3 and Risk of Non-Alcoholic Fatty Liver Disease in a Han Chinese Population
Lin, Shao-Wei; Lu, Qing-Qing; Hu, Zhi-Jian; Lin, Xu
2012-01-01
We investigated the possible association between genetic variants in the Patatin like phospholipase-3 (PNPLA3) gene and nonalcoholic fatty liver disease (NAFLD) in a Han Chinese population. We evaluated twelve tagging single-nucleotide polymorphisms (tSNPs) of the PNPLA3 gene in a frequency matched case–control study from Fuzhou city of China (553 cases, 553 controls). In the multivariate logistic regression analysis, the rs738409 GG or GC, and rs139051 TT genotypes were found to be associated with increased risk of NAFLD, and a significant trend of increased risk with increasing numbers of risk genotype was observed in the cumulative effect analysis of these single nucleotide polymorphisms. Furthermore, haplotype association analysis showed that, compared with the most common haplotype, the CAAGAATGCGTG and CGAAGGTGTCCG haplotypes conferred a statistically significant increased risk for NAFLD, while the CGGGAACCCGCG haplotype decreased the risk of NAFLD. Moreover, rs738409 C>G appeared to have a multiplicative joint effect with tea drinking (P<0.005) and an additive joint effect with obesity (Interaction contrast ratio (ICR) = 2.31, 95% CI: 0.7–8.86), hypertriglyceridemia (ICR = 3.07, 95% CI: 0.98–5.09) or hypertension (ICR = 1.74, 95% CI: 0.52–3.12). Our data suggests that PNPLA3 genetic polymorphisms might influence the susceptibility to NAFLD development independently or jointly in Han Chinese. PMID:23226254
Elfassihi, Latifa; Giroux, Sylvie; Bureau, Alexandre; Laflamme, Nathalie; Cole, David Ec; Rousseau, François
2010-04-01
Osteoporosis is a bone disease characterized by low bone mineral density (BMD), a highly heritable polygenic trait. Women are more prone than men to develop osteoporosis owing to a lower peak bone mass and accelerated bone loss at menopause. Lack of estrogen thus is a major risk factor for osteoporosis. In addition to having strong similarity to the estrogen receptor 1 (ESR1), the orphan nuclear estrogen-related receptor gamma (ESRRgamma) is widely expressed and shows overlap with ESR1 expression in tissues where estrogen has important physiologic functions. For these reasons, we have undertaken a study of ESRRgamma sequence variants in association with bone measurements [heel quantitative ultrasound (QUS) by measurements of broadband ultrasound attenuation (BUA), speed of sound (SOS), and stiffness index (SI) and dual-energy X-ray absorptiometry (DXA) at the femoral neck (FN) and lumbar spine (LS)]. A silent variant was found to be associated with multiple bone measurements (LS, BUA, SOS, and SI), the p values ranging from .006 to .04 in a sample of 5144 Quebec women. The region of this variant was analyzed using the HapMap database and the Gabriel method to define a block of 20 kb. Using the Tagger method, eight TagSNPs were identified and genotyped in a sample of 1335 women. Four of these SNPs capture the five major block haplotypes. One SNP (rs2818964) and one haplotype were significantly associated with multiple bone measures. All SNPs involved in the associations were analyzed in two other sample sets with significant results in the same direction. These results suggest involvement of ESRRgamma in the determination of bone density in women. Copyright 2010 American Society for Bone and Mineral Research.
Strep-Tagged Protein Purification.
Maertens, Barbara; Spriestersbach, Anne; Kubicek, Jan; Schäfer, Frank
2015-01-01
The Strep-tag system can be used to purify recombinant proteins from any expression system. Here, protocols for lysis and affinity purification of Strep-tagged proteins from E. coli, baculovirus-infected insect cells, and transfected mammalian cells are given. Depending on the amount of Strep-tagged protein in the lysate, a protocol for batch binding and subsequent washing and eluting by gravity flow can be used. Agarose-based matrices with the coupled Strep-Tactin ligand are the resins of choice, with a binding capacity of up to 9 mg ml(-1). For purification of lower amounts of Strep-tagged proteins, the use of Strep-Tactin magnetic beads is suitable. In addition, Strep-tagged protein purification can also be automated using prepacked columns for FPLC or other liquid-handling chromatography instrumentation, but automated purification is not discussed in this protocol. The protocols described here can be regarded as an update of the Strep-Tag Protein Handbook (Qiagen, 2009). © 2015 Elsevier Inc. All rights reserved.
Liang, Yulan; Kelemen, Arpad
2017-09-01
existence of moderate or modifiable effects. Further analysis with the inclusions of gene-gene and gene-environmental interactions shows interactions between rs17231896 (CETP) and rs17222772 (ALOX); rs17231896 (CETP) and gender. rs17237890 (CETP) and rs2070744 (NOS3) are found to be significantly associated with risks of MI adjusted by both SNPs and environmental factors. After multiple testing adjustments, these effects diminished as expected. In addition, an interaction between drinking and smoking status is significant. Overall, the prediction power in successfully classifying MI status is increased to 80% with inclusions of all significant tagSNPs and environmental factors and their interactions compared with environmental factors only (72%).Having a history of either HC or MI has significant effects on each other in both directions, in addition to HTN and gender. Genes/SNPs identified from this analysis that are associated with HC may be potentially linked to MI, which could be further examined and validated through haplotype-pairs analysis with appropriate population stratification corrections, and function/pathway regulation analysis to eliminate the limitations of the current analysis.
Method for designing gas tag compositions
Gross, Kenny C.
1995-01-01
For use in the manufacture of gas tags such as employed in a nuclear reactor gas tagging failure detection system, a method for designing gas tagging compositions utilizes an analytical approach wherein the final composition of a first canister of tag gas as measured by a mass spectrometer is designated as node #1. Lattice locations of tag nodes in multi-dimensional space are then used in calculating the compositions of a node #2 and each subsequent node so as to maximize the distance of each node from any combination of tag components which might be indistinguishable from another tag composition in a reactor fuel assembly. Alternatively, the measured compositions of tag gas numbers 1 and 2 may be used to fix the locations of nodes 1 and 2, with the locations of nodes 3-N then calculated for optimum tag gas composition. A single sphere defining the lattice locations of the tag nodes may be used to define approximately 20 tag nodes, while concentric spheres can extend the number of tag nodes to several hundred.
Method for designing gas tag compositions
Gross, K.C.
1995-04-11
For use in the manufacture of gas tags such as employed in a nuclear reactor gas tagging failure detection system, a method for designing gas tagging compositions utilizes an analytical approach wherein the final composition of a first canister of tag gas as measured by a mass spectrometer is designated as node No. 1. Lattice locations of tag nodes in multi-dimensional space are then used in calculating the compositions of a node No. 2 and each subsequent node so as to maximize the distance of each node from any combination of tag components which might be indistinguishable from another tag composition in a reactor fuel assembly. Alternatively, the measured compositions of tag gas numbers 1 and 2 may be used to fix the locations of nodes 1 and 2, with the locations of nodes 3-N then calculated for optimum tag gas composition. A single sphere defining the lattice locations of the tag nodes may be used to define approximately 20 tag nodes, while concentric spheres can extend the number of tag nodes to several hundred. 5 figures.
Behar, Doron M.; Rosset, Saharon; Tzur, Shay; Selig, Sara; Yudkovsky, Guennady; Bercovici, Sivan; Kopp, Jeffrey B.; Winkler, Cheryl A.; Nelson, George W.; Wasser, Walter G.; Skorecki, Karl
2010-01-01
Recent studies identified MYH9 as a major susceptibility gene for common forms of non-diabetic end-stage kidney disease (ESKD). A set of African ancestry DNA sequence variants comprising the E-1 haplotype, was significantly associated with ESKD. In order to determine whether African ancestry variants are also associated with disease susceptibility in admixed populations with differing genomic backgrounds, we genotyped a total of 1425 African and Hispanic American subjects comprising dialysis patients with diabetic and non-diabetic ESKD and controls, using 42 single nucleotide polymorphisms (SNPs) within the MYH9 gene and 40 genome-wide and 38 chromosome 22 ancestry informative markers. Following ancestry correction, logistic regression demonstrated that three of the E-1 SNPs are also associated with non-diabetic ESKD in the new sample sets of both African and Hispanic Americans, with a stronger association in Hispanic Americans. We also identified MYH9 SNPs that are even more powerfully associated with the disease phenotype than the E-1 SNPs. These newly associated SNPs, could be divided into those comprising a haplotype termed S-1 whose association was significant under a recessive or additive inheritance mode (rs5750248, OR 4.21, P < 0.01, Hispanic Americans, recessive), and those comprising a haplotype termed F-1 whose association was significant under a dominant or additive inheritance mode (rs11912763, OR 4.59, P < 0.01, Hispanic Americans, dominant). These findings strengthen the contention that a sequence variant of MYH9, common in populations with varying degrees of African ancestry admixture, and in strong linkage disequilibrium with the associated SNPs and haplotypes reported herein, strongly predisposes to non-diabetic ESKD. PMID:20144966
Behar, Doron M; Rosset, Saharon; Tzur, Shay; Selig, Sara; Yudkovsky, Guennady; Bercovici, Sivan; Kopp, Jeffrey B; Winkler, Cheryl A; Nelson, George W; Wasser, Walter G; Skorecki, Karl
2010-05-01
Recent studies identified MYH9 as a major susceptibility gene for common forms of non-diabetic end-stage kidney disease (ESKD). A set of African ancestry DNA sequence variants comprising the E-1 haplotype, was significantly associated with ESKD. In order to determine whether African ancestry variants are also associated with disease susceptibility in admixed populations with differing genomic backgrounds, we genotyped a total of 1425 African and Hispanic American subjects comprising dialysis patients with diabetic and non-diabetic ESKD and controls, using 42 single nucleotide polymorphisms (SNPs) within the MYH9 gene and 40 genome-wide and 38 chromosome 22 ancestry informative markers. Following ancestry correction, logistic regression demonstrated that three of the E-1 SNPs are also associated with non-diabetic ESKD in the new sample sets of both African and Hispanic Americans, with a stronger association in Hispanic Americans. We also identified MYH9 SNPs that are even more powerfully associated with the disease phenotype than the E-1 SNPs. These newly associated SNPs, could be divided into those comprising a haplotype termed S-1 whose association was significant under a recessive or additive inheritance mode (rs5750248, OR 4.21, P < 0.01, Hispanic Americans, recessive), and those comprising a haplotype termed F-1 whose association was significant under a dominant or additive inheritance mode (rs11912763, OR 4.59, P < 0.01, Hispanic Americans, dominant). These findings strengthen the contention that a sequence variant of MYH9, common in populations with varying degrees of African ancestry admixture, and in strong linkage disequilibrium with the associated SNPs and haplotypes reported herein, strongly predisposes to non-diabetic ESKD.
WebTag: Web browsing into sensor tags over NFC.
Echevarria, Juan Jose; Ruiz-de-Garibay, Jonathan; Legarda, Jon; Alvarez, Maite; Ayerbe, Ana; Vazquez, Juan Ignacio
2012-01-01
Information and Communication Technologies (ICTs) continue to overcome many of the challenges related to wireless sensor monitoring, such as for example the design of smarter embedded processors, the improvement of the network architectures, the development of efficient communication protocols or the maximization of the life cycle autonomy. This work tries to improve the communication link of the data transmission in wireless sensor monitoring. The upstream communication link is usually based on standard IP technologies, but the downstream side is always masked with the proprietary protocols used for the wireless link (like ZigBee, Bluetooth, RFID, etc.). This work presents a novel solution (WebTag) for a direct IP based access to a sensor tag over the Near Field Communication (NFC) technology for secure applications. WebTag allows a direct web access to the sensor tag by means of a standard web browser, it reads the sensor data, configures the sampling rate and implements IP based security policies. It is, definitely, a new step towards the evolution of the Internet of Things paradigm.
WebTag: Web Browsing into Sensor Tags over NFC
Echevarria, Juan Jose; Ruiz-de-Garibay, Jonathan; Legarda, Jon; Álvarez, Maite; Ayerbe, Ana; Vazquez, Juan Ignacio
2012-01-01
Information and Communication Technologies (ICTs) continue to overcome many of the challenges related to wireless sensor monitoring, such as for example the design of smarter embedded processors, the improvement of the network architectures, the development of efficient communication protocols or the maximization of the life cycle autonomy. This work tries to improve the communication link of the data transmission in wireless sensor monitoring. The upstream communication link is usually based on standard IP technologies, but the downstream side is always masked with the proprietary protocols used for the wireless link (like ZigBee, Bluetooth, RFID, etc.). This work presents a novel solution (WebTag) for a direct IP based access to a sensor tag over the Near Field Communication (NFC) technology for secure applications. WebTag allows a direct web access to the sensor tag by means of a standard web browser, it reads the sensor data, configures the sampling rate and implements IP based security policies. It is, definitely, a new step towards the evolution of the Internet of Things paradigm. PMID:23012511
Zhang, RuiJie; Li, Xia; Jiang, YongShuai; Liu, GuiYou; Li, ChuanXing; Zhang, Fan; Xiao, Yun; Gong, BinSheng
2009-02-01
High-throughout single nucleotide polymorphism detection technology and the existing knowledge provide strong support for mining the disease-related haplotypes and genes. In this study, first, we apply four kinds of haplotype identification methods (Confidence Intervals, Four Gamete Tests, Solid Spine of LD and fusing method of haplotype block) into high-throughout SNP genotype data to identify blocks, then use cluster analysis to verify the effectiveness of the four methods, and select the alcoholism-related SNP haplotypes through risk analysis. Second, we establish a mapping from haplotypes to alcoholism-related genes. Third, we inquire NCBI SNP and gene databases to locate the blocks and identify the candidate genes. In the end, we make gene function annotation by KEGG, Biocarta, and GO database. We find 159 haplotype blocks, which relate to the alcoholism most possibly on chromosome 1 approximately 22, including 227 haplotypes, of which 102 SNP haplotypes may increase the risk of alcoholism. We get 121 alcoholism-related genes and verify their reliability by the functional annotation of biology. In a word, we not only can handle the SNP data easily, but also can locate the disease-related genes precisely by combining our novel strategies of mining alcoholism-related haplotypes and genes with existing knowledge framework.
Rah, HyungChul; Choi, Yi Seul; Jeon, Young Joo; Choi, Youngsok; Cha, Sun Hee; Choi, Dong Hee; Ko, Jung Jae; Shim, Sung Han; Kim, Nam Keun
2012-05-01
The objective was to investigate the association between idiopathic recurrent spontaneous abortion (RSA) and 3 SLC19A1 polymorphisms (-43T>C, 80G>A, and 696C>T). DNA from 269 patients with RSA and 125 controls were genotyped for the 3 SLC19A1 single nucleotide polymorphisms (SNPs) by polymerase chain reaction-restriction fragment length polymorphism. Homocysteine and folate levels of 100 patients with RSA were available for analysis. The combination genotypes of SLC19A1 -43TC/80GG, -43TC/80AA, and -43CC/80GA; 80GA/696TT, 80AA/696CC; and -43TC/696CC were less frequent in patients with RSA compared to controls (P < .05 for each). The -43C/80A/696 T and -43T/80G/696C haplotypes were more frequent in patients than controls, whereas -43T/80A/696C, -43C/80A/696C, -43C/80G/696C, -43C/80G/696T, and -43T/80G/696T haplotypes were less frequent in patients (P < .05 for each). The -43T/80G and 80A/696T haplotypes were more frequent in patients, while -43T/80A, -43C/80G, 80A/696C, 80G/696T, and -43C/696C haplotypes occurred less frequently in patients (P < .05 for each). The associations between idiopathic RSA occurrence and SLC19A1 -43T>C/80G>A/696C>T polymorphisms were identified and can be developed as biomarkers for RSA risk.
Burdick, Summer M.
2011-01-01
Passive integrated transponder (PIT) tags are commonly used to mark small catostomids, but tag loss and the effect of tagging on mortality have not been assessed for juveniles of the endangered Lost River sucker Deltistes luxatus. I evaluated tag loss and short-term (34-d) mortality associated with the PIT tagging of juvenile Lost River suckers in the laboratory by using a completely randomized design and three treatment groups (PIT tagged, positive control, and control). An empty needle was inserted into each positive control fish, whereas control fish were handled but not tagged. Only one fish expelled its PIT tag. Mortality rate averaged 9.8 ± 3.4% (mean ± SD) for tagged fish; mortality was 0% for control and positive control fish. All tagging mortalities occurred in fish with standard lengths of 71 mm or less, and most of the mortalities occurred within 48 h of tagging. My results indicate that 12.45- × 2.02-mm PIT tags provide a viable method of marking juvenile Lost River suckers that are 72 mm or larger.
MOHANTY, APARAJITA; MARTÍN, JUAN PEDRO; GONZÁLEZ, LUIS MIGUEL; AGUINAGALDE, ITZIAR
2003-01-01
Chloroplast DNA (cpDNA) and mitochondrial DNA (mtDNA) were studied in 24 populations of Prunus spinosa sampled across Europe. The cpDNA and mtDNA fragments were amplified using universal primers and subsequently digested with restriction enzymes to obtain the polymorphisms. Combinations of all the polymorphisms resulted in 33 cpDNA haplotypes and two mtDNA haplotypes. Strict association between the cpDNA haplotypes and the mtDNA haplotypes was detected in most cases, indicating conjoint inheritance of the two genomes. The most frequent and abundant cpDNA haplotype (C20; frequency, 51 %) is always associated with the more frequent and abundant mtDNA haplotype (M1; frequency, 84 %). All but two of the cpDNA haplotypes associated with the less frequent mtDNA haplotype (M2) are private haplotypes. These private haplotypes are phylogenetically related but geographically unrelated. They form a separate cluster on the minimum‐length spanning tree. PMID:14534199
Chromatin remodeling gene EZH2 involved in the genetic etiology of autism in Chinese Han population.
Li, Jun; You, Yang; Yue, Weihua; Yu, Hao; Lu, Tianlan; Wu, Zhiliu; Jia, Meixiang; Ruan, Yanyan; Liu, Jing; Zhang, Dai; Wang, Lifang
2016-01-01
Autism spectrum disorder (ASD) is a group of severe neurodevelopmental disorders. Epigenetic factors play a critical role in the etiology of ASD. Enhancer of zest homolog 2 (EZH2), which encodes a histone methyltransferase, plays an important role in the process of chromatin remodeling during neurodevelopment. Further, EZH2 is located in chromosome 7q35-36, which is one of the linkage regions for autism. However, the genetic relationship between autism and EZH2 remains unclear. To investigate the association between EZH2 and autism in Chinese Han population, we performed a family-based association study between autism and three tagged single nucleotide polymorphisms (SNPs) that covered 95.4% of the whole region of EZH2. In the discovery cohort of 239 trios, two SNPs (rs740949 and rs6464926) showed a significant association with autism. To decrease false positive results, we expanded the sample size to 427 trios. A SNP (rs6464926) was significantly associated with autism even after Bonferroni correction (p=0.008). Haplotype G-T (rs740949 and rs6464926) was a risk factor for autism (Z=2.655, p=0.008, Global p=0.024). In silico function prediction for SNPs indicated that these two SNPs might be regulatory SNPs. Expression pattern of EZH2 showed that it is highly expressed in human embryonic brains. In conclusion, our findings demonstrate that EZH2 might contribute to the genetic etiology of autism in Chinese Han population. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Leung, Kim Hung; Yiu, Wai Chi; Yap, Maurice K H; Ng, Po Wah; Fung, Wai Yan; Sham, Pak Chung; Yip, Shea Ping
2011-06-01
This study examined the relationship between high myopia and three myopia candidate genes--matrix metalloproteinase 2 (MMP2) and tissue inhibitor of metalloproteinase-2 and -3 (TIMP2 and TIMP3)--involved in scleral remodeling. Recruited for the study were unrelated adult Han Chinese who were high myopes (spherical equivalent, ≤ -6.0 D in both eyes; cases) and emmetropes (within ±1.0 D in both eyes; controls). Sample set 1 had 300 cases and 300 controls, and sample set 2 had 356 cases and 354 controls. Forty-nine tag single-nucleotide polymorphisms (SNPs) were selected from these candidate genes. The first stage was an initial screen of six case pools and six control pools constructed from sample set 1, each pool consisting of 50 distinct subjects of the same affection status. In the second stage, positive SNPs from the first stage were confirmed by genotyping individual samples forming the DNA pools. In the third stage, positive SNPs from stage 2 were replicated, with sample set 2 genotyped individually. Of the 49 SNPs screened by DNA pooling, three passed the lenient threshold of P < 0.10 (nested ANOVA) and were followed up by individual genotyping. Of the three SNPs genotyped, two TIMP3 SNPs were found to be significantly associated with high myopia by single-marker or haplotype analysis. However, the initial positive results could not be replicated by sample set 2. MMP2, TIPM2, and TIMP3 genes were not associated with high myopia in this Chinese sample and hence are unlikely to play a major role in the genetic susceptibility to high myopia.
β-globin gene cluster haplotypes in ethnic minority populations of southwest China
Sun, Hao; Liu, Hongxian; Huang, Kai; Lin, Keqin; Huang, Xiaoqin; Chu, Jiayou; Ma, Shaohui; Yang, Zhaoqing
2017-01-01
The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5′ sites and 3′ sites of the β-globin gene cluster. 5′ haplotypes 2 (+−−−), 6 (−++−+), 9 (−++++) and 3′ haplotype FW3 (−+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China. PMID:28205625
Ancient mitochondrial haplotypes and evidence for intragenic recombination in a gynodioecious plant.
Städler, Thomas; Delph, Lynda F
2002-09-03
Because of their extremely low nucleotide mutation rates, plant mitochondrial genes are generally not expected to show variation within species. Remarkably, we found nine distinct cytochrome b sequence haplotypes in the gynodioecious alpine plant Silene acaulis, with two or more haplotypes coexisting locally in each of three sampled regions. Moreover, there is evidence for intragenic recombination in the history of the haplotype sample, implying at least transient heteroplasmy of mitochondrial DNA (mtDNA). Heteroplasmy might be achieved by one of two potential mechanisms, either continuous coexistence of subgenomic fragments in low stoichiometry, or occasional paternal leakage of mtDNA. On the basis of levels of synonymous nucleotide substitutions, the average divergence time between haplotypes is estimated to be at least 15 million years. Ancient coalescence of extant haplotypes is further indicated by the paucity of fixed differences in haplotypes obtained from related species, a pattern expected under trans-specific evolution. Our data are consistent with models of frequency-dependent selection on linked cytoplasmic male-sterility factors, the putative molecular basis of females in gynodioecious populations. However, associations between marker loci and the inferred male-sterility genes can be maintained only with very low rates of recombination. Heteroplasmy and recombination between divergent haplotypes imply unexplored consequences for the evolutionary dynamics of gynodioecy, a widespread plant breeding system.
2011-01-01
Introduction The Toll-like receptor 7 (TLR7) gene, encoded on human chromosome Xp22.3, is crucial for type I interferon production. A recent multicenter study in East Asian populations, comprising Chinese, Korean and Japanese participants, identified an association of a TLR7 single-nucleotide polymorphism (SNP) located in the 3' untranslated region (3' UTR), rs3853839, with systemic lupus erythematosus (SLE), especially in males, although some difference was observed among the tested populations. To test whether additional polymorphisms contribute to SLE in Japanese, we systematically analyzed the association of TLR7 with SLE in a Japanese female population. Methods A case-control association study was conducted on eight tag SNPs in the TLR7 region, including rs3853839, in 344 Japanese females with SLE and 274 healthy female controls. Results In addition to rs3853839, two SNPs in intron 2, rs179019 and rs179010, which were in moderate linkage disequilibrium with each other (r2 = 0.53), showed an association with SLE (rs179019: P = 0.016, odds ratio (OR) 2.02, 95% confidence interval (95% CI) 1.15 to 3.54; rs179010: P = 0.018, OR 1.75, 95% CI 1.10 to 2.80 (both under the recessive model)). Conditional logistic regression analysis revealed that the association of the intronic SNPs and the 3' UTR SNP remained significant after we adjusted them for each other. When only the patients and controls carrying the risk genotypes at the 3' UTR SNPpositionwere analyzed, the risk of SLE was significantly increased when the individuals also carried the risk genotypes at both of the intronic SNPs (P = 0.0043, OR 2.45, 95% CI 1.31 to 4.60). Furthermore, the haplotype containing the intronic risk alleles in addition to the 3' UTR risk allele was associated with SLE under the recessive model (P = 0.016, OR 2.37, 95% CI 1.17 to 4.80), but other haplotypes were not associated with SLE. Conclusions The TLR7 intronic SNPs rs179019 and rs179010 are associated with SLE independently of
Geographic distribution of haplotype diversity at the bovine casein locus
Jann, Oliver C; Ibeagha-Awemu, Eveline M; Özbeyaz, Ceyhan; Zaragoza, Pilar; Williams, John L; Ajmone-Marsan, Paolo; Lenstra, Johannes A; Moazami-Goudarzi, Katy; Erhardt, Georg
2004-01-01
The genetic diversity of the casein locus in cattle was studied on the basis of haplotype analysis. Consideration of recently described genetic variants of the casein genes which to date have not been the subject of diversity studies, allowed the identification of new haplotypes. Genotyping of 30 cattle breeds from four continents revealed a geographically associated distribution of haplotypes, mainly defined by frequencies of alleles at CSN1S1 and CSN3. The genetic diversity within taurine breeds in Europe was found to decrease significantly from the south to the north and from the east to the west. Such geographic patterns of cattle genetic variation at the casein locus may be a result of the domestication process of modern cattle as well as geographically differentiated natural or artificial selection. The comparison of African Bos taurus and Bos indicus breeds allowed the identification of several Bos indicus specific haplotypes (CSN1S1*C-CSN2*A2-CSN3*AI/CSN3*H) that are not found in pure taurine breeds. The occurrence of such haplotypes in southern European breeds also suggests that an introgression of indicine genes into taurine breeds could have contributed to the distribution of the genetic variation observed. PMID:15040901
Dixon, Christopher J.; Mesa, Matthew G.
2011-01-01
We monitored survival and tag loss among Moapa White River springfish Crenichthys baileyi moapae that were surgically implanted with passive integrated transponder (PIT; 9 × 2 mm) tags. The fish used in the study ranged from 40 to 67 mm in total length and from 1.0 to 6.5 g in mass; the PIT tag: body weight ratios were 1.0–6.1%. Fish were held for 41 d in live cages within a small, warm desert stream. Survival did not differ between untagged control fish (94.5%) and tagged fish (95.6%). Survival did not appear to be influenced by fish size or PIT tag: body weight ratio, but the small number of fish that died precluded a detailed analysis. Tag retention was 100% among the 86 fish that survived over the 41 d. Our results suggest that surgically implanting 9-mm PIT tags into Moapa White River springfish as small as 40 mm is an effective method for marking them because it has minimal impacts on survival and tag retention is high. More work is needed on the effects of PIT tagging on growth and other performance metrics of springfish and other small desert fishes.
Discovery, evaluation and distribution of haplotypes of the wheat Ppd-D1 gene.
Guo, Zhiai; Song, Yanxia; Zhou, Ronghua; Ren, Zhenglong; Jia, Jizeng
2010-02-01
Ppd-D1 is one of the most potent genes affecting the photoperiod response of wheat (Triticum aestivum). Only two alleles, insensitive Ppd-D1a and sensitive Ppd-D1b, were known previously, and these did not adequately explain the broad adaptation of wheat to photoperiod variation. In this study, five diagnostic molecular markers were employed to identify Ppd-D1 haplotypes in 492 wheat varieties from diverse geographic locations and 55 accessions of Aegilops tauschii, the D genome donor species of wheat. Six Ppd-D1 haplotypes, designated I-VI, were identified. Types II, V and VI were considered to be more ancient and types I, III and IV were considered to be derived from type II. The transcript abundances of the Ppd-D1 haplotypes showed continuous variation, being highest for haplotype I, lowest for haplotype III, and correlating negatively with varietal differences in heading time. These haplotypes also significantly affected other agronomic traits. The distribution frequency of Ppd-D1 haplotypes showed partial correlations with both latitudes and altitudes of wheat cultivation regions. The evolution, expression and distribution of Ppd-D1 haplotypes were consistent evidentially with each other. What was regarded as a pair of alleles in the past can now be considered a series of alleles leading to continuous variation.
SORL1 variants and risk of late-onset Alzheimer's disease.
Li, Yonghong; Rowland, Charles; Catanese, Joseph; Morris, John; Lovestone, Simon; O'Donovan, Michael C; Goate, Alison; Owen, Michael; Williams, Julie; Grupe, Andrew
2008-02-01
A recent study reported significant association of late-onset Alzheimer's disease (LOAD) with multiple single nucleotide polymorphisms (SNPs) and haplotypes in SORL1, a neuronal sortilin-related receptor protein known to be involved in the trafficking and processing of amyloid precursor protein. Here we attempted to validate this finding in three large, well characterized case-control series. Approximately 2000 samples from the three series were individually genotyped for 12 SNPs, including the 10 reported significant SNPs and 2 that constitute the reported significant haplotypes. A total of 25 allelic and haplotypic association tests were performed. One SNP rs2070045 was marginally replicated in the three sample sets combined (nominal P=0.035); however, this result does not remain significant when accounting for multiple comparisons. Further validation in other sample sets will be required to assess the true effects of SORL1 variants in LOAD.
Haplotype estimation using sequencing reads.
Delaneau, Olivier; Howie, Bryan; Cox, Anthony J; Zagury, Jean-François; Marchini, Jonathan
2013-10-03
High-throughput sequencing technologies produce short sequence reads that can contain phase information if they span two or more heterozygote genotypes. This information is not routinely used by current methods that infer haplotypes from genotype data. We have extended the SHAPEIT2 method to use phase-informative sequencing reads to improve phasing accuracy. Our model incorporates the read information in a probabilistic model through base quality scores within each read. The method is primarily designed for high-coverage sequence data or data sets that already have genotypes called. One important application is phasing of single samples sequenced at high coverage for use in medical sequencing and studies of rare diseases. Our method can also use existing panels of reference haplotypes. We tested the method by using a mother-father-child trio sequenced at high-coverage by Illumina together with the low-coverage sequence data from the 1000 Genomes Project (1000GP). We found that use of phase-informative reads increases the mean distance between switch errors by 22% from 274.4 kb to 328.6 kb. We also used male chromosome X haplotypes from the 1000GP samples to simulate sequencing reads with varying insert size, read length, and base error rate. When using short 100 bp paired-end reads, we found that using mixtures of insert sizes produced the best results. When using longer reads with high error rates (5-20 kb read with 4%-15% error per base), phasing performance was substantially improved. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Social Tagging of Mission Data
NASA Technical Reports Server (NTRS)
Norris, Jeffrey S.; Wallick, Michael N.; Joswig, Joseph C.; Powell, Mark W.; Torres, Recaredo J.; Mittman, David S.; Abramyan, Lucy; Crockett, Thomas M.; Shams, Khawaja S.; Fox, Jason M.;
2010-01-01
Mars missions will generate a large amount of data in various forms, such as daily plans, images, and scientific information. Often, there is a semantic linkage between images that cannot be captured automatically. Software is needed that will provide a method for creating arbitrary tags for this mission data so that items with a similar tag can be related to each other. The tags should be visible and searchable for all users. A new routine was written to offer a new and more flexible search option over previous applications. This software allows users of the MSLICE program to apply any number of arbitrary tags to a piece of mission data through a MSLICE search interface. The application of tags creates relationships between data that did not previously exist. These tags can be easily removed and changed, and contain enough flexibility to be specifically configured for any mission. This gives users the ability to quickly recall or draw attention to particular pieces of mission data, for example: Give a semantic and meaningful description to mission data; for example, tag all images with a rock in them with the tag "rock." Rapidly recall specific and useful pieces of data; for example, tag a plan as"driving template." Call specific data to a user s attention; for example, tag a plan as "for:User." This software is part of the MSLICE release, which was written in Java. It will run on any current Windows, Macintosh, or Linux system.
Profiling deleterious non-synonymous SNPs of smoker's gene CYP1A1.
Ramesh, A Sai; Khan, Imran; Farhan, Md; Thiagarajan, Padma
2013-01-01
CYP1A1 gene belongs to the cytochrome P450 family and is known better as smokers' gene due to its hyperactivation as a consequence of long term smoking. The expression of CYP1A1 induces polycyclic aromatic hydrocarbon production in the lungs, which when over expressed, is known to cause smoking related diseases, such as cardiovascular pathologies, cancer, and diabetes. Single nucleotide polymorphisms (SNPs) are the simplest form of genetic variations that occur at a higher frequency, and are denoted as synonymous and non-synonymous SNPs on the basis of their effects on the amino acids. This study adopts a systematic in silico approach to predict the deleterious SNPs that are associated with disease conditions. It is inferred that four SNPs are highly deleterious, among which the SNP with rs17861094 is commonly predicted to be harmful by all tools. Hydrophobic (isoleucine) to hydrophilic (serine) amino acid variation was observed in the candidate gene. Hence, this investigation aims to characterize a candidate gene from 159 SNPs of CYP1A1.
Y-STR haplotypes of Native American populations from the Brazilian Amazon region.
Palha, Teresinha Jesus Brabo Ferreira; Rodrigues, Elzemar Martins Ribeiro; dos Santos, Sidney Emanuel Batista
2010-10-01
The allele and haplotype frequencies of nine Y-STRs (DYS19, DYS389 I, DYS389 II, DYS390, DYS391, DYS392, DYS393, DYS385 I/II) were determined in a sample of six native tribes from the Brazilian Amazon (Tiriyó, Awa-Guajá, Waiãpi, Urubu-Kaapor, Zoé and Parakanã). Forty-eight different haplotypes were identified, 28 of which unique. Five haplotypes are very frequent and were shared by over 10 individuals. The estimated haplotype diversity (0.9114) was very low compared to other geographic groups, including Africans, Europeans and Asians. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Hodoğlugil, Uğur; Williamson, David W.; Yu, Yi; Farrer, Lindsay A.; Mahley, Robert W.
2011-01-01
Summary We narrowed chromosome 15q21-23 linkage to plasma high density lipoprotein cholesterol (HDL-C) levels in atherogenic dyslipidemic Turkish families by fine mapping, then focused on glucuronic acid epimerase (GLCE), a heparan sulfate proteoglycan (HSPG) biosynthesis enzyme. HSPGs participate in lipid metabolism along with apolipoprotein (apo) E. Of 31 SNPs in the GLCE locus, nine analyzed by haplotype were associated with plasma HDL-C and triglyceride levels (permuted p = 0.006 and 0.013, respectively) in families. Of five tagging GLCE SNPs in two cohorts of unrelated subjects, three (rs16952868, rs11631403, rs3865014) were associated with triglyceride and HDL-C levels in males (non-permuted p < 0.05). The association was stronger in APOE 2/3 subjects (apoE2 has reduced binding to HSPGs) and reached multiple-testing significance (p < 0.05) in both males and females (n = 2612). Similar results were obtained in the second cohort (n = 1164). Interestingly, at the GLCE locus, bounded by recombination hotspots, Turks had a minor allele frequency of SNPs resembling Chinese more than European ancestry; adjoining regions on chromosome 15 resembled the European pattern. Studies of glce+/–apoe–/– mice fed a chow or high-fat diet supported a role for GLCE in lipid metabolism. Thus, SNPs in GLCE are associated with triglyceride and HDL-C levels in Turks, and mouse studies support a role for glce in lipid metabolism. PMID:21488854
Identification of bovine NPC1 gene cSNPs and their effects on body size traits of Qinchuan cattle.
Dang, Yonglong; Li, Mingxun; Yang, Mingjuan; Cao, Xiukai; Lan, Xianyong; Lei, Chuzhao; Zhang, Chunlei; Lin, Qing; Chen, Hong
2014-05-01
NPC1 gene is an important gene closely related to the Niemann-Pick type C (NPC). Mutations in the NPC1 gene tend to cause Niemann-Pick type C, a lysosomal storage disorder. Previous studies have shown that NPC1 protein plays an important role in subcellular lipid transport, homeostasis, platelet function and formation, which are basic metabolic activities in the process of development. In this study, to explore the association between the NPC1 gene variation and body size traits in Qinchuan cattle, we detected four novel coding single nucleotide polymorphisms (cSNPs) in the bovine NPC1 gene, including one missense mutation (SNP1) and three synonymous mutations (SNP2, SNP3 and SNP4). Population genetic analyses of 518 individuals and association correlations between cSNPs and bovine body size traits were conducted in this research. A missense mutation at SNP1 locus was found to be significantly related to the heart girth, hip width and body weight (P<0.01 or P<0.05, 3.5-year-old). Two synonymous mutations at SNP2 and SNP3 loci also showed significant effects on hip width (P<0.05, 3.5-year-old). One synonymous mutation at SNP4 locus showed significant effect on body weight (P<0.05, 2.0-year-old). Combined haplotypes H2H6 and H6H6 showed significant effects on body size traits such as heart girth, hip width, and body weight (3.5-year-old, P<0.01 or P<0.05). This study provides evidence that the NPC1 gene might be involved in the regulation of bovine growth and body development, and may be considered as a candidate gene for marker assisted selection (MAS) in beef cattle breeding industry. Copyright © 2014. Published by Elsevier B.V.
Genetically encoded fluorescent tags
Thorn, Kurt
2017-01-01
Genetically encoded fluorescent tags are protein sequences that can be fused to a protein of interest to render it fluorescent. These tags have revolutionized cell biology by allowing nearly any protein to be imaged by light microscopy at submicrometer spatial resolution and subsecond time resolution in a live cell or organism. They can also be used to measure protein abundance in thousands to millions of cells using flow cytometry. Here I provide an introduction to the different genetic tags available, including both intrinsically fluorescent proteins and proteins that derive their fluorescence from binding of either endogenous or exogenous fluorophores. I discuss their optical and biological properties and guidelines for choosing appropriate tags for an experiment. Tools for tagging nucleic acid sequences and reporter molecules that detect the presence of different biomolecules are also briefly discussed. PMID:28360214
Lawhorn, Collene; Yuferov, Vadim; Randesi, Matthew; Ho, Ann; Morgello, Susan; Kreek, Mary Jeanne; Levran, Orna
2013-01-01
Background Chemokine receptors CCR2 and CCR5 play a key role in immune and inflammatory responses and have been associated with several diseases, including AIDS. In order to comprehend health disparities it is important to understand the nature of genetic variation in specific genes of interest in different populations. Current studies of the CCR2 and CCR5 receptor genes are primarily focused on the CCR5-Δ32, and CCR2-V64I SNPs. Methods Sanger sequencing was used to sequence the regions containing 16 SNPs in the adjacent CCR2 and CCR5 genes (including CCR5-Δ32, and CCR2-V64I) in 249 subjects of African, European and Hispanic ancestry. Linkage disequilibrium (LD) and haplotypes were determined using Haploview. Results The data revealed large differences in allele frequencies of several SNPs and LD patterns among the ethnic groups, including SNPs that were restricted to Africans or Europeans. Seven known CCR5 haplotypes and six novel CCR2 haplotypes were identified. A rare case of an HIV+ subject with the CCR5-Δ32/Δ32 was identified. Conclusions These data demonstrate a LD between CCR2 and CCR5 at several loci and provide new information about CCR2 that contributes to our understanding of its population-specific genetic variability. The data indicate that in addition to CCR5-Δ32 and CCR2-V64I, other SNPs and haplotypes may be important genetic determinants of disease and should be investigated. PMID:24011637
Louzoun, Yoram; Alter, Idan; Gragert, Loren; Albrecht, Mark; Maiers, Martin
2018-05-01
Regardless of sampling depth, accurate genotype imputation is limited in regions of high polymorphism which often have a heavy-tailed haplotype frequency distribution. Many rare haplotypes are thus unobserved. Statistical methods to improve imputation by extending reference haplotype distributions using linkage disequilibrium patterns that relate allele and haplotype frequencies have not yet been explored. In the field of unrelated stem cell transplantation, imputation of highly polymorphic human leukocyte antigen (HLA) genes has an important application in identifying the best-matched stem cell donor when searching large registries totaling over 28,000,000 donors worldwide. Despite these large registry sizes, a significant proportion of searched patients present novel HLA haplotypes. Supporting this observation, HLA population genetic models have indicated that many extant HLA haplotypes remain unobserved. The absent haplotypes are a significant cause of error in haplotype matching. We have applied a Bayesian inference methodology for extending haplotype frequency distributions, using a model where new haplotypes are created by recombination of observed alleles. Applications of this joint probability model offer significant improvement in frequency distribution estimates over the best existing alternative methods, as we illustrate using five-locus HLA frequency data from the National Marrow Donor Program registry. Transplant matching algorithms and disease association studies involving phasing and imputation of rare variants may benefit from this statistical inference framework.
Plessky, Victor P; Reindl, Leonhard M
2010-03-01
SAW tags were invented more than 30 years ago, but only today are the conditions united for mass application of this technology. The devices in the 2.4-GHz ISM band can be routinely produced with optical lithography, high-resolution radar systems can be built up using highly sophisticated, but low-cost RF-chips, and the Internet is available for global access to the tag databases. The "Internet of Things," or I-o-T, will demand trillions of cheap tags and sensors. The SAW tags can overcome semiconductor-based analogs in many aspects: they can be read at a distance of a few meters with readers radiating power levels 2 to 3 orders lower, they are cheap, and they can operate in robust environments. Passive SAW tags are easily combined with sensors. Even the "anti-collision" problem (i.e., the simultaneous reading of many nearby tags) has adequate solutions for many practical applications. In this paper, we discuss the state-of-the-art in the development of SAW tags. The design approaches will be reviewed and optimal tag designs, as well as encoding methods, will be demonstrated. We discuss ways to reduce the size and cost of these devices. A few practical examples of tags using a time-position coding with 10(6) different codes will be demonstrated. Phase-coded devices can additionally increase the number of codes at the expense of a reduction of reading distance. We also discuss new and exciting perspectives of using ultra wide band (UWB) technology for SAW-tag systems. The wide frequency band available for this standard provides a great opportunity for SAW tags to be radically reduced in size to about 1 x 1 mm(2) while keeping a practically infinite number of possible different codes. Finally, the reader technology will be discussed, as well as detailed comparison made between SAW tags and IC-based semiconductor device.
Isely, J.J.; Eversole, A.G.
1998-01-01
Juvenile red swamp crayfish (or crawfish), Procambarus clarkii (20-41 mm in total length) were collected from a crayfish culture pond by dipnetting and tagged with sequentially numbered, standard length, binary-coded wire tags. Four replicates of 50 crayfish were impaled perpendicular to the long axis of the abdomen with a fixed needle. Tags were injected transversely into the ventral surface of the first or second abdominal segment and were imbedded in the musculature just beneath the abdominal sternum. Tags were visible upon inspection. Additionally, two replicates of 50 crayfish were not tagged and were used as controls. Growth, survival, and tag retention were evaluated after 7 d in individual containers, after 100 d in aquaria, and after 200 d in field cages. Tag retention during each sample period was 100%, and average mortality of tagged crayfish within 7 d of tagging was 1%. Mortality during the remainder of the study was high (75-91%) but was similar between treatment and control samples. Most of the deaths were probably due to cannibalism. Average total length increased threefold during the course of the study, and crayfish reached maturity. Because crayfish were mature by the end of the study, we concluded that the coded wire tag was retained through the life history of the crayfish.
HLA-A*02 allele frequencies and haplotypic associations in Koreans.
Park, M H; Whang, D H; Kang, S J; Han, K S
2000-03-01
We have investigated the frequencies of HLA-A*02 alleles and their haplotypic associations with HLA-B and -DRB1 loci in 439 healthy unrelated Koreans, including 214 parents from 107 families. All of the 227 samples (51.7%) typed as A2 by serology were analyzed for A*02 alleles using polymerase chain reaction (PCR)-low ionic strength-single-strand conformation polymorphism (LIS-SSCP) method. A total of six different A*02 alleles were detected (A*02 allele frequency 29.6%): A*0201/9 (16.6%), *0203 (0.5%), *0206 (9.3%), *0207 (3.0%), and one each case of *0210 and *02 undetermined type. Two characteristic haplotypes showing the strongest linkage disequilibrium were A*0203-B38-DRB]*1502 and A*0207-B46-DRB1*0803. Besides these strong associations, significant two-locus associations (P<0.001) were observed for A*0201 with B61, DRB1*0901 and DRB1*1401, and for A*0206 with B48 and B61. HLA haplotypes carrying HLA-A2 showed a variable distribution of A*02 alleles, and all of the eight most common A2-B-DR haplotypes occurring at frequencies of > or =1% were variably associated with two different A*02 alleles. These results demonstrate that substantial heterogeneity is present in the distribution of HLA-A*02 alleles and related haplotypes in Koreans.
Trott, Josephine F; Freking, Bradley A; Hovey, Russell C
2014-02-01
The actions of prolactin (PRL) are mediated by both long (LF) and short isoforms (SF) of the PRL receptor (PRLR). Here, we report on a genetic and functional analysis of the porcine PRLR (pPRLR) SF. Three single nucleotide polymorphisms (SNPs) within exon 11 of the pPRLR-SF give rise to four amino acid haplotypes of the intracellular domain. We identified the dimorphic insertion of a short interspersed repetitive DNA element (PRE-1) along with 32 SNPs and four other insertion/deletion sites within the 3' untranslated region (UTR) of pPRLR-SF. The PRE-1 element reduced protein translation in vitro by 75%, whereas the combination of 10 SNPs and one insertion/deletion decreased translation by 50%. Full-length cDNAs for all four haplotypes of pPRLR-SF were cloned behind the elongation factor 1-alpha promoter and functionally analyzed in vitro. None of the haplotypes could initiate transcription from the ß-casein promoter, whereas all four were dominant negatives against PRL-activation of the pPRLR-LF. Two of the haplotypes completely inhibited pPRLR-LF activity at a four-fold excess, whereas the others required a six-fold excess to impart the same effect. The ligand binding affinities of the pPRLR-SF haplotypes did not differ. Expression of the pPRLR-SF increased linearly during gestation in the endometrium and was hormonally regulated in a tissue-specific manner in the mammary glands and uterus. In conclusion, we identified a PRE-1 and other SNPs in the pPRLR-SF 3' UTR that reduce protein expression and four haplotypes of the pPRLR-SF that suppress pPRLR-LF signaling and may differentially impact the phenotypic effects of PRL in vivo. © 2013 Stichting International Foundation for Animal Genetics.
SNP-VISTA: An Interactive SNPs Visualization Tool
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shah, Nameeta; Teplitsky, Michael V.; Pennacchio, Len A.
2005-07-05
Recent advances in sequencing technologies promise better diagnostics for many diseases as well as better understanding of evolution of microbial populations. Single Nucleotide Polymorphisms(SNPs) are established genetic markers that aid in the identification of loci affecting quantitative traits and/or disease in a wide variety of eukaryotic species. With today's technological capabilities, it is possible to re-sequence a large set of appropriate candidate genes in individuals with a given disease and then screen for causative mutations.In addition, SNPs have been used extensively in efforts to study the evolution of microbial populations, and the recent application of random shotgun sequencing to environmentalmore » samples makes possible more extensive SNP analysis of co-occurring and co-evolving microbial populations. The program is available at http://genome.lbl.gov/vista/snpvista.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Banerjee, Poulabi; Bahlo, Melanie; Schwartz, Jody R.
2002-01-01
Genome wide disease association analysis using SNPs is being explored as a method for dissecting complex genetic traits and a vast number of SNPs have been generated for this purpose. As there are cost and throughput limitations of genotyping large numbers of SNPs and statistical issues regarding the large number of dependent tests on the same data set, to make association analysis practical it has been proposed that SNPs should be prioritized based on likely functional importance. The most easily identifiable functional SNPs are coding SNPs (cSNPs) and accordingly cSNPs have been screened in a number of studies. SNPs inmore » gene regulatory sequences embedded in noncoding DNA are another class of SNPs suggested for prioritization due to their predicted quantitative impact on gene expression. The main challenge in evaluating these SNPs, in contrast to cSNPs is a lack of robust algorithms and databases for recognizing regulatory sequences in noncoding DNA. Approaches that have been previously used to delineate noncoding sequences with gene regulatory activity include cross-species sequence comparisons and the search for sequences recognized by transcription factors. We combined these two methods to sift through mouse human genomic sequences to identify putative gene regulatory elements and subsequently localized SNPs within these sequences in a 1 Megabase (Mb) region of human chromosome 5q31, orthologous to mouse chromosome 11 containing the Interleukin cluster.« less
VNTR alleles associated with the {alpha}-globin locus are haplotype and population related
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martinson, J.J.; Clegg, J.B.; Boyce, A.J.
1994-09-01
The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception ofmore » closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.« less
Daing, Anika; Singh, Sarvendra Vikram; Saimbi, Charanjeet Singh; Khan, Mohammad Akhlaq
2012-01-01
Purpose Cyclooxygenase (COX) enzyme catalyzes the production of prostaglandins, which are important mediators of tissue destruction in periodontitis. Single nucleotide polymorphisms of COX2 enzyme have been associated with increasing susceptibility to inflammatory diseases. The present study evaluates the association of two single nucleotide polymorphisms in COX2 gene (-1195G>A and 8473C>T) with chronic periodontitis in North Indians. Methods Both SNPs and their haplotypes were used to explore the associations between COX2 polymorphisms and chronic periodontitis in 56 patients and 60 controls. Genotyping was done by polymerase chain reaction followed by restriction fragment length polymorphism. Chi-square test and logistic regression analysis were performed for association analysis. Results By the individual genotype analysis, mutant genotypes (GA and AA) of COX2 -1195 showed more than a two fold risk (odds ratio [OR]>2) and COX2 8473 (TC and CC) showed a reduced risk for the disease, but the findings were not statistically significant. Haplotype analysis showed that the frequency of the haplotype AT was higher in the case group and a significant association was found for haplotype AT (OR, 1.79; 95% confidence interval, 1.03 to 3.11; P=0.0370) indicating an association between the AT haplotype of COX2 gene SNPs and chronic periodontitis. Conclusions Individual genotypes of both the SNPs were not associated while haplotype AT was found to be associated with chronic periodontitis in North Indians. PMID:23185695
Bosch, T M; Doodeman, V D; Smits, P H M; Meijerman, I; Schellens, J H M; Beijnen, J H
2006-01-01
A possible explanation for the wide interindividual variability in toxicity and efficacy of drug therapy is variation in genes encoding drug-metabolizing enzymes and drug transporters. The allelic frequency of these genetic variants, linkage disequilibrium (LD), and haplotype of these polymorphisms are important parameters in determining the genetic differences between patients. The aim of this study was to explore the frequencies of polymorphisms in drug-metabolizing enzymes (CYP1A1, CYP2C9, CYP2C19, CYP3A4, CYP2D6, CYP3A5, DPYD, UGT1A1, GSTM1, GSTP1, GSTT1) and drug transporters (ABCB1[MDR1] and ABCC2[MRP2]), and to investigate the LD and perform haplotype analysis of these polymorphisms in a Dutch population. Blood samples were obtained from 100 healthy volunteers and genomic DNA was isolated and amplified by PCR. The amplification products were sequenced and analyzed for the presence of polymorphisms by sequence alignment. In the study population, we identified 13 new single nucleotide polymorphisms (SNPs) in Caucasians and three new SNPs in non-Caucasians, in addition to previously recognized SNPs. Three of the new SNPs were found within exons, of which two resulted in amino acid changes (A428T in CYP2C9 resulting in the amino acid substitution D143V; and C4461T in ABCC2 in a non-Caucasian producing the amino acid change T1476M). Several LDs and haplotypes were found in the Caucasian individuals. In this Dutch population, the frequencies of 16 new SNPs and those of previously recognized SNPs were determined in genes coding for drug-metabolizing enzymes and drug transporters. Several LDs and haplotypes were also inferred. These data are important for further research to help explain the interindividual pharmacokinetic and pharmacodynamic variability in response to drug therapy.
Directional Radio-Frequency Identification Tag Reader
NASA Technical Reports Server (NTRS)
Medelius, Pedro J.; Taylor, John D.; Henderson, John J.
2004-01-01
A directional radio-frequency identification (RFID) tag reader has been designed to facilitate finding a specific object among many objects in a crowded room. The device could be an adjunct to an electronic inventory system that tracks RFID-tagged objects as they move through reader-equipped doorways. Whereas commercial RFID-tag readers do not measure directions to tagged objects, the device is equipped with a phased-array antenna and a received signal-strength indicator (RSSI) circuit for measuring direction. At the beginning of operation, it is set to address only the RFID tag of interest. It then continuously transmits a signal to interrogate that tag while varying the radiation pattern of the antenna. It identifies the direction to the tag as the radiation pattern direction of peak strength of the signal returned by the tag. An approximate distance to the tag is calculated from the peak signal strength. The direction and distance can be displayed on a screen. A prototype containing a Yagi antenna was found to be capable of detecting a 915.5-MHz tag at a distance of approximately equal to 15 ft (approximately equal to 4.6 m).
Paris, Margot; Marcombe, Sebastien; Coissac, Eric; Corbel, Vincent; David, Jean-Philippe; Després, Laurence
2013-01-01
Mosquito control is often the main method used to reduce mosquito-transmitted diseases. In order to investigate the genetic basis of resistance to the bio-insecticide Bacillus thuringiensis subsp. israelensis (Bti), we used information on polymorphism obtained from cDNA tag sequences from pooled larvae of laboratory Bti-resistant and susceptible Aedes aegypti mosquito strains to identify and analyse 1520 single nucleotide polymorphisms (SNPs). Of the 372 SNPs tested, 99.2% were validated using DNA Illumina GoldenGate® array, with a strong correlation between the allelic frequencies inferred from the pooled and individual data (r = 0.85). A total of 11 genomic regions and five candidate genes were detected using a genome scan approach. One of these candidate genes showed significant departures from neutrality in the resistant strain at sequence level. Six natural populations from Martinique Island were sequenced for the 372 tested SNPs with a high transferability (87%), and association mapping analyses detected 14 loci associated with Bti resistance, including one located in a putative receptor for Cry11 toxins. Three of these loci were also significantly differentiated between the laboratory strains, suggesting that most of the genes associated with resistance might differ between the two environments. It also suggests that common selected regions might harbour key genes for Bti resistance. PMID:24187584
Polymorphisms within the FANCA gene associate with premature ovarian failure in Korean women.
Pyun, Jung-A; Kim, Sunshin; Cha, Dong Hyun; Kwack, KyuBum
2014-05-01
This study investigated whether polymorphisms within the Fanconi anemia complementation group A (FANCA) gene contribute to the increased risk of premature ovarian failure (POF) in Korean women. Ninety-eight women with POF and 218 controls participated in this study. Genomic DNA from peripheral blood was isolated, and GoldenGate genotyping assay was used to identify single nucleotide polymorphisms (SNPs) within the FANCA gene. Two significant SNPs (rs1006547 and rs2239359; P < 0.05) were identified by logistic regression analysis, but results were insignificant after Bonferroni correction. Six SNPs formed a linkage disequilibrium block, and three main haplotypes were found. Two of three haplotypes (AAAGAA and GGGAGG) distributed highly in the POF group, whereas the remaining haplotype (GGAAGG) distributed highly in the control group by logistic regression analysis (highest odds ratio, 2.515; 95% CI, 1.515-4.175; P = 0.00036). Our observations suggest that genetic variations in the FANCA gene may increase the risk for POF in Korean women.
Rao, Kollu Nageswara; Ritch, Robert; Dorairaj, Syril K; Kaur, Inderjeet; Liebmann, Jeffrey M; Thomas, Ravi; Chakrabarti, Subhabrata
2008-07-09
Single nucleotide polymorphisms (SNPs) in the LOXL1 gene have been implicated in exfoliation syndrome (XFS) and exfoliation glaucoma (XFG). We have shown that these SNPs are not associated with the primary glaucomas such as primary open-angle (POAG) glaucoma and primary angle-closure glaucoma (PACG). To further establish the specificity of LOXL1 SNPs for XFS and XFG, we determined whether these SNPs were involved in pigment dispersion syndrome (PDS) and pigmentary glaucoma (PG). Three SNPs of LOXL1 (rs1048661, rs3825942, and rs2165241) were screened in a cohort of 78 unrelated and clinically well characterized glaucoma cases comprising of PG (n=44) and PDS (n=34) patients as well as 108 ethnically matched normal controls of Caucasian origin. The criteria for diagnosis of PDS/PG were Krukenberg spindle, hyperpigmentation of the trabecular meshwork, and wide open angle. Transillumination defects were detected by infrared pupillography, and the presence of a Zentmayer ring was considered as a confirmatory sign. All three SNPs were genotyped in cases and controls by resequencing the genomic region of LOXL1 harboring these variants and were further confirmed by polymerase chain reaction (PCR)-based restriction digestions. Haplotypes were generated from the genotype data, and the linkage disequilibrium (LD) and haplotype analysis were done with Haploview software that uses the expectation maximization (EM) algorithm. The LOXL1 SNPs showed no significant association with PDS or PG. There was no significant difference in the frequencies of the risk alleles of rs1048661 ('G' allele; p=0.309), rs3825942 ('G' allele' p=0.461), and rs2165241 ('T' allele; p=0.432) between PG/PDS cases and controls. Similarly, there was no involvement of the XFS/XFG-associated haplotypes, 'G-G' (p=0.643; [OR=1.08, 95%CI, 0.59-1.97]) and 'T-G' (p=0.266; [OR=1.35, 95%CI, 0.70-2.60]), with the PDS/PG phenotypes. The risk haplotype 'G-G' was observed in ~55% of the normal controls. There was no
Mapping of HLA- DQ haplotypes in a group of Danish patients with celiac disease.
Lund, Flemming; Hermansen, Mette N; Pedersen, Merete F; Hillig, Thore; Toft-Hansen, Henrik; Sölétormos, György
2015-10-01
A cost-effective identification of HLA- DQ risk haplotypes using the single nucleotide polymorphism (SNP) technique has recently been applied in the diagnosis of celiac disease (CD) in four European populations. The objective of the study was to map risk HLA- DQ haplotypes in a group of Danish CD patients using the SNP technique. Cohort A: Among 65 patients with gastrointestinal symptoms we compared the HLA- DQ2 and HLA- DQ8 risk haplotypes obtained by the SNP technique (method 1) with results based on a sequence specific primer amplification technique (method 2) and a technique used in an assay from BioDiagene (method 3). Cohort B: 128 patients with histologically verified CD were tested for CD risk haplotypes (method 1). Patients with negative results were further tested for sub-haplotypes of HLA- DQ2 (methods 2 and 3). Cohort A: The three applied methods provided the same HLA- DQ2 and HLA- DQ8 results among 61 patients. Four patients were negative for the HLA- DQ2 and HLA- DQ8 haplotypes (method 1) but were positive for the HLA- DQ2.5-trans and HLA- DQ2.2 haplotypes (methods 2 and 3). Cohort B: A total of 120 patients were positive for the HLA- DQ2.5-cis and HLA- DQ8 haplotypes (method 1). The remaining seven patients were positive for HLA- DQ2.5-trans or HLA- DQ2.2 haplotypes (methods 2 and 3). One patient was negative with all three HLA methods. The HLA- DQ risk haplotypes were detected in 93.8% of the CD patients using the SNP technique (method 1). The sensitivity increased to 99.2% by combining methods 1 - 3.
NASA Astrophysics Data System (ADS)
Guo, Y.; Liu, J.; Mauzerall, D. L.; Emmons, L. K.; Horowitz, L. W.; Fan, S.; Li, X.; Tao, S.
2014-12-01
Long-range transport of ozone is of great concern, yet the source-receptor relationships derived previously depend strongly on the source attribution techniques used. Here we describe a new tagged ozone mechanism (full-tagged), the design of which seeks to take into account the combined effects of emissions of ozone precursors, CO, NOx and VOCs, from a particular source, while keeping the current state of chemical equilibrium unchanged. We label emissions from the target source (A) and background (B). When two species from A and B sources react with each other, half of the resulting products are labeled A, and half B. Thus the impact of a given source on downwind regions is recorded through tagged chemistry. We then incorporate this mechanism into the Model for Ozone and Related chemical Tracers (MOZART-4) to examine the impact of anthropogenic emissions within North America, Europe, East Asia and South Asia on ground-level ozone downwind of source regions during 1999-2000. We compare our results with two previously used methods -- the sensitivity and tagged-N approaches. The ozone attributed to a given source by the full-tagged method is more widely distributed spatially, but has weaker seasonal variability than that estimated by the other methods. On a seasonal basis, for most source/receptor pairs, the full-tagged method estimates the largest amount of tagged ozone, followed by the sensitivity and tagged-N methods. In terms of trans-Pacific influence of ozone pollution, the full-tagged method estimates the strongest impact of East Asian (EA) emissions on the western U.S. (WUS) in MAM and JJA (~3 ppbv), which is substantially different in magnitude and seasonality from tagged-N and sensitivity studies. This difference results from the full-tagged method accounting for the maintenance of peroxy radicals (e.g., CH3O2, CH3CO3, and HO2), in addition to NOy, as effective reservoirs of EA source impact across the Pacific, allowing for a significant contribution to
Allelic expression mapping across cellular lineages to establish impact of non-coding SNPs
Adoue, Veronique; Schiavi, Alicia; Light, Nicholas; Almlöf, Jonas Carlsson; Lundmark, Per; Ge, Bing; Kwan, Tony; Caron, Maxime; Rönnblom, Lars; Wang, Chuan; Chen, Shu-Huang; Goodall, Alison H; Cambien, Francois; Deloukas, Panos; Ouwehand, Willem H; Syvänen, Ann-Christine; Pastinen, Tomi
2014-01-01
Most complex disease-associated genetic variants are located in non-coding regions and are therefore thought to be regulatory in nature. Association mapping of differential allelic expression (AE) is a powerful method to identify SNPs with direct cis-regulatory impact (cis-rSNPs). We used AE mapping to identify cis-rSNPs regulating gene expression in 55 and 63 HapMap lymphoblastoid cell lines from a Caucasian and an African population, respectively, 70 fibroblast cell lines, and 188 purified monocyte samples and found 40–60% of these cis-rSNPs to be shared across cell types. We uncover a new class of cis-rSNPs, which disrupt footprint-derived de novo motifs that are predominantly bound by repressive factors and are implicated in disease susceptibility through overlaps with GWAS SNPs. Finally, we provide the proof-of-principle for a new approach for genome-wide functional validation of transcription factor–SNP interactions. By perturbing NFκB action in lymphoblasts, we identified 489 cis-regulated transcripts with altered AE after NFκB perturbation. Altogether, we perform a comprehensive analysis of cis-variation in four cell populations and provide new tools for the identification of functional variants associated to complex diseases. PMID:25326100
A novel method for in silico identification of regulatory SNPs in human genome.
Li, Rong; Zhong, Dexing; Liu, Ruiling; Lv, Hongqiang; Zhang, Xinman; Liu, Jun; Han, Jiuqiang
2017-02-21
Regulatory single nucleotide polymorphisms (rSNPs), kind of functional noncoding genetic variants, can affect gene expression in a regulatory way, and they are thought to be associated with increased susceptibilities to complex diseases. Here a novel computational approach to identify potential rSNPs is presented. Different from most other rSNPs finding methods which based on hypothesis that SNPs causing large allele-specific changes in transcription factor binding affinities are more likely to play regulatory functions, we use a set of documented experimentally verified rSNPs and nonfunctional background SNPs to train classifiers, so the discriminating features are found. To characterize variants, an extensive range of characteristics, such as sequence context, DNA structure and evolutionary conservation etc. are analyzed. Support vector machine is adopted to build the classifier model together with an ensemble method to deal with unbalanced data. 10-fold cross-validation result shows that our method can achieve accuracy with sensitivity of ~78% and specificity of ~82%. Furthermore, our method performances better than some other algorithms based on aforementioned hypothesis in handling false positives. The original data and the source matlab codes involved are available at https://sourceforge.net/projects/rsnppredict/. Copyright © 2016 Elsevier Ltd. All rights reserved.
Genetic polymorphisms in TERT are associated with increased risk of esophageal cancer.
Wu, Yifei; Yan, Mengdan; Li, Jing; Li, Jingjie; Chen, Zhengshuai; Chen, Peng; Li, Bin; Chen, Fulin; Jin, Tianbo; Chen, Chao
2017-02-07
Single nucleotide polymorphisms (SNPs) in TERT may be associated with susceptibility to esophageal cancer. In this study, we analyzed the association between TERT SNPs and risk of esophageal cancer in 386 esophageal cancer patients and 495 healthy subjects from the Xi'an area of China. Of the four SNPs examined, rs10069690 and rs2242652 were correlated with esophageal cancer risk. Additionally, after adjusting for age and gender, the "Trs10069690Ars2242652", "Trs10069690Grs2242652" haplotypes were associated with an increased risk of esophageal cancer, while the and "Crs10069690Grs2242652" haplotype was associated with a decreased risk of esophageal cancer. These findings suggest that TERT polymorphisms may contribute to the development of esophageal cancer.
Assessing transmission of ‘Candidatus Liberibacter solanacearum’ haplotypes through seed potato
USDA-ARS?s Scientific Manuscript database
Conflicting data has previously been reported concerning the impact of zebra chip disease transmission through seed tubers. These discrepancies may be due to the experimental design of each study, whereby different pathogen haplotypes, insect vector haplotypes, and potato plant varieties were used....
Zumárraga, Mercedes; Arrúe, Aurora; Basterreche, Nieves; Macías, Isabel; Catalán, Ana; Madrazo, Arantza; Bustamante, Sonia; Zamalloa, María I; Erkoreka, Leire; Gordo, Estibaliz; Arnaiz, Ainara; Olivas, Olga; Arroita, Ariane; Marín, Elena; González-Torres, Miguel A
2016-06-01
We examined the association of COMT haplotypes and plasma metabolites of catecholamines in relation to the clinical response to antipsychotics in schizophrenic and bipolar patients. We studied 165 patients before and after four weeks of treatment, and 163 healthy controls. We assessed four COMT haplotypes and the plasma concentrations of HVA, DOPAC and MHPG. Bipolar patients: haplotypes are associated with age at onset and clinical evolution. In schizophrenic patients, an haplotype previously associated with increased risk, is related to better response of negative symptoms. Haplotypes would be good indicators of the clinical status and the treatment response in bipolar and schizophrenic patients. Larger studies are required to elucidate the clinical usefulness of these findings.