Single nucleotide polymorphism and haplotype effects associated with somatic cell score in German Holstein cattle

PubMed Central

2014-01-01

Background To better understand the genetic determination of udder health, we performed a genome-wide association study (GWAS) on a population of 2354 German Holstein bulls for which daughter yield deviations (DYD) for somatic cell score (SCS) were available. For this study, we used genetic information of 44 576 informative single nucleotide polymorphisms (SNPs) and 11 725 inferred haplotype blocks. Results When accounting for the sub-structure of the analyzed population, 16 SNPs and 10 haplotypes in six genomic regions were significant at the Bonferroni threshold of P ≤ 1.14 × 10-6. The size of the identified regions ranged from 0.05 to 5.62 Mb. Genomic regions on chromosomes 5, 6, 18 and 19 coincided with known QTL affecting SCS, while additional genomic regions were found on chromosomes 13 and X. Of particular interest is the region on chromosome 6 between 85 and 88 Mb, where QTL for mastitis traits and significant SNPs for SCS in different Holstein populations coincide with our results. In all identified regions, except for the region on chromosome X, significant SNPs were present in significant haplotypes. The minor alleles of identified SNPs on chromosomes 18 and 19, and the major alleles of SNPs on chromosomes 6 and X were favorable for a lower SCS. Differences in somatic cell count (SCC) between alternative SNP alleles reached 14 000 cells/mL. Conclusions The results support the polygenic nature of the genetic determination of SCS, confirm the importance of previously reported QTL, and provide evidence for the segregation of additional QTL for SCS in Holstein cattle. The small size of the regions identified here will facilitate the search for causal genetic variations that affect gene functions. PMID:24898131

Haplotype diversity in 11 candidate genes across four populations.

PubMed

Beaty, T H; Fallin, M D; Hetmanski, J B; McIntosh, I; Chong, S S; Ingersoll, R; Sheng, X; Chakraborty, R; Scott, A F

2005-09-01

Analysis of haplotypes based on multiple single-nucleotide polymorphisms (SNP) is becoming common for both candidate gene and fine-mapping studies. Before embarking on studies of haplotypes from genetically distinct populations, however, it is important to consider variation both in linkage disequilibrium (LD) and in haplotype frequencies within and across populations, as both vary. Such diversity will influence the choice of "tagging" SNPs for candidate gene or whole-genome association studies because some markers will not be polymorphic in all samples and some haplotypes will be poorly represented or completely absent. Here we analyze 11 genes, originally chosen as candidate genes for oral clefts, where multiple markers were genotyped on individuals from four populations. Estimated haplotype frequencies, measures of pairwise LD, and genetic diversity were computed for 135 European-Americans, 57 Chinese-Singaporeans, 45 Malay-Singaporeans, and 46 Indian-Singaporeans. Patterns of pairwise LD were compared across these four populations and haplotype frequencies were used to assess genetic variation. Although these populations are fairly similar in allele frequencies and overall patterns of LD, both haplotype frequencies and genetic diversity varied significantly across populations. Such haplotype diversity has implications for designing studies of association involving samples from genetically distinct populations.

FamLBL: detecting rare haplotype disease association based on common SNPs using case-parent triads.

PubMed

Wang, Meng; Lin, Shili

2014-09-15

In recent years, there has been an increasing interest in using common single-nucleotide polymorphisms (SNPs) amassed in genome-wide association studies to investigate rare haplotype effects on complex diseases. Evidence has suggested that rare haplotypes may tag rare causal single-nucleotide variants, making SNP-based rare haplotype analysis not only cost effective, but also more valuable for detecting causal variants. Although a number of methods for detecting rare haplotype association have been proposed in recent years, they are population based and thus susceptible to population stratification. We propose family-triad-based logistic Bayesian Lasso (famLBL) for estimating effects of haplotypes on complex diseases using SNP data. By choosing appropriate prior distribution, effect sizes of unassociated haplotypes can be shrunk toward zero, allowing for more precise estimation of associated haplotypes, especially those that are rare, thereby achieving greater detection power. We evaluate famLBL using simulation to gauge its type I error and power. Compared with its population counterpart, LBL, highlights famLBL's robustness property in the presence of population substructure. Further investigation by comparing famLBL with Family-Based Association Test (FBAT) reveals its advantage for detecting rare haplotype association. famLBL is implemented as an R-package available at http://www.stat.osu.edu/∼statgen/SOFTWARE/LBL/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Haplotypes composed of minor frequency single nucleotide polymorphisms of the TNF gene protect from progression into sepsis: A study using the new sepsis classification.

PubMed

Retsas, Theodoros; Huse, Klaus; Lazaridis, Lazaros-Dimitrios; Karampela, Niki; Bauer, Michael; Platzer, Matthias; Kolonia, Virginia; Papageorgiou, Eirini; Giamarellos-Bourboulis, Evangelos J; Dimopoulos, George

2018-02-01

Several articles have provided conflicting results regarding the role of single nucleotide polymorphisms (SNPs) in the promoter region of the TNF gene in susceptibility to sepsis. Former articles have been based on previous definitions of sepsis. This study investigated the influence of TNF haplotypes on the development of sepsis using the new Sepsis-3 definitions. DNA was isolated from patients suffering from infection and systemic inflammatory response syndrome. Haplotyping was performed for six SNPs of TNF. The serum levels of tumour necrosis factor alpha (TNF-α) of these patients were measured using an enzyme immunosorbent assay. Patients were classified into infection and sepsis categories using the Sepsis-3 definitions. Associations between the TNF haplotypes and the clinical characteristics and serum TNF-α levels of the patients were examined. The most common TNF haplotype h1 was composed of major alleles of the studied SNPs. Carriage of haplotypes composed of minor frequency alleles was associated with a lower risk of developing sepsis (odds ratio 0.41, 95% confidence interval 0.19-0.88, p=0.022), but this did not affect the 28-day outcome. Serum TNF-α levels were significantly higher among patients homozygous for h1 haplotypes who developed sepsis compared to infection (p=0.032); a similar result was not observed for patients carrying other haplotypes. Haplotypes containing minor frequency SNP alleles of TNF protect against the development of sepsis without affecting the outcome. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

The effect of missing data on linkage disequilibrium mapping and haplotype association analysis in the GAW14 simulated datasets

PubMed Central

McCaskie, Pamela A; Carter, Kim W; McCaskie, Simon R; Palmer, Lyle J

2005-01-01

We used our newly developed linkage disequilibrium (LD) plotting software, JLIN, to plot linkage disequilibrium between pairs of single-nucleotide polymorphisms (SNPs) for three chromosomes of the Genetic Analysis Workshop 14 Aipotu simulated population to assess the effect of missing data on LD calculations. Our haplotype analysis program, SIMHAP, was used to assess the effect of missing data on haplotype-phenotype association. Genotype data was removed at random, at levels of 1%, 5%, and 10%, and the LD calculations and haplotype association results for these levels of missingness were compared to those for the complete dataset. It was concluded that ignoring individuals with missing data substantially affects the number of regions of LD detected which, in turn, could affect tagging SNPs chosen to generate haplotypes. PMID:16451612

The clinical application of single-sperm-based SNP haplotyping for PGD of osteogenesis imperfecta.

PubMed

Chen, Linjun; Diao, Zhenyu; Xu, Zhipeng; Zhou, Jianjun; Yan, Guijun; Sun, Haixiang

2018-05-15

Osteogenesis imperfecta (OI) is a genetically heterogeneous disorder, presenting either autosomal dominant, autosomal recessive or X-linked inheritance patterns. The majority of OI cases are autosomal dominant and are caused by heterozygous mutations in either the COL1A1 or COL1A2 gene. In these dominant disorders, allele dropout (ADO) can lead to misdiagnosis in preimplantation genetic diagnosis (PGD). Polymorphic markers linked to the mutated genes have been used to establish haplotypes for identifying ADO and ensuring the accuracy of PGD. However, the haplotype of male patients cannot be determined without data from affected relatives. Here, we developed a method for single-sperm-based single-nucleotide polymorphism (SNP) haplotyping via next-generation sequencing (NGS) for the PGD of OI. After NGS, 10 informative polymorphic SNP markers located upstream and downstream of the COL1A1 gene and its pathogenic mutation site were linked to individual alleles in a single sperm from an affected male. After haplotyping, a normal blastocyst was transferred to the uterus for a subsequent frozen embryo transfer cycle. The accuracy of PGD was confirmed by amniocentesis at 19 weeks of gestation. A healthy infant weighing 4,250 g was born via vaginal delivery at the 40th week of gestation. Single-sperm-based SNP haplotyping can be applied for PGD of any monogenic disorders or de novo mutations in males in whom the haplotype of paternal mutations cannot be determined due to a lack of affected relatives. ADO: allele dropout; DI: dentinogenesis imperfect; ESHRE: European Society of Human Reproduction and Embryology; FET: frozen embryo transfer; gDNA: genomic DNA; ICSI: intracytoplasmic sperm injection; IVF: in vitro fertilization; MDA: multiple displacement amplification; NGS: next-generation sequencing; OI: osteogenesis imperfect; PBS: phosphate buffer saline; PCR: polymerase chain reaction; PGD: preimplantation genetic diagnosis; SNP: single-nucleotide polymorphism; STR

Effective detection of human leukocyte antigen risk alleles in celiac disease using tag single nucleotide polymorphisms.

PubMed

Monsuur, Alienke J; de Bakker, Paul I W; Zhernakova, Alexandra; Pinto, Dalila; Verduijn, Willem; Romanos, Jihane; Auricchio, Renata; Lopez, Ana; van Heel, David A; Crusius, J Bart A; Wijmenga, Cisca

2008-05-28

The HLA genes, located in the MHC region on chromosome 6p21.3, play an important role in many autoimmune disorders, such as celiac disease (CD), type 1 diabetes (T1D), rheumatoid arthritis, multiple sclerosis, psoriasis and others. Known HLA variants that confer risk to CD, for example, include DQA1*05/DQB1*02 (DQ2.5) and DQA1*03/DQB1*0302 (DQ8). To diagnose the majority of CD patients and to study disease susceptibility and progression, typing these strongly associated HLA risk factors is of utmost importance. However, current genotyping methods for HLA risk factors involve many reactions, and are complicated and expensive. We sought a simple experimental approach using tagging SNPs that predict the CD-associated HLA risk factors. Our tagging approach exploits linkage disequilibrium between single nucleotide polymorphism (SNPs) and the CD-associated HLA risk factors DQ2.5 and DQ8 that indicate direct risk, and DQA1*0201/DQB1*0202 (DQ2.2) and DQA1*0505/DQB1*0301 (DQ7) that attribute to the risk of DQ2.5 to CD. To evaluate the predictive power of this approach, we performed an empirical comparison of the predicted DQ types, based on these six tag SNPs, with those executed with current validated laboratory typing methods of the HLA-DQA1 and -DQB1 genes in three large cohorts. The results were validated in three European celiac populations. Using this method, only six SNPs were needed to predict the risk types carried by >95% of CD patients. We determined that for this tagging approach the sensitivity was >0.991, specificity >0.996 and the predictive value >0.948. Our results show that this tag SNP method is very accurate and provides an excellent basis for population screening for CD. This method is broadly applicable in European populations.

OAS single-nucleotide polymorphisms and haplotypes are associated with variations in immune responses to rubella vaccine

PubMed Central

Haralambieva, Iana H.; Dhiman, Neelam; Ovsyannikova, Inna G.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

2010-01-01

Interferon (IFN)-induced antiviral genes are crucial players in innate antiviral defense and potential determinants of immune response heterogeneity. We selected 114 candidate SNPs from 12 antiviral genes using an LD tagSNP selection approach and genotyped them in a cohort of 738 schoolchildren immunized with two doses of rubella vaccine. Associations between SNPs/haplotypes and rubella virus-specific immune measures were assessed using linear regression methodologies. We identified 23 significant associations (p<0.05) between polymorphisms within the 2′-5′-oligoadenylate synthetase (OAS) gene cluster, and rubella virus-specific IL-2, IL-10, IL-6 secretion and antibody levels. The minor allele variants of three OAS1 SNPs (rs3741981/Ser162Gly, rs1051042/Thr361Arg, rs2660), located in a linkage disequilibrium block of functional importance, were significantly associated with an increase in rubella virus-specific IL-2/Th1 response (p≤0.024). Seven OAS1 and OAS3 promoter/regulatory SNPs were similarly associated with IL-2 secretion. Importantly, two SNPs (rs3741981 and rs10774670), independently cross-regulated rubella virus-specific IL-10 secretion levels (p≤0.031). Furthermore, both global tests and individual haplotype analyses revealed significant associations between OAS1 haplotypes and rubella virus-specific cytokine secretion. Our results suggest that innate immunity and OAS genetic variations are likely involved in modulating the magnitude and quality of the adaptive immune responses to live attenuated rubella vaccine. PMID:20079393

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

A High-Throughput Data Mining of Single Nucleotide Polymorphisms in Coffea Species Expressed Sequence Tags Suggests Differential Homeologous Gene Expression in the Allotetraploid Coffea arabica1[W

PubMed Central

Vidal, Ramon Oliveira; Mondego, Jorge Maurício Costa; Pot, David; Ambrósio, Alinne Batista; Andrade, Alan Carvalho; Pereira, Luiz Filipe Protasio; Colombo, Carlos Augusto; Vieira, Luiz Gonzaga Esteves; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães

2010-01-01

Polyploidization constitutes a common mode of evolution in flowering plants. This event provides the raw material for the divergence of function in homeologous genes, leading to phenotypic novelty that can contribute to the success of polyploids in nature or their selection for use in agriculture. Mounting evidence underlined the existence of homeologous expression biases in polyploid genomes; however, strategies to analyze such transcriptome regulation remained scarce. Important factors regarding homeologous expression biases remain to be explored, such as whether this phenomenon influences specific genes, how paralogs are affected by genome doubling, and what is the importance of the variability of homeologous expression bias to genotype differences. This study reports the expressed sequence tag assembly of the allopolyploid Coffea arabica and one of its direct ancestors, Coffea canephora. The assembly was used for the discovery of single nucleotide polymorphisms through the identification of high-quality discrepancies in overlapped expressed sequence tags and for gene expression information indirectly estimated by the transcript redundancy. Sequence diversity profiles were evaluated within C. arabica (Ca) and C. canephora (Cc) and used to deduce the transcript contribution of the Coffea eugenioides (Ce) ancestor. The assignment of the C. arabica haplotypes to the C. canephora (CaCc) or C. eugenioides (CaCe) ancestral genomes allowed us to analyze gene expression contributions of each subgenome in C. arabica. In silico data were validated by the quantitative polymerase chain reaction and allele-specific combination TaqMAMA-based method. The presence of differential expression of C. arabica homeologous genes and its implications in coffee gene expression, ontology, and physiology are discussed. PMID:20864545

Identification of single nucleotide polymorphism in ginger using expressed sequence tags

PubMed Central

Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J

2009-01-01

Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184

Genetic analysis of autoimmune regulator haplotypes in alopecia areata.

PubMed

Wengraf, D A; McDonagh, A J G; Lovewell, T R J; Vasilopoulos, Y; Macdonald-Hull, S P; Cork, M J; Messenger, A G; Tazi-Ahnini, R

2008-03-01

Alopecia areata is an immune-mediated disorder, occurring with the highest observed frequency in the rare recessive autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) syndrome caused by mutations of the autoimmune regulator (AIRE) gene on chromosome 21q22.3. We have previously detected association between alopecia areata and a single nucleotide polymorphism (SNP) in the AIRE gene in patients without APECED, and we now report the findings of an extended examination of the association of alopecia areata with haplotype analysis including six SNPs in the AIRE gene: C-103T, C4144G, T5238C, G6528A, T7215C and T11787C. In Caucasian groups of 295 patients and 363 controls, we found strong association between the AIRE 7215C allele and AA [P = 3.8 x 10(-8), OR (95% CI): 2.69 (1.8-4.0)]. The previously reported association between AA and the AIRE 4144G allele was no longer significant on correction for multiple testing. The AIRE haplotypes CCTGCT and CGTGCC showed a highly significant association with AA [P = 6.05 x 10(-6), 9.47 (2.91-30.8) and P = 0.001, 3.51 (1.55-7.95), respectively]. To select the haplotypes most informative for analysis, we tagged the polymorphisms using SNPTag software. Employing AIRE C-103T, G6528A, T7215C and T11787C as tag SNPs, two haplotypes were associated with AA; AIRE CGCT and AIRE CGCC [P = 3.84 x 10(-7), 11.40 (3.53-36.9) and P = 3.94 x 10(-4), 2.13 (1.39-3.24) respectively]. The AIRE risk haplotypes identified in this study potentially account for a major component of the genetic risk of developing alopecia areata.

Decision Tree Algorithm-Generated Single-Nucleotide Polymorphism Barcodes of rbcL Genes for 38 Brassicaceae Species Tagging.

PubMed

Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei

2018-01-01

DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.

Identification of rheumatoid arthritis biomarkers based on single nucleotide polymorphisms and haplotype blocks: A systematic review and meta-analysis

PubMed Central

Saad, Mohamed N.; Mabrouk, Mai S.; Eldeib, Ayman M.; Shaker, Olfat G.

2015-01-01

Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA) is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP) approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field. PMID:26843965

Common PCSK1 haplotypes are associated with obesity in the Chinese population.

PubMed

Chang, Yi-Cheng; Chiu, Yen-Feng; Shih, Kuang-Chung; Lin, Ming-Wei; Sheu, Wayne Huey-Herng; Donlon, Timothy; Curb, Jess David; Jou, Yuh-Shan; Chang, Tien-Jyun; Li, Hung-Yuan; Chuang, Lee-Ming

2010-07-01

Prohormone convertase subtilisin/kexin type 1 (PCSK1) genetic polymorphisms have recently been associated with obesity in European populations. This study aimed to examine whether common PCSK1 genetic variation is associated with obesity and related metabolic phenotypes in the Chinese population. We genotyped nine common tag single-nucleotide polymorphisms (tagSNP) of the PCSK1 gene in 1,094 subjects of Chinese origin from the Stanford Asia-Pacific Program for Hypertension and Insulin Resistance (SAPPHIRe) family study. One SNP in the PCSK1 gene (rs155971) were nominally associated with risk of obesity in the SAPPHIRe cohort (P = 0.01). A common protective haplotype was associated with reduced risk of obesity (23.79% vs. 32.89%, P = 0.01) and smaller waist circumference (81.71 +/- 10.22 vs. 84.75 +/- 10.48 cm, P = 0.02). Another common haplotype was significantly associated with increased risk of obesity (37.07% vs. 23.84%, P = 0.005). The global P value for haplotype association with obesity was 0.02. We also identified a suggestive association of another PCSK1 SNP (rs3811951) with fasting glucose, fasting insulin, homeostasis model assessment of insulin resistance (HOMA(IR)), triglycerides, and high-density lipoprotein cholesterol (P = 0.05, 0.003, 0.001, 0.04, and 0.04, respectively). These data indicate common PCSK1 genetic variants are associated with obesity in the Chinese population.

Nucleotide-binding oligomerization domain containing 1 (NOD1) haplotypes and single nucleotide polymorphisms modify susceptibility to inflammatory bowel diseases in a New Zealand caucasian population: a case-control study

PubMed Central

Huebner, Claudia; Ferguson, Lynnette R; Han, Dug Yeo; Philpott, Martin; Barclay, Murray L; Gearry, Richard B; McCulloch, Alan; Demmers, Pieter S; Browning, Brian L

2009-01-01

Background The nucleotide-binding oligomerization domain containing 1 (NOD1) gene encodes a pattern recognition receptor that senses pathogens, leading to downstream responses characteristic of innate immunity. We investigated the role of NOD1 single nucleotide polymorphisms (SNPs) on IBD risk in a New Zealand Caucasian population, and studied Nod1 expression in response to bacterial invasion in the Caco2 cell line. Findings DNA samples from 388 Crohn's disease (CD), 405 ulcerative colitis (UC), 27 indeterminate colitis patients and 201 randomly selected controls, from Canterbury, New Zealand were screened for 3 common SNPs in NOD1, using the MassARRAY® iPLEX Gold assay. Transcriptional activation of the protein produced by NOD1 (Nod1) was studied after infection of Caco2 cells with Escherichia coli LF82. Carrying the rs2075818 G allele decreased the risk of CD (OR = 0.66, 95% CI = 0.50–0.88, p < 0.002) but not UC. There was an increased frequency of the three SNP (rs2075818, rs2075822, rs2907748) haplotype, CTG (p = 0.004) and a decreased frequency of the GTG haplotype (p = 0.02).in CD. The rs2075822 CT or TT genotypes were at an increased frequency (genotype p value = 0.02), while the rs2907748 AA or AG genotypes showed decreased frequencies in UC (p = 0.04), but not in CD. Functional assays showed that Nod1 is produced 6 hours after bacterial invasion of the Caco2 cell line. Conclusion The NOD1 gene is important in signalling invasion of colonic cells by pathogenic bacteria, indicative of its' key role in innate immunity. Carrying specific SNPs in this gene significantly modifies the risk of CD and/or UC in a New Zealand Caucasian population. PMID:19327158

Tag SNP selection via a genetic algorithm.

PubMed

Mahdevar, Ghasem; Zahiri, Javad; Sadeghi, Mehdi; Nowzari-Dalini, Abbas; Ahrabian, Hayedeh

2010-10-01

Single Nucleotide Polymorphisms (SNPs) provide valuable information on human evolutionary history and may lead us to identify genetic variants responsible for human complex diseases. Unfortunately, molecular haplotyping methods are costly, laborious, and time consuming; therefore, algorithms for constructing full haplotype patterns from small available data through computational methods, Tag SNP selection problem, are convenient and attractive. This problem is proved to be an NP-hard problem, so heuristic methods may be useful. In this paper we present a heuristic method based on genetic algorithm to find reasonable solution within acceptable time. The algorithm was tested on a variety of simulated and experimental data. In comparison with the exact algorithm, based on brute force approach, results show that our method can obtain optimal solutions in almost all cases and runs much faster than exact algorithm when the number of SNP sites is large. Our software is available upon request to the corresponding author.

Haplotype-Based Genotyping in Polyploids.

PubMed

Clevenger, Josh P; Korani, Walid; Ozias-Akins, Peggy; Jackson, Scott

2018-01-01

Accurate identification of polymorphisms from sequence data is crucial to unlocking the potential of high throughput sequencing for genomics. Single nucleotide polymorphisms (SNPs) are difficult to accurately identify in polyploid crops due to the duplicative nature of polyploid genomes leading to low confidence in the true alignment of short reads. Implementing a haplotype-based method in contrasting subgenome-specific sequences leads to higher accuracy of SNP identification in polyploids. To test this method, a large-scale 48K SNP array (Axiom Arachis2) was developed for Arachis hypogaea (peanut), an allotetraploid, in which 1,674 haplotype-based SNPs were included. Results of the array show that 74% of the haplotype-based SNP markers could be validated, which is considerably higher than previous methods used for peanut. The haplotype method has been implemented in a standalone program, HAPLOSWEEP, which takes as input bam files and a vcf file and identifies haplotype-based markers. Haplotype discovery can be made within single reads or span paired reads, and can leverage long read technology by targeting any length of haplotype. Haplotype-based genotyping is applicable in all allopolyploid genomes and provides confidence in marker identification and in silico-based genotyping for polyploid genomics.

A powerful approach reveals numerous expression quantitative trait haplotypes in multiple tissues.

PubMed

Ying, Dingge; Li, Mulin Jun; Sham, Pak Chung; Li, Miaoxin

2018-04-26

Recently many studies showed single nucleotide polymorphisms (SNPs) affect gene expression and contribute to development of complex traits/diseases in a tissue context-dependent manner. However, little is known about haplotype's influence on gene expression and complex traits, which reflects the interaction effect between SNPs. In the present study, we firstly proposed a regulatory region guided eQTL haplotype association analysis approach, and then systematically investigate the expression quantitative trait loci (eQTL) haplotypes in 20 different tissues by the approach. The approach has a powerful design of reducing computational burden by the utilization of regulatory predictions for candidate SNP selection and multiple testing corrections on non-independent haplotypes. The application results in multiple tissues showed that haplotype-based eQTLs not only increased the number of eQTL genes in a tissue specific manner, but were also enriched in loci that associated with complex traits in a tissue-matched manner. In addition, we found that tag SNPs of eQTL haplotypes from whole blood were selectively enriched in certain combination of regulatory elements (e.g. promoters and enhancers) according to predicted chromatin states. In summary, this eQTL haplotype detection approach, together with the application results, shed insights into synergistic effect of sequence variants on gene expression and their susceptibility to complex diseases. The executable application "eHaplo" is implemented in Java and is publicly available at http://grass.cgs.hku.hk/limx/ehaplo/. jonsonfox@gmail.com, limiaoxin@mail.sysu.edu.cn. Supplementary data are available at Bioinformatics online.

A mixed integer linear programming model to reconstruct phylogenies from single nucleotide polymorphism haplotypes under the maximum parsimony criterion

PubMed Central

2013-01-01

Background Phylogeny estimation from aligned haplotype sequences has attracted more and more attention in the recent years due to its importance in analysis of many fine-scale genetic data. Its application fields range from medical research, to drug discovery, to epidemiology, to population dynamics. The literature on molecular phylogenetics proposes a number of criteria for selecting a phylogeny from among plausible alternatives. Usually, such criteria can be expressed by means of objective functions, and the phylogenies that optimize them are referred to as optimal. One of the most important estimation criteria is the parsimony which states that the optimal phylogeny T∗for a set H of n haplotype sequences over a common set of variable loci is the one that satisfies the following requirements: (i) it has the shortest length and (ii) it is such that, for each pair of distinct haplotypes hi,hj∈H, the sum of the edge weights belonging to the path from hi to hj in T∗ is not smaller than the observed number of changes between hi and hj. Finding the most parsimonious phylogeny for H involves solving an optimization problem, called the Most Parsimonious Phylogeny Estimation Problem (MPPEP), which is NP-hard in many of its versions. Results In this article we investigate a recent version of the MPPEP that arises when input data consist of single nucleotide polymorphism haplotypes extracted from a population of individuals on a common genomic region. Specifically, we explore the prospects for improving on the implicit enumeration strategy of implicit enumeration strategy used in previous work using a novel problem formulation and a series of strengthening valid inequalities and preliminary symmetry breaking constraints to more precisely bound the solution space and accelerate implicit enumeration of possible optimal phylogenies. We present the basic formulation and then introduce a series of provable valid constraints to reduce the solution space. We then prove

Ultraaccurate genome sequencing and haplotyping of single human cells.

PubMed

Chu, Wai Keung; Edge, Peter; Lee, Ho Suk; Bansal, Vikas; Bafna, Vineet; Huang, Xiaohua; Zhang, Kun

2017-11-21

Accurate detection of variants and long-range haplotypes in genomes of single human cells remains very challenging. Common approaches require extensive in vitro amplification of genomes of individual cells using DNA polymerases and high-throughput short-read DNA sequencing. These approaches have two notable drawbacks. First, polymerase replication errors could generate tens of thousands of false-positive calls per genome. Second, relatively short sequence reads contain little to no haplotype information. Here we report a method, which is dubbed SISSOR (single-stranded sequencing using microfluidic reactors), for accurate single-cell genome sequencing and haplotyping. A microfluidic processor is used to separate the Watson and Crick strands of the double-stranded chromosomal DNA in a single cell and to randomly partition megabase-size DNA strands into multiple nanoliter compartments for amplification and construction of barcoded libraries for sequencing. The separation and partitioning of large single-stranded DNA fragments of the homologous chromosome pairs allows for the independent sequencing of each of the complementary and homologous strands. This enables the assembly of long haplotypes and reduction of sequence errors by using the redundant sequence information and haplotype-based error removal. We demonstrated the ability to sequence single-cell genomes with error rates as low as 10 -8 and average 500-kb-long DNA fragments that can be assembled into haplotype contigs with N50 greater than 7 Mb. The performance could be further improved with more uniform amplification and more accurate sequence alignment. The ability to obtain accurate genome sequences and haplotype information from single cells will enable applications of genome sequencing for diverse clinical needs. Copyright © 2017 the Author(s). Published by PNAS.

Fine definition of the pedigree haplotypes of closely related rice cultivars by means of genome-wide discovery of single-nucleotide polymorphisms.

PubMed

Yamamoto, Toshio; Nagasaki, Hideki; Yonemaru, Jun-ichi; Ebana, Kaworu; Nakajima, Maiko; Shibaya, Taeko; Yano, Masahiro

2010-04-27

To create useful gene combinations in crop breeding, it is necessary to clarify the dynamics of the genome composition created by breeding practices. A large quantity of single-nucleotide polymorphism (SNP) data is required to permit discrimination of chromosome segments among modern cultivars, which are genetically related. Here, we used a high-throughput sequencer to conduct whole-genome sequencing of an elite Japanese rice cultivar, Koshihikari, which is closely related to Nipponbare, whose genome sequencing has been completed. Then we designed a high-throughput typing array based on the SNP information by comparison of the two sequences. Finally, we applied this array to analyze historical representative rice cultivars to understand the dynamics of their genome composition. The total 5.89-Gb sequence for Koshihikari, equivalent to 15.7 x the entire rice genome, was mapped using the Pseudomolecules 4.0 database for Nipponbare. The resultant Koshihikari genome sequence corresponded to 80.1% of the Nipponbare sequence and led to the identification of 67,051 SNPs. A high-throughput typing array consisting of 1917 SNP sites distributed throughout the genome was designed to genotype 151 representative Japanese cultivars that have been grown during the past 150 years. We could identify the ancestral origin of the pedigree haplotypes in 60.9% of the Koshihikari genome and 18 consensus haplotype blocks which are inherited from traditional landraces to current improved varieties. Moreover, it was predicted that modern breeding practices have generally decreased genetic diversity Detection of genome-wide SNPs by both high-throughput sequencer and typing array made it possible to evaluate genomic composition of genetically related rice varieties. With the aid of their pedigree information, we clarified the dynamics of chromosome recombination during the historical rice breeding process. We also found several genomic regions decreasing genetic diversity which might be

Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana).

PubMed

Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila

2010-07-16

Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A

Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana)

PubMed Central

2010-01-01

Background Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Results Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M

HLA Type Inference via Haplotypes Identical by Descent

NASA Astrophysics Data System (ADS)

Setty, Manu N.; Gusev, Alexander; Pe'Er, Itsik

The Human Leukocyte Antigen (HLA) genes play a major role in adaptive immune response and are used to differentiate self antigens from non self ones. HLA genes are hyper variable with nearly every locus harboring over a dozen alleles. This variation plays an important role in susceptibility to multiple autoimmune diseases and needs to be matched on for organ transplantation. Unfortunately, HLA typing by serological methods is time consuming and expensive compared to high throughput Single Nucleotide Polymorphism (SNP) data. We present a new computational method to infer per-locus HLA types using shared segments Identical By Descent (IBD), inferred from SNP genotype data. IBD information is modeled as graph where shared haplotypes are explored among clusters of individuals with known and unknown HLA types to identify the latter. We analyze performance of the method in a previously typed subset of the HapMap population, achieving accuracy of 96% in HLA-A, 94% in HLA-B, 95% in HLA-C, 77% in HLA-DR1, 93% in HLA-DQA1 and 90% in HLA-DQB1 genes. We compare our method to a tag SNP based approach and demonstrate higher sensitivity and specificity. Our method demonstrates the power of using shared haplotype segments for large-scale imputation at the HLA locus.

Association of galanin haplotypes with alcoholism and anxiety in two ethnically distinct populations

PubMed Central

Belfer, I; Hipp, H; McKnight, C; Evans, C; Buzas, B; Bollettino, A; Albaugh, B; Virkkunen, M; Yuan, Q; Max, MB; Goldman, D; Enoch, MA

2009-01-01

The neuropeptide galanin (GAL) is widely expressed in the central nervous system. Animal studies have implicated GAL in alcohol abuse and anxiety: chronic ethanol intake increases hypothalamic GAL mRNA; high levels of stress increase GAL release in the central amygdala. The coding sequence of the galanin gene, GAL, is highly conserved and a functional polymorphism has not yet been found. The aim of our study was, for the first time, to identify GAL haplotypes and investigate associations with alcoholism and anxiety. Seven single-nucleotide polymorphisms (SNPs) spanning GAL were genotyped in 65 controls from five populations: US and Finnish Caucasians, African Americans, Plains and Southwestern Indians. A single haplotype block with little evidence of historical recombination was observed for each population. Four tag SNPs were then genotyped in DSM-III-R lifetime alcoholics and nonalcoholics from two population isolates: 514 Finnish Caucasian men and 331 Plains Indian men and women. Tridimensional Personality Questionnaire harm avoidance (HA) scores, a dimensional measure of anxiety, were obtained. There was a haplotype association with alcoholism in both the Finnish (P=0.001) and Plains Indian (P=0.004) men. The SNPs were also significantly associated. Alcoholics were divided into high and low HA groups (≥ and < mean HA of population). In the Finns, haplotype (P < 0.0001) and diplotype (P < 0.0001) distributions differed between high HA alcoholics, low HA alcoholics and nonalcoholics. Our results from two independent populations suggest that GAL may contribute to vulnerability to alcoholism, perhaps mediated by dimensional anxiety. PMID:16314872

Single nucleotide polymorphisms of TNF-Α gene in febrile seizures.

PubMed

Zare-Shahabadi, Ameneh; Ashrafi, Mahmoud Reza; Shahrokhi, Amin; Soltani, Samaneh; Zoghi, Samaneh; Soleimani, Farin; Vameghi, Roshanak; Badv, Reza Shervin; Rezaei, Nima

2015-09-15

Febrile seizures (FS) is the most common seizure disorder during childhood. This study was performed in 78 patients with FS and 137 control subjects to assess polymorphisms of the TNF-α gene at positions -308 and -238, using the polymerase chain reaction and the sequence specific primers method. The highest positive allelic association that made the patients susceptible to FS was seen for TNF-α -238/G (p<0.0001). The GG genotype at TNF-α -238 was significantly higher in the patients with FS, compared to the controls (p=0.0001). Also, GA genotype at the same position was significantly lower in patients than in controls (P=0.0001). The GG haplotype had a significant positive association at TNF-α (308, 238) while GA haplotype showed a negative association (P<0.001). Our data support the idea that TNF-α single-nucleotide polymorphisms play a role in the pathogenesis of FS. Copyright © 2015 Elsevier B.V. All rights reserved.

Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

PubMed

Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

2012-01-01

We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

Combination Testing Using a Single MSH5 Variant alongside HLA Haplotypes Improves the Sensitivity of Predicting Coeliac Disease Risk in the Polish Population.

PubMed

Paziewska, Agnieszka; Cukrowska, Bozena; Dabrowska, Michalina; Goryca, Krzysztof; Piatkowska, Magdalena; Kluska, Anna; Mikula, Michal; Karczmarski, Jakub; Oralewska, Beata; Rybak, Anna; Socha, Jerzy; Balabas, Aneta; Zeber-Lubecka, Natalia; Ambrozkiewicz, Filip; Konopka, Ewa; Trojanowska, Ilona; Zagroba, Malgorzata; Szperl, Malgorzata; Ostrowski, Jerzy

2015-01-01

Assessment of non-HLA variants alongside standard HLA testing was previously shown to improve the identification of potential coeliac disease (CD) patients. We intended to identify new genetic variants associated with CD in the Polish population that would improve CD risk prediction when used alongside HLA haplotype analysis. DNA samples of 336 CD and 264 unrelated healthy controls were used to create DNA pools for a genome wide association study (GWAS). GWAS findings were validated with individual HLA tag single nucleotide polymorphism (SNP) typing of 473 patients and 714 healthy controls. Association analysis using four HLA-tagging SNPs showed that, as was found in other populations, positive predicting genotypes (HLA-DQ2.5/DQ2.5, HLA-DQ2.5/DQ2.2, and HLA-DQ2.5/DQ8) were found at higher frequencies in CD patients than in healthy control individuals in the Polish population. Both CD-associated SNPs discovered by GWAS were found in the CD susceptibility region, confirming the previously-determined association of the major histocompatibility (MHC) region with CD pathogenesis. The two most significant SNPs from the GWAS were rs9272346 (HLA-dependent; localized within 1 Kb of DQA1) and rs3130484 (HLA-independent; mapped to MSH5). Specificity of CD prediction using the four HLA-tagging SNPs achieved 92.9%, but sensitivity was only 45.5%. However, when a testing combination of the HLA-tagging SNPs and the MSH5 SNP was used, specificity decreased to 80%, and sensitivity increased to 74%. This study confirmed that improvement of CD risk prediction sensitivity could be achieved by including non-HLA SNPs alongside HLA SNPs in genetic testing.

Haplotype Structure of the ENPP1 Gene and Nominal Association of the K121Q Missense Single Nucleotide Polymorphism With Glycemic Traits in the Framingham Heart Study

PubMed Central

Stolerman, Elliot S.; Manning, Alisa K.; McAteer, Jarred B.; Dupuis, Josée; Fox, Caroline S.; Cupples, L. Adrienne; Meigs, James B.; Florez, Jose C.

2008-01-01

OBJECTIVE—A recent meta-analysis demonstrated a nominal association of the ectonucleotide pyrophosphatase phosphodiesterase 1 (ENPP1) K→Q missense single nucleotide polymorphism (SNP) at position 121 with type 2 diabetes. We set out to confirm the association of ENPP1 K121Q with hyperglycemia, expand this association to insulin resistance traits, and determine whether the association stems from K121Q or another variant in linkage disequilibrium with it. RESEARCH DESIGN AND METHODS—We characterized the haplotype structure of ENPP1 and selected 39 tag SNPs that captured 96% of common variation in the region (minor allele frequency ≥5%) with an r2 value ≥0.80. We genotyped the SNPs in 2,511 Framingham Heart Study participants and used age- and sex-adjusted linear mixed effects (LME) models to test for association with quantitative metabolic traits. We also examined whether interaction between K121Q and BMI affected glycemic trait levels. RESULTS—The Q allele of K121Q (rs1044498) was associated with increased fasting plasma glucose (FPG), A1C, fasting insulin, and insulin resistance by homeostasis model assessment (HOMA-IR; all P = 0.01–0.006). Two noncoding SNPs (rs7775386 and rs7773477) demonstrated similar associations, but LME models indicated that their effects were not independent from K121Q. We found no association of K121Q with obesity, but interaction models suggested that the effect of the Q allele on FPG and HOMA-IR was stronger in those with a higher BMI (P = 0.008 and 0.01 for interaction, respectively). CONCLUSIONS—The Q allele of ENPP1 K121Q is associated with hyperglycemia and insulin resistance in whites. We found an adiposity-SNP interaction, with a stronger association of K121Q with diabetes-related quantitative traits in people with a higher BMI. PMID:18426862

Population Structure With Localized Haplotype Clusters

PubMed Central

Browning, Sharon R.; Weir, Bruce S.

2010-01-01

We propose a multilocus version of FST and a measure of haplotype diversity using localized haplotype clusters. Specifically, we use haplotype clusters identified with BEAGLE, which is a program implementing a hidden Markov model for localized haplotype clustering and performing several functions including inference of haplotype phase. We apply this methodology to HapMap phase 3 data. With this haplotype-cluster approach, African populations have highest diversity and lowest divergence from the ancestral population, East Asian populations have lowest diversity and highest divergence, and other populations (European, Indian, and Mexican) have intermediate levels of diversity and divergence. These relationships accord with expectation based on other studies and accepted models of human history. In contrast, the population-specific FST estimates obtained directly from single-nucleotide polymorphisms (SNPs) do not reflect such expected relationships. We show that ascertainment bias of SNPs has less impact on the proposed haplotype-cluster-based FST than on the SNP-based version, which provides a potential explanation for these results. Thus, these new measures of FST and haplotype-cluster diversity provide an important new tool for population genetic analysis of high-density SNP data. PMID:20457877

Single Marker and Haplotype-Based Association Analysis of Semolina and Pasta Colour in Elite Durum Wheat Breeding Lines Using a High-Density Consensus Map.

PubMed

N'Diaye, Amidou; Haile, Jemanesh K; Cory, Aron T; Clarke, Fran R; Clarke, John M; Knox, Ron E; Pozniak, Curtis J

2017-01-01

Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype

Single Marker and Haplotype-Based Association Analysis of Semolina and Pasta Colour in Elite Durum Wheat Breeding Lines Using a High-Density Consensus Map

PubMed Central

Haile, Jemanesh K.; Cory, Aron T.; Clarke, Fran R.; Clarke, John M.; Knox, Ron E.; Pozniak, Curtis J.

2017-01-01

Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype

The single-nucleotide polymorphisms in CHD5 affect the prognosis of patients with hepatocellular carcinoma

PubMed Central

Zhu, Xiao; Kong, Qingming; Xie, Liwei; Chen, Zhihong; Li, Hongmei; Zhu, Zhu; Huang, Yongmei; Lan, Feifei; Luo, Haiqing; Zhan, Jingting; Ding, Hongrong; Lei, Jinli; Xiao, Qin; Fu, Weiming; Fan, Wenguo; Zhang, Jinfang; Luo, Hui

2018-01-01

Previous studies showed that the low expressions of chromodomain-helicase-DNA-binding protein 5 (CHD5) were intensively associated with deteriorative biologic and clinical characteristics as well as outcomes in many tumors. The aim of this study is to determine whether CHD5 single nucleotide polymorphisms (SNPs) contribute to the prognosis of hepatocellular carcima (HCC). The SNPs were selected according to their linkage disequilibrium (LD) in the targeted next-generation sequencing (NGS) and then genotyped with TaqMan probers. We revealed a rare haplotype AG in CHD5 (SNPs: rs12564469-rs9434711) was markedly associated with HCC prognosis. The univariate and multivariate regression analyses revealed the patients with worse overall survival time were those with tumor metastasis and haplotype AG, as well as cirrhosis, poor differentiation and IV-TNM stage. Based on the available public databases, we discovered the significant association between haplotype AG and CHD5 mRNA expressions only existed in Chinese. These data proposed that the potentially genetic haplotype might functionally contribute to HCC prognosis and CHD5 mRNA expressions. PMID:29568352

TNF-alpha SNP haplotype frequencies in equidae.

PubMed

Brown, J J; Ollier, W E R; Thomson, W; Matthews, J B; Carter, S D; Binns, M; Pinchbeck, G; Clegg, P D

2006-05-01

Tumour necrosis factor alpha (TNF-alpha) is a pro-inflammatory cytokine that plays a crucial role in the regulation of inflammatory and immune responses. In all vertebrate species the genes encoding TNF-alpha are located within the major histocompatability complex. In the horse TNF-alpha has been ascribed a role in a variety of important disease processes. Previously two single nucleotide polymorphisms (SNPs) have been reported within the 5' un-translated region of the equine TNF-alpha gene. We have examined the equine TNF-alpha promoter region further for additional SNPs by analysing DNA from 131 horses (Equus caballus), 19 donkeys (E. asinus), 2 Grant's zebras (E. burchellii boehmi) and one onager (E. hemionus). Two further SNPs were identified at nucleotide positions 24 (T/G) and 452 (T/C) relative to the first nucleotide of the 522 bp polymerase chain reaction product. A sequence variant at position 51 was observed between equidae. SNaPSHOT genotyping assays for these and the two previously reported SNPs were performed on 457 horses comprising seven different breeds and 23 donkeys to determine the gene frequencies. SNP frequencies varied considerably between different horse breeds and also between the equine species. In total, nine different TNF-alpha promoter SNP haplotypes and their frequencies were established amongst the various equidae examined, with some haplotypes being found only in horses and others only in donkeys or zebras. The haplotype frequencies observed varied greatly between different horse breeds. Such haplotypes may relate to levels of TNF-alpha production and disease susceptibility and further investigation is required to identify associations between particular haplotypes and altered risk of disease.

Y-SNPs haplotype diversity in four Chinese cattle breeds.

PubMed

Zhang, Runfeng; Cheng, Ming; Li, Xiaofeng; Chen, Fuying; Zheng, Jing; Wang, Xiaofei; Meng, Quanke

2013-01-01

To investigate the genetic diversity of Chinese cattle, 96 male samples of 4 Chinese native cattle breeds were investigated using 5 single nucleotide polymorphisms specific to the bovine Y chromosome. Two previously described haplotypes (taurine Y2 and indicine Y3) were detected in 74 and 22 animals, respectively. The haplotype frequencies varied amongst the four native breeds. The taurine Y2 haplotype dominated in the Qinchuan, Dabieshan, and Yunba breeds. However, the indicine Y3 haplotype occurred in high frequency in the Enshi breed. Among the four native breeds, Yunba had the highest haplotype diversity (0.4330 ± 0.0750), followed by Qinchuan (0.2899 ± 0.1028) and Enshi (0.2222 ± 0.1662), Dabieshan was the least differentiated (0.1079 ± 0.0680). Compared with some foreign cattle breeds, the low level of haplotype diversity was detected in our breeds (0.2633 ± 0.1030).

Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

NASA Astrophysics Data System (ADS)

Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

2017-02-01

Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P < 0.01), from which we constructed four main haplotypes due to linkage disequilibrium. Furthermore, the most effective haplotype H2 (GAGGAT) had extremely significant relationship with high glycogen content ( P < 0.0001). These findings revealed the potential influence of Cg-GYS polymorphism on the glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

Fcγ receptor IIIa single-nucleotide polymorphisms and haplotypes affect human IgG binding and are associated with lupus nephritis in African Americans.

PubMed

Dong, Chaoling; Ptacek, Travis S; Redden, David T; Zhang, Kui; Brown, Elizabeth E; Edberg, Jeffrey C; McGwin, Gerald; Alarcón, Graciela S; Ramsey-Goldman, Rosalind; Reveille, John D; Vilá, Luis M; Petri, Michelle; Qin, Aijian; Wu, Jianming; Kimberly, Robert P

2014-05-01

To investigate whether the Fcγ receptor IIIa-66L/R/H (FcγRIIIa-66L/R/H) polymorphism influences net effective receptor function and to assess if the FCGR3A combined genotypes formed by FcγRIIIa-66L/R/H and FcγRIIIa-176F/V, as well as copy number variation (CNV), confer risk of developing systemic lupus erythematosus (SLE) and lupus nephritis. FcγRIIIa variants, expressed on A20 IIA1.6 cells, were used in flow cytometry-based human IgG-binding assays. Using Pyrosequencing methodology, FCGR3A single-nucleotide polymorphism and CNV genotypes were determined in a cohort of 1,728 SLE patients and 2,404 healthy controls. The FcγRIIIa-66L/R/H (rs10127939) polymorphism influenced ligand binding capacity in the presence of the FcγRIIIa-176V (rs396991) allele. There was a trend toward an association of the low-binding FcγRIIIa-176F allele with lupus nephritis among African Americans (P = 0.0609) but not among European Americans (P > 0.10). Nephritis among African American patients with SLE was associated with FcγRIIIa low-binding haplotypes containing the 66L/R/H and 176F variants (P = 0.03) and with low-binding genotype combinations (P = 0.002). No association was observed among European American patients with SLE. The distribution of FCGR3A CNV was not significantly different among controls and SLE patients with or without nephritis. FcγRIIIa-66L/R/H influences ligand binding. The low-binding haplotypes formed by 66L/R/H and 176F confer enhanced risk of lupus nephritis in African Americans. FCGR3A CNVs are not associated with SLE or lupus nephritis in either African Americans or European Americans. Copyright © 2014 by the American College of Rheumatology.

Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.

PubMed

Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R

2001-11-23

Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.

Brain white matter development is associated with a human-specific haplotype increasing the synthesis of long chain fatty acids.

PubMed

Peters, Bart D; Voineskos, Aristotle N; Szeszko, Philip R; Lett, Tristram A; DeRosse, Pamela; Guha, Saurav; Karlsgodt, Katherine H; Ikuta, Toshikazu; Felsky, Daniel; John, Majnu; Rotenberg, David J; Kennedy, James L; Lencz, Todd; Malhotra, Anil K

2014-04-30

The genetic and molecular pathways driving human brain white matter (WM) development are only beginning to be discovered. Long chain polyunsaturated fatty acids (LC-PUFAs) have been implicated in myelination in animal models and humans. The biosynthesis of LC-PUFAs is regulated by the fatty acid desaturase (FADS) genes, of which a human-specific haplotype is strongly associated with ω-3 and ω-6 LC-PUFA concentrations in blood. To investigate the relationship between LC-PUFA synthesis and human brain WM development, we examined whether this FADS haplotype is associated with age-related WM differences across the life span in healthy individuals 9-86 years of age (n = 207). Diffusion tensor imaging was performed to measure fractional anisotropy (FA), a putative measure of myelination, of the cerebral WM tracts. FADS haplotype status was determined with a single nucleotide polymorphism (rs174583) that tags this haplotype. Overall, normal age-related WM differences were observed, including higher FA values in early adulthood compared with childhood, followed by lower FA values across older age ranges. However, individuals homozygous for the minor allele (associated with lower LC-PUFA concentrations) did not display these normal age-related WM differences (significant age × genotype interactions, p(corrected) < 0.05). These findings suggest that LC-PUFAs are involved in human brain WM development from childhood into adulthood. This haplotype and LC-PUFAs may play a role in myelin-related disorders of neurodevelopmental origin.

A parsimonious tree-grow method for haplotype inference.

PubMed

Li, Zhenping; Zhou, Wenfeng; Zhang, Xiang-Sun; Chen, Luonan

2005-09-01

Haplotype information has become increasingly important in analyzing fine-scale molecular genetics data, such as disease genes mapping and drug design. Parsimony haplotyping is one of haplotyping problems belonging to NP-hard class. In this paper, we aim to develop a novel algorithm for the haplotype inference problem with the parsimony criterion, based on a parsimonious tree-grow method (PTG). PTG is a heuristic algorithm that can find the minimum number of distinct haplotypes based on the criterion of keeping all genotypes resolved during tree-grow process. In addition, a block-partitioning method is also proposed to improve the computational efficiency. We show that the proposed approach is not only effective with a high accuracy, but also very efficient with the computational complexity in the order of O(m2n) time for n single nucleotide polymorphism sites in m individual genotypes. The software is available upon request from the authors, or from http://zhangroup.aporc.org/bioinfo/ptg/ chen@elec.osaka-sandai.ac.jp Supporting materials is available from http://zhangroup.aporc.org/bioinfo/ptg/bti572supplementary.pdf

Haplotype-based approach to known MS-associated regions increases the amount of explained risk

PubMed Central

Khankhanian, Pouya; Gourraud, Pierre-Antoine; Lizee, Antoine; Goodin, Douglas S

2015-01-01

Genome-wide association studies (GWAS), using single nucleotide polymorphisms (SNPs), have yielded 110 non-human leucocyte antigen genomic regions that are associated with multiple sclerosis (MS). Despite this large number of associations, however, only 28% of MS-heritability can currently be explained. Here we compare the use of multi-SNP-haplotypes to the use of single-SNPs as alternative methods to describe MS genetic risk. SNP-haplotypes (of various lengths from 1 up to 15 contiguous SNPs) were constructed at each of the 110 previously identified, MS-associated, genomic regions. Even after correcting for the larger number of statistical comparisons made when using the haplotype-method, in 32 of the regions, the SNP-haplotype based model was markedly more significant than the single-SNP based model. By contrast, in no region was the single-SNP based model similarly more significant than the SNP-haplotype based model. Moreover, when we included the 932 MS-associated SNP-haplotypes (that we identified from 102 regions) as independent variables into a logistic linear model, the amount of MS-heritability, as assessed by Nagelkerke's R-squared, was 38%, which was considerably better than 29%, which was obtained by using only single-SNPs. This study demonstrates that SNP-haplotypes can be used to fine-map the genetic associations within regions of interest previously identified by single-SNP GWAS. Moreover, the amount of the MS genetic risk explained by the SNP-haplotype associations in the 110 MS-associated genomic regions was considerably greater when using SNP-haplotypes than when using single-SNPs. Also, the use of SNP-haplotypes can lead to the discovery of new regions of interest, which have not been identified by a single-SNP GWAS. PMID:26185143

Single-molecule dilution and multiple displacement amplification for molecular haplotyping.

PubMed

Paul, Philip; Apgar, Josh

2005-04-01

Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.

Massively parallel haplotyping on microscopic beads for the high-throughput phase analysis of single molecules.

PubMed

Boulanger, Jérôme; Muresan, Leila; Tiemann-Boege, Irene

2012-01-01

In spite of the many advances in haplotyping methods, it is still very difficult to characterize rare haplotypes in tissues and different environmental samples or to accurately assess the haplotype diversity in large mixtures. This would require a haplotyping method capable of analyzing the phase of single molecules with an unprecedented throughput. Here we describe such a haplotyping method capable of analyzing in parallel hundreds of thousands single molecules in one experiment. In this method, multiple PCR reactions amplify different polymorphic regions of a single DNA molecule on a magnetic bead compartmentalized in an emulsion drop. The allelic states of the amplified polymorphisms are identified with fluorescently labeled probes that are then decoded from images taken of the arrayed beads by a microscope. This method can evaluate the phase of up to 3 polymorphisms separated by up to 5 kilobases in hundreds of thousands single molecules. We tested the sensitivity of the method by measuring the number of mutant haplotypes synthesized by four different commercially available enzymes: Phusion, Platinum Taq, Titanium Taq, and Phire. The digital nature of the method makes it highly sensitive to detecting haplotype ratios of less than 1:10,000. We also accurately quantified chimera formation during the exponential phase of PCR by different DNA polymerases.

HERC1 polymorphisms: population-specific variations in haplotype composition.

PubMed

Yuasa, Isao; Umetsu, Kazuo; Nishimukai, Hiroaki; Fukumori, Yasuo; Harihara, Shinji; Saitou, Naruya; Jin, Feng; Chattopadhyay, Prasanta K; Henke, Lotte; Henke, Jürgen

2009-08-01

Human HERC1 is one of six HERC proteins and may play an important role in intracellular membrane trafficking. The human HERC1 gene is suggested to have been affected by local positive selection. To assess the global frequency distributions of coding and non-coding single nucleotide polymorphisms (SNPs) in the HERC1 gene, we developed a new simultaneous genotyping method for four SNPs, and applied this method to investigate 1213 individuals from 12 global populations. The results confirmed remarked differences in the allele and haplotype frequencies between East Asian and non-East Asian populations. One of the three common haplotypes observed was found to be characteristic of East Asians, who showed a relatively uniform distribution of haplotypes. Information on haplotypes would be useful for testing the function of polymorphisms in the HERC1 gene. This is the first study to investigate the distribution of HERC1 polymorphisms in various populations. (c) 2009 John Wiley & Sons, Ltd.

Absence of the tag polymorphism for the risk haplotype HLA-DR2 for multiple sclerosis in Wixárika subjects from Mexico.

PubMed

González-Enríquez, G V; Torres-Mendoza, B M; Márquez-Pedroza, J; Macías-Islas, M A; Ortiz, G G; Cruz-Ramos, J A

2018-02-03

The HLA-DRB1*15:01 allele has a demonstrated risk for the development of multiple sclerosis (MS) in most populations around the world. The single nucleotide polymorphism (SNP) rs3129934 is found in linkage disequilibrium with the risk haplotype formed by the HLA-DRB1*15:01 and HLA-DQB1*06:02 alleles, and it is considered a reliable marker of the presence of this haplotype. Native Americans have a null or low prevalence of MS. In this study, we sought to identify the frequency of rs3129934 in the Wixárika ethnic group as well as in Mestizo (mixed race) patients with MS and in controls from western Mexico. Through real-time polymerase chain reaction (PCR) using TaqMan probes, we analyzed the allele and genotype frequencies of rs3129934 in Mestizo individuals with and without MS and in 73 Wixárika subjects from the state of Jalisco, Mexico. The Wixárika subjects were homozygote for the C allele of rs3129934. The allele and genotype frequency in Mestizos with MS was similar to that of other MS populations with Caucasian ancestry. The absence of the T risk allele rs3129934 (associated with the haplotype HLA-DRB1*15:01, HLA-DQ1*06:02) in this sample of Wixárika subjects is consistent with the unreported MS in this Amerindian group, related to absence of such paramount genetic risk factor.

Linear reduction methods for tag SNP selection.

PubMed

He, Jingwu; Zelikovsky, Alex

2004-01-01

It is widely hoped that constructing a complete human haplotype map will help to associate complex diseases with certain SNP's. Unfortunately, the number of SNP's is huge and it is very costly to sequence many individuals. Therefore, it is desirable to reduce the number of SNP's that should be sequenced to considerably small number of informative representatives, so called tag SNP's. In this paper, we propose a new linear algebra based method for selecting and using tag SNP's. Our method is purely combinatorial and can be combined with linkage disequilibrium (LD) and block based methods. We measure the quality of our tag SNP selection algorithm by comparing actual SNP's with SNP's linearly predicted from linearly chosen tag SNP's. We obtain an extremely good compression and prediction rates. For example, for long haplotypes (>25000 SNP's), knowing only 0.4% of all SNP's we predict the entire unknown haplotype with 2% accuracy while the prediction method is based on a 10% sample of the population.

Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

PubMed Central

Kim, Kyung-Seon; Kim, Ghi-Su; Hwang, Joo-Yeon; Lee, Hye-Ja; Park, Mi-Hyun; Kim, Kwang-joong; Jung, Jongsun; Cha, Hyo-Soung; Shin, Hyoung Doo; Kang, Jong-Ho; Park, Eui Kyun; Kim, Tae-Ho; Hong, Jung-Min; Koh, Jung-Min; Oh, Bermseok; Kimm, Kuchan; Kim, Shin-Yoon; Lee, Jong-Young

2007-01-01

Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs) that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63%) had been previously identified and 331 (37%) were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less) of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF) > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an analysis of genetic

Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

PubMed

Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

2011-12-01

Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Single nucleotide polymorphism markers for low-dose aspirin-associated peptic ulcer and ulcer bleeding.

PubMed

Shiotani, Akiko; Murao, Takahisa; Fujita, Yoshihiko; Fujimura, Yoshinori; Sakakibara, Takashi; Nishio, Kazuto; Haruma, Ken

2014-12-01

In our previous study, the SLCO1B1 521TT genotype and the SLCO1B1*1b haplotype were significantly associated with the risk of peptic ulcer in patients taking low-dose aspirin (LDA). The aim of the present study was to investigate pharmacogenomic profile of LDA-induced peptic ulcer and ulcer bleeding. Patients taking 100 mg of enteric-coated aspirin for cardiovascular diseases and with a peptic ulcer or ulcer bleeding and patients who also participated in endoscopic surveillance were studied. Genome-wide analysis of single nucleotide polymorphisms (SNPs) was performed using the Affymetrix DME Plus Premier Pack. SLCO1B1*1b haplotype and candidate genotypes of genes associated with ulcer bleeding or small bowel bleeding identified by genome-wide analysis were determined using TaqMan SNP Genotyping Assay kits, polymerase chain reaction-restriction fragment length polymorphism, and direct sequencing. Of 593 patients enrolled, 111 patients had a peptic ulcer and 45 had ulcer bleeding. The frequencies of the SLCO1B1*1b haplotype and CHST2 2082 T allele were significantly greater in patients with peptic ulcer and ulcer bleeding compared to the controls. After adjustment for significant factors, the SLCO1B1*1b haplotype was associated with peptic ulcer (OR 2.20, 95% CI 1.24-3.89) and CHST2 2082 T allele with ulcer bleeding (2.57, 1.07-6.17). The CHST2 2082 T allele as well as SLCO1B1*1b haplotype may identify patients at increased risk for aspirin-induced peptic ulcer or ulcer bleeding. © 2014 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

Functional analysis of regulatory single-nucleotide polymorphisms.

PubMed

Pampín, Sandra; Rodríguez-Rey, José C

2007-04-01

The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.

A phased SNP-based classification of sickle cell anemia HBB haplotypes.

PubMed

Shaikho, Elmutaz M; Farrell, John J; Alsultan, Abdulrahman; Qutub, Hatem; Al-Ali, Amein K; Figueiredo, Maria Stella; Chui, David H K; Farrer, Lindsay A; Murphy, George J; Mostoslavsky, Gustavo; Sebastiani, Paola; Steinberg, Martin H

2017-08-11

Sickle cell anemia causes severe complications and premature death. Five common β-globin gene cluster haplotypes are each associated with characteristic fetal hemoglobin (HbF) levels. As HbF is the major modulator of disease severity, classifying patients according to haplotype is useful. The first method of haplotype classification used restriction fragment length polymorphisms (RFLPs) to detect single nucleotide polymorphisms (SNPs) in the β-globin gene cluster. This is labor intensive, and error prone. We used genome-wide SNP data imputed to the 1000 Genomes reference panel to obtain phased data distinguishing parental alleles. We successfully haplotyped 813 sickle cell anemia patients previously classified by RFLPs with a concordance >98%. Four SNPs (rs3834466, rs28440105, rs10128556, and rs968857) marking four different restriction enzyme sites unequivocally defined most haplotypes. We were able to assign a haplotype to 86% of samples that were either partially or misclassified using RFLPs. Phased data using only four SNPs allowed unequivocal assignment of a haplotype that was not always possible using a larger number of RFLPs. Given the availability of genome-wide SNP data, our method is rapid and does not require high computational resources.

Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

PubMed

Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

2016-07-25

Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

Using haplotypes to unravel the inheritance of Holstein coat color for a larger audience

USDA-ARS?s Scientific Manuscript database

Haplotype testing identifies single-nucleotide polymorphisms that bracket a group of alleles from several different genes located on a specific chromosomal section of DNA. For a trait with a limited number of genotypes and phenotypes, the rules of inheritance can be determined by matching up certain...

Linear reduction method for predictive and informative tag SNP selection.

PubMed

He, Jingwu; Westbrooks, Kelly; Zelikovsky, Alexander

2005-01-01

Constructing a complete human haplotype map is helpful when associating complex diseases with their related SNPs. Unfortunately, the number of SNPs is very large and it is costly to sequence many individuals. Therefore, it is desirable to reduce the number of SNPs that should be sequenced to a small number of informative representatives called tag SNPs. In this paper, we propose a new linear algebra-based method for selecting and using tag SNPs. We measure the quality of our tag SNP selection algorithm by comparing actual SNPs with SNPs predicted from selected linearly independent tag SNPs. Our experiments show that for sufficiently long haplotypes, knowing only 0.4% of all SNPs the proposed linear reduction method predicts an unknown haplotype with the error rate below 2% based on 10% of the population.

FRET-based binding assay between a fluorescent cAMP analogue and a cyclic nucleotide-binding domain tagged with a CFP.

PubMed

Romero, Francisco; Santana-Calvo, Carmen; Sánchez-Guevara, Yoloxochitl; Nishigaki, Takuya

2017-09-01

The cyclic nucleotide-binding domain (CNBD) functions as a regulatory domain of many proteins involved in cyclic nucleotide signalling. We developed a straightforward and reliable binding assay based on intermolecular fluorescence resonance energy transfer (FRET) between an adenosine-3', 5'-cyclic monophosphate analogue labelled with fluorescein and a recombinant CNBD of human EPAC1 tagged with a cyan fluorescence protein (CFP). The high FRET efficiency of this method (~ 80%) allowed us to perform several types of binding experiments with nanomolar range of sample using conventional equipment. In addition, the CFP tag on the CNBD enabled us to perform a specific binding experiment using an unpurified protein. Considering these advantages, this technique is useful to study poorly characterized CNBDs. © 2017 Federation of European Biochemical Societies.

A single nucleotide polymorphism in APOA5 determines triglyceride levels in Hong Kong and Guangzhou Chinese

PubMed Central

Jiang, Chao Qiang; Liu, Bin; Cheung, Bernard MY; Lam, Tai Hing; Lin, Jie Ming; Li Jin, Ya; Yue, Xiao Jun; Ong, Kwok Leung; Tam, Sidney; Wong, Ka Sing; Tomlinson, Brian; Lam, Karen SL; Thomas, G Neil

2010-01-01

Single nucleotide polymorphisms (SNPs) in the apolipoprotein A5 (APOA5) gene have been associated with hypertriglyceridaemia. We investigated which SNPs in the APOA5 gene were associated with triglyceride levels in two independent Chinese populations. In all, 1375 subjects in the Hong Kong Cardiovascular Risk Factor Prevalence Study were genotyped for five tagging SNPs chosen from HapMap. Replication was sought in 1996 subjects from the Guangzhou Biobank Cohort Study. Among the five SNPs, rs662799 (-1131T>C) was strongly related to log-transformed triglyceride levels among Hong Kong subjects (β=0.192, P=2.6 × 10−13). Plasma triglyceride level was 36.1% higher in CC compared to TT genotype. This association was confirmed in Guangzhou subjects (β=0.159, P=1.3 × 10−12), and was significantly irrespective of sex, age group, obesity, metabolic syndrome, hypertension, diabetes, smoking and alcohol drinking. The odds ratios and 95% confidence interval for plasma triglycerides ≥1.7 mmol/l associated with TC and CC genotypes were, respectively, 1.81 (1.37–2.39) and 2.22 (1.44–3.43) in Hong Kong and 1.27 (1.05–1.54) and 1.97 (1.42–2.73) in Guangzhou. Haplotype analysis suggested the association was due to rs662799 only. The corroborative findings in two independent populations indicate that the APOA5-1131T>C polymorphism is an important and clinically relevant determinant of plasma triglyceride levels in the Chinese population. PMID:20571505

Haplotype-Based Association Analysis via Variance-Components Score Test

PubMed Central

Tzeng, Jung-Ying ; Zhang, Daowen 

2007-01-01

Haplotypes provide a more informative format of polymorphisms for genetic association analysis than do individual single-nucleotide polymorphisms. However, the practical efficacy of haplotype-based association analysis is challenged by a trade-off between the benefits of modeling abundant variation and the cost of the extra degrees of freedom. To reduce the degrees of freedom, several strategies have been considered in the literature. They include (1) clustering evolutionarily close haplotypes, (2) modeling the level of haplotype sharing, and (3) smoothing haplotype effects by introducing a correlation structure for haplotype effects and studying the variance components (VC) for association. Although the first two strategies enjoy a fair extent of power gain, empirical evidence showed that VC methods may exhibit only similar or less power than the standard haplotype regression method, even in cases of many haplotypes. In this study, we report possible reasons that cause the underpowered phenomenon and show how the power of the VC strategy can be improved. We construct a score test based on the restricted maximum likelihood or the marginal likelihood function of the VC and identify its nontypical limiting distribution. Through simulation, we demonstrate the validity of the test and investigate the power performance of the VC approach and that of the standard haplotype regression approach. With suitable choices for the correlation structure, the proposed method can be directly applied to unphased genotypic data. Our method is applicable to a wide-ranging class of models and is computationally efficient and easy to implement. The broad coverage and the fast and easy implementation of this method make the VC strategy an effective tool for haplotype analysis, even in modern genomewide association studies. PMID:17924336

Unraveling Haplotype Diversity of the Apical Membrane Antigen-1 Gene in Plasmodium falciparum Populations in Thailand

PubMed Central

Lumkul, Lalita; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn

2018-01-01

Development of an effective vaccine is critically needed for the prevention of malaria. One of the key antigens for malaria vaccines is the apical membrane antigen 1 (AMA-1) of the human malaria parasite Plasmodium falciparum, the surface protein for erythrocyte invasion of the parasite. The gene encoding AMA-1 has been sequenced from populations of P. falciparum worldwide, but the haplotype diversity of the gene in P. falciparum populations in the Greater Mekong Subregion (GMS), including Thailand, remains to be characterized. In the present study, the AMA-1 gene was PCR amplified and sequenced from the genomic DNA of 65 P. falciparum isolates from 5 endemic areas in Thailand. The nearly full-length 1,848 nucleotide sequence of AMA-1 was subjected to molecular analyses, including nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity and neutrality tests. Phylogenetic analysis and pairwise population differentiation (Fst indices) were performed to infer the population structure. The analyses identified 60 single nucleotide polymorphic loci, predominately located in domain I of AMA-1. A total of 31 unique AMA-1 haplotypes were identified, which included 11 novel ones. The phylogenetic tree of the AMA-1 haplotypes revealed multiple clades of AMA-1, each of which contained parasites of multiple geographical origins, consistent with the Fst indices indicating genetic homogeneity or gene flow among geographically distinct populations of P. falciparum in Thailand’s borders with Myanmar, Laos and Cambodia. In summary, the study revealed novel haplotypes and population structure needed for the further advancement of AMA-1-based malaria vaccines in the GMS. PMID:29742870

The prognostic impact of germline 46/1 haplotype of Janus kinase 2 in cytogenetically normal acute myeloid leukemia

PubMed Central

Nahajevszky, Sarolta; Andrikovics, Hajnalka; Batai, Arpad; Adam, Emma; Bors, Andras; Csomor, Judit; Gopcsa, Laszlo; Koszarska, Magdalena; Kozma, Andras; Lovas, Nora; Lueff, Sandor; Matrai, Zoltan; Meggyesi, Nora; Sinko, Janos; Sipos, Andrea; Varkonyi, Andrea; Fekete, Sandor; Tordai, Attila; Masszi, Tamas

2011-01-01

Background Prognostic risk stratification according to acquired or inherited genetic alterations has received increasing attention in acute myeloid leukemia in recent years. A germline Janus kinase 2 haplotype designated as the 46/1 haplotype has been reported to be associated with an inherited predisposition to myeloproliferative neoplasms, and also to acute myeloid leukemia with normal karyotype. The aim of this study was to assess the prognostic impact of the 46/1 haplotype on disease characteristics and treatment outcome in acute myeloid leukemia. Design and Methods Janus kinase 2 rs12343867 single nucleotide polymorphism tagging the 46/1 haplotype was genotyped by LightCycler technology applying melting curve analysis with the hybridization probe detection format in 176 patients with acute myeloid leukemia under 60 years diagnosed consecutively and treated with curative intent. Results The morphological subtype of acute myeloid leukemia with maturation was less frequent among 46/1 carriers than among non-carriers (5.6% versus 17.2%, P=0.018, cytogenetically normal subgroup: 4.3% versus 20.6%, P=0.031), while the morphological distribution shifted towards the myelomonocytoid form in 46/1 haplotype carriers (28.1% versus 14.9%, P=0.044, cytogenetically normal subgroup: 34.0% versus 11.8%, P=0.035). In cytogenetically normal cases of acute myeloid leukemia, the 46/1 carriers had a considerably lower remission rate (78.7% versus 94.1%, P=0.064) and more deaths in remission or in aplasia caused by infections (46.8% versus 23.5%, P=0.038), resulting in the 46/1 carriers having shorter disease-free survival and overall survival compared to the 46/1 non-carriers. In multivariate analysis, the 46/1 haplotype was an independent adverse prognostic factor for disease-free survival (P=0.024) and overall survival (P=0.024) in patients with a normal karyotype. Janus kinase 2 46/1 haplotype had no impact on prognosis in the subgroup with abnormal karyotype. Conclusions Janus

Association of single-nucleotide polymorphisms of the tau gene with late-onset Parkinson disease.

PubMed

Martin, E R; Scott, W K; Nance, M A; Watts, R L; Hubble, J P; Koller, W C; Lyons, K; Pahwa, R; Stern, M B; Colcher, A; Hiner, B C; Jankovic, J; Ondo, W G; Allen, F H; Goetz, C G; Small, G W; Masterman, D; Mastaglia, F; Laing, N G; Stajich, J M; Ribble, R C; Booze, M W; Rogala, A; Hauser, M A; Zhang, F; Gibson, R A; Middleton, L T; Roses, A D; Haines, J L; Scott, B L; Pericak-Vance, M A; Vance, J M

2001-11-14

The human tau gene, which promotes assembly of neuronal microtubules, has been associated with several rare neurologic diseases that clinically include parkinsonian features. We recently observed linkage in idiopathic Parkinson disease (PD) to a region on chromosome 17q21 that contains the tau gene. These factors make tau a good candidate for investigation as a susceptibility gene for idiopathic PD, the most common form of the disease. To investigate whether the tau gene is involved in idiopathic PD. Among a sample of 1056 individuals from 235 families selected from 13 clinical centers in the United States and Australia and from a family ascertainment core center, we tested 5 single-nucleotide polymorphisms (SNPs) within the tau gene for association with PD, using family-based tests of association. Both affected (n = 426) and unaffected (n = 579) family members were included; 51 individuals had unclear PD status. Analyses were conducted to test individual SNPs and SNP haplotypes within the tau gene. Family-based tests of association, calculated using asymptotic distributions. Analysis of association between the SNPs and PD yielded significant evidence of association for 3 of the 5 SNPs tested: SNP 3, P =.03; SNP 9i, P =.04; and SNP 11, P =.04. The 2 other SNPs did not show evidence of significant association (SNP 9ii, P =.11, and SNP 9iii, P =.87). Strong evidence of association was found with haplotype analysis, with a positive association with one haplotype (P =.009) and a negative association with another haplotype (P =.007). Substantial linkage disequilibrium (P<.001) was detected between 4 of the 5 SNPs (SNPs 3, 9i, 9ii, and 11). This integrated approach of genetic linkage and positional association analyses implicates tau as a susceptibility gene for idiopathic PD.

Association of Single-Nucleotide Polymorphisms of the Tau Gene With Late-Onset Parkinson Disease

PubMed Central

Martin, Eden R.; Scott, William K.; Nance, Martha A.; Watts, Ray L.; Hubble, Jean P.; Koller, William C.; Lyons, Kelly; Pahwa, Rajesh; Stern, Matthew B.; Colcher, Amy; Hiner, Bradley C.; Jankovic, Joseph; Ondo, William G.; Allen, Fred H.; Goetz, Christopher G.; Small, Gary W.; Masterman, Donna; Mastaglia, Frank; Laing, Nigel G.; Stajich, Jeffrey M.; Ribble, Robert C.; Booze, Michael W.; Rogala, Allison; Hauser, Michael A.; Zhang, Fengyu; Gibson, Rachel A.; Middleton, Lefkos T.; Roses, Allen D.; Haines, Jonathan L.; Scott, Burton L.; Pericak-Vance, Margaret A.; Vance, Jeffery M.

2013-01-01

Context The human tau gene, which promotes assembly of neuronal microtubules, has been associated with several rare neurologic diseases that clinically include parkinsonian features. We recently observed linkage in idiopathic Parkinson disease (PD) to a region on chromosome 17q21 that contains the tau gene. These factors make tau a good candidate for investigation as a susceptibility gene for idiopathic PD, the most common form of the disease. Objective To investigate whether the tau gene is involved in idiopathic PD. Design, Setting, and Participants Among a sample of 1056 individuals from 235 families selected from 13 clinical centers in the United States and Australia and from a family ascertainment core center, we tested 5 single-nucleotide polymorphisms (SNPs) within the tau gene for association with PD, using family-based tests of association. Both affected (n = 426) and unaffected (n = 579) family members were included; 51 individuals had unclear PD status. Analyses were conducted to test individual SNPs and SNP haplotypes within the tau gene. Main Outcome Measure Family-based tests of association, calculated using asymptotic distributions. Results Analysis of association between the SNPs and PD yielded significant evidence of association for 3 of the 5 SNPs tested: SNP 3, P = .03; SNP 9i, P = .04; and SNP 11, P = .04. The 2 other SNPs did not show evidence of significant association (SNP 9ii, P = .11, and SNP 9iii, P = .87). Strong evidence of association was found with haplotype analysis, with a positive association with one haplotype (P = .009) and a negative association with another haplotype (P = .007). Substantial linkage disequilibrium (P<.001) was detected between 4 of the 5 SNPs (SNPs 3,9i, 9ii, and 11). Conclusions This integrated approach of genetic linkage and positional association analyses implicates tau as a susceptibility gene for idiopathic PD. PMID:11710889

Integrating sequence and array data to create an improved 1000 Genomes Project haplotype reference panel.

PubMed

Delaneau, Olivier; Marchini, Jonathan

2014-06-13

A major use of the 1000 Genomes Project (1000 GP) data is genotype imputation in genome-wide association studies (GWAS). Here we develop a method to estimate haplotypes from low-coverage sequencing data that can take advantage of single-nucleotide polymorphism (SNP) microarray genotypes on the same samples. First the SNP array data are phased to build a backbone (or 'scaffold') of haplotypes across each chromosome. We then phase the sequence data 'onto' this haplotype scaffold. This approach can take advantage of relatedness between sequenced and non-sequenced samples to improve accuracy. We use this method to create a new 1000 GP haplotype reference set for use by the human genetic community. Using a set of validation genotypes at SNP and bi-allelic indels we show that these haplotypes have lower genotype discordance and improved imputation performance into downstream GWAS samples, especially at low-frequency variants.

The analysis of APOL1 genetic variation and haplotype diversity provided by 1000 Genomes project.

PubMed

Peng, Ting; Wang, Li; Li, Guisen

2017-08-11

The APOL1 gene variants has been shown to be associated with an increased risk of multiple kinds of diseases, particularly in African Americans, but not in Caucasians and Asians. In this study, we explored the single nucleotide polymorphism (SNP) and haplotype diversity of APOL1 gene in different races provided by 1000 Genomes project. Variants of APOL1 gene in 1000 Genome Project were obtained and SNPs located in the regulatory region or coding region were selected for genetic variation analysis. Total 2504 individuals from 26 populations were classified as four groups that included Africa, Europe, Asia and Admixed populations. Tag SNPs were selected to evaluate the haplotype diversities in the four populations by HaploStats software. APOL1 gene was surrounded by some of the most polymorphic genes in the human genome, variation of APOL1 gene was common, with up to 613 SNP (1000 Genome Project reported) and 99 of them (16.2%) with MAF ≥ 1%. There were 79 SNPs in the URR and 92 SNPs in 3'UTR. Total 12 SNPs in URR and 24 SNPs in 3'UTR were considered as common variants with MAF ≥ 1%. It is worth noting that URR-1 was presents lower frequencies in European populations, while other three haplotypes taken an opposite pattern; 3'UTR presents several high-frequency variation sites in a short segment, and the differences of its haplotypes among different population were significant (P < 0.01), UTR-1 and UTR-5 presented much higher frequency in African population, while UTR-2, UTR-3 and UTR-4 were much lower. APOL1 coding region showed that two SNP of G1 with higher frequency are actually pull down the haplotype H-1 frequency when considering all populations pooled together, and the diversity among the four populations be widen by the G1 two mutation (P 1  = 3.33E-4 vs P 2  = 3.61E-30). The distributions of APOL1 gene variants and haplotypes were significantly different among the different populations, in either regulatory or coding regions. It could provide

Single Color Multiplexed ddPCR Copy Number Measurements and Single Nucleotide Variant Genotyping.

PubMed

Wood-Bouwens, Christina M; Ji, Hanlee P

2018-01-01

Droplet digital PCR (ddPCR) allows for accurate quantification of genetic events such as copy number variation and single nucleotide variants. Probe-based assays represent the current "gold-standard" for detection and quantification of these genetic events. Here, we introduce a cost-effective single color ddPCR assay that allows for single genome resolution quantification of copy number and single nucleotide variation.

Cloud computing-based TagSNP selection algorithm for human genome data.

PubMed

Hung, Che-Lun; Chen, Wen-Pei; Hua, Guan-Jie; Zheng, Huiru; Tsai, Suh-Jen Jane; Lin, Yaw-Ling

2015-01-05

Single nucleotide polymorphisms (SNPs) play a fundamental role in human genetic variation and are used in medical diagnostics, phylogeny construction, and drug design. They provide the highest-resolution genetic fingerprint for identifying disease associations and human features. Haplotypes are regions of linked genetic variants that are closely spaced on the genome and tend to be inherited together. Genetics research has revealed SNPs within certain haplotype blocks that introduce few distinct common haplotypes into most of the population. Haplotype block structures are used in association-based methods to map disease genes. In this paper, we propose an efficient algorithm for identifying haplotype blocks in the genome. In chromosomal haplotype data retrieved from the HapMap project website, the proposed algorithm identified longer haplotype blocks than an existing algorithm. To enhance its performance, we extended the proposed algorithm into a parallel algorithm that copies data in parallel via the Hadoop MapReduce framework. The proposed MapReduce-paralleled combinatorial algorithm performed well on real-world data obtained from the HapMap dataset; the improvement in computational efficiency was proportional to the number of processors used.

SNPing Away at Complex Diseases: Analysis of Single-Nucleotide Polymorphisms around APOE in Alzheimer Disease

PubMed Central

Martin, Eden R.; Lai, Eric H.; Gilbert, John R.; Rogala, Allison R.; Afshari, A. J.; Riley, John; Finch, K. L.; Stevens, J. F.; Livak, K. J.; Slotterbeck, Brandon D.; Slifer, Susan H.; Warren, Liling L.; Conneally, P. Michael; Schmechel, Donald E.; Purvis, Ian; Pericak-Vance, Margaret A.; Roses, Allen D.; Vance, Jeffery M.

2000-01-01

There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P⩽.05) was identified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes. PMID:10869235

SNPing away at complex diseases: analysis of single-nucleotide polymorphisms around APOE in Alzheimer disease.

PubMed

Martin, E R; Lai, E H; Gilbert, J R; Rogala, A R; Afshari, A J; Riley, J; Finch, K L; Stevens, J F; Livak, K J; Slotterbeck, B D; Slifer, S H; Warren, L L; Conneally, P M; Schmechel, D E; Purvis, I; Pericak-Vance, M A; Roses, A D; Vance, J M

2000-08-01

There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (PHaplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes.

Novel strategies to mine alcoholism-related haplotypes and genes by combining existing knowledge framework.

PubMed

Zhang, RuiJie; Li, Xia; Jiang, YongShuai; Liu, GuiYou; Li, ChuanXing; Zhang, Fan; Xiao, Yun; Gong, BinSheng

2009-02-01

High-throughout single nucleotide polymorphism detection technology and the existing knowledge provide strong support for mining the disease-related haplotypes and genes. In this study, first, we apply four kinds of haplotype identification methods (Confidence Intervals, Four Gamete Tests, Solid Spine of LD and fusing method of haplotype block) into high-throughout SNP genotype data to identify blocks, then use cluster analysis to verify the effectiveness of the four methods, and select the alcoholism-related SNP haplotypes through risk analysis. Second, we establish a mapping from haplotypes to alcoholism-related genes. Third, we inquire NCBI SNP and gene databases to locate the blocks and identify the candidate genes. In the end, we make gene function annotation by KEGG, Biocarta, and GO database. We find 159 haplotype blocks, which relate to the alcoholism most possibly on chromosome 1 approximately 22, including 227 haplotypes, of which 102 SNP haplotypes may increase the risk of alcoholism. We get 121 alcoholism-related genes and verify their reliability by the functional annotation of biology. In a word, we not only can handle the SNP data easily, but also can locate the disease-related genes precisely by combining our novel strategies of mining alcoholism-related haplotypes and genes with existing knowledge framework.

Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

PubMed Central

Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

2012-01-01

Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

A novel haplotype of spinocerebellar ataxia type 6 contributes to the highest prevalence in western Japan.

PubMed

Terasawa, Hideo; Oda, Masaya; Morino, Hiroyuki; Miyachi, Takafumi; Izumi, Yuishin; Maruyama, Hirofumi; Matsumoto, Masayasu; Kawakami, Hideshi

2004-03-25

The highest prevalence rate of spinocerebellar ataxia type 6 (SCA6) in the worldwide population is in the Chugoku and Kansai areas of Western Japan, but the reason of this geographic characteristics is unclear. We investigated the predisposing haplotypes and their geographic distribution. Genotyping of five microsatellite markers and three single nucleotide polymorphisms linked to the CACNA1A gene in 150 Japanese SCA6 patients from unrelated 118 families revealed three major haplotypes, carrying a pool of one common haplotype core. A founder chromosome was thought to have historically diverged into at least three types. One of the major haplotypes newly identified showed a strong geographical cluster around the Seto Inland Sea in the Chugoku and Kansai areas of Western Japan, whereas the others were widely distributed throughout Japan. The distribution of predisposing haplotypes contributes to the geographical differences in prevalence of SCA6.

CLUSTAG: hierarchical clustering and graph methods for selecting tag SNPs.

PubMed

Ao, S I; Yip, Kevin; Ng, Michael; Cheung, David; Fong, Pui-Yee; Melhado, Ian; Sham, Pak C

2005-04-15

Cluster and set-cover algorithms are developed to obtain a set of tag single nucleotide polymorphisms (SNPs) that can represent all the known SNPs in a chromosomal region, subject to the constraint that all SNPs must have a squared correlation R2>C with at least one tag SNP, where C is specified by the user. http://hkumath.hku.hk/web/link/CLUSTAG/CLUSTAG.html mng@maths.hku.hk.

Compositions and methods for detecting single nucleotide polymorphisms

DOEpatents

Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

2016-11-22

Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

A single nucleotide polymorphism in osteonectin 3’ untranslated region regulates bone volume and is targeted by miR-433

PubMed Central

Dole, Neha S.; Kapinas, Kristina; Kessler, Catherine B.; Yee, Siu-Pok; Adams, Douglas J.; Pereira, Renata C.; Delany, Anne M.

2014-01-01

Osteonectin/SPARC is one of the most abundant non-collagenous extracellular matrix proteins in bone, regulating collagen fiber assembly and promoting osteoblast differentiation. Osteonectin-null and –haploinsufficient mice have low turnover osteopenia, indicating that osteonectin contributes to normal bone formation. In male idiopathic osteoporosis patients, osteonectin 3’ UTR single nucleotide polymorphism (SNP) haplotypes that differed only at SNP1599 (rs1054204) were previously associated with bone mass. Haplotype A (containing SNP1599G) was more frequent in severely affected patients, whereas haplotype B (containing SNP1599C) was more frequent in less affected patients and healthy controls. We hypothesized that SNP1599 contributes to variability in bone mass by modulating osteonectin levels. Osteonectin 3’UTR reporter constructs demonstrated that haplotype A has a repressive effect on gene expression compared to B. We found that SNP1599G contributed to a miR-433 binding site and miR-433 inhibitor relieved repression of the haplotype A, but not B, 3’ UTR reporter construct. We tested our hypothesis in vivo, using a knock-in approach to replace the mouse osteonectin 3’ UTR with human haplotype A or B 3’ UTR. Compared to haplotype A mice, bone osteonectin levels were higher in haplotype B mice. B mice displayed higher bone formation rate and gained more trabecular bone with age. When parathyroid hormone was administered intermittently, haplotype B mice gained more cortical bone area than A mice. Cultured marrow stromal cells from B mice deposited more mineralized matrix and had higher osteocalcin mRNA compared with A mice, demonstrating a cell-autonomous effect on differentiation. Altogether, SNP1599 differentially regulates osteonectin expression and contributes to variability in bone mass, by a mechanism that may involve differential targeting by miR-433. This work validates the findings of the previous candidate gene study, and it assigns a

Functional single nucleotide polymorphisms of matrix metalloproteinase 7 and 12 genes in idiopathic recurrent spontaneous abortion.

PubMed

Barišić, Anita; Pereza, Nina; Hodžić, Alenka; Kapović, Miljenko; Peterlin, Borut; Ostojić, Saša

2017-03-01

The aim of this study was to investigate the potential association of matrix metalloproteinase 7 (MMP7) -181 A/G and MMP12 -82 A/G functional single nucleotide polymorphisms (SNP) with idiopathic recurrent spontaneous abortion (IRSA) in Slovenian reproductive couples. A case-control study was conducted on 149 couples with 3 or more consecutive idiopathic spontaneous pregnancy loses and 149 women and men with at least 2 live births and no history of pregnancy complications. Genotyping of MMP7 -181 A/G and MMP12 -82 A/G SNPs was performed using polymerase chain reaction and restriction fragment length polymorphism methods. There were no statistically significant differences in the distribution of MMP7 -181 A/G and MMP12 -82 A/G genotype, allele, or haplotype frequencies between IRSA patients and controls, as well as patients' primary and secondary IRSA. We also found no association of MMP7 -181 A/G and MMP12 -82 A/G genotypes, alleles, and haplotypes with IRSA. We found no evidence to support the association between IRSA and MMP7 -181 A/G and MMP12 -82 A/G SNPs in Slovenian reproductive couples.

A Genome-Wide Scan for Breast Cancer Risk Haplotypes among African American Women

PubMed Central

Song, Chi; Chen, Gary K.; Millikan, Robert C.; Ambrosone, Christine B.; John, Esther M.; Bernstein, Leslie; Zheng, Wei; Hu, Jennifer J.; Ziegler, Regina G.; Nyante, Sarah; Bandera, Elisa V.; Ingles, Sue A.; Press, Michael F.; Deming, Sandra L.; Rodriguez-Gil, Jorge L.; Chanock, Stephen J.; Wan, Peggy; Sheng, Xin; Pooler, Loreall C.; Van Den Berg, David J.; Le Marchand, Loic; Kolonel, Laurence N.; Henderson, Brian E.; Haiman, Chris A.; Stram, Daniel O.

2013-01-01

Genome-wide association studies (GWAS) simultaneously investigating hundreds of thousands of single nucleotide polymorphisms (SNP) have become a powerful tool in the investigation of new disease susceptibility loci. Haplotypes are sometimes thought to be superior to SNPs and are promising in genetic association analyses. The application of genome-wide haplotype analysis, however, is hindered by the complexity of haplotypes themselves and sophistication in computation. We systematically analyzed the haplotype effects for breast cancer risk among 5,761 African American women (3,016 cases and 2,745 controls) using a sliding window approach on the genome-wide scale. Three regions on chromosomes 1, 4 and 18 exhibited moderate haplotype effects. Furthermore, among 21 breast cancer susceptibility loci previously established in European populations, 10p15 and 14q24 are likely to harbor novel haplotype effects. We also proposed a heuristic of determining the significance level and the effective number of independent tests by the permutation analysis on chromosome 22 data. It suggests that the effective number was approximately half of the total (7,794 out of 15,645), thus the half number could serve as a quick reference to evaluating genome-wide significance if a similar sliding window approach of haplotype analysis is adopted in similar populations using similar genotype density. PMID:23468962

The JAK2 GGCC (46/1) Haplotype in Myeloproliferative Neoplasms: Causal or Random?

PubMed

Anelli, Luisa; Zagaria, Antonella; Specchia, Giorgina; Albano, Francesco

2018-04-11

The germline JAK2 haplotype known as "GGCC or 46/1 haplotype" (haplotype GGCC_46/1 ) consists of a combination of single nucleotide polymorphisms (SNPs) mapping in a region of about 250 kb, extending from the JAK2 intron 10 to the Insulin-like 4 ( INLS4 ) gene. Four main SNPs (rs3780367, rs10974944, rs12343867, and rs1159782) generating a "GGCC" combination are more frequently indicated to represent the JAK2 haplotype. These SNPs are inherited together and are frequently associated with the onset of myeloproliferative neoplasms (MPN) positive for both JAK2 V617 and exon 12 mutations. The association between the JAK2 haplotype GGCC_46/1 and mutations in other genes, such as thrombopoietin receptor ( MPL ) and calreticulin ( CALR ), or the association with triple negative MPN, is still controversial. This review provides an overview of the frequency and the role of the JAK2 haplotype GGCC_46/1 in the pathogenesis of different myeloid neoplasms and describes the hypothetical mechanisms at the basis of the association with JAK2 gene mutations. Moreover, possible clinical implications are discussed, as different papers reported contrasting data about the correlation between the JAK2 haplotype GGCC_46/1 and blood cell count, survival, or disease progression.

Single Nucleotide Polymorphism (SNP)-Strings: An Alternative Method for Assessing Genetic Associations

PubMed Central

Goodin, Douglas S.; Khankhanian, Pouya

2014-01-01

Background Genome-wide association studies (GWAS) identify disease-associations for single-nucleotide-polymorphisms (SNPs) from scattered genomic-locations. However, SNPs frequently reside on several different SNP-haplotypes, only some of which may be disease-associated. This circumstance lowers the observed odds-ratio for disease-association. Methodology/Principal Findings Here we develop a method to identify the two SNP-haplotypes, which combine to produce each person’s SNP-genotype over specified chromosomal segments. Two multiple sclerosis (MS)-associated genetic regions were modeled; DRB1 (a Class II molecule of the major histocompatibility complex) and MMEL1 (an endopeptidase that degrades both neuropeptides and β-amyloid). For each locus, we considered sets of eleven adjacent SNPs, surrounding the putative disease-associated gene and spanning ∼200 kb of DNA. The SNP-information was converted into an ordered-set of eleven-numbers (subject-vectors) based on whether a person had zero, one, or two copies of particular SNP-variant at each sequential SNP-location. SNP-strings were defined as those ordered-combinations of eleven-numbers (0 or 1), representing a haplotype, two of which combined to form the observed subject-vector. Subject-vectors were resolved using probabilistic methods. In both regions, only a small number of SNP-strings were present. We compared our method to the SHAPEIT-2 phasing-algorithm. When the SNP-information spanning 200 kb was used, SHAPEIT-2 was inaccurate. When the SHAPEIT-2 window was increased to 2,000 kb, the concordance between the two methods, in both of these eleven-SNP regions, was over 99%, suggesting that, in these regions, both methods were quite accurate. Nevertheless, correspondence was not uniformly high over the entire DNA-span but, rather, was characterized by alternating peaks and valleys of concordance. Moreover, in the valleys of poor-correspondence, SHAPEIT-2 was also inconsistent with itself, suggesting that

Identification and genetic effect of haplotype in the bovine BMP7 gene.

PubMed

Huang, Yong-Zhen; Wang, Xin-Lei; He, Hua; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong

2013-12-15

Bone morphogenetic proteins (BMPs) are peptide growth factors belonging to the transforming growth factor-beta (TGF-β) superfamily, and some members of the BMP family support white adipocyte differentiation. In this study, we focused on the BMP7 which singularly promotes the differentiation of brown preadipocytes. Haplotypes involving 5 single nucleotide polymorphism (SNP) sites in the bovine BMP7 gene were identified and their effect on body weight was analyzed. 16 haplotypes and 18 combined haplotypes were revealed and the linkage disequilibrium was assessed in the cattle population with 602 individuals representing three main cattle breeds from China. The results showed that haplotypes 3, 10 and 14 were predominant and accounted for 75.64%, 69.85%, and 83.36% in Nanyang, Qinchuan and Jiaxian cattle breeds, respectively. The statistical analyses indicated that the SNP 1, 4, and 5 are associated with the body weight, body length, and heart girth at 12 and 24 months in Nanyang cattle population (P<0.05), whereas there is no significant association between their 16 haplotypes and 18 combined haplotypes. Our results provide evidence that some SNPs and haplotypes in BMP7 are associated with growth traits, and may be utilized as a genetic marker in marker-assisted selection for beef cattle breeding programs. Copyright © 2013. Published by Elsevier B.V.

Global variation in CYP2C8–CYP2C9 functional haplotypes

PubMed Central

Speed, William C; Kang, Soonmo Peter; Tuck, David P; Harris, Lyndsay N; Kidd, Kenneth K

2009-01-01

We have studied the global frequency distributions of 10 single nucleotide polymorphisms (SNPs) across 132 kb of CYP2C8 and CYP2C9 in ∼2500 individuals representing 45 populations. Five of the SNPs were in noncoding sequences; the other five involved the more common missense variants (four in CYP2C8, one in CYP2C9) that change amino acids in the gene products. One haplotype containing two CYP2C8 coding variants and one CYP2C9 coding variant reaches an average frequency of 10% in Europe; a set of haplotypes with a different CYP2C8 coding variant reaches 17% in Africa. In both cases these haplotypes are found in other regions of the world at <1%. This considerable geographic variation in haplotype frequencies impacts the interpretation of CYP2C8/CYP2C9 association studies, and has pharmacogenomic implications for drug interactions. PMID:19381162

Cloud Computing-Based TagSNP Selection Algorithm for Human Genome Data

PubMed Central

Hung, Che-Lun; Chen, Wen-Pei; Hua, Guan-Jie; Zheng, Huiru; Tsai, Suh-Jen Jane; Lin, Yaw-Ling

2015-01-01

Single nucleotide polymorphisms (SNPs) play a fundamental role in human genetic variation and are used in medical diagnostics, phylogeny construction, and drug design. They provide the highest-resolution genetic fingerprint for identifying disease associations and human features. Haplotypes are regions of linked genetic variants that are closely spaced on the genome and tend to be inherited together. Genetics research has revealed SNPs within certain haplotype blocks that introduce few distinct common haplotypes into most of the population. Haplotype block structures are used in association-based methods to map disease genes. In this paper, we propose an efficient algorithm for identifying haplotype blocks in the genome. In chromosomal haplotype data retrieved from the HapMap project website, the proposed algorithm identified longer haplotype blocks than an existing algorithm. To enhance its performance, we extended the proposed algorithm into a parallel algorithm that copies data in parallel via the Hadoop MapReduce framework. The proposed MapReduce-paralleled combinatorial algorithm performed well on real-world data obtained from the HapMap dataset; the improvement in computational efficiency was proportional to the number of processors used. PMID:25569088

Population Genetics of Verticillium dahliae in Iran Based on Microsatellite and Single Nucleotide Polymorphism Markers.

PubMed

Rafiei, Vahideh; Banihashemi, Ziaeddin; Bautista-Jalon, Laura S; Del Mar Jiménez-Gasco, Maria; Turgeon, B Gillian; Milgroom, Michael G

2018-06-01

Verticillium dahliae is a plant pathogenic fungus that reproduces asexually and its population structure is highly clonal. In the present study, 78 V. dahliae isolates from Iran were genotyped for mating type, single nucleotide polymorphisms (SNPs), and microsatellites to assign them to clonal lineages and to determine population genetic structure in Iran. The mating type of all isolates was MAT1-2. Based on neighbor-joining analysis and minimum spanning networks constructed from SNPs and microsatellite genotypes, respectively, all but four isolates were assigned to lineage 2B 824 ; four isolates were assigned to lineage 4B. The inferred coalescent genealogy of isolates in lineage 2B 824 showed a clear divergence into two clades that corresponded to geographic origin and host. Haplotypes of cotton and pistachio isolates sampled from central Iran were in one clade, and those of isolates from Prunus spp. sampled from northwestern Iran were in the other. The strong divergence in haplotypes between the two clades suggests that there were at least two separate introductions of lineage 2B 824 to different parts of Iran. Given the history of cotton and pistachio cultivation and Verticillium wilt in Iran, these results are consistent with the hypothesis that cotton was historically a likely source inoculum causing Verticillium wilt in pistachio.

SNP and haplotype analysis of paired box 3 (PAX3) gene provide evidence for association with growth traits in Chinese cattle.

PubMed

Xu, Yao; Cai, Hanfang; Zhou, Yang; Shi, Tao; Lan, Xianyong; Zhang, Chunlei; Lei, Chuzhao; Jia, Yutang; Chen, Hong

2014-07-01

Paired box 3 (PAX3) belongs to the PAX superfamily of transcription factors and plays essential roles in the embryogenesis and postnatal formation of limb musculature through affecting the survival of muscle progenitor cells. By genetic mapping, PAX3 gene is assigned in the interval of quantitative trait loci for body weight on bovine BTA2. The objectives of this study were to detect polymorphisms of PAX3 gene in 1,241 cattle from five breeds and to investigate their effects on growth traits. Initially, three novel single nucleotide polymorphisms (SNPs) were identified by DNA pool sequencing and aCRS-RFLP methods (AC_000159: g.T-580G, g.A4617C and g.79018Ins/del G), which were located at 5'-UTR, exon 4 and intron 6, respectively. A total of eight haplotypes were constructed and the frequency of the three main haplotypes H1 (TAG), H2 (GCG) and H3 (GAG) accounted for over 81.7 % of the total individuals. Statistical analysis revealed that the three SNPs were associated with body height and body length of Nanyang and Chinese Caoyuan cattle at the age of 6 and/or 12 months old (P < 0.05), and consistently significant effects were also found in the haplotype combination analysis on these traits (P < 0.05). This study presented a complete scan of variations within bovine PAX3 gene, which could provide evidence for improving the economic traits of cattle by using these variations as potentially genetic markers in early marker-assisted selection programs.

Molecular identification and first report of mitochondrial COI gene haplotypes in the hawksbill turtle Eretmochelys imbricata (Testudines: Cheloniidae) in the Colombian Caribbean nesting colonies.

PubMed

Daza-Criado, L; Hernández-Fernández, J

2014-02-21

Hawksbill sea turtles Eretmochelys imbricata are found extensively around the world, including the Atlantic, Pacific, and Indian Oceans; the Persian Gulf, and the Red and Mediterranean Seas. Populations of this species are affected by international trafficking of their shields, meat, and eggs, making it a critically endangered animal. We determined the haplotypes of 17 hawksbill foraging turtles of Islas del Rosario (Bolivar) and of the nesting beach Don Diego (Magdalena) in the Colombian Caribbean based on amplification and sequencing of the mitochondrial gene cytochrome oxidase c subunit I (COI). We identified 5 haplotypes, including EI-A1 previously reported in Puerto Rico, which was similar to 10 of the study samples. To our knowledge, the remaining 4 haplotypes have not been described. Samples EICOI11 and EICOI3 showed 0.2% divergence from EI-A1, by a single nucleotide change, and were classified as the EI-A2 haplotype. EICOI6, EICOI14, and EICOI12 samples showed 0.2% divergence from EI-A1 and 0.3% divergence from EI-A2 and were classified as EI-A3 haplotype. Samples EICOI16 and EICOI15 presented 5 nucleotide changes each and were classified as 2 different haplotypes, EI-A4 and EI-A5, respectively. The last 2 haplotypes had higher nucleotide diversity (K2P=1.7%) than that by the first 3 haplotypes. EI-A1 and EI-A2 occurred in nesting individuals, and EI-A2, EI-A3, EI-A4, and EI-A5 occurred in foraging individuals. The description of the haplotypes may be associated with reproductive migrations or foraging and could support the hypothesis of natal homing. Furthermore, they can be used in phylogeographic studies.

Intrahaplotypic Variants Differentiate Complex Linkage Disequilibrium within Human MHC Haplotypes

PubMed Central

Lam, Tze Hau; Tay, Matthew Zirui; Wang, Bei; Xiao, Ziwei; Ren, Ee Chee

2015-01-01

Distinct regions of long-range genetic fixation in the human MHC region, known as conserved extended haplotypes (CEHs), possess unique genomic characteristics and are strongly associated with numerous diseases. While CEHs appear to be homogeneous by SNP analysis, the nature of fine variations within their genomic structure is unknown. Using multiple, MHC-homozygous cell lines, we demonstrate extensive sequence conservation in two common Asian MHC haplotypes: A33-B58-DR3 and A2-B46-DR9. However, characterization of phase-resolved MHC haplotypes revealed unique intra-CEH patterns of variation and uncovered 127 single nucleotide variants (SNVs) which are missing from public databases. We further show that the strong linkage disequilibrium structure within the human MHC that typically confounds precise identification of genetic features can be resolved using intra-CEH variants, as evidenced by rs3129063 and rs448489, which affect expression of ZFP57, a gene important in methylation and epigenetic regulation. This study demonstrates an improved strategy that can be used towards genetic dissection of diseases. PMID:26593880

The JAK2 GGCC (46/1) Haplotype in Myeloproliferative Neoplasms: Causal or Random?

PubMed Central

Anelli, Luisa; Zagaria, Antonella; Specchia, Giorgina

2018-01-01

The germline JAK2 haplotype known as “GGCC or 46/1 haplotype” (haplotypeGGCC_46/1) consists of a combination of single nucleotide polymorphisms (SNPs) mapping in a region of about 250 kb, extending from the JAK2 intron 10 to the Insulin-like 4 (INLS4) gene. Four main SNPs (rs3780367, rs10974944, rs12343867, and rs1159782) generating a “GGCC” combination are more frequently indicated to represent the JAK2 haplotype. These SNPs are inherited together and are frequently associated with the onset of myeloproliferative neoplasms (MPN) positive for both JAK2 V617 and exon 12 mutations. The association between the JAK2 haplotypeGGCC_46/1 and mutations in other genes, such as thrombopoietin receptor (MPL) and calreticulin (CALR), or the association with triple negative MPN, is still controversial. This review provides an overview of the frequency and the role of the JAK2 haplotypeGGCC_46/1 in the pathogenesis of different myeloid neoplasms and describes the hypothetical mechanisms at the basis of the association with JAK2 gene mutations. Moreover, possible clinical implications are discussed, as different papers reported contrasting data about the correlation between the JAK2 haplotypeGGCC_46/1 and blood cell count, survival, or disease progression. PMID:29641446

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Single nucleotide polymorphisms of the angiotensin-converting enzyme (ACE) gene are associated with essential hypertension and increased ACE enzyme levels in Mexican individuals.

PubMed

Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

2013-01-01

To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Nine ACE gene polymorphisms were genotyped by 5' exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). The results suggest that single nucleotide polymorphisms and the "GGATG" haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels.

Novel and efficient tag SNPs selection algorithms.

PubMed

Chen, Wen-Pei; Hung, Che-Lun; Tsai, Suh-Jen Jane; Lin, Yaw-Ling

2014-01-01

SNPs are the most abundant forms of genetic variations amongst species; the association studies between complex diseases and SNPs or haplotypes have received great attention. However, these studies are restricted by the cost of genotyping all SNPs; thus, it is necessary to find smaller subsets, or tag SNPs, representing the rest of the SNPs. In fact, the existing tag SNP selection algorithms are notoriously time-consuming. An efficient algorithm for tag SNP selection was presented, which was applied to analyze the HapMap YRI data. The experimental results show that the proposed algorithm can achieve better performance than the existing tag SNP selection algorithms; in most cases, this proposed algorithm is at least ten times faster than the existing methods. In many cases, when the redundant ratio of the block is high, the proposed algorithm can even be thousands times faster than the previously known methods. Tools and web services for haplotype block analysis integrated by hadoop MapReduce framework are also developed using the proposed algorithm as computation kernels.

APC Yin-Yang haplotype associated with colorectal cancer risk

PubMed Central

GARRE, P.; DE LA HOYA, M.; INIESTA, P.; ROMERA, A.; LLOVET, P.; GONZALEZ, S.; PEREZ-SEGURA, P.; CAPELLA, G.; DIAZ-RUBIO, E.; CALDES, T.

2010-01-01

The Yin-Yang haplotype is defined as two mismatched haplotypes (Yin and Yang) representing the majority of the existing haplotypes in a particular genomic region. The human adenomatous polyposis coli (APC) gene shows a Yin-Yang haplotype pattern accounting for 84% of all of the haplotypes existing in the Spanish population. Several association studies have been published regarding APC gene variants (SNPs and haplotypes) and colorectal cancer (CRC) risk. However, no studies concerning diplotype structure and CRC risk have been conducted. The aim of the present study was to investigate whether the APC Yin-Yang homozygote diplotype is over-represented in patients with sporadic CRC when compared to its distribution in controls, and its association with CRC risk. TaqMan® assays were used to genotype three tagSNPs selected across the APC Yin-Yang region. Frequencies of the APC Yin-Yang tagSNP alleles, haplotype and diplotype of 378 CRC cases and 642 controls were compared. Two Spanish CRC group samples were included [Hospital Clínico San Carlos in Madrid (HCSC) and Instituto Catalán de Oncología in Barcelona (ICO)]. Analysis of 157 consecutive CRC patients and 405 control subjects from HCSC showed a significative effect for the risk of CRC (OR=1.93; 95% CI 1.32–2.81; P=0.001). However, this effect was not confirmed in 221 CRC patients and 237 control subjects from ICO (OR=0.89; 95% CI 0.61–1.28; P=0.521). We found a significant association between the APC homozygote Yin-Yang diplotype and the risk of colorectal cancer in the HCSC samples. However, we did not observe this association in the ICO samples. These observations suggest that a study with a larger Spanish cohort is necessary to confirm the effects of the APC Yin-Yang diplotype on the risk of CRC. PMID:22993613

APC Yin-Yang haplotype associated with colorectal cancer risk.

PubMed

Garre, P; DE LA Hoya, M; Iniesta, P; Romera, A; Llovet, P; Gonzalez, S; Perez-Segura, P; Capella, G; Diaz-Rubio, E; Caldes, T

2010-09-01

The Yin-Yang haplotype is defined as two mismatched haplotypes (Yin and Yang) representing the majority of the existing haplotypes in a particular genomic region. The human adenomatous polyposis coli (APC) gene shows a Yin-Yang haplotype pattern accounting for 84% of all of the haplotypes existing in the Spanish population. Several association studies have been published regarding APC gene variants (SNPs and haplotypes) and colorectal cancer (CRC) risk. However, no studies concerning diplotype structure and CRC risk have been conducted. The aim of the present study was to investigate whether the APC Yin-Yang homozygote diplotype is over-represented in patients with sporadic CRC when compared to its distribution in controls, and its association with CRC risk. TaqMan(®) assays were used to genotype three tagSNPs selected across the APC Yin-Yang region. Frequencies of the APC Yin-Yang tagSNP alleles, haplotype and diplotype of 378 CRC cases and 642 controls were compared. Two Spanish CRC group samples were included [Hospital Clínico San Carlos in Madrid (HCSC) and Instituto Catalán de Oncología in Barcelona (ICO)]. Analysis of 157 consecutive CRC patients and 405 control subjects from HCSC showed a significative effect for the risk of CRC (OR=1.93; 95% CI 1.32-2.81; P=0.001). However, this effect was not confirmed in 221 CRC patients and 237 control subjects from ICO (OR=0.89; 95% CI 0.61-1.28; P=0.521). We found a significant association between the APC homozygote Yin-Yang diplotype and the risk of colorectal cancer in the HCSC samples. However, we did not observe this association in the ICO samples. These observations suggest that a study with a larger Spanish cohort is necessary to confirm the effects of the APC Yin-Yang diplotype on the risk of CRC.

DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

NASA Astrophysics Data System (ADS)

Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan

2017-02-01

Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

A prospective study of XRCC1 haplotypes and their interaction with plasma carotenoids on breast cancer risk

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mohrenweiser, H W; Han, J; Hankinson, S E

2004-01-15

The XRCC1 protein is involved in the base excision repair pathway through interactions with other proteins. Polymorphisms in the XRCC1 gene may lead to variation in repair proficiency and confer inherited predisposition to cancer. We prospectively assessed the associations between polymorphisms and haplotypes in XRCC1 and breast cancer risk in a nested case-control study within the Nurses' Health Study (incident cases, n 1004; controls, n 1385). We further investigated gene-environment interactions between the XRCC1 variations and plasma carotenoids on breast cancer risk. We genotyped four haplotype-tagging single nucleotide polymorphisms Arg {sup 194}Trp, C26602T, Arg{sup 399}Gln, and Gln{sup 632}Gln in themore » XRCC1 gene. Five common haplotypes accounted for 99% of the chromosomes in the present study population of mostly Caucasian women. We observed a marginally significant reduction in the risk of breast cancer among {sup 194}Trp carriers. As compared with no-carriers, women with at least one {sup 194}Trp allele had a multivariate odds ratio of 0.79 (95% of the confidence interval, 0.60 -1.04). The inferred haplotype harboring the {sup 194}Trp allele was more common in controls than in cases (6.6 versus 5.3%, P 0.07). We observed that the Arg {sup 194}Trp modified the inverse associations of plasma -carotene level (P, ordinal test for interaction 0.02) and plasma -carotene level (P, ordinal test for interaction 0.003) with breast cancer risk. No suggestion of an interaction was observed between the Arg {sup 194}Trp and cigarette smoking. Our results suggest an inverse association between XRCC1 {sup 194}Trp allele and breast cancer risk. The findings of the effect modification of the Arg {sup 194}Trp on the relations of plasma -and -carotene levels with breast cancer risk suggest a potential protective effect of carotenoids in breast carcinogenesis by preventing oxidative DNA damage.« less

Construction and forensic genetic characterization of 11 autosomal haplotypes consisting of 22 tri-allelic indels.

PubMed

Zhao, Xiaohong; Chen, Xiaogang; Zhao, Yuancun; Zhang, Shu; Gao, Zehua; Yang, Yiwen; Wang, Yufang; Zhang, Ji

2018-05-01

Insertion/deletion polymorphisms (indels), which combine the advantages of both short tandem repeats and single-nucleotide polymorphisms, are suitable for parentage testing. To overcome the limitations of the low polymorphism of di-allelic indels, we constructed a set of haplotypes with physically linked, multi-allelic indels. Candidate haplotypes were selected from the 1000 Genomes Project database, and were subject to the following criteria for inclusion: (i) each marker must have a minimum allele frequency (MAF) of ≥0.1 in the Han population of China; (ii) markers must exist in a non-coding region; (iii) the physical distance between a pair of candidate indels must be <500 bp; (iv) the allele length variation of each indel from 1 to 20 bp; (v) different haplotypes must be located on different chromosomes or chromosomal arms, or be more than 10 Mb apart if on the same chromosomal arm; and (vi) they must not be located across a recombination hotspot. A multiplex system with 11 haplotype markers, comprising 22 tri-allelic indel loci distributed over 10 chromosomes was developed. To validate the multiplex panel, we investigated the haplotype distribution in sets of two and three-generation pedigrees. The results demonstrated that the haplotypes consisting of multi-allelic indel markers exhibited higher polymorphism than a single indel locus, and thus provide Supplementary information for forensic kinship identification. Copyright © 2018 Elsevier B.V. All rights reserved.

Bootstrap study of genome-enabled prediction reliabilities using haplotype blocks across Nordic Red cattle breeds.

PubMed

Cuyabano, B C D; Su, G; Rosa, G J M; Lund, M S; Gianola, D

2015-10-01

This study compared the accuracy of genome-enabled prediction models using individual single nucleotide polymorphisms (SNP) or haplotype blocks as covariates when using either a single breed or a combined population of Nordic Red cattle. The main objective was to compare predictions of breeding values of complex traits using a combined training population with haplotype blocks, with predictions using a single breed as training population and individual SNP as predictors. To compare the prediction reliabilities, bootstrap samples were taken from the test data set. With the bootstrapped samples of prediction reliabilities, we built and graphed confidence ellipses to allow comparisons. Finally, measures of statistical distances were used to calculate the gain in predictive ability. Our analyses are innovative in the context of assessment of predictive models, allowing a better understanding of prediction reliabilities and providing a statistical basis to effectively calibrate whether one prediction scenario is indeed more accurate than another. An ANOVA indicated that use of haplotype blocks produced significant gains mainly when Bayesian mixture models were used but not when Bayesian BLUP was fitted to the data. Furthermore, when haplotype blocks were used to train prediction models in a combined Nordic Red cattle population, we obtained up to a statistically significant 5.5% average gain in prediction accuracy, over predictions using individual SNP and training the model with a single breed. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms

PubMed Central

Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C. V. Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K.

2016-01-01

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum, indicating a population bottleneck during domestication of C. baccatum. In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum, 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index (FST) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9–2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers. PMID:27857720

Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms.

PubMed

Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C V Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K

2016-01-01

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum , indicating a population bottleneck during domestication of C. baccatum . In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum , 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index ( F ST ) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9-2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers.

Computational intelligence in bioinformatics: SNP/haplotype data in genetic association study for common diseases.

PubMed

Kelemen, Arpad; Vasilakos, Athanasios V; Liang, Yulan

2009-09-01

Comprehensive evaluation of common genetic variations through association of single-nucleotide polymorphism (SNP) structure with common complex disease in the genome-wide scale is currently a hot area in human genome research due to the recent development of the Human Genome Project and HapMap Project. Computational science, which includes computational intelligence (CI), has recently become the third method of scientific enquiry besides theory and experimentation. There have been fast growing interests in developing and applying CI in disease mapping using SNP and haplotype data. Some of the recent studies have demonstrated the promise and importance of CI for common complex diseases in genomic association study using SNP/haplotype data, especially for tackling challenges, such as gene-gene and gene-environment interactions, and the notorious "curse of dimensionality" problem. This review provides coverage of recent developments of CI approaches for complex diseases in genetic association study with SNP/haplotype data.

The role of the JAK2 GGCC haplotype and the TET2 gene in familial myeloproliferative neoplasms

PubMed Central

Olcaydu, Damla; Rumi, Elisa; Harutyunyan, Ashot; Passamonti, Francesco; Pietra, Daniela; Pascutto, Cristiana; Berg, Tiina; Jäger, Roland; Hammond, Emma; Cazzola, Mario; Kralovics, Robert

2011-01-01

Background Myeloproliferative neoplasms constitute a group of diverse chronic myeloid malignancies that share pathogenic features such as acquired mutations in the JAK2, TET2, CBL and MPL genes. There are recent reports that a JAK2 gene haplotype (GGCC or 46/1) confers susceptibility to JAK2 mutation-positive myeloproliferative neoplasms. The aim of this study was to examine the role of the JAK2 GGCC haplotype and germline mutations of TET2, CBL and MPL in familial myeloproliferative neoplasms. Design and Methods We investigated patients with familial (n=88) or sporadic (n=684) myeloproliferative neoplasms, and a control population (n=203) from the same demographic area in Italy. Association analysis was performed using tagged single nucleotide polymorphisms (rs10974944 and rs12343867) of the JAK2 haplotype. Sequence analysis of TET2, CBL and MPL was conducted in the 88 patients with familial myeloproliferative neoplasms. Results Association analysis revealed no difference in haplotype frequency between familial and sporadic cases of myeloproliferative neoplasms (P=0.6529). No germline mutations in TET2, CBL or MPL that segregate with the disease phenotype were identified. As we observed variability in somatic mutations in the affected members of a pedigree with myeloproliferative neoplasms, we postulated that somatic mutagenesis is increased in familial myeloproliferative neoplasms. Accordingly, we compared the incidence of malignant disorders between sporadic and familial patients. Although the overall incidence of malignant disorders did not differ significantly between cases of familial and sporadic myeloproliferative neoplasms, malignancies were more frequent in patients with familial disease aged between 50 to 70 years (P=0.0198) than in patients in the same age range with sporadic myeloproliferative neoplasms. Conclusions We conclude that the JAK2 GGCC haplotype and germline mutations of TET2, CBL or MPL do not explain familial clustering of

The IGF1 small dog haplotype is derived from Middle Eastern grey wolves.

PubMed

Gray, Melissa M; Sutter, Nathan B; Ostrander, Elaine A; Wayne, Robert K

2010-02-24

A selective sweep containing the insulin-like growth factor 1 (IGF1) gene is associated with size variation in domestic dogs. Intron 2 of IGF1 contains a SINE element and single nucleotide polymorphism (SNP) found in all small dog breeds that is almost entirely absent from large breeds. In this study, we surveyed a large sample of grey wolf populations to better understand the ancestral pattern of variation at IGF1 with a particular focus on the distribution of the small dog haplotype and its relationship to the origin of the dog. We present DNA sequence data that confirms the absence of the derived small SNP allele in the intron 2 region of IGF1 in a large sample of grey wolves and further establishes the absence of a small dog associated SINE element in all wild canids and most large dog breeds. Grey wolf haplotypes from the Middle East have higher nucleotide diversity suggesting an origin there. Additionally, PCA and phylogenetic analyses suggests a closer kinship of the small domestic dog IGF1 haplotype with those from Middle Eastern grey wolves. The absence of both the SINE element and SNP allele in grey wolves suggests that the mutation for small body size post-dates the domestication of dogs. However, because all small dogs possess these diagnostic mutations, the mutations likely arose early in the history of domestic dogs. Our results show that the small dog haplotype is closely related to those in Middle Eastern wolves and is consistent with an ancient origin of the small dog haplotype there. Thus, in concordance with past archeological studies, our molecular analysis is consistent with the early evolution of small size in dogs from the Middle East.See associated opinion by Driscoll and Macdonald: http://jbiol.com/content/9/2/10.

Live single-cell laser tag.

PubMed

Binan, Loïc; Mazzaferri, Javier; Choquet, Karine; Lorenzo, Louis-Etienne; Wang, Yu Chang; Affar, El Bachir; De Koninck, Yves; Ragoussis, Jiannis; Kleinman, Claudia L; Costantino, Santiago

2016-05-20

The ability to conduct image-based, non-invasive cell tagging, independent of genetic engineering, is key to cell biology applications. Here we introduce cell labelling via photobleaching (CLaP), a method that enables instant, specific tagging of individual cells based on a wide array of criteria such as shape, behaviour or positional information. CLaP uses laser illumination to crosslink biotin onto the plasma membrane, coupled with streptavidin conjugates to label individual cells for genomic, cell-tracking, flow cytometry or ultra-microscopy applications. We show that the incorporated mark is stable, non-toxic, retained for several days, and transferred by cell division but not to adjacent cells in culture. To demonstrate the potential of CLaP for genomic applications, we combine CLaP with microfluidics-based single-cell capture followed by transcriptome-wide next-generation sequencing. Finally, we show that CLaP can also be exploited for inducing transient cell adhesion to substrates for microengineering cultures with spatially patterned cell types.

MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

PubMed

Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

2016-10-01

The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

Dominant Sequences of Human Major Histocompatibility Complex Conserved Extended Haplotypes from HLA-DQA2 to DAXX

PubMed Central

Larsen, Charles E.; Alford, Dennis R.; Trautwein, Michael R.; Jalloh, Yanoh K.; Tarnacki, Jennifer L.; Kunnenkeri, Sushruta K.; Fici, Dolores A.; Yunis, Edmond J.; Awdeh, Zuheir L.; Alper, Chester A.

2014-01-01

We resequenced and phased 27 kb of DNA within 580 kb of the MHC class II region in 158 population chromosomes, most of which were conserved extended haplotypes (CEHs) of European descent or contained their centromeric fragments. We determined the single nucleotide polymorphism and deletion-insertion polymorphism alleles of the dominant sequences from HLA-DQA2 to DAXX for these CEHs. Nine of 13 CEHs remained sufficiently intact to possess a dominant sequence extending at least to DAXX, 230 kb centromeric to HLA-DPB1. We identified the regions centromeric to HLA-DQB1 within which single instances of eight “common” European MHC haplotypes previously sequenced by the MHC Haplotype Project (MHP) were representative of those dominant CEH sequences. Only two MHP haplotypes had a dominant CEH sequence throughout the centromeric and extended class II region and one MHP haplotype did not represent a known European CEH anywhere in the region. We identified the centromeric recombination transition points of other MHP sequences from CEH representation to non-representation. Several CEH pairs or groups shared sequence identity in small blocks but had significantly different (although still conserved for each separate CEH) sequences in surrounding regions. These patterns partly explain strong calculated linkage disequilibrium over only short (tens to hundreds of kilobases) distances in the context of a finite number of observed megabase-length CEHs comprising half a population's haplotypes. Our results provide a clearer picture of European CEH class II allelic structure and population haplotype architecture, improved regional CEH markers, and raise questions concerning regional recombination hotspots. PMID:25299700

Ancient mitochondrial haplotypes and evidence for intragenic recombination in a gynodioecious plant.

PubMed

Städler, Thomas; Delph, Lynda F

2002-09-03

Because of their extremely low nucleotide mutation rates, plant mitochondrial genes are generally not expected to show variation within species. Remarkably, we found nine distinct cytochrome b sequence haplotypes in the gynodioecious alpine plant Silene acaulis, with two or more haplotypes coexisting locally in each of three sampled regions. Moreover, there is evidence for intragenic recombination in the history of the haplotype sample, implying at least transient heteroplasmy of mitochondrial DNA (mtDNA). Heteroplasmy might be achieved by one of two potential mechanisms, either continuous coexistence of subgenomic fragments in low stoichiometry, or occasional paternal leakage of mtDNA. On the basis of levels of synonymous nucleotide substitutions, the average divergence time between haplotypes is estimated to be at least 15 million years. Ancient coalescence of extant haplotypes is further indicated by the paucity of fixed differences in haplotypes obtained from related species, a pattern expected under trans-specific evolution. Our data are consistent with models of frequency-dependent selection on linked cytoplasmic male-sterility factors, the putative molecular basis of females in gynodioecious populations. However, associations between marker loci and the inferred male-sterility genes can be maintained only with very low rates of recombination. Heteroplasmy and recombination between divergent haplotypes imply unexplored consequences for the evolutionary dynamics of gynodioecy, a widespread plant breeding system.

Mitochondrial haplotypes are not associated with mice selectively bred for high voluntary wheel running.

PubMed

Wone, Bernard W M; Yim, Won C; Schutz, Heidi; Meek, Thomas H; Garland, Theodore

2018-04-04

Mitochondrial haplotypes have been associated with human and rodent phenotypes, including nonshivering thermogenesis capacity, learning capability, and disease risk. Although the mammalian mitochondrial D-loop is highly polymorphic, D-loops in laboratory mice are identical, and variation occurs elsewhere mainly between nucleotides 9820 and 9830. Part of this region codes for the tRNA Arg gene and is associated with mitochondrial densities and number of mtDNA copies. We hypothesized that the capacity for high levels of voluntary wheel-running behavior would be associated with mitochondrial haplotype. Here, we analyzed the mtDNA polymorphic region in mice from each of four replicate lines selectively bred for 54 generations for high voluntary wheel running (HR) and from four control lines (Control) randomly bred for 54 generations. Sequencing the polymorphic region revealed a variable number of adenine repeats. Single nucleotide polymorphisms (SNPs) varied from 2 to 3 adenine insertions, resulting in three haplotypes. We found significant genetic differentiations between the HR and Control groups (F st  = 0.779, p ≤ 0.0001), as well as among the replicate lines of mice within groups (F sc  = 0.757, p ≤ 0.0001). Haplotypes, however, were not strongly associated with voluntary wheel running (revolutions run per day), nor with either body mass or litter size. This system provides a useful experimental model to dissect the physiological processes linking mitochondrial, genomic SNPs, epigenetics, or nuclear-mitochondrial cross-talk to exercise activity. Copyright © 2018. Published by Elsevier B.V.

Variation analysis and gene annotation of eight MHC haplotypes: The MHC Haplotype Project

PubMed Central

Horton, Roger; Gibson, Richard; Coggill, Penny; Miretti, Marcos; Allcock, Richard J.; Almeida, Jeff; Forbes, Simon; Gilbert, James G. R.; Halls, Karen; Harrow, Jennifer L.; Hart, Elizabeth; Howe, Kevin; Jackson, David K.; Palmer, Sophie; Roberts, Anne N.; Sims, Sarah; Stewart, C. Andrew; Traherne, James A.; Trevanion, Steve; Wilming, Laurens; Rogers, Jane; de Jong, Pieter J.; Elliott, John F.; Sawcer, Stephen; Todd, John A.; Trowsdale, John

2008-01-01

The human major histocompatibility complex (MHC) is contained within about 4 Mb on the short arm of chromosome 6 and is recognised as the most variable region in the human genome. The primary aim of the MHC Haplotype Project was to provide a comprehensively annotated reference sequence of a single, human leukocyte antigen-homozygous MHC haplotype and to use it as a basis against which variations could be assessed from seven other similarly homozygous cell lines, representative of the most common MHC haplotypes in the European population. Comparison of the haplotype sequences, including four haplotypes not previously analysed, resulted in the identification of >44,000 variations, both substitutions and indels (insertions and deletions), which have been submitted to the dbSNP database. The gene annotation uncovered haplotype-specific differences and confirmed the presence of more than 300 loci, including over 160 protein-coding genes. Combined analysis of the variation and annotation datasets revealed 122 gene loci with coding substitutions of which 97 were non-synonymous. The haplotype (A3-B7-DR15; PGF cell line) designated as the new MHC reference sequence, has been incorporated into the human genome assembly (NCBI35 and subsequent builds), and constitutes the largest single-haplotype sequence of the human genome to date. The extensive variation and annotation data derived from the analysis of seven further haplotypes have been made publicly available and provide a framework and resource for future association studies of all MHC-associated diseases and transplant medicine. PMID:18193213

The Single Nucleotide Polymorphism Consortium

NASA Technical Reports Server (NTRS)

Morgan, Michael

2003-01-01

I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

Homozygosity of single nucleotide polymorphisms in the 3' region of the canine estrogen receptor 1 gene is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas.

PubMed

Pathirana, Indunil N; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

2011-06-01

Differences in the distribution of single nucleotide polymorphisms (SNPs) and haplotypes in the estrogen receptor α gene (ESR1) were examined in Miniature Dachshunds (n = 48), Chihuahuas (n = 20) and Toy Poodles (n = 18). Five DNA fragments located in the 40-kb region at the 3' end of ESR1 were amplified by polymerase chain reaction and were directly sequenced. We compared allele, genotype and estimated haplotype frequencies at each SNP in the 3' end of ESR1 for these three breeds of small dog. The frequency of the major allele and the genotype frequency of the major allele homozygotes, were significantly higher in Toy Poodles for five SNPs (SNP #5, #14-17) than in Miniature Dachshunds, and significantly higher in Toy Poodles than Chihuahuas for three SNPs (SNP #15-17). A common haplotype block was identified in an approximately 20-kb region encompassing four SNPs (SNPs # 14-17). The frequencies of the most abundant estimated haplotype (GTTG) and GTTG homozygotes were significantly higher in Toy Poodles than in the other two breeds. These results imply that homozygosity for the allele, genotype and haplotype distribution within the block at the 3' end of ESR1 is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas. © 2011 The Authors; Animal Science Journal © 2011 Japanese Society of Animal Science.

HLA-G Haplotypes Are Differentially Associated with Asthmatic Features.

PubMed

Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie

2018-01-01

Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA - G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter

HLA-G Haplotypes Are Differentially Associated with Asthmatic Features

PubMed Central

Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie

2018-01-01

Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA-G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter

Single Nucleotide Polymorphisms of the Angiotensin-Converting Enzyme (ACE) Gene Are Associated with Essential Hypertension and Increased ACE Enzyme Levels in Mexican Individuals

PubMed Central

Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

2013-01-01

Aim To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Methods Nine ACE gene polymorphisms were genotyped by 5′ exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Results Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). Conclusion The results suggest that single nucleotide polymorphisms and the “GGATG” haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels. PMID:23741507

Genetic variation of the androgen receptor and risk of myocardial infarction and ischemic stroke in women.

PubMed

Rexrode, Kathryn M; Ridker, Paul M; Hegener, Hillary H; Buring, Julie E; Manson, JoAnn E; Zee, Robert Y L

2008-05-01

Androgen receptors (AR) are expressed in endothelial cells and vascular smooth-muscle cells. Some studies suggest an association between AR gene variation and risk of cardiovascular disease (CVD) in men; however, the relationship has not been examined in women. Six haplotype block-tagging single nucleotide polymorphisms (rs962458, rs6152, rs1204038, rs2361634, rs1337080, rs1337082), as well as the cysteine, adenine, guanine (CAG) microsatellite in exon 1, of the AR gene were evaluated among 300 white postmenopausal women who developed CVD (158 myocardial infarctions and 142 ischemic strokes) and an equal number of matched controls within the Women's Health Study. Genotype distributions were similar between cases and controls, and genotypes were not significantly related to risk of CVD, myocardial infarctions or ischemic stroke in conditional logistic regression models. Seven common haplotypes were observed, but distributions did not differ between cases and controls nor were significant associations observed in logistic regression analysis. The median CAG repeat length was 21. In conditional logistic regression, there was no association between the number of alleles with CAG repeat length >or=21 (or >or=22) and risk of CVD, myocardial infarctions or ischemic stroke. No association between AR genetic variation, as measured by haplotype-tagging single nucleotide polymorphisms and CAG repeat number, and risk of CVD was observed in women.

A scale space based algorithm for automated segmentation of single shot tagged MRI of shearing deformation.

PubMed

Sprengers, Andre M J; Caan, Matthan W A; Moerman, Kevin M; Nederveen, Aart J; Lamerichs, Rolf M; Stoker, Jaap

2013-04-01

This study proposes a scale space based algorithm for automated segmentation of single-shot tagged images of modest SNR. Furthermore the algorithm was designed for analysis of discontinuous or shearing types of motion, i.e. segmentation of broken tag patterns. The proposed algorithm utilises non-linear scale space for automatic segmentation of single-shot tagged images. The algorithm's ability to automatically segment tagged shearing motion was evaluated in a numerical simulation and in vivo. A typical shearing deformation was simulated in a Shepp-Logan phantom allowing for quantitative evaluation of the algorithm's success rate as a function of both SNR and the amount of deformation. For a qualitative in vivo evaluation tagged images showing deformations in the calf muscles and eye movement in a healthy volunteer were acquired. Both the numerical simulation and the in vivo tagged data demonstrated the algorithm's ability for automated segmentation of single-shot tagged MR provided that SNR of the images is above 10 and the amount of deformation does not exceed the tag spacing. The latter constraint can be met by adjusting the tag delay or the tag spacing. The scale space based algorithm for automatic segmentation of single-shot tagged MR enables the application of tagged MR to complex (shearing) deformation and the processing of datasets with relatively low SNR.

Single Nucleotide Polymorphism Markers for Genetic Mapping in Drosophila melanogaster

PubMed Central

Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed; Mapa, Felipa A.; Ruddy, David A.; Ryan, Jessica J.; Young, Lynn M.; Wells, Trent; Kopczynski, Casey; Ellis, Michael C.

2001-01-01

For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that recently have revolutionized human, mouse, and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila by using a sequence tagged site-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that span the genome. Most of these markers are single nucleotide polymorphisms and sequences for these variants are provided in an accessible format. The average density of the new markers is one per 225 kb on the autosomes and one per megabase on the X chromosome. We include in this survey a set of P-element strains that provide additional use for high-resolution mapping. We show one application of the new markers in a simple set of crosses to map a mutation in the hedgehog gene to an interval of <1 Mb. This new map resource significantly increases the efficiency and resolution of recombination mapping and will be of immediate value to the Drosophila research community. PMID:11381036

Allopregnanolone levels and depressive symptoms during pregnancy in relation to single nucleotide polymorphisms in the allopregnanolone synthesis pathway.

PubMed

Hellgren, Charlotte; Comasco, Erika; Skalkidou, Alkistis; Sundström-Poromaa, Inger

2017-08-01

Allopregnanolone, a neurosteroid whose levels rise throughout gestation, putatively stabilizes antenatal mood. The present study aimed to investigate associations of plasma allopregnanolone to antenatal depressive symptoms, as well as to genetic and obstetric factors. Allopregnanolone plasma levels from 284 pregnant women were measured around gestational week 18. Haplotype tag single nucleotide polymorphisms in the aldo-keto reductase family 1, members C2 and C4 (AKR1C2, AKR1C4), and steroid 5 alpha-reductase 1 and 2 (SRD5A1, and SRD5A2) genes were genotyped in a larger sample of pregnant women (n=1351). The Edinburgh Postnatal Depression Scale (EPDS) was administered via web-questionnaires in gestational weeks 17 and 32. Demographic and obstetric data was retrieved from web-questionnaires and medical records. There was no association between allopregnanolone levels and depressive symptoms. Furthermore, no associations between allopregnanolone level and synthesis pathway genotypes were found after accounting for multiple comparisons. However, exploratory analyses suggested that the women who were homozygous for the minor allele of the AKR1C2 polymorphism rs1937863 had nominally lower allopregnanolone levels and lower depression scores in gestational week 17, but also the highest increase in depression scores between week 17 and 32. Additionally, higher body mass index was associated with lower allopregnanolone levels. The results do not support second trimester plasma allopregnanolone as a mood stabilizing factor. However, we speculate that AKR1C2 variation may alter the susceptibility to depressive symptoms through effects on central allopregnanolone synthesis. Another implication of this study is that the relationship between neuroactive steroids and obesity in pregnancy deserves to be investigated. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Functional effects of single nucleotide polymorphisms in the coding region of human N-acetyltransferase 1

PubMed Central

Zhu, Yuanqi; Hein, David W.

2007-01-01

Genetic variants of human N-acetyltransferase 1 (NAT1) are associated with cancer and birth defects. N- and O-acetyltransferase catalytic activities, Michaelis-Menten kinetic constants (Km & Vmax), and steady state expression levels of NAT1-specific mRNA and protein were determined for the reference NAT1*4 and variant human NAT1 haplotypes possessing single nucleotide polymorphisms (SNPs) in the open reading frame. Although none of the SNPs caused a significant effect on steady state levels of NAT1-specific mRNA, C97T(R33stop), C190T(R64W), C559T (R187stop) and A752T(D251V) each reduced NAT1 protein level and/or N- and O-acetyltransferase catalytic activities to levels below detection. G560A(R187Q) substantially reduced NAT1 protein level and catalytic activities and increased substrate Km. The G445A(V149I), G459A(synonymous) and T640G(S214A) haplotype present in NAT1*11 significantly (p<0.05) increased NAT1 protein level and catalytic activity. Neither T21G(synonymous), T402C(synonymous), A613G(M205V), T777C(synonymous), G781A(E261K), or A787G(I263V) significantly affected Km, catalytic activity, mRNA or protein level. These results suggest heterogeneity among slow NAT1 acetylator phenotypes. PMID:17909564

Single nucleotide polymorphisms and microsatellites in the canine glutathione S-transferase pi 1 (GSTP1) gene promoter.

PubMed

Sacco, James; Mann, Sarah; Toral, Keller

2017-01-01

Genetic polymorphisms within the glutathione S-transferase P1 ( GSTP1 ) gene affect the elimination of toxic xenobiotics by the GSTP1 enzyme. In dogs, exposure to environmental chemicals that may be GSTP1 substrates is associated with cancer. The objectives of this study were to investigate the genetic variability in the GSTP1 promoter in a diverse population of 278 purebred dogs, compare the incidence of any variants found between breeds, and predict their effects on gene expression. To provide information on ancestral alleles, a number of wolves, coyotes, and foxes were also sequenced. Fifteen single nucleotide polymorphisms (SNPs) and two microsatellites were discovered. Three of these loci were only polymorphic in dogs while three other SNPs were unique to wolves and coyotes. The major allele at c.-46 is T in dogs but is C in the wild canids. The c.-185 delT variant was unique to dogs. The microsatellite located in the 5' untranslated region (5'UTR) was a highly polymorphic GCC tandem repeat, consisting of simple and compound alleles that varied in size from 10 to 22-repeat units. The most common alleles consisted of 11, 16, and 17-repeats. The 11-repeat allele was found in 10% of dogs but not in the other canids. Unequal recombination and replication slippage between similar and distinct alleles may be the mechanism for the multiple microsatellites observed. Twenty-eight haplotypes were constructed in the dog, and an additional 8 were observed in wolves and coyotes. While the most common haplotype acrossbreeds was the wild-type *1A(17), other prevalent haplotypes included *3A(11) in Greyhounds, *6A(16) in Labrador Retrievers, *9A(16) in Golden Retrievers, and *8A(19) in Standard Poodles. Boxers and Siberian Huskies exhibited minimal haplotypic diversity. Compared to the simple 16*1 allele, the compound 16*2 allele (found in 12% of dogs) may interfere with transcription factor binding and/or the stability of the GSTP1 transcript. Dogs and other canids exhibit

ABCB1 haplotype and OPRM1 118A > G genotype interaction in methadone maintenance treatment pharmacogenetics

PubMed Central

Barratt, Daniel T; Coller, Janet K; Hallinan, Richard; Byrne, Andrew; White, Jason M; Foster, David JR; Somogyi, Andrew A

2012-01-01

Background: Genetic variability in ABCB1, encoding the P-glycoprotein efflux transporter, has been linked to altered methadone maintenance treatment dose requirements. However, subsequent studies have indicated that additional environmental or genetic factors may confound ABCB1 pharmacogenetics in different methadone maintenance treatment settings. There is evidence that genetic variability in OPRM1, encoding the mu opioid receptor, and ABCB1 may interact to affect morphine response in opposite ways. This study aimed to examine whether a similar gene-gene interaction occurs for methadone in methadone maintenance treatment. Methods: Opioid-dependent subjects (n = 119) maintained on methadone (15–300 mg/day) were genotyped for five single nucleotide polymorphisms of ABCB1 (61A > G; 1199G > A; 1236C > T; 2677G > T; 3435C > T), as well as for the OPRM1 118A > G single nucleotide polymorphism. Subjects’ methadone doses and trough plasma (R)-methadone concentrations (Ctrough) were compared between ABCB1 haplotypes (with and without controlling for OPRM1 genotype), and between OPRM1 genotypes (with and without controlling for ABCB1 haplotype). Results: Among wild-type OPRM1 subjects, an ABCB1 variant haplotype group (subjects with a wild-type and 61A:1199G:1236C:2677T:3435T haplotype combination, or homozygous for the 61A:1199G:1236C:2677T:3435T haplotype) had significantly lower doses (median ± standard deviation 35 ± 5 versus 180 ± 65 mg/day, P < 0.01) and Ctrough (78 ± 22 versus 177 ± 97 ng/mL, P < 0.05) than ABCB1 wild-type subjects. Among subjects with the most common ABCB1 haplotype combination (wild-type with 61A:1199G:1236T:2677T:3435T), the OPRM1 118 A/G genotype was associated with a significantly higher Ctrough than 118 A/A (250 ± 126 versus 108 ± 36 ng/mL, P = 0.016). No ABCB1 haplotype group or OPRM1 genotype was associated with dose or Ctrough without taking into account confounding genetic variability at the other locus. Therefore, two

Analysis of single nucleotide polymorphisms in the 3' region of the estrogen receptor 1 gene in normal and cryptorchid Miniature Dachshunds and Chihuahuas.

PubMed

Pathirana, Indunil Nishantha; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Kida, Kayoko; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

2010-08-01

This study was performed to examine the distribution of single nucleotide polymorphisms (SNPs) and estimated haplotypes in the canine estrogen receptor (ER) alpha gene (ESR1) and the association of them with different phenotypes of cryptorchidism (CO) in Miniature Dachshunds and Chihuahuas. Forty CO and 68 normal dogs were used, and CO was classified into unilateral (UCO; n=33) and bilateral CO (BCO; n=5) or into abdominal (ACO; n=16) and inguinal CO (ICO; n=22). Thirteen DNA fragments located in the 70-kb region at the 3' end of ESR1 were amplified by PCR and sequenced to examine 13 SNPs (#1-#13) reported in a canine SNP database. Ten SNPs (#1-#4, #7, #8, #10-#13) were not polymorphic, and 5 new SNPs (#14-#18) were discovered. A common haplotype block in normal, CO and CO phenotypes was identified for an approximately 20-kb region encompassing 4 SNPs (#14-#17). Allele, genotype and haplotype frequencies in CO without classification by phenotype and also in UCO, ACO and ICO phenotypes were not statistically different from the normal group. Significant differences in genotype frequencies and homozygosity for the estimated GTTG haplotype within the block were observed in BCO compared with the normal group, although the number of BCO animals was small. Our results demonstrate that the examined SNPs and haplotypes in the 3' end of canine ESR1 are not associated with unilateral, abdominal and inguinal CO phenotypes and CO per se in Miniature Dachshunds and Chihuahuas. Further studies are necessary to suggest a clear association between the ESR1 SNPs and bilateral CO in dogs.

A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice.

PubMed

Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, Hongbin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan

2007-04-17

The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.

A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice

PubMed Central

Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, HongBin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan

2007-01-01

Background The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. Results A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. Conclusion A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia. PMID:17439653

A new mathematical modeling for pure parsimony haplotyping problem.

PubMed

Feizabadi, R; Bagherian, M; Vaziri, H R; Salahi, M

2016-11-01

Pure parsimony haplotyping (PPH) problem is important in bioinformatics because rational haplotyping inference plays important roles in analysis of genetic data, mapping complex genetic diseases such as Alzheimer's disease, heart disorders and etc. Haplotypes and genotypes are m-length sequences. Although several integer programing models have already been presented for PPH problem, its NP-hardness characteristic resulted in ineffectiveness of those models facing the real instances especially instances with many heterozygous sites. In this paper, we assign a corresponding number to each haplotype and genotype and based on those numbers, we set a mixed integer programing model. Using numbers, instead of sequences, would lead to less complexity of the new model in comparison with previous models in a way that there are neither constraints nor variables corresponding to heterozygous nucleotide sites in it. Experimental results approve the efficiency of the new model in producing better solution in comparison to two state-of-the art haplotyping approaches. Copyright © 2016 Elsevier Inc. All rights reserved.

TUMOR HAPLOTYPE ASSEMBLY ALGORITHMS FOR CANCER GENOMICS

PubMed Central

AGUIAR, DEREK; WONG, WENDY S.W.; ISTRAIL, SORIN

2014-01-01

The growing availability of inexpensive high-throughput sequence data is enabling researchers to sequence tumor populations within a single individual at high coverage. But, cancer genome sequence evolution and mutational phenomena like driver mutations and gene fusions are difficult to investigate without first reconstructing tumor haplotype sequences. Haplotype assembly of single individual tumor populations is an exceedingly difficult task complicated by tumor haplotype heterogeneity, tumor or normal cell sequence contamination, polyploidy, and complex patterns of variation. While computational and experimental haplotype phasing of diploid genomes has seen much progress in recent years, haplotype assembly in cancer genomes remains uncharted territory. In this work, we describe HapCompass-Tumor a computational modeling and algorithmic framework for haplotype assembly of copy number variable cancer genomes containing haplotypes at different frequencies and complex variation. We extend our polyploid haplotype assembly model and present novel algorithms for (1) complex variations, including copy number changes, as varying numbers of disjoint paths in an associated graph, (2) variable haplotype frequencies and contamination, and (3) computation of tumor haplotypes using simple cycles of the compass graph which constrain the space of haplotype assembly solutions. The model and algorithm are implemented in the software package HapCompass-Tumor which is available for download from http://www.brown.edu/Research/Istrail_Lab/. PMID:24297529

Mapping of HLA- DQ haplotypes in a group of Danish patients with celiac disease.

PubMed

Lund, Flemming; Hermansen, Mette N; Pedersen, Merete F; Hillig, Thore; Toft-Hansen, Henrik; Sölétormos, György

2015-10-01

A cost-effective identification of HLA- DQ risk haplotypes using the single nucleotide polymorphism (SNP) technique has recently been applied in the diagnosis of celiac disease (CD) in four European populations. The objective of the study was to map risk HLA- DQ haplotypes in a group of Danish CD patients using the SNP technique. Cohort A: Among 65 patients with gastrointestinal symptoms we compared the HLA- DQ2 and HLA- DQ8 risk haplotypes obtained by the SNP technique (method 1) with results based on a sequence specific primer amplification technique (method 2) and a technique used in an assay from BioDiagene (method 3). Cohort B: 128 patients with histologically verified CD were tested for CD risk haplotypes (method 1). Patients with negative results were further tested for sub-haplotypes of HLA- DQ2 (methods 2 and 3). Cohort A: The three applied methods provided the same HLA- DQ2 and HLA- DQ8 results among 61 patients. Four patients were negative for the HLA- DQ2 and HLA- DQ8 haplotypes (method 1) but were positive for the HLA- DQ2.5-trans and HLA- DQ2.2 haplotypes (methods 2 and 3). Cohort B: A total of 120 patients were positive for the HLA- DQ2.5-cis and HLA- DQ8 haplotypes (method 1). The remaining seven patients were positive for HLA- DQ2.5-trans or HLA- DQ2.2 haplotypes (methods 2 and 3). One patient was negative with all three HLA methods. The HLA- DQ risk haplotypes were detected in 93.8% of the CD patients using the SNP technique (method 1). The sensitivity increased to 99.2% by combining methods 1 - 3.

Genetic differences in the two main groups of the Japanese population based on autosomal SNPs and haplotypes.

PubMed

Yamaguchi-Kabata, Yumi; Tsunoda, Tatsuhiko; Kumasaka, Natsuhiko; Takahashi, Atsushi; Hosono, Naoya; Kubo, Michiaki; Nakamura, Yusuke; Kamatani, Naoyuki

2012-05-01

Although the Japanese population has a rather low genetic diversity, we recently confirmed the presence of two main clusters (the Hondo and Ryukyu clusters) through principal component analysis of genome-wide single-nucleotide polymorphism (SNP) genotypes. Understanding the genetic differences between the two main clusters requires further genome-wide analyses based on a dense SNP set and comparison of haplotype frequencies. In the present study, we determined haplotypes for the Hondo cluster of the Japanese population by detecting SNP homozygotes with 388,591 autosomal SNPs from 18,379 individuals and estimated the haplotype frequencies. Haplotypes for the Ryukyu cluster were inferred by a statistical approach using the genotype data from 504 individuals. We then compared the haplotype frequencies between the Hondo and Ryukyu clusters. In most genomic regions, the haplotype frequencies in the Hondo and Ryukyu clusters were very similar. However, in addition to the human leukocyte antigen region on chromosome 6, other genomic regions (chromosomes 3, 4, 5, 7, 10 and 12) showed dissimilarities in haplotype frequency. These regions were enriched for genes involved in the immune system, cell-cell adhesion and the intracellular signaling cascade. These differentiated genomic regions between the Hondo and Ryukyu clusters are of interest because they (1) should be examined carefully in association studies and (2) likely contain genes responsible for morphological or physiological differences between the two groups.

High-Density SNP Genotyping to Define β-Globin Locus Haplotypes

PubMed Central

Liu, Li; Muralidhar, Shalini; Singh, Manisha; Sylvan, Caprice; Kalra, Inderdeep S.; Quinn, Charles T.; Onyekwere, Onyinye C.; Pace, Betty S.

2014-01-01

Five major β-globin locus haplotypes have been established in individuals with sickle cell disease (SCD) from the Benin, Bantu, Senegal, Cameroon, and Arab-Indian populations. Historically, β-haplotypes were established using restriction fragment length polymorphism (RFLP) analysis across the β-locus, which consists of five functional β-like globin genes located on chromosome 11. Previous attempts to correlate these haplotypes as robust predictors of clinical phenotypes observed in SCD have not been successful. We speculate that the coverage and distribution of the RFLP sites located proximal to or within the globin genes are not sufficiently dense to accurately reflect the complexity of this region. To test our hypothesis, we performed RFLP analysis and high-density single nucleotide polymorphism (SNP) genotyping across the β-locus using DNA samples from either healthy African Americans with normal hemoglobin A (HbAA) or individuals with homozygous SS (HbSS) disease. Using the genotyping data from 88 SNPs and Haploview analysis, we generated a greater number of haplotypes than that observed with RFLP analysis alone. Furthermore, a unique pattern of long-range linkage disequilibrium between the locus control region and the β-like globin genes was observed in the HbSS group. Interestingly, we observed multiple SNPs within the HindIII restriction site located in the Gγ-globin intervening sequence II which produced the same RFLP pattern. These findings illustrated the inability of RFLP analysis to decipher the complexity of sequence variations that impacts genomic structure in this region. Our data suggest that high density SNP mapping may be required to accurately define β-haplotypes that correlate with the different clinical phenotypes observed in SCD. PMID:18829352

Association study between kynurenine 3-monooxygenase gene and schizophrenia in the Japanese population.

PubMed

Aoyama, N; Takahashi, N; Saito, S; Maeno, N; Ishihara, R; Ji, X; Miura, H; Ikeda, M; Suzuki, T; Kitajima, T; Yamanouchi, Y; Kinoshita, Y; Yoshida, K; Iwata, N; Inada, T; Ozaki, N

2006-06-01

Several lines of evidence suggest that metabolic changes in the kynurenic acid (KYNA) pathway are related to the etiology of schizophrenia. The inhibitor of kynurenine 3-monooxygenase (KMO) is known to increase KYNA levels, and the KMO gene is located in the chromosome region associated with schizophrenia, 1q42-q44. Single-marker and haplotype analyses for 6-tag single nucleotide polymorphisms (SNPs) of KMO were performed (cases = 465, controls = 440). Significant association of rs2275163 with schizophrenia was observed by single-marker comparisons (P = 0.032) and haplotype analysis including this SNP (P = 0.0049). Significant association of rs2275163 and haplotype was not replicated using a second, independent set of samples (cases = 480, controls = 448) (P = 0.706 and P = 0.689, respectively). These results suggest that the KMO is unlikely to be related to the development of schizophrenia in Japanese.

Association of ORAI1 Haplotypes with the Risk of HLA-B27 Positive Ankylosing Spondylitis

PubMed Central

Wei, James Cheng-Chung; Yen, Jeng-Hsien; Juo, Suh-Hang Hank; Chen, Wei-Chiao; Wang, Yu-Shiuan; Chiu, Yi-Ching; Hsieh, Tusty-Jiuan; Guo, Yuh-Cherng; Huang, Chun-Huang; Wong, Ruey-Hong; Wang, Hui-Po; Tsai, Ke-Li; Wu, Yang-Chang; Chang, Hsueh-Wei; Hsi, Edward; Chang, Wei-Pin; Chang, Wei-Chiao

2011-01-01

Ankylosing spondylitis (AS) is a chronic inflammation of the sacroiliac joints, spine and peripheral joints. The aetiology of ankylosing spondylitis is still unclear. Previous studies have indicated that genetics factors such as human leukocyte antigen HLA-B27 associates to AS susceptibility. We carried out a case-control study to determine whether the genetic polymorphisms of ORAI1 gene, a major component of store-operated calcium channels that involved the regulation of immune system, is a susceptibility factor to AS in a Taiwanese population. We enrolled 361 AS patients fulfilled the modified New York criteria and 379 controls from community. Five tagging single nucleotides polymorphisms (tSNPs) at ORAI1 were selected from the data of Han Chinese population in HapMap project. Clinical statuses of AS were assessed by the Bath Ankylosing Spondylitis Disease Activity Index (BASDAI), Bath Ankylosing Spondylitis Functional Index (BASFI), and Bath Ankylosing Spondylitis Global Index (BAS-G). Our results indicated that subjects carrying the minor allele homozygote (CC) of the promoter SNP rs12313273 or TT homozygote of the SNP rs7135617 had an increased risk of HLA-B27 positive AS. The minor allele C of 3′UTR SNP rs712853 exerted a protective effect to HLA-B27 positive AS. Furthermore, the rs12313273/rs7135617 pairwise allele analysis found that C-G (OR 1.69, 95% CI 1.27, 2.25; p = 0.0003) and T-T (OR 1.75, 95% CI 1.36, 2.27; p<0.0001) haplotypes had a significantly association with the risk of HLA-B27-positive AS in comparison with the T-G carriers. This is the first study that indicate haplotypes of ORAI1 (rs12313273 and rs7135617) are associated with the risk of HLA-B27 positive AS. PMID:21674042

Effects of IL-10 haplotype and atomic bomb radiation exposure on gastric cancer risk.

PubMed

Hayashi, Tomonori; Ito, Reiko; Cologne, John; Maki, Mayumi; Morishita, Yukari; Nagamura, Hiroko; Sasaki, Keiko; Hayashi, Ikue; Imai, Kazue; Yoshida, Kengo; Kajimura, Junko; Kyoizumi, Seishi; Kusunoki, Yoichiro; Ohishi, Waka; Fujiwara, Saeko; Akahoshi, Masazumi; Nakachi, Kei

2013-07-01

Gastric cancer (GC) is one of the cancers that reveal increased risk of mortality and incidence in atomic bomb survivors. The incidence of gastric cancer in the Life Span Study cohort of the Radiation Effects Research Foundation (RERF) increased with radiation dose (gender-averaged excess relative risk per Gy = 0.28) and remains high more than 65 years after exposure. To assess a possible role of gene-environment interaction, we examined the dose response for gastric cancer incidence based on immunosuppression-related IL-10 genotype, in a cohort study with 200 cancer cases (93 intestinal, 96 diffuse and 11 other types) among 4,690 atomic bomb survivors participating in an immunological substudy. Using a single haplotype block composed of four haplotype-tagging SNPs (comprising the major haplotype allele IL-10-ATTA and the minor haplotype allele IL-10-GGCG, which are categorized by IL-10 polymorphisms at -819A>G and -592T>G, +1177T>C and +1589A>G), multiplicative and additive models for joint effects of radiation and this IL-10 haplotyping were examined. The IL-10 minor haplotype allele(s) was a risk factor for intestinal type gastric cancer but not for diffuse type gastric cancer. Radiation was not associated with intestinal type gastric cancer. In diffuse type gastric cancer, the haplotype-specific excess relative risk (ERR) for radiation was statistically significant only in the major homozygote category of IL-10 (ERR = 0.46/Gy, P = 0.037), whereas estimated ERR for radiation with the minor IL-10 homozygotes was close to 0 and nonsignificant. Thus, the minor IL-10 haplotype might act to reduce the radiation related risk of diffuse-type gastric cancer. The results suggest that this IL-10 haplotyping might be involved in development of radiation-associated gastric cancer of the diffuse type, and that IL-10 haplotypes may explain individual differences in the radiation-related risk of gastric cancer. © 2013 by Radiation Research Society

Lower frequency of the HLA-G UTR-4 haplotype in women with unexplained recurrent miscarriage.

PubMed

Meuleman, T; Drabbels, J; van Lith, J M M; Dekkers, O M; Rozemuller, E; Cretu-Stancu, M; Claas, F H J; Bloemenkamp, K W M; Eikmans, M

2018-04-01

HLA-G expressed by trophoblasts at the fetal-maternal interface and its soluble form have immunomodulatory effects. HLA-G expression depends on the combination of DNA polymorphisms. We hypothesized that combinations of specific single nucleotide polymorphisms (SNPs) in the 3'untranslated region (3'UTR) of HLA-G play a role in unexplained recurrent miscarriage. In a case control design, 100 cases with at least three unexplained consecutive miscarriages prior to the 20th week of gestation were included. Cases were at time of the third miscarriage younger than 36 years, and they conceived all their pregnancies from the same partner. The control group included 89 women with an uneventful pregnancy. The association of HLA-G 3'UTR SNPs and specific HLA-G haplotype with recurrent miscarriage was studied with logistic regression. Odds ratios (OR) and 95% confidence intervals (95% CI) were reported. Individual SNPs were not significantly associated with recurrent miscarriage after correction for multiple comparisons. However, the presence of the UTR-4 haplotype, which included +3003C, was significantly lower in women with recurrent miscarriage (OR 0.4, 95% CI 0.2-0.8, p = 0.015). In conclusion, this is the first study to perform a comprehensive analysis of HLA-G SNPs and HLA-G haplotypes in a well-defined group of women with recurrent miscarriage and women with uneventful pregnancy. The UTR-4 haplotype was less frequently observed in women with recurrent miscarriage, suggesting an immunoregulatory role of this haplotype for continuation of the pregnancy without complications. Thus, association of HLA-G with recurrent miscarriage is not related to single polymorphisms in the 3'UTR, but is rather dependent on haplotypes. Copyright © 2018 Elsevier B.V. All rights reserved.

Two independent apolipoprotein A5 haplotypes influence human plasma triglyceride levels.

PubMed

Pennacchio, Len A; Olivier, Michael; Hubacek, Jaroslav A; Krauss, Ronald M; Rubin, Edward M; Cohen, Jonathan C

2002-11-15

The recently identified apolipoprotein A5 gene (APOA5) has been shown to play an important role in determining plasma triglyceride concentrations in humans and mice. We previously identified an APOA5 haplotype (designated APOA5*2) that is present in approximately 16% of Caucasians and is associated with increased plasma triglyceride concentrations. In this report we describe another APOA5 haplotype (APOA5*3) containing the rare allele of the single nucleotide polymorphism c.56C>G that changes serine to tryptophan at codon 19 and is independently associated with high plasma triglyceride levels in three different populations. In a sample of 264 Caucasian men and women with plasma triglyceride concentrations above the 90th percentile or below the 10th percentile, the APOA5*3 haplotype was more than three-fold more common in the group with high plasma triglyceride levels. In a second independently ascertained sample of Caucasian men and women (n=419) who were studied while consuming their self-selected diets as well as after high-carbohydrate diets and high-fat diets, the APOA5*3 haplotype was associated with increased plasma triglyceride levels on all three dietary regimens. In a third population comprising 2660 randomly selected individuals, the APOA5*3 haplotype was found in 12% of Caucasians, 14% of African-Americans and 28% of Hispanics and was associated with increased plasma triglyceride levels in both men and women in each ethnic group. These findings establish that the APOA5 locus contributes significantly to inter-individual variation in plasma triglyceride levels in humans. Together, the APOA5*2 and APOA5*3 haplotypes are found in 25-50% of African-Americans, Hispanics and Caucasians and support the contribution of common human variation to quantitative phenotypes in the general population.

Two independent apolipoprotein a5 Haplotypes influence human plasma triglyceride levels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pennacchio, Len A.; Olivier, Michael; Hubacek, Jaroslav A.

2002-09-16

The recently identified apolipoprotein A5 gene (APOA5) has been shown to play an important role in determining plasma triglyceride concentrations in humans and mice. We previously identified an APOA5 haplotype (designated APOA5*2) that is present in {approx}16 percent of Caucasians and is associated with increased plasma triglyceride concentrations. In this report we describe another APOA5 haplotype (APOA5*3) containing the rare allele of the single nucleotide polymorphism c.56C>G that changes serine to tryptophan at codon 19 and is independently associated with high plasma triglyceride levels in three different populations. In a sample of 264 Caucasian men and women with plasma triglyceridemore » concentrations above the 90th percentile or below the 10th percentile, the APOA5*3 haplotype was more than three-fold more common in the group with high plasma triglyceride levels. In a second independently ascertained sample of Caucasian men and women (n 1/4 419) who were studied while consuming their self-selected diets as well as after high-carbohydrate diets and high-fat diets, the APOA5*3 haplotype was associated with increased plasma triglyceride levels on all three dietary regimens. In a third population comprising 2660 randomly selected individuals, the APOA5*3 haplotype was found in 12 percent of Caucasians, 14 percent of African-Americans and 28 percent of Hispanics and was associated with increased plasma triglyceride levels in both men and women in each ethnic group. These findings establish that the APOA5 locus contributes significantly to inter-individual variation in plasma triglyceride levels in humans. Together, the APOA5*2 and APOA5*3 haplotypes are found in 25 50 percent of African-Americans, Hispanics and Caucasians and support the contribution of common human variation to quantitative phenotypes in the general population.« less

Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

PubMed Central

Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

2016-01-01

Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

Single-nucleotide polymorphism genotyping on optical thin-film biosensor chips.

PubMed

Zhong, Xiao-Bo; Reynolds, Robert; Kidd, Judith R; Kidd, Kenneth K; Jenison, Robert; Marlar, Richard A; Ward, David C

2003-09-30

Single-nucleotide polymorphisms (SNPs) constitute the bulk of human genetic variation and provide excellent markers to identify genetic factors contributing to complex disease susceptibility. A rapid, sensitive, and inexpensive assay is important for large-scale SNP scoring. Here we report the development of a multiplex SNP detection system using silicon chips coated to create a thin-film optical biosensor. Allele-discriminating, aldehyde-labeled oligonucleotides are arrayed and covalently attached to a hydrazinederivatized chip surface. Target sequences (e.g., PCR amplicons) then are hybridized in the presence of a mixture of biotinylated detector probes, one for each SNP, and a thermostable DNA ligase. After a stringent wash (0.01 M NaOH), ligation of biotinylated detector probes to perfectly matched capture oligomers is visualized as a color change on the chip surface (gold to blue/purple) after brief incubations with an anti-biotin IgG-horseradish peroxidase conjugate and a precipitable horseradish peroxidase substrate. Testing of PCR fragments is completed in 30-40 min. Up to several hundred SNPs can be assayed on a 36-mm2 chip, and SNP scoring can be done by eye or with a simple digital-camera system. This assay is extremely robust, exhibits high sensitivity and specificity, and is format-flexible and economical. In studies of mutations associated with risk for venous thrombosis and genotyping/haplotyping of African-American samples, we document high-fidelity analysis with 0 misassignments in 500 assays performed in duplicate.

Association of tumour necrosis factor-alpha G/A -238 and G/A -308 single nucleotide polymorphisms with juvenile idiopathic arthritis.

PubMed

Maddah, M; Harsini, S; Ziaee, V; Moradinejad, M H; Rezaei, A; Zoghi, S; Sadr, M; Aghighi, Y; Rezaei, N

2016-12-01

Juvenile idiopathic arthritis (JIA) is a heterogeneous autoimmune disorder of unknown origin. As proinflammatory cytokines are known to contribute towards the pathogenesis of JIA, this case-control study was performed to examine the associations of certain single nucleotide polymorphisms (SNPs) of tumour necrosis factor-α (TNF-α) gene. Fifty-three patients with JIA participated in this study as patients group and compared with 137 healthy unrelated controls. Genotyping was performed for TNF-α gene at positions -308 and -238, using polymerase chain reaction with sequence-specific primers method. Results of the analysed data revealed a significant positive association for TNF-α gene at positions -308 and -238 for A allele in patients group compared with controls (P < 0.01). At the genotypic level, the frequency of TNF-α gene at positions -308 and -238 for GG genotype was discovered to be higher in the patients with JIA compared to the healthy controls (P < 0.01), while GA genotype at the same positions was observed to be less frequent in the case group than the controls (P < 0.01). At the haplotypic level, a significant positive association for TNF-α GG haplotype (positions -308, -238) together with a notable negative association for TNF-α AG and GA haplotypes at the same positions were detected in the patients group in comparison with the healthy individuals (P < 0.01). Cytokine gene polymorphisms might affect the development of JIA. Particular TNF-α gene variants could render individuals more susceptible to JIA.. © 2016 John Wiley & Sons Ltd.

Single nucleotide polymorphisms in the CXCR1 gene and its association with clinical mastitis incidence in Polish Holstein-Friesian cows.

PubMed

Pokorska, J; Dusza, M; Kułaj, D; Żukowski, K; Makulska, J

2016-04-28

The aim of this study was to identify the association between single nucleotide polymorphisms (SNPs) in the bovine chemokine receptor (CXCR1) gene and the resistance or susceptibility of cows to mastitis. The analysis of the CXCR1 polymorphism was carried out using polymerase chain reaction restriction fragment length polymorphism analysis for six SNP mutations (c.+291C>T, c.+365T>C, c.+816C>A, c.+819G>A, +1093C>T, and +1373C>A), of which four were located within the coding region and two in the 3'UTR region of the CXCR1 gene. Genetic material from 146 Polish Holstein-Friesian cows was analyzed after dividing into two groups depending on the incidence of clinical mastitis. Identified polymorphisms were in linkage disequilibrium and formed two linkage groups. Three haplotypes (CCCATA, TTAGCC, CTCGCC), forming six haplotype combinations, were detected. The logistic regression showed a significant association between the CC genotype at c.+365T>C and susceptibility of cows to clinical mastitis (P = 0.047). The frequency of haplotype combination 1/1 (CCCATA/CCCATA) was not significantly higher in cows susceptible to mastitis (P = 0.062). Of the identified SNP mutations, only c.+365T>C is a nonsynonymous mutation that induces a change in the coded protein [GCC (Ala) to GTC (Val) at the 122nd amino acid]. This amino acid change can result in changes in receptor function, which may be a reason for the increased mastitis incidence observed in cows with polymorphism at this site.

Evidence of triple mutant Pfdhps ISGNGA haplotype in Plasmodium falciparum isolates from North-east India: An analysis of sulfadoxine resistant haplotype selection.

PubMed

Das, Manuj K; Chetry, Sumi; Kalita, Mohan C; Dutta, Prafulla

2016-12-01

North-east region of India has consistent role in the spread of multi drug resistant Plasmodium (P.) falciparum to other parts of Southeast Asia. After rapid clinical treatment failure of Artemisinin based combination therapy-Sulphadoxine/Pyrimethamine (ACT-SP) chemoprophylaxis, Artemether-Lumefantrine (ACT-AL) combination therapy was introduced in the year 2012 in this region for the treatment of uncomplicated P. falciparum malaria. In a DNA sequencing based polymorphism analysis, seven codons of P. falciparum dihydropteroate synthetase ( Pf dhps) gene were screened in a total of 127 P. falciparum isolates collected from Assam, Arunachal Pradesh and Tripura of North-east India during the year 2014 and 2015 to document current sulfadoxine resistant haplotypes. Sequences were analyzed to rearrange both nucleotide and protein haplotypes. Molecular diversity indices were analyzed in DNA Sequence Polymorphism software (DnaSP) on the basis of Pf dhps gene sequences. Disappearance from selective neutrality was assessed based on the ratio of non-synonomous to synonomous nucleotide substitutions [dN/dS ratio]. Moreover, two-tailed Z test was performed in search of the significance for probability of rejecting null hypothesis of strict neutrality [dN = dS]. Presence of mutant P. falciparum multidrug resistance protein1 ( Pf mdr1) was also checked in those isolates that were present with new Pf dhps haplotypes. Phylogenetic relationship based on Pf dhps gene was reconstructed in Molecular Evolutionary Genetics Analysis (MEGA). Among eight different sulfadoxine resistant haplotypes found, IS GNG A haplotype was documented in a total of five isolates from Tripura with association of a new mutant M538 R allele. Sequence analysis of Pf mdr1 gene in these five isolates came to notice that not all but only one isolate was mutant at codon 86 (N86 Y ; Y YSND) in the multidrug resistance protein. Molecular diversity based on Pf dhps haplotypes revealed that P. falciparum

COMT haplotypes modulate associations of antenatal maternal anxiety and neonatal cortical morphology.

PubMed

Qiu, Anqi; Tuan, Ta Anh; Ong, Mei Lyn; Li, Yue; Chen, Helen; Rifkin-Graboi, Anne; Broekman, Birit F P; Kwek, Kenneth; Saw, Seang-Mei; Chong, Yap-Seng; Gluckman, Peter D; Fortier, Marielle V; Holbrook, Joanna Dawn; Meaney, Michael J

2015-02-01

Exposure to antenatal maternal anxiety and complex genetic variations may shape fetal brain development. In particular, the catechol-O-methyltransferase (COMT) gene, located on chromosome 22q11.2, regulates catecholamine signaling in the prefrontal cortex and is implicated in anxiety, pain, and stress responsivity. This study examined whether individual single-nucleotide polymorphisms (SNPs) of the COMT gene and their haplotypes moderate the association between antenatal maternal anxiety and in utero cortical development. A total of 146 neonates were genotyped and underwent MRI shortly after birth. Neonatal cortical morphology was characterized using cortical thickness. Antenatal maternal anxiety was assessed using the State-Trait Anxiety Inventory at week 26 of pregnancy. Individual COMT SNPs (val158met, rs737865, and rs165599) modulated the association between antenatal maternal anxiety and the prefrontal and parietal cortical thickness in neonates. Based on haplotype trend regression analysis, findings also showed that among rs737865-val158met-rs165599 haplotypes, the A-val-G (AGG) haplotype probabilities modulated positive associations of antenatal maternal anxiety with cortical thickness in the right ventrolateral prefrontal cortex and the right superior parietal cortex and precuneus. In contrast, the G-met-A (GAA) haplotype probabilities modulated negative associations of antenatal maternal anxiety with cortical thickness in bilateral precentral gyrus and the dorsolateral prefrontal cortex. These results suggest that the association between maternal anxiety and in utero neurodevelopment is modified through complex genetic variation in COMT. Such genetic moderation may explain, in part, the variation in phenotypic outcomes in offspring associated with maternal emotional well-being.

Prion gene haplotypes of U.S. cattle

PubMed Central

Clawson, Michael L; Heaton, Michael P; Keele, John W; Smith, Timothy PL; Harhay, Gregory P; Laegreid, William W

2006-01-01

Background Bovine spongiform encephalopathy (BSE) is a fatal neurological disorder characterized by abnormal deposits of a protease-resistant isoform of the prion protein. Characterizing linkage disequilibrium (LD) and haplotype networks within the bovine prion gene (PRNP) is important for 1) testing rare or common PRNP variation for an association with BSE and 2) interpreting any association of PRNP alleles with BSE susceptibility. The objective of this study was to identify polymorphisms and haplotypes within PRNP from the promoter region through the 3'UTR in a diverse sample of U.S. cattle genomes. Results A 25.2-kb genomic region containing PRNP was sequenced from 192 diverse U.S. beef and dairy cattle. Sequence analyses identified 388 total polymorphisms, of which 287 have not previously been reported. The polymorphism alleles define PRNP by regions of high and low LD. High LD is present between alleles in the promoter region through exon 2 (6.7 kb). PRNP alleles within the majority of intron 2, the entire coding sequence and the untranslated region of exon 3 are in low LD (18.0 kb). Two haplotype networks, one representing the region of high LD and the other the region of low LD yielded nineteen different combinations that represent haplotypes spanning PRNP. The haplotype combinations are tagged by 19 polymorphisms (htSNPS) which characterize variation within and across PRNP. Conclusion The number of polymorphisms in the prion gene region of U.S. cattle is nearly four times greater than previously described. These polymorphisms define PRNP haplotypes that may influence BSE susceptibility in cattle. PMID:17092337

Single cell analysis using surface enhanced Raman scattering (SERS) tags

PubMed Central

Nolan, John P.; Duggan, Erika; Liu, Er; Condello, Danilo; Dave, Isha; Stoner, Samuel A.

2013-01-01

Fluorescence is a mainstay of bioanalytical methods, offering sensitive and quantitative reporting, often in multiplexed or multiparameter assays. Perhaps the best example of the latter is flow cytometry, where instruments equipped with multiple lasers and detectors allow measurement of 15 or more different fluorophores simultaneously, but increases beyond this number are limited by the relatively broad emission spectra. Surface enhanced Raman scattering (SERS) from metal nanoparticles can produce signal intensities that rival fluorescence, but with narrower spectral features that allow a greater degree of multiplexing. We are developing nanoparticle SERS tags as well as Raman flow cytometers for multiparameter single cell analysis of suspension or adherent cells. SERS tags are based on plasmonically active nanoparticles (gold nanorods) whose plasmon resonance can be tuned to give optimal SERS signals at a desired excitation wavelength. Raman resonant compounds are adsorbed on the nanoparticles to confer a unique spectral fingerprint on each SERS tag, which are then encapsulated in a polymer coating for conjugation to antibodies or other targeting molecules. Raman flow cytometry employs a high resolution spectral flow cytometer capable of measuring the complete SERS spectra, as well as conventional flow cytometry measurements, from thousands of individual cells per minute. Automated spectral unmixing algorithms extract the contributions of each SERS tag from each cell to generate high content, multiparameter single cell population data. SERS-based cytometry is a powerful complement to conventional fluorescence-based cytometry. The narrow spectral features of the SERS signal enables more distinct probes to be measured in a smaller region of the optical spectrum with a single laser and detector, allowing for higher levels of multiplexing and multiparameter analysis. PMID:22498143

Investigation of extended Y chromosome STR haplotypes in Sardinia.

PubMed

Lacerenza, D; Aneli, S; Di Gaetano, C; Critelli, R; Piazza, A; Matullo, G; Culigioni, C; Robledo, R; Robino, C; Calò, C

2017-03-01

Y-chromosomal variation of selected single nucleotide polymorphisms (SNPs) and 32 short tandem repeat (STR) loci was evaluated in Sardinia in three open population groups (Northern Sardinia, n=40; Central Sardinia, n=56; Southern Sardinia, n=91) and three isolates (Desulo, n=34; Benetutti, n=45, Carloforte, n=42). The tested Y-STRs consisted of Yfiler ® Plus markers and the seven rapidly mutating (RM) loci not included in the YFiler ® Plus kit (DYF399S1, DYF403S1ab, DYF404S1, DYS526ab, DYS547, DYS612, and DYS626). As expected, inclusion of additional Y-STR loci increased haplotype diversity (h), though complete differentiation of male lineages was impossible even by means of RM Y-STRs (h=0.99997). Analysis of molecular variance indicated that the three open populations were fairly homogeneous, whereas signs of genetic heterogeneity could be detected when the three isolates were also included in the analysis. Multidimensional scaling analysis showed that, even for extended haplotypes including RM Y-STR markers, Sardinians were clearly differentiated from populations of the Italian peninsula and Sicily. The only exception was represented by the Carloforte sample that, in accordance with its peculiar population history, clustered with Northern/Central Italian populations. The introduction of extended forensic Y-STR panels, including highly variable RM Y-STR markers, is expected to reduce the impact of population structure on haplotype frequency estimations. However, our results show that the availability of geographically detailed reference databases is still important for the assessment of the evidential value of a Y-haplotype match. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Differential distribution of Y-chromosome haplotypes in Swiss and Southern European goat breeds.

PubMed

Vidal, Oriol; Drögemüller, Cord; Obexer-Ruff, Gabriela; Reber, Irene; Jordana, Jordi; Martínez, Amparo; Bâlteanu, Valentin Adrian; Delgado, Juan Vicente; Eghbalsaied, Shahin; Landi, Vincenzo; Goyache, Felix; Traoré, Amadou; Pazzola, Michele; Vacca, Giuseppe Massimo; Badaoui, Bouabid; Pilla, Fabio; D'Andrea, Mariasilvia; Álvarez, Isabel; Capote, Juan; Sharaf, Abdoallah; Pons, Àgueda; Amills, Marcel

2017-11-23

The analysis of Y-chromosome variation has provided valuable clues about the paternal history of domestic animal populations. The main goal of the current work was to characterize Y-chromosome diversity in 31 goat populations from Central Eastern (Switzerland and Romania) and Southern Europe (Spain and Italy) as well as in reference populations from Africa and the Near East. Towards this end, we have genotyped seven single nucleotide polymorphisms (SNPs), mapping to the SRY, ZFY, AMELY and DDX3Y Y-linked loci, in 275 bucks from 31 populations. We have observed a low level of variability in the goat Y-chromosome, with just five haplotypes segregating in the whole set of populations. We have also found that Swiss bucks carry exclusively Y1 haplotypes (Y1A: 24%, Y1B1: 15%, Y1B2: 43% and Y1C: 18%), while in Italian and Spanish bucks Y2A is the most abundant haplotype (77%). Interestingly, in Carpathian goats from Romania the Y2A haplotype is also frequent (42%). The high Y-chromosome differentiation between Swiss and Italian/Spanish breeds might be due to the post-domestication spread of two different Near Eastern genetic stocks through the Danubian and Mediterranean corridors. Historical gene flow between Southern European and Northern African goats might have also contributed to generate such pattern of genetic differentiation.

Study of π 0 pair production in single-tag two-photon collisions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Masuda, M.; Uehara, S.; Watanabe, Y.

2016-02-01

We report a measurement of the differential cross section of π^0 pair production in single-tag two-photon collisions, y*y->π^0π^0, in e+e- scattering. The cross section is measured for Q^2up to 30 GeV^2 is the negative of the invariant mass squared of the tagged photon

Human leukocyte antigen class I region single-nucleotide polymorphisms are associated with leprosy susceptibility in Vietnam and India.

PubMed

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin

2011-05-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.

Human Leukocyte Antigen Class I Region Single-Nucleotide Polymorphisms are Associated with Leprosy Susceptibility in Vietnam and India

PubMed Central

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre

2011-01-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816

VKORC1 haplotypes are associated with arterial vascular diseases (stroke, coronary heart disease, and aortic dissection).

PubMed

Wang, Yibo; Zhang, Weili; Zhang, Yuhui; Yang, Yuejin; Sun, Lizhong; Hu, Shengshou; Chen, Jilin; Zhang, Channa; Zheng, Yi; Zhen, Yisong; Sun, Kai; Fu, Chunyan; Yang, Tao; Wang, Jianwei; Sun, Jing; Wu, Haiying; Glasgow, Wayne C; Hui, Rutai

2006-03-28

The haplotypes in the gene vitamin K epoxide reductase complex subunit 1 (VKORC1) have been found to affect warfarin dose response through effects on the formation of reduced-form vitamin K, a cofactor for gamma-carboxylation of vitamin K-dependent proteins, which is involved in the coagulation cascade and has a potential impact on atherosclerosis. We hypothesized that VKORC1-dependent effects on the coagulation cascade and atherosclerosis would contribute to susceptibility for vascular diseases. To test the hypothesis, we studied the association of polymorphisms of VKORC1 with stroke (1811 patients), coronary heart disease (740 patients), and aortic dissection (253 patients) compared with matched controls (n=1811, 740, and 416, respectively). Five common noncoding single-nucleotide polymorphisms of VKORC1 were identified in a natural haplotype block with strong linkage disequilibrium (D'>0.9, r2>0.9), then single-nucleotide polymorphism (SNP) +2255 in the block was selected for the association study. We found that the presence of the C allele of the +2255 locus conferred almost twice the risk of vascular disease (odds ratio [OR] 1.95, 95% confidence interval [CI] .58 to 2.41, P<0.001 for stroke; OR 1.72, 95% CI 1.24 to 2.38, P<0.01 for coronary heart disease; and OR 1.90, 95% CI 1.04 to 3.48, P<0.05 for aortic dissection). We also observed that subjects with the CC and CT genotypes had lower levels of undercarboxylated osteocalcin (a regulator for the bone), probably vascular calcification, and lower levels of protein induced in vitamin K absence or antagonism II (PIVKA-II, a des-gamma-carboxy prothrombin) than those with TT genotypes. The haplotype of VKORC1 may serve as a novel genetic marker for the risk of stroke, coronary heart disease, and aortic dissection.

Sex differences in TTC12/ANKK1 haplotype associations with daily tobacco smoking in Black and White Americans.

PubMed

David, Sean P; Mezuk, Briana; Zandi, Peter P; Strong, David; Anthony, James C; Niaura, Raymond; Uhl, George R; Eaton, William W

2010-03-01

The 11q23.1 genomic region has been associated with nicotine dependence in Black and White Americans. By conducting linkage disequilibrium analyses of 7 informative single nucleotide polymorphisms (SNPs) within the tetratricopeptide repeat domain 12 (TTC12)/ankyrin repeat and kinase containing 1 (ANKK1)/dopamine (D2) receptor gene cluster, we identified haplotype block structures in 270 Black and 368 White (n = 638) participants, from the Baltimore Epidemiologic Catchment Area cohort study, spanning the TTC12 and ANKK1 genes consisting of three SNPs (rs2303380-rs4938015-rs11604671). Informative haplotypes were examined for sex-specific associations with daily tobacco smoking initiation and cessation using longitudinal data from 1993-1994 and 2004-2005 interviews. There was a Haplotype x Sex interaction such that Black men possessing the GTG haplotype who were smokers in 1993-2004 were more likely to have stopped smoking by 2004-2005 (55.6% GTG vs. 22.0% other haplotypes), while Black women were less likely to have quit smoking if they possessed the GTG (20.8%) versus other haplotypes (24.0%; p = .028). In Whites, the GTG haplotype (vs. other haplotypes) was associated with lifetime history of daily smoking (smoking initiation; odds ratio = 1.6; 95% CI = 1.1-2.4; p = .013). Moreover, there was a Haplotype x Sex interaction such that there was higher prevalence of smoking initiation with GTG (77.6%) versus other haplotypes (57.0%; p = .043). In 2 different ethnic American populations, we observed man-woman variation in the influence of the rs2303380-rs4938015-rs11604671 GTG haplotype on smoking initiation and cessation. These results should be replicated in larger cohorts to establish the relationship among the rs2303380-rs4938015-rs11604671 haplotype block, sex, and smoking behavior.

Steady-state free precession with myocardial tagging: CSPAMM in a single breathhold.

PubMed

Zwanenburg, Jaco J M; Kuijer, Joost P A; Marcus, J Tim; Heethaar, Robert M

2003-04-01

A method is presented that combines steady-state free precession (SSFP) cine imaging with myocardial tagging. Before the tagging preparation at each ECG-R wave, the steady-state magnetization is stored as longitudinal magnetization by an alpha/2 flip-back pulse. Imaging is continued immediately after tagging preparation, using linearly increasing startup angles (LISA) with a rampup over 10 pulses. Interleaved segmented k-space ordering is used to prevent artifacts from the increasing signal during the LISA rampup. First, this LISA-SSFP method was evaluated regarding ghost artifacts from the steady-state interruption by comparing LISA with an alpha/2 startup method. Next, LISA-SSFP was compared with spoiled gradient echo (SGRE) imaging, regarding tag contrast-to-noise ratio and tag persistence. The measurements were performed in phantoms and in six subjects applying breathhold cine imaging with tagging (temporal resolution 51 ms). The results show that ghost artifacts are negligible for the LISA method. Compared to the SGRE reference, LISA-SSFP was two times faster, with a slightly better tag contrast-to-noise. Additionally, the tags persisted 126 ms longer with LISA-SSFP than with SGRE imaging. The high efficiency of LISA-SSFP enables the acquisition of complementary tagged (CSPAMM) images in a single breathhold. Copyright 2003 Wiley-Liss, Inc.

Genetic Variants in IRF6 and the Risk of Facial Clefts: Single-Marker and Haplotype-Based Analyses in a Population-Based Case-Control Study of Facial Clefts in Norway

PubMed Central

Jugessur, Astanand; Rahimov, Fedik; Lie, Rolv T.; Wilcox, Allen J.; Gjessing, Håkon K.; Nilsen, Roy M.; Nguyen, Truc Trung; Murray, Jeffrey C.

2009-01-01

Mutations in the gene encoding interferon regulatory factor 6 (IRF6) underlie a common form of syndromic clefting known as Van der Woude syndrome. Lip pits and missing teeth are the only additional features distinguishing the syndrome from isolated clefts. Van der Woude syndrome, therefore, provides an excellent model for studying the isolated forms of clefting. From a population-based case-control study of facial clefts in Norway (1996–2001), we selected 377 cleft lip with or without cleft palate (CL/P), 196 cleft palate only (CPO), and 763 control infant-parent triads for analysis. We genotyped six single nucleotide polymorphisms within the IRF6 locus and estimated the relative risks (RR) conferred on the child by alleles and haplotypes of the child and of the mother. On the whole, there were strong statistical associations with CL/P but not CPO in our data. In single-marker analyses, mothers with a double-dose of the ‘a’-allele at rs4844880 had an increased risk of having a child with CL/P (RR = 1.85, 95% confidence interval: 1.04–3.25; P = 0.036). An RR of 0.38 (95% confidence interval: 0.16–0.92; P = 0.031) was obtained when the child carried a single-dose of the ‘a’-allele at rs2235371 (the p.V274I polymorphism). The P-value for the overall test was <0.001. In haplotype analyses, several of the fetal and maternal haplotype relative risks were statistically significant individually but were not strong enough to show up on the overall test (P = 0.113). Taken together, these findings further support a role for IRF6 variants in clefting of the lip and provide specific risk estimates in a Norwegian population. PMID:18278815

Comparative Analyses of Single-Nucleotide Polymorphisms in the TNF Promoter Region Provide Further Validation for the Vervet Monkey Model of Obesity

PubMed Central

Gray, Stanton B; Howard, Timothy D; Langefeld, Carl D; Hawkins, Gregory A; Diallo, Abdoulaye F; Wagner, Janice D

2009-01-01

Tumor necrosis factor is a cytokine that plays critical roles in inflammation, the innate immune response, and a variety of other physiologic and pathophysiologic processes. In addition, TNF has recently been shown to mediate an intersection of chronic, low-grade inflammation and concurrent metabolic dysregulation associated with obesity and its comorbidities. As part of an ongoing initiative to further characterize vervet monkeys originating from St Kitts as an animal model of obesity and inflammation, we sequenced and genotyped the human ortholog vervet TNF gene and approximately 1 kb of the flanking 3′ and 5′ regions from 265 monkeys in a closed, pedigreed colony. This process revealed a total of 11 single-nucleotide polymorphisms (SNPs) and a single 4-bp insertion–deletion, with minor allele frequencies of 0.08 to 0.39. Many of these polymorphisms were in strong or complete linkage disequilibrium with each other, and all but 1 were contained within a single haplotype block, comprising 5 haplotypes with frequencies of 0.075 to 0.298. Using sequences from humans, chimpanzees, vervets, baboons, and rhesus macaques, phylogenetic shadowing of the TNF promoter region revealed that vervet SNPs, like the SNPs in related species, were clustered nonrandomly and nonuniformly around conserved transcription factor binding sites. These data, combined with previously defined heritable phenotypes, permit future association analyses in this nonhuman primate model and have great potential to help dissect the genetic and nongenetic contributions to complex diseases like obesity. More broadly, the sequence data and comparative analyses reported herein facilitates study of the evolution of regulatory sequences of inflammatory and immune-related genes. PMID:20034434

Comparative analysis of the IGF2 and ZBED6 gene variants and haplotypes reveals significant effect of growth traits in cattle.

PubMed

Huang, Yong-Zhen; Zhan, Zhao-Yang; Sun, Yu-Jia; Wang, Jing; Li, Ming-Xun; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong

2013-06-01

Muscle growth is a complex phenomenon regulated by many factors, whereby net growth results from the combined action of synthesis and turnover. Insulin-like growth factor 2 (IGF2) is a fetal growth and differentiation factor that plays an important role in muscle growth and in myoblast proliferation and differentiation; Zinc finger, BED-type containing 6 (ZBED6) is a novel transcription factor that was identified and shown to act as a repressor of IGF2 transcription in skeletal muscle. In this study, a total of seven single nucleotide polymorphisms (SNPs) were identified, four SNPs in intron 8 of IGF2 and one promoter SNP and two missense mutations in the coding region of ZBED6, two of which were in complete linkage disequilibrium (LD) in the bovine IGF2. The 58 haplotypes were inferred in 1522 individuals representing four purebred cattle breeds from China. The seven SNPs, 79 and 66 combined diplotypes were revealed for association with body mass in Nanyang and Jiaxian cattle populations at five different ages (P < 0.05 or 0.01). The mutant-type variants and haplotype 58 (likely in LD with the beneficial quantitative trait nucleotide allele) was superior for body mass; the heterozygote diplotype of the most common haplotypes 58 was associated with higher body mass compared to either heterozygote or homozygote. The statistical analyses indicated that the mutant-type variants and haplotypes are significantly associated with body mass in study cattle populations at different ages. These data demonstrate that variants and haplotypes are associated with growth traits, and these results may provide important biological insights into the phenotypic differentiation that is associated with adaptation and specialization of cattle breeds.

Association between endothelin type A receptor haplotypes and mortality in coronary heart disease.

PubMed

Ellis, Katrina L; Pilbrow, Anna P; Potter, Howard C; Frampton, Chris M; Doughty, Rob N; Whalley, Gillian A; Ellis, Chris J; Palmer, Barry R; Skelton, Lorraine; Yandle, Tim G; Troughton, Richard W; Richards, A Mark; A Cameron, Vicky

2012-05-01

The endothelin type A receptor, encoded by EDNRA, mediates the effects of endothelin-1 to promote vasoconstriction, vascular cell growth, adhesion, fibrosis and thrombosis. We investigated the association between EDNRA haplotype and cardiovascular outcomes in patients with coronary artery disease. Coronary disease patients (n = 1007) were genotyped for the His323His (rs5333) variant and one tag SNP from each of the major EDNRA haplotype blocks (rs6537484, rs1568136, rs5335 and rs10003447). EDNRA haplotype associations with clinical history, natriuretic peptides cardiac function and cardiovascular outcomes were tested over a median 3.8 years. Univariate analysis identified a 'low-risk' EDNRA haplotype associated with later age of Type 2 diabetes onset (p = 0.004) smaller BMI (p = 0.021), and reduced mortality (log rank p = 0.001). Cox proportional hazards analysis including established cardiovascular risk factors revealed an independent association between haplotype and mortality (p < 0.0001). These data highlight the potential importance of the endothelin system, and in particular EDNRA in coronary disease.

Detecting Single-Nucleotide Substitutions Induced by Genome Editing.

PubMed

Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R

2016-08-01

The detection of genome editing is critical in evaluating genome-editing tools or conditions, but it is not an easy task to detect genome-editing events-especially single-nucleotide substitutions-without a surrogate marker. Here we introduce a procedure that significantly contributes to the advancement of genome-editing technologies. It uses droplet digital polymerase chain reaction (ddPCR) and allele-specific hydrolysis probes to detect single-nucleotide substitutions generated by genome editing (via homology-directed repair, or HDR). HDR events that introduce substitutions using donor DNA are generally infrequent, even with genome-editing tools, and the outcome is only one base pair difference in 3 billion base pairs of the human genome. This task is particularly difficult in induced pluripotent stem (iPS) cells, in which editing events can be very rare. Therefore, the technological advances described here have implications for therapeutic genome editing and experimental approaches to disease modeling with iPS cells. © 2016 Cold Spring Harbor Laboratory Press.

Haplotypes in the APOA1-C3-A4-A5 gene cluster affect plasma lipids in both humans and baboons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Qian-fei; Liu, Xin; O'Connell, Jeff

2003-09-15

Genetic studies in non-human primates serve as a potential strategy for identifying genomic intervals where polymorphisms impact upon human disease-related phenotypes. It remains unclear, however, whether independently arising polymorphisms in orthologous regions of non-human primates leads to similar variation in a quantitative trait found in both species. To explore this paradigm, we studied a baboon apolipoprotein gene cluster (APOA1/C3/A4/A5) for which the human gene orthologs have well established roles in influencing plasma HDL-cholesterol and triglyceride concentrations. Our extensive polymorphism analysis of this 68 kb gene cluster in 96 pedigreed baboons identified several haplotype blocks each with limited diversity, consistent withmore » haplotype findings in humans. To determine whether baboons, like humans, also have particular haplotypes associated with lipid phenotypes, we genotyped 634 well characterized baboons using 16 haplotype tagging SNPs. Genetic analysis of single SNPs, as well as haplotypes, revealed an association of APOA5 and APOC3 variants with HDL cholesterol and triglyceride concentrations, respectively. Thus, independent variation in orthologous genomic intervals does associate with similar quantitative lipid traits in both species, supporting the possibility of uncovering human QTL genes in a highly controlled non-human primate model.« less

Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents.

PubMed

Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z

2014-03-01

The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P < 0.05), six significantly downregulated MGMT promoter activity (29-97% decrease; P < 0.05) and one haplotype had no effect. Mechanistic studies conducted support the conclusion that MGMT P/E haplotypes, rather than individual SNPs, differentially regulate MGMT transcription and could thus play a significant role in human sensitivity to environmental and therapeutic alkylating agents.

Influence of angiotensin converting enzyme (ACE) gene rs4362 polymorphism on the progression of kidney failure in patients with autosomal dominant polycystic kidney disease (ADPKD).

PubMed

Ramanathan, Gnanasambandan; Ghosh, Santu; Elumalai, Ramprasad; Periyasamy, Soundararajan; Lakkakula, Bhaskar V K S

2016-06-01

Autosomal dominant polycystic kidney disease (ADPKD) is an inherited systemic disorder, characterized by the fluid filled cysts in the kidneys leading to end stage renal failure in later years of life. Hypertension is one of the major factors independently contributing to the chronic kidney disease (CKD) progression. The renin-angiotensin aldosterone system (RAAS) genes have been extensively studied as hypertension candidate genes. The aim of the present study was to investigate the role of angiotensin converting enzyme tagging - single nucleotide polymorphisms (ACE tag-SNPs) in progression of CKD in patients with ADPKD. m0 ethods: In the present study six ACE tagSNPs (angiotensin converting enzyme tag single nucleotide polymorphisms) and insertion/deletion (I/D) in 102 ADPKD patients and 106 control subjects were investigated. The tagSNPs were genotyped using FRET-based KASPar method and ACE ID by polymerase chain reaction (PCR) and electrophoresis. Genotypes and haplotypes were compared between ADPKD patients and controls. Univariate and multivariate logistic regression analyses were performed to assess the effect of genotypes and hypertension on CKD advancement. Mantel-Haenszel (M-H) stratified analysis was performed to study the relationship between different CKD stages and hypertension and their interaction. All loci were polymorphic and except rs4293 SNP the remaining loci followed Hardy-Weinberg equilibrium. Distribution of ACE genotypes and haplotypes in controls and ADPKD patients was not significant. A significant linkage disequilibrium (LD) was observed between SNPs forming two LD blocks. The univariate analysis revealed that the age, hypertension, family history of diabetes and ACE rs4362 contributed to the advancement of CKD. The results suggest that the ACE genotypes are effect modifiers of the relationship between hypertension and CKD advancement among the ADPKD patients.

Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.

PubMed

Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

2015-01-01

Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.

Allelic variation of the Waxy gene in foxtail millet [Setaria italica (L.) P. Beauv.] by single nucleotide polymorphisms.

PubMed

Van, K; Onoda, S; Kim, M Y; Kim, K D; Lee, S-H

2008-03-01

The Waxy (Wx) gene product controls the formation of a straight chain polymer of amylose in the starch pathway. Dominance/recessiveness of the Wx allele is associated with amylose content, leading to non-waxy/waxy phenotypes. For a total of 113 foxtail millet accessions, agronomic traits and the molecular differences of the Wx gene were surveyed to evaluate genetic diversities. Molecular types were associated with phenotypes determined by four specific primer sets (non-waxy, Type I; low amylose, Type VI; waxy, Type IV or V). Additionally, the insertion of transposable element in waxy was confirmed by ex1/TSI2R, TSI2F/ex2, ex2int2/TSI7R and TSI7F/ex4r. Seventeen single nucleotide polymorphims (SNPs) were observed from non-coding regions, while three SNPs from coding regions were non-synonymous. Interestingly, the phenotype of No. 88 was still non-waxy, although seven nucleotides (AATTGGT) insertion at 2,993 bp led to 78 amino acids shorter. The rapid decline of r (2) in the sequenced region (exon 1-intron 1-exon 2) suggested a low level of linkage disequilibrium and limited haplotype structure. K (s) values and estimation of evolutionary events indicate early divergence of S. italica among cereal crops. This study suggested the Wx gene was one of the targets in the selection process during domestication.

IL1B-CGTC haplotype is associated with colorectal cancer in admixed individuals with increased African ancestry

PubMed Central

Sanabria-Salas, María Carolina; Hernández-Suárez, Gustavo; Umaña-Pérez, Adriana; Rawlik, Konrad; Tenesa, Albert; Serrano-López, Martha Lucía; Sánchez de Gómez, Myriam; Rojas, Martha Patricia; Bravo, Luis Eduardo; Albis, Rosario; Plata, José Luis; Green, Heather; Borgovan, Theodor; Li, Li; Majumdar, Sumana; Garai, Jone; Lee, Edward; Ashktorab, Hassan; Brim, Hassan; Li, Li; Margolin, David; Fejerman, Laura; Zabaleta, Jovanny

2017-01-01

Single-nucleotide polymorphisms (SNPs) in cytokine genes can affect gene expression and thereby modulate inflammation and carcinogenesis. However, the data on the association between SNPs in the interleukin 1 beta gene (IL1B) and colorectal cancer (CRC) are conflicting. We found an association between a 4-SNP haplotype block of the IL1B (-3737C/-1464G/-511T/-31C) and CRC risk, and this association was exclusively observed in individuals with a higher proportion of African ancestry, such as individuals from the Coastal Colombian region (odds ratio, OR 2.06; 95% CI 1.31–3.25; p < 0.01). Moreover, a significant interaction between this CRC risk haplotype and local African ancestry dosage was identified in locus 2q14 (p = 0.03). We conclude that Colombian individuals with high African ancestry proportions at locus 2q14 harbour more IL1B-CGTC copies and are consequently at an increased risk of CRC. This haplotype has been previously found to increase the IL1B promoter activity and is the most frequent haplotype in African Americans. Despite of limitations in the number of samples and the lack of functional analysis to examine the effect of these haplotypes on CRC cell lines, our results suggest that inflammation and ethnicity play a major role in the modulation of CRC risk. PMID:28157220

Haplotypes of CYP3A4 and their close linkage with CYP3A5 haplotypes in a Japanese population.

PubMed

Fukushima-Uesaka, Hiromi; Saito, Yoshiro; Watanabe, Hidemi; Shiseki, Kisho; Saeki, Mayumi; Nakamura, Takahiro; Kurose, Kouichi; Sai, Kimie; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Kitakaze, Masafumi; Hanai, Sotaro; Nakajima, Toshiharu; Matsumoto, Kenji; Saito, Hirohisa; Goto, Yu-ichi; Kimura, Hideo; Katoh, Masaaki; Sugai, Kenji; Minami, Narihiro; Shirao, Kuniaki; Tamura, Tomohide; Yamamoto, Noboru; Minami, Hironobu; Ohtsu, Atsushi; Yoshida, Teruhiko; Saijo, Nagahiro; Kitamura, Yutaka; Kamatani, Naoyuki; Ozawa, Shogo; Sawada, Jun-ichi

2004-01-01

In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A4 in a Japanese population, the distal enhancer and proximal promoter regions, all exons, and the surrounding introns were sequenced from genomic DNA of 416 Japanese subjects. We found 24 SNPs, including 17 novel ones: two in the distal enhancer, four in the proximal promoter, one in the 5'-untranslated region (UTR), seven in the introns, and three in the 3'-UTR. The most common SNP was c.1026+12G>A (IVS10+12G>A), with a 0.249 frequency. Four non-synonymous SNPs, c.554C>G (p.T185S, CYP3A4(*)16), c.830_831insA (p.E277fsX8, (*)6), c.878T>C (p.L293P, (*)18), and c.1088 C>T (p.T363M, (*)11) were found with frequencies of 0.014, 0.001, 0.028, and 0.002, respectively. No SNP was found in the known nuclear transcriptional factor-binding sites in the enhancer and promoter regions. Using these 24 SNPs, 16 haplotypes were unambiguously identified, and nine haplotypes were inferred by aid of an expectation-maximization-based program. In addition, using data from 186 subjects enabled a close linkage to be found between CYP3A4 and CYP3A5 SNPs, especially among the SNPs at c.1026+12 in CYP3A4 and c.219-237 (IVS3-237, a key SNP site for CYP3A5(*)3), c.865+77 (IVS9+77) and c.1523 in CYP3A5. This result suggested that CYP3A4 and CYP3A5 are within the same gene block. Haplotype analysis between CYP3A4 and CYP3A5 revealed several major haplotype combinations in the CYP3A4-CYP3A5 block. Our findings provide fundamental and useful information for genotyping CYP3A4 (and CYP3A5) in the Japanese, and probably Asian populations. Copyright 2003 Wiley-Liss, Inc.

An EPAS1 haplotype is associated with high altitude polycythemia in male Han Chinese at the Qinghai-Tibetan plateau.

PubMed

Chen, Yu; Jiang, Chunhua; Luo, Yongjun; Liu, Fuyu; Gao, Yuqi

2014-12-01

Hemoglobin concentration at high altitude is considered an important marker of high altitude adaptation, and native Tibetans in the Qinghai-Tibetan plateau show lower hemoglobin concentrations than Han people who have emigrated from plains areas. Genetic studies revealed that EPAS1 plays a key role in high altitude adaptation and is associated with the low hemoglobin concentration in Tibetans. Three single nucleotide polymorphisms (rs13419896, rs4953354, rs1868092) of noncoding regions in EPAS1 exhibited significantly different allele frequencies in the Tibetan and Han populations and were associated with low hemoglobin concentrations in Tibetans. To explore the hereditary basis of high altitude polycythemia (HAPC) and investigate the association between EPAS1 and HAPC in the Han population, these 3 single nucleotide polymorphisms were assessed in 318 male Han Chinese HAPC patients and 316 control subjects. Genotyping was performed by high resolution melting curve analysis. The G-G-G haplotype of rs13419896, rs4953354, and rs1868092 was significantly more frequent in HAPC patients than in control subjects, whereas no differences in the allele or genotype frequencies of the 3 single nucleotide polymorphisms were found between HAPC patients and control subjects. Moreover, genotypes of rs1868092 (AA) and rs4953354 (GG) that were not observed in the Chinese Han in the Beijing population were found at frequencies of 1.6% and 0.9%, respectively, in our study population of HAPC patients and control subjects. Carriers of this EPAS1 haplotype (G-G-G, rs13419896, rs4953354, and rs1868092) may have a higher risk for HAPC. These results may contribute to a better understanding of the pathogenesis of HAPC in the Han population. Copyright © 2014 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

The α‐synuclein gene in multiple system atrophy

PubMed Central

Ozawa, T; Healy, D G; Abou‐Sleiman, P M; Ahmadi, K R; Quinn, N; Lees, A J; Shaw, K; Wullner, U; Berciano, J; Moller, J C; Kamm, C; Burk, K; Josephs, K A; Barone, P; Tolosa, E; Goldstein, D B; Wenning, G; Geser, F; Holton, J L; Gasser, T; Revesz, T; Wood, N W

2006-01-01

Background The formation of α‐synuclein aggregates may be a critical event in the pathogenesis of multiple system atrophy (MSA). However, the role of this gene in the aetiology of MSA is unknown and untested. Method The linkage disequilibrium (LD) structure of the α‐synuclein gene was established and LD patterns were used to identify a set of tagging single nucleotide polymorphisms (SNPs) that represent 95% of the haplotype diversity across the entire gene. The effect of polymorphisms on the pathological expression of MSA in pathologically confirmed cases was also evaluated. Results and conclusion In 253 Gilman probable or definite MSA patients, 457 possible, probable, and definite MSA cases and 1472 controls, a frequency difference for the individual tagging SNPs or tag‐defined haplotypes was not detected. No effect was observed of polymorphisms on the pathological expression of MSA in pathologically confirmed cases. PMID:16543523

Haplotypes and gene expression implicate the MAPT region for Parkinson disease

PubMed Central

Tobin, J.E.; Latourelle, J.C.; Lew, M.F.; Klein, C.; Suchowersky, O.; Shill, H.A.; Golbe, L.I.; Mark, M.H.; Growdon, J.H.; Wooten, G.F.; Racette, B.A.; Perlmutter, J.S.; Watts, R.; Guttman, M.; Baker, K.B.; Goldwurm, S.; Pezzoli, G.; Singer, C.; Saint-Hilaire, M.H.; Hendricks, A.E.; Williamson, S.; Nagle, M.W.; Wilk, J.B.; Massood, T.; Laramie, J.M.; DeStefano, A.L.; Litvan, I.; Nicholson, G.; Corbett, A.; Isaacson, S.; Burn, D.J.; Chinnery, P.F.; Pramstaller, P.P.; Sherman, S.; Al-hinti, J.; Drasby, E.; Nance, M.; Moller, A.T.; Ostergaard, K.; Roxburgh, R.; Snow, B.; Slevin, J.T.; Cambi, F.; Gusella, J.F.; Myers, R.H.

2009-01-01

Background Microtubule-associated protein tau (MAPT) has been associated with several neurodegenerative disorders including forms of parkinsonism and Parkinson disease (PD). We evaluated the association of the MAPT region with PD in a large cohort of familial PD cases recruited by the GenePD Study. In addition, postmortem brain samples from patients with PD and neurologically normal controls were used to evaluate whether the expression of the 3-repeat and 4-repeat isoforms of MAPT, and neighboring genes Saitohin (STH) and KIAA1267, are altered in PD cerebellum. Methods Twenty-one single-nucleotide polymorphisms (SNPs) in the region of MAPT on chromosome 17q21 were genotyped in the GenePD Study. Single SNPs and haplotypes, including the H1 haplotype, were evaluated for association to PD. Relative quantification of gene expression was performed using real-time RT-PCR. Results After adjusting for multiple comparisons, SNP rs1800547 was significantly associated with PD affection. While the H1 haplotype was associated with a significantly increased risk for PD, a novel H1 subhaplotype was identified that predicted a greater increased risk for PD. The expression of 4-repeat MAPT, STH, and KIAA1267 was significantly increased in PD brains relative to controls. No difference in expression was observed for 3-repeat MAPT. Conclusions This study supports a role for MAPT in the pathogenesis of familial and idiopathic Parkinson disease (PD). Interestingly, the results of the gene expression studies suggest that other genes in the vicinity of MAPT, specifically STH and KIAA1267, may also have a role in PD and suggest complex effects for the genes in this region on PD risk. PMID:18509094

Better ILP models for haplotype assembly.

PubMed

Etemadi, Maryam; Bagherian, Mehri; Chen, Zhi-Zhong; Wang, Lusheng

2018-02-19

The haplotype assembly problem for diploid is to find a pair of haplotypes from a given set of aligned Single Nucleotide Polymorphism (SNP) fragments (reads). It has many applications in association studies, drug design, and genetic research. Since this problem is computationally hard, both heuristic and exact algorithms have been designed for it. Although exact algorithms are much slower, they are still of great interest because they usually output significantly better solutions than heuristic algorithms in terms of popular measures such as the Minimum Error Correction (MEC) score, the number of switch errors, and the QAN50 score. Exact algorithms are also valuable because they can be used to witness how good a heuristic algorithm is. The best known exact algorithm is based on integer linear programming (ILP) and it is known that ILP can also be used to improve the output quality of every heuristic algorithm with a little decline in speed. Therefore, faster ILP models for the problem are highly demanded. As in previous studies, we consider not only the general case of the problem but also its all-heterozygous case where we assume that if a column of the input read matrix contains at least one 0 and one 1, then it corresponds to a heterozygous SNP site. For both cases, we design new ILP models for the haplotype assembly problem which aim at minimizing the MEC score. The new models are theoretically better because they contain significantly fewer constraints. More importantly, our experimental results show that for both simulated and real datasets, the new model for the all-heterozygous (respectively, general) case can usually be solved via CPLEX (an ILP solver) at least 5 times (respectively, twice) faster than the previous bests. Indeed, the running time can sometimes be 41 times better. This paper proposes a new ILP model for the haplotype assembly problem and its all-heterozygous case, respectively. Experiments with both real and simulated datasets show that the

A Candidate Trans-acting Modulator of Fetal Hemoglobin Gene Expression in the Arab-Indian Haplotype of Sickle Cell Anemia

PubMed Central

Vathipadiekal, Vinod; Farrell, John J.; Wang, Shuai; Edward, Heather L.; Shappell, Heather; Al-Rubaish, A.M.; Al-Muhanna, Fahad; Naserullah, Z.; Alsuliman, A.; Qutub, Hatem Othman; Simkin, Irene; Farrer, Lindsay A.; Jiang, Zhihua; Luo, Hong-Yuan; Huang, Shengwen; Mostoslavsky, Gustavo; Murphy, George J.; Patra, Pradeep.K.; Chui, David H.K.; Alsultan, Abdulrahman; Al-Ali, Amein K.; Sebastiani, Paola.; Steinberg, Martin. H.

2016-01-01

Fetal hemoglobin (HbF) levels are higher in the Arab-Indian (AI) β-globin gene haplotype of sickle cell anemia compared with African-origin haplotypes. To study genetic elements that effect HbF expression in the AI haplotype we completed whole genome sequencing in 14 Saudi AI haplotype sickle hemoglobin homozygotes—seven selected for low HbF (8.2±1.3%) and seven selected for high HbF (23.5±.2.6%). An intronic single nucleotide polymorphism (SNP) in ANTXR1, an anthrax toxin receptor (chromosome 2p13), was associated with HbF. These results were replicated in two independent Saudi AI haplotype cohorts of 120 and 139 patients, but not in 76 Saudi Benin haplotype, 894 African origin haplotype and 44 Arab Indian haplotype patients of Indian descent, suggesting that this association is effective only in the Saudi AI haplotype background. ANTXR1 variants explained 10% of the HbF variability compared with 8% for BCL11A. These two genes had independent, additive effects on HbF and together explained about 15% of HbF variability in Saudi AI sickle cell anemia patients. ANTXR1 was expressed at mRNA and protein levels in erythroid progenitors derived from induced pluripotent stem cells (iPSCs) and CD34+ cells. As CD34+ cells matured and their HbF decreased ANTXR1 expression increased; as iPSCs differentiated and their HbF increased, ANTXR1 expression decreased. Along with elements in cis to the HbF genes, ANTXR1 contributes to the variation in HbF in Saudi AI haplotype sickle cell anemia and is the first gene in trans to HBB that is associated with HbF only in carriers of the Saudi AI haplotype. PMID:27501013

δ-Aminolevulinic Acid Dehydratase Single Nucleotide Polymorphism 2 (ALAD2) and Peptide Transporter 2*2 Haplotype (hPEPT2*2) Differently Influence Neurobehavior in Low-Level Lead Exposed Children

PubMed Central

Sobin, Christina; Gisel Flores-Montoya, Mayra; Gutierrez, Marisela; Parisi, Natali; Schaub, Tanner

2014-01-01

Delta-aminolevulinic acid dehydratase single nucleotide polymorphism 2 (ALAD2) and peptide transporter haplotype 2*2 (hPEPT2*2) through different pathways can increase brain levels of delta-aminolevulinic acid and are associated with higher blood lead burden in young children. Past child and adult findings regarding ALAD2 and neurobehavior have been inconsistent, and the possible association of hPEPT2*2 and neurobehavior has not yet been examined. Mean blood lead level (BLL), genotype, and neurobehavioral function (fine motor dexterity, working memory, visual attention and short-term memory) were assessed in 206 males and 215 females ages 5.1 to 11.8 years. Ninety-six percent of children had BLLs < 5.0 µg/dL. After adjusting for covariates (sex, age and mother’s level of education) and sibling exclusion (N = 252), generalized linear mixed model analyses showed opposite effects for the ALAD2 and hPEPT2*2 genetic variants. Significant effects for ALAD2 were observed only as interactions with BLL and the results suggested that ALAD2 was neuroprotective. As BLL increased, ALAD2 was associated with enhanced visual attention and enhanced working memory (fewer commission errors). Independent of BLL, hPEPT2*2 predicted poorer motor dexterity and poorer working memory (more commission errors). BLL alone predicted poorer working memory from increased omission errors. The findings provided further substantiation that (independent of the genetic variants examined) lowest-level lead exposure disrupted early neurobehavioral function, and suggested that common genetic variants alter the neurotoxic potential of low-level lead. ALAD2 and hPEPT2*2 may be valuable markers of risk, and indicate novel mechanisms of lead-induced neurotoxicity. Longitudinal studies are needed to examine long-term influences of these genetic variants on neurobehavior. PMID:25514583

δ-Aminolevulinic acid dehydratase single nucleotide polymorphism 2 (ALAD2) and peptide transporter 2*2 haplotype (hPEPT2*2) differently influence neurobehavior in low-level lead exposed children.

PubMed

Sobin, Christina; Flores-Montoya, Mayra Gisel; Gutierrez, Marisela; Parisi, Natali; Schaub, Tanner

2015-01-01

Delta-aminolevulinic acid dehydratase single nucleotide polymorphism 2 (ALAD2) and peptide transporter haplotype 2*2 (hPEPT2*2) through different pathways can increase brain levels of delta-aminolevulinic acid and are associated with higher blood lead burden in young children. Past child and adult findings regarding ALAD2 and neurobehavior have been inconsistent, and the possible association of hPEPT2*2 and neurobehavior has not yet been examined. Mean blood lead level (BLL), genotype, and neurobehavioral function (fine motor dexterity, working memory, visual attention and short-term memory) were assessed in 206 males and 215 females ages 5.1-11.8years. Ninety-six percent of children had BLLs<5.0μg/dl. After adjusting for covariates (sex, age and mother's level of education) and sibling exclusion (N=252), generalized linear mixed model analyses showed opposite effects for the ALAD2 and hPEPT2*2 genetic variants. Significant effects for ALAD2 were observed only as interactions with BLL and the results suggested that ALAD2 was neuroprotective. As BLL increased, ALAD2 was associated with enhanced visual attention and enhanced working memory (fewer commission errors). Independent of BLL, hPEPT2*2 predicted poorer motor dexterity and poorer working memory (more commission errors). BLL alone predicted poorer working memory from increased omission errors. The findings provided further substantiation that (independent of the genetic variants examined) lowest-level lead exposure disrupted early neurobehavioral function, and suggested that common genetic variants alter the neurotoxic potential of low-level lead. ALAD2 and hPEPT2*2 may be valuable markers of risk, and indicate novel mechanisms of lead-induced neurotoxicity. Longitudinal studies are needed to examine long-term influences of these genetic variants on neurobehavior. Copyright © 2014 Elsevier Inc. All rights reserved.

Meta-analysis of haplotype-association studies: comparison of methods and empirical evaluation of the literature

PubMed Central

2011-01-01

Background Meta-analysis is a popular methodology in several fields of medical research, including genetic association studies. However, the methods used for meta-analysis of association studies that report haplotypes have not been studied in detail. In this work, methods for performing meta-analysis of haplotype association studies are summarized, compared and presented in a unified framework along with an empirical evaluation of the literature. Results We present multivariate methods that use summary-based data as well as methods that use binary and count data in a generalized linear mixed model framework (logistic regression, multinomial regression and Poisson regression). The methods presented here avoid the inflation of the type I error rate that could be the result of the traditional approach of comparing a haplotype against the remaining ones, whereas, they can be fitted using standard software. Moreover, formal global tests are presented for assessing the statistical significance of the overall association. Although the methods presented here assume that the haplotypes are directly observed, they can be easily extended to allow for such an uncertainty by weighting the haplotypes by their probability. Conclusions An empirical evaluation of the published literature and a comparison against the meta-analyses that use single nucleotide polymorphisms, suggests that the studies reporting meta-analysis of haplotypes contain approximately half of the included studies and produce significant results twice more often. We show that this excess of statistically significant results, stems from the sub-optimal method of analysis used and, in approximately half of the cases, the statistical significance is refuted if the data are properly re-analyzed. Illustrative examples of code are given in Stata and it is anticipated that the methods developed in this work will be widely applied in the meta-analysis of haplotype association studies. PMID:21247440

Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data.

PubMed

Excoffier, L; Smouse, P E; Quattro, J M

1992-06-01

We present here a framework for the study of molecular variation within a single species. Information on DNA haplotype divergence is incorporated into an analysis of variance format, derived from a matrix of squared-distances among all pairs of haplotypes. This analysis of molecular variance (AMOVA) produces estimates of variance components and F-statistic analogs, designated here as phi-statistics, reflecting the correlation of haplotypic diversity at different levels of hierarchical subdivision. The method is flexible enough to accommodate several alternative input matrices, corresponding to different types of molecular data, as well as different types of evolutionary assumptions, without modifying the basic structure of the analysis. The significance of the variance components and phi-statistics is tested using a permutational approach, eliminating the normality assumption that is conventional for analysis of variance but inappropriate for molecular data. Application of AMOVA to human mitochondrial DNA haplotype data shows that population subdivisions are better resolved when some measure of molecular differences among haplotypes is introduced into the analysis. At the intraspecific level, however, the additional information provided by knowing the exact phylogenetic relations among haplotypes or by a nonlinear translation of restriction-site change into nucleotide diversity does not significantly modify the inferred population genetic structure. Monte Carlo studies show that site sampling does not fundamentally affect the significance of the molecular variance components. The AMOVA treatment is easily extended in several different directions and it constitutes a coherent and flexible framework for the statistical analysis of molecular data.

KCNQ1 Haplotypes Associate with Type 2 Diabetes in Malaysian Chinese Subjects

PubMed Central

Saif-Ali, Riyadh; Ismail, Ikram S.; Al-Hamodi, Zaid; Al-Mekhlafi, Hesham M.; Siang, Lee C.; Alabsi, Aied M.; Muniandy, Sekaran

2011-01-01

The aim of this study was to investigate the association of single nucleotide polymorphisms (SNPs) and haplotypes of potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1) with type 2 diabetes (T2D) in Malaysian Chinese subjects. The KCNQ1 SNPs rs2237892, rs2283228 and rs2237895 were genotyped in 300 T2D patients and 230 control subjects without diabetes and metabolic syndrome. Two logistic regression models of analysis were applied, the first adjusted for age and gender while the second adjusted for age, gender and body mass index. The additive genetic analysis showed that adjusting for body mass index (BMI) even strengthened association of rs2237892, rs2283228 and rs2237895 with T2D (OR = 2.0, P = 5.1 × 10−5; OR = 1.9, P = 5.2 × 10−5; OR = 1.9, P = 7.8 × 10−5, respectively). The haplotype TCA containing the allele of rs2237892 (T), rs2283228 (C) and rs2237895 (A) was highly protective against T2D (Second model; OR = 0.17, P = 3.7 × 10−11). The KCNQ1 rs2237892 (TT), and the protective haplotype (TCA) were associated with higher beta-cell function (HOMA-B) in normal subjects (P = 0.0002; 0.014, respectively). This study found that KCNQ1 SNPs was associated with T2D susceptibility in Malaysian Chinese subjects. In addition, certain KCNQ1 haplotypes were strongly associated with T2D. PMID:22016621

Genetic variants in PNPLA3 and risk of non-alcoholic fatty liver disease in a Han Chinese population.

PubMed

Peng, Xian-E; Wu, Yun-Li; Lin, Shao-Wei; Lu, Qing-Qing; Hu, Zhi-Jian; Lin, Xu

2012-01-01

We investigated the possible association between genetic variants in the Patatin like phospholipase-3 (PNPLA3) gene and nonalcoholic fatty liver disease (NAFLD) in a Han Chinese population. We evaluated twelve tagging single-nucleotide polymorphisms (tSNPs) of the PNPLA3 gene in a frequency matched case-control study from Fuzhou city of China (553 cases, 553 controls). In the multivariate logistic regression analysis, the rs738409 GG or GC, and rs139051 TT genotypes were found to be associated with increased risk of NAFLD, and a significant trend of increased risk with increasing numbers of risk genotype was observed in the cumulative effect analysis of these single nucleotide polymorphisms. Furthermore, haplotype association analysis showed that, compared with the most common haplotype, the CAAGAATGCGTG and CGAAGGTGTCCG haplotypes conferred a statistically significant increased risk for NAFLD, while the CGGGAACCCGCG haplotype decreased the risk of NAFLD. Moreover, rs738409 C>G appeared to have a multiplicative joint effect with tea drinking (P<0.005) and an additive joint effect with obesity (Interaction contrast ratio (ICR) = 2.31, 95% CI: 0.7-8.86), hypertriglyceridemia (ICR = 3.07, 95% CI: 0.98-5.09) or hypertension (ICR = 1.74, 95% CI: 0.52-3.12). Our data suggests that PNPLA3 genetic polymorphisms might influence the susceptibility to NAFLD development independently or jointly in Han Chinese.

Association study of two functional single nucleotide polymorphisms of neuropeptide y gene with multiple sclerosis.

PubMed

Mohammadi, Seyed Mahdi; Shirvani Farsani, Zeinab; Dosti, Rozita; Sahraian, Mohammad Ali; Behmanesh, Mehrdad

2016-12-01

Multiple sclerosis (MS) is an autoimmune disease of the central nervous system characterized by brain inflammation, demyelination and axonal loss. Neuropeptide Y (NPY) has a critical role in the maintenance of homeostasis in the immune system and coping of stress condition. In the current study we analyzed 188 patients suffering from MS and 204 unrelated healthy controls for two functional single nucleotide polymorphisms (SNPs), NPY 20T>C (rs16139) and NPY -485T>C (rs16147) using PCR-RFLP and Mismatch PCR-RFLP methods. Our results demonstrated that homozygocity in the minor allele for NPY -485T>C polymorphism is associated with the MS risk in patients in compare with healthy controls (CC vs. TT, P=0.033; CC vs. TT+TC, P=0.02). In addition, by comparison with allele T, the frequency of NPY -485C allele was higher in cases than in control subjects and present increased risk of MS, but statistically significant was borderline (P=0.053). The stratification for disease progression revealed a significant difference in the allelic and genotypic distribution between subgroups of MS and controls. The frequency of the CC genotype and C allele was higher in the primary progressive MS patients when compared with control group (CC vs. TT, P=0.019; CC vs. TT+TC, P=0.008; C vs. T, P=0.022). In addition, the frequency of CC genotype was higher in the relapsing remitting MS patients when compared with control group (CC vs. TT, P=0.034; CC vs. TT+TC, P=0.016). Haplotype analysis demonstrated that the haplotype 3 (CT) is more common in RR MS (P=0.041), and PP MS (P=0.031) than control group. In conclusion, the obtained results demonstrate the probable role of NPY SNPs in susceptibility to MS within the Iranian population. Copyright © 2016 Elsevier Ltd. All rights reserved.

Linkage Disequilibrium and Haplotype Diversity in the Genes of the Renin–Angiotensin System: Findings From the Family Blood Pressure Program

PubMed Central

Zhu, Xiaofeng; Yan, Denise; Cooper, Richard S.; Luke, Amy; Ikeda, Morna A.; Chang, Yen-Pei C.; Weder, Alan; Chakravarti, Aravinda

2003-01-01

Association studies of candidate genes with complex traits have generally used one or a few single nucleotide polymorphisms (SNPs), although variation in the extent of linkage disequilibrium (LD) within genes markedly influences the sensitivity and precision of association studies. The extent of LD and the underlying haplotype structure for most candidate genes are still unavailable. We sampled 193 blacks (African-Americans) and 160 whites (European-Americans) and estimated the intragenic LD and the haplotype structure in four genes of the renin–angiotensin system. We genotyped 25 SNPs, with all but one of the pairs spaced between 1 and 20 kb, thus providing resolution at small scale. The pattern of LD within a gene was very heterogeneous. Using a robust method to define haplotype blocks, blocks of limited haplotype diversity were identified at each locus; between these blocks, LD was lost owing to the history of recombination events. As anticipated, there was less LD among blacks, the number of haplotypes was substantially larger, and shorter haplotype segments were found, compared with whites. These findings have implications for candidate-gene association studies and indicate that variation between populations of European and African origin in haplotype diversity is characteristic of most genes. [The sequence data described in this paper are available in GenBank under the following accession nos: AGT, MIM 106150; Renin, MIM 179820; ACE, MIM 106180; Angiotensin receptor I, MIM 106165. Supplementary material is available online at http://www.genome.org.] PMID:12566395

Catechol-O-methyltransferase gene haplotypes in Mexican and Spanish patients with fibromyalgia

PubMed Central

Vargas-Alarcón, Gilberto; Fragoso, José-Manuel; Cruz-Robles, David; Vargas, Angélica; Vargas, Alfonso; Lao-Villadóniga, José-Ignacio; García-Fructuoso, Ferrán; Ramos-Kuri, Manuel; Hernández, Fernando; Springall, Rashidi; Bojalil, Rafael; Vallejo, Maite; Martínez-Lavín, Manuel

2007-01-01

Autonomic dysfunction is frequent in patients with fibromyalgia (FM). Heart rate variability analyses have demonstrated signs of ongoing sympathetic hyperactivity. Catecholamines are sympathetic neurotransmitters. Catechol-O-methyltransferase (COMT), an enzyme, is the major catecholamine-clearing pathway. There are several single-nucleotide polymorphisms (SNPs) in the COMT gene associated with the different catecholamine-clearing abilities of the COMT enzyme. These SNPs are in linkage disequilibrium and segregate as 'haplotypes'. Healthy females with a particular COMT gene haplotype (ACCG) producing a defective enzyme are more sensitive to painful stimuli. The objective of our study was to define whether women with FM, from two different countries (Mexico and Spain), have the COMT gene haplotypes that have been previously associated with greater sensitivity to pain. All the individuals in the study were female. Fifty-seven Mexican patients and 78 Spanish patients were compared with their respective healthy control groups. All participants filled out the Fibromyalgia Impact Questionnaire (FIQ). Six COMT SNPs (rs2097903, rs6269, rs4633, rs4818, rs4680, and rs165599) were genotyped from peripheral blood DNA. In Spanish patients, there was a significant association between three SNPs (rs6269, rs4818, and rs4680) and the presence of FM when compared with healthy controls. Moreover, in Spanish patients with the 'high pain sensitivity' haplotype (ACCG), the disease, as assessed by the FIQ, was more severe. By contrast, Mexican patients displayed only a weak association between rs6269 and rs165599, and some FIQ subscales. In our group of Spanish patients, there was an association between FM and the COMT haplotype previously associated with high pain sensitivity. This association was not observed in Mexican patients. Studies with a larger sample size are needed in order to verify or amend these preliminary results. PMID:17961261

4G/5G Plasminogen Activator Inhibitor-1 Polymorphisms and Haplotypes Are Associated with Pneumonia

PubMed Central

Yende, Sachin; Angus, Derek C.; Ding, Jingzhong; Newman, Anne B.; Kellum, John A.; Li, Rongling; Ferrell, Robert E.; Zmuda, Joseph; Kritchevsky, Stephen B.; Harris, Tamara B.; Garcia, Melissa; Yaffe, Kristine; Wunderink, Richard G.

2007-01-01

Rationale: Plasminogen activator inhibitor (PAI)-1 inhibits urokinase and tissue plasminogen activator, required for host response to infection. Whether variation within the PAI-1 gene is associated with increased susceptibility to infection is unknown. Objectives: To ascertain the role of the 4G/5G polymorphism and other genetic variants within the PAI-1 gene. We hypothesized that variants associated with increased PAI-1 expression would be associated with an increased occurrence of community-acquired pneumonia (CAP). Methods: Longitudinal analysis (>12 yr) of the Health, Aging, and Body Composition cohort, aged 65–74 years at start of analysis. Measurements and Main Results: We genotyped the 4G/5G PAI-1 polymorphism and six additional single nucleotide polymorphisms. Of the 3,075 subjects, 272 (8.8%) had at least one hospitalization for CAP. Among whites, variants at the PAI4G,5G, PAI2846, and PAI7343 sites had higher risk of CAP (P = 0.018, 0.021, and 0.021, respectively). At these sites, variants associated with higher PAI-1 expression were associated with increased CAP susceptibility. Compared with the 5G/5G genotypes at PAI4G,5G site, the 4G/4G and 4G/5G genotypes were associated with a 1.98-fold increased risk of CAP (95% confidence interval, 1.2–3.2; P = 0.006). In whole blood stimulation assay, subjects with a 4G allele had 3.3- and 1.9-fold increased PAI-1 expression (P = 0.043 and 0.034, respectively). In haplotype analysis, the 4G/G/C/A haplotype at the PAI4G,5G, PAI2846, PAI4588, and PAI7343 single nucleotide polymorphisms was associated with higher CAP susceptibility, whereas the 5G/G/C/A haplotype was associated with lower CAP susceptibility. No associations were seen among blacks. Conclusions: Genotypes associated with increased expression of PAI-1 were associated with increased susceptibility to CAP in elderly whites. PMID:17761618

Cytochrome P450 2E1 gene polymorphisms/haplotypes and anti-tuberculosis drug-induced hepatitis in a Chinese cohort.

PubMed

Tang, Shaowen; Lv, Xiaozhen; Zhang, Yuan; Wu, Shanshan; Yang, Zhirong; Xia, Yinyin; Tu, Dehua; Deng, Peiyuan; Ma, Yu; Chen, Dafang; Zhan, Siyan

2013-01-01

The pathogenic mechanism of anti-tuberculosis (anti-TB) drug-induced hepatitis is associated with drug metabolizing enzymes. No tagging single-nucleotide polymorphisms (tSNPs) of cytochrome P450 2E1(CYP2E1) in the risk of anti-TB drug-induced hepatitis have been reported. The present study was aimed at exploring the role of tSNPs in CYP2E1 gene in a population-based anti-TB treatment cohort. A nested case-control study was designed. Each hepatitis case was 14 matched with controls by age, gender, treatment history, disease severity and drug dosage. The tSNPs were selected by using Haploview 4.2 based on the HapMap database of Han Chinese in Beijing, and detected by using TaqMan allelic discrimination technology. Eighty-nine anti-TB drug-induced hepatitis cases and 356 controls were included in this study. 6 tSNPs (rs2031920, rs2070672, rs915908, rs8192775, rs2515641, rs2515644) were genotyped and minor allele frequencies of these tSNPs were 21.9%, 23.0%, 19.1%, 23.6%, 20.8% and 44.4% in the cases and 20.9%, 22.7%, 18.9%, 23.2%, 18.2% and 43.2% in the controls, respectively. No significant difference was observed in genotypes or allele frequencies of the 6 tSNPs between case group and control group, and neither of haplotypes in block 1 nor in block 2 was significantly associated with the development of hepatitis. Based on the Chinese anti-TB treatment cohort, we did not find a statistically significant association between genetic polymorphisms of CYP2E1 and the risk of anti-TB drug-induced hepatitis. None of the haplotypes showed a significant association with the development of hepatitis in Chinese TB population.

Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm

PubMed Central

Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

2015-01-01

Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. ‘Cayenne’, ‘Spanish’, ‘Queen’) was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops. PMID:26640697

A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

PubMed Central

Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

2003-01-01

A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

COI haplotype groups in Mesocriconema (Nematoda: Criconematidae) and their morphospecies associations.

PubMed

Powers, T O; Bernard, E C; Harris, T; Higgins, R; Olson, M; Lodema, M; Mullin, P; Sutton, L; Powers, K S

2014-07-03

Without applying an a priori bias for species boundaries, specimen identities in the plant-parasitic nematode genus Mesocriconema were evaluated by examining mitochondrial COI nucleotide sequences, morphology, and biogeography. A total of 242 specimens that morphologically conformed to the genus were individually photographed, measured, and amplified by a PCR primer set to preserve the linkage between specimen morphology and a specific DNA barcode sequence. Specimens were extracted from soil samples representing 45 locations across 23 ecoregions in North America. Dendrograms constructed by neighbor-joining, maximum likelihood, and Bayesian Inference using a 721-bp COI barcode were used to group COI haplotypes. Each tree-building approach resulted in 24 major haplotype groups within the dataset. The distinctiveness of these groups was evaluated by node support, genetic distance, absence of intermediates, and several measures of distinctiveness included in software used for the exploration of species boundaries. Five of the 24 COI haplotype groups corresponded to morphologically characterized, Linnaean species. Morphospecies conforming to M. discus, Discocriconemella inarata, M. rusticum, M. onoense, and M. kirjanovae were represented by groups composed of multiple closely related or identical COI haplotypes. In other cases, morphospecies names could be equally applied to multiple haplotype groups that were genetically distant from each other. Identification based on morphology alone resulted in M. curvatum and M. ornatum species designations applied to seven and three groups, respectively. Morphological characters typically used for species level identification were demonstrably variable within haplotype groups, suggesting caution in assigning species names based on published compendia that solely consider morphological characters. Morphospecies classified as M. xenoplax formed a monophyletic group composed of seven genetically distinct COI subgroups. The species

Impacts of TNF-LTA SNPs/Haplotypes and Lifestyle Factors on Oral Carcinoma in an Indian Population.

PubMed

Bandil, Kapil; Singhal, Pallavi; Sharma, Upma; Hussain, Showket; Basu, Surojit; Parashari, Aditya; Singh, Veena; Sehgal, Ashok; Shivam, Animesh; Ahuja, Puneet; Bharadwaj, Mausumi; Banerjee, Basu Dev; Mehrotra, Ravi

2016-10-01

To investigate a potential association between single-nucleotide polymorphisms (SNPs) and  haplotypes at the TNFA-LTA locus and the development of oral cancer in an Indian population. In this study, 150 oral precancer/cancer samples (50 precancer and 100 cancer), along with an equal number of control samples, were genotyped. Six SNPs at the TNF-LTA locus (i.e., -238G/A, -308G/A, -857C/T, -863C/A, -1031T/C, and +252A/G) were analyzed by use of a polymerase chain reaction-restriction fragment length polymorphism method, the assay was validated by sequencing 10 % of samples. The allelic frequencies of TNFA and LTA SNPs were found to be significantly associated with the risk of oral cancer and precancerous lesions in comparison with controls (P < 0.0003). Further haplotypic analysis showed that two haplotypes (ATCTGG and ACACGG) served as risk haplotypes for oral cancer. These haplotypes were also found to be significantly and positively associated with lifestyle habits (tobacco chewing P = 0.04, odds ratio [OR] 3.4) and socioeconomic status (P = 0.01, OR 3.4). We noticed an increased percentage of risk haplotypes correlating with the aggressiveness of oral cancer. The percentages of risk haplotypes were found to be threefold higher in precancer and fourfold higher in advanced stages of oral cancer in comparison with controls. Five SNPs at the TNF-LTA locus (i.e., -308G>A, -857C>T, -863C>A, -1031T>C, and +252A>G) were found to be associated with the development of oral cancer. Two haplotypes (ATCTGG and ACACGG) emerged as major risk haplotypes for oral carcinoma progression and were also found to be associated with lifestyle factors and clinical aggressiveness. These findings make the TNF-LTA locus a suitable candidate for a future biomarker, which may be used either for early detection or for helping to improve treatment efficacy and effectiveness.

Genomic dissection of a ‘Fuji’ apple cultivar: re-sequencing, SNP marker development, definition of haplotypes, and QTL detection

PubMed Central

Kunihisa, Miyuki; Moriya, Shigeki; Abe, Kazuyuki; Okada, Kazuma; Haji, Takashi; Hayashi, Takeshi; Kawahara, Yoshihiro; Itoh, Ryutaro; Itoh, Takeshi; Katayose, Yuichi; Kanamori, Hiroyuki; Matsumoto, Toshimi; Mori, Satomi; Sasaki, Harumi; Matsumoto, Takashi; Nishitani, Chikako; Terakami, Shingo; Yamamoto, Toshiya

2016-01-01

‘Fuji’ is one of the most popular and highly-produced apple cultivars worldwide, and has been frequently used in breeding programs. The development of genotypic markers for the preferable phenotypes of ‘Fuji’ is required. Here, we aimed to define the haplotypes of ‘Fuji’ and find associations between haplotypes and phenotypes of five traits (harvest day, fruit weight, acidity, degree of watercore, and flesh mealiness) by using 115 accessions related to ‘Fuji’. Through the re-sequencing of ‘Fuji’ genome, total of 2,820,759 variants, including single nucleotide polymorphisms (SNPs) and insertions or deletions (indels) were detected between ‘Fuji’ and ‘Golden Delicious’ reference genome. We selected mapping-validated 1,014 SNPs, most of which were heterozygous in ‘Fuji’ and capable of distinguishing alleles inherited from the parents of ‘Fuji’ (i.e., ‘Ralls Janet’ and ‘Delicious’). We used these SNPs to define the haplotypes of ‘Fuji’ and trace their inheritance in relatives, which were shown to have an average of 27% of ‘Fuji’ genome. Analysis of variance (ANOVA) based on ‘Fuji’ haplotypes identified one quantitative trait loci (QTL) each for harvest time, acidity, degree of watercore, and mealiness. A haplotype from ‘Delicious’ chr14 was considered to dominantly cause watercore, and one from ‘Ralls Janet’ chr1 was related to low-mealiness. PMID:27795675

HIGH-THROUGHPUT IDENTIFICATION OF THE PREDOMINANT MALARIA PARASITE CLONE IN COMPLEX BLOOD STAGE INFECTIONS USING A MULTI-SNP MOLECULAR HAPLOTYPING ASSAY

PubMed Central

COLE-TOBIAN, JENNIFER L.; ZIMMERMAN, PETER A.; KING, CHRISTOPHER L.

2013-01-01

Individuals living in malaria endemic areas are often infected with multiple parasite clones. Currently used single nucleotide polymorphism (SNP) genotyping methods for malaria parasites are cumbersome; furthermore, few methods currently exist that can rapidly determine the most abundant clone in these complex infections. Here we describe an oligonucleotide ligation assay (OLA) to distinguish SNPs in the Plasmodium vivax Duffy binding protein gene (Pvdbp) at 14 polymorphic residues simultaneously. Allele abundance is determined by the highest mean fluorescent intensity of each allele. Using mixtures of plasmids encoding known haplotypes of the Pvdbp, single clones of P. vivax parasites from infected Aotus monkeys, and well-defined mixed infections from field samples, we were able to identify the predominant Pvdbp genotype with > 93% accuracy when the dominant clone is twice as abundant as a lesser genotype and > 97% of the time if the ratio was 5:1 or greater. Thus, the OLA can accurately, reproducibly, and rapidly determine the predominant parasite haplotype in complex blood stage infections. PMID:17255222

The autoimmune regulator gene (AIRE) is strongly associated with vitiligo.

PubMed

Tazi-Ahnini, R; McDonagh, A J G; Wengraf, D A; Lovewell, T R J; Vasilopoulos, Y; Messenger, A G; Cork, M J; Gawkrodger, D J

2008-09-01

Vitiligo is an autoimmune disorder that occurs with greatly increased frequency in the rare recessive autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy syndrome (APECED) caused by mutations of the autoimmune regulator (AIRE) gene on chromosome 21q22.3. We have previously detected an association between alopecia areata and single nucleotide polymorphisms (SNPs) in the AIRE gene. To report the findings of an extended study including haplotype analysis on six AIRE polymorphisms (AIRE C-103T, C4144G, T5238C, G6528A, T7215C and T11787C) in vitiligo, another APECED-associated disease. A case-control analysis was performed. Results showed a strong association between AIRE 7215C and vitiligo [P = 1.36 x 10(-5), odds ratio (OR) 3.12, 95% confidence interval (CI) 1.87-5.46]. We found no significant association with the other polymorphisms individually. However, haplotype analysis revealed that the AIRE haplotype CCTGCC showed a highly significant association with vitiligo (P = 4.14 x 10(-4), OR 3.00, 95% CI 1.70-5.28). To select the most informative minimal haplotypes, we tagged the polymorphisms using SNP tag software. Using AIRE C-103T, G6528A, T7215C and T11787C as tag SNPs, the haplotype AIRE CGCC was associated with vitiligo (P = 0.003, OR 2.49, 95% CI 1.45-4.26). The link between vitiligo and AIRE raises the possibility that defective skin peripheral antigen selection in the thymus is involved in the changes that result in melanocyte destruction in this disorder.

TNF-alpha single nucleotide polymorphisms in atopic dermatitis.

PubMed

Behniafard, Nasrin; Gharagozlou, Mohammad; Farhadi, Elham; Khaledi, Mojdeh; Sotoudeh, Soheila; Darabi, Behzad; Fathi, Seid Mohammad; Gholizadeh Moghaddam, Zahra; Mahmoudi, Mahdi; Aghamohammadi, Asghar; Amirzargar, Ali Akbar; Rezaei, Nima

2012-01-01

Tumor necrosis factor-alpha (TNF-α) could be considered as potential biomarkers in atopic dermatitis (AD), while its level could be influenced by cytokine single gene polymorphisms (SNP). This study was performed in 89 pediatric patients with AD and 137 controls to assess polymorphisms of the TNF-α gene at positions -308 and -238, using the polymerase chain reaction and the sequence-specific primers method. The highest positive allelic association that made the patients susceptible to AD was seen for TNF-α -238/G (p<0.001) and TNF-α -308/G (p = 0.003). The GG genotypes at TNF-α -238 and TNF-α -308, were both significantly higher in the patients with AD, compared to the controls (p<0.01). The GG haplotype at TNF-α (-308,-238) was seen in 92.7% of the patients, which was significantly higher than the controls (p<0.001), while a negative haplotypic association with AD was seen for TNF-α (-308, -238) AG and GA (p<0.01). This study showed that the AG genotype of TNF-α -308, associated with a high production of cytokines, was significantly decreased in patients with AD, while the low-producing GG genotype, which could lead to low production of TNF-α, was over-expressed in the atopic patients.

LDlink: a web-based application for exploring population-specific haplotype structure and linking correlated alleles of possible functional variants.

PubMed

Machiela, Mitchell J; Chanock, Stephen J

2015-11-01

Assessing linkage disequilibrium (LD) across ancestral populations is a powerful approach for investigating population-specific genetic structure as well as functionally mapping regions of disease susceptibility. Here, we present LDlink, a web-based collection of bioinformatic modules that query single nucleotide polymorphisms (SNPs) in population groups of interest to generate haplotype tables and interactive plots. Modules are designed with an emphasis on ease of use, query flexibility, and interactive visualization of results. Phase 3 haplotype data from the 1000 Genomes Project are referenced for calculating pairwise metrics of LD, searching for proxies in high LD, and enumerating all observed haplotypes. LDlink is tailored for investigators interested in mapping common and uncommon disease susceptibility loci by focusing on output linking correlated alleles and highlighting putative functional variants. LDlink is a free and publically available web tool which can be accessed at http://analysistools.nci.nih.gov/LDlink/. mitchell.machiela@nih.gov. Published by Oxford University Press 2015. This work is written by US Government employees and is in the public domain in the US.

Association studies of excision repair cross-complementation group 1 (ERCC1) haplotypes with lung and head and neck cancer risk in a Caucasian population.

PubMed

Jones, Nathan R; Spratt, Thomas E; Berg, Arthur S; Muscat, Joshua E; Lazarus, Philip; Gallagher, Carla J

2011-04-01

The formation of bulky DNA adducts caused by diol epoxide derivatives of polycyclic aromatic hydrocarbons has been associated with tobacco-induced cancers, and inefficient repair of such adducts by the nucleotide excision repair (NER) system has been linked to increased risk of tobacco-induced lung and head and neck (H&N) cancers. The human excision repair cross-complementation group 1 (ERCC1) protein is essential for a functional NER system and genetic variation in ERCC1 may contribute to impaired DNA repair capacity and increased lung and H&N cancer risk. In order to comprehensively capture common genetic variation in the ERCC1 gene, Caucasian data from the International HapMap project was used to assess linkage disequilibrium and choose four tagSNPs (rs1319052, rs3212955, rs3212948, and rs735482) in the ERCC1 gene to genotype 452 lung cancer cases, 175 H&N cancer cases, and 790 healthy controls. Haplotypes were estimated using expectation maximization (EM) algorithm, and haplotype association with cancer was investigated using Haplo.stats software adjusting for known covariates. The genotype and haplotype frequencies matched previous estimates from Caucasians. There was no significant difference in the prevalence of rs1319052, rs3212955, rs3212948, and rs735482 when comparing lung or H&N cancer cases with controls (p-values>0.05). Similarly, there was no association between ERCC1 haplotypes and lung or H&N cancer susceptibility in this Caucasian population (p-values>0.05). No associations were found when stratifying lung cancer cases by histology, sex, smoking status, or smoking intensity. This study suggests that ERCC1 polymorphisms and haplotypes do not play a role in lung and H&N cancer susceptibility in Caucasians. Copyright © 2010 Elsevier Ltd. All rights reserved.

Single nucleotide polymorphism analysis using different colored dye dimer probes

NASA Astrophysics Data System (ADS)

Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter

2006-09-01

Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.

Association study between single nucleotide polymorphisms in promoter region of AVPR1A and Korean autism spectrum disorders.

PubMed

Yang, So Young; Cho, Soo-Churl; Yoo, Hee Jeong; Cho, In Hee; Park, Mira; Kim, Boong-Nyun; Kim, Jae-Won; Shin, Min-Sup; Park, Tae-Won; Son, Jung-Woo; Chung, Un-Sun; Kim, Hyo-Won; Yang, Young-Hui; Kang, Je-Ouk; Kim, Soon Ae

2010-08-02

To determine the association between arginine vasopressin receptor 1A gene (AVPR1A) and autism spectrum disorders (ASDs), we examined 3 single nucleotide polymorphisms (SNPs), namely, rs7294536, rs3759292, and rs10877969, in the promoter region of AVPR1A by using a family-based association test (FBAT) in 151 Korean trios. Our results demonstrated a statistically significant association between autism and SNPs (additive model: rs7294536, chi(2)=9.328, df=2, P=0.002; rs10877969, chi(2)=11.529, df=2, P<0.001) as well as between autism and haplotype analysis (additive model: chi(2)=14.122, df=3, P=0.003). In addition, we found that ADI-R scores calculated by using a diagnostic algorithm for failure to develop peer relationships (A2) were higher in subjects having the AA genotype than in subjects having the AG and GG genotypes of rs7294536. Thus, our study provides evidence for a possible association between these SNPs and the phenotype of ASDs. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

TLR7 single-nucleotide polymorphisms in the 3' untranslated region and intron 2 independently contribute to systemic lupus erythematosus in Japanese women: a case-control association study

PubMed Central

2011-01-01

Introduction The Toll-like receptor 7 (TLR7) gene, encoded on human chromosome Xp22.3, is crucial for type I interferon production. A recent multicenter study in East Asian populations, comprising Chinese, Korean and Japanese participants, identified an association of a TLR7 single-nucleotide polymorphism (SNP) located in the 3' untranslated region (3' UTR), rs3853839, with systemic lupus erythematosus (SLE), especially in males, although some difference was observed among the tested populations. To test whether additional polymorphisms contribute to SLE in Japanese, we systematically analyzed the association of TLR7 with SLE in a Japanese female population. Methods A case-control association study was conducted on eight tag SNPs in the TLR7 region, including rs3853839, in 344 Japanese females with SLE and 274 healthy female controls. Results In addition to rs3853839, two SNPs in intron 2, rs179019 and rs179010, which were in moderate linkage disequilibrium with each other (r2 = 0.53), showed an association with SLE (rs179019: P = 0.016, odds ratio (OR) 2.02, 95% confidence interval (95% CI) 1.15 to 3.54; rs179010: P = 0.018, OR 1.75, 95% CI 1.10 to 2.80 (both under the recessive model)). Conditional logistic regression analysis revealed that the association of the intronic SNPs and the 3' UTR SNP remained significant after we adjusted them for each other. When only the patients and controls carrying the risk genotypes at the 3' UTR SNPpositionwere analyzed, the risk of SLE was significantly increased when the individuals also carried the risk genotypes at both of the intronic SNPs (P = 0.0043, OR 2.45, 95% CI 1.31 to 4.60). Furthermore, the haplotype containing the intronic risk alleles in addition to the 3' UTR risk allele was associated with SLE under the recessive model (P = 0.016, OR 2.37, 95% CI 1.17 to 4.80), but other haplotypes were not associated with SLE. Conclusions The TLR7 intronic SNPs rs179019 and rs179010 are associated with SLE independently of

Two single-nucleotide polymorphisms of the RELN gene and symptom-based and developmental deficits among children and adolescents with autistic spectrum disorders in the Tianjin, China.

PubMed

Wang, Geng-Fu; Ye, Sheng; Gao, Lei; Han, Yu; Guo, Xuan; Dong, Xiao-Peng; Su, Yuan-Yuan; Zhang, Xin

2018-05-10

Increasing evidence has revealed that genetic variants in Reelin (RELN) gene, especially single-nucleotide polymorphisms (SNPs), correlate with autistic spectrum disorders (ASD) risk; however, no consensus have been reached. This study aimed to provide additional evidence for the association between two SNPs of RELN (i.e., rs736707, rs2229864) and ASD risk, as well as the relationship between RELN gene and symptom-based and developmental deficits of ASD patients in Chinese Han children and adolescents. 157 ASD subjects and 256 typical development (TD) controls were genotyped by TaqMan® genotyping assay. ASD patients were assessed by Childhood Autism Rating Scale (CARS), Autism Behavior Checklist (ABC), and Early Childhood Development Questionnaire (ECDQ). We found that SNP rs2229864 was associated with the genetic predisposition of ASD, whereas a negative association between SNP rs2229864 and symptom-based and developmental features was detected. In contrast, RELN rs736707 correlated with the sensory subscale of the ABC, the relating subscale of the ABC and the total score of ABC, although we did not detect a significant association between SNP rs736707 and ASD risk. Furthermore, a significant rs736707-rs2229864 haplotype was detected. Individuals with a CC haplotype were more likely to have ASD, but individuals with a CT haplotype had more chance be TD controls. Further studies using more samples and including more gene variants in RELN are warranted to confirm our results. Copyright © 2018 Elsevier B.V. All rights reserved.

In Vivo Characterization of Human APOA5 Haplotypes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahituv, Nadav; Akiyama, Jennifer; Chapman-Helleboid, Audrey

2006-10-01

Increased plasma triglycerides concentrations are an independent risk factor for cardiovascular disease. Numerous studies support a reproducible genetic association between two minor haplotypes in the human apolipoprotein A5 gene (APOA5) and increased plasma triglyceride concentrations. We thus sought to investigate the effect of these minor haplotypes (APOA5*2 and APOA5*3) on ApoAV plasma levels through the precise insertion of single-copy intact APOA5 haplotypes at a targeted location in the mouse genome. While we found no difference in the amount of human plasma ApoAV in mice containing the common APOA5*1 and minor APOA5*2 haplotype, the introduction of the single APOA5*3 defining allelemore » (19W) resulted in 3-fold lower ApoAV plasma levels consistent with existing genetic association studies. These results indicate that S19W polymorphism is likely to be functional and explain the strong association of this variant with plasma triglycerides supporting the value of sensitive in vivo assays to define the functional nature of human haplotypes.« less

Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

PubMed

Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

2010-11-01

Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

A Simple Sequence Repeat- and Single-Nucleotide Polymorphism-Based Genetic Linkage Map of the Brown Planthopper, Nilaparvata lugens

PubMed Central

Jairin, Jirapong; Kobayashi, Tetsuya; Yamagata, Yoshiyuki; Sanada-Morimura, Sachiyo; Mori, Kazuki; Tashiro, Kosuke; Kuhara, Satoru; Kuwazaki, Seigo; Urio, Masahiro; Suetsugu, Yoshitaka; Yamamoto, Kimiko; Matsumura, Masaya; Yasui, Hideshi

2013-01-01

In this study, we developed the first genetic linkage map for the major rice insect pest, the brown planthopper (BPH, Nilaparvata lugens). The linkage map was constructed by integrating linkage data from two backcross populations derived from three inbred BPH strains. The consensus map consists of 474 simple sequence repeats, 43 single-nucleotide polymorphisms, and 1 sequence-tagged site, for a total of 518 markers at 472 unique positions in 17 linkage groups. The linkage groups cover 1093.9 cM, with an average distance of 2.3 cM between loci. The average number of marker loci per linkage group was 27.8. The sex-linkage group was identified by exploiting X-linked and Y-specific markers. Our linkage map and the newly developed markers used to create it constitute an essential resource and a useful framework for future genetic analyses in BPH. PMID:23204257

A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

PubMed

Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

2006-04-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.

Association of ESR1 gene tagging SNPs with breast cancer risk

PubMed Central

Dunning, Alison M.; Healey, Catherine S.; Baynes, Caroline; Maia, Ana-Teresa; Scollen, Serena; Vega, Ana; Rodríguez, Raquel; Barbosa-Morais, Nuno L.; Ponder, Bruce A.J.; Low, Yen-Ling; Bingham, Sheila; Haiman, Christopher A.; Le Marchand, Loic; Broeks, Annegien; Schmidt, Marjanka K.; Hopper, John; Southey, Melissa; Beckmann, Matthias W.; Fasching, Peter A.; Peto, Julian; Johnson, Nichola; Bojesen, Stig E.; Nordestgaard, Børge; Milne, Roger L.; Benitez, Javier; Hamann, Ute; Ko, Yon; Schmutzler, Rita K.; Burwinkel, Barbara; Schürmann, Peter; Dörk, Thilo; Heikkinen, Tuomas; Nevanlinna, Heli; Lindblom, Annika; Margolin, Sara; Mannermaa, Arto; Kosma, Veli-Matti; Chen, Xiaoqing; Spurdle, Amanda; Change-Claude, Jenny; Flesch-Janys, Dieter; Couch, Fergus J.; Olson, Janet E.; Severi, Gianluca; Baglietto, Laura; Børresen-Dale, Anne-Lise; Kristensen, Vessela; Hunter, David J.; Hankinson, Susan E.; Devilee, Peter; Vreeswijk, Maaike; Lissowska, Jolanta; Brinton, Louise; Liu, Jianjun; Hall, Per; Kang, Daehee; Yoo, Keun-Young; Shen, Chen-Yang; Yu, Jyh-Cherng; Anton-Culver, Hoda; Ziogoas, Argyrios; Sigurdson, Alice; Struewing, Jeff; Easton, Douglas F.; Garcia-Closas, Montserrat; Humphreys, Manjeet K.; Morrison, Jonathan; Pharoah, Paul D.P.; Pooley, Karen A.; Chenevix-Trench, Georgia

2009-01-01

We have conducted a three-stage, comprehensive single nucleotide polymorphism (SNP)-tagging association study of ESR1 gene variants (SNPs) in more than 55 000 breast cancer cases and controls from studies within the Breast Cancer Association Consortium (BCAC). No large risks or highly significant associations were revealed. SNP rs3020314, tagging a region of ESR1 intron 4, is associated with an increase in breast cancer susceptibility with a dominant mode of action in European populations. Carriers of the c-allele have an odds ratio (OR) of 1.05 [95% Confidence Intervals (CI) 1.02–1.09] relative to t-allele homozygotes, P = 0.004. There is significant heterogeneity between studies, P = 0.002. The increased risk appears largely confined to oestrogen receptor-positive tumour risk. The region tagged by SNP rs3020314 contains sequence that is more highly conserved across mammalian species than the rest of intron 4, and it may subtly alter the ratio of two mRNA splice forms. PMID:19126777

PAX6 Haplotypes Are Associated with High Myopia in Han Chinese

PubMed Central

Jiang, Bo; Yap, Maurice K. H.; Leung, Kim Hung; Ng, Po Wah; Fung, Wai Yan; Lam, Wai Wa; Gu, Yang-shun; Yip, Shea Ping

2011-01-01

Background The paired box 6 (PAX6) gene is considered as a master gene for eye development. Linkage of myopia to the PAX6 region on chromosome 11p13 was shown in several studies, but the results for association between myopia and PAX6 were inconsistent so far. Methodology/Principal Findings We genotyped 16 single nucleotide polymorphisms (SNPs) in the PAX6 gene and its regulatory regions in an initial study for 300 high myopia cases and 300 controls (Group 1), and successfully replicated the positive results with another independent group of 299 high myopia cases and 299 controls (Group 2). Five SNPs were genotyped in the replication study. The spherical equivalent of subjects with high myopia was ≤−8.0 dioptres. The PLINK package was used for genetic data analysis. No association was found between each of the SNPs and high myopia. However, exhaustive sliding-window haplotype analysis highlighted an important role for rs12421026 because haplotypes containing this SNP were found to be associated with high myopia. The most significant results were given by the 4-SNP haplotype window consisting of rs2071754, rs3026393, rs1506 and rs12421026 (P = 3.54×10−10, 4.06×10−11 and 1.56×10−18 for Group 1, Group 2 and Combined Group, respectively) and the 3-SNP haplotype window composed of rs3026393, rs1506 and rs12421026 (P = 5.48×10−10, 7.93×10−12 and 6.28×10−23 for the three respective groups). The results remained significant after correction for multiple comparisons by permutations. The associated haplotyes found in a previous study were also successfully replicated in this study. Conclusions/Significance PAX6 haplotypes are associated with susceptibility to the development of high myopia in Chinese. The PAX6 locus plays a role in high myopia. PMID:21589860

Osmium Tag for Posttranscriptionally Modified RNA.

PubMed

Debnath, Turja Kanti; Okamoto, Akimitsu

2018-05-25

Nucleotide modifications of cellular RNA are highly abundant and diverse, but their origin and functions have not yet been investigated. 5-Methylcytidine (m5C) and 5-methyluridine (m5U) are highly abundant posttranscriptionally modified nucleotides observed in various natural RNAs. Such nucleotides have been labeled through a chemical approach as both undergo oxidation at the C5-C6 double bond, leading to the formation of osmium-bipyridine complexes, which are identified by mass spectrometry. This osmium tag made it possible to distinguished m5C and m5U from their isomers 2'-O-methylcytidine and 2'-O-methyluridine, respectively. Queuosine and 2-methylthio-N6-isopentenyladenosine in tRNA were also tagged through this complex formation--this is the first time that this has ever been achieved. Osmylation has emerged as a structure-selective reaction and largely governed by the environment of the target site (the steric and higher order structure), therefore it could be helpful for studying the structure and dynamics of RNA-protein interactions. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Electrical detection and quantification of single and mixed DNA nucleotides in suspension

NASA Astrophysics Data System (ADS)

Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

2016-09-01

High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

Theoretical underpinning of the single-molecule-dilution (SMD) method of direct haplotype resolution.

PubMed Central

Stephens, J C; Rogers, J; Ruano, G

1990-01-01

In a recent paper we have shown that DNA haplotypes of multiply heterozygous individuals can be resolved directly by polymerase-chain-reaction (PCR) amplification of a single molecule of genomic template. Our method (the single-molecule-dilution [SMD] method) relies on the stochastic separation of maternal and paternal alleles at high dilution. The stochasticity of separation and the potential for DNA shearing (which could separate the loci of interest) are two factors that can compromise the results of the experiment. This paper explores the consequences of these two factors and shows that the SMD method can be expected to work very reliably even in the presence of a moderate amount of DNA shearing. PMID:2339707

Detecting local haplotype sharing and haplotype association

USDA-ARS?s Scientific Manuscript database

A novel haplotype association method is presented, and its power is demonstrated. Relying on a statistical model for linkage disequilibrium (LD), the method first infers ancestral haplotypes and their loadings at each marker for each individual. The loadings are then used to quantify local haplotype...

Detecting associated single-nucleotide polymorphisms on the X chromosome in case control genome-wide association studies.

PubMed

Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen

2017-04-01

In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.

Prospects for inferring pairwise relationships with single nucleotide polymorphisms

Treesearch

Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

2003-01-01

An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

No association between polymorphisms/haplotypes of the vascular endothelial growth factor gene and preeclampsia

PubMed Central

2011-01-01

Background Preeclampsia (PE) is the first worldwide cause of death in pregnant women, intra-uterine growth retardation, and fetal prematurity. Some vascular endothelial grown factor gene (VEGF) polymorphisms have been associated to PE and other pregnancy disturbances. We evaluated the associations between VEGF genotypes/haplotypes and PE in Mexican women. Methods 164 pregnant women were enrolled in a case-control study (78 cases and 86 normotensive pregnant controls). The rs699947 (-2578C/A), rs1570360 (-1154G/A), rs2010963 (+405G/C), and rs25648 (-7C/T), VEGF variants were discriminated using Polymerase Chain Reaction - Restriction Fragment Length Polymorphism (PCR-RFLP) methods or Taqman single nucleotide polymorphism (SNP) assays. Results The proportions of the minor allele for rs699947, rs1570360, rs2010963, and rs25648 VEGF SNPs were 0.33, 0.2, 0.39, and 0.17 in controls, and 0.39, 0.23, 0.41, and 0.15 in cases, respectively (P values > 0.05). The most frequent haplotypes of rs699947, rs1570360, rs2010963, and rs25648 VEGF SNPs, were C-G-C-C and C-G-G-C with frequencies of 0.39, 0.21 in cases and 0.37, 0.25 in controls, respectively (P values > 0.05) Conclusion There was no evidence of an association between VEGF alleles, genotypes, or haplotypes frequencies and PE in our study. PMID:21575227

Genetic Variants in PNPLA3 and Risk of Non-Alcoholic Fatty Liver Disease in a Han Chinese Population

PubMed Central

Lin, Shao-Wei; Lu, Qing-Qing; Hu, Zhi-Jian; Lin, Xu

2012-01-01

We investigated the possible association between genetic variants in the Patatin like phospholipase-3 (PNPLA3) gene and nonalcoholic fatty liver disease (NAFLD) in a Han Chinese population. We evaluated twelve tagging single-nucleotide polymorphisms (tSNPs) of the PNPLA3 gene in a frequency matched case–control study from Fuzhou city of China (553 cases, 553 controls). In the multivariate logistic regression analysis, the rs738409 GG or GC, and rs139051 TT genotypes were found to be associated with increased risk of NAFLD, and a significant trend of increased risk with increasing numbers of risk genotype was observed in the cumulative effect analysis of these single nucleotide polymorphisms. Furthermore, haplotype association analysis showed that, compared with the most common haplotype, the CAAGAATGCGTG and CGAAGGTGTCCG haplotypes conferred a statistically significant increased risk for NAFLD, while the CGGGAACCCGCG haplotype decreased the risk of NAFLD. Moreover, rs738409 C>G appeared to have a multiplicative joint effect with tea drinking (P<0.005) and an additive joint effect with obesity (Interaction contrast ratio (ICR) = 2.31, 95% CI: 0.7–8.86), hypertriglyceridemia (ICR = 3.07, 95% CI: 0.98–5.09) or hypertension (ICR = 1.74, 95% CI: 0.52–3.12). Our data suggests that PNPLA3 genetic polymorphisms might influence the susceptibility to NAFLD development independently or jointly in Han Chinese. PMID:23226254

Inverse correlation between HPSE gene single nucleotide polymorphisms and heparanase expression: possibility of multiple levels of heparanase regulation

PubMed Central

Ostrovsky, Olga; Korostishevsky, Michael; Shafat, Itay; Mayorov, Margarita; Ilan, Neta; Vlodavsky, Israel; Nagler, Arnon

2009-01-01

Heparanase is an endo-β-glucuronidase that specifically cleaves the saccharide chains of heparan sulfate proteoglycans. Heparanase plays important roles in processes such as angiogenesis, tumor metastasis, tissue repair and remodeling, inflammation and autoimmunity. Genetic variations of the heparanase gene (HPSE) have been associated with heparanase transcription level. The present study was undertaken to identify haplotype or single nucleotide polymorphisms (SNPs) genotype combinations that correlate with heparanase expression both at the mRNA and protein levels. For this purpose, 11 HPSE gene SNPs were genotyped among 108 healthy individuals. Five out of the eleven polymorphisms revealed an association between the SNPs and heparanase expression. SNP rs4693608 exhibited a strong evidence of association. Analysis of haplotypes distribution revealed that the combination of two SNPs (rs4693608 and rs4364254) disclosed the most significant result. This approach allowed segregation of possible genotype combinations to three groups that correlate with low (LR: GG-CC, GG-CT, GG-TT, GA-CC), intermediate (MR: GA-CT, GA-TT) and high (HR: AA-TT, AA-CT) heparanase expression. Unexpectedly, LR genotype combinations were associated with low mRNA expressions level and high heparanase concentration in plasma, while HR genotype combinations were associated with high expression of mRNA and low plasma protein level. Because the main site of activity of secreted active heparanase is the extracellular matrix and cell surface, the origin and functional significance of plasma heparanase remain to be investigated. The current study indicates that rs4693608 and rs4364254 SNPs are involved in the regulation of heparanase expression and provides the basis for further studies on the association between HPSE gene SNPs and disease outcome. PMID:19406828

Identification of relevant single-nucleotide polymorphisms in Pneumocystis jirovecii: relationship with clinical data.

PubMed

Esteves, F; Gaspar, J; Marques, T; Leite, R; Antunes, F; Mansinho, K; Matos, O

2010-07-01

Pneumocystis jirovecii is a poorly understood pathogen that causes opportunistic pneumonia (Pneumocystis pneumonia (PcP)) in patients with AIDS. The present study was aimed at correlating genetic differences in P. jirovecii isolates and clinical patient data. A description of genetic diversity in P. jirovecii isolates from human immunodeficiency virus-positive patients, based on the identification of multiple single-nucleotide polymorphisms (SNPs) at five distinct loci encoding mitochondrial large-subunit rRNA (mtLSU rRNA), cytochrome b (CYB), superoxide dismutase (SOD), dihydrofolate reductase (DHFR), and dihydropteroate synthase (DHPS), was achieved using PCR with DNA sequencing and restriction fragment length polymorphism analysis. The statistical analysis revealed several interesting correlations among the four most relevant SNPs (mt85, SOD110, SOD215, and DHFR312) and specific clinical parameters: mt85C was associated with undiagnosed or atypical PcP episodes and favourable follow-up; SOD215C was associated with favourable follow-up; and DHFR312T was associated with PcP cases presenting moderate to high parasite burdens. The genotypes mt85C/SOD215C and SOD110T/SOD215C were found to be associated with less virulent P. jirovecii infections, whereas the genotype SOD110T/SOD215T was found to be related to more virulent PcP episodes. The present work demonstrated that potential P. jirovecii haplotypes may be related to the clinical data and outcome of PcP.

Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

PubMed

Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

2017-04-18

Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

Globally dispersed Y chromosomal haplotypes in wild and domestic sheep.

PubMed

Meadows, J R S; Hanotte, O; Drögemüller, C; Calvo, J; Godfrey, R; Coltman, D; Maddox, J F; Marzanov, N; Kantanen, J; Kijas, J W

2006-10-01

To date, investigations of genetic diversity and the origins of domestication in sheep have utilised autosomal microsatellites and variation in the mitochondrial genome. We present the first analysis of both domestic and wild sheep using genetic markers residing on the ovine Y chromosome. Analysis of a single nucleotide polymorphism (oY1) in the SRY promoter region revealed that allele A-oY1 was present in all wild bighorn sheep (Ovis canadensis), two subspecies of thinhorn sheep (Ovis dalli), European Mouflon (Ovis musimon) and the Barbary (Ammontragis lervia). A-oY1 also had the highest frequency (71.4%) within 458 domestic sheep drawn from 65 breeds sampled from Africa, Asia, Australia, the Caribbean, Europe, the Middle East and Central Asia. Sequence analysis of a second locus, microsatellite SRYM18, revealed a compound repeat array displaying fixed differences, which identified bighorn and thinhorn sheep as distinct from the European Mouflon and domestic animals. Combined genotypic data identified 11 male-specific haplotypes that represented at least two separate lineages. Investigation of the geographical distribution of each haplotype revealed that one (H6) was both very common and widespread in the global sample of domestic breeds. The remaining haplotypes each displayed more restricted and informative distributions. For example, H5 was likely founded following the domestication of European breeds and was used to trace the recent transportation of animals to both the Caribbean and Australia. A high rate of Y chromosomal dispersal appears to have taken place during the development of domestic sheep as only 12.9% of the total observed variation was partitioned between major geographical regions.

Frequency distribution of interleukin-10 haplotypes (-1082 A>G, -819 C>T, and -592 C>A) in a Mexican population.

PubMed

Vázquez-Villamar, M; Palafox-Sánchez, C A; Hernández-Bello, J; Muñoz-Valle, J F; Valle, Y; Cruz, A; Alatorre-Meza, A I; Oregon-Romero, E

2016-11-03

Interleukin 10 (IL-10) is an immunoregulatory cytokine with multiple roles in the immune system. Three single nucleotide polymorphisms at positions -1082 (A>G), -819 (C>T), and -592 (C>A) in the promoter region of the IL10 gene are believed to be associated with different inflammatory, infectious, and autoimmune diseases. These polymorphisms exhibit a strong linkage disequilibrium (LD) and form three principal haplotypes (GCC, ACC, and ATA). The GCC and ATA haplotypes have been associated with high and low levels of IL-10 production, respectively. The aim of this study was to establish the allele and haplotype frequencies of the IL10 polymorphisms in Mestizos from western Mexico. SNPs were analyzed in 340 healthy unrelated Mestizos from western Mexico by polymerase chain reaction-restriction fragment length polymorphism. The studied population presented significant differences, in the distribution of IL10 polymorphisms, from the Asian, African, and European populations. We also observed a strong LD within -1082 A>G, -819 C>T, and -592 C>A (100% pc = 7.735 x 10 -18 ). The haplotypes ACC (45.4%), ATA (22.0%), GTA (14.9%), and GCC (13.9%) were most frequently observed in this population. The haplotype frequencies, however, differed from those reported previously in Mestizos from central Mexico, Asians, Africans, and European Caucasians, suggesting a differential gene flow in the Mexican Mestizo population. This could account for the genetic variability between Mexicans and populations of other ethnicities. The study of these polymorphisms and their haplotypes could help in expanding our knowledge to design future disease-risk studies on the western Mexican population.

Single-molecule comparison of DNA Pol I activity with native and analog nucleotides

NASA Astrophysics Data System (ADS)

Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip

2014-03-01

DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.

Analysis of Shared Haplotypes amongst Palauans Maps Loci for Psychotic Disorders to 4q28 and 5q23-q31.

PubMed

Bodea, Corneliu A; Middleton, Frank A; Melhem, Nadine M; Klei, Lambertus; Song, Youeun; Tiobech, Josepha; Marumoto, Pearl; Yano, Victor; Faraone, Stephen V; Roeder, Kathryn; Myles-Worsley, Marina; Devlin, Bernie; Byerley, William

2017-02-01

To localize genetic variation affecting risk for psychotic disorders in the population of Palau, we genotyped DNA samples from 203 Palauan individuals diagnosed with psychotic disorders, broadly defined, and 125 control subjects using a genome-wide single nucleotide polymorphism array. Palau has unique features advantageous for this study: due to its population history, Palauans are substantially interrelated; affected individuals often, but not always, cluster in families; and we have essentially complete ascertainment of affected individuals. To localize risk variants to genomic regions, we evaluated long-shared haplotypes, ≥10 Mb, identifying clusters of affected individuals who share such haplotypes. This extensive sharing, typically identical by descent, was significantly greater in cases than population controls, even after controlling for relatedness. Several regions of the genome exhibited substantial excess of shared haplotypes for affected individuals, including 3p21, 3p12, 4q28, and 5q23-q31. Two of these regions, 4q28 and 5q23-q31, showed significant linkage by traditional LOD score analysis and could harbor variants of more sizeable risk for psychosis or a multiplicity of risk variants. The pattern of haplotype sharing in 4q28 highlights PCDH10 , encoding a cadherin-related neuronal receptor, as possibly involved in risk.

A risk PRODH haplotype affects sensorimotor gating, memory, schizotypy, and anxiety in healthy male subjects.

PubMed

Roussos, Panos; Giakoumaki, Stella G; Bitsios, Panos

2009-06-15

Significant associations have been shown for haplotypes comprising three PRODH single nucleotide polymorphisms (SNPs; 1945T/C, 1766A/G, 1852G/A) located in the 3' region of the gene, suggesting a role of these variants in the etiopathogenesis of schizophrenia. We assessed the relationship between these high-risk PRODH polymorphisms and schizophrenia-related endophenotypes in a large and highly homogeneous cohort of healthy males. Participants (n = 217) were tested in prepulse inhibition (PPI), verbal and working memory, trait anxiety and schizotypy. The QTPHASE from the UNPHASED package was used for the association analysis of each SNP or haplotype data. This procedure revealed significant phenotypic impact of the risk CGA haplotype. Subjects were then divided in two groups; levels of PPI, anxiety, and schizotypy, verbal and working memory were compared with analysis of variance. CGA carriers (n = 32) exhibited attenuated PPI (p < .001) and verbal memory (p < .001) and higher anxiety (p < .004) and schizotypy (p < .008) compared with the noncarriers (n = 185). There were no differences in baseline startle, demographics, and working memory. The main significant correlations were schizotypy x PPI [85-dB, 120-msec trials] in the carriers and schizotypy x anxiety in the entire group and the noncarriers but not the carriers group. Our results strongly support PPI as a valid schizophrenia endophenotype and highlight the importance of examining the role of risk haplotypes on multiple endophenotypes and have implications for understanding the continuum from normality to psychosis, transitional states, and the genetics of schizophrenia-related traits.

Analysis of single nucleotide polymorphisms in case-control studies.

PubMed

Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

2011-01-01

Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

The Association of a Novel Haplotype in the Dopamine Transporter with Preschool Age Posttraumatic Stress Disorder

PubMed Central

Brett, Zoë H.; Henry, Caitlin; Scheeringa, Michael

2013-01-01

Abstract Objective Significant evidence supports a genetic contribution to the development of posttraumatic stress disorder (PTSD). Three previous studies have demonstrated an association between PTSD and the nine repeat allele of the 3′ untranslated region (3′UTR) variable number tandem repeat (VNTR) in the dopamine transporter (DAT, rs28363170). Recently a novel, functionally significant C/T single-nucleotide polymorphism (SNP) in the 3′UTR (rs27072) with putative interactions with the 3′VNTR, has been identified. To provide enhanced support for the role of DAT and striatal dopamine regulation in the development of PTSD, this study examined the impact of a haplotype defined by the C allele of rs27072 and the nine repeat allele of the 3′VNTR on PTSD diagnosis in young trauma-exposed children. Methods DAT haplotypes were determined in 150 trauma-exposed 3–6 year-old children. PTSD was assessed with a semistructured interview. After excluding double heterozygotes, analysis was performed on 143 total subjects. Haplotype was examined in relation to categorical and continuous measures of PTSD, controlling for trauma type and race. Additional analysis within the two largest race categories was performed, as other means of controlling for ethnic stratification were not available. Results The number of haplotypes (0, 1, or 2) defined by the presence of the nine repeat allele of rs28363170 (VNTR in the 3′UTR) and the C allele of rs27072 (SNP in the 3′UTR) was significantly associated with both the diagnosis of PTSD and total PTSD symptoms. Specifically, children with one or two copies of the haplotype had significantly more PTSD symptoms and were more likely to be diagnosed with PTSD than were children without this haplotype. Conclusions These findings extend previous findings associating genetic variation in the DAT with PTSD. The association of a haplotype in DAT with PTSD provides incremental traction for a model of genetic vulnerability to PTSD, a

[Association between the methylenetetrahydrofolate reductase gene polymorphisms and haplotype with toxicity response of high dose methotrexate chemotherapy].

PubMed

Liao, Qing-Chuan; Li, Xiao-Lei; Liu, Si-Ting; Zhang, Yong; Li, Tian-Yuan; Qiu, Jin-Chun

2012-07-01

To investigate the association between single nucleotide polymorphisms (SNP) and its haplotypes of methylenetetrahydrofolate reductase (MTHFR) gene with high dose methotrexate (HDMTX)-induced toxicity in children with acute lymphoblastic leukemia (ALL). HDMTX-treated children with ALL (1.2 to 14-years old) were selected from inpatient and followed for a retrospective study. The toxicity response of HDMTX chemotherapy was evaluated using WHO common toxicity criteria. Sixty-one patients with therapy-related toxicity and 36 patients without therapy-related toxicity were genotyped for 2 SNP (677C > T and 1298A > C) of the MTHFR gene by polymerase chain reaction-restriction fragment length polymorphism. Frequency of haplotypes and linkage disequilibrium of MTHFR gene were analyzed by SHEsis program. The distribution of MTHFR gene 677C > T polymorphism did not appeare different between groups with or without toxicity response (χ(2) = 4.609, P = 0.100), but the 1298A > C polymorphism was significantly different (χ(2) = 10.192, P = 0.006). Individuals who carried C allele (AC + CC genotype) had a decreased risk of toxicity response compared to AA genotype (OR = 0.245, 95%CI: 0.099 - 0.607, P = 0.002). 677C > T and 1298A > C polymorphisms showed strong linkage disequilibrium (D' = 0.895). The CC haplotype was significantly associated with decreased risk of toxicity response (OR = 0.338, 95%CI: 0.155 - 0.738, P = 0.005), while the TA haplotype was significantly associated with the increased risk of toxicity response (OR = 1.907, 95%CI: 1.045 - 3.482, P = 0.035). MTHFR gene 1298C allele and CC haplotype might serve as protective factors while TA haplotype as a risk factor for the susceptibility to toxicity response of HDMTX chemotherapy in children with ALL.

Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

USDA-ARS?s Scientific Manuscript database

We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

efficient association study design via power-optimized tag SNP selection

PubMed Central

HAN, BUHM; KANG, HYUN MIN; SEO, MYEONG SEONG; ZAITLEN, NOAH; ESKIN, ELEAZAR

2008-01-01

Discovering statistical correlation between causal genetic variation and clinical traits through association studies is an important method for identifying the genetic basis of human diseases. Since fully resequencing a cohort is prohibitively costly, genetic association studies take advantage of local correlation structure (or linkage disequilibrium) between single nucleotide polymorphisms (SNPs) by selecting a subset of SNPs to be genotyped (tag SNPs). While many current association studies are performed using commercially available high-throughput genotyping products that define a set of tag SNPs, choosing tag SNPs remains an important problem for both custom follow-up studies as well as designing the high-throughput genotyping products themselves. The most widely used tag SNP selection method optimizes over the correlation between SNPs (r2). However, tag SNPs chosen based on an r2 criterion do not necessarily maximize the statistical power of an association study. We propose a study design framework that chooses SNPs to maximize power and efficiently measures the power through empirical simulation. Empirical results based on the HapMap data show that our method gains considerable power over a widely used r2-based method, or equivalently reduces the number of tag SNPs required to attain the desired power of a study. Our power-optimized 100k whole genome tag set provides equivalent power to the Affymetrix 500k chip for the CEU population. For the design of custom follow-up studies, our method provides up to twice the power increase using the same number of tag SNPs as r2-based methods. Our method is publicly available via web server at http://design.cs.ucla.edu. PMID:18702637

HapMap tagSNP transferability in multiple populations: general guidelines

PubMed Central

Xing, Jinchuan; Witherspoon, David J.; Watkins, W. Scott; Zhang, Yuhua; Tolpinrud, Whitney; Jorde, Lynn B.

2008-01-01

This PDF receipt will only be used as the basis for generating PubMed Central (PMC) documents. PMC documents will be made available for review after conversion (approx. 2–3 weeks time). Any corrections that need to be made will be done at that time. No materials will be released to PMC without the approval of an author. Only the PMC documents will appear on PubMed Central -- this PDF Receipt will not appear on PubMed Central. Linkage disequilibrium (LD) has received much recent attention because of its value in localizing disease-causing genes. Due to the extensive LD between neighboring loci in the human genome, it is believed that a subset of the single nucleotide polymorphisms in a region (tagSNPs) can be selected to capture most of the remaining SNP variants. In this study, we examined LD patterns and HapMap tagSNP transferability in more than 300 individuals. A South Indian and an African Mbuti Pygmy population sample were included to evaluate the performance of HapMap tagSNPs in geographically distinct and genetically isolated populations. Our results show that HapMap tagSNPs selected with r2 >= 0.8 can capture more than 85% of the SNPs in populations that are from the same continental group. Combined tagSNPs from HapMap CEU and CHB+JPT serve as the best reference for the Indian sample. The HapMap YRI are a sufficient reference for tagSNP selection in the Pygmy sample. In addition to our findings, we reviewed over 25 recent studies of tagSNP transferability and propose a general guideline for selecting tagSNPs from HapMap populations. PMID:18482828

[Single nucleotide polymorphism and its application in allogeneic hematopoietic stem cell transplantation--review].

PubMed

Li, Su-Xia

2004-12-01

Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.

Identification of a psoriasis susceptibility candidate gene by linkage disequilibrium mapping with a localized single nucleotide polymorphism map.

PubMed

Hewett, Duncan; Samuelsson, Lena; Polding, Joanne; Enlund, Fredrik; Smart, Devi; Cantone, Kathryn; See, Chee Gee; Chadha, Sapna; Inerot, Annica; Enerback, Charlotta; Montgomery, Doug; Christodolou, Chris; Robinson, Phil; Matthews, Paul; Plumpton, Mary; Wahlstrom, Jan; Swanbeck, Gunnar; Martinsson, Tommy; Roses, Allen; Riley, John; Purvis, Ian

2002-03-01

Psoriasis is a chronic inflammatory disease of the skin with both genetic and environmental risk factors. Here we describe the creation of a single-nucleotide polymorphism (SNP) map spanning 900-1200 kb of chromosome 3q21, which had been previously recognized as containing a psoriasis susceptibility locus, PSORS5. We genotyped 644 individuals, from 195 Swedish psoriatic families, for 19 polymorphisms. Linkage disequilibrium (LD) between marker and disease was assessed using the transmission/disequilibrium test (TDT). In the TDT analysis, alleles of three of these SNPs showed significant association with disease (P<0.05). A 160-kb interval encompassing these three SNPs was sequenced, and a coding sequence consisting of 13 exons was identified. The predicted protein shares 30-40% homology with the family of cation/chloride cotransporters. A five-marker haplotype spanning the 3' half of this gene is associated with psoriasis to a P value of 3.8<10(-5). We have called this gene SLC12A8, coding for a member of the solute carrier family 12 proteins. It belongs to a class of genes that were previously unrecognized as playing a role in psoriasis pathogenesis.

Haplotypes in SLC24A5 Gene as Ancestry Informative Markers in Different Populations

PubMed Central

Giardina, Emiliano; Pietrangeli, Ilenia; Martínez-Labarga, Cristina; Martone, Claudia; de Angelis, Flavio; Spinella, Aldo; De Stefano, Gianfranco; Rickards, Olga; Novelli, Giuseppe

2008-01-01

Ancestry informative markers (AIMs) are human polymorphisms that exhibit substantially allele frequency differences among populations. These markers can be useful to provide information about ancestry of samples which may be useful in predicting a perpetrator’s ethnic origin to aid criminal investigations. Variations in human pigmentation are the most obvious phenotypes to distinguish individuals. It has been recently shown that the variation of a G in an A allele of the coding single-nucleotide polymorphism (SNP) rs1426654 within SLC24A5 gene varies in frequency among several population samples according to skin pigmentation. Because of these observations, the SLC24A5 locus has been evaluated as Ancestry Informative Region (AIR) by typing rs1426654 together with two additional intragenic markers (rs2555364 and rs16960620) in 471 unrelated individuals originating from three different continents (Africa, Asia and Europe). This study further supports the role of human SLC24A5 gene in skin pigmentation suggesting that variations in SLC24A5 haplotypes can correlate with human migration and ancestry. Furthermore, our data do reveal the utility of haplotype and combined unphased genotype analysis of SLC24A5 in predicting ancestry and provide a good example of usefulness of genetic characterization of larger regions, in addition to single polymorphisms, as candidates for population-specific sweeps in the ancestral population. PMID:19440451

OmpF, a nucleotide-sensing nanoprobe, computational evaluation of single channel activities

NASA Astrophysics Data System (ADS)

Abdolvahab, R. H.; Mobasheri, H.; Nikouee, A.; Ejtehadi, M. R.

2016-09-01

The results of highthroughput practical single channel experiments should be formulated and validated by signal analysis approaches to increase the recognition precision of translocating molecules. For this purpose, the activities of the single nano-pore forming protein, OmpF, in the presence of nucleotides were recorded in real time by the voltage clamp technique and used as a means for nucleotide recognition. The results were analyzed based on the permutation entropy of current Time Series (TS), fractality, autocorrelation, structure function, spectral density, and peak fraction to recognize each nucleotide, based on its signature effect on the conductance, gating frequency and voltage sensitivity of channel at different concentrations and membrane potentials. The amplitude and frequency of ion current fluctuation increased in the presence of Adenine more than Cytosine and Thymine in milli-molar (0.5 mM) concentrations. The variance of the current TS at various applied voltages showed a non-monotonic trend whose initial increasing slope in the presence of Thymine changed to a decreasing one in the second phase and was different from that of Adenine and Cytosine; e.g., by increasing the voltage from 40 to 140 mV in the 0.5 mM concentration of Adenine or Cytosine, the variance decreased by one third while for the case of Thymine it was doubled. Moreover, according to the structure function of TS, the fractality of current TS differed as a function of varying membrane potentials (pd) and nucleotide concentrations. Accordingly, the calculated permutation entropy of the TS, validated the biophysical approach defined for the recognition of different nucleotides at various concentrations, pd's and polarities. Thus, the promising outcomes of the combined experimental and theoretical methodologies presented here can be implemented as a complementary means in pore-based nucleotide recognition approaches.

BMP4 and FGF3 haplotypes increase the risk of tendinopathy in volleyball athletes.

PubMed

Salles, José Inácio; Amaral, Marcus Vinícius; Aguiar, Diego Pinheiro; Lira, Daisy Anne; Quinelato, Valquiria; Bonato, Letícia Ladeira; Duarte, Maria Eugenia Leite; Vieira, Alexandre Rezende; Casado, Priscila Ladeira

2015-03-01

To investigate whether genetic variants can be correlated with tendinopathy in elite male volleyball athletes. Case-control study. Fifteen single nucleotide polymorphisms within BMP4, FGF3, FGF10, FGFR1 genes were investigated in 138 elite volleyball athletes, aged between 18 and 35 years, who undergo 4-5h of training per day: 52 with tendinopathy and 86 with no history of pain suggestive of tendinopathy in patellar, Achilles, shoulder, and hip abductors tendons. The clinical diagnostic criterion was progressive pain during training, confirmed by magnetic resonance image. Genomic DNA was obtained from saliva samples. Genetic markers were genotyped using TaqMan real-time PCR. Chi-square test compared genotypes and haplotype differences between groups. Multivariate logistic regression analyzed the significance of covariates and incidence of tendinopathy. Statistical analysis revealed participant age (p=0.005) and years of practice (p=0.004) were risk factors for tendinopathy. A significant association between BMP4 rs2761884 (p=0.03) and tendinopathy was observed. Athletes with a polymorphic genotype have 2.4 times more susceptibility to tendinopathy (OR=2.39; 95%CI=1.10-5.19). Also, association between disease and haplotype TTGGA in BMP4 (p=0.01) was observed. The FGF3 TGGTA haplotype showed a tendency of association with tendinopathy (p=0.05), and so did FGF10 rs900379. FGFR1 showed no association with disease. These findings indicate that haplotypes in BMP4 and FGF3 genes may contribute to the tendon disease process in elite volleyball athletes. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

NASA Astrophysics Data System (ADS)

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-04-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

PubMed Central

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-01-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928

Canis mtDNA HV1 database: a web-based tool for collecting and surveying Canis mtDNA HV1 haplotype in public database.

PubMed

Thai, Quan Ke; Chung, Dung Anh; Tran, Hoang-Dung

2017-06-26

Canine and wolf mitochondrial DNA haplotypes, which can be used for forensic or phylogenetic analyses, have been defined in various schemes depending on the region analyzed. In recent studies, the 582 bp fragment of the HV1 region is most commonly used. 317 different canine HV1 haplotypes have been reported in the rapidly growing public database GenBank. These reported haplotypes contain several inconsistencies in their haplotype information. To overcome this issue, we have developed a Canis mtDNA HV1 database. This database collects data on the HV1 582 bp region in dog mitochondrial DNA from the GenBank to screen and correct the inconsistencies. It also supports users in detection of new novel mutation profiles and assignment of new haplotypes. The Canis mtDNA HV1 database (CHD) contains 5567 nucleotide entries originating from 15 subspecies in the species Canis lupus. Of these entries, 3646 were haplotypes and grouped into 804 distinct sequences. 319 sequences were recognized as previously assigned haplotypes, while the remaining 485 sequences had new mutation profiles and were marked as new haplotype candidates awaiting further analysis for haplotype assignment. Of the 3646 nucleotide entries, only 414 were annotated with correct haplotype information, while 3232 had insufficient or lacked haplotype information and were corrected or modified before storing in the CHD. The CHD can be accessed at http://chd.vnbiology.com . It provides sequences, haplotype information, and a web-based tool for mtDNA HV1 haplotyping. The CHD is updated monthly and supplies all data for download. The Canis mtDNA HV1 database contains information about canine mitochondrial DNA HV1 sequences with reconciled annotation. It serves as a tool for detection of inconsistencies in GenBank and helps identifying new HV1 haplotypes. Thus, it supports the scientific community in naming new HV1 haplotypes and to reconcile existing annotation of HV1 582 bp sequences.

Top single nucleotide polymorphisms affecting carbohydrate metabolism in metabolic syndrome: from the LIPGENE study.

PubMed

Delgado-Lista, Javier; Perez-Martinez, Pablo; Solivera, Juan; Garcia-Rios, Antonio; Perez-Caballero, A I; Lovegrove, Julie A; Drevon, Christian A; Defoort, Catherine; Blaak, Ellen E; Dembinska-Kieć, Aldona; Risérus, Ulf; Herruzo-Gomez, Ezequiel; Camargo, Antonio; Ordovas, Jose M; Roche, Helen; Lopez-Miranda, José

2014-02-01

Metabolic syndrome (MetS) is a high-prevalence condition characterized by altered energy metabolism, insulin resistance, and elevated cardiovascular risk. Although many individual single nucleotide polymorphisms (SNPs) have been linked to certain MetS features, there are few studies analyzing the influence of SNPs on carbohydrate metabolism in MetS. A total of 904 SNPs (tag SNPs and functional SNPs) were tested for influence on 8 fasting and dynamic markers of carbohydrate metabolism, by performance of an intravenous glucose tolerance test in 450 participants in the LIPGENE study. From 382 initial gene-phenotype associations between SNPs and any phenotypic variables, 61 (16% of the preselected variables) remained significant after bootstrapping. Top SNPs affecting glucose metabolism variables were as follows: fasting glucose, rs26125 (PPARGC1B); fasting insulin, rs4759277 (LRP1); C-peptide, rs4759277 (LRP1); homeostasis assessment of insulin resistance, rs4759277 (LRP1); quantitative insulin sensitivity check index, rs184003 (AGER); sensitivity index, rs7301876 (ABCC9), acute insulin response to glucose, rs290481 (TCF7L2); and disposition index, rs12691 (CEBPA). We describe here the top SNPs linked to phenotypic features in carbohydrate metabolism among approximately 1000 candidate gene variations in fasting and postprandial samples of 450 patients with MetS from the LIPGENE study.

Improved imputation of low-frequency and rare variants using the UK10K haplotype reference panel.

PubMed

Huang, Jie; Howie, Bryan; McCarthy, Shane; Memari, Yasin; Walter, Klaudia; Min, Josine L; Danecek, Petr; Malerba, Giovanni; Trabetti, Elisabetta; Zheng, Hou-Feng; Gambaro, Giovanni; Richards, J Brent; Durbin, Richard; Timpson, Nicholas J; Marchini, Jonathan; Soranzo, Nicole

2015-09-14

Imputing genotypes from reference panels created by whole-genome sequencing (WGS) provides a cost-effective strategy for augmenting the single-nucleotide polymorphism (SNP) content of genome-wide arrays. The UK10K Cohorts project has generated a data set of 3,781 whole genomes sequenced at low depth (average 7x), aiming to exhaustively characterize genetic variation down to 0.1% minor allele frequency in the British population. Here we demonstrate the value of this resource for improving imputation accuracy at rare and low-frequency variants in both a UK and an Italian population. We show that large increases in imputation accuracy can be achieved by re-phasing WGS reference panels after initial genotype calling. We also present a method for combining WGS panels to improve variant coverage and downstream imputation accuracy, which we illustrate by integrating 7,562 WGS haplotypes from the UK10K project with 2,184 haplotypes from the 1000 Genomes Project. Finally, we introduce a novel approximation that maintains speed without sacrificing imputation accuracy for rare variants.

Single nucleotide polymorphisms in Plasmodium falciparum V type H(+) pyrophosphatase gene (pfvp2) and their associations with pfcrt and pfmdr1 polymorphisms.

PubMed

Jovel, Irina Tatiana; Ferreira, Pedro Eduardo; Veiga, Maria Isabel; Malmberg, Maja; Mårtensson, Andreas; Kaneko, Akira; Zakeri, Sedigheh; Murillo, Claribel; Nosten, Francois; Björkman, Anders; Ursing, Johan

2014-06-01

Chloroquine resistance in Plasmodium falciparum malaria has been associated with pfcrt 76T (chloroquine resistance transporter gene) and pfmdr1 86Y (multidrug resistance gene 1) alleles. Pfcrt 76T enables transport of protonated chloroquine out of the parasites digestive vacuole resulting in a loss of hydrogen ions (H(+)). V type H(+) pyrophosphatase (PfVP2) is thought to pump H(+) into the digestive vacuole. This study aimed to describe the geographic distribution of single nucleotide polymorphisms in pfvp2 and their possible associations with pfcrt and pfmdr1 polymorphisms. Blood samples from 384 patients collected (1981-2009) in Honduras (n=35), Colombia (n=50), Liberia (n=50), Guinea Bissau (n=50), Tanzania (n=50), Iran (n=50), Thailand (n=49) and Vanuatu (n=50) were analysed. The pfcrt 72-76 haplotype, pfmdr1 copy numbers, pfmdr1 N86Y and pfvp2 V405I, K582R and P711S alleles were identified using PCR based methods. Pfvp2 was amplified in 344 samples. The pfvp2 allele proportions were V405 (97%), 405I (3%), K582 (99%), 582R (1%), P711 (97%) and 711S (3%). The number of patients with any of pfvp2 405I, 582R and/or 711S were as follows: Honduras (2/30), Colombia (0/46), Liberia (7/48), Guinea-Bissau (4/50), Tanzania (3/48), Iran (3/50), Thailand (1/49) and Vanuatu (0/31). The alleles were most common in Liberia (P=0.01) and Liberia+Guinea-Bissau (P=0.01). The VKP haplotype was found in 189/194 (97%) and 131/145 (90%) samples harbouring pfcrt 76T and pfcrt K76 respectively (P=0.007). The VKP haplotype was dominant. Most pfvp2 405I, 582R and 711S SNPs were seen where CQ resistance was not highly prevalent at the time of blood sampling possibly due to greater genetic variation prior to the bottle neck event of spreading CQ resistance. The association between the pfvp2 VKP haplotype and pfcrt 76T, which may indicate that pfvp2 is involved in CQ resistance, should therefore be interpreted with caution. Copyright © 2014 Elsevier B.V. All rights reserved.

A Comparative Genomics Strategy for Targeted Discovery of Single-Nucleotide Polymorphisms and Conserved-Noncoding Sequences in Orphan Crops1[W

PubMed Central

Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.

2006-01-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

PTCH1 gene haplotype association with basal cell carcinoma after transplantation.

PubMed

Begnini, A; Tessari, G; Turco, A; Malerba, G; Naldi, L; Gotti, E; Boschiero, L; Forni, A; Rugiu, C; Piaserico, S; Fortina, A B; Brunello, A; Cascone, C; Girolomoni, G; Gomez Lira, M

2010-08-01

Basal cell carcinoma (BCC) is 10 times more frequent in organ transplant recipients (OTRs) than in the general population. Factors in OTRs conferring increased susceptibility to BCC include ultraviolet radiation exposure, immunosuppression, viral infections such as human papillomavirus, phototype and genetic predisposition. The PTCH1 gene is a negative regulator of the hedgehog pathway, that provides mitogenic signals to basal cells in skin. PTCH1 gene mutations cause naevoid BCC syndrome, and contribute to the development of sporadic BCC and other types of cancers. Associations have been reported between PTCH1 polymorphisms and BCC susceptibility in nontransplanted individuals. To search for novel common polymorphisms in the proximal 5' regulatory region upstream of PTCH1 gene exon 1B, and to investigate the possible association of PTCH1 polymorphisms and haplotypes with BCC risk after organ transplantation. Three PTCH1 single nucleotide polymorphisms (rs2297086, rs2066836 and rs357564) were analysed by restriction fragment length polymorphism analysis in 161 northern Italian OTRs (56 BCC cases and 105 controls). Two regions of the PTCH1 gene promoter were screened by heteroduplex analysis in 30 cases and 30 controls. Single locus analysis showed no significant association. Haplotype T(1686)-T(3944) appeared to confer a significantly higher risk for BCC development (odds ratio 2.98, 95% confidence interval 2.55-3.48; P = 0.001). Two novel rare polymorphisms were identified at positions 176 and 179 of the 5'UTR. Two novel alleles of the -4 (CGG)(n) microsatellite were identified. No association of this microsatellite with BCC was observed. Haplotypes containing T(1686)-T(3944) alleles were shown to be associated with an increased BCC risk in our study population. These data appear to be of great interest for further investigations in a larger group of transplant individuals. Our results do not support the hypothesis that common polymorphisms in the proximal 5

Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

PubMed

Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

2006-03-01

Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

PubMed

Chen, Sherry Xi; Seelig, Georg

2016-04-20

Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

Genetic polymorphisms in ESR1 and ESR2 genes, and risk of hypospadias in a multiethnic study population.

PubMed

Choudhry, Shweta; Baskin, Laurence S; Lammer, Edward J; Witte, John S; Dasgupta, Sudeshna; Ma, Chen; Surampalli, Abhilasha; Shen, Joel; Shaw, Gary M; Carmichael, Suzan L

2015-05-01

Estrogenic endocrine disruptors acting via estrogen receptors α (ESR1) and β (ESR2) have been implicated in the etiology of hypospadias, a common congenital malformation of the male external genitalia. We determined the association of single nucleotide polymorphisms in ESR1 and ESR2 genes with hypospadias in a racially/ethnically diverse study population of California births. We investigated the relationship between hypospadias and 108 ESR1 and 36 ESR2 single nucleotide polymorphisms in 647 cases and 877 population based nonmalformed controls among infants born in selected California counties from 1990 to 2003. Subgroup analyses were performed by race/ethnicity (nonHispanic white and Hispanic subjects) and by hypospadias severity (mild to moderate and severe). Odds ratios for 33 of the 108 ESR1 single nucleotide polymorphisms had p values less than 0.05 (p = 0.05 to 0.007) for risk of hypospadias. However, none of the 36 ESR2 single nucleotide polymorphisms was significantly associated. In stratified analyses the association results were consistent by disease severity but different sets of single nucleotide polymorphisms were significantly associated with hypospadias in nonHispanic white and Hispanic subjects. Due to high linkage disequilibrium across the single nucleotide polymorphisms, haplotype analyses were conducted and identified 6 haplotype blocks in ESR1 gene that had haplotypes significantly associated with an increased risk of hypospadias (OR 1.3 to 1.8, p = 0.04 to 0.00001). Similar to single nucleotide polymorphism analysis, different ESR1 haplotypes were associated with risk of hypospadias in nonHispanic white and Hispanic subjects. No significant haplotype association was observed for ESR2. The data provide evidence that ESR1 single nucleotide polymorphisms and haplotypes influence the risk of hypospadias in white and Hispanic subjects, and warrant further examination in other study populations. Copyright © 2015 American Urological Association

Association of Interleukin-1 Gene Single Nucleotide Polymorphisms with Keratoconus in Chinese Han Population.

PubMed

Wang, Yani; Wei, Wei; Zhang, Changning; Zhang, XueHui; Liu, Ming; Zhu, Xiuping; Xu, Kun

2016-05-01

To investigate whether interleukin-1 alpha (IL1A) and interleukin-1 beta (IL1B) polymorphisms are associated with keratoconus (KC) in unrelated Chinese Han patients. The IL1A (rs2071376) and IL1B (rs1143627, rs16944) polymorphisms were genotyped in 115 unrelated Chinese Han KC patients and 101 healthy Chinese Han volunteers with the Sequenom MassARRAY RS1000. Sequenom Typer 4.0 software, PLINK 1.07, Haploview 4.0 software platform were used to analyze the allelic variants of IL1A and IL1B genes, and their association with KC risk factors were assessed. Among the variants, the three SNPs (rs2071376 in IL1A, rs1143627 and rs16944 in the promoter region of IL1B) were different between the two groups. The A allele of rs2071376 (A > C, p = 0.017, OR = 1.968, 95% C.I. 1.313-3.425), the C allele of rs1143627 (C > T, p < 0.001, OR = 2.864, 95% C.I. 1.631-4.968) and the A allele of rs16944 (A > G, p = 0.002, OR = 2.401, 95% C.I. 1.396-4.161) were associated with a increased risk of KC in Chinese Han patients. This study showed that rs2071376, rs1143627 and rs16944 had significant differences in associations between KC patients and the control group when different genotypes were analyzed in three models (dominant, recessive, and additive). In the haplotype analysis, the two single nucleotide polymorphisms (SNPs), rs1143627 and rs16944 showed strong linkage disequilibrium. In addition, Haplotype "ACA" was found to be associated with a higher risk of developing KC (OR = 12.91, p < 0.001). Keratocyte apoptosis is an initiating event in the pathogenesis of KC which could be induced by the altered levels of IL1 gene. These findings confirmed that polymorphisms in IL1 genes were associated with risk of KC in the Chinese Han population, which help us to gain insight into the pathogenesis of KC.

Characterization of swine leukocyte antigen alleles and haplotypes on a novel miniature pig line, Microminipig.

PubMed

Ando, A; Imaeda, N; Ohshima, S; Miyamoto, A; Kaneko, N; Takasu, M; Shiina, T; Kulski, J K; Inoko, H; Kitagawa, H

2014-12-01

Microminipigs are extremely small-sized, novel miniature pigs that were recently developed for medical research. The inbred Microminipigs with defined swine leukocyte antigen (SLA) haplotypes are expected to be useful for allo- and xenotransplantation studies and also for association analyses between SLA haplotypes and immunological traits. To establish SLA-defined Microminipig lines, we characterized the polymorphic SLA alleles for three class I (SLA-1, SLA-2 and SLA-3) and two class II (SLA-DRB1 and SLA-DQB1) genes of 14 parental Microminipigs using a high-resolution nucleotide sequence-based typing method. Eleven class I and II haplotypes, including three recombinant haplotypes, were found in the offspring of the parental Microminipigs. Two class I and class II haplotypes, Hp-31.0 (SLA-1*1502-SLA-3*070102-SLA-2*1601) and Hp-0.37 (SLA-DRB1*0701-SLA-DQB1*0502), are novel and have not so far been reported in other pig breeds. Crossover regions were defined by the analysis of 22 microsatellite markers within the SLA class III region of three recombinant haplotypes. The SLA allele and haplotype information of Microminipigs in this study will be useful to establish SLA homozygous lines including three recombinants for transplantation and immunological studies. © 2014 Stichting International Foundation for Animal Genetics.

Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

ERIC Educational Resources Information Center

Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

2012-01-01

Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

Genetic structure of Plasmodium vivax using the merozoite surface protein 1 icb5-6 fragment reveals new hybrid haplotypes in southern Mexico

PubMed Central

2014-01-01

Background Plasmodium vivax is a protozoan parasite with an extensive worldwide distribution, being highly prevalent in Asia as well as in Mesoamerica and South America. In southern Mexico, P. vivax transmission has been endemic and recent studies suggest that these parasites have unique biological and genetic features. The msp1 gene has shown high rate of nucleotide substitutions, deletions, insertions, and its mosaic structure reveals frequent events of recombination, maybe between highly divergent parasite isolates. Methods The nucleotide sequence variation in the polymorphic icb5-6 fragment of the msp1 gene of Mexican and worldwide isolates was analysed. To understand how genotype diversity arises, disperses and persists in Mexico, the genetic structure and genealogical relationships of local isolates were examined. To identify new sequence hybrids and their evolutionary relationships with other P. vivax isolates circulating worldwide two haplotype networks were constructed questioning that two portions of the icb5-6 have different evolutionary history. Results Twelve new msp1 icb5-6 haplotypes of P. vivax from Mexico were identified. These nucleotide sequences show mosaic structure comprising three partially conserved and two variable subfragments and resulted into five different sequence types. The variable subfragment sV1 has undergone recombination events and resulted in hybrid sequences and the haplotype network allocated the Mexican haplotypes to three lineages, corresponding to the Sal I and Belem types, and other more divergent group. In contrast, the network from icb5-6 fragment but not sV1 revealed that the Mexican haplotypes belong to two separate lineages, none of which are closely related to Sal I or Belem sequences. Conclusions These results suggest that the new hybrid haplotypes from southern Mexico were the result of at least three different recombination events. These rearrangements likely resulted from the recombination between haplotypes of

Association of the IL4R single-nucleotide polymorphism I50V with recurrent spontaneous abortion (RSA).

PubMed

Tavasolian, Fataneh; Abdollahi, Elham; Samadi, Morteza

2014-07-01

Recurrent spontaneous abortion (RSA) is defined as three or more consecutive abortions before the 20th week of gestation. There is increasing evidence to support an immunological mechanism for the occurrence of RSA. The purpose of our study was to examine whether single-nucleotide polymorphisms (SNPs) of the interleukin-4 receptor gene IL4R influence susceptibility to, recurrent spontaneous abortion. This is a case-control study. We recruited 200 patients with RSA (case group) using established diagnostic criteria and 200, normal individuals (control group) at the fertility and infertility center in Yazd city and Isfahan city during 2012 to 2013. We screened the I50V variant in IL-4R in patients and controls by PCR-RFLF method, and we performed an association analysis between I50V variant and RSA.the data was analyzed by spss 16 software using Chi-square test. No differences in the genotype and allele frequencies of the I50V SNPs were identified between patients with RSA and healthy controls. The frequency of SNP in IL-4 receptor (I50V) in patients with recurrent spontaneous abortion did not differ significantly compared with the control group. Analysis of IL4R SNP haplotypes or complex alleles suggested no dominant protection in patients with RSA.

A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.

PubMed

Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

2011-06-15

A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

Submegabase Clusters of Unstable Tandem Repeats Unique to the Tla Region of Mouse T Haplotypes

PubMed Central

Uehara, H.; Ebersole, T.; Bennett, D.; Artzt, K.

1990-01-01

We describe here the identification and genomic organization of mouse t haplotype-specific elements (TSEs) 7.8 and 5.8 kb in length. The TSEs exist as submegabase-long clusters of tandem repeats localized in the Tla region of the major histocompatibility complex of all t haplotype chromosomes examined. In contrast, no such clusters were detected among 12 inbred strains of Mus musculus and other Mus species; thus, clusters of TSEs represent the first absolutely qualitative difference between t haplotypes and wild-type chromosomes. Pulsed field gel electrophoresis shows that the number of clusters, and the number of repeats in each cluster are extremely variable. Dramatic quantitative differences of TSEs uniquely distinguish every independent t haplotype from any other. The complete nucleotide sequence of one 7.8-kb TSE reveals significant homology to the ETn (a major transcript in the early embryo of the mouse), and some homologies to intracisternal A-particles and the mammary tumor virus env gene. Apart from the diagnostic relevance to t haplotypes, evolutionary and functional significances are discussed with respect to chromosome structure and genetic recombination. PMID:2076812

Toll-like receptor 4 polymorphisms and their haplotypes modulate the risk of developing diabetic retinopathy in type 2 diabetes patients

PubMed Central

Singh, Kanhaiya; Kant, Shri; Singh, Vivek Kumar; Agrawal, Neeraj K.; Gupta, Sanjeev K.

2014-01-01

Purpose Persistent inflammation and impaired neovascularization in type 2 diabetes mellitus (T2DM) patients may lead to development of macro- and microvascular complications. Diabetic retinopathy (DR) is one of the secondary microvascular complications of T2DM. Improper activation of the innate immune system may be an important contributor in the pathophysiology of DR. Toll-like receptor 4 (TLR4) is an important mediator of innate immunity, and genetic alterations in TLR4 support inflammation in the hyperglycemic condition. The present work was designed to investigate whether the TLR4 single nucleotide polymorphisms (SNPs) rs4986790, rs4986791, rs10759931, rs1927911, and rs1927914 are associated with DR in a north Indian population. Methods The study group of 698 individuals (128 DR, 250 T2DM, 320 controls) was genotyped by PCR-RFLP. Haplotype and linkage disequilibrium between SNPs were determined using Haploview software. Results Combined risk genotypes of TLR4 SNPs rs10759931 (odds ratio [OR] 1.50, p = 0.05) and rs1927914 (OR 1.48, p = 0.05) were found to be significantly associated with pathogenesis of DR. A total of 14 haplotypes with frequency >1% were obtained using Haploview software. Haplotypes ACATC (37.5%) and ACATT (14.8%) were the two most common haplotypes obtained. Conclusions Results of the present case-control study that included 698 north Indian subjects suggested that TLR4 SNPs rs10759931 and rs1927914 modulate the risk of DR in T2DM cases. Association analysis using haplotypes showed none of the haplotypes were associated with either susceptibility or resistance to DR in a north Indian population. PMID:24883015

A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

ERIC Educational Resources Information Center

Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

2016-01-01

The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

Recovery of Native Genetic Background in Admixed Populations Using Haplotypes, Phenotypes, and Pedigree Information – Using Cika Cattle as a Case Breed

PubMed Central

Simčič, Mojca; Smetko, Anamarija; Sölkner, Johann; Seichter, Doris; Gorjanc, Gregor; Kompan, Dragomir; Medugorac, Ivica

2015-01-01

The aim of this study was to obtain unbiased estimates of the diversity parameters, the population history, and the degree of admixture in Cika cattle which represents the local admixed breeds at risk of extinction undergoing challenging conservation programs. Genetic analyses were performed on the genome-wide Single Nucleotide Polymorphism (SNP) Illumina Bovine SNP50 array data of 76 Cika animals and 531 animals from 14 reference populations. To obtain unbiased estimates we used short haplotypes spanning four markers instead of single SNPs to avoid an ascertainment bias of the BovineSNP50 array. Genome-wide haplotypes combined with partial pedigree and type trait classification show the potential to improve identification of purebred animals with a low degree of admixture. Phylogenetic analyses demonstrated unique genetic identity of Cika animals. Genetic distance matrix presented by rooted Neighbour-Net suggested long and broad phylogenetic connection between Cika and Pinzgauer. Unsupervised clustering performed by the admixture analysis and two-dimensional presentation of the genetic distances between individuals also suggest Cika is a distinct breed despite being similar in appearance to Pinzgauer. Animals identified as the most purebred could be used as a nucleus for a recovery of the native genetic background in the current admixed population. The results show that local well-adapted strains, which have never been intensively managed and differentiated into specific breeds, exhibit large haplotype diversity. They suggest a conservation and recovery approach that does not rely exclusively on the search for the original native genetic background but rather on the identification and removal of common introgressed haplotypes would be more powerful. Successful implementation of such an approach should be based on combining phenotype, pedigree, and genome-wide haplotype data of the breed of interest and a spectrum of reference breeds which potentially have had

Haplotype combination of the bovine CFL2 gene sequence variants and association with growth traits in Qinchuan cattle.

PubMed

Sun, Yujia; Lan, Xianyong; Lei, Chuzhao; Zhang, Chunlei; Chen, Hong

2015-06-01

The aim of this study was to examine the association of cofilin2 (CFL2) gene polymorphisms with growth traits in Chinese Qinchuan cattle. Three single nucleotide polymorphisms (SNPs) were identified in the bovine CFL2 gene using DNA sequencing and (forced) PCR-RFLP methods. These polymorphisms included a missense mutation (NC_007319.5: g. C 2213 G) in exon 4, one synonymous mutation (NC_007319.5: g. T 1694 A) in exon 4, and a mutation (NC_007319.5: g. G 1500 A) in intron 2, respectively. In addition, we evaluated the haplotype frequency and linkage disequilibrium coefficient of three sequence variants in 488 individuals in QC cattle. All the three SNPs in QC cattle belonged to an intermediate level of genetic diversity (0.25Haplotype analysis of three SNPs showed that 8 different haplotypes were identified in all, but only 5 haplotypes were listed except for those with a frequency of <0.03. Hap4 (-GTC-) had the highest haplotype frequencies (34.70%). However in the three SNPs there were no significant associations between the 13 combined genotypes of the CFL2 gene and growth traits. LD analysis showed that the SNP T 1694 A and C 2213 G loci had a strong linkage (r(2)>0.33). Association analysis indicated that SNP G 1500 A, T 1694 A and C 2213 G were significantly associated with growth traits in the QC population. The results of our study suggest that the CFL2 gene may be a strong candidate gene that affects growth traits in the QC cattle breeding program. Copyright © 2015 Elsevier B.V. All rights reserved.

Identification and characterization of single nucleotide polymorphisms (SNPs) in Culex theileri (Diptera: Culicidae).

PubMed

Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent

2012-05-01

Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.

Haplotypic Background of a Private Allele at High Frequency in the Americas

PubMed Central

Schroeder, Kari B.; Jakobsson, Mattias; Crawford, Michael H.; Schurr, Theodore G.; Boca, Simina M.; Conrad, Donald F.; Tito, Raul Y.; Osipova, Ludmilla P.; Tarskaia, Larissa A.; Zhadanov, Sergey I.; Wall, Jeffrey D.; Pritchard, Jonathan K.; Malhi, Ripan S.; Smith, David G.; Rosenberg, Noah A.

2009-01-01

Recently, the observation of a high-frequency private allele, the 9-repeat allele at microsatellite D9S1120, in all sampled Native American and Western Beringian populations has been interpreted as evidence that all modern Native Americans descend primarily from a single founding population. However, this inference assumed that all copies of the 9-repeat allele were identical by descent and that the geographic distribution of this allele had not been influenced by natural selection. To investigate whether these assumptions are satisfied, we genotyped 34 single nucleotide polymorphisms across ∼500 kilobases (kb) around D9S1120 in 21 Native American and Western Beringian populations and 54 other worldwide populations. All chromosomes with the 9-repeat allele share the same haplotypic background in the vicinity of D9S1120, suggesting that all sampled copies of the 9-repeat allele are identical by descent. Ninety-one percent of these chromosomes share the same 76.26 kb haplotype, which we call the “American Modal Haplotype” (AMH). Three observations lead us to conclude that the high frequency and widespread distribution of the 9-repeat allele are unlikely to be the result of positive selection: 1) aside from its association with the 9-repeat allele, the AMH does not have a high frequency in the Americas, 2) the AMH is not unusually long for its frequency compared with other haplotypes in the Americas, and 3) in Latin American mestizo populations, the proportion of Native American ancestry at D9S1120 is not unusual compared with that observed at other genomewide microsatellites. Using a new method for estimating the time to the most recent common ancestor (MRCA) of all sampled copies of an allele on the basis of an estimate of the length of the genealogy descended from the MRCA, we calculate the mean time to the MRCA of the 9-repeat allele to be between 7,325 and 39,900 years, depending on the demographic model used. The results support the hypothesis that all

Development of 101 novel EST-derived single nucleotide polymorphism markers for Zhikong scallop ( Chlamys farreri)

NASA Astrophysics Data System (ADS)

Li, Jiqin; Bao, Zhenmin; Li, Ling; Wang, Xiaojian; Wang, Shi; Hu, Xiaoli

2013-09-01

Zhikong scallop ( Chlamys farreri) is an important maricultured species in China. Many researches on this species, such as population genetics and QTL fine-mapping, need a large number of molecular markers. In this study, based on the expressed sequence tags (EST), a total of 300 putative single nucleotide polymorphisms (SNPs) were selected and validated using high resolution melting (HRM) technology with unlabeled probe. Of them, 101 (33.7%) were found to be polymorphic in 48 individuals from 4 populations. Further evaluation with 48 individuals from Qingdao population showed that all the polymorphic loci had two alleles with the minor allele frequency ranged from 0.046 to 0.500. The observed and expected heterozygosities ranged from 0.000 to 0.925 and from 0.089 to 0.505, respectively. Fifteen loci deviated significantly from Hardy-Weinberg equilibrium and significant linkage disequilibrate was detected in one pair of markers. BLASTx gave significant hits for 72 of the 101 polymorphic SNP-containing ESTs. Thirty four polymorphic SNP loci were predicted to be non-synonymous substitutions as they caused either the change of codons (33 SNPs) or pretermination of translation (1 SNP). The markers developed can be used for the population studies and genetic improvement on Zhikong scallop.

Genome Patterns of Selection and Introgression of Haplotypes in Natural Populations of the House Mouse (Mus musculus)

PubMed Central

Staubach, Fabian; Lorenc, Anna; Messer, Philipp W.; Tang, Kun; Petrov, Dmitri A.; Tautz, Diethard

2012-01-01

General parameters of selection, such as the frequency and strength of positive selection in natural populations or the role of introgression, are still insufficiently understood. The house mouse (Mus musculus) is a particularly well-suited model system to approach such questions, since it has a defined history of splits into subspecies and populations and since extensive genome information is available. We have used high-density single-nucleotide polymorphism (SNP) typing arrays to assess genomic patterns of positive selection and introgression of alleles in two natural populations of each of the subspecies M. m. domesticus and M. m. musculus. Applying different statistical procedures, we find a large number of regions subject to apparent selective sweeps, indicating frequent positive selection on rare alleles or novel mutations. Genes in the regions include well-studied imprinted loci (e.g. Plagl1/Zac1), homologues of human genes involved in adaptations (e.g. alpha-amylase genes) or in genetic diseases (e.g. Huntingtin and Parkin). Haplotype matching between the two subspecies reveals a large number of haplotypes that show patterns of introgression from specific populations of the respective other subspecies, with at least 10% of the genome being affected by partial or full introgression. Using neutral simulations for comparison, we find that the size and the fraction of introgressed haplotypes are not compatible with a pure migration or incomplete lineage sorting model. Hence, it appears that introgressed haplotypes can rise in frequency due to positive selection and thus can contribute to the adaptive genomic landscape of natural populations. Our data support the notion that natural genomes are subject to complex adaptive processes, including the introgression of haplotypes from other differentiated populations or species at a larger scale than previously assumed for animals. This implies that some of the admixture found in inbred strains of mice may also have

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes

USDA-ARS?s Scientific Manuscript database

Technical Abstract: 20-75 CHARACTER LINES A strategy for a genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into respective genomes. In this study, nucle...

Exploring and Harnessing Haplotype Diversity to Improve Yield Stability in Crops.

PubMed

Qian, Lunwen; Hickey, Lee T; Stahl, Andreas; Werner, Christian R; Hayes, Ben; Snowdon, Rod J; Voss-Fels, Kai P

2017-01-01

In order to meet future food, feed, fiber, and bioenergy demands, global yields of all major crops need to be increased significantly. At the same time, the increasing frequency of extreme weather events such as heat and drought necessitates improvements in the environmental resilience of modern crop cultivars. Achieving sustainably increase yields implies rapid improvement of quantitative traits with a very complex genetic architecture and strong environmental interaction. Latest advances in genome analysis technologies today provide molecular information at an ultrahigh resolution, revolutionizing crop genomic research, and paving the way for advanced quantitative genetic approaches. These include highly detailed assessment of population structure and genotypic diversity, facilitating the identification of selective sweeps and signatures of directional selection, dissection of genetic variants that underlie important agronomic traits, and genomic selection (GS) strategies that not only consider major-effect genes. Single-nucleotide polymorphism (SNP) markers today represent the genotyping system of choice for crop genetic studies because they occur abundantly in plant genomes and are easy to detect. SNPs are typically biallelic, however, hence their information content compared to multiallelic markers is low, limiting the resolution at which SNP-trait relationships can be delineated. An efficient way to overcome this limitation is to construct haplotypes based on linkage disequilibrium, one of the most important features influencing genetic analyses of crop genomes. Here, we give an overview of the latest advances in genomics-based haplotype analyses in crops, highlighting their importance in the context of polyploidy and genome evolution, linkage drag, and co-selection. We provide examples of how haplotype analyses can complement well-established quantitative genetics frameworks, such as quantitative trait analysis and GS, ultimately providing an effective tool

Single Nucleotide Polymorphisms in Cellular Drug Transporters Are Associated with Intolerance to Antiretroviral Therapy in Brazilian HIV-1 Positive Individuals.

PubMed

Arruda, Mônica Barcellos; Campagnari, Francine; de Almeida, Tailah Bernardo; Couto-Fernandez, José Carlos; Tanuri, Amilcar; Cardoso, Cynthia Chester

2016-01-01

Adverse reactions are the main cause of treatment discontinuation among HIV+ individuals. Genes related to drug absorption, distribution, metabolism and excretion (ADME) influence drug bioavailability and treatment response. We have investigated the association between single nucleotide polymorphisms (SNPs) in 29 ADME genes and intolerance to therapy in a case-control study including 764 individuals. Results showed that 15 SNPs were associated with intolerance to nucleoside and 11 to non-nucleoside reverse transcriptase inhibitors (NRTIs and NNRTIs), and 8 to protease inhibitors (PIs) containing regimens under alpha = 0.05. After Bonferroni adjustment, two associations remained statistically significant. SNP rs2712816, at SLCO2B1 was associated to intolerance to NRTIs (ORGA/AA = 2.37; p = 0.0001), while rs4148396, at ABCC2, conferred risk of intolerance to PIs containing regimens (ORCT/TT = 2.64; p = 0.00009). Accordingly, haplotypes carrying rs2712816A and rs4148396T alleles were also associated to risk of intolerance to NRTIs and PIs, respectively. Our data reinforce the role of drug transporters in response to HIV therapy and may contribute to a future development of personalized therapies.

Effects of apolipoprotein A5 haplotypes on the ratio of triglyceride to high-density lipoprotein cholesterol and the risk for metabolic syndrome in Koreans.

PubMed

Cha, Seongwon; Yu, Hyunjoo; Park, Ah Yeon; Song, Kwang Hoon

2014-03-12

Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C-G-A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS.

Two haplotype clusters of Echinococcus granulosus sensu stricto in northern Iraq (Kurdistan region) support the hypothesis of a parasite cradle in the Middle East.

PubMed

Hassan, Zuber Ismael; Meerkhan, Azad Abdullah; Boufana, Belgees; Hama, Abdullah A; Ahmed, Bayram Dawod; Mero, Wijdan Mohammed Salih; Orsten, Serra; Interisano, Maria; Pozio, Edoardo; Casulli, Adriano

2017-08-01

Human cystic echinococcosis (CE) caused by Echinococcus granulosus s.s. is a major public health problem in Iraqi Kurdistan with a reported surgical incidence of 6.3 per 100,000 Arbil inhabitants. A total of 125 Echinococcus isolates retrieved from sheep, goats and cattle were used in this study. Our aim was to determine species/genotypes infecting livestock in Iraqi Kurdistan and examine intraspecific variation and population structure of Echinococcus granulosus s.s. in this region and relate it to that of other regions worldwide. Using nucleotide sequences of the mitochondrial cytochrome c oxidase subunit 1 (cox 1) we identified E. granulosus s.s. as the cause of hydatidosis in all examined animals. The haplotype network displayed a double-clustered topology with two main E. granulosus s.s. haplotypes, (KU05) and (KU33). The 'founder' haplotype (KU05) confirmed the presence of a common lineage of non-genetically differentiated populations as inferred by the low non-significant fixation index values. Overall diversity and neutrality indices indicated demographic expansion. We used E. granulosus s.s. nucleotide sequences from GenBank to draw haplotype networks for the Middle East (Iran, Jordan and Turkey), Europe (Albania, Greece, Italy, Romania and Spain), China, Mongolia, Russia, South America (Argentina, Brazil, Chile and Mexico) and Tunisia. Networks with two haplotype clusters like that reported here for Iraqi Kurdistan were seen for the Middle East, Europe, Mongolia, Russia and Tunisia using both 827bp and 1609bp cox1 nucleotide sequences, whereas a star-like network was observed for China and South America. We hypothesize that the double clustering seen at what is generally assumed to be the cradle of domestication may have emerged independently and dispersed from the Middle East to other regions and that haplotype (KU33) may be the main haplotype within a second cluster in the Middle East from where it has spread into Europe, Mongolia, Russia and North

Relationship of polymorphisms and haplotype in interleukin-16 and adiponectin gene with late-onset Alzheimer’s disease risk

PubMed Central

Yin, Honglei; Zhang, Yuzhen; Hua, Linlin; Li, Jinfeng; Zeng, Zhilei; Yang, Xiaopeng; Gong, Bin; Geng, Shuang; Liu, Yajun; Zhang, Hui; Liu, Yanqiu; Zhao, Jing; Wang, Yunliang

2017-01-01

Aims To investigate the impact of Interleukin-16 (IL- 16) and Adiponectin (ANP) gene single nucleotide polymorphisms (SNPs), gene- gene interactions and haplotype on late-onset Alzheimer’s disease (LOAD) risk. Methods Hardy-Weinberg equilibrium (HWE), haplotype and pairwise linkage disequilibrium (LD) analysis were investigated by using SNPstats (available online at http://bioinfo.iconcologia.net/SNPstats). Generalized multifactor dimensionality reduction (GMDR) was used to examine interaction among 4 SNPs, odds ratio (OR) and 95% confident interval (95%CI) were calculated by logistic regression model. Results LOAD risk was significantly higher in carriers of rs266729- G allele than those with CC genotype (CG+ GG versus CC), OR (95%CI) =1.61 (1.26-1.96), and higher in carriers of rs1501299- T allele, OR (95%CI) = 1.62 (1.32-2.12), lower in carriers of rs4072111- T allele, adjusted OR (95%CI) =0.65 (0.44-0.93). We also found a significant gene- gene interaction between rs266729 and rs4072111. Participants with CG or GG of rs266729 and CC of rs4072111 genotype have the highest LOAD risk, OR (95%CI) = 2.62 (1.64 -3.58). Haplotype containing the rs266729- G and rs1501299- T alleles were associated with increased LOAD risk, OR (95%CI)= 1.83 (1.32- 2.43), and haplotype containing the rs1131445- C and rs4072111- T alleles were associated with decreased LOAD risk, OR (95%CI)= 0.53 (0.18- 0.95). Conclusions We concluded that rs266729 and rs1501299 minor alleles were associated with increased LOAD risk, but rs4072111 minor allele was associated with decreased LOAD risk. We also found that interaction involving rs266729 and rs4072111, and haplotype combinations were associated with LOAD risk. PMID:29108295

Genome sequence, comparative analysis and haplotype structure of the domestic dog.

PubMed

Lindblad-Toh, Kerstin; Wade, Claire M; Mikkelsen, Tarjei S; Karlsson, Elinor K; Jaffe, David B; Kamal, Michael; Clamp, Michele; Chang, Jean L; Kulbokas, Edward J; Zody, Michael C; Mauceli, Evan; Xie, Xiaohui; Breen, Matthew; Wayne, Robert K; Ostrander, Elaine A; Ponting, Chris P; Galibert, Francis; Smith, Douglas R; DeJong, Pieter J; Kirkness, Ewen; Alvarez, Pablo; Biagi, Tara; Brockman, William; Butler, Jonathan; Chin, Chee-Wye; Cook, April; Cuff, James; Daly, Mark J; DeCaprio, David; Gnerre, Sante; Grabherr, Manfred; Kellis, Manolis; Kleber, Michael; Bardeleben, Carolyne; Goodstadt, Leo; Heger, Andreas; Hitte, Christophe; Kim, Lisa; Koepfli, Klaus-Peter; Parker, Heidi G; Pollinger, John P; Searle, Stephen M J; Sutter, Nathan B; Thomas, Rachael; Webber, Caleb; Baldwin, Jennifer; Abebe, Adal; Abouelleil, Amr; Aftuck, Lynne; Ait-Zahra, Mostafa; Aldredge, Tyler; Allen, Nicole; An, Peter; Anderson, Scott; Antoine, Claudel; Arachchi, Harindra; Aslam, Ali; Ayotte, Laura; Bachantsang, Pasang; Barry, Andrew; Bayul, Tashi; Benamara, Mostafa; Berlin, Aaron; Bessette, Daniel; Blitshteyn, Berta; Bloom, Toby; Blye, Jason; Boguslavskiy, Leonid; Bonnet, Claude; Boukhgalter, Boris; Brown, Adam; Cahill, Patrick; Calixte, Nadia; Camarata, Jody; Cheshatsang, Yama; Chu, Jeffrey; Citroen, Mieke; Collymore, Alville; Cooke, Patrick; Dawoe, Tenzin; Daza, Riza; Decktor, Karin; DeGray, Stuart; Dhargay, Norbu; Dooley, Kimberly; Dooley, Kathleen; Dorje, Passang; Dorjee, Kunsang; Dorris, Lester; Duffey, Noah; Dupes, Alan; Egbiremolen, Osebhajajeme; Elong, Richard; Falk, Jill; Farina, Abderrahim; Faro, Susan; Ferguson, Diallo; Ferreira, Patricia; Fisher, Sheila; FitzGerald, Mike; Foley, Karen; Foley, Chelsea; Franke, Alicia; Friedrich, Dennis; Gage, Diane; Garber, Manuel; Gearin, Gary; Giannoukos, Georgia; Goode, Tina; Goyette, Audra; Graham, Joseph; Grandbois, Edward; Gyaltsen, Kunsang; Hafez, Nabil; Hagopian, Daniel; Hagos, Birhane; Hall, Jennifer; Healy, Claire; Hegarty, Ryan; Honan, Tracey; Horn, Andrea; Houde, Nathan; Hughes, Leanne; Hunnicutt, Leigh; Husby, M; Jester, Benjamin; Jones, Charlien; Kamat, Asha; Kanga, Ben; Kells, Cristyn; Khazanovich, Dmitry; Kieu, Alix Chinh; Kisner, Peter; Kumar, Mayank; Lance, Krista; Landers, Thomas; Lara, Marcia; Lee, William; Leger, Jean-Pierre; Lennon, Niall; Leuper, Lisa; LeVine, Sarah; Liu, Jinlei; Liu, Xiaohong; Lokyitsang, Yeshi; Lokyitsang, Tashi; Lui, Annie; Macdonald, Jan; Major, John; Marabella, Richard; Maru, Kebede; Matthews, Charles; McDonough, Susan; Mehta, Teena; Meldrim, James; Melnikov, Alexandre; Meneus, Louis; Mihalev, Atanas; Mihova, Tanya; Miller, Karen; Mittelman, Rachel; Mlenga, Valentine; Mulrain, Leonidas; Munson, Glen; Navidi, Adam; Naylor, Jerome; Nguyen, Tuyen; Nguyen, Nga; Nguyen, Cindy; Nguyen, Thu; Nicol, Robert; Norbu, Nyima; Norbu, Choe; Novod, Nathaniel; Nyima, Tenchoe; Olandt, Peter; O'Neill, Barry; O'Neill, Keith; Osman, Sahal; Oyono, Lucien; Patti, Christopher; Perrin, Danielle; Phunkhang, Pema; Pierre, Fritz; Priest, Margaret; Rachupka, Anthony; Raghuraman, Sujaa; Rameau, Rayale; Ray, Verneda; Raymond, Christina; Rege, Filip; Rise, Cecil; Rogers, Julie; Rogov, Peter; Sahalie, Julie; Settipalli, Sampath; Sharpe, Theodore; Shea, Terrance; Sheehan, Mechele; Sherpa, Ngawang; Shi, Jianying; Shih, Diana; Sloan, Jessie; Smith, Cherylyn; Sparrow, Todd; Stalker, John; Stange-Thomann, Nicole; Stavropoulos, Sharon; Stone, Catherine; Stone, Sabrina; Sykes, Sean; Tchuinga, Pierre; Tenzing, Pema; Tesfaye, Senait; Thoulutsang, Dawa; Thoulutsang, Yama; Topham, Kerri; Topping, Ira; Tsamla, Tsamla; Vassiliev, Helen; Venkataraman, Vijay; Vo, Andy; Wangchuk, Tsering; Wangdi, Tsering; Weiand, Michael; Wilkinson, Jane; Wilson, Adam; Yadav, Shailendra; Yang, Shuli; Yang, Xiaoping; Young, Geneva; Yu, Qing; Zainoun, Joanne; Zembek, Lisa; Zimmer, Andrew; Lander, Eric S

2005-12-08

Here we report a high-quality draft genome sequence of the domestic dog (Canis familiaris), together with a dense map of single nucleotide polymorphisms (SNPs) across breeds. The dog is of particular interest because it provides important evolutionary information and because existing breeds show great phenotypic diversity for morphological, physiological and behavioural traits. We use sequence comparison with the primate and rodent lineages to shed light on the structure and evolution of genomes and genes. Notably, the majority of the most highly conserved non-coding sequences in mammalian genomes are clustered near a small subset of genes with important roles in development. Analysis of SNPs reveals long-range haplotypes across the entire dog genome, and defines the nature of genetic diversity within and across breeds. The current SNP map now makes it possible for genome-wide association studies to identify genes responsible for diseases and traits, with important consequences for human and companion animal health.

Near East mtDNA haplotype variants in Roman cattle from Augusta Raurica, Switzerland, and in the Swiss Evolène breed.

PubMed

Schlumbaum, A; Turgay, M; Schibler, J

2006-08-01

Typical Near East mitochondrial haplotypes of the T2 lineage were found in one cattle metacarpus sample from the Roman period and in two present-day Evolène cattle in Switzerland. Sequences from eight additional Evolène and four Raetian Grey aligned to the European haplotype T3. Analysis of nucleotide diversity within the mitochondrial D-loop of both studied Swiss cattle breeds revealed high haplotype diversity and similar diversity to a European cattle reference group. Mitochondrial T3 haplotypes radiated star-like from two similarly frequent haplotypes, possibly indicating two different expansion routes. The breed structure of Evolène cattle can be explained either by an introduction of diverse female lineages from the domestication centre or by later admixture. The introduction of the Near East lineage to Switzerland must have happened during the Roman time or earlier.

Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

PubMed Central

Wang, Shichen; Wong, Debbie; Forrest, Kerrie; Allen, Alexandra; Chao, Shiaoman; Huang, Bevan E; Maccaferri, Marco; Salvi, Silvio; Milner, Sara G; Cattivelli, Luigi; Mastrangelo, Anna M; Whan, Alex; Stephen, Stuart; Barker, Gary; Wieseke, Ralf; Plieske, Joerg; International Wheat Genome Sequencing Consortium; Lillemo, Morten; Mather, Diane; Appels, Rudi; Dolferus, Rudy; Brown-Guedira, Gina; Korol, Abraham; Akhunova, Alina R; Feuillet, Catherine; Salse, Jerome; Morgante, Michele; Pozniak, Curtis; Luo, Ming-Cheng; Dvorak, Jan; Morell, Matthew; Dubcovsky, Jorge; Ganal, Martin; Tuberosa, Roberto; Lawley, Cindy; Mikoulitch, Ivan; Cavanagh, Colin; Edwards, Keith J; Hayden, Matthew; Akhunov, Eduard

2014-01-01

High-density single nucleotide polymorphism (SNP) genotyping arrays are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships between individuals in populations and studying marker–trait associations in mapping experiments. We developed a genotyping array including about 90 000 gene-associated SNPs and used it to characterize genetic variation in allohexaploid and allotetraploid wheat populations. The array includes a significant fraction of common genome-wide distributed SNPs that are represented in populations of diverse geographical origin. We used density-based spatial clustering algorithms to enable high-throughput genotype calling in complex data sets obtained for polyploid wheat. We show that these model-free clustering algorithms provide accurate genotype calling in the presence of multiple clusters including clusters with low signal intensity resulting from significant sequence divergence at the target SNP site or gene deletions. Assays that detect low-intensity clusters can provide insight into the distribution of presence–absence variation (PAV) in wheat populations. A total of 46 977 SNPs from the wheat 90K array were genetically mapped using a combination of eight mapping populations. The developed array and cluster identification algorithms provide an opportunity to infer detailed haplotype structure in polyploid wheat and will serve as an invaluable resource for diversity studies and investigating the genetic basis of trait variation in wheat. PMID:24646323

Extensive population structure in San, Khoe, and mixed ancestry populations from southern Africa revealed by 44 short 5-SNP haplotypes.

PubMed

Schlebusch, Carina M; Soodyall, Himlya

2012-12-01

The San and Khoe people currently represent remnant groups of a much larger and widely distributed population of hunter-gatherers and pastoralists who had exclusive occupation of southern Africa before the arrival of Bantu-speaking groups in the past 1,200 years and sea-borne immigrants within the last 350 years. Genetic studies [mitochondrial deoxyribonucleic acid (DNA) and Y-chromosome] conducted on San and Khoe groups revealed that they harbor some of the most divergent lineages found in living peoples throughout the world. Recently, high-density, autosomal, single-nucleotide polymorphism (SNP)-array studies confirmed the early divergence of Khoe-San population groups from all other human populations. The present study made use of 220 autosomal SNP markers (in the format of both haplotypes and genotypes) to examine the population structure of various San and Khoe groups and their relationship to other neighboring groups. Whereas analyses based on the genotypic SNP data only supported the division of the included populations into three main groups-Khoe-San, Bantu-speakers, and non-African populations-haplotype analyses revealed finer structure within Khoe-San populations. By the use of only 44 short SNP haplotypes (compiled from a total of 220 SNPs), most of the Khoe-San groups could be resolved as separate groups by applying STRUCTURE analyses. Therefore, by carefully selecting a few SNPs and combining them into haplotypes, we were able to achieve the same level of population distinction that was achieved previously in high-density SNP studies on the same population groups. Using haplotypes proved to be a very efficient and cost-effective way to study population structure. Copyright © 2013 Wayne State University Press, Detroit, Michigan 48201-1309.

Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

PubMed

Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

2015-03-04

Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

The whole genome sequences and experimentally phased haplotypes of over 100 personal genomes.

PubMed

Mao, Qing; Ciotlos, Serban; Zhang, Rebecca Yu; Ball, Madeleine P; Chin, Robert; Carnevali, Paolo; Barua, Nina; Nguyen, Staci; Agarwal, Misha R; Clegg, Tom; Connelly, Abram; Vandewege, Ward; Zaranek, Alexander Wait; Estep, Preston W; Church, George M; Drmanac, Radoje; Peters, Brock A

2016-10-11

Since the completion of the Human Genome Project in 2003, it is estimated that more than 200,000 individual whole human genomes have been sequenced. A stunning accomplishment in such a short period of time. However, most of these were sequenced without experimental haplotype data and are therefore missing an important aspect of genome biology. In addition, much of the genomic data is not available to the public and lacks phenotypic information. As part of the Personal Genome Project, blood samples from 184 participants were collected and processed using Complete Genomics' Long Fragment Read technology. Here, we present the experimental whole genome haplotyping and sequencing of these samples to an average read coverage depth of 100X. This is approximately three-fold higher than the read coverage applied to most whole human genome assemblies and ensures the highest quality results. Currently, 114 genomes from this dataset are freely available in the GigaDB repository and are associated with rich phenotypic data; the remaining 70 should be added in the near future as they are approved through the PGP data release process. For reproducibility analyses, 20 genomes were sequenced at least twice using independent LFR barcoded libraries. Seven genomes were also sequenced using Complete Genomics' standard non-barcoded library process. In addition, we report 2.6 million high-quality, rare variants not previously identified in the Single Nucleotide Polymorphisms database or the 1000 Genomes Project Phase 3 data. These genomes represent a unique source of haplotype and phenotype data for the scientific community and should help to expand our understanding of human genome evolution and function.

Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

USDA-ARS?s Scientific Manuscript database

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

Resolving incomplete single nucleotide polymorphism tagging of HLA-DQ2.2 for coeliac disease genotyping using digital droplet PCR.

PubMed

Hardy, M Y; Ontiveros, N; Varney, M D; Tye-Din, J A

2018-04-01

A hallmark of coeliac disease (CD) is the exceptionally strong genetic association with HLA-DQ2.5, DQ8, and DQ2.2. HLA typing provides information on CD risk important to both clinicians and researchers. A method that enables simple and fast detection of all CD risk genotypes is particularly desirable for the study of large populations. Single nucleotide polymorphism (SNP)-based HLA typing can detect the CD risk genotypes by detecting a combination of six SNPs but this approach can struggle to resolve HLA-DQ2.2, seen in 4% of European CD patients, because of the low resolution of one negatively predicting SNP. We sought to optimise SNP-based HLA typing by harnessing the additional resolution of digital droplet PCR to resolve HLA-DQ2.2. Here we test this two-step approach in an unselected sample of Mexican DNA and compare its accuracy to DNA typed using traditional exon detection. The addition of digital droplet PCR for samples requiring negative prediction of HLA-DQ2.2 enabled HLA-DQ2.2 to be accurately typed. This technique is a simple addition to a SNP-based typing strategy and enables comprehensive definition of all at-risk HLA genotypes in CD in a timely and cost-effective manner. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

D-loop haplotype diversity in Brazilian horse breeds

PubMed Central

Ianella, Patrícia; Albuquerque, Maria do Socorro Maués; Paiva, Samuel Rezende; do Egito, Andréa Alves; Almeida, Leonardo Daniel; Sereno, Fabiana T. P. S.; Carvalho, Luiz Felipe Ramos; Mariante, Arthur da Silva; McManus, Concepta Margaret

2017-01-01

Abstract The first horses were brought to Brazil by the colonizers after 1534. Over the centuries, these animals evolved and adapted to local environmental conditions usually unsuitable for exotic breeds, thereby originating locally adapted Brazilian breeds. The present work represents the first description of maternal genetic diversity in these horse breeds based on D-loop sequences. A D-Loop HSV-I fragment of 252 bp, from 141 horses belonging to ten Brazilian breeds / genetic groups (locally adapted and specialized breeds) were analysed. Thirty-five different haplotypes belonging to 18 haplogroups were identified with 33 polymorphic sites. Haplotype diversity (varying from 0.20 to 0.96) and nucleotide diversity (varying from 0.0039 to 0.0239) was lower for locally adapted than for specialized breeds, with the same pattern observed for FST values. Haplogroups identified in Brazilian breeds are in agreement with previous findings in South American samples. The low variability observed mainly in locally adapted breeds, indicates that, to ensure conservation of these breeds, careful reproductive management is needed. Additional genetic characterization studies are required to support accurate decision-making. PMID:28863209

APOC3/A5 haplotypes, lipid levels, and risk of myocardial infarction in the Central Valley of Costa Rica.

PubMed

Ruiz-Narváez, Edward A; Yang, Yadong; Nakanishi, Yukiko; Kirchdorfer, Jill; Campos, Hannia

2005-12-01

Genetic variation in the APOC3 and APOA5 genes has been associated with plasma triglyceride concentrations and may affect the risk of myocardial infarction (MI). To assess whether APOC3/A5 haplotypes are associated with risk of MI, we examined three single-nucleotide polymorphisms (SNPs) in APOC3 (3238C>G, -455T>C, and -482C>T) and six SNPs in the APOA5 gene (-1131T>C, c.-3A>G, c.56C>G, IVS3+476G>A, c.553G>T, and c.1259T>C) in incident cases (n = 1,703) of a first nonfatal MI matched for gender, age, and area of residence with population-based controls (n = 1,703). Conditional logistic regression models, adjusted for potential environmental confounders, were used for analysis. The common APOC3*222 haplotype was more frequent in cases than in controls (17.4% and 13.7%, respectively, P < 0.001) and was associated with increased risk of MI [odds ratio (OR) = 1.27; 95% confidence interval (95% CI), 1.09, 1.48] compared with APOC3*111 wild-type haplotype. This association was independent of the APOA5 SNPs. Although the APOC3 3238G, APOA5 -1131C, APOA5 c.-3G, and APOA5 c.1259C alleles were associated with higher triglyceride plasma concentrations, these effects could not explain the associations with MI in this population. In summary, this study supports the hypothesis that haplotypes in the APOC3 gene but not in the APOA5 gene increase susceptibility to MI.

Association between SLC19A1 Gene Polymorphism and High Dose Methotrexate Toxicity in Childhood Acute Lymphoblastic Leukaemia and Non Hodgkin Malignant Lymphoma: Introducing a Haplotype based Approach

PubMed Central

Kotnik, Barbara Faganel; Jazbec, Janez; Grabar, Petra Bohanec; Rodriguez-Antona, Cristina

2017-01-01

Abstract Background We investigated the clinical relevance of SLC 19A1 genetic variability for high dose methotrexate (HD-MTX) related toxicities in children and adolescents with acute lymphoblastic leukaemia (ALL) and non Hodgkin malignant lymphoma (NHML). Patients and methods Eighty-eight children and adolescents with ALL/NHML were investigated for the influence of SLC 19A1 single nucleotide polymorphisms (SNPs) and haplotypes on HD-MTX induced toxicities. Results Patients with rs2838958 TT genotype had higher probability for mucositis development as compared to carriers of at least one rs2838958 C allele (OR 0.226 (0.071–0.725), p < 0.009). Haplotype TGTTCCG (H4) statistically significantly reduced the risk for the occurrence of adverse events during treatment with HD-MTX (OR 0.143 (0.023–0.852), p = 0.030). Conclusions SLC 19A1 SNP and haplotype analysis could provide additional information in a personalized HD-MTX therapy for children with ALL/NHML in order to achieve better treatment outcome. However further studies are needed to validate the results. PMID:29333125

The Impact of BDNF Polymorphisms on Suicidality in Treatment-Resistant Major Depressive Disorder: A European Multicenter Study.

PubMed

Schosser, Alexandra; Carlberg, Laura; Calati, Raffaella; Serretti, Alessandro; Massat, Isabel; Spindelegger, Christoph; Linotte, Sylvie; Mendlewicz, Julien; Souery, Daniel; Zohar, Joseph; Montgomery, Stuart; Kasper, Siegfried

2017-10-01

Numerous studies have reported associations between the brain-derived neurotrophic factor (BDNF) gene and psychiatric disorders, including suicidal behavior, although with conflicting results. A total of 250 major depressive disorder patients were collected in the context of a European multicenter resistant depression study and treated with antidepressants at adequate doses for at least 4 weeks. Suicidality was assessed using the Mini International Neuropsychiatric Interview and Hamilton Rating Scale for Depression, and treatment response using the HAM-D. Genotyping was performed for the functional Val66Met polymorphism (rs6265) and 7 additional tagging single nucleotide polymorphisms within the BDNF gene. Neither BDNF single markers nor haplotypes were found to be associated with suicide risk and lifetime history of suicide attempts. Gender-specific analyses revealed nonsignificant single marker (rs908867) and haplotypic association with suicide risk in males after multiple testing correction. Analyzing treatment response phenotypes, the functional Val66Met polymorphism as well as rs10501087 showed significant genotypic and haplotypic association with suicide risk in remitters (n=34, 13.6%). Considering the sample size, the present findings need to be replicated in larger samples to confirm or refute a role of BDNF in the investigated suicidal behavior phenotypes. © The Author 2017. Published by Oxford University Press on behalf of CINP.

Unique haplotypes of cacao trees as revealed by trnH-psbA chloroplast DNA

PubMed Central

Gutiérrez-López, Nidia; Ovando-Medina, Isidro; Salvador-Figueroa, Miguel; Molina-Freaner, Francisco; Avendaño-Arrazate, Carlos H.

2016-01-01

Cacao trees have been cultivated in Mesoamerica for at least 4,000 years. In this study, we analyzed sequence variation in the chloroplast DNA trnH-psbA intergenic spacer from 28 cacao trees from different farms in the Soconusco region in southern Mexico. Genetic relationships were established by two analysis approaches based on geographic origin (five populations) and genetic origin (based on a previous study). We identified six polymorphic sites, including five insertion/deletion (indels) types and one transversion. The overall nucleotide diversity was low for both approaches (geographic = 0.0032 and genetic = 0.0038). Conversely, we obtained moderate to high haplotype diversity (0.66 and 0.80) with 10 and 12 haplotypes, respectively. The common haplotype (H1) for both networks included cacao trees from all geographic locations (geographic approach) and four genetic groups (genetic approach). This common haplotype (ancient) derived a set of intermediate haplotypes and singletons interconnected by one or two mutational steps, which suggested directional selection and event purification from the expansion of narrow populations. Cacao trees from Soconusco region were grouped into one cluster without any evidence of subclustering based on AMOVA (FST = 0) and SAMOVA (FST = 0.04393) results. One population (Mazatán) showed a high haplotype frequency; thus, this population could be considered an important reservoir of genetic material. The indels located in the trnH-psbA intergenic spacer of cacao trees could be useful as markers for the development of DNA barcoding. PMID:27076998

Evaluation of the association between the JAK2 46/1 haplotype and chronic myeloproliferative neoplasms in a Brazilian population

PubMed Central

Silva, Sarah Pagliarini- e-; Santos, Bruna Cunha; de Figueiredo Pereira, Elizangela Mendes; Ferreira, Mari Ellen; Baraldi, Elaine Cristina; Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2013-01-01

OBJECTIVE: The JAK2 46/1 haplotype has recently been described as a major contributing factor to the development of myeloproliferative neoplasm, whether positive or negative for the JAK2 V617F mutation. The G allele, identified by a single-nucleotide polymorphism known as JAK2 rs10974944, is part of the JAK2 46/1 haplotype. The aim of this study was to verify the association between the presence of the G allele and the development of BCR-ABL-negative chronic myeloproliferative neoplasms in our population. METHODS: Blood and oral mucosa swab samples were obtained from 56 patients of two local Brazilian hospitals who had previously been diagnosed with BCR-ABL-negative chronic myeloproliferative neoplasms. Blood samples from 90 local blood donors were used as controls. The presence of the G allele was assessed using a PCR-RFLP assay after extracting DNA from the samples. RESULTS: The presence of the G allele was strongly associated with the presence of BCR-ABL-negative chronic myeloproliferative neoplasms (p = 0.0001; OR = 2.674; 95% CI = 1.630−4.385) in the studied population. CONCLUSION: In agreement with previous reports, the JAK2 46/1 haplotype, represented in this study by the presence of the G allele, is an important predisposing factor in the oncogenetic development of these neoplasms in our population. PMID:23420150

Haplotype analysis of the apolipoprotein A5 gene in obese pediatric patients.

PubMed

Horvatovich, Katalin; Bokor, Szilvia; Baráth, Akos; Maász, Anita; Kisfali, Péter; Járomi, Luca; Polgár, Noémi; Tóth, Dénes; Répásy, Judit; Endreffy, Emoke; Molnár, Dénes; Melegh, Béla

2011-06-01

Apolipoprotein A5 (APOA5) gene variants have been shown to be associated with elevated TG levels; the T-1131C (rs662799) variant has been reported to confer risk for the metabolic syndrome in adult populations. Little is known about the APOA5 variants in pediatric population, no such information is available for pediatric obesity at all. Here we examined four haplotype-tagging polymorphisms (T-1131C, IVS3 + G476A [rs2072560], T1259C [rs2266788] and C56G [rs3135506]) and studied also the frequency of major naturally occurring haplotypes of APOA5 in obese children. The polymorphisms were analyzed in 232 obese children, and in 137 healthy, normal weight controls, using PCR-RFLP methods. In the pediatric patients we could confirm the already known adult subjects based association of -1131C, IVS3 + 476A and 1259C variants with elevated triglyceride concentrations, both in obese patients and in the controls. The prevalence of the APOA5*2 haplotype (containing the minor allele of T-1131C, IVS3 + G476A and T1259C SNPs together) was 15.5% in obese children, and 5.80% in the controls (p<0.001); multiple logistic regression analysis revealed that this haplotype confers susceptibility for development of obesity (OR=2.87; 95% CI: 1.29-6.37; p≤0.01). By contrast, the APOA5*4 haplotype (with -1131C alone) did not show similar associations. Our findings also suggest that the APOA5*5 haplotype (1259C alone) can be protective against obesity (OR=0.25; 95% CI: 0.07-0.80; p<0.05). While previous studies in adults demonstrated, that the APOA5 -1131C minor allele confers risk for adult metabolic syndrome, here we show, that the susceptibility nature of this SNP restricted to the APOA5*2 haplotype in pediatric obese subjects.

Genomic association for sexual precocity in beef heifers using pre-selection of genes and haplotype reconstruction

PubMed Central

Barbero, Marina M. D.; Oliveira, Henrique N.; de Camargo, Gregório M. F.; Fernandes Júnior, Gerardo A.; Aspilcueta-Borquis, Rusbel R.; Souza, Fabio R. P.; Boligon, Arione A.; Melo, Thaise P.; Regatieri, Inaê C.; Feitosa, Fabieli L. B.; Fonseca, Larissa F. S.; Magalhães, Ana F. B.; Costa, Raphael B.; Albuquerque, Lucia G.

2018-01-01

Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs. PMID:29293544

Genomic association for sexual precocity in beef heifers using pre-selection of genes and haplotype reconstruction.

PubMed

Takada, Luciana; Barbero, Marina M D; Oliveira, Henrique N; de Camargo, Gregório M F; Fernandes Júnior, Gerardo A; Aspilcueta-Borquis, Rusbel R; Souza, Fabio R P; Boligon, Arione A; Melo, Thaise P; Regatieri, Inaê C; Feitosa, Fabieli L B; Fonseca, Larissa F S; Magalhães, Ana F B; Costa, Raphael B; Albuquerque, Lucia G

2018-01-01

Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs.

Evaluation of a Panel of Single-Nucleotide Polymorphisms in miR-146a and miR-196a2 Genomic Regions in Patients with Chronic Periodontitis.

PubMed

Venugopal, Priyanka; Lavu, Vamsi; RangaRao, Suresh; Venkatesan, Vettriselvi

2017-04-01

Periodontitis is an inflammatory disease caused by bacterial triggering of the host immune-inflammatory response, which in turn is regulated by microRNAs (miRNA). Polymorphisms in the miRNA pathways affect the expression of several target genes such as tumor necrosis factor-α and interleukins, which are associated with progression of disease. The objective of this study was to identify the association between the MiR-146a single nucleotide polymorphisms (SNPs) (rs2910164, rs57095329, and rs73318382), the MiR-196a2 (rs11614913) SNP and chronic periodontitis. Genotyping was performed for the MiR-146a (rs2910164, rs57095329, and rs73318382) and the MiR-196a2 (rs11614913) polymorphisms in 180 healthy controls and 190 cases of chronic periodontitis by the direct Sanger sequencing technique. The strength of the association between the polymorphisms and chronic periodontitis was evaluated using logistic regression analysis. Haplotype and linkage analyses among the polymorphisms was performed. Multifactorial dimensionality reduction was performed to determine epistatic interaction among the polymorphisms. The MiR-196a2 polymorphism revealed a significant inverse association with chronic periodontitis. Haplotype analysis of MiR-146a and MiR-196a2 polymorphisms revealed 13 different combinations, of which 5 were found to have an inverse association with chronic periodontitis. The present study has demonstrated a significant inverse association of MiR-196a2 polymorphism with chronic periodontitis.

Different effects of apolipoprotein A5 SNPs and haplotypes on triglyceride concentration in three ethnic origins.

PubMed

Ken-Dror, Gie; Goldbourt, Uri; Dankner, Rachel

2010-05-01

Several polymorphisms in the ApoA5 gene emerged as important candidate genes in triglyceride metabolism. The aim of this study was to determine the associations between ApoA5 polymorphisms, plasma triglyceride concentrations and the presence of cardiovascular disease (CVD) in three ethnic origins. Genotypes for 15 single nucleotide polymorphisms (SNPs) were determined in 659 older adults (mean age 71+/-7 years) who immigrated to Israel or whose ancestors originated from East Europe (Ashkenazi), North Africa, Asia (Sephardic) or Yemen (Yemenite). The minor alleles of the four common SNPs (rs662799, rs651821, rs2072560 and rs2266788) are associated with an increase of 27-38% in triglyceride concentration among Ashkenazi and Yemenite Jews compared with the major alleles, but not among those of Sephardic origin. Conversely, among the Sephardic group, the presence of the minor allele in SNP rs3135506 compared with the major allele was associated with an increase of 34% in triglyceride concentration. The four SNPs were in significant linkage disequilibrium (D'=0.96-0.99), resulting in three haplotypes H1, H2 and H3, representing 98-99% of the population. Haplotype H2 was significantly associated with triglyceride concentration among Ashkenazi and Yemenite but not among Sephardic Jews. Conversely, haplotype H3 was associated with triglyceride concentration in Sephardic but not in Ashkenazi and Yemenite Jews. Ashkenazi carriers of H2 haplotype had a CVD odds ratio of 2.19 (95% CI: 1.05-4.58) compared with H1 (the most frequent), after adjustment for all other risk factors. These results suggest that different SNPs in ApoA5 polymorphisms may be associated with triglyceride concentration and CVD in each of these ethnic origins.

Single tag for total carbohydrate analysis.

PubMed

Anumula, Kalyan Rao

2014-07-15

Anthranilic acid (2-aminobenzoic acid, 2-AA) has the remarkable property of reacting rapidly with every type of reducing carbohydrate. Reactivity of 2-AA with carbohydrates in aqueous solutions surpasses all other tags reported to date. This unique capability is attributed to the strategically located -COOH which accelerates Schiff base formation. Monosaccharides, oligosaccharides (N-, O-, and lipid linked and glycans in secretory fluids), glycosaminoglycans, and polysaccharides can be easily labeled with 2-AA. With 2-AA, labeling is simple in aqueous solutions containing proteins, peptides, buffer salts, and other ingredients (e.g., PNGase F, glycosidase, and transferase reaction mixtures). In contrast, other tags require relatively pure glycans for labeling in anhydrous dimethyl sulfoxide-acetic acid medium. Acidic conditions are known to cause desialylation, thus requiring a great deal of attention to sample preparation. Simpler labeling is achieved with 2-AA within 30-60 min in mild acetate-borate buffered solution. 2-AA provides the highest sensitivity and resolution in chromatographic methods for carbohydrate analysis in a simple manner. Additionally, 2-AA is uniquely qualified for quantitative analysis by mass spectrometry in the negative mode. Analyses of 2-AA-labeled carbohydrates by electrophoresis and other techniques have been reported. Examples cited here demonstrate that 2-AA is the universal tag for total carbohydrate analysis. Copyright © 2014 Elsevier Inc. All rights reserved.

Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.

Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donormore » ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.« less

Prospecting for pig single nucleotide polymorphisms in the human genome: have we struck gold?

PubMed

Grapes, L; Rudd, S; Fernando, R L; Megy, K; Rocha, D; Rothschild, M F

2006-06-01

Gene-to-gene variation in the frequency of single nucleotide polymorphisms (SNPs) has been observed in humans, mice, rats, primates and pigs, but a relationship across species in this variation has not been described. Here, the frequency of porcine coding SNPs (cSNPs) identified by in silico methods, and the frequency of murine cSNPs, were compared with the frequency of human cSNPs across homologous genes. From 150,000 porcine expressed sequence tag (EST) sequences, a total of 452 SNP-containing sequence clusters were found, totalling 1394 putative SNPs. All the clustered porcine EST annotations and SNP data have been made publicly available at http://sputnik.btk.fi/project?name=swine. Human and murine cSNPs were identified from dbSNP and were characterized as either validated or total number of cSNPs (validated plus non-validated) for comparison purposes. The correlation between in silico pig cSNP and validated human cSNP densities was found to be 0.77 (p < 0.00001) for a set of 25 homologous genes, while a correlation of 0.48 (p < 0.0005) was found for a primarily random sample of 50 homologous human and mouse genes. This is the first evidence of conserved gene-to-gene variability in cSNP frequency across species and indicates that site-directed screening of porcine genes that are homologous to cSNP-rich human genes may rapidly advance cSNP discovery in pigs.

Genome-scale engineering of Saccharomyces cerevisiae with single-nucleotide precision.

PubMed

Bao, Zehua; HamediRad, Mohammad; Xue, Pu; Xiao, Han; Tasan, Ipek; Chao, Ran; Liang, Jing; Zhao, Huimin

2018-07-01

We developed a CRISPR-Cas9- and homology-directed-repair-assisted genome-scale engineering method named CHAnGE that can rapidly output tens of thousands of specific genetic variants in yeast. More than 98% of target sequences were efficiently edited with an average frequency of 82%. We validate the single-nucleotide resolution genome-editing capability of this technology by creating a genome-wide gene disruption collection and apply our method to improve tolerance to growth inhibitors.

Abdominal obesity and hyperglycemia mask the effect of a common APOC3 haplotype on the risk of myocardial infarction123

PubMed Central

Ruiz-Narváez, Edward A; Sacks, Frank M; Campos, Hannia

2013-01-01

Background Plasma apolipoprotein (apo) C-III strongly predicts myocardial infarction (MI) and directly activates atherogenic processes invascularcells.Geneticvariationintheinsulinresponseelementofthe APOC3 promoter is associated with an increased risk of MI. Objective The objective was to determine whether the APOC3 promoter variation affects plasma apo C-III concentrations and MI only when insulin sensitivity is normal. Design TheAPOC3*222haplotype,definedbytheminorallelesofthe single nucleotide polymorphisms 3238C→G, –455T→C, and –482C→T, was studied in 1703 matched nonfatal case-control pairs with MI in the Central Valley of Costa Rica. We used fasting hyper-glycemia and abdominal obesity as surrogates for insulin sensitivity. Results The APOC3*222 haplotype was associated with higher apo C-III concentrations only in those with the lowest waist circumference or fasting glucose concentration. The association between the APOC3*222 haplotype and nonfatal MI, previously reported in this population, was strongly influenced by fasting hyperglycemia and abdominal obesity. The odds ratios for MI for the APOC3*222 haplotype were 1.72 (95% CI: 1.16, 2.54) and 1.84 (1.31, 2.59) in subjects in the lowest quintiles of abdominal obesity and fasting hyperglycemia, respectively, and were 0.75 (0.54, 1.05) and 1.16 (0.85, 1.59) in subjects in the highest quintiles, respectively (P for interaction <0.05). Conclusion The results support the concept that mutations in the APOC3 promoter inhibit the down-regulation of APOC3 expression by insulin. This cardioprotective system becomes dysfunctional in abdominal obesity and hyperglycemia. PMID:18541587

Mitochondrial control region haplotypes of the South American sea lion Otaria flavescens (Shaw, 1800).

PubMed

Artico, L O; Bianchini, A; Grubel, K S; Monteiro, D S; Estima, S C; Oliveira, L R de; Bonatto, S L; Marins, L F

2010-09-01

The South American sea lion, Otaria flavescens, is widely distributed along the Pacific and Atlantic coasts of South America. However, along the Brazilian coast, there are only two nonbreeding sites for the species (Refúgio de Vida Silvestre da Ilha dos Lobos and Refúgio de Vida Silvestre do Molhe Leste da Barra do Rio Grande), both in Southern Brazil. In this region, the species is continuously under the effect of anthropic activities, mainly those related to environmental contamination with organic and inorganic chemicals and fishery interactions. This paper reports, for the first time, the genetic diversity of O. flavescens found along the Southern Brazilian coast. A 287-bp fragment of the mitochondrial DNA control region (D-loop) was analyzed. Seven novel haplotypes were found in 56 individuals (OFA1-OFA7), with OFA1 being the most frequent (47.54%). Nucleotide diversity was moderate (π = 0.62%) and haplotype diversity was relatively low (67%). Furthermore, the median joining network analysis indicated that Brazilian haplotypes formed a reciprocal monophyletic clade when compared to the haplotypes from the Peruvian population on the Pacific coast. These two populations do not share haplotypes and may have become isolated some time back. Further genetic studies covering the entire species distribution are necessary to better understand the biological implications of the results reported here for the management and conservation of South American sea lions.

Detection of single-nucleotide polymorphisms using gold nanoparticles and single-strand-specific nucleases.

PubMed

Chen, Yen-Ting; Hsu, Chiao-Ling; Hou, Shao-Yi

2008-04-15

The current study reports an assay approach that can detect single-nucleotide polymorphisms (SNPs) and identify the position of the point mutation through a single-strand-specific nuclease reaction and a gold nanoparticle assembly. The assay can be implemented via three steps: a single-strand-specific nuclease reaction that allows the enzyme to truncate the mutant DNA; a purification step that uses capture probe-gold nanoparticles and centrifugation; and a hybridization reaction that induces detector probe-gold nanoparticles, capture probe-gold nanoparticles, and the target DNA to form large DNA-linked three-dimensional aggregates of gold nanoparticles. At high temperature (63 degrees C in the current case), the purple color of the perfect match solution would not change to red, whereas a mismatched solution becomes red as the assembled gold nanoparticles separate. Using melting analysis, the position of the point mutation could be identified. This assay provides a convenient colorimetric detection that enables point mutation identification without the need for expensive mass spectrometry. To our knowledge, this is the first report concerning SNP detection based on a single-strand-specific nuclease reaction and a gold nanoparticle assembly.

Effects of apolipoprotein A5 haplotypes on the ratio of triglyceride to high-density lipoprotein cholesterol and the risk for metabolic syndrome in Koreans

PubMed Central

2014-01-01

Background Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. Methods The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). Results The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C–G–A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. Conclusions We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS. PMID:24618354

Association of Cytokine Candidate Genes with Severity of Pain and Co-Occurring Symptoms in Breast Cancer Patients Receiving Chemotherapy

DTIC Science & Technology

2013-10-01

identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year

No association between apolipoprotein E or N-acetyltransferase 2 gene polymorphisms and age-related hearing loss.

PubMed

Dawes, Piers; Platt, Hazel; Horan, Michael; Ollier, William; Munro, Kevin; Pendleton, Neil; Payton, Antony

2015-01-01

Age-related hearing loss has a genetic component, but there have been limited genetic studies in this field. Both N-acetyltransferase 2 and apolipoprotein E genes have previously been associated. However, these studies have either used small sample sizes, examined a limited number of polymorphisms, or have produced conflicting results. Here we use a haplotype tagging approach to determine association with age-related hearing loss and investigate epistasis between these two genes. Candidate gene association study of a continuous phenotype. We investigated haplotype tagging single nucleotide polymorphisms in the N-acetyltransferase 2 gene and the presence/absence of the apolipoprotein E ε4 allele for association with age-related hearing loss in a cohort of 265 Caucasian elderly volunteers from Greater Manchester, United Kingdom. Hearing phenotypes were generated using principal component analysis of the hearing threshold levels for the better ear (severity, slope, and concavity). Genotype data for the N-acetyltransferase 2 gene was obtained from existing genome-wide association study data from the Illumina 610-Quadv1 chip. Apolipoprotein E genotyping was performed using Sequenom technology. Linear regression analysis was performed using Plink and Stata software. No significant associations (P value, > 0.05) were observed between the N-acetyltransferase 2 or apolipoprotein E gene polymorphisms and any hearing factor. No significant association was observed for epistasis analysis of apolipoprotein E ε4 and the N-acetyltransferase 2 single nucleotide polymorphism rs1799930 (NAT2*6A). We found no evidence to support that either N-acetyltransferase 2 or apolipoprotein E gene polymorphisms are associated with age-related hearing loss in a cohort of 265 elderly volunteers. © 2014 The American Laryngological, Rhinological and Otological Society, Inc.

PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma.

PubMed

Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li

2009-03-01

The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.

Haplotypes of heparin-binding epidermal-growth-factor-like growth factor gene are associated with pre-eclampsia.

PubMed

Harendra, Galhenagey Gayani; Jayasekara, Rohan W; Dissanayake, Vajira H W

2012-01-01

Heparin-binding epidermal-growth-factor-like growth factor (HBEGF) plays an important role in placentation, including impaired placentation, the primary defect seen in pre-eclampsia. We carried out a case-control disease-association study to examine the association of single nucleotide polymorphisms (SNP) in the HBEGF gene and haplotypes defined by them with pre-eclampsia in a Sinhalese population in Sri Lanka. A total of 175 women with pre-eclampsia and 171 matched normotensive controls were genotyped for six SNP selected in silico as having putative functional effects using mass array Sequenom iplex methodology and a newly designed polymerase chain reaction-restriction fragment length polymorphism assay. The individual SNP were not associated with pre-eclampsia. The haplotypes defined by them, however, showed both predisposing (rs13385T,rs2074613G,rs2237076G,rs2074611C,rs4150196A,rs1862176A; odds ratio,1.65; 95% confidence interval1.04-2.60; P=0.032) and protective (rs13385C,rs2074613G,rs2237076A,rs2074611C,rs4150196A,rs1862176A; odds ratio,0.20; 95% confidence interval, 0.04-0.89; P=0.034) effects. These results confirm that polymorphisms in the HGEGF gene are associated with pre-eclampsia. The haplotypes are likely to exert their effects through the numerous transcription regulation factors binding to the polymorphic sites, namely GATA-1, GATA-3, MZF-1 and AML-1a. © 2011 The Authors. Journal of Obstetrics and Gynaecology Research © 2011 Japan Society of Obstetrics and Gynecology.

A single nucleotide polymorphism in the 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene ( HMGCR) influences the serum triacylglycerol relationship with dietary fat and fibre in the European Prospective Investigation into Cancer and Nutrition in Norfolk (EPIC-Norfolk) study.

PubMed

Freitas, Renata N; Khaw, Kay-Tee; Wu, Kelvin; Bowman, Richard; Jeffery, Hannah; Luben, Robert; Wareham, Nicolas J; Bingham, Sheila A

2010-09-01

The objective of the present study was to investigate the influence of the single nucleotide polymorphism (rs17238540) at the 3-hydroxy-3-methylglutaryl-coenzyme A reductase gene (HMGCR) on the relationship between serum lipids and dietary fat and fibre (NSP). FFQ and pyrosequencing were used to assess cross-sectional dietary intake and HMGCR genotype in a population study with data for serum lipids available. Genotype frequencies and allele distributions for 23 011 participants were: TT 95.65 %, TG 4.29 % and GG 0.06 %; T 97.8 % and G 2.2 %. In regression analyses, the TG+GG group showed a significant positive relationship between TAG and SFA intake (+0.11 (95 % CI 0.02, 0.20) mmol TAG/l; P = 0.017; per 3 % SFA energy increase) while the TT individuals showed no change in the TAG levels related to SFA intake ( - 0.0007 (95 % CI - 0.02, 0.02) mmol TAG/l; P = 0.99). TG+GG individuals showed an inverse relationship between TAG and fibre intake higher ( - 0.14 (95 % CI - 0.22, - 0.05) mmol TAG/l than the TT group ( - 0.04 (95 % CI - 0.06, - 0.02) mmol TAG/l). In both cases the respective coefficient regressions of TAG were different between the genotype groups (Z = 2.27, P = 0.023 for SFA intake; Z = 2.19, P = 0.029 for fibre intake). Individuals carrying the G allele may show a greater response in lower TAG levels with reduced SFA intake and increased fibre intake compared with those homozygous for the T allele. The effectiveness of different dietary interventions to control serum lipids may vary according to HMGCR genotype.

Parallel gene analysis with allele-specific padlock probes and tag microarrays

PubMed Central

Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

2003-01-01

Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

Association of polymorphisms and haplotypes in the cytochrome P450 1B1 gene with uterine leiomyoma: A case control study

PubMed Central

SALIMI, SAEEDEH; KHODAMIAN, MARYAM; NAROOIE-NEJAD, MEHRNAZ; HAJIZADEH, AZAM; FAZELI, KIMIA; NAMAZI, LIDA; YAGHMAEI, MINOO

2015-01-01

Uterine leiomyoma (UL) is an estrogen-dependent neoplasm of the uterus and estrogen metabolizing enzymes affect its promotion and progression. The aim of the present study was to evaluate the association between four single-nucleotide polymorphisms (SNPs) of the cytochrome P450 1B1 (CYP1B1) gene and UL risk. Four SNPs of the CYP1B1 gene in 105 UL patients and 112 unrelated healthy controls were genotyped using a direct sequencing method. Haplotype analyses were performed with UNPHASED software and linkage disequilibrium (LD) was assessed by Haploview software. There were no associations between Leu432Val (rs1056836), Asp449Asp (rs1056837) and Asn453Ser (rs1800440) polymorphisms of the CYP1B1 gene and UL. Although the genotypic frequencies of the Arg368His (rs79204362) polymorphism did not differ between the two groups, the frequency of A (His) allele was significantly higher in UL females (P=0.02). In addition, the frequency of GTAA haplotype was significantly higher in the controls and played a protective role in UL susceptibility. A strong LD between the three common SNPs (rs1056836, rs1056837 and rs1800440) in the CYP1B1 gene was observed in the population. In conclusion, a higher frequency of the CYP1B1 368His (A) allele was observed in UL females. The frequency of the GTAA haplotype was significantly higher in healthy females and this haplotype played a protective role in UL susceptibility. PMID:26075073

Abdominal obesity and hyperglycemia mask the effect of a common APOC3 haplotype on the risk of myocardial infarction.

PubMed

Ruiz-Narváez, Edward A; Sacks, Frank M; Campos, Hannia

2008-06-01

Plasma apolipoprotein (apo) C-III strongly predicts myocardial infarction (MI) and directly activates atherogenic processes in vascular cells. Genetic variation in the insulin response element of the APOC3 promoter is associated with an increased risk of MI. The objective was to determine whether the APOC3 promoter variation affects plasma apo C-III concentrations and MI only when insulin sensitivity is normal. The APOC3*222 haplotype, defined by the minor alleles of the single nucleotide polymorphisms 3238C-->G, -455T-->C, and -482C-->T, was studied in 1703 matched nonfatal case-control pairs with MI in the Central Valley of Costa Rica. We used fasting hyperglycemia and abdominal obesity as surrogates for insulin sensitivity. The APOC3*222 haplotype was associated with higher apo C-III concentrations only in those with the lowest waist circumference or fasting glucose concentration. The association between the APOC3*222 haplotype and nonfatal MI, previously reported in this population, was strongly influenced by fasting hyperglycemia and abdominal obesity. The odds ratios for MI for the APOC3*222 haplotype were 1.72 (95% CI: 1.16, 2.54) and 1.84 (1.31, 2.59) in subjects in the lowest quintiles of abdominal obesity and fasting hyperglycemia, respectively, and were 0.75 (0.54, 1.05) and 1.16 (0.85, 1.59) in subjects in the highest quintiles, respectively (P for interaction <0.05). The results support the concept that mutations in the APOC3 promoter inhibit the down-regulation of APOC3 expression by insulin. This cardioprotective system becomes dysfunctional in abdominal obesity and hyperglycemia.

Haplotype Analysis Discriminates Genetic Risk for DR3-Associated Endocrine Autoimmunity and Helps Define Extreme Risk for Addison’s Disease

PubMed Central

Baker, Peter R.; Baschal, Erin E.; Fain, Pam R.; Triolo, Taylor M.; Nanduri, Priyaanka; Siebert, Janet C.; Armstrong, Taylor K.; Babu, Sunanda R.; Rewers, Marian J.; Gottlieb, Peter A.; Barker, Jennifer M.; Eisenbarth, George S.

2010-01-01

Context: Multiple autoimmune disorders (e.g. Addison’s disease, type 1 diabetes, celiac disease) are associated with HLA-DR3, but it is likely that alleles of additional genes in linkage disequilibrium with HLA-DRB1 contribute to disease. Objective: The objective of the study was to characterize major histocompatability complex (MHC) haplotypes conferring extreme risk for autoimmune Addison’s disease (AD). Design, Setting, and Participants: Eighty-six 21-hydroxylase autoantibody-positive, nonautoimmune polyendocrine syndrome type 1, Caucasian individuals collected from 1992 to 2009 with clinical AD from 68 families (12 multiplex and 56 simplex) were genotyped for HLA-DRB1, HLA-DQB1, MICA, HLA-B, and HLA-A as well as high density MHC single-nucleotide polymorphism (SNP) analysis for 34. Main Outcome Measures: AD and genotype were measured. Result: Ninety-seven percent of the multiplex individuals had both HLA-DR3 and HLA-B8 vs. 60% of simplex AD patients (P = 9.72 × 10−4) and 13% of general population controls (P = 3.00 × 10−19). The genotype DR3/DR4 with B8 was present in 85% of AD multiplex patients, 24% of simplex patients, and 1.5% of control individuals (P = 4.92 × 10−191). The DR3-B8 haplotype of AD patients had HLA-A1 less often (47%) than controls (81%, P = 7.00 × 10−5) and type 1 diabetes patients (73%, P = 1.93 × 10−3). Analysis of 1228 SNPs across the MHC for individuals with AD revealed a shorter conserved haplotype (3.8) with the loss of the extended conserved 3.8.1 haplotype approximately halfway between HLA-B and HLA-A. Conclusion: Extreme risk for AD, especially in multiplex families, is associated with haplotypic DR3 variants, in particular a portion (3.8) but not all of the conserved 3.8.1 haplotype. PMID:20631027

A haplotype of three SNPs in FTO had a strong association with body composition and BMI in Iranian male adolescents.

PubMed

Kalantari, Naser; Keshavarz Mohammadi, Nastaran; Izadi, Pantea; Doaei, Saeid; Gholamalizadeh, Maryam; Eini-Zinab, Hassan; Salonurmi, Tuire; Rafieifar, Shahram; Janipoor, Reza; Azizi Tabesh, Ghasem

2018-01-01

Single-nucleotide polymorphisms (SNPs), which are located in the first intron of the FTO gene, are reported to be associated with body weight and the body mass index (BMI). However, their effects on anthropometric measurements in adolescents are poorly understood. This study aimed to investigate the association of three adjacent polymorphisms (rs9930506, rs9930501, & rs9932754) in the FTO gene with anthropometric indices in Iranian adolescent males. The participants comprised a total of 237 adolescent males who were recruited randomly from two high schools in Tehran, Iran. The DNA samples were genotyped for the FTO gene polymorphisms by DNA sequencing. BMI, body fat percentage (BF%), and body muscle percentage (BM%) were determined using a validated bioelectrical impedance analysis scale. The association of the FTO polymorphisms with weight, height, BMI, BF%, and BM% was investigated. A haplotype of rs9930506, rs9930501, and rs9932754 (GGT) in the first intron of the FTO with complete linkage disequilibrium (LD) was found to be significantly associated with higher weight (OR = 1.32), BMI (OR = 5.36) and BF% (OR = 1.46), and lower BM% (OR = 3.59) (all P<0.001). None of the students with GGC genotypes were underweight, while all of the students with AAT genotypes had high muscle mass. A haplotype in the first intron of the FTO gene had a strong association with obesity indices in Iranian adolescent males. The FTO gene polymorphisms might have greater effects on anthropometric indices than what was previously imagined. Moreover, we suggested that the FTO gene exerted their effects on anthropometric measurements through haplotypes (and not single SNPs).

Relationships among calpastatin single nucleotide polymorphisms, calpastatin expression and tenderness in pork longissimus

USDA-ARS?s Scientific Manuscript database

Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...

Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7

USDA-ARS?s Scientific Manuscript database

Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...

Single nucleotide polymorphism analysis reveals heterogeneity within a seedling tree population of a polyembryonic mango cultivar.

PubMed

Winterhagen, Patrick; Wünsche, Jens-Norbert

2016-05-01

Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.

Genetic Structures of Copy Number Variants Revealed by Genotyping Single Sperm

PubMed Central

Luo, Minjie; Cui, Xiangfeng; Fredman, David; Brookes, Anthony J.; Azaro, Marco A.; Greenawalt, Danielle M.; Hu, Guohong; Wang, Hui-Yun; Tereshchenko, Irina V.; Lin, Yong; Shentu, Yue; Gao, Richeng; Shen, Li; Li, Honghua

2009-01-01

Background Copy number variants (CNVs) occupy a significant portion of the human genome and may have important roles in meiotic recombination, human genome evolution and gene expression. Many genetic diseases may be underlain by CNVs. However, because of the presence of their multiple copies, variability in copy numbers and the diploidy of the human genome, detailed genetic structure of CNVs cannot be readily studied by available techniques. Methodology/Principal Findings Single sperm samples were used as the primary subjects for the study so that CNV haplotypes in the sperm donors could be studied individually. Forty-eight CNVs characterized in a previous study were analyzed using a microarray-based high-throughput genotyping method after multiplex amplification. Seventeen single nucleotide polymorphisms (SNPs) were also included as controls. Two single-base variants, either allelic or paralogous, could be discriminated for all markers. Microarray data were used to resolve SNP alleles and CNV haplotypes, to quantitatively assess the numbers and compositions of the paralogous segments in each CNV haplotype. Conclusions/Significance This is the first study of the genetic structure of CNVs on a large scale. Resulting information may help understand evolution of the human genome, gain insight into many genetic processes, and discriminate between CNVs and SNPs. The highly sensitive high-throughput experimental system with haploid sperm samples as subjects may be used to facilitate detailed large-scale CNV analysis. PMID:19384415

Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

PubMed

Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

2013-09-23

Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

Effect of Variation in Diacylglycerol Kinase Eta (DGKH) Gene on Brain Function in a Cohort at Familial Risk of Bipolar Disorder

PubMed Central

Whalley, Heather C; Papmeyer, Martina; Romaniuk, Liana; Johnstone, Eve C; Hall, Jeremy; Lawrie, Stephen M; Sussmann, Jessika E; McIntosh, Andrew M

2012-01-01

Several lines of evidence indicate that the diacylglycerol kinase eta (DGKH) gene is implicated in the etiology of bipolar disorder (BD). However, the functional neural mechanisms of DGKH's risk association remain unknown. Therefore, we examined the effects of three haplotype-tagging risk variants in DGKH (single nucleotide polymorphisms rs9315885, rs1012053, and rs1170191) on brain activation using a verbal fluency functional magnetic resonance imaging task. The subject groups consisted of young individuals at high familial risk of BD (n=81) and a comparison group of healthy controls (n=75). Individuals were grouped based on risk haplotypes described in previous studies. There was a significant risk haplotype*group interaction in the left medial frontal gyrus (BA10, involving anterior cingulate BA32), left precuneus, and right parahippocampal gyrus. All regions demonstrated greater activation during the baseline condition than sentence completion. Individuals at high familial risk for BD homozygous for the DGKH risk haplotype demonstrated relatively greater activation (poor suppression) of these regions during the task vs the low-risk haplotype subjects. The reverse pattern was seen for the control subjects. These findings suggest that there are differential effects of the DGKH gene in healthy controls vs the bipolar high-risk group, which manifests as a failure to disengage default-mode regions in those at familial risk carrying the risk haplotype. PMID:22048461

A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

PubMed

Zeng, Lingwen; Xiao, Zhuo

2017-01-01

A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

Single Nucleotide Polymorphism Analysis of European Archaeological M. leprae DNA

PubMed Central

Watson, Claire L.; Lockwood, Diana N. J.

2009-01-01

Background Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA) from medieval bones and single nucleotide polymorphism (SNP) typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. Methods and Findings Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia) and are dated around the medieval period (476 to 1350 A.D.). we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs) in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3). Conclusions These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide. PMID:19847306

Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients

NASA Astrophysics Data System (ADS)

Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier

2016-05-01

We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f

Mapping a New Spontaneous Preterm Birth Susceptibility Gene, IGF1R, Using Linkage, Haplotype Sharing, and Association Analysis

PubMed Central

Luukkonen, Aino; Teramo, Kari; Puttonen, Hilkka; Ojaniemi, Marja; Varilo, Teppo; Chaudhari, Bimal P.; Plunkett, Jevon; Murray, Jeffrey C.; McCarroll, Steven A.; Muglia, Louis J.; Palotie, Aarno; Hallman, Mikko

2011-01-01

Preterm birth is the major cause of neonatal death and serious morbidity. Most preterm births are due to spontaneous onset of labor without a known cause or effective prevention. Both maternal and fetal genomes influence the predisposition to spontaneous preterm birth (SPTB), but the susceptibility loci remain to be defined. We utilized a combination of unique population structures, family-based linkage analysis, and subsequent case-control association to identify a susceptibility haplotype for SPTB. Clinically well-characterized SPTB families from northern Finland, a subisolate founded by a relatively small founder population that has subsequently experienced a number of bottlenecks, were selected for the initial discovery sample. Genome-wide linkage analysis using a high-density single-nucleotide polymorphism (SNP) array in seven large northern Finnish non-consanginous families identified a locus on 15q26.3 (HLOD 4.68). This region contains the IGF1R gene, which encodes the type 1 insulin-like growth factor receptor IGF-1R. Haplotype segregation analysis revealed that a 55 kb 12-SNP core segment within the IGF1R gene was shared identical-by-state (IBS) in five families. A follow-up case-control study in an independent sample representing the more general Finnish population showed an association of a 6-SNP IGF1R haplotype with SPTB in the fetuses, providing further evidence for IGF1R as a SPTB predisposition gene (frequency in cases versus controls 0.11 versus 0.05, P = 0.001, odds ratio 2.3). This study demonstrates the identification of a predisposing, low-frequency haplotype in a multifactorial trait using a well-characterized population and a combination of family and case-control designs. Our findings support the identification of the novel susceptibility gene IGF1R for predisposition by the fetal genome to being born preterm. PMID:21304894

Efficient algorithms for polyploid haplotype phasing.

PubMed

He, Dan; Saha, Subrata; Finkers, Richard; Parida, Laxmi

2018-05-09

Inference of haplotypes, or the sequence of alleles along the same chromosomes, is a fundamental problem in genetics and is a key component for many analyses including admixture mapping, identifying regions of identity by descent and imputation. Haplotype phasing based on sequencing reads has attracted lots of attentions. Diploid haplotype phasing where the two haplotypes are complimentary have been studied extensively. In this work, we focused on Polyploid haplotype phasing where we aim to phase more than two haplotypes at the same time from sequencing data. The problem is much more complicated as the search space becomes much larger and the haplotypes do not need to be complimentary any more. We proposed two algorithms, (1) Poly-Harsh, a Gibbs Sampling based algorithm which alternatively samples haplotypes and the read assignments to minimize the mismatches between the reads and the phased haplotypes, (2) An efficient algorithm to concatenate haplotype blocks into contiguous haplotypes. Our experiments showed that our method is able to improve the quality of the phased haplotypes over the state-of-the-art methods. To our knowledge, our algorithm for haplotype blocks concatenation is the first algorithm that leverages the shared information across multiple individuals to construct contiguous haplotypes. Our experiments showed that it is both efficient and effective.

Molecular characterization of a long range haplotype affecting protein yield and mastitis susceptibility in Norwegian Red cattle.

PubMed

Sodeland, Marte; Grove, Harald; Kent, Matthew; Taylor, Simon; Svendsen, Morten; Hayes, Ben J; Lien, Sigbjørn

2011-08-11

Previous fine mapping studies in Norwegian Red cattle (NRC) in the region 86-90.4 Mb on Bos taurus chromosome 6 (BTA6) has revealed a quantitative trait locus (QTL) for protein yield (PY) around 88 Mb and a QTL for clinical mastitis (CM) around 90 Mb. The close proximity of these QTLs may partly explain the unfavorable genetic correlation between these two traits in NRC. A long range haplotype covering this region was introduced into the NRC population through the importation of a Holstein-Friesian bull (1606 Frasse) from Sweden in the 1970s. It has been suggested that this haplotype has a favorable effect on milk protein content but an unfavorable effect on mastitis susceptibility. Selective breeding for milk production traits is likely to have increased the frequency of this haplotype in the NRC population. Association mapping for PY and CM in NRC was performed using genotypes from 556 SNPs throughout the region 86-97 Mb on BTA6 and daughter-yield-deviations (DYDs) from 2601 bulls made available from the Norwegian dairy herd recording system. Highest test scores for PY were found for single-nucleotide polymorphisms (SNPs) within and surrounding the genes CSN2 and CSN1S2, coding for the β-casein and α(S2)-casein proteins. High coverage re-sequencing by high throughput sequencing technology enabled molecular characterization of a long range haplotype from 1606 Frasse encompassing these two genes. Haplotype analysis of a large number of descendants from this bull indicated that the haplotype was not markedly disrupted by recombination in this region. The haplotype was associated with both increased milk protein content and increased susceptibility to mastitis, which might explain parts of the observed genetic correlation between PY and CM in NRC. Plausible causal polymorphisms affecting PY were detected in the promoter region and in the 5'-flanking UTR of CSN1S2. These polymorphisms could affect transcription or translation of CSN1S2 and thereby affect the amount

Haplotype analysis indicates an association between the DOPA decarboxylase (DDC) gene and nicotine dependence.

PubMed

Ma, Jennie Z; Beuten, Joke; Payne, Thomas J; Dupont, Randolph T; Elston, Robert C; Li, Ming D

2005-06-15

DOPA decarboxylase (DDC; also known as L-amino acid decarboxylase; AADC) is involved in the synthesis of dopamine, norepinephrine and serotonin. Because the mesolimbic dopaminergic system is implicated in the reinforcing effects of many drugs, including nicotine, the DDC gene is considered a plausible candidate for involvement in the development of vulnerability to nicotine dependence (ND). Further, this gene is located within the 7p11 region that showed a 'suggestive linkage' to ND in our previous genome-wide scan in the Framingham Heart Study population. In the present study, we tested eight single nucleotide polymorphisms (SNPs) within DDC for association with ND, which was assessed by smoking quantity (SQ), the heaviness of smoking index (HSI) and the Fagerstrom test for ND (FTND) score, in a total of 2037 smokers and non-smokers from 602 nuclear families of African- or European-American (AA or EA, respectively) ancestry. Association analysis for individual SNPs using the PBAT-GEE program indicated that SNP rs921451 was significantly associated with two of the three adjusted ND measures in the EA sample (P=0.01-0.04). Haplotype-based association analysis revealed a protective T-G-T-G haplotype for rs921451-rs3735273-rs1451371-rs2060762 in the AA sample, which was significantly associated with all three adjusted ND measures after correction for multiple testing (min Z=-2.78, P=0.006 for HSI). In contrast, we found a high-risk T-G-T-G haplotype for a different SNP combination in the EA sample, rs921451-rs3735273-rs1451371-rs3757472, which showed a significant association after Bonferroni correction with the SQ and FTND score (max Z=2.73, P=0.005 for FTND). In summary, our findings provide the first evidence for the involvement of DDC in the susceptibility to ND and, further, reveal the racial specificity of its impact.

HAPRAP: a haplotype-based iterative method for statistical fine mapping using GWAS summary statistics.

PubMed

Zheng, Jie; Rodriguez, Santiago; Laurin, Charles; Baird, Denis; Trela-Larsen, Lea; Erzurumluoglu, Mesut A; Zheng, Yi; White, Jon; Giambartolomei, Claudia; Zabaneh, Delilah; Morris, Richard; Kumari, Meena; Casas, Juan P; Hingorani, Aroon D; Evans, David M; Gaunt, Tom R; Day, Ian N M

2017-01-01

Fine mapping is a widely used approach for identifying the causal variant(s) at disease-associated loci. Standard methods (e.g. multiple regression) require individual level genotypes. Recent fine mapping methods using summary-level data require the pairwise correlation coefficients ([Formula: see text]) of the variants. However, haplotypes rather than pairwise [Formula: see text], are the true biological representation of linkage disequilibrium (LD) among multiple loci. In this article, we present an empirical iterative method, HAPlotype Regional Association analysis Program (HAPRAP), that enables fine mapping using summary statistics and haplotype information from an individual-level reference panel. Simulations with individual-level genotypes show that the results of HAPRAP and multiple regression are highly consistent. In simulation with summary-level data, we demonstrate that HAPRAP is less sensitive to poor LD estimates. In a parametric simulation using Genetic Investigation of ANthropometric Traits height data, HAPRAP performs well with a small training sample size (N < 2000) while other methods become suboptimal. Moreover, HAPRAP's performance is not affected substantially by single nucleotide polymorphisms (SNPs) with low minor allele frequencies. We applied the method to existing quantitative trait and binary outcome meta-analyses (human height, QTc interval and gallbladder disease); all previous reported association signals were replicated and two additional variants were independently associated with human height. Due to the growing availability of summary level data, the value of HAPRAP is likely to increase markedly for future analyses (e.g. functional prediction and identification of instruments for Mendelian randomization). The HAPRAP package and documentation are available at http://apps.biocompute.org.uk/haprap/ CONTACT: : jie.zheng@bristol.ac.uk or tom.gaunt@bristol.ac.ukSupplementary information: Supplementary data are available at

Endurance exercise training effects on body fatness, VO2max, HDL-C subfractions, and glucose tolerance are influenced by a PLIN haplotype in older Caucasians.

PubMed

Jenkins, Nathan T; McKenzie, Jennifer A; Damcott, Coleen M; Witkowski, Sarah; Hagberg, James M

2010-03-01

Perilipins are lipid droplet-coating proteins that regulate intracellular lipolysis in adipocytes. A haplotype of two perilipin gene (PLIN) single nucleotide polymorphisms, 13041A>G and 14995A>T, has been previously associated with obesity risk. Furthermore, the available data indicate that this association may be modified by sex. We hypothesized that this haplotype would associate with body fatness, aerobic fitness, and a number of cardiovascular (CV) risk factor phenotypes before and after a 6-mo endurance exercise training program in sedentary older Caucasians. The major haplotype group (13041A/14995A; n = 57) had significantly lower body mass index (BMI) and body fatness compared with noncarriers of the AA haplotype (n = 44) before the training intervention. Training improved body composition in both groups, but fatness remained higher in noncarriers than AA carriers after training. This fat retention in noncarriers blunted their maximal oxygen uptake (Vo(2 max)) adaptation to training. Female noncarriers had substantially higher concentrations of several conventionally and NMR-measured HDL-C subfractions than male noncarriers before and after training, but only minimal differences were found between the sexes in the AA haplotype group. Haplotype group differences in baseline and after-training responses to an oral glucose tolerance test (OGTT) also differed by sex, as noncarrier men had the highest baseline area under the insulin curve (insulin AUC), but were the only group to significantly improve insulin AUC with training. The insulin sensitivity index and plasma glucose responses to the OGTT were more favorable in AA carriers than noncarriers before and after training. Overall, our findings suggest that PLIN variation explains some of the interindividual differences in the response of obesity and CV phenotypes to exercise training. Furthermore, these data contribute to the growing understanding of PLIN as a candidate gene for human obesity and the

Association analysis of calpain 10 gene variants/haplotypes with gestational diabetes mellitus among Mexican women.

PubMed

Castro-Martínez, Anna Gabriela; Sánchez-Corona, José; Vázquez-Vargas, Adriana Patricia; García-Zapién, Alejandra Guadalupe; López-Quintero, Andres; Villalpando-Velazco, Héctor Javier; Flores-Martínez, Silvia Esperanza

2018-02-28

Gestational diabetes mellitus (GDM) is a metabolically complex disease with major genetic determinants. GDM has been associated with insulin resistance and dysfunction of pancreatic beta cells, so the GDM candidate genes are those that encode proteins modulating the function and secretion of insulin, such as that for calpain 10 (CAPN10). This study aimed to assess whether single nucleotide polymorphism (SNP)-43, SNP-44, SNP-63, and the indel-19 variant, and specific haplotypes of the CAPN10 gene were associated with gestational diabetes mellitus. We studied 116 patients with gestational diabetes mellitus and 83 women with normal glucose tolerance. Measurements of anthropometric and biochemical parameters were performed. SNP-43, SNP-44, and SNP-63 were identified by polymerase chain reaction (PCR)-restriction fragment length polymorphisms, while the indel-19 variant was detected by TaqMan qPCR assays.  The allele, genotype, and haplotype frequencies of the four variants did not differ significantly between women with gestational diabetes mellitus and controls. However, in women with gestational diabetes mellitus, glucose levels were significantly higher bearing the 3R/3R genotype than in carriers of the 3R/2R genotype of the indel-19 variant (p = 0.006). In conclusion, the 3R/3R genotype of the indel-19 variant of the CAPN-10 gene influenced increased glucose levels in these Mexican women with gestational diabetes mellitus.

Italian familial defective apolipoprotein B patients share a unique haplotype with other Caucasian patients.

PubMed

Cefalù, A B; Barbagallo, C M; Sesti, E; Caldarella, R; Polizzi, F; Marino, G; Noto, D; Rolleri, M; Travali, S; Scalisi, G; Notarbartolo, A; Corsini, A; Bertolini, S; Averna, M R

2001-09-01

Familial defective apolipoprotein (apo) B-100 together with familial hypercholesterolemia are the two common genetic conditions that cause hypercholesterolemia. Familial defective apolipoprotein B-100 is due to mutations around codon 3500 of the apo B gene. The most-characterized mutation is a G>A transition at nucleotide 10,708 that results in the substitution of arginine by glutamine at codon 3500 (Apo B Arg3500Gln). Two other mutations are caused by a C>T transition, one at nucleotide 10,800 (Apo B Arg3531Cys) and the other at nucleotide 10,707 (apo B Arg3500Trp). In the present study we describe three new Italian cases of familial defective apolipoprotein B-100 (Apo B Arg3500Gln), one from the Liguria region and two from Sicily, and the haplotype of the apo B gene co-segregating with the mutation. By screening two groups of probands, clinically diagnosed as having Familial Hypercholesterolemia (700 from mainland Italy and 305 from Sicily), the prevalence of familial defective apolipoprotein B-100 due to Arg3500Gln was found to be very low (0.28% and 0.65%, respectively). The Arg3531Cys mutation was not detected in any proband. In the three new families with Arg3500Gln mutation in the present study and in one previously described in Italy, the mutation was associated with a unique apo B haplotype, which is consistent with data previously reported for Caucasian patients [XbaI-, MspI+, EcoRI-, presence of the 5' signal peptide insertion (Ins) allele, and the 49-repeat allele of the 3'-VNTR].

[Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

PubMed

Wu, Lei; He, Yao; Zhang, Di

2015-11-01

To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

Assembly and diploid architecture of an individual human genome via single-molecule technologies

PubMed Central

Pendleton, Matthew; Sebra, Robert; Pang, Andy Wing Chun; Ummat, Ajay; Franzen, Oscar; Rausch, Tobias; Stütz, Adrian M; Stedman, William; Anantharaman, Thomas; Hastie, Alex; Dai, Heng; Fritz, Markus Hsi-Yang; Cao, Han; Cohain, Ariella; Deikus, Gintaras; Durrett, Russell E; Blanchard, Scott C; Altman, Roger; Chin, Chen-Shan; Guo, Yan; Paxinos, Ellen E; Korbel, Jan O; Darnell, Robert B; McCombie, W Richard; Kwok, Pui-Yan; Mason, Christopher E; Schadt, Eric E; Bashir, Ali

2015-01-01

We present the first comprehensive analysis of a diploid human genome that combines single-molecule sequencing with single-molecule genome maps. Our hybrid assembly markedly improves upon the contiguity observed from traditional shotgun sequencing approaches, with scaffold N50 values approaching 30 Mb, and we identified complex structural variants (SVs) missed by other high-throughput approaches. Furthermore, by combining Illumina short-read data with long reads, we phased both single-nucleotide variants and SVs, generating haplotypes with over 99% consistency with previous trio-based studies. Our work shows that it is now possible to integrate single-molecule and high-throughput sequence data to generate de novo assembled genomes that approach reference quality. PMID:26121404

Assembly and diploid architecture of an individual human genome via single-molecule technologies.

PubMed

Pendleton, Matthew; Sebra, Robert; Pang, Andy Wing Chun; Ummat, Ajay; Franzen, Oscar; Rausch, Tobias; Stütz, Adrian M; Stedman, William; Anantharaman, Thomas; Hastie, Alex; Dai, Heng; Fritz, Markus Hsi-Yang; Cao, Han; Cohain, Ariella; Deikus, Gintaras; Durrett, Russell E; Blanchard, Scott C; Altman, Roger; Chin, Chen-Shan; Guo, Yan; Paxinos, Ellen E; Korbel, Jan O; Darnell, Robert B; McCombie, W Richard; Kwok, Pui-Yan; Mason, Christopher E; Schadt, Eric E; Bashir, Ali

2015-08-01

We present the first comprehensive analysis of a diploid human genome that combines single-molecule sequencing with single-molecule genome maps. Our hybrid assembly markedly improves upon the contiguity observed from traditional shotgun sequencing approaches, with scaffold N50 values approaching 30 Mb, and we identified complex structural variants (SVs) missed by other high-throughput approaches. Furthermore, by combining Illumina short-read data with long reads, we phased both single-nucleotide variants and SVs, generating haplotypes with over 99% consistency with previous trio-based studies. Our work shows that it is now possible to integrate single-molecule and high-throughput sequence data to generate de novo assembled genomes that approach reference quality.

Novel Tenascin-C Haplotype Modifies the Risk for a Failure to Heal After Rotator Cuff Repair.

PubMed

Kluger, Rainer; Huber, Klaus R; Seely, Philipp G; Berger, Christian E; Frommlet, Florian

2017-11-01

Several single-nucleotide polymorphisms (SNPs) in the TNC gene have recently been found to be associated with degenerative rotator cuff tears. Exonic SNPs in the TNC gene are related to the risk for a failure to heal after rotator cuff repair. Case-control study; Level of evidence, 3. A total of 302 patients from the Vienna area and European Caucasian ancestry underwent mini-open rotator cuff repair for a full-thickness superior or posterosuperior tear and were assessed for the integrity of the repair 1 year postoperatively with a real-time 7.5- to 10-MHz ultrasound linear array transducer. Outcomes were classified as intact (complete footprint coverage), small (<200 mm 2 ), or large (≥200 mm 2 ) recurrent defect. Patients were genotyped for 15 previously identified risk SNPs within a 49-kbp segment of the TNC gene with the KASP genotyping technology or the Ion-Torrent Personal Genome Machine System. All recurrent defects were atraumatic failures, and the overall failure rate was 39.7%. Of the traditional risk factors, only the initial tear size was significantly associated with a failure to heal. In a multinomial logistic regression model, the T allele at rs1138545 [C>T] was protective for a large recurrent defect (odds ratio = 0.16; 95% CI, 0.09-0.31). The role of rs1138545 was further backed by haplotype analysis, which showed that the combination of the C allele at rs1138545 [C>T], the A allele at rs2104772 [A>T], and the G allele at rs10759752 [A>G] formed the risk-related haplotype [CAG]. The CAG haplotype was associated with large recurrent defects ( P < .0001; haplotype frequency, 0.394; haplotype score, 4.518). Exonic marker rs1138545 transcribed into all isoforms of the TNC protein, whereas exonic marker rs2104772, which has been associated with Achilles tendinopathy before, transcribed only into large isoforms of the TNC protein. Recurrent defects after rotator cuff repairs are clinically relevant, and a heritable component of the disorder is plausible

Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR.

PubMed

Tyson, Jess; Armour, John A L

2012-12-11

Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.

Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR

PubMed Central

2012-01-01

Background Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. Results In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. Conclusion This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example. PMID:23231411

SPECHT - single-stage phosphopeptide enrichment and stable-isotope chemical tagging: quantitative phosphoproteomics of insulin action in muscle.

PubMed

Kettenbach, Arminja N; Sano, Hiroyuki; Keller, Susanna R; Lienhard, Gustav E; Gerber, Scott A

2015-01-30

The study of cellular signaling remains a significant challenge for translational and clinical research. In particular, robust and accurate methods for quantitative phosphoproteomics in tissues and tumors represent significant hurdles for such efforts. In the present work, we design, implement and validate a method for single-stage phosphopeptide enrichment and stable isotope chemical tagging, or SPECHT, that enables the use of iTRAQ, TMT and/or reductive dimethyl-labeling strategies to be applied to phosphoproteomics experiments performed on primary tissue. We develop and validate our approach using reductive dimethyl-labeling and HeLa cells in culture, and find these results indistinguishable from data generated from more traditional SILAC-labeled HeLa cells mixed at the cell level. We apply the SPECHT approach to the quantitative analysis of insulin signaling in a murine myotube cell line and muscle tissue, identify known as well as new phosphorylation events, and validate these phosphorylation sites using phospho-specific antibodies. Taken together, our work validates chemical tagging post-single-stage phosphoenrichment as a general strategy for studying cellular signaling in primary tissues. Through the use of a quantitatively reproducible, proteome-wide phosphopeptide enrichment strategy, we demonstrated the feasibility of post-phosphopeptide purification chemical labeling and tagging as an enabling approach for quantitative phosphoproteomics of primary tissues. Using reductive dimethyl labeling as a generalized chemical tagging strategy, we compared the performance of post-phosphopeptide purification chemical tagging to the well established community standard, SILAC, in insulin-stimulated tissue culture cells. We then extended our method to the analysis of low-dose insulin signaling in murine muscle tissue, and report on the analytical and biological significance of our results. Copyright © 2014 Elsevier B.V. All rights reserved.

Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing

NASA Astrophysics Data System (ADS)

Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

2016-05-01

A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori

Spatial and temporal distribution of the neutral polymorphisms in the last ZFX intron: analysis of the haplotype structure and genealogy.

PubMed Central

Jaruzelska, J; Zietkiewicz, E; Batzer, M; Cole, D E; Moisan, J P; Scozzari, R; Tavaré, S; Labuda, D

1999-01-01

With 10 segregating sites (simple nucleotide polymorphisms) in the last intron (1089 bp) of the ZFX gene we have observed 11 haplotypes in 336 chromosomes representing a worldwide array of 15 human populations. Two haplotypes representing 77% of all chromosomes were distributed almost evenly among four continents. Five of the remaining haplotypes were detected in Africa and 4 others were restricted to Eurasia and the Americas. Using the information about the ancestral state of the segregating positions (inferred from human-great ape comparisons), we applied coalescent analysis to estimate the age of the polymorphisms and the resulting haplotypes. The oldest haplotype, with the ancestral alleles at all the sites, was observed at low frequency only in two groups of African origin. Its estimated age of 740 to 1100 kyr corresponded to the time to the most recent common ancestor. The two most frequent worldwide distributed haplotypes were estimated at 550 to 840 and 260 to 400 kyr, respectively, while the age of the continentally restricted polymorphisms was 120 to 180 kyr and smaller. Comparison of spatial and temporal distribution of the ZFX haplotypes suggests that modern humans diverged from the common ancestral stock in the Middle Paleolithic era. Subsequent range expansion prevented substantial gene flow among continents, separating African groups from populations that colonized Eurasia and the New World. PMID:10388827

Spatial and temporal distribution of the neutral polymorphisms in the last ZFX intron: analysis of the haplotype structure and genealogy.

PubMed

Jaruzelska, J; Zietkiewicz, E; Batzer, M; Cole, D E; Moisan, J P; Scozzari, R; Tavaré, S; Labuda, D

1999-07-01

With 10 segregating sites (simple nucleotide polymorphisms) in the last intron (1089 bp) of the ZFX gene we have observed 11 haplotypes in 336 chromosomes representing a worldwide array of 15 human populations. Two haplotypes representing 77% of all chromosomes were distributed almost evenly among four continents. Five of the remaining haplotypes were detected in Africa and 4 others were restricted to Eurasia and the Americas. Using the information about the ancestral state of the segregating positions (inferred from human-great ape comparisons), we applied coalescent analysis to estimate the age of the polymorphisms and the resulting haplotypes. The oldest haplotype, with the ancestral alleles at all the sites, was observed at low frequency only in two groups of African origin. Its estimated age of 740 to 1100 kyr corresponded to the time to the most recent common ancestor. The two most frequent worldwide distributed haplotypes were estimated at 550 to 840 and 260 to 400 kyr, respectively, while the age of the continentally restricted polymorphisms was 120 to 180 kyr and smaller. Comparison of spatial and temporal distribution of the ZFX haplotypes suggests that modern humans diverged from the common ancestral stock in the Middle Paleolithic era. Subsequent range expansion prevented substantial gene flow among continents, separating African groups from populations that colonized Eurasia and the New World.

Endurance exercise training effects on body fatness, V̇o2max, HDL-C subfractions, and glucose tolerance are influenced by a PLIN haplotype in older Caucasians

PubMed Central

Jenkins, Nathan T.; McKenzie, Jennifer A.; Damcott, Coleen M.; Witkowski, Sarah

2010-01-01

Perilipins are lipid droplet-coating proteins that regulate intracellular lipolysis in adipocytes. A haplotype of two perilipin gene (PLIN) single nucleotide polymorphisms, 13041A>G and 14995A>T, has been previously associated with obesity risk. Furthermore, the available data indicate that this association may be modified by sex. We hypothesized that this haplotype would associate with body fatness, aerobic fitness, and a number of cardiovascular (CV) risk factor phenotypes before and after a 6-mo endurance exercise training program in sedentary older Caucasians. The major haplotype group (13041A/14995A; n = 57) had significantly lower body mass index (BMI) and body fatness compared with noncarriers of the AA haplotype (n = 44) before the training intervention. Training improved body composition in both groups, but fatness remained higher in noncarriers than AA carriers after training. This fat retention in noncarriers blunted their maximal oxygen uptake (V̇o2max) adaptation to training. Female noncarriers had substantially higher concentrations of several conventionally and NMR-measured HDL-C subfractions than male noncarriers before and after training, but only minimal differences were found between the sexes in the AA haplotype group. Haplotype group differences in baseline and after-training responses to an oral glucose tolerance test (OGTT) also differed by sex, as noncarrier men had the highest baseline area under the insulin curve (insulin AUC), but were the only group to significantly improve insulin AUC with training. The insulin sensitivity index and plasma glucose responses to the OGTT were more favorable in AA carriers than noncarriers before and after training. Overall, our findings suggest that PLIN variation explains some of the interindividual differences in the response of obesity and CV phenotypes to exercise training. Furthermore, these data contribute to the growing understanding of PLIN as a candidate gene for human obesity and the

A susceptible haplotype within APOE gene influences BMD and intensifies the osteoporosis risk in postmenopausal women of Northwest India.

PubMed

Singh, Monica; Singh, Puneetpal; Singh, Surinder; Juneja, Pawan Kumar; Kaur, Taranpal

2010-11-01

The association of apolipoprotein E (APOE) genotypes with bone mineral density (BMD) and risk of osteoporosis have remained unclear. The influence of APOE gene polymorphisms on BMD as genetic mediators of osteoporosis risk needs to be explored in Indian postmenopausal females where this disease is rising rampantly. The present study investigated the role and relevance of four pertinent APOE single nucleotide polymorphisms: 5'UTR G/C (rs440446), Int2 G/A (rs769450), Exon4 T/C (rs429358), Exon4C/T (rs7412) in DEXA verified 133 osteoporotic, 57 osteopenic and 83 normal postmenopausal females of India, who were not taking hormone replacement therapy. Minor allele frequencies of rs440446 and rs429358 were higher in osteoporotic females (0.31, 0.18) than osteopenic (0.29, 0.15) and females having normal bone mass (0.16, 0.07). Disease association analysis revealed a susceptibility haplotype CGTC (in order of rs440446, rs769450, rs429358, rs7412) and the carriers of this haplotype has higher risk of osteopenia (OR 3.53, 95% CI 1.21-11.0, P=0.017) and osteoporosis (OR 3.61, 95% CI 1.53-9.48, P=0.002) after adjusting the confounding effect of age, BMI and years since menopause. Females who possess either one copy or two copies of the haplotype have lesser BMD values of lumbar spine (0.88 and 0.85 g/cm(2)) and femoral neck (0.84 and 0.82 g/cm(2)) than those females who possess zero copy (0.9 and 0.87 g/cm(2), respectively). The present study exposed a susceptibility haplotype CGTC, within APOE gene, which was found to be associated with BMD and risk of osteopenia and osteoporosis in postmenopausal females of India. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

The MLH1 c.-27C>A and c.85G>T variants are linked to dominantly inherited MLH1 epimutation and are borne on a European ancestral haplotype.

PubMed

Kwok, Chau-To; Vogelaar, Ingrid P; van Zelst-Stams, Wendy A; Mensenkamp, Arjen R; Ligtenberg, Marjolijn J; Rapkins, Robert W; Ward, Robyn L; Chun, Nicolette; Ford, James M; Ladabaum, Uri; McKinnon, Wendy C; Greenblatt, Marc S; Hitchins, Megan P

2014-05-01

Germline mutations of the DNA mismatch repair genes MLH1, MSH2, MSH6 or PMS2, and deletions affecting the EPCAM gene adjacent to MSH2, underlie Lynch syndrome by predisposing to early-onset colorectal, endometrial and other cancers. An alternative but rare cause of Lynch syndrome is constitutional epimutation of MLH1, whereby promoter methylation and transcriptional silencing of one allele occurs throughout normal tissues. A dominantly transmitted constitutional MLH1 epimutation has been linked to an MLH1 haplotype bearing two single-nucleotide variants, NM_000249.2: c.-27C>A and c.85G>T, in a Caucasian family with Lynch syndrome from Western Australia. Subsequently, a second seemingly unrelated Caucasian Australian case with the same MLH1 haplotype and concomitant epimutation was reported. We now describe three additional, ostensibly unrelated, cancer-affected families of European heritage with this MLH1 haplotype in association with constitutional epimutation, bringing the number of index cases reported to five. Array-based genotyping in four of these families revealed shared haplotypes between individual families that extended across ≤2.6-≤6.4 megabase regions of chromosome 3p, indicating common ancestry. A minimal ≤2.6 megabase founder haplotype common to all four families was identified, which encompassed MLH1 and additional flanking genes and segregated with the MLH1 epimutation in each family. Our findings indicate that the MLH1 c.-27C>A and c.85G>T variants are borne on a European ancestral haplotype and provide conclusive evidence for its pathogenicity via a mechanism of epigenetic silencing of MLH1 within normal tissues. Additional descendants bearing this founder haplotype may exist who are also at high risk of developing Lynch syndrome-related cancers.

Method for designing gas tag compositions

DOEpatents

Gross, Kenny C.

1995-01-01

For use in the manufacture of gas tags such as employed in a nuclear reactor gas tagging failure detection system, a method for designing gas tagging compositions utilizes an analytical approach wherein the final composition of a first canister of tag gas as measured by a mass spectrometer is designated as node #1. Lattice locations of tag nodes in multi-dimensional space are then used in calculating the compositions of a node #2 and each subsequent node so as to maximize the distance of each node from any combination of tag components which might be indistinguishable from another tag composition in a reactor fuel assembly. Alternatively, the measured compositions of tag gas numbers 1 and 2 may be used to fix the locations of nodes 1 and 2, with the locations of nodes 3-N then calculated for optimum tag gas composition. A single sphere defining the lattice locations of the tag nodes may be used to define approximately 20 tag nodes, while concentric spheres can extend the number of tag nodes to several hundred.

Method for designing gas tag compositions

DOEpatents

Gross, K.C.

1995-04-11

For use in the manufacture of gas tags such as employed in a nuclear reactor gas tagging failure detection system, a method for designing gas tagging compositions utilizes an analytical approach wherein the final composition of a first canister of tag gas as measured by a mass spectrometer is designated as node No. 1. Lattice locations of tag nodes in multi-dimensional space are then used in calculating the compositions of a node No. 2 and each subsequent node so as to maximize the distance of each node from any combination of tag components which might be indistinguishable from another tag composition in a reactor fuel assembly. Alternatively, the measured compositions of tag gas numbers 1 and 2 may be used to fix the locations of nodes 1 and 2, with the locations of nodes 3-N then calculated for optimum tag gas composition. A single sphere defining the lattice locations of the tag nodes may be used to define approximately 20 tag nodes, while concentric spheres can extend the number of tag nodes to several hundred. 5 figures.

Haplotype diversity of the myostatin gene among beef cattle breeds

PubMed Central

Dunner, Susana; Miranda, M Eugenia; Amigues, Yves; Cañón, Javier; Georges, Michel; Hanset, Roger; Williams, John; Ménissier, François

2003-01-01

A total of 678 individuals from 28 European bovine breeds were both phenotyped and analysed at the myostatin locus by the Single Strand Conformation Polymorphism (SSCP) method. Seven new mutations were identified which contribute to the high polymorphism (1 SNP every 100 bp) present in this small gene; twenty haplotypes were described and a genotyping method was set up using the Oligonucleotide Ligation Assay (OLA) method. Some haplotypes appeared to be exclusive to a particular breed; this was the case for 5 in the Charolaise (involving mutation Q204X) and 7 in the Maine-Anjou (involving mutation E226X). The relationships between the different haplotypes were studied, thus allowing to test the earlier hypothesis on the origin of muscular hypertrophy in Europe: muscular hypertrophy (namely nt821(del11)) was mainly spread in different waves from northern Europe milk purpose populations in most breeds; however, other mutations (mostly disruptive) arose in a single breed, were highly selected and have since scarcely evolved to other populations. PMID:12605853

Singapore Genome Variation Project: a haplotype map of three Southeast Asian populations.

PubMed

Teo, Yik-Ying; Sim, Xueling; Ong, Rick T H; Tan, Adrian K S; Chen, Jieming; Tantoso, Erwin; Small, Kerrin S; Ku, Chee-Seng; Lee, Edmund J D; Seielstad, Mark; Chia, Kee-Seng

2009-11-01

The Singapore Genome Variation Project (SGVP) provides a publicly available resource of 1.6 million single nucleotide polymorphisms (SNPs) genotyped in 268 individuals from the Chinese, Malay, and Indian population groups in Southeast Asia. This online database catalogs information and summaries on genotype and phased haplotype data, including allele frequencies, assessment of linkage disequilibrium (LD), and recombination rates in a format similar to the International HapMap Project. Here, we introduce this resource and describe the analysis of human genomic variation upon agglomerating data from the HapMap and the Human Genome Diversity Project, providing useful insights into the population structure of the three major population groups in Asia. In addition, this resource also surveyed across the genome for variation in regional patterns of LD between the HapMap and SGVP populations, and for signatures of positive natural selection using two well-established metrics: iHS and XP-EHH. The raw and processed genetic data, together with all population genetic summaries, are publicly available for download and browsing through a web browser modeled with the Generic Genome Browser.

Singapore Genome Variation Project: A haplotype map of three Southeast Asian populations

PubMed Central

Teo, Yik-Ying; Sim, Xueling; Ong, Rick T.H.; Tan, Adrian K.S.; Chen, Jieming; Tantoso, Erwin; Small, Kerrin S.; Ku, Chee-Seng; Lee, Edmund J.D.; Seielstad, Mark; Chia, Kee-Seng

2009-01-01

The Singapore Genome Variation Project (SGVP) provides a publicly available resource of 1.6 million single nucleotide polymorphisms (SNPs) genotyped in 268 individuals from the Chinese, Malay, and Indian population groups in Southeast Asia. This online database catalogs information and summaries on genotype and phased haplotype data, including allele frequencies, assessment of linkage disequilibrium (LD), and recombination rates in a format similar to the International HapMap Project. Here, we introduce this resource and describe the analysis of human genomic variation upon agglomerating data from the HapMap and the Human Genome Diversity Project, providing useful insights into the population structure of the three major population groups in Asia. In addition, this resource also surveyed across the genome for variation in regional patterns of LD between the HapMap and SGVP populations, and for signatures of positive natural selection using two well-established metrics: iHS and XP-EHH. The raw and processed genetic data, together with all population genetic summaries, are publicly available for download and browsing through a web browser modeled with the Generic Genome Browser. PMID:19700652

Single nucleotide polymorphism in the STAT5b gene is associated with body weight and reproductive traits of the Jinghai Yellow chicken.

PubMed

Zhao, X H; Wang, J Y; Zhang, G X; Wei, Y; Gu, Y P; Yu, Y B

2012-04-01

In our research, signal transducer and activator of transcription 5b (STAT5b) gene was studied as candidate gene associated with body weight and reproductive traits of Jinghai Yellow chicken. Single nucleotide polymorphisms (SNPs) of STAT5b gene were examined in both Jinghai Yellow chicken and three reference chicken populations including the Bian, Youxi and Arbor Acre chickens. Two SNPs (C-1591T and G-250A) were detected in the 5' flanking region of STAT5b gene. Association indicated that the C-1591T mutation is significantly associated with age at fist egg, The G-250A mutation is significantly related with hatch weight and body weight at 300 days. Additionally four STAT5b haplotypes (H1, CG; H2, TG; H3, AC and H4, TA) and their frequency distributions were estimated using the phase program. Diplotype H3H4 is dominant for 8, 16 week-age-weight and body weight at first egg. Thus STAT5b gene may be served as a potential genetic marker for growth and reproduction traits evaluation of the Jinghai Yellow chicken. This study will provide valuable information for the protection and breeding of Jinghai Yellow chicken.

Contribution of 20 single nucleotide polymorphisms of 13 genes to dyslipidemia associated with antiretroviral therapy.

PubMed

Arnedo, Mireia; Taffé, Patrick; Sahli, Roland; Furrer, Hansjakob; Hirschel, Bernard; Elzi, Luigia; Weber, Rainer; Vernazza, Pietro; Bernasconi, Enos; Darioli, Roger; Bergmann, Sven; Beckmann, Jacques S; Telenti, Amalio; Tarr, Philip E

2007-09-01

HIV-1 infected individuals have an increased cardiovascular risk which is partially mediated by dyslipidemia. Single nucleotide polymorphisms in multiple genes involved in lipid transport and metabolism are presumed to modulate the risk of dyslipidemia in response to antiretroviral therapy. The contribution to dyslipidemia of 20 selected single nucleotide polymorphisms of 13 genes reported in the literature to be associated with plasma lipid levels (ABCA1, ADRB2, APOA5, APOC3, APOE, CETP, LIPC, LIPG, LPL, MDR1, MTP, SCARB1, and TNF) was assessed by longitudinally modeling more than 4400 plasma lipid determinations in 438 antiretroviral therapy-treated participants during a median period of 4.8 years. An exploratory genetic score was tested that takes into account the cumulative contribution of multiple gene variants to plasma lipids. Variants of ABCA1, APOA5, APOC3, APOE, and CETP contributed to plasma triglyceride levels, particularly in the setting of ritonavir-containing antiretroviral therapy. Variants of APOA5 and CETP contributed to high-density lipoprotein-cholesterol levels. Variants of CETP and LIPG contributed to non-high-density lipoprotein-cholesterol levels, a finding not reported previously. Sustained hypertriglyceridemia and low high-density lipoprotein-cholesterol during the study period was significantly associated with the genetic score. Single nucleotide polymorphisms of ABCA1, APOA5, APOC3, APOE, and CETP contribute to plasma triglyceride and high-density lipoprotein-cholesterol levels during antiretroviral therapy exposure. Genetic profiling may contribute to the identification of patients at risk for antiretroviral therapy-related dyslipidemia.

Multilocus analysis of nucleotide variation and speciation in three closely related Populus (Salicaceae) species.

PubMed

Du, Shuhui; Wang, Zhaoshan; Ingvarsson, Pär K; Wang, Dongsheng; Wang, Junhui; Wu, Zhiqiang; Tembrock, Luke R; Zhang, Jianguo

2015-10-01

Historical tectonism and climate oscillations can isolate and contract the geographical distributions of many plant species, and they are even known to trigger species divergence and ultimately speciation. Here, we estimated the nucleotide variation and speciation in three closely related Populus species, Populus tremuloides, P. tremula and P. davidiana, distributed in North America and Eurasia. We analysed the sequence variation in six single-copy nuclear loci and three chloroplast (cpDNA) fragments in 497 individuals sampled from 33 populations of these three species across their geographic distributions. These three Populus species harboured relatively high levels of nucleotide diversity and showed high levels of nucleotide differentiation. Phylogenetic analysis revealed that P. tremuloides diverged earlier than the other two species. The cpDNA haplotype network result clearly illustrated the dispersal route from North America to eastern Asia and then into Europe. Molecular dating results confirmed that the divergence of these three species coincided with the sundering of the Bering land bridge in the late Miocene and a rapid uplift of the Qinghai-Tibetan Plateau around the Miocene/Pliocene boundary. Vicariance-driven successful allopatric speciation resulting from historical tectonism and climate oscillations most likely played roles in the formation of the disjunct distributions and divergence of these three Populus species. © 2015 John Wiley & Sons Ltd.

Single nucleotide variations: Biological impact and theoretical interpretation

PubMed Central

Katsonis, Panagiotis; Koire, Amanda; Wilson, Stephen Joseph; Hsu, Teng-Kuei; Lua, Rhonald C; Wilkins, Angela Dawn; Lichtarge, Olivier

2014-01-01

Genome-wide association studies (GWAS) and whole-exome sequencing (WES) generate massive amounts of genomic variant information, and a major challenge is to identify which variations drive disease or contribute to phenotypic traits. Because the majority of known disease-causing mutations are exonic non-synonymous single nucleotide variations (nsSNVs), most studies focus on whether these nsSNVs affect protein function. Computational studies show that the impact of nsSNVs on protein function reflects sequence homology and structural information and predict the impact through statistical methods, machine learning techniques, or models of protein evolution. Here, we review impact prediction methods and discuss their underlying principles, their advantages and limitations, and how they compare to and complement one another. Finally, we present current applications and future directions for these methods in biological research and medical genetics. PMID:25234433

Genetic variation of the ghrelin signaling system in females with severe alcohol dependence.

PubMed

Landgren, Sara; Jerlhag, Elisabet; Hallman, Jarmila; Oreland, Lars; Lissner, Lauren; Strandhagen, Elisabeth; Thelle, Dag S; Zetterberg, Henrik; Blennow, Kaj; Engel, Jörgen A

2010-09-01

Central ghrelin signaling is required for the rewarding effects of alcohol in mice. Because ghrelin is implied in other addictive behaviors such as eating disorders and smoking, and because there is co-morbidity between these disorders and alcohol dependence, the ghrelin signaling system could be involved in mediating reward in general. Furthermore, in humans, single nucleotide polymorphisms (SNPs) and haplotypes of the pro-ghrelin gene (GHRL) and the ghrelin receptor gene (GHSR) have previously been associated with increased alcohol consumption and increased body weight. Known gender differences in plasma ghrelin levels prompted us to investigate genetic variation of the ghrelin signaling system in females with severe alcohol dependence (n = 113) and in a selected control sample of female low-consumers of alcohol from a large cohort study in southwest Sweden (n = 212). Six tag SNPs in the GHRL (rs696217, rs3491141, rs4684677, rs35680, rs42451, and rs26802) and four tag SNPs in the GHSR (rs495225, rs2232165, rs572169, and rs2948694) were genotyped in all individuals. We found that one GHRL haplotype was associated with reports of paternal alcohol dependence as well as with reports of withdrawal symptoms in the female alcohol-dependent group. Associations with 2 GHSR haplotypes and smoking were also shown. One of these haplotypes was also negatively associated with BMI in controls, while another haplotype was associated with having the early-onset, more heredity-driven, type 2 form of alcohol dependence in the patient group. Taken together, the genes encoding the ghrelin signaling system cannot be regarded as major susceptibility genes for female alcohol dependence, but is, however, involved in paternal heritability and may affect other reward- and energy-related factors such as smoking and BMI.

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

APOBEC3H haplotypes and HIV-1 pro-viral vif DNA sequence diversity in early untreated human immunodeficiency virus-1 infection.

PubMed

Gourraud, P A; Karaouni, A; Woo, J M; Schmidt, T; Oksenberg, J R; Hecht, F M; Liegler, T J; Barbour, J D

2011-03-01

We examined single nucleotide polymorphisms (SNP) in the APOBEC3 locus on chromosome 22, paired with population sequences of pro-viral human immunodeficiency virus-1 (HIV-1) vif from peripheral blood mononuclear cells, from 96 recently HIV-1-infected treatment-naive adults. We found evidence for the existence of an APOBEC3H linkage disequilibrium (LD) block associated with variation in GA → AA, or APOBEC3F/H signature, sequence changes in pro-viral HIV-1 vif sequence (top 10 significant SNPs with a significant p = 4.8 × 10(-3)). We identified a common five position risk haplotype distal to APOBEC3H (A3Hrh). These markers were in high LD (D' = 1; r(2) = 0.98) to a previously described A3H "RED" haplotype containing a variant (E121) with enhanced susceptibility to HIV-1 Vif. This association was confirmed by a haplotype analysis. Homozygote carriers of the A3Hrh had lower GA->AA (A3F/H) sequence editing upon pro-viral HIV-1 vif sequence (p = 0.01), and lower HIV-1 RNA levels over time during early, untreated HIV-1 infection, (p = 0.015 mixed effects model). This effect may be due to enhanced susceptibility of A3H forms to HIV-1 Vif mediated viral suppression of sequence editing activity, slowing viral diversification and escape from immune responses. Copyright © 2011 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Association analysis of single nucleotide polymorphisms in candidate genes with root traits in maize (Zea mays L.) seedlings.

PubMed

Kumar, Bharath; Abdel-Ghani, Adel H; Pace, Jordon; Reyes-Matamoros, Jenaro; Hochholdinger, Frank; Lübberstedt, Thomas

2014-07-01

Several genes involved in maize root development have been isolated. Identification of SNPs associated with root traits would enable the selection of maize lines with better root architecture that might help to improve N uptake, and consequently plant growth particularly under N deficient conditions. In the present study, an association study (AS) panel consisting of 74 maize inbred lines was screened for seedling root traits in 6, 10, and 14-day-old seedlings. Allele re-sequencing of candidate root genes Rtcl, Rth3, Rum1, and Rul1 was also carried out in the same AS panel lines. All four candidate genes displayed different levels of nucleotide diversity, haplotype diversity and linkage disequilibrium. Gene based association analyses were carried out between individual polymorphisms in candidate genes, and root traits measured in 6, 10, and 14-day-old maize seedlings. Association analyses revealed several polymorphisms within the Rtcl, Rth3, Rum1, and Rul1 genes associated with seedling root traits. Several nucleotide polymorphisms in Rtcl, Rth3, Rum1, and Rul1 were significantly (P<0.05) associated with seedling root traits in maize suggesting that all four tested genes are involved in the maize root development. Thus considerable allelic variation present in these root genes can be exploited for improving maize root characteristics. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders

PubMed Central

Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro

2016-01-01

Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874

Global spread and genetic variants of the two CYP9M10 haplotype forms associated with insecticide resistance in Culex quinquefasciatus Say.

PubMed

Itokawa, K; Komagata, O; Kasai, S; Kawada, H; Mwatele, C; Dida, G O; Njenga, S M; Mwandawiro, C; Tomita, T

2013-09-01

Insecticide resistance develops as a genetic factor (allele) conferring lower susceptibility to insecticides proliferates within a target insect population under strong positive selection. Intriguingly, a resistance allele pre-existing in a population often bears a series of further adaptive allelic variants through new mutations. This phenomenon occasionally results in replacement of the predominating resistance allele by fitter new derivatives, and consequently, development of greater resistance at the population level. The overexpression of the cytochrome P450 gene CYP9M10 is associated with pyrethroid resistance in the southern house mosquito Culex quinquefasciatus. Previously, we have found two genealogically related overexpressing CYP9M10 haplotypes, which differ in gene copy number (duplicated and non-duplicated). The duplicated haplotype was derived from the non-duplicated overproducer probably recently. In the present study, we investigated allelic series of CYP9M10 involved in three C. quinquefasciatus laboratory colonies recently collected from three different localities. Duplicated and non-duplicated overproducing haplotypes coexisted in African and Asian colonies indicating a global distribution of both haplotype lineages. The duplicated haplotypes both in the Asian and African colonies were associated with higher expression levels and stronger resistance than non-duplicated overproducing haplotypes. There were slight variation in expression level among the non-duplicated overproducing haplotypes. The nucleotide sequences in coding and upstream regions among members of this group also showed a little diversity. Non-duplicated overproducing haplotypes with relatively higher expression were genealogically closer to the duplicated haplotypes than the other non-duplicated overproducing haplotypes, suggesting multiple cis-acting mutations before duplication.

Association of two Common Single Nucleotide Polymorphisms (+45T/G and +276G/T) of ADIPOQ Gene with Coronary Artery Disease in Type 2 Diabetic Patients

PubMed Central

Mohammadzadeh, Ghorban; Ghaffari, Mohammad-Ali; Heibar, Habib; Bazyar, Mohammad

2016-01-01

Background: Adiponectin, an adipocyte-secreted hormone, is known to have anti-atherogenic, anti-inflammatory, and anti-diabetic properties. In the present study, the association between two common single nucleotide polymorphisms (SNPs) (+45T/G and +276G/T) of ADIOPQ gene and coronary artery disease (CAD) was assessed in the subjects with type 2 diabetes (T2DM). Methods: Genotypes of two SNPs were determined by polymerase chain reaction-restriction fragment length polymorphism in 200 subjects with T2DM (100 subjects with CAD and 100 without CAD). Results: The frequency of TT genotype of +276G/T was significantly elevated in CAD compared to controls (χ2=7.967, P=0.019). A similar difference was found in the allele frequency of +276G/T between two groups (χ2=3.895, P=0.048). The increased risk of CAD was associated with +276 TT genotype when compared to reference GG genotype (OR=5.158; 95% CI=1.016-26.182, P=0.048). However, no similar difference was found in genotype and allele frequencies of SNP +45T/G between two groups. There was a CAD protective haplotype combination of +276 wild-type and +45 mutant-type allele (276G-45G) (OR=0.37, 95% CI=0.16-0.86, P=0.022) in the subject population. Conclusion: Our findings indicated that T allele of SNP +276G/T is more associated with the increased risk of CAD in subjects with T2DM. Also, a haplotype combination of +45G/+276G of these two SNPs has a protective effect on the risk of CAD. PMID:26781170

Epistatic interaction between haplotypes of the ghrelin ligand and receptor genes influence susceptibility to myocardial infarction and coronary artery disease.

PubMed

Baessler, Andrea; Fischer, Marcus; Mayer, Bjoern; Koehler, Martina; Wiedmann, Silke; Stark, Klaus; Doering, Angela; Erdmann, Jeanette; Riegger, Guenter; Schunkert, Heribert; Kwitek, Anne E; Hengstenberg, Christian

2007-04-15

Data from both experimental models and humans provide evidence that ghrelin and its receptor, the growth hormone secretagogue receptor (ghrelin receptor, GHSR), possess a variety of cardiovascular effects. Thus, we hypothesized that genetic variants within the ghrelin system (ligand ghrelin and its receptor GHSR) are associated with susceptibility to myocardial infarction (MI) and coronary artery disease (CAD). Seven single nucleotide polymorphisms (SNPs) covering the GHSR region as well as eight SNPs across the ghrelin gene (GHRL) region were genotyped in index MI patients (864 Caucasians, 'index MI cases') from the German MI family study and in matched controls without evidence of CAD (864 Caucasians, 'controls', MONICA Augsburg). In addition, siblings of these MI patients with documented severe CAD (826 'affected sibs') were matched likewise with controls (n = 826 Caucasian 'controls') and used for verification. The effect of interactions between genetic variants of both genes of the ghrelin system was explored by conditional classification tree models. We found association of several GHSR SNPs with MI [best SNP odds ratio (OR) 1.7 (1.2-2.5); P = 0.002] using a recessive model. Moreover, we identified a common GHSR haplotype which significantly increases the risk for MI [multivariate adjusted OR for homozygous carriers 1.6 (1.1-2.5) and CAD OR 1.6 (1.1-2.5)]. In contrast, no relationship between genetic variants and the disease could be revealed for GHRL. However, the increase in MI/CAD frequency related to the susceptible GHSR haplotype was abolished when it coincided with a common GHRL haplotype. Multivariate adjustments as well as permutation-based methods conveyed the same results. These data are the first to demonstrate an association of SNPs and haplotypes within important genes of the ghrelin system and the susceptibility to MI, whereas association with MI/CAD could be identified for genetic variants across GHSR, no relationship could be revealed for GHRL

Transfusion strategy for weak D type 4.0 based on RHD alleles and RH haplotypes in Tunisia

PubMed Central

Ouchari, Mouna; Srivastava, Kshitij; Romdhane, Houda; Yacoub, Saloua Jemni; Flegel, Willy Albert

2017-01-01

Background With more than 460 RHD alleles, this gene is the most complex and polymorphic among all blood group systems. The Tunisian population has the largest known prevalence of weak D type 4.0 alleles, occurring in 1 of 105 RH haplotypes. We aimed to establish a rationale for the transfusion strategy of weak D type 4.0 in Tunisia. Study design and methods Donors were randomly screened for the serological weak D phenotype. The RHD coding sequence and parts of the introns were sequenced. To establish the RH haplotype, the RHCE gene was tested for characteristic single nucleotide positions. Results We determined all RHD alleles and the RH haplotypes coding for the serologic weak D phenotype among 13,431 Tunisian donations. A serologic weak D phenotype was found in 67 individuals (0.50%). Among them, 60 carried a weak D type 4 allele: 53 weak D type 4.0, 6 weak D type 4.2.2 (DAR), and 1 weak D type 4.1. Another 4 donors had 1 variant allele each: DVII, weak D type 1, weak D type 3, and weak D type 100, while 3 donors showed a normal RHD sequence. The weak D type 4.0 was most often linked to RHCE*ceVS.04.01, weak D type 4.2.2 to RHCE*ceAR, and weak D type 4.1 to RHCE*ceVS.02, while the other RHD alleles were linked to one of the common RHCE alleles. Conclusions Among the weak D phenotypes in Tunisia, no novel RHD allele was found and almost 90% were caused by alleles of the weak D type 4 cluster, of which 88% represented the weak D type 4.0 allele. Based on established RH haplotypes for variant RHD and RHCE alleles and the lack of adverse clinical reports, we recommend D positive transfusions for patients with weak D type 4.0 in Tunisia. PMID:29193104

Transfusion strategy for weak D Type 4.0 based on RHD alleles and RH haplotypes in Tunisia.

PubMed

Ouchari, Mouna; Srivastava, Kshitij; Romdhane, Houda; Jemni Yacoub, Saloua; Flegel, Willy Albert

2018-02-01

With more than 460 RHD alleles, this gene is the most complex and polymorphic among all blood group systems. The Tunisian population has the largest known prevalence of weak D Type 4.0 alleles, occurring in one of 105 RH haplotypes. We aimed to establish a rationale for the transfusion strategy of weak D Type 4.0 in Tunisia. Donors were randomly screened for the serologic weak D phenotype. The RHD coding sequence and parts of the introns were sequenced. To establish the RH haplotype, the RHCE gene was tested for characteristic single-nucleotide positions. We determined all RHD alleles and the RH haplotypes coding for the serologic weak D phenotype among 13,431 Tunisian donations. A serologic weak D phenotype was found in 67 individuals (0.50%). Among them, 60 carried a weak D Type 4 allele: 53 weak D Type 4.0, six weak D Type 4.2.2 (DAR), and one weak D Type 4.1. An additional four donors had one variant allele each: DVII, weak D Type 1, weak D Type 3, and weak D type 100, while three donors showed a normal RHD sequence. The weak D Type 4.0 was most often linked to RHCE*ceVS.04.01, weak D Type 4.2.2 to RHCE*ceAR, and weak D Type 4.1 to RHCE*ceVS.02, while the other RHD alleles were linked to one of the common RHCE alleles. Among the weak D phenotypes in Tunisia, no novel RHD allele was found and almost 90% were caused by alleles of the weak D Type 4 cluster, of which 88% represented the weak D Type 4.0 allele. Based on established RH haplotypes for variant RHD and RHCE alleles and the lack of adverse clinical reports, we recommend D+ transfusions for patients with weak D Type 4.0 in Tunisia. © 2017 AABB.

Genetic variation in C-reactive protein (CRP) gene may be associated with risk of systemic lupus erythematosus and CRP concentrations.

PubMed

Shih, P Betty; Manzi, Susan; Shaw, Penny; Kenney, Margaret; Kao, Amy H; Bontempo, Franklin; Barmada, M Michael; Kammerer, Candace; Kamboh, M Ilyas

2008-11-01

The gene coding for C-reactive protein (CRP) is located on chromosome 1q23.2, which falls within a linkage region thought to harbor a systemic lupus erythematosus (SLE) susceptibility gene. Recently, 2 single-nucleotide polymorphisms (SNP) in the CRP gene (+838, +2043) have been shown to be associated with CRP concentrations and/or SLE risk in a British family-based cohort. Our study was done to confirm the reported association in an independent population-based case-control cohort, and also to investigate the influence of 3 additional CRP tagSNP (-861, -390, +90) on SLE risk and serum CRP concentrations. DNA from 337 Caucasian women who met the American College of Rheumatology criteria for definite (n = 324) or probable (n = 13) SLE and 448 Caucasian healthy female controls was genotyped for 5 CRP tagSNP (-861, -390, +90, +838, +2043). Genotyping was performed using restriction fragment length polymorphism-polymerase chain reaction, pyrosequencing, or TaqMan assays. Serum CRP levels were measured using ELISA. Association studies were performed using the chi-squared distribution, Z-test, Fisher's exact test, and analysis of variance. Haplotype analysis was performed using EH software and the haplo.stats package in R 2.1.2. While none of the SNP were found to be associated with SLE risk individually, there was an association with the 5 SNP haplotypes (p < 0.001). Three SNP (-861, -390, +90) were found to significantly influence serum CRP level in SLE cases, both independently and as haplotypes. Our data suggest that unique haplotype combinations in the CRP gene may modify the risk of developing SLE and influence circulating CRP levels.

Decreased necrotizing fasciitis capacity caused by a single nucleotide mutation that alters a multiple gene virulence axis

PubMed Central

Olsen, Randall J.; Sitkiewicz, Izabela; Ayeras, Ara A.; Gonulal, Vedia E.; Cantu, Concepcion; Beres, Stephen B.; Green, Nicole M.; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P.; Montgomery, Charles A.; Cartwright, Joiner; McGeer, Allison; Low, Donald E.; Whitney, Adeline R.; Cagle, Philip T.; Blasdel, Terry L.; DeLeo, Frank R.; Musser, James M.

2010-01-01

Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis (“flesh-eating disease”). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the ΔmtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research. PMID:20080771

Decreased necrotizing fasciitis capacity caused by a single nucleotide mutation that alters a multiple gene virulence axis.

PubMed

Olsen, Randall J; Sitkiewicz, Izabela; Ayeras, Ara A; Gonulal, Vedia E; Cantu, Concepcion; Beres, Stephen B; Green, Nicole M; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P; Montgomery, Charles A; Cartwright, Joiner; McGeer, Allison; Low, Donald E; Whitney, Adeline R; Cagle, Philip T; Blasdel, Terry L; DeLeo, Frank R; Musser, James M

2010-01-12

Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis ("flesh-eating disease"). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the DeltamtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research.

Genomic-assisted haplotype analysis and the development of high-throughput SNP markers for salinity tolerance in soybean

PubMed Central

Patil, Gunvant; Do, Tuyen; Vuong, Tri D.; Valliyodan, Babu; Lee, Jeong-Dong; Chaudhary, Juhi; Shannon, J. Grover; Nguyen, Henry T.

2016-01-01

Soil salinity is a limiting factor of crop yield. The soybean is sensitive to soil salinity, and a dominant gene, Glyma03g32900 is primarily responsible for salt-tolerance. The identification of high throughput and robust markers as well as the deployment of salt-tolerant cultivars are effective approaches to minimize yield loss under saline conditions. We utilized high quality (15x) whole-genome resequencing (WGRS) on 106 diverse soybean lines and identified three major structural variants and allelic variation in the promoter and genic regions of the GmCHX1 gene. The discovery of single nucleotide polymorphisms (SNPs) associated with structural variants facilitated the design of six KASPar assays. Additionally, haplotype analysis and pedigree tracking of 93 U.S. ancestral lines were performed using publically available WGRS datasets. Identified SNP markers were validated, and a strong correlation was observed between the genotype and salt treatment phenotype (leaf scorch, chlorophyll content and Na+ accumulation) using a panel of 104 soybean lines and, an interspecific bi-parental population (F8) from PI483463 x Hutcheson. These markers precisely identified salt-tolerant/sensitive genotypes (>91%), and different structural-variants (>98%). These SNP assays, supported by accurate phenotyping, haplotype analyses and pedigree tracking information, will accelerate marker-assisted selection programs to enhance the development of salt-tolerant soybean cultivars. PMID:26781337

Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

Study of KS0 pair production in single-tag two-photon collisions

NASA Astrophysics Data System (ADS)

Masuda, M.; Uehara, S.; Watanabe, Y.; Adachi, I.; Ahn, J. K.; Aihara, H.; Al Said, S.; Asner, D. M.; Atmacan, H.; Aulchenko, V.; Aushev, T.; Ayad, R.; Babu, V.; Badhrees, I.; Bansal, V.; Behera, P.; Berger, M.; Bhardwaj, V.; Bhuyan, B.; Biswal, J.; Bondar, A.; Bonvicini, G.; Bozek, A.; Bračko, M.; Červenkov, D.; Chen, A.; Cheon, B. G.; Chilikin, K.; Cho, K.; Choi, Y.; Choudhury, S.; Cinabro, D.; Czank, T.; Dash, N.; Di Carlo, S.; Doležal, Z.; Drásal, Z.; Dutta, D.; Eidelman, S.; Epifanov, D.; Fast, J. E.; Ferber, T.; Fulsom, B. G.; Garg, R.; Gaur, V.; Gabyshev, N.; Garmash, A.; Gelb, M.; Giri, A.; Goldenzweig, P.; Guido, E.; Haba, J.; Hayasaka, K.; Hayashii, H.; Hedges, M. T.; Hou, W.-S.; Iijima, T.; Inami, K.; Inguglia, G.; Ishikawa, A.; Itoh, R.; Iwasaki, M.; Iwasaki, Y.; Jacobs, W. W.; Jaegle, I.; Jin, Y.; Joo, K. K.; Julius, T.; Kang, K. H.; Karyan, G.; Kawasaki, T.; Kichimi, H.; Kiesling, C.; Kim, D. Y.; Kim, H. J.; Kim, J. B.; Kim, K. T.; Kim, S. H.; Kodyš, P.; Kotchetkov, D.; Križan, P.; Kroeger, R.; Krokovny, P.; Kulasiri, R.; Kuzmin, A.; Kwon, Y.-J.; Lee, I. S.; Lee, S. C.; Li, L. K.; Li, Y.; Li Gioi, L.; Libby, J.; Liventsev, D.; Lubej, M.; Luo, T.; Matsuda, T.; Matvienko, D.; Merola, M.; Miyabayashi, K.; Miyata, H.; Mizuk, R.; Mohanty, G. B.; Moon, H. K.; Mori, T.; Mussa, R.; Nakao, M.; Nakazawa, H.; Nanut, T.; Nath, K. J.; Natkaniec, Z.; Nayak, M.; Niiyama, M.; Nisar, N. K.; Nishida, S.; Ogawa, S.; Okuno, S.; Ono, H.; Onuki, Y.; Pakhlov, P.; Pakhlova, G.; Pal, B.; Park, H.; Paul, S.; Pedlar, T. K.; Pestotnik, R.; Piilonen, L. E.; Ritter, M.; Rostomyan, A.; Russo, G.; Sakai, Y.; Salehi, M.; Sandilya, S.; Santelj, L.; Sanuki, T.; Savinov, V.; Schneider, O.; Schnell, G.; Schwanda, C.; Seidl, R.; Seino, Y.; Senyo, K.; Seon, O.; Sevior, M. E.; Shebalin, V.; Shen, C. P.; Shibata, T.-A.; Shimizu, N.; Shiu, J.-G.; Shwartz, B.; Sokolov, A.; Solovieva, E.; Starič, M.; Strube, J. F.; Sumihama, M.; Sumiyoshi, T.; Takizawa, M.; Tamponi, U.; Tanida, K.; Tenchini, F.; Teramoto, Y.; Uchida, M.; Uglov, T.; Unno, Y.; Uno, S.; Urquijo, P.; Van Hulse, C.; Varner, G.; Vinokurova, A.; Vorobyev, V.; Vossen, A.; Wang, B.; Wang, C. H.; Wang, M.-Z.; Wang, P.; Wang, X. L.; Watanabe, M.; Widmann, E.; Won, E.; Ye, H.; Yuan, C. Z.; Yusa, Y.; Zakharov, S.; Zhang, Z. P.; Zhilich, V.; Zhukova, V.; Zhulanov, V.; Zupanc, A.; Belle Collaboration

2018-03-01

We report a measurement of the cross section for KS0 pair production in single-tag two-photon collisions, γ*γ →KS0KS0, for Q2 up to 30 GeV2 , where Q2 is the negative of the invariant mass squared of the tagged photon. The measurement covers the kinematic range 1.0 GeV

A CT-rich haplotype in intron 4 of SNCA confers risk for Lewy body pathology in Alzheimer’s disease and affects SNCA expression

PubMed Central

Lutz, Michael W.; Saul, Robert; Linnertz, Colton; Glenn, Omolara-Chinue; Roses, Allen D.; Chiba-Falek, Ornit

2015-01-01

INTRODUCTION We recently showed that tagging-SNPs across the SNCA locus were significantly associated with increased risk for LB pathology in AD cases. However, the actual genetic variant(s) that underlie the observed associations remain elusive. METHODS We used a bioinformatics algorithm to catalogue Structural-Variants in a region of SNCA-intron4, followed by phased-sequencing. We performed a genetic-association analysis in autopsy series of LBV/AD cases compared with AD-only controls. We investigated the biological functions by expression analysis using temporal-cortex samples. RESULTS We identified four distinct haplotypes within a highly-polymorphic-low-complexity CT-rich region. We showed that a specific haplotype conferred risk to develop LBV/AD. We demonstrated that the CT-rich site acts as an enhancer element, where the risk haplotype was significantly associated with elevated levels of SNCA-mRNA. DISCUSSION We have discovered a novel haplotype in a CT-rich region in SNCA that contributes to LB pathology in AD patients, possibly via cis-regulation of the gene expression. PMID:26079410

Nucleotide cleaving agents and method

DOEpatents

Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

2000-01-01

The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

Association between VEGF polymorphisms (936c/t, -460t/c and -634g/c) with haplotypes and coronary heart disease susceptibility.

PubMed

Han, Xia; Liu, Lili; Niu, Jiamin; Yang, Jun; Zhang, Zengtang; Zhang, Zhiqiang

2015-01-01

Our aim was to investigate the association between single nucleotide polymorphisms (SNPs) of vascular endothelial growth factor (VEGF) and coronary heart disease (CHD) susceptibility in Chinese Han population. 144 CHD patients and 150 healthy individuals were enrolled in the study. Three SNPs (936C/T, -460T/C and -634G/C) of VEGF were chose and then were genotyped with Sequenom time-of-flight mass spectrometry (TOFMS). Odds ratio (OR) with 95% confidence interval (CI) were used to evaluate the association of genotypes and haplotypes and CHD susceptibility. The frequencies of -460T/C CC genotype (13.6%) was found higher in the case group than that of control group (6.7%), which indicated that CC genotype was a risk factor for CHD (OR=2.50, 95% CI=1.10-5.68). Correspondently, the C allele appeared to increase the risk of CHD (OR=1.54, 95% CI=1.07-2.22). For -634G/C polymorphism, the risk of the CC genotype carrier for CHD increased 2.24 fold compared to the wild genotype. Moreover, -634G/CC allele was significantly associated with CHD susceptibility (OR=1.65, 95% CI=1.15-2.36). In addition, +936C/T CT genotype and C allele appeared to be a genetic-susceptibility factors for CHD (OR=2.43, 95% CI=1.44-4.10; OR=1.95, 95% CI=1.26-3.02). The haplotype analysis showed that T-C-T, C-C-C and C-G-C haplotypes all could increase the risk for CHD (OR: 2.43, 2.77 and 2.33). we concluded VEGF polymorphisms were associated with CHD susceptibility. Moreover, the haplotypes of T-C-T, C-C-C and C-G-C all could increase the risk for CHD.

Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

NASA Astrophysics Data System (ADS)

Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

Conserved extended haplotypes discriminate HLA-DR3-homozygous Basque patients with type 1 diabetes mellitus and celiac disease.

PubMed

Bilbao, J R; Calvo, B; Aransay, A M; Martin-Pagola, A; Perez de Nanclares, G; Aly, T A; Rica, I; Vitoria, J C; Gaztambide, S; Noble, J; Fain, P R; Awdeh, Z L; Alper, C A; Castaño, L

2006-10-01

The major susceptibility locus for type 1 diabetes mellitus (T1D) maps to the human lymphocyte antigen (HLA) class II region in the major histocompatibility complex on chromosome 6p21. In southern European populations, like the Basques, the greatest risk to T1D is associated with DR3 homo- and heterozygosity and is comparable to that of DR3/DR4, the highest risk genotype in northern European populations. Celiac disease (CD) is another DR3-associated autoimmune disorder showing certain overlap with T1D that has been explained by the involvement of common genetic determinants, a situation more frequent in DR3-rich populations, like the Basques. As both T1D- and CD-associated HLA alleles are part of conserved extended haplotypes (CEH), we compared DR3-homozygous T1D and CD patients to determine whether CEHs were equally distributed between both disorders or there was a differential contribution of different haplotypes. We observed a very pronounced distribution bias (P<10(-5)) of the two major DR3 CEHs, with DR3-B18 predominating in T1D and DR3-B8 in CD. Additionally, high-density single nucleotide polymorphism (SNP) analysis of the complete CEH [A*30-B*18-MICA*4-F1C30-DRB1*0301-DQB1*0201-DPB1*0202] revealed extraordinary conservation throughout the 4.9 Mbp analyzed supporting the existence of additional diabetogenic variants (other than HLA-DRB1*0301-DQB1*0201), conserved within the DR3-B18 CEH (but not in other DR3 haplotypes) that could explain its enhanced diabetogenicity.

ENGINES: exploring single nucleotide variation in entire human genomes.

PubMed

Amigo, Jorge; Salas, Antonio; Phillips, Christopher

2011-04-19

Next generation ultra-sequencing technologies are starting to produce extensive quantities of data from entire human genome or exome sequences, and therefore new software is needed to present and analyse this vast amount of information. The 1000 Genomes project has recently released raw data for 629 complete genomes representing several human populations through their Phase I interim analysis and, although there are certain public tools available that allow exploration of these genomes, to date there is no tool that permits comprehensive population analysis of the variation catalogued by such data. We have developed a genetic variant site explorer able to retrieve data for Single Nucleotide Variation (SNVs), population by population, from entire genomes without compromising future scalability and agility. ENGINES (ENtire Genome INterface for Exploring SNVs) uses data from the 1000 Genomes Phase I to demonstrate its capacity to handle large amounts of genetic variation (>7.3 billion genotypes and 28 million SNVs), as well as deriving summary statistics of interest for medical and population genetics applications. The whole dataset is pre-processed and summarized into a data mart accessible through a web interface. The query system allows the combination and comparison of each available population sample, while searching by rs-number list, chromosome region, or genes of interest. Frequency and FST filters are available to further refine queries, while results can be visually compared with other large-scale Single Nucleotide Polymorphism (SNP) repositories such as HapMap or Perlegen. ENGINES is capable of accessing large-scale variation data repositories in a fast and comprehensive manner. It allows quick browsing of whole genome variation, while providing statistical information for each variant site such as allele frequency, heterozygosity or FST values for genetic differentiation. Access to the data mart generating scripts and to the web interface is granted from

β2-Adrenergic receptor promoter haplotype influences the severity of acute viral respiratory tract infection during infancy: a prospective cohort study.

PubMed

Wu, Pingsheng; Larkin, Emma K; Reiss, Sara S; Carroll, Kecia N; Summar, Marshall L; Minton, Patricia A; Woodward, Kimberly B; Liu, Zhouwen; Islam, Jessica Y; Hartert, Tina V; Moore, Paul E

2015-09-14

Despite the significant interest in β2-Adrenergic receptor (ADRB2) polymorphisms related to asthma, whether ADRB2 genetic variants are similarly associated with acute respiratory tract infections have not been studied. We hypothesized that genetic variants in ADRB2 associated with a response to asthma therapy during an asthma exacerbation were also associated with severity of acute respiratory tract infections. To test this hypothesis, we genotyped 5 common polymorphisms in the promoter region and coding block of the ADRB2 gene (loci -2387, -2274, -1343, +46, and +79) from 374 Caucasian and African American term infants who were enrolled at the time of acute respiratory illness over four respiratory viral seasons. Severity of respiratory tract infections was measured using a bronchiolitis severity score (BSS; range = 0-12, clinically significant difference = 0.5) with a higher score indicating more severe disease. We assigned the promoter, coding and combined promoter and coding haplotypes to the unphased genotype data. The associations between each of these five single-nucleotide polymorphisms (SNPs) as well as the haplotypes and infant BSS were analyzed using nonparametric univariate analysis and multivariable proportional odds model separately in Caucasians and African Americans. There was no significant association between infant BSS and each of the SNPs in both Caucasians and African Americans. However, promoter haplotype CCA was associated with a decreased BSS in African Americans in a dose dependent manner. The median (interquartile range) BSS of infants with no copies of the CCA haplotype, one copy, and two copies of the CCA haplotype were 5.5 (2.0, 8.0), 4.0 (1.0, 7.5), and 3.0 (1.0, 4.0), respectively. This dose dependent relationship persisted after adjusting for infant age, gender, daycare exposure, secondhand smoke exposure, prior history of breastfeeding, siblings at home, and enrollment season (adjusted odds ratio: 0.59, 95% confidence

Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

PubMed Central

El-Sabrout, Karim; Aggag, Sarah A.

2017-01-01

Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

MADD-FOLH1 Polymorphisms and Their Haplotypes with Serum Lipid Levels and the Risk of Coronary Heart Disease and Ischemic Stroke in a Chinese Han Population.

PubMed

Wu, Dong-Feng; Yin, Rui-Xing; Cao, Xiao-Li; Huang, Feng; Wu, Jin-Zhen; Chen, Wu-Xian

2016-04-08

This study aimed to detect the association of the MADD-FOLH1 single nucleotide polymorphisms (SNPs) and their haplotypes with the risk of coronary heart disease (CHD) and ischemic stroke (IS) in a Chinese Han population. Six SNPs of rs7395662, rs326214, rs326217, rs1051006, rs3736101, and rs7120118 were genotyped in 584 CHD and 555 IS patients, and 596 healthy controls. The genotypic and allelic frequencies of the rs7395662 SNP were different between controls and patients, and the genotypes of the rs7395662 SNP were associated with the risk of CHD and IS in different genetic models. Six main haplotypes among the rs1051006, rs326214, rs326217, rs3736101, and rs7120118 SNPs were detected in our study population, the haplotypes of G-G-T-G-C and G-A-T-G-T were associated with an increased risk of CHD and IS, respectively. The subjects with rs7395662GG genotype in controls had higher triglyceride (TG) and lower high-density lipoprotein cholesterol (HDL-C) levels than the subjects with AA/AG genotypes. Several SNPs interacted with alcohol consumption to influence serum TG (rs326214, rs326217, and rs7120118) and HDL-C (rs7395662) levels. The SNP of rs3736101 interacted with cigarette smoking to modify serum HDL-C levels. The SNP of rs1051006 interacted with body mass index ≥24 kg/m² to modulate serum low-density lipoprotein cholesterol levels. The interactions of several haplotypes and alcohol consumption on the risk of CHD and IS were also observed.

A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, G K; Hillier, L; Brandstrom, M

2005-02-20

We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less

Association between Single Nucleotide Polymorphisms of the Major Histocompatibility Complex Class II Gene and Newcastle Disease Virus Titre and Body Weight in Leung Hang Khao Chickens

PubMed Central

Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.

2016-01-01

The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325

Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene

PubMed Central

2012-01-01

Background MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD) within this gene in Chinese indigenous breeds and Western commercial breeds. Results A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb) in Western commercial breeds. The significant positive Tajima’D, and Fu and Li’s D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Conclusions Chinese and Western breeds have similar nucleotide diversity

Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene.

PubMed

Yang, Ming; Yang, Bin; Yan, Xueming; Ouyang, Jing; Zeng, Weihong; Ai, Huashui; Ren, Jun; Huang, Lusheng

2012-07-13

MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD) within this gene in Chinese indigenous breeds and Western commercial breeds. A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb) in Western commercial breeds. The significant positive Tajima'D, and Fu and Li's D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Chinese and Western breeds have similar nucleotide diversity but evolve divergently in the MUC4

Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

USDA-ARS?s Scientific Manuscript database

High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...

Precise detection of de novo single nucleotide variants in human genomes.

PubMed

Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael

2018-05-22

The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

Phylogeography of haplotypes of five microsatellites located in a low-recombination region of the X chromosome: studies worldwide and in Brazilian populations.

PubMed

Pereira, Rinaldo Wellerson; Pena, Sérgio D J

2006-01-01

We studied five microsatellites (DXS995, DXS8076, DXS8114, DXS1002 and DXS1050) located in a region of very low recombination rate in the long arm of the human X chromosome (Xq13.3-Xq21.3). No recombination was seen in 291 meioses in CEPH families. To test whether haplotypes composed of the five microsatellites could differentiate among distinct human continental populations, we studied an international panel containing 72 males from Africa, Europe, Asia and the America. Haplotypic diversity was very high within these groups and no haplotypes were shared among them. This led to the hope that we might be able to identify continent-specific lineages. However, in a median joining network there was no clear discrimination of the different continental groups. We then tested whether we could identify X chromosomal lineages from different continental origins in Brazilians. We typed 180 white Brazilians from four different geographical regions and examined their proportions of haplotype sharing with Africans, Asians, Europeans and Amerindians. No phylogeographical patterns emerged from the data. Moreover, there were several instances of the same haplotype being shared by many (and in one instance all) groups, suggesting that recombination might be occurring. We thus studied pairwise the level of linkage disequilibrium (LD) between the microsatellites. No detectable linkage disequilibrium between the most external loci DXS995 and DXS1050 was observed. Thus, even though recombination may be absent on short time spans, as seen in the CEPH pedigrees, on a long term basis it occurs often enough to dissipate all linkage disequilibrium. On the other hand, we observed very strong linkage disequilibrium between the pairs DXS995/DXS8076 and DXS1002/DXS8114, raising the possibility of resequencing the segment between them to identify single nucleotide polymorphisms (SNPs) in their intervals. The combination of X-linked microsatellites and SNPs in strong linkage disequilibrium might

A haplotype of polymorphisms in ASE-1, RAI and ERCC1 and the effects of tobacco smoking and alcohol consumption on risk of colorectal cancer: a Danish prospective case-cohort study.

PubMed

Hansen, Rikke D; Sørensen, Mette; Tjønneland, Anne; Overvad, Kim; Wallin, Håkan; Raaschou-Nielsen, Ole; Vogel, Ulla

2008-02-20

Single nucleotide polymorphisms (SNPs) are the most frequent type of genetic variation in the human genome, and are of interest for the study of susceptibility to and protection from diseases. The haplotype at chromosome 19q13.2-3 encompassing the three SNPs ASE-1 G-21A, RAI IVS1 A4364G and ERCC1 Asn118Asn have been associated with risk of breast cancer and lung cancer. Haplotype carriers are defined as the homozygous carriers of RAI IVS1 A4364GA, ERCC1 Asn118AsnT and ASE-1 G-21AG. We aimed to evaluate whether the three polymorphisms and the haplotype are associated to risk of colorectal cancer, and investigated gene-environment associations between the polymorphisms and the haplotype and smoking status at enrolment, smoking duration, average smoking intensity and alcohol consumption, respectively, in relation to risk of colorectal cancer. Associations between the three individual polymorphisms, the haplotype and risk of colorectal cancer were examined, as well as gene-environment interaction, in a Danish case-cohort study including 405 cases and a comparison group of 810 persons. Incidence rate ratio (IRR) were estimated by the Cox proportional hazards model stratified according to gender, and two-sided 95% confidence intervals (CI) and p-values were calculated based on robust estimates of the variance-covariance matrix and Wald's test of the Cox regression parameter. No consistent associations between the three individual polymorphisms, the haplotype and risk of colorectal cancer were found. No statistically significant interactions between the genotypes and the lifestyle exposures smoking or alcohol consumption were observed. Our results suggest that the ASE-1 G-21A, RAI IVS1 A4364G and ERCC1 Asn118Asn polymorphisms and the previously identified haplotype are not associated with risk of colorectal cancer. We found no evidence of gene-environment interaction between the three polymorphisms and the haplotype and smoking intensity and alcohol consumption

HLA-A*02 allele frequencies and haplotypic associations in Koreans.

PubMed

Park, M H; Whang, D H; Kang, S J; Han, K S

2000-03-01

We have investigated the frequencies of HLA-A*02 alleles and their haplotypic associations with HLA-B and -DRB1 loci in 439 healthy unrelated Koreans, including 214 parents from 107 families. All of the 227 samples (51.7%) typed as A2 by serology were analyzed for A*02 alleles using polymerase chain reaction (PCR)-low ionic strength-single-strand conformation polymorphism (LIS-SSCP) method. A total of six different A*02 alleles were detected (A*02 allele frequency 29.6%): A*0201/9 (16.6%), *0203 (0.5%), *0206 (9.3%), *0207 (3.0%), and one each case of *0210 and *02 undetermined type. Two characteristic haplotypes showing the strongest linkage disequilibrium were A*0203-B38-DRB]*1502 and A*0207-B46-DRB1*0803. Besides these strong associations, significant two-locus associations (P<0.001) were observed for A*0201 with B61, DRB1*0901 and DRB1*1401, and for A*0206 with B48 and B61. HLA haplotypes carrying HLA-A2 showed a variable distribution of A*02 alleles, and all of the eight most common A2-B-DR haplotypes occurring at frequencies of > or =1% were variably associated with two different A*02 alleles. These results demonstrate that substantial heterogeneity is present in the distribution of HLA-A*02 alleles and related haplotypes in Koreans.

Efficacy of Single-Suture Incision Closures in Tagged Juvenile Chinook Salmon Exposed to Simulated Turbine Passage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boyd, James W.; Deters, Katherine A.; Brown, Richard S.

2011-09-01

Reductions in the size of acoustic transmitters implanted in migrating juvenile salmonids have resulted in the use of a shorter incision-one that may warrant only a single suture for closure. However, it is not known whether a single suture will sufficiently hold the incision closed when fish are decompressed and when outward pressure is placed on the surgical site during turbine passage through hydroelectric dams. The objective of this study was to evaluate the effectiveness of single-suture incision closures on five response variables in juvenile Chinook salmon Oncorhynchus tshawytscha that were subjected to simulated turbine passage. An acoustic transmitter (0.43more » g in air) and a passive integrated transponder tag (0.10 g in air) were implanted in each fish; the 6-mm incisions were closed with either one suture or two sutures. After exposure to simulated turbine passage, none of the fish exhibited expulsion of transmitters. In addition, the percentage of fish with suture tearing, incision tearing, or mortal injury did not differ between treatments. Expulsion of viscera through the incision was higher among fish that received one suture (12%) than among fish that received two sutures (1%). The higher incidence of visceral expulsion through single-suture incisions warrants concern. Consequently, for cases in which tagged juvenile salmonidsmay be exposed to turbine passage, we do not recommend the use of one suture to close 6-mm incisions associated with acoustic transmitter implantation.« less

[Single-nucleotide polymorphism in populations of sockeye salmon Oncorhynchus nerka from Kamchatka Peninsula].

PubMed

Khrustaleva, A M; Gritsenko, O F; Klovach, N V

2013-11-01

The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected.

High-throughput single nucleotide polymorphism genotyping for breeding applications in rice using the BeadXpress platform

USDA-ARS?s Scientific Manuscript database

Multiplexed single nucleotide polymorphism (SNP) markers have the potential to increase the speed and cost-effectiveness of genotyping, provided that an optimal SNP density is used for each application. To test the efficiency of multiplexed SNP genotyping for diversity, mapping and breeding applicat...

Single nucleotide polymorphism of CC chemokine ligand 5 promoter gene in recipients may predict the risk of chronic graft-versus-host disease and its severity after allogeneic transplantation.

PubMed

Kim, Dong Hwan; Jung, Hee Du; Lee, Nan Young; Sohn, Sang Kyun

2007-10-15

Leukocyte trafficking, regulated by chemokine ligands and their receptors, involves in the pathogenesis of graft-versus-host disease (GVHD) including CC ligand 5 (CCL5) or CC receptor 5 (CCR5). The current study analyzed the association of acute or chronic GVHD (cGVHD) with the CCR5/CCL5 gene single nucleotide polymorphisms (SNPs) of recipients and donors. We evaluated the SNPs of CCL5 promoter gene at position -28 (rs1800825)/-403 (rs2107538) and CCR5 gene at 59029 (rs1799987) in 72 recipients and donors using polymerase chain reaction/RFLP (Restriction Fragment Length Polymorphism) methods. With a median follow up of 924 days for survivors (range 48-2,360 days), the CG genotype of CCL5 gene at position -28 in recipients was significantly associated with a higher incidence of cGVHD (P=0.004), extensive cGVHD (P=0.038 by Seattle's criteria), and severe grade of cGVHD at presentation (P=0.017 by prognostic grading by Apkek et al.) compared to CC genotype. In terms of haplotype analysis, the recipients with AG haplotype of CCL5 gene also showed a higher incidence of cGVHD (P=0.003), extensive cGVHD (P=0.023), and more severe grade of cGVHD (P=0.020). However, there was no association of CCL5/CCR5 SNPs with acute GVHD. The donors' genotype of CCL5/CCR5 was not associated with the risk of cGVHD. The CCL5 promoter gene polymorphism of recipients was associated with the risk of cGVHD and its severity. The current study suggested an involvement of CCL5 in leukocyte trafficking for the development of cGVHD.

Haplotype estimation using sequencing reads.

PubMed

Delaneau, Olivier; Howie, Bryan; Cox, Anthony J; Zagury, Jean-François; Marchini, Jonathan

2013-10-03

High-throughput sequencing technologies produce short sequence reads that can contain phase information if they span two or more heterozygote genotypes. This information is not routinely used by current methods that infer haplotypes from genotype data. We have extended the SHAPEIT2 method to use phase-informative sequencing reads to improve phasing accuracy. Our model incorporates the read information in a probabilistic model through base quality scores within each read. The method is primarily designed for high-coverage sequence data or data sets that already have genotypes called. One important application is phasing of single samples sequenced at high coverage for use in medical sequencing and studies of rare diseases. Our method can also use existing panels of reference haplotypes. We tested the method by using a mother-father-child trio sequenced at high-coverage by Illumina together with the low-coverage sequence data from the 1000 Genomes Project (1000GP). We found that use of phase-informative reads increases the mean distance between switch errors by 22% from 274.4 kb to 328.6 kb. We also used male chromosome X haplotypes from the 1000GP samples to simulate sequencing reads with varying insert size, read length, and base error rate. When using short 100 bp paired-end reads, we found that using mixtures of insert sizes produced the best results. When using longer reads with high error rates (5-20 kb read with 4%-15% error per base), phasing performance was substantially improved. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Incorporation of causative quantitative trait nucleotides in single-step GBLUP.

PubMed

Fragomeni, Breno O; Lourenco, Daniela A L; Masuda, Yutaka; Legarra, Andres; Misztal, Ignacy

2017-07-26

Much effort is put into identifying causative quantitative trait nucleotides (QTN) in animal breeding, empowered by the availability of dense single nucleotide polymorphism (SNP) information. Genomic selection using traditional SNP information is easily implemented for any number of genotyped individuals using single-step genomic best linear unbiased predictor (ssGBLUP) with the algorithm for proven and young (APY). Our aim was to investigate whether ssGBLUP is useful for genomic prediction when some or all QTN are known. Simulations included 180,000 animals across 11 generations. Phenotypes were available for all animals in generations 6 to 10. Genotypes for 60,000 SNPs across 10 chromosomes were available for 29,000 individuals. The genetic variance was fully accounted for by 100 or 1000 biallelic QTN. Raw genomic relationship matrices (GRM) were computed from (a) unweighted SNPs, (b) unweighted SNPs and causative QTN, (c) SNPs and causative QTN weighted with results obtained with genome-wide association studies, (d) unweighted SNPs and causative QTN with simulated weights, (e) only unweighted causative QTN, (f-h) as in (b-d) but using only the top 10% causative QTN, and (i) using only causative QTN with simulated weight. Predictions were computed by pedigree-based BLUP (PBLUP) and ssGBLUP. Raw GRM were blended with 1 or 5% of the numerator relationship matrix, or 1% of the identity matrix. Inverses of GRM were obtained directly or with APY. Accuracy of breeding values for 5000 genotyped animals in the last generation with PBLUP was 0.32, and for ssGBLUP it increased to 0.49 with an unweighted GRM, 0.53 after adding unweighted QTN, 0.63 when QTN weights were estimated, and 0.89 when QTN weights were based on true effects known from the simulation. When the GRM was constructed from causative QTN only, accuracy was 0.95 and 0.99 with blending at 5 and 1%, respectively. Accuracies simulating 1000 QTN were generally lower, with a similar trend. Accuracies using the

Association of Nitric Oxide Synthase and Matrix Metalloprotease Single Nucleotide Polymorphisms with Preeclampsia and Its Complications

PubMed Central

Leonardo, Daniela P.; Albuquerque, Dulcinéia M.; Lanaro, Carolina; Baptista, Letícia C.; Cecatti, José G.; Surita, Fernanda G.; Parpinelli, Mary A.; Costa, Fernando F.; Franco-Penteado, Carla F.; Fertrin, Kleber Y.; Costa, Maria Laura

2015-01-01

Background Preeclampsia is one of the leading causes of maternal and neonatal morbidity and mortality in the world, but its appearance is still unpredictable and its pathophysiology has not been entirely elucidated. Genetic studies have associated single nucleotide polymorphisms in genes encoding nitric oxide synthase and matrix metalloproteases with preeclampsia, but the results are largely inconclusive across different populations. Objectives To investigate the association of single nucleotide polymorphisms (SNPs) in NOS3 (G894T, T-786C, and a variable number of tandem repetitions VNTR in intron 4), MMP2 (C-1306T), and MMP9 (C-1562T) genes with preeclampsia in patients from Southeastern Brazil. Methods This prospective case-control study enrolled 77 women with preeclampsia and 266 control pregnant women. Clinical data were collected to assess risk factors and the presence of severe complications, such as eclampsia and HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Results We found a significant association between the single nucleotide polymorphism NOS3 T-786C and preeclampsia, independently from age, height, weight, or the other SNPs studied, and no association was found with the other polymorphisms. Age and history of preeclampsia were also identified as risk factors. The presence of at least one polymorphic allele for NOS3 T-786C was also associated with the occurrence of eclampsia or HELLP syndrome among preeclamptic women. Conclusions Our data support that the NOS3 T-786C SNP is associated with preeclampsia and the severity of its complications. PMID:26317342

A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

PubMed

Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

2012-09-04

A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

Method of preparing gas tags for identification of single and multiple failures of nuclear reactor fuel assemblies

DOEpatents

McCormick, Norman J.

1976-01-01

For use in the identification of failed fuel assemblies in a nuclear reactor, the ratios of the tag gas isotopic concentrations are located on curved surfaces to enable the ratios corresponding to failure of a single fuel assembly to be distinguished from those formed from any combination of two or more failed assemblies.

Association of Single Nucleotide Polymorphisms in the ST3GAL4 Gene with VWF Antigen and Factor VIII Activity.

PubMed

Song, Jaewoo; Xue, Cheng; Preisser, John S; Cramer, Drake W; Houck, Katie L; Liu, Guo; Folsom, Aaron R; Couper, David; Yu, Fuli; Dong, Jing-Fei

2016-01-01

VWF is extensively glycosylated with biantennary core fucosylated glycans. Most N-linked and O-linked glycans on VWF are sialylated. FVIII is also glycosylated, with a glycan structure similar to that of VWF. ST3GAL sialyltransferases catalyze the transfer of sialic acids in the α2,3 linkage to termini of N- and O-glycans. This sialic acid modification is critical for VWF synthesis and activity. We analyzed genetic and phenotypic data from the Atherosclerosis Risk in Communities (ARIC) study for the association of single nucleotide polymorphisms (SNPs) in the ST3GAL4 gene with plasma VWF levels and FVIII activity in 12,117 subjects. We also analyzed ST3GAL4 SNPs found in 2,535 subjects of 26 ethnicities from the 1000 Genomes (1000G) project for ethnic diversity, SNP imputation, and ST3GAL4 haplotypes. We identified 14 and 1,714 ST3GAL4 variants in the ARIC GWAS and 1000G databases respectively, with 46% being ethnically diverse in their allele frequencies. Among the 14 ST3GAL4 SNPs found in ARIC GWAS, the intronic rs2186717, rs7928391, and rs11220465 were associated with VWF levels and with FVIII activity after adjustment for age, BMI, hypertension, diabetes, ever-smoking status, and ABO. This study illustrates the power of next-generation sequencing in the discovery of new genetic variants and a significant ethnic diversity in the ST3GAL4 gene. We discuss potential mechanisms through which these intronic SNPs regulate ST3GAL4 biosynthesis and the activity that affects VWF and FVIII.

H-PoP and H-PoPG: heuristic partitioning algorithms for single individual haplotyping of polyploids.

PubMed

Xie, Minzhu; Wu, Qiong; Wang, Jianxin; Jiang, Tao

2016-12-15

Some economically important plants including wheat and cotton have more than two copies of each chromosome. With the decreasing cost and increasing read length of next-generation sequencing technologies, reconstructing the multiple haplotypes of a polyploid genome from its sequence reads becomes practical. However, the computational challenge in polyploid haplotyping is much greater than that in diploid haplotyping, and there are few related methods. This article models the polyploid haplotyping problem as an optimal poly-partition problem of the reads, called the Polyploid Balanced Optimal Partition model. For the reads sequenced from a k-ploid genome, the model tries to divide the reads into k groups such that the difference between the reads of the same group is minimized while the difference between the reads of different groups is maximized. When the genotype information is available, the model is extended to the Polyploid Balanced Optimal Partition with Genotype constraint problem. These models are all NP-hard. We propose two heuristic algorithms, H-PoP and H-PoPG, based on dynamic programming and a strategy of limiting the number of intermediate solutions at each iteration, to solve the two models, respectively. Extensive experimental results on simulated and real data show that our algorithms can solve the models effectively, and are much faster and more accurate than the recent state-of-the-art polyploid haplotyping algorithms. The experiments also show that our algorithms can deal with long reads and deep read coverage effectively and accurately. Furthermore, H-PoP might be applied to help determine the ploidy of an organism. https://github.com/MinzhuXie/H-PoPG CONTACT: xieminzhu@hotmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

PubMed

Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

2015-05-15

Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

Two families from New England with usher syndrome type IC with distinct haplotypes.

PubMed

DeAngelis, M M; McGee, T L; Keats, B J; Slim, R; Berson, E L; Dryja, T P

2001-03-01

To search for patients with Usher syndrome type IC among those with Usher syndrome type I who reside in New England. Genotype analysis of microsatellite markers closely linked to the USH1C locus was done using the polymerase chain reaction. We compared the haplotype of our patients who were homozygous in the USH1C region with the haplotypes found in previously reported USH1C Acadian families who reside in southwestern Louisiana and from a single family residing in Lebanon. Of 46 unrelated cases of Usher syndrome type I residing in New England, two were homozygous at genetic markers in the USH1C region. Of these, one carried the Acadian USH1C haplotype and had Acadian ancestors (that is, from Nova Scotia) who did not participate in the 1755 migration of Acadians to Louisiana. The second family had a haplotype that proved to be the same as that of a family with USH1C residing in Lebanon. Each of the two families had haplotypes distinct from the other. This is the first report that some patients residing in New England have Usher syndrome type IC. Patients with Usher syndrome type IC can have the Acadian haplotype or the Lebanese haplotype compatible with the idea that at least two independently arising pathogenic mutations have occurred in the yet-to-be identified USH1C gene.

Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

Gene-Based Single Nucleotide Polymorphism Markers for Genetic and Association Mapping in Common Bean

PubMed Central

2012-01-01

Background In common bean, expressed sequence tags (ESTs) are an underestimated source of gene-based markers such as insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). However, due to the nature of these conserved sequences, detection of markers is difficult and portrays low levels of polymorphism. Therefore, development of intron-spanning EST-SNP markers can be a valuable resource for genetic experiments such as genetic mapping and association studies. Results In this study, a total of 313 new gene-based markers were developed at target genes. Intronic variation was deeply explored in order to capture more polymorphism. Introns were putatively identified after comparing the common bean ESTs with the soybean genome, and the primers were designed over intron-flanking regions. The intronic regions were evaluated for parental polymorphisms using the single strand conformational polymorphism (SSCP) technique and Sequenom MassARRAY system. A total of 53 new marker loci were placed on an integrated molecular map in the DOR364 × G19833 recombinant inbred line (RIL) population. The new linkage map was used to build a consensus map, merging the linkage maps of the BAT93 × JALO EEP558 and DOR364 × BAT477 populations. A total of 1,060 markers were mapped, with a total map length of 2,041 cM across 11 linkage groups. As a second application of the generated resource, a diversity panel with 93 genotypes was evaluated with 173 SNP markers using the MassARRAY-platform and KASPar technology. These results were coupled with previous SSR evaluations and drought tolerance assays carried out on the same individuals. This agglomerative dataset was examined, in order to discover marker-trait associations, using general linear model (GLM) and mixed linear model (MLM). Some significant associations with yield components were identified, and were consistent with previous findings. Conclusions In short, this study illustrates the power of intron

Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus.

PubMed

Rogers, Stephanie M; Payton, Mark; Allen, Robert W; Melcher, Ulrich; Carver, Jesse; Fletcher, Jacqueline

2012-05-17

The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough

Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations.

PubMed

Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

2007-08-10

The sickle (betas) mutation in the beta-globin gene (HBB) occurs on five "classical" betas haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the betas allele - a consequence of protection from severe malarial infection afforded by heterozygotes - has been associated with a high degree of extended haplotype similarity. The relationship between classical betas haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical betas haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). The most common betas sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the betas mutation. Two different classical betas haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of betas haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle

Genome-wide Association Study Identifies HLA 8.1 Ancestral Haplotype Alleles as Major Genetic Risk Factors for Myositis Phenotypes

PubMed Central

Miller, Frederick W.; Chen, Wei; O’Hanlon, Terrance P.; Cooper, Robert G.; Vencovsky, Jiri; Rider, Lisa G.; Danko, Katalin; Wedderburn, Lucy R.; Lundberg, Ingrid E.; Pachman, Lauren M.; Reed, Ann M.; Ytterberg, Steven R.; Padyukov, Leonid; Selva-O’Callaghan, Albert; Radstake, Timothy R.; Isenberg, David A.; Chinoy, Hector; Ollier, William E.R.; Scheet, Paul; Peng, Bo; Lee, Annette; Byun, Jinyoung; Lamb, Janine A.; Gregersen, Peter K.; Amos, Christopher I.

2016-01-01

Autoimmune muscle diseases (myositis) comprise a group of complex phenotypes influenced by genetic and environmental factors. To identify genetic risk factors in patients of European ancestry, we conducted a genome-wide association study (GWAS) of the major myositis phenotypes in a total of 1710 cases, which included 705 adult dermatomyositis; 473 juvenile dermatomyositis; 532 polymyositis; and 202 adult dermatomyositis, juvenile dermatomyositis or polymyositis patients with anti-histidyl tRNA synthetase (anti-Jo-1) autoantibodies, and compared them with 4724 controls. Single-nucleotide polymorphisms showing strong associations (P < 5 × 10−8) in GWAS were identified in the major histocompatibility complex (MHC) region for all myositis phenotypes together, as well as for the four clinical and autoantibody phenotypes studied separately. Imputation and regression analyses found that alleles comprising the human leukocyte antigen (HLA) 8.1 ancestral haplotype (AH8.1) defined essentially all the genetic risk in the phenotypes studied. Although the HLA DRB1*03:01 allele showed slightly stronger associations with adult and juvenile dermatomyositis, and HLA B*08:01 with polymyositis and anti-Jo-1 autoantibody-positive myositis, multiple alleles of AH8.1 were required for the full risk effects. Our findings establish that alleles of the AH8.1haplotype comprise the primary genetic risk factors associated with the major myositis phenotypes in geographically diverse Caucasian populations. PMID:26291516

Single-cell high resolution melting analysis: A novel, generic, pre-implantation genetic diagnosis (PGD) method applied to cystic fibrosis (HRMA CF-PGD).

PubMed

Destouni, A; Poulou, M; Kakourou, G; Vrettou, C; Tzetis, M; Traeger-Synodinos, J; Kitsiou-Tzeli, S

2016-03-01

Institutions offering CF-PGD face the challenge of developing and optimizing single cell genotyping protocols that should cover for the extremely heterogeneous CF mutation spectrum. Here we report the development and successful clinical application of a generic CF-PGD protocol to facilitate direct detection of any CFTR nucleotide variation(s) by HRMA and simultaneous confirmation of diagnosis through haplotype analysis. A multiplex PCR was optimized supporting co-amplification of any CFTR exon-region, along with 6 closely linked STRs. Single cell genotypes were established through HRM analysis following melting of the 2nd round PCR products and were confirmed by STR haplotype analysis of the 1st PCR products. The protocol was validated pre-clinically, by testing 208 single lymphocytes, isolated from whole blood samples from 4 validation family trios. Fifteen PGD cycles were performed and 103 embryos were biopsied. In 15 clinical PGD cycles, genotypes were achieved in 88/93 (94.6%) embryo biopsy samples, of which 57/88 (64.8%) were deemed genetically suitable for embryo transfer. Amplification failed at all loci for 10/103 blastomeres biopsied from poor quality embryos. Six clinical pregnancies were achieved (2 twin, 4 singletons). PGD genotypes were confirmed following conventional amniocentesis or chorionic villus sampling in all achieved pregnancies. The single cell HRMA CF-PGD protocol described herein is a flexible, generic, low cost and robust genotyping method, which facilitates the analysis of any CFTR genotype combination. Single-cell HRMA can be beneficial to other clinical settings, for example the detection of single nucleotide variants in single cells derived from clinical tumor samples. Copyright © 2015 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

Short communication: Relationship of call rate and accuracy of single nucleotide polymorphism genotypes in dairy cattle

USDA-ARS?s Scientific Manuscript database

Call rate has been used as a measure of quality on both a single nucleotide polymorphism (SNP) and animal basis since SNP genotypes were first used in genomic evaluation of dairy cattle. The genotyping laboratories perform initial quality control screening and genotypes that fail are usually exclude...

A Single IGF1 Allele Is a Major Determinant of Small Size in Dogs

PubMed Central

Sutter, Nathan B.; Bustamante, Carlos D.; Chase, Kevin; Gray, Melissa M.; Zhao, Keyan; Zhu, Lan; Padhukasahasram, Badri; Karlins, Eric; Davis, Sean; Jones, Paul G.; Quignon, Pascale; Johnson, Gary S.; Parker, Heidi G.; Fretwell, Neale; Mosher, Dana S.; Lawler, Dennis F.; Satyaraj, Ebenezer; Nordborg, Magnus; Lark, K. Gordon; Wayne, Robert K.; Ostrander, Elaine A.

2009-01-01

The domestic dog exhibits greater diversity in body size than any other terrestrial vertebrate. We used a strategy that exploits the breed structure of dogs to investigate the genetic basis of size. First, through a genome-wide scan, we identified a major quantitative trait locus (QTL) on chromosome 15 influencing size variation within a single breed. Second, we examined genetic variation in the 15-megabase interval surrounding the QTL in small and giant breeds and found marked evidence for a selective sweep spanning a single gene (IGF1), encoding insulin-like growth factor 1. A single IGF1 single-nucleotide polymorphism haplotype is common to all small breeds and nearly absent from giant breeds, suggesting that the same causal sequence variant is a major contributor to body size in all small dogs. PMID:17412960

A single IGF1 allele is a major determinant of small size in dogs.

PubMed

Sutter, Nathan B; Bustamante, Carlos D; Chase, Kevin; Gray, Melissa M; Zhao, Keyan; Zhu, Lan; Padhukasahasram, Badri; Karlins, Eric; Davis, Sean; Jones, Paul G; Quignon, Pascale; Johnson, Gary S; Parker, Heidi G; Fretwell, Neale; Mosher, Dana S; Lawler, Dennis F; Satyaraj, Ebenezer; Nordborg, Magnus; Lark, K Gordon; Wayne, Robert K; Ostrander, Elaine A

2007-04-06

The domestic dog exhibits greater diversity in body size than any other terrestrial vertebrate. We used a strategy that exploits the breed structure of dogs to investigate the genetic basis of size. First, through a genome-wide scan, we identified a major quantitative trait locus (QTL) on chromosome 15 influencing size variation within a single breed. Second, we examined genetic variation in the 15-megabase interval surrounding the QTL in small and giant breeds and found marked evidence for a selective sweep spanning a single gene (IGF1), encoding insulin-like growth factor 1. A single IGF1 single-nucleotide polymorphism haplotype is common to all small breeds and nearly absent from giant breeds, suggesting that the same causal sequence variant is a major contributor to body size in all small dogs.

Single-nucleotide polymorphisms of MMP2 in MMP/TIMP pathways associated with the risk of alcohol-induced osteonecrosis of the femoral head in Chinese males: A case-control study.

PubMed

Yu, Yan; Xie, Zhilan; Wang, Jihan; Chen, Chu; Du, Shuli; Chen, Peng; Li, Bin; Jin, Tianbo; Zhao, Heping

2016-12-01

The proportion of alcohol-induced osteonecrosis of the femoral head (ONFH) in all ONFH patients was 30.7%, with males prevailing among the ONFH patients in mainland China (70.1%). Matrix metalloproteinase 2 (MMP2), a member of the MMP gene family, encodes the enzyme MMP2, which can promote osteoclast migration, attachment, and bone matrix degradation. In this case-control study, we aimed to investigate the association between MMP2 and the alcohol-induced ONFH in Chinese males.In total, 299 patients with alcohol-induced ONFH and 396 healthy controls were recruited for a case-control association study. Five single-nucleotide polymorphisms within the MMP2 locus were genotyped and examined for their correlation with the risk of alcohol-induced ONFH and treatment response using Pearson χ test and unconditional logistic regression analysis. We identified 3 risk alleles for carriers: the allele "T" of rs243849 increased the risk of alcohol-induced ONFH in the allele model, the log-additive model without adjustment, and the log-additive model with adjustment for age. Conversely, the genotypes "CC" in rs7201 and "CC" in rs243832 decreased the risk of alcohol-induced ONFH, as revealed by the recessive model. After the Bonferroni multiple adjustment, no significant association was found. Furthermore, the haplotype analysis showed that the "TT" haplotype of MMP2 was more frequent among patients with alcohol-induced ONFH by unconditional logistic regression analysis adjusted for age.In conclusion, there may be an association between MMP2 and the risk of alcohol-induced ONFH in North-Chinese males. However, studies on larger populations are needed to confirm this hypothesis; these data may provide a theoretical foundation for future studies.

Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

USDA-ARS?s Scientific Manuscript database

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

A Case–control and a family-based association study revealing an association between CYP2E1 polymorphisms and nasopharyngeal carcinoma risk in Cantonese

PubMed Central

Jia, Wei-Hua; Pan, Qing-Hua; Qin, Hai-De; Xu, Ya-Fei; Shen, Guo-Ping; Chen, Lina; Chen, Li-Zhen; Feng, Qi-Sheng; Hong, Ming-Huang; Zeng, Yi-Xin; Shugart, Yin Yao

2009-01-01

Nasopharyngeal carcinoma (NPC) is rare in most parts of the world but is more prevalent in Southern China, especially in Guangdong. The cytochrome P450 2E1 (CYP2E1) has been recognized as one of the critically important enzymes involved in oxidizing carcinogens and is probably to be associated with NPC carcinogenesis. To systematically investigate the association between genetic variants in CYP2E1 and NPC risk in Cantonese, two independent studies, a family-based association study and a case–control study, were conducted using the haplotype-tagging single-nucleotide polymorphism approach. A total of 2499 individuals from 546 nuclear families were initially genotyped for the family-based association study. Single-nucleotide polymorphisms (SNPs) rs9418990, rs915908, rs8192780, rs1536826, rs3827688 and one haplotype h2 (CGTGTTAA) were revealed to be significantly associated with the NPC phenotype (P = 0.045–0.003 and P = 0.003, respectively). To follow up the initial study, a case–control study including 755 cases and 755 controls was conducted. Similar results were observed in the case–control study in individuals <46 years of age and had a history of cigarette smoking, with odds ratios (ORs) of specific genotypes ranging from 1.88 to 2.99 corresponding to SNP rs9418990, rs3813865, rs915906, rs2249695, rs8192780, rs1536826, rs3827688 and of haplotypes h2 with OR = 1.65 (P = 0.026), h5 (CCCGTTAA) with OR = 2.58 (P = 0.007). The values of false-positive report probability were <0.015 for six SNPs, suggesting that the reported associations are less probably to be false. This study provides robust evidence for associations between genetic variants of CYP2E1 and NPC risk. PMID:19805575

How Have Self-Incompatibility Haplotypes Diversified? Generation of New Haplotypes during the Evolution of Self-Incompatibility from Self-Compatibility.

PubMed

Sakai, Satoki

2016-08-01

I developed a gametophytic self-incompatibility (SI) model to study the conditions leading to diversification in SI haplotypes. In the model, the SI system is assumed to be incomplete, and the pollen expressing a given specificity is not fully rejected by the pistils expressing the same specificity. I also assumed that mutations can occur that enhance the rejection of pollen by pistils with the same haplotype variant and reduce rejection by pistils with other variants in the same haplotype. I found that if such mutations occur, the new haplotypes (mutant variants) can stably coexist with the ancestral haplotype in which the mutant arose. This is because pollen bearing the new haplotype is most strongly rejected by pistils bearing the same new haplotype among the pistils in the population; hence, negative frequency-dependent selection prevents their fixation. I also performed simulations and found that the nearly complete SI system evolves from completely self-compatible populations and that SI haplotypes can increase to about 40-50 within a few thousand generations. On the basis of my findings, I propose that diversification of SI haplotypes occurred during the evolution of SI from self-compatibility.

Development of single-nucleotide polymorphism markers for Bromus tectorum (Poaceae) from a partially sequenced transcriptome

Treesearch

Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins

2016-01-01

Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...

Meta-analysis of the relationship between single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease.

PubMed

Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang

2018-02-23

The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.

Eurasian otters, Lutra lutra, have a dominant mtDNA haplotype from the Iberian Peninsula to Scandinavia.

PubMed

Ferrando, Ainhoa; Ponsà, Montserrat; Marmi, Josep; Domingo-Roura, Xavier

2004-01-01

The Eurasian otter, Lutra lutra, has a Palaearctic distribution and has suffered a severe decline throughout Europe during the last century. Previous studies in this and other mustelids have shown reduced levels of variability in mitochondrial DNA, although otter phylogeographic studies were restricted to central-western Europe. In this work we have sequenced 361 bp of the mtDNA control region in 73 individuals from eight countries and added our results to eight sequences available from GenBank and the literature. The range of distribution has been expanded in relation to previous works north towards Scandinavia, east to Russia and Belarus, and south to the Iberian Peninsula. We found a single dominant haplotype in 91.78% of the samples, and six more haplotypes deviating a maximum of two mutations from the dominant haplotype restricted to a single country. Variability was extremely low in western Europe but higher in eastern countries. This, together with the lack of phylogeographical structuring, supports the postglacial recolonization of Europe from a single refugium. The Eurasian otter mtDNA control region has a 220-bp variable minisatellite in Domain III that we sequenced in 29 otters. We found a total of 19 minisatellite haplotypes, but they showed no phylogenetic information.

DNAzyme based gap-LCR detection of single-nucleotide polymorphism.

PubMed

Zhou, Li; Du, Feng; Zhao, Yongyun; Yameen, Afshan; Chen, Haodong; Tang, Zhuo

2013-07-15

Fast and accurate detection of single-nucleotide polymorphism (SNP) is thought more and more important for understanding of human physiology and elucidating the molecular based diseases. A great deal of effort has been devoted to developing accurate, rapid, and cost-effective technologies for SNP analysis. However most of those methods developed to date incorporate complicated probe labeling and depend on advanced equipment. The DNAzyme based Gap-LCR detection method averts any chemical modification on probes and circumvents those problems by incorporating a short functional DNA sequence into one of LCR primers. Two kinds of exonuclease are utilized in our strategy to digest all the unreacted probes and release the DNAzymes embedded in the LCR product. The DNAzyme applied in our method is a versatile tool to report the result of SNP detection in colorimetric or fluorometric ways for different detection purposes. Copyright © 2013 Elsevier B.V. All rights reserved.

Analysis of association of clinical aspects and IL1B tagSNPs with severe preeclampsia.

PubMed

Leme Galvão, Larissa Paes; Menezes, Filipe Emanuel; Mendonca, Caio; Barreto, Ikaro; Alvim-Pereira, Claudia; Alvim-Pereira, Fabiano; Gurgel, Ricardo

2016-01-01

This study investigates the association between IL1B genotypes using a tag SNP (single polymorphism) approach, maternal and environmental factors in Brazilian women with severe preeclampsia. A case-control study with a total of 456 patients (169 preeclamptic women and 287 controls) was conducted in the two reference maternity hospitals of Sergipe state, Northeast Brazil. A questionnaire was administered and DNA was extracted to genotype the population for four tag SNPs of the IL1Beta: rs 1143643, rs 1143633, rs 1143634 and rs 1143630. Haplotype association analysis and p-values were calculated using the THESIAS test. Odds ratio (OR) estimation, confidence interval (CI) and multivariate logistic regression were performed. High pregestational body mass index (pre-BMI), first gestation, cesarean section, more than six medical visits, low level of consciousness on admission and TC and TT genotype in rs1143630 of IL1Beta showed association with the preeclamptic group in univariate analysis. After multivariate logistic regression pre-BMI, first gestation and low level of consciousness on admission remained associated. We identified an association between clinical variables and preeclampsia. Univariate analysis suggested that inflammatory process-related genes, such as IL1B, may be involved and should be targeted in further studies. The identification of the genetic background involved in preeclampsia host response modulation is mandatory in order to understand the preeclampsia process.

Crosstalk between Diverse Synthetic Protein Degradation Tags in Escherichia coli.

PubMed

Butzin, Nicholas C; Mather, William H

2018-01-19

Recently, a synthetic circuit in E. coli demonstrated that two proteins engineered with LAA tags targeted to the native protease ClpXP are susceptible to crosstalk due to competition for degradation between proteins. To understand proteolytic crosstalk beyond the single protease regime, we investigated in E. coli a set of synthetic circuits designed to probe the dynamics of existing and novel degradation tags fused to fluorescent proteins. These circuits were tested using both microplate reader and single-cell assays. We first quantified the degradation rates of each tag in isolation. We then tested if there was crosstalk between two distinguishable fluorescent proteins engineered with identical or different degradation tags. We demonstrated that proteolytic crosstalk was indeed not limited to the LAA degradation tag, but was also apparent between other diverse tags, supporting the complexity of the E. coli protein degradation system.

A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

The association between oxytocin receptor gene (OXTR) polymorphisms and affective temperaments, as measured by TEMPS-A.

PubMed

Kawamura, Yoshiya; Liu, Xiaoxi; Akiyama, Tsuyoshi; Shimada, Takafumi; Otowa, Takeshi; Sakai, Yoshie; Kakiuchi, Chihiro; Umekage, Tadashi; Sasaki, Tsukasa; Akiskal, Hagop S

2010-12-01

Oxytocin is associated with social interaction, trust, and affectivity. Affective temperaments are traits based on Kraepelin's typological definition of the "fundamental states" of manic-depressive illness. These states can be measured by the Temperament Evaluation of Memphis, Pisa, Paris and San Diego-Autoquestionnaire version (TEMPS-A). The objective of this study is to assess the association between oxytocin receptor gene (OXTR) polymorphisms and affective temperaments. Participants consisted of 493 genetically unrelated, non-clinical Japanese subjects (307 males and 186 females). The Mini-International Neuropsychiatric Interview (MINI) was used to screen and exclude those who had a lifetime diagnosis of schizophrenia or other psychotic disorders. Fifteen OXTR tag single nucleotide polymorphisms (SNPs) were genotyped using TaqMan® or direct sequencing. The Haploview 4.1. software determined the haplotype block structure. Haplotype-based quantitative trait association analysis with Bonferroni correction using PLINK 1.06 software was used to assess the association between haplotypes and the following affective temperaments: depressive, cyclothymic, hyperthymic, irritable, and anxious. Two haplotype blocks were identified on the OXTR. The depressive temperament was significantly associated with the most frequent haplotype GGGTGTC (rs11131149/rs2243370/rs2243369/rs13316193/rs2254298/rs2268493/rs2268491) (corrected P<0.05). This study consisted of participants from a corporation and the effect sizes were small. The findings suggest that an OXTR haplotype is associated with a discrete depressive temperament. Clarification of the biological basis of this temperamental trait may help to elucidate the pathophysiology of depressive disorder. Copyright © 2010 Elsevier B.V. All rights reserved.

Large Scale Single Nucleotide Polymorphism Study of PD Susceptibility

DTIC Science & Technology

2006-03-01

familial PD, the results of intensive investigations of polymorphisms in dozens of genes related to sporadic, late onset, typical PD have not shown...association between classical, sporadic PD and 2386 SNPs in 23 genes implicated in the pathogenesis of PD; (2) construct haplotypes based on the SNP...derived from this study may be applied in other complex disorders for the identification of susceptibility genes , as well as in genome-wide SNP

Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.

PubMed

Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S

2012-11-10

We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.

Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

PubMed

Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

2017-02-15

Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

Haplotypic Analysis of Wellcome Trust Case Control Consortium Data

PubMed Central

Browning, Brian L.; Browning, Sharon R.

2008-01-01

We applied a recently developed multilocus association testing method (localized haplotype clustering) to Wellcome Trust Case Control Consortium data (14,000 cases of seven common diseases and 3,000 shared controls genotyped on the Affymetrix 500K array). After rigorous data quality filtering, we identified three disease-associated loci with strong statistical support from localized haplotype cluster tests but with only marginal significance in single marker tests. These loci are chromosomes 10p15.1 with type 1 diabetes (p = 5.1 × 10-9), 12q15 with type 2 diabetes (p = 1.9 × 10-7) and 15q26.2 with hypertension (p = 2.8 × 10-8). We also detected the association of chromosome 9p21.3 with type 2 diabetes (p = 2.8 × 10-8), although this locus did not pass our stringent genotype quality filters. The association of 10p15.1 with type 1 diabetes and 9p21.3 with type 2 diabetes have both been replicated in other studies using independent data sets. Overall, localized haplotype cluster analysis had better success detecting disease associated variants than a previous single-marker analysis of imputed HapMap SNPs. We found that stringent application of quality score thresholds to genotype data substantially reduced false-positive results arising from genotype error. In addition, we demonstrate that it is possible to simultaneously phase 16,000 individuals genotyped on genome-wide data (450K markers) using the Beagle software package. PMID:18224336

Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations

PubMed Central

Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

2007-01-01

Background The sickle (βs) mutation in the beta-globin gene (HBB) occurs on five "classical" βs haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the βs allele – a consequence of protection from severe malarial infection afforded by heterozygotes – has been associated with a high degree of extended haplotype similarity. The relationship between classical βs haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical βs haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). Results The most common βs sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the βs mutation. Conclusion Two different classical βs haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of βs haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence