Genetic Structures of Copy Number Variants Revealed by Genotyping Single Sperm

PubMed Central

Luo, Minjie; Cui, Xiangfeng; Fredman, David; Brookes, Anthony J.; Azaro, Marco A.; Greenawalt, Danielle M.; Hu, Guohong; Wang, Hui-Yun; Tereshchenko, Irina V.; Lin, Yong; Shentu, Yue; Gao, Richeng; Shen, Li; Li, Honghua

2009-01-01

Background Copy number variants (CNVs) occupy a significant portion of the human genome and may have important roles in meiotic recombination, human genome evolution and gene expression. Many genetic diseases may be underlain by CNVs. However, because of the presence of their multiple copies, variability in copy numbers and the diploidy of the human genome, detailed genetic structure of CNVs cannot be readily studied by available techniques. Methodology/Principal Findings Single sperm samples were used as the primary subjects for the study so that CNV haplotypes in the sperm donors could be studied individually. Forty-eight CNVs characterized in a previous study were analyzed using a microarray-based high-throughput genotyping method after multiplex amplification. Seventeen single nucleotide polymorphisms (SNPs) were also included as controls. Two single-base variants, either allelic or paralogous, could be discriminated for all markers. Microarray data were used to resolve SNP alleles and CNV haplotypes, to quantitatively assess the numbers and compositions of the paralogous segments in each CNV haplotype. Conclusions/Significance This is the first study of the genetic structure of CNVs on a large scale. Resulting information may help understand evolution of the human genome, gain insight into many genetic processes, and discriminate between CNVs and SNPs. The highly sensitive high-throughput experimental system with haploid sperm samples as subjects may be used to facilitate detailed large-scale CNV analysis. PMID:19384415

A powerful approach reveals numerous expression quantitative trait haplotypes in multiple tissues.

PubMed

Ying, Dingge; Li, Mulin Jun; Sham, Pak Chung; Li, Miaoxin

2018-04-26

Recently many studies showed single nucleotide polymorphisms (SNPs) affect gene expression and contribute to development of complex traits/diseases in a tissue context-dependent manner. However, little is known about haplotype's influence on gene expression and complex traits, which reflects the interaction effect between SNPs. In the present study, we firstly proposed a regulatory region guided eQTL haplotype association analysis approach, and then systematically investigate the expression quantitative trait loci (eQTL) haplotypes in 20 different tissues by the approach. The approach has a powerful design of reducing computational burden by the utilization of regulatory predictions for candidate SNP selection and multiple testing corrections on non-independent haplotypes. The application results in multiple tissues showed that haplotype-based eQTLs not only increased the number of eQTL genes in a tissue specific manner, but were also enriched in loci that associated with complex traits in a tissue-matched manner. In addition, we found that tag SNPs of eQTL haplotypes from whole blood were selectively enriched in certain combination of regulatory elements (e.g. promoters and enhancers) according to predicted chromatin states. In summary, this eQTL haplotype detection approach, together with the application results, shed insights into synergistic effect of sequence variants on gene expression and their susceptibility to complex diseases. The executable application "eHaplo" is implemented in Java and is publicly available at http://grass.cgs.hku.hk/limx/ehaplo/. jonsonfox@gmail.com, limiaoxin@mail.sysu.edu.cn. Supplementary data are available at Bioinformatics online.

cFinder: definition and quantification of multiple haplotypes in a mixed sample.

PubMed

Niklas, Norbert; Hafenscher, Julia; Barna, Agnes; Wiesinger, Karin; Pröll, Johannes; Dreiseitl, Stephan; Preuner-Stix, Sandra; Valent, Peter; Lion, Thomas; Gabriel, Christian

2015-09-07

Next-generation sequencing allows for determining the genetic composition of a mixed sample. For instance, when performing resistance testing for BCR-ABL1 it is necessary to identify clones and define compound mutations; together with an exact quantification this may complement diagnosis and therapy decisions with additional information. Moreover, that applies not only to oncological issues but also determination of viral, bacterial or fungal infection. The efforts to retrieve multiple haplotypes (more than two) and proportion information from data with conventional software are difficult, cumbersome and demand multiple manual steps. Therefore, we developed a tool called cFinder that is capable of automatic detection of haplotypes and their accurate quantification within one sample. BCR-ABL1 samples containing multiple clones were used for testing and our cFinder could identify all previously found clones together with their abundance and even refine some results. Additionally, reads were simulated using GemSIM with multiple haplotypes, the detection was very close to linear (R(2) = 0.96). Our aim is not to deduce haploblocks over statistics, but to characterize one sample's composition precisely. As a result the cFinder reports the connections of variants (haplotypes) with their readcount and relative occurrence (percentage). Download is available at http://sourceforge.net/projects/cfinder/. Our cFinder is implemented in an efficient algorithm that can be run on a low-performance desktop computer. Furthermore, it considers paired-end information (if available) and is generally open for any current next-generation sequencing technology and alignment strategy. To our knowledge, this is the first software that enables researchers without extensive bioinformatic support to designate multiple haplotypes and how they constitute to a sample.

A parsimonious tree-grow method for haplotype inference.

PubMed

Li, Zhenping; Zhou, Wenfeng; Zhang, Xiang-Sun; Chen, Luonan

2005-09-01

Haplotype information has become increasingly important in analyzing fine-scale molecular genetics data, such as disease genes mapping and drug design. Parsimony haplotyping is one of haplotyping problems belonging to NP-hard class. In this paper, we aim to develop a novel algorithm for the haplotype inference problem with the parsimony criterion, based on a parsimonious tree-grow method (PTG). PTG is a heuristic algorithm that can find the minimum number of distinct haplotypes based on the criterion of keeping all genotypes resolved during tree-grow process. In addition, a block-partitioning method is also proposed to improve the computational efficiency. We show that the proposed approach is not only effective with a high accuracy, but also very efficient with the computational complexity in the order of O(m2n) time for n single nucleotide polymorphism sites in m individual genotypes. The software is available upon request from the authors, or from http://zhangroup.aporc.org/bioinfo/ptg/ chen@elec.osaka-sandai.ac.jp Supporting materials is available from http://zhangroup.aporc.org/bioinfo/ptg/bti572supplementary.pdf

Next generation haplotyping to decipher nuclear genomic interspecific admixture in Citrus species: analysis of chromosome 2.

PubMed

Curk, Franck; Ancillo, Gema; Garcia-Lor, Andres; Luro, François; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Navarro, Luis; Ollitrault, Patrick

2014-12-29

The most economically important Citrus species originated by natural interspecific hybridization between four ancestral taxa (Citrus reticulata, Citrus maxima, Citrus medica, and Citrus micrantha) and from limited subsequent interspecific recombination as a result of apomixis and vegetative propagation. Such reticulate evolution coupled with vegetative propagation results in mosaic genomes with large chromosome fragments from the basic taxa in frequent interspecific heterozygosity. Modern breeding of these species is hampered by their complex heterozygous genomic structures that determine species phenotype and are broken by sexual hybridisation. Nevertheless, a large amount of diversity is present in the citrus gene pool, and breeding to allow inclusion of desirable traits is of paramount importance. However, the efficient mobilization of citrus biodiversity in innovative breeding schemes requires previous understanding of Citrus origins and genomic structures. Haplotyping of multiple gene fragments along the whole genome is a powerful approach to reveal the admixture genomic structure of current species and to resolve the evolutionary history of the gene pools. In this study, the efficiency of parallel sequencing with 454 methodology to decipher the hybrid structure of modern citrus species was assessed by analysis of 16 gene fragments on chromosome 2. 454 amplicon libraries were established using the Fluidigm array system for 48 genotypes and 16 gene fragments from chromosome 2. Haplotypes were established from the reads of each accession and phylogenetic analyses were performed using the haplotypic data for each gene fragment. The length of 454 reads and the level of differentiation between the ancestral taxa of modern citrus allowed efficient haplotype phylogenetic assignations for 12 of the 16 gene fragments. The analysis of the mixed genomic structure of modern species and cultivars (i) revealed C. maxima introgressions in modern mandarins, (ii) was consistent with previous hypotheses regarding the origin of secondary species, and (iii) provided a new picture of the evolution of chromosome 2. 454 sequencing was an efficient strategy to establish haplotypes with significant phylogenetic assignations in Citrus, providing a new picture of the mixed structure on chromosome 2 in 48 citrus genotypes.

HaploForge: a comprehensive pedigree drawing and haplotype visualization web application.

PubMed

Tekman, Mehmet; Medlar, Alan; Mozere, Monika; Kleta, Robert; Stanescu, Horia

2017-12-15

Haplotype reconstruction is an important tool for understanding the aetiology of human disease. Haplotyping infers the most likely phase of observed genotypes conditional on constraints imposed by the genotypes of other pedigree members. The results of haplotype reconstruction, when visualized appropriately, show which alleles are identical by descent despite the presence of untyped individuals. When used in concert with linkage analysis, haplotyping can help delineate a locus of interest and provide a succinct explanation for the transmission of the trait locus. Unfortunately, the design choices made by existing haplotype visualization programs do not scale to large numbers of markers. Indeed, following haplotypes from generation to generation requires excessive scrolling back and forth. In addition, the most widely used program for haplotype visualization produces inconsistent recombination artefacts for the X chromosome. To resolve these issues, we developed HaploForge, a novel web application for haplotype visualization and pedigree drawing. HaploForge takes advantage of HTML5 to be fast, portable and avoid the need for local installation. It can accurately visualize autosomal and X-linked haplotypes from both outbred and consanguineous pedigrees. Haplotypes are coloured based on identity by descent using a novel A* search algorithm and we provide a flexible viewing mode to aid visual inspection. HaploForge can currently process haplotype reconstruction output from Allegro, GeneHunter, Merlin and Simwalk. HaploForge is licensed under GPLv3 and is hosted and maintained via GitHub. https://github.com/mtekman/haploforge. r.kleta@ucl.ac.uk. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Wolbachia association with the tsetse fly, Glossina fuscipes fuscipes, reveals high levels of genetic diversity and complex evolutionary dynamics

PubMed Central

2013-01-01

Background Wolbachia pipientis, a diverse group of α-proteobacteria, can alter arthropod host reproduction and confer a reproductive advantage to Wolbachia-infected females (cytoplasmic incompatibility (CI)). This advantage can alter host population genetics because Wolbachia-infected females produce more offspring with their own mitochondrial DNA (mtDNA) haplotypes than uninfected females. Thus, these host haplotypes become common or fixed (selective sweep). Although simulations suggest that for a CI-mediated sweep to occur, there must be a transient phase with repeated initial infections of multiple individual hosts by different Wolbachia strains, this has not been observed empirically. Wolbachia has been found in the tsetse fly, Glossina fuscipes fuscipes, but it is not limited to a single host haplotype, suggesting that CI did not impact its population structure. However, host population genetic differentiation could have been generated if multiple Wolbachia strains interacted in some populations. Here, we investigated Wolbachia genetic variation in G. f. fuscipes populations of known host genetic composition in Uganda. We tested for the presence of multiple Wolbachia strains using Multi-Locus Sequence Typing (MLST) and for an association between geographic region and host mtDNA haplotype using Wolbachia DNA sequence from a variable locus, groEL (heat shock protein 60). Results MLST demonstrated that some G. f. fuscipes carry Wolbachia strains from two lineages. GroEL revealed high levels of sequence diversity within and between individuals (Haplotype diversity = 0.945). We found Wolbachia associated with 26 host mtDNA haplotypes, an unprecedented result. We observed a geographical association of one Wolbachia lineage with southern host mtDNA haplotypes, but it was non-significant (p = 0.16). Though most Wolbachia-infected host haplotypes were those found in the contact region between host mtDNA groups, this association was non-significant (p = 0.17). Conclusions High Wolbachia sequence diversity and the association of Wolbachia with multiple host haplotypes suggest that different Wolbachia strains infected G. f. fuscipes multiple times independently. We suggest that these observations reflect a transient phase in Wolbachia evolution that is influenced by the long gestation and low reproductive output of tsetse. Although G. f. fuscipes is superinfected with Wolbachia, our data does not support that bidirectional CI has influenced host genetic diversity in Uganda. PMID:23384159

Gene genealogies for genetic association mapping, with application to Crohn's disease

PubMed Central

Burkett, Kelly M.; Greenwood, Celia M. T.; McNeney, Brad; Graham, Jinko

2013-01-01

A gene genealogy describes relationships among haplotypes sampled from a population. Knowledge of the gene genealogy for a set of haplotypes is useful for estimation of population genetic parameters and it also has potential application in finding disease-predisposing genetic variants. As the true gene genealogy is unknown, Markov chain Monte Carlo (MCMC) approaches have been used to sample genealogies conditional on data at multiple genetic markers. We previously implemented an MCMC algorithm to sample from an approximation to the distribution of the gene genealogy conditional on haplotype data. Our approach samples ancestral trees, recombination and mutation rates at a genomic focal point. In this work, we describe how our sampler can be used to find disease-predisposing genetic variants in samples of cases and controls. We use a tree-based association statistic that quantifies the degree to which case haplotypes are more closely related to each other around the focal point than control haplotypes, without relying on a disease model. As the ancestral tree is a latent variable, so is the tree-based association statistic. We show how the sampler can be used to estimate the posterior distribution of the latent test statistic and corresponding latent p-values, which together comprise a fuzzy p-value. We illustrate the approach on a publicly-available dataset from a study of Crohn's disease that consists of genotypes at multiple SNP markers in a small genomic region. We estimate the posterior distribution of the tree-based association statistic and the recombination rate at multiple focal points in the region. Reassuringly, the posterior mean recombination rates estimated at the different focal points are consistent with previously published estimates. The tree-based association approach finds multiple sub-regions where the case haplotypes are more genetically related than the control haplotypes, and that there may be one or multiple disease-predisposing loci. PMID:24348515

Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru

PubMed Central

Akinyi, Sheila; Hayden, Tonya; Gamboa, Dionicia; Torres, Katherine; Bendezu, Jorge; Abdallah, Joseph F.; Griffing, Sean M.; Quezada, Wilmer Marquiño; Arrospide, Nancy; De Oliveira, Alexandre Macedo; Lucas, Carmen; Magill, Alan J.; Bacon, David J.; Barnwell, John W.; Udhayakumar, Venkatachalam

2013-01-01

The majority of malaria rapid diagnostic tests (RDTs) detect Plasmodium falciparum histidine-rich protein 2 (PfHRP2), encoded by the pfhrp2 gene. Recently, P. falciparum isolates from Peru were found to lack pfhrp2 leading to false-negative RDT results. We hypothesized that pfhrp2-deleted parasites in Peru derived from a single genetic event. We evaluated the parasite population structure and pfhrp2 haplotype of samples collected between 1998 and 2005 using seven neutral and seven chromosome 8 microsatellite markers, respectively. Five distinct pfhrp2 haplotypes, corresponding to five neutral microsatellite-based clonal lineages, were detected in 1998-2001; pfhrp2 deletions occurred within four haplotypes. In 2003-2005, outcrossing among the parasite lineages resulted in eight population clusters that inherited the five pfhrp2 haplotypes seen previously and a new haplotype; pfhrp2 deletions occurred within four of these haplotypes. These findings indicate that the genetic origin of pfhrp2 deletion in Peru was not a single event, but likely occurred multiple times. PMID:24077522

Efficient algorithms for polyploid haplotype phasing.

PubMed

He, Dan; Saha, Subrata; Finkers, Richard; Parida, Laxmi

2018-05-09

Inference of haplotypes, or the sequence of alleles along the same chromosomes, is a fundamental problem in genetics and is a key component for many analyses including admixture mapping, identifying regions of identity by descent and imputation. Haplotype phasing based on sequencing reads has attracted lots of attentions. Diploid haplotype phasing where the two haplotypes are complimentary have been studied extensively. In this work, we focused on Polyploid haplotype phasing where we aim to phase more than two haplotypes at the same time from sequencing data. The problem is much more complicated as the search space becomes much larger and the haplotypes do not need to be complimentary any more. We proposed two algorithms, (1) Poly-Harsh, a Gibbs Sampling based algorithm which alternatively samples haplotypes and the read assignments to minimize the mismatches between the reads and the phased haplotypes, (2) An efficient algorithm to concatenate haplotype blocks into contiguous haplotypes. Our experiments showed that our method is able to improve the quality of the phased haplotypes over the state-of-the-art methods. To our knowledge, our algorithm for haplotype blocks concatenation is the first algorithm that leverages the shared information across multiple individuals to construct contiguous haplotypes. Our experiments showed that it is both efficient and effective.

Origins and Domestication of Cultivated Banana Inferred from Chloroplast and Nuclear Genes

PubMed Central

Zhang, Cui; Wang, Xin-Feng; Shi, Feng-Xue; Chen, Wen-Na; Ge, Xue-Jun

2013-01-01

Background Cultivated bananas are large, vegetatively-propagated members of the genus Musa. More than 1,000 cultivars are grown worldwide and they are major economic and food resources in numerous developing countries. It has been suggested that cultivated bananas originated from the islands of Southeast Asia (ISEA) and have been developed through complex geodomestication pathways. However, the maternal and parental donors of most cultivars are unknown, and the pattern of nucleotide diversity in domesticated banana has not been fully resolved. Methodology/Principal Findings We studied the genetics of 16 cultivated and 18 wild Musa accessions using two single-copy nuclear (granule-bound starch synthase I, GBSS I, also known as Waxy, and alcohol dehydrogenase 1, Adh1) and two chloroplast (maturase K, matK, and the trnL-F gene cluster) genes. The results of phylogenetic analyses showed that all A-genome haplotypes of cultivated bananas were grouped together with those of ISEA subspecies of M. acuminata (A-genome). Similarly, the B- and S-genome haplotypes of cultivated bananas clustered with the wild species M. balbisiana (B-genome) and M. schizocarpa (S-genome), respectively. Notably, it has been shown that distinct haplotypes of each cultivar (A-genome group) were nested together to different ISEA subspecies M. acuminata. Analyses of nucleotide polymorphism in the Waxy and Adh1 genes revealed that, in comparison to the wild relatives, cultivated banana exhibited slightly lower nucleotide diversity both across all sites and specifically at silent sites. However, dramatically reduced nucleotide diversity was found at nonsynonymous sites for cultivated bananas. Conclusions/Significance Our study not only confirmed the origin of cultivated banana as arising from multiple intra- and inter-specific hybridization events, but also showed that cultivated banana may have not suffered a severe genetic bottleneck during the domestication process. Importantly, our findings suggested that multiple maternal origins and a reduction in nucleotide diversity at nonsynonymous sites are general attributes of cultivated bananas. PMID:24260405

Single Marker and Haplotype-Based Association Analysis of Semolina and Pasta Colour in Elite Durum Wheat Breeding Lines Using a High-Density Consensus Map.

PubMed

N'Diaye, Amidou; Haile, Jemanesh K; Cory, Aron T; Clarke, Fran R; Clarke, John M; Knox, Ron E; Pozniak, Curtis J

2017-01-01

Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype-based analysis over single marker analysis to detect loci associated with colour traits in durum wheat.

Detecting disease-predisposing variants: the haplotype method.

PubMed Central

Valdes, A M; Thomson, G

1997-01-01

For many HLA-associated diseases, multiple alleles-- and, in some cases, multiple loci--have been suggested as the causative agents. The haplotype method for identifying disease-predisposing amino acids in a genetic region is a stratification analysis. We show that, for each haplotype combination containing all the amino acid sites involved in the disease process, the relative frequencies of amino acid variants at sites not involved in disease but in linkage disequilibrium with the disease-predisposing sites are expected to be the same in patients and controls. The haplotype method is robust to mode of inheritance and penetrance of the disease and can be used to determine unequivocally whether all amino acid sites involved in the disease have not been identified. Using a resampling technique, we developed a statistical test that takes account of the nonindependence of the sites sampled. Further, when multiple sites in the genetic region are involved in disease, the test statistic gives a closer fit to the null expectation when some--compared with none--of the true predisposing factors are included in the haplotype analysis. Although the haplotype method cannot distinguish between very highly correlated sites in one population, ethnic comparisons may help identify the true predisposing factors. The haplotype method was applied to insulin-dependent diabetes mellitus (IDDM) HLA class II DQA1-DQB1 data from Caucasian, African, and Japanese populations. Our results indicate that the combination DQA1#52 (Arg predisposing) DQB1#57 (Asp protective), which has been proposed as an important IDDM agent, does not include all the predisposing elements. With rheumatoid arthritis HLA class II DRB1 data, the results were consistent with the shared-epitope hypothesis. PMID:9042931

The distribution of HLA haplotypes in the ethnic groups that make up the Brazilian Bone Marrow Volunteer Donor Registry (REDOME).

PubMed

Halagan, Michael; Oliveira, Danielli Cristina; Maiers, Martin; Fabreti-Oliveira, Raquel A; Moraes, Maria Elisa Hue; Visentainer, Jeane Eliete Laguila; Pereira, Noemi Farah; Romero, Matilde; Cardoso, Juliana Fernandes; Porto, Luís Cristóvão

2018-04-26

The Registries of Bone Marrow Donors around the world include more than 30 million volunteer donors from 57 different countries, and were responsible for over 17,000 hematopoietic stem cell transplants in 2016. The Brazilian Bone Marrow Volunteer Donor Registry (REDOME) was established in 1993 and is the third largest registry in the world with more than 4.3 million donors. We characterized HLA allele and haplotypes frequencies from REDOME comparing them with the donor self-reported race group classification. Five-locus haplotype frequencies (A~C~B~DRB1~DQB1) were estimated for each of the six race groups, resolving phase and allelic ambiguity using the expectation-maximization (EM) algorithm. The top 100 haplotypes in the race groups were separated into eight clusters of haplotypes, based on haplotype similarity, using CLUTO. We present HLA allele and haplotype frequency data from six race groups from 2,938,259 individuals from REDOME. The most frequent haplotype was the same for all groups: A*01:01g~C*07:01g~B*08:01g~DRB1*03:01g~DQB1*02:01g. Some frequent haplotypes such as A*02:01g~C*16:01g~B*44:03~DRB1*07:01g~DQB1*02:01g was not found in people with Preta (Sub-Saharan African descent). A cluster including Branca (European) and Parda or non-informed (admixed) could be distinguished from both Preta (SubSaharan) and Indígena (Amerindian) groups, and from the Amarela (Asian) ones, which clustered with their original population. These results have implications on cross-population matching and can help in donor searches and population-based recruitment strategies.

Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood.

PubMed

Hammer, Michael F; Behar, Doron M; Karafet, Tatiana M; Mendez, Fernando L; Hallmark, Brian; Erez, Tamar; Zhivotovsky, Lev A; Rosset, Saharon; Skorecki, Karl

2009-11-01

It has been known for over a decade that a majority of men who self report as members of the Jewish priesthood (Cohanim) carry a characteristic Y chromosome haplotype termed the Cohen Modal Haplotype (CMH). The CMH has since been used to trace putative Jewish ancestral origins of various populations. However, the limited number of binary and STR Y chromosome markers used previously did not provide the phylogenetic resolution needed to infer the number of independent paternal lineages that are encompassed within the Cohanim or their coalescence times. Accordingly, we have genotyped 75 binary markers and 12 Y-STRs in a sample of 215 Cohanim from diverse Jewish communities, 1,575 Jewish men from across the range of the Jewish Diaspora, and 2,099 non-Jewish men from the Near East, Europe, Central Asia, and India. While Cohanim from diverse backgrounds carry a total of 21 Y chromosome haplogroups, 5 haplogroups account for 79.5% of Cohanim Y chromosomes. The most frequent Cohanim lineage (46.1%) is marked by the recently reported P58 T->C mutation, which is prevalent in the Near East. Based on genotypes at 12 Y-STRs, we identify an extended CMH on the J-P58* background that predominates in both Ashkenazi and non-Ashkenazi Cohanim and is remarkably absent in non-Jews. The estimated divergence time of this lineage based on 17 STRs is 3,190 +/- 1,090 years. Notably, the second most frequent Cohanim lineage (J-M410*, 14.4%) contains an extended modal haplotype that is also limited to Ashkenazi and non-Ashkenazi Cohanim and is estimated to be 4.2 +/- 1.3 ky old. These results support the hypothesis of a common origin of the CMH in the Near East well before the dispersion of the Jewish people into separate communities, and indicate that the majority of contemporary Jewish priests descend from a limited number of paternal lineages.

Dual African Origins of Global Aedes aegypti s.l. Populations Revealed by Mitochondrial DNA

PubMed Central

Moore, Michelle; Sylla, Massamba; Goss, Laura; Burugu, Marion Warigia; Sang, Rosemary; Kamau, Luna W.; Kenya, Eucharia Unoma; Bosio, Chris; Munoz, Maria de Lourdes; Sharakova, Maria; Black, William Cormack

2013-01-01

Background Aedes aegypti is the primary global vector to humans of yellow fever and dengue flaviviruses. Over the past 50 years, many population genetic studies have documented large genetic differences among global populations of this species. These studies initially used morphological polymorphisms, followed later by allozymes, and most recently various molecular genetic markers including microsatellites and mitochondrial markers. In particular, since 2000, fourteen publications and four unpublished datasets have used sequence data from the NADH dehydrogenase subunit 4 mitochondrial gene to compare Ae. aegypti collections and collectively 95 unique mtDNA haplotypes have been found. Phylogenetic analyses in these many studies consistently resolved two clades but no comprehensive study of mtDNA haplotypes have been made in Africa, the continent in which the species originated. Methods and Findings ND4 haplotypes were sequenced in 426 Ae. aegypti s.l. from Senegal, West Africa and Kenya, East Africa. In Senegal 15 and in Kenya 7 new haplotypes were discovered. When added to the 95 published haplotypes and including 6 African Aedes species as outgroups, phylogenetic analyses showed that all but one Senegal haplotype occurred in a basal clade while most East African haplotypes occurred in a second clade arising from the basal clade. Globally distributed haplotypes occurred in both clades demonstrating that populations outside Africa consist of mixtures of mosquitoes from both clades. Conclusions Populations of Ae. aegypti outside Africa consist of mosquitoes arising from one of two ancestral clades. One clade is basal and primarily associated with West Africa while the second arises from the first and contains primarily mosquitoes from East Africa PMID:23638196

Imputation of microsatellite alleles from dense SNP genotypes for parentage verification across multiple Bos taurus and Bos indicus breeds

PubMed Central

McClure, Matthew C.; Sonstegard, Tad S.; Wiggans, George R.; Van Eenennaam, Alison L.; Weber, Kristina L.; Penedo, Cecilia T.; Berry, Donagh P.; Flynn, John; Garcia, Jose F.; Carmo, Adriana S.; Regitano, Luciana C. A.; Albuquerque, Milla; Silva, Marcos V. G. B.; Machado, Marco A.; Coffey, Mike; Moore, Kirsty; Boscher, Marie-Yvonne; Genestout, Lucie; Mazza, Raffaele; Taylor, Jeremy F.; Schnabel, Robert D.; Simpson, Barry; Marques, Elisa; McEwan, John C.; Cromie, Andrew; Coutinho, Luiz L.; Kuehn, Larry A.; Keele, John W.; Piper, Emily K.; Cook, Jim; Williams, Robert; Van Tassell, Curtis P.

2013-01-01

To assist cattle producers transition from microsatellite (MS) to single nucleotide polymorphism (SNP) genotyping for parental verification we previously devised an effective and inexpensive method to impute MS alleles from SNP haplotypes. While the reported method was verified with only a limited data set (N = 479) from Brown Swiss, Guernsey, Holstein, and Jersey cattle, some of the MS-SNP haplotype associations were concordant across these phylogenetically diverse breeds. This implied that some haplotypes predate modern breed formation and remain in strong linkage disequilibrium. To expand the utility of MS allele imputation across breeds, MS and SNP data from more than 8000 animals representing 39 breeds (Bos taurus and B. indicus) were used to predict 9410 SNP haplotypes, incorporating an average of 73 SNPs per haplotype, for which alleles from 12 MS markers could be accurately be imputed. Approximately 25% of the MS-SNP haplotypes were present in multiple breeds (N = 2 to 36 breeds). These shared haplotypes allowed for MS imputation in breeds that were not represented in the reference population with only a small increase in Mendelian inheritance inconsistancies. Our reported reference haplotypes can be used for any cattle breed and the reported methods can be applied to any species to aid the transition from MS to SNP genetic markers. While ~91% of the animals with imputed alleles for 12 MS markers had ≤1 Mendelian inheritance conflicts with their parents' reported MS genotypes, this figure was 96% for our reference animals, indicating potential errors in the reported MS genotypes. The workflow we suggest autocorrects for genotyping errors and rare haplotypes, by MS genotyping animals whose imputed MS alleles fail parentage verification, and then incorporating those animals into the reference dataset. PMID:24065982

Single Marker and Haplotype-Based Association Analysis of Semolina and Pasta Colour in Elite Durum Wheat Breeding Lines Using a High-Density Consensus Map

PubMed Central

Haile, Jemanesh K.; Cory, Aron T.; Clarke, Fran R.; Clarke, John M.; Knox, Ron E.; Pozniak, Curtis J.

2017-01-01

Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype-based analysis over single marker analysis to detect loci associated with colour traits in durum wheat. PMID:28135299

The haplotype-resolved genome and epigenome of the aneuploid HeLa cancer cell line.

PubMed

Adey, Andrew; Burton, Joshua N; Kitzman, Jacob O; Hiatt, Joseph B; Lewis, Alexandra P; Martin, Beth K; Qiu, Ruolan; Lee, Choli; Shendure, Jay

2013-08-08

The HeLa cell line was established in 1951 from cervical cancer cells taken from a patient, Henrietta Lacks. This was the first successful attempt to immortalize human-derived cells in vitro. The robust growth and unrestricted distribution of HeLa cells resulted in its broad adoption--both intentionally and through widespread cross-contamination--and for the past 60 years it has served a role analogous to that of a model organism. The cumulative impact of the HeLa cell line on research is demonstrated by its occurrence in more than 74,000 PubMed abstracts (approximately 0.3%). The genomic architecture of HeLa remains largely unexplored beyond its karyotype, partly because like many cancers, its extensive aneuploidy renders such analyses challenging. We carried out haplotype-resolved whole-genome sequencing of the HeLa CCL-2 strain, examined point- and indel-mutation variations, mapped copy-number variations and loss of heterozygosity regions, and phased variants across full chromosome arms. We also investigated variation and copy-number profiles for HeLa S3 and eight additional strains. We find that HeLa is relatively stable in terms of point variation, with few new mutations accumulating after early passaging. Haplotype resolution facilitated reconstruction of an amplified, highly rearranged region of chromosome 8q24.21 at which integration of the human papilloma virus type 18 (HPV-18) genome occurred and that is likely to be the event that initiated tumorigenesis. We combined these maps with RNA-seq and ENCODE Project data sets to phase the HeLa epigenome. This revealed strong, haplotype-specific activation of the proto-oncogene MYC by the integrated HPV-18 genome approximately 500 kilobases upstream, and enabled global analyses of the relationship between gene dosage and expression. These data provide an extensively phased, high-quality reference genome for past and future experiments relying on HeLa, and demonstrate the value of haplotype resolution for characterizing cancer genomes and epigenomes.

Toward Male Individualization with Rapidly Mutating Y-Chromosomal Short Tandem Repeats

PubMed Central

Ballantyne, Kaye N; Ralf, Arwin; Aboukhalid, Rachid; Achakzai, Niaz M; Anjos, Maria J; Ayub, Qasim; Balažic, Jože; Ballantyne, Jack; Ballard, David J; Berger, Burkhard; Bobillo, Cecilia; Bouabdellah, Mehdi; Burri, Helen; Capal, Tomas; Caratti, Stefano; Cárdenas, Jorge; Cartault, François; Carvalho, Elizeu F; Carvalho, Monica; Cheng, Baowen; Coble, Michael D; Comas, David; Corach, Daniel; D'Amato, Maria E; Davison, Sean; de Knijff, Peter; De Ungria, Maria Corazon A; Decorte, Ronny; Dobosz, Tadeusz; Dupuy, Berit M; Elmrghni, Samir; Gliwiński, Mateusz; Gomes, Sara C; Grol, Laurens; Haas, Cordula; Hanson, Erin; Henke, Jürgen; Henke, Lotte; Herrera-Rodríguez, Fabiola; Hill, Carolyn R; Holmlund, Gunilla; Honda, Katsuya; Immel, Uta-Dorothee; Inokuchi, Shota; Jobling, Mark A; Kaddura, Mahmoud; Kim, Jong S; Kim, Soon H; Kim, Wook; King, Turi E; Klausriegler, Eva; Kling, Daniel; Kovačević, Lejla; Kovatsi, Leda; Krajewski, Paweł; Kravchenko, Sergey; Larmuseau, Maarten H D; Lee, Eun Young; Lessig, Ruediger; Livshits, Ludmila A; Marjanović, Damir; Minarik, Marek; Mizuno, Natsuko; Moreira, Helena; Morling, Niels; Mukherjee, Meeta; Munier, Patrick; Nagaraju, Javaregowda; Neuhuber, Franz; Nie, Shengjie; Nilasitsataporn, Premlaphat; Nishi, Takeki; Oh, Hye H; Olofsson, Jill; Onofri, Valerio; Palo, Jukka U; Pamjav, Horolma; Parson, Walther; Petlach, Michal; Phillips, Christopher; Ploski, Rafal; Prasad, Samayamantri P R; Primorac, Dragan; Purnomo, Gludhug A; Purps, Josephine; Rangel-Villalobos, Hector; Rębała, Krzysztof; Rerkamnuaychoke, Budsaba; Gonzalez, Danel Rey; Robino, Carlo; Roewer, Lutz; Rosa, Alexandra; Sajantila, Antti; Sala, Andrea; Salvador, Jazelyn M; Sanz, Paula; Schmitt, Cornelia; Sharma, Anil K; Silva, Dayse A; Shin, Kyoung-Jin; Sijen, Titia; Sirker, Miriam; Siváková, Daniela; Škaro, Vedrana; Solano-Matamoros, Carlos; Souto, Luis; Stenzl, Vlastimil; Sudoyo, Herawati; Syndercombe-Court, Denise; Tagliabracci, Adriano; Taylor, Duncan; Tillmar, Andreas; Tsybovsky, Iosif S; Tyler-Smith, Chris; van der Gaag, Kristiaan J; Vanek, Daniel; Völgyi, Antónia; Ward, Denise; Willemse, Patricia; Yap, Eric PH; Yong, Rita YY; Pajnič, Irena Zupanič; Kayser, Manfred

2014-01-01

Relevant for various areas of human genetics, Y-chromosomal short tandem repeats (Y-STRs) are commonly used for testing close paternal relationships among individuals and populations, and for male lineage identification. However, even the widely used 17-loci Yfiler set cannot resolve individuals and populations completely. Here, 52 centers generated quality-controlled data of 13 rapidly mutating (RM) Y-STRs in 14,644 related and unrelated males from 111 worldwide populations. Strikingly, >99% of the 12,272 unrelated males were completely individualized. Haplotype diversity was extremely high (global: 0.9999985, regional: 0.99836–0.9999988). Haplotype sharing between populations was almost absent except for six (0.05%) of the 12,156 haplotypes. Haplotype sharing within populations was generally rare (0.8% nonunique haplotypes), significantly lower in urban (0.9%) than rural (2.1%) and highest in endogamous groups (14.3%). Analysis of molecular variance revealed 99.98% of variation within populations, 0.018% among populations within groups, and 0.002% among groups. Of the 2,372 newly and 156 previously typed male relative pairs, 29% were differentiated including 27% of the 2,378 father–son pairs. Relative to Yfiler, haplotype diversity was increased in 86% of the populations tested and overall male relative differentiation was raised by 23.5%. Our study demonstrates the value of RM Y-STRs in identifying and separating unrelated and related males and provides a reference database. PMID:24917567

Phylogeography of Canada Geese (Branta canadensis) in western North America

USGS Publications Warehouse

Scribner, K.T.; Talbot, S.L.; Pearce, J.M.; Pierson, Barbara J.; Bollinger, K.S.; Derksen, D.V.

2003-01-01

Using molecular genetic markers that differ in mode of inheritance and rate of evolution, we examined levels and partitioning of genetic variation for seven nominal subspecies (11 breeding populations) of Canada Geese (Branta canadensis) in western North America. Gene trees constructed from mtDNA control region sequence data show that subspecies of Canada Geese do not have distinct mtDNA. Large- and small-bodied forms of Canada Geese were highly diverged (0. 077 average sequence divergence) and represent monophyletic groups. A majority (65%) of 20 haplotypes resolved were observed in single breeding locales. However, within both large- and small-bodied forms certain haplotypes occurred across multiple subspecies. Population trees for both nuclear (microsatellites) and mitochondrial markers were generally concordant and provide resolution of population and subspecific relationships indicating incomplete lineage sorting. All populations and subspecies were genetically diverged, but to varying degrees. Analyses of molecular variance, nested-clade and coalescence-based analyses of mtDNA suggest that both historical (past fragmentation) and contemporary forces have been important in shaping current spatial genetic distributions. Gene flow appears to be ongoing though at different rates, even among currently recognized subspecies. The efficacy of current subspecific taxonomy is discussed in light of hypothesized historical vicariance and current demographic trends of management and conservation concern.

Transcriptome analysis reveals the same 17 S-locus F-box genes in two haplotypes of the self-incompatibility locus of Petunia inflata.

PubMed

Williams, Justin S; Der, Joshua P; dePamphilis, Claude W; Kao, Teh-Hui

2014-07-01

Petunia possesses self-incompatibility, by which pistils reject self-pollen but accept non-self-pollen for fertilization. Self-/non-self-recognition between pollen and pistil is regulated by the pistil-specific S-RNase gene and by multiple pollen-specific S-locus F-box (SLF) genes. To date, 10 SLF genes have been identified by various methods, and seven have been shown to be involved in pollen specificity. For a given S-haplotype, each SLF interacts with a subset of its non-self S-RNases, and an as yet unknown number of SLFs are thought to collectively mediate ubiquitination and degradation of all non-self S-RNases to allow cross-compatible pollination. To identify a complete suite of SLF genes of P. inflata, we used a de novo RNA-seq approach to analyze the pollen transcriptomes of S2-haplotype and S3-haplotype, as well as the leaf transcriptome of the S3S3 genotype. We searched for genes that fit several criteria established from the properties of the known SLF genes and identified the same seven new SLF genes in S2-haplotype and S3-haplotype, suggesting that a total of 17 SLF genes constitute pollen specificity in each S-haplotype. This finding lays the foundation for understanding how multiple SLF genes evolved and the biochemical basis for differential interactions between SLF proteins and S-RNases. © 2014 American Society of Plant Biologists. All rights reserved.

MHC variability in heritage breeds of chickens.

PubMed

Fulton, J E; Lund, A R; McCarron, A M; Pinegar, K N; Korver, D R; Classen, H L; Aggrey, S; Utterbach, C; Anthony, N B; Berres, M E

2016-02-01

The chicken Major Histocompatibility Complex (MHC) is very strongly associated with disease resistance and thus is a very important region of the chicken genome. Historically, MHC (B locus) has been identified by the use of serology with haplotype specific alloantisera. These antisera can be difficult to produce and frequently cross-react with multiple haplotypes and hence their application is generally limited to inbred and MHC-defined lines. As a consequence, very little information about MHC variability in heritage chicken breeds is available. DNA-based methods are now available for examining MHC variability in these previously uncharacterized populations. A high density SNP panel consisting of 101 SNP that span a 230,000 bp region of the chicken MHC was used to examine MHC variability in 17 heritage populations of chickens from five universities from Canada and the United States. The breeds included 6 heritage broiler lines, 3 Barred Plymouth Rock, 2 New Hampshire and one each of Rhode Island Red, Light Sussex, White Leghorn, Dark Brown Leghorn, and 2 synthetic lines. These heritage breeds contained from one to 11 haplotypes per line. A total of 52 unique MHC haplotypes were found with only 10 of them identical to serologically defined haplotypes. Furthermore, nine MHC recombinants with their respective parental haplotypes were identified. This survey confirms the value of these non-commercially utilized lines in maintaining genetic diversity. The identification of multiple MHC haplotypes and novel MHC recombinants indicates that diversity is being generated and maintained within these heritage populations. © 2016 Poultry Science Association Inc.

HLA-DRB*1501 associations with magnetic resonance imaging measures of grey matter pathology in multiple sclerosis.

PubMed

Yaldizli, Özgür; Sethi, Varun; Pardini, Matteo; Tur, Carmen; Mok, Kin Y; Muhlert, Nils; Liu, Zheng; Samson, Rebecca S; Wheeler-Kingshott, Claudia A M; Yousry, Tarek A; Houlden, Henry; Hardy, John; Miller, David H; Chard, Declan T

2016-05-01

The HLA-DRB*1501 haplotype influences the risk of developing multiple sclerosis (MS), but it is not known how it affects grey matter pathology. To assess HLA-DRB(*)1501 effects on magnetic resonance imaging (MRI) cortical grey matter pathology. Whole and lesional cortical grey matter volumes, lesional and normal-appearing grey matter magnetization transfer ratio were measured in 85 people with MS and 36 healthy control subjects. HLA-DRB(*)1501 haplotype was determined by genotyping (rs3135388). No significant differences were observed in MRI measures between the HLA-DRB(*)1501 subgroups. The HLA-DRB(*)1501 haplotype is not strongly associated with MRI-visible grey matter pathology. Copyright © 2016 Elsevier B.V. All rights reserved.

Haplotype Reconstruction in Large Pedigrees with Many Untyped Individuals

NASA Astrophysics Data System (ADS)

Li, Xin; Li, Jing

Haplotypes, as they specify the linkage patterns between dispersed genetic variations, provide important information for understanding the genetics of human traits. However haplotypes are not directly available from current genotyping platforms, and hence there are extensive investigations of computational methods to recover such information. Two major computational challenges arising in current family-based disease studies are large family sizes and many ungenotyped family members. Traditional haplotyping methods can neither handle large families nor families with missing members. In this paper, we propose a method which addresses these issues by integrating multiple novel techniques. The method consists of three major components: pairwise identical-bydescent (IBD) inference, global IBD reconstruction and haplotype restoring. By reconstructing the global IBD of a family from pairwise IBD and then restoring the haplotypes based on the inferred IBD, this method can scale to large pedigrees, and more importantly it can handle families with missing members. Compared with existing methods, this method demonstrates much higher power to recover haplotype information, especially in families with many untyped individuals.

Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data.

PubMed

Excoffier, L; Smouse, P E; Quattro, J M

1992-06-01

We present here a framework for the study of molecular variation within a single species. Information on DNA haplotype divergence is incorporated into an analysis of variance format, derived from a matrix of squared-distances among all pairs of haplotypes. This analysis of molecular variance (AMOVA) produces estimates of variance components and F-statistic analogs, designated here as phi-statistics, reflecting the correlation of haplotypic diversity at different levels of hierarchical subdivision. The method is flexible enough to accommodate several alternative input matrices, corresponding to different types of molecular data, as well as different types of evolutionary assumptions, without modifying the basic structure of the analysis. The significance of the variance components and phi-statistics is tested using a permutational approach, eliminating the normality assumption that is conventional for analysis of variance but inappropriate for molecular data. Application of AMOVA to human mitochondrial DNA haplotype data shows that population subdivisions are better resolved when some measure of molecular differences among haplotypes is introduced into the analysis. At the intraspecific level, however, the additional information provided by knowing the exact phylogenetic relations among haplotypes or by a nonlinear translation of restriction-site change into nucleotide diversity does not significantly modify the inferred population genetic structure. Monte Carlo studies show that site sampling does not fundamentally affect the significance of the molecular variance components. The AMOVA treatment is easily extended in several different directions and it constitutes a coherent and flexible framework for the statistical analysis of molecular data.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andrew, S.E.; Goldberg, Y.P.; Squitieri, F.

Huntington disease (HD) is one of 7 disorders now known to be caused by expansion of a trinucleotide repeat. The HD mutation is a polymorphic trinucleotide (CAG) repeat in the 5{prime} region of a novel gene that expands beyond the normal range of 10-35 repeats in persons destined to develop the disease. Haplotype analysis of other dynamic mutation disorders such as myotonic dystrophy and Fragil X have suggested that a rare ancestral expansion event on a normal chromosome is followed by subsequent expansion events, resulting in a pool of chromosomes in the premutation range, which is inherently unstable and pronemore » to further multiple expansion events leading to disease range chromosomes. Haplotype analysis of 67 HD and 84 control chromosomes using 5 polymorphic markers, both intragenic and 5{prime} to the disease mutation, demonstrate that multiple haplotypes underlie HD. However, 94% of the chromosomes can be grouped under two major haplotypes. These two haplotypes are also present in the normal population. A third major haplotype is seen on 38% of normal chromosomes but rarely on HD chromosomes (6%). CAG lengths on the normal chromosomes with the two haplotypes seen in the HD population are higher than those seen on the normal chromosomes with the haplotype rarely seen on HD chromosomes. Furthermore, in populations with a diminished frequency of HD, CAG length on normal chromosomes is significantly less than other populations with higher prevalence rates for HD. These data suggest that CAG length on normal chromosomes may be a significant factor contributing to repeat instability that eventually leads to chromosomes with CAG repeat lengths in the HD range. Haplotypes on the HD chromosomes are identical to those normal chromosomes which have CAG lengths in the high range of normal, suggesting that further expansions of this pool of chromosomes leads to chromosomes with CAG repeat sizes within the disease range, consistent with a multistep model.« less

Genetic structure of Phytophthora infestans populations in China indicates multiple migration events.

PubMed

Guo, Liyun; Zhu, Xiao-Qiong; Hu, Chia-Hui; Ristaino, Jean Beagle

2010-10-01

One hundred isolates of Phytophthora infestans collected from 10 provinces in China between 1998 and 2004 were analyzed for mating type, metalaxyl resistance, mitochondrial DNA (mtDNA) haplotype, allozyme genotype, and restriction fragment length polymorphism (RFLP) with the RG-57 probe. In addition, herbarium samples collected in China, Russia, Australia, and other Asian countries were also typed for mtDNA haplotype. The Ia haplotype was found during the first outbreaks of the disease in China (1938 and 1940), Japan (1901, 1930, and 1931), India (1913), Peninsular Malaysia (1950), Nepal (1954), The Philippines (1910), Australia (1917), Russia (1917), and Latvia (1935). In contrast, the Ib haplotype was found after 1950 in China on both potato and tomato (1952, 1954, 1956, and 1982) and in India (1968 and 1974). Another migration of a genotype found in Siberia called SIB-1 (Glucose-6-phosphate isomerase [Gpi] 100/100, Peptidase [Pep] 100/100, IIa mtDNA haplotype) was identified using RFLP fingerprints among 72% of the isolates and was widely distributed in the north and south of China and has also been reported in Japan. A new genotype named CN-11 (Gpi 100/111, Pep 100/100, IIb mtDNA haplotype), found only in the south of China, and two additional genotypes (Gpi 100/100, Pep 100/100, Ia mtDNA haplotype) named CN-9 and CN-10 were identified. There were more diverse genotypes among isolates from Yunnan province than elsewhere. The SIB-1 (IIa) genotype is identical to those from Siberia, suggesting later migration of this genotype from either Russia or Japan into China. The widespread predominance of SIB-1 suggests that this genotype has enhanced fitness compared with other genotypes found. Movement of the pathogen into China via infected seed from several sources most likely accounts for the distribution of pathogen genotypes observed. MtDNA haplotype evidence and RFLP data suggest multiple migrations of the pathogen into China after the initial introduction of the Ia haplotype in the 1930s.

Mitochondrial DNA and trade data support multiple origins of Helicoverpa armigera (Lepidoptera, Noctuidae) in Brazil

PubMed Central

Tay, Wee Tek; Walsh, Thomas K.; Downes, Sharon; Anderson, Craig; Jermiin, Lars S.; Wong, Thomas K. F.; Piper, Melissa C.; Chang, Ester Silva; Macedo, Isabella Barony; Czepak, Cecilia; Behere, Gajanan T.; Silvie, Pierre; Soria, Miguel F.; Frayssinet, Marie; Gordon, Karl H. J.

2017-01-01

The Old World bollworm Helicoverpa armigera is now established in Brazil but efforts to identify incursion origin(s) and pathway(s) have met with limited success due to the patchiness of available data. Using international agricultural/horticultural commodity trade data and mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and cytochrome b (Cyt b) gene markers, we inferred the origins and incursion pathways into Brazil. We detected 20 mtDNA haplotypes from six Brazilian states, eight of which were new to our 97 global COI-Cyt b haplotype database. Direct sequence matches indicated five Brazilian haplotypes had Asian, African, and European origins. We identified 45 parsimoniously informative sites and multiple substitutions per site within the concatenated (945 bp) nucleotide dataset, implying that probabilistic phylogenetic analysis methods are needed. High diversity and signatures of uniquely shared haplotypes with diverse localities combined with the trade data suggested multiple incursions and introduction origins in Brazil. Increasing agricultural/horticultural trade activities between the Old and New Worlds represents a significant biosecurity risk factor. Identifying pest origins will enable resistance profiling that reflects countries of origin to be included when developing a resistance management strategy, while identifying incursion pathways will improve biosecurity protocols and risk analysis at biosecurity hotspots including national ports. PMID:28350004

Mitochondrial DNA and trade data support multiple origins of Helicoverpa armigera (Lepidoptera, Noctuidae) in Brazil.

PubMed

Tay, Wee Tek; Walsh, Thomas K; Downes, Sharon; Anderson, Craig; Jermiin, Lars S; Wong, Thomas K F; Piper, Melissa C; Chang, Ester Silva; Macedo, Isabella Barony; Czepak, Cecilia; Behere, Gajanan T; Silvie, Pierre; Soria, Miguel F; Frayssinet, Marie; Gordon, Karl H J

2017-03-28

The Old World bollworm Helicoverpa armigera is now established in Brazil but efforts to identify incursion origin(s) and pathway(s) have met with limited success due to the patchiness of available data. Using international agricultural/horticultural commodity trade data and mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and cytochrome b (Cyt b) gene markers, we inferred the origins and incursion pathways into Brazil. We detected 20 mtDNA haplotypes from six Brazilian states, eight of which were new to our 97 global COI-Cyt b haplotype database. Direct sequence matches indicated five Brazilian haplotypes had Asian, African, and European origins. We identified 45 parsimoniously informative sites and multiple substitutions per site within the concatenated (945 bp) nucleotide dataset, implying that probabilistic phylogenetic analysis methods are needed. High diversity and signatures of uniquely shared haplotypes with diverse localities combined with the trade data suggested multiple incursions and introduction origins in Brazil. Increasing agricultural/horticultural trade activities between the Old and New Worlds represents a significant biosecurity risk factor. Identifying pest origins will enable resistance profiling that reflects countries of origin to be included when developing a resistance management strategy, while identifying incursion pathways will improve biosecurity protocols and risk analysis at biosecurity hotspots including national ports.

Mitochondrial DNA and trade data support multiple origins of Helicoverpa armigera (Lepidoptera, Noctuidae) in Brazil

NASA Astrophysics Data System (ADS)

Tay, Wee Tek; Walsh, Thomas K.; Downes, Sharon; Anderson, Craig; Jermiin, Lars S.; Wong, Thomas K. F.; Piper, Melissa C.; Chang, Ester Silva; Macedo, Isabella Barony; Czepak, Cecilia; Behere, Gajanan T.; Silvie, Pierre; Soria, Miguel F.; Frayssinet, Marie; Gordon, Karl H. J.

2017-03-01

The Old World bollworm Helicoverpa armigera is now established in Brazil but efforts to identify incursion origin(s) and pathway(s) have met with limited success due to the patchiness of available data. Using international agricultural/horticultural commodity trade data and mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and cytochrome b (Cyt b) gene markers, we inferred the origins and incursion pathways into Brazil. We detected 20 mtDNA haplotypes from six Brazilian states, eight of which were new to our 97 global COI-Cyt b haplotype database. Direct sequence matches indicated five Brazilian haplotypes had Asian, African, and European origins. We identified 45 parsimoniously informative sites and multiple substitutions per site within the concatenated (945 bp) nucleotide dataset, implying that probabilistic phylogenetic analysis methods are needed. High diversity and signatures of uniquely shared haplotypes with diverse localities combined with the trade data suggested multiple incursions and introduction origins in Brazil. Increasing agricultural/horticultural trade activities between the Old and New Worlds represents a significant biosecurity risk factor. Identifying pest origins will enable resistance profiling that reflects countries of origin to be included when developing a resistance management strategy, while identifying incursion pathways will improve biosecurity protocols and risk analysis at biosecurity hotspots including national ports.

Novel full-length major histocompatibility complex class I allele discovery and haplotype definition in pig-tailed macaques.

PubMed

Semler, Matthew R; Wiseman, Roger W; Karl, Julie A; Graham, Michael E; Gieger, Samantha M; O'Connor, David H

2018-06-01

Pig-tailed macaques (Macaca nemestrina, Mane) are important models for human immunodeficiency virus (HIV) studies. Their infectability with minimally modified HIV makes them a uniquely valuable animal model to mimic human infection with HIV and progression to acquired immunodeficiency syndrome (AIDS). However, variation in the pig-tailed macaque major histocompatibility complex (MHC) and the impact of individual transcripts on the pathogenesis of HIV and other infectious diseases is understudied compared to that of rhesus and cynomolgus macaques. In this study, we used Pacific Biosciences single-molecule real-time circular consensus sequencing to describe full-length MHC class I (MHC-I) transcripts for 194 pig-tailed macaques from three breeding centers. We then used the full-length sequences to infer Mane-A and Mane-B haplotypes containing groups of MHC-I transcripts that co-segregate due to physical linkage. In total, we characterized full-length open reading frames (ORFs) for 313 Mane-A, Mane-B, and Mane-I sequences that defined 86 Mane-A and 106 Mane-B MHC-I haplotypes. Pacific Biosciences technology allows us to resolve these Mane-A and Mane-B haplotypes to the level of synonymous allelic variants. The newly defined haplotypes and transcript sequences containing full-length ORFs provide an important resource for infectious disease researchers as certain MHC haplotypes have been shown to provide exceptional control of simian immunodeficiency virus (SIV) replication and prevention of AIDS-like disease in nonhuman primates. The increased allelic resolution provided by Pacific Biosciences sequencing also benefits transplant research by allowing researchers to more specifically match haplotypes between donors and recipients to the level of nonsynonymous allelic variation, thus reducing the risk of graft-versus-host disease.

Phylogeographic study of Chinese seabuckthorn (Hippophae rhamnoides subsp. sinensis Rousi) reveals two distinct haplotype groups and multiple microrefugia on the Qinghai-Tibet Plateau

PubMed Central

Wang, Hongfang; Liu, Han; Yang, Mingbo; Bao, Lei; Ge, Jianping

2014-01-01

Historical climate change can shape the genetic pattern of a species. Studies on this phenomenon provide great advantage in predicting the response of species to current and future global climate change. Chinese seabuckthorn (Hippophae rhamnoides subsp. sinensis) is one of the most important cultivated plants in Northwest China. However, the subspecies history and the potential genetic resources within the subspecies range remain unclear. In this study, we utilized two intergenic chloroplast regions to characterize the spatial genetic distribution of the species. We found 19 haplotypes in total, 12 of which were unique to the Chinese seabuckthorn. The populations observed on the Qinghai-Tibet Plateau (QTP) consisted of most of the haplotypes, while in the northeast of the range of the subspecies, an area not on the QTP, only four haplotypes were detected. Our study also revealed two distinct haplotype groups of the subspecies with a sharp transition region located in the south of the Zoige Basin. 89.96% of the genetic variation located between the regions. Mismatch analysis indicated old expansions of these two haplotype groups, approximately around the early stage of Pleistocene. Additional morphological proofs from existing studies and habitat differentiation supported a long independent colonization history among the two regions. Potential adaptation probably occurred but needs more genome and morphology data in future. Chinese seabuckthorn have an older population expansion compared with subspecies in Europe. The lack of large land ice sheets and the heterogeneous landscape of the QTP could have provided extensive microrefugia for Chinese seabuckthorn during the glaciation period. Multiple localities sustaining high-frequency private haplotypes support this hypothesis. Our study gives clear insight into the distribution of genetic resources and the evolutionary history of Chinese seabuckthorn. PMID:25540697

Wide-ranging phylogeographic structure of invasive red lionfish in the Western Atlantic and Greater Caribbean

USGS Publications Warehouse

Butterfield, John S.; Díaz-Ferguson, Edgardo; Silliman, Brian R.; Saunders, Jonathan W.; Buddo, Dayne; Mignucci-Giannoni, Antonio A.; Searle, Linda; Allen, Aarin Conrad; Hunter, Margaret E.

2015-01-01

The red lionfish (Pterois volitans) is an invasive predatory marine fish that has rapidly expanded its presence in the Western Hemisphere. We collected 214 invasive red lionfish samples from nine countries and territories, including seven unpublished locations. To more comprehensively evaluate connectivity, we compiled our d-loop sequence data with 846 published sequences, resulting in 1,060 samples from 14 locations. We found low nucleotide diversity (π = 0.003) and moderate haplotype diversity (h = 0.59). Using haplotype population pairwise ΦST tests, we analyzed possible phylogeographic breaks that were previously proposed based on other reef organisms. We found support for the Bahamas/Turks/Caicos versus Caribbean break (ΦST = 0.12) but not for the Northwestern Caribbean, Eastern Caribbean, or US East Coast versus Bahamas breaks. The Northern Region had higher variation and more haplotypes, supporting introductions of at least five haplotypes to the region. Our wide-ranging samples showed that a lower-frequency haplotype in the Northern Region dominated the Southern Region and suggested multiple introductions, possibly to the south. We tested multiple scenarios of phylogeographic structure with analyses of molecular variance and found support for a Northern and Southern Region split at the Bahamas/Turks/Caicos versus Caribbean break (percentage of variation among regions = 8.49 %). We found that Puerto Rico clustered with the Southern Region more strongly than with the Northern Region, as opposed to previous reports. We also found the rare haplotype H03 for the first time in the southern Caribbean (Panama), indicating that either secondary releases occurred or that the low-frequency haplotypes have had time to disperse to extreme southern Caribbean locations.

Single Nucleotide Polymorphism (SNP)-Strings: An Alternative Method for Assessing Genetic Associations

PubMed Central

Goodin, Douglas S.; Khankhanian, Pouya

2014-01-01

Background Genome-wide association studies (GWAS) identify disease-associations for single-nucleotide-polymorphisms (SNPs) from scattered genomic-locations. However, SNPs frequently reside on several different SNP-haplotypes, only some of which may be disease-associated. This circumstance lowers the observed odds-ratio for disease-association. Methodology/Principal Findings Here we develop a method to identify the two SNP-haplotypes, which combine to produce each person’s SNP-genotype over specified chromosomal segments. Two multiple sclerosis (MS)-associated genetic regions were modeled; DRB1 (a Class II molecule of the major histocompatibility complex) and MMEL1 (an endopeptidase that degrades both neuropeptides and β-amyloid). For each locus, we considered sets of eleven adjacent SNPs, surrounding the putative disease-associated gene and spanning ∼200 kb of DNA. The SNP-information was converted into an ordered-set of eleven-numbers (subject-vectors) based on whether a person had zero, one, or two copies of particular SNP-variant at each sequential SNP-location. SNP-strings were defined as those ordered-combinations of eleven-numbers (0 or 1), representing a haplotype, two of which combined to form the observed subject-vector. Subject-vectors were resolved using probabilistic methods. In both regions, only a small number of SNP-strings were present. We compared our method to the SHAPEIT-2 phasing-algorithm. When the SNP-information spanning 200 kb was used, SHAPEIT-2 was inaccurate. When the SHAPEIT-2 window was increased to 2,000 kb, the concordance between the two methods, in both of these eleven-SNP regions, was over 99%, suggesting that, in these regions, both methods were quite accurate. Nevertheless, correspondence was not uniformly high over the entire DNA-span but, rather, was characterized by alternating peaks and valleys of concordance. Moreover, in the valleys of poor-correspondence, SHAPEIT-2 was also inconsistent with itself, suggesting that the SNP-string method is more accurate across the entire region. Conclusions/Significance Accurate haplotype identification will enhance the detection of genetic-associations. The SNP-string method provides a simple means to accomplish this and can be extended to cover larger genomic regions, thereby improving a GWAS’s power, even for those published previously. PMID:24727690

Asian population frequencies and haplotype distribution of killer cell immunoglobulin-like receptor (KIR) genes among Chinese, Malay, and Indian in Singapore.

PubMed

Lee, Yi Chuan; Chan, Soh Ha; Ren, Ee Chee

2008-11-01

Killer cell immunoglobulin-like receptors (KIR) gene frequencies have been shown to be distinctly different between populations and contribute to functional variation in the immune response. We have investigated KIR gene frequencies in 370 individuals representing three Asian populations in Singapore and report here the distribution of 14 KIR genes (2DL1, 2DL2, 2DL3, 2DL4, 2DL5, 2DS1, 2DS2, 2DS3, 2DS4, 2DS5, 3DL1, 3DL2, 3DL3, 3DS1) with two pseudogenes (2DP1, 3DP1) among Singapore Chinese (n = 210); Singapore Malay (n = 80), and Singapore Indian (n = 80). Four framework genes (KIR3DL3, 3DP1, 2DL4, 3DL2) and a nonframework pseudogene 2DP1 were detected in all samples while KIR2DS2, 2DL2, 2DL5, and 2DS5 had the greatest significant variation across the three populations. Fifteen significant linkage patterns, consistent with associations between genes of A and B haplotypes, were observed. Eighty-four distinct KIR profiles were determined in our populations, 38 of which had not been described in other populations. KIR haplotype studies were performed using nine Singapore Chinese families comprising 34 individuals. All genotypes could be resolved into corresponding pairs of existing haplotypes with eight distinct KIR genotypes and eight different haplotypes. The haplotype A2 with frequency of 63.9% was dominant in Singapore Chinese, comparable to that reported in Korean and Chinese Han. The A haplotypes predominate in Singapore Chinese, with ratio of A to B haplotypes of approximately 3:1. Comparison with KIR frequencies in other populations showed that Singapore Chinese shared similar distributions with Chinese Han, Japanese, and Korean; Singapore Indian was found to be comparable with North Indian Hindus while Singapore Malay resembled the Thai.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pirastu, M.; Galanello, R.; Doherty, M.A.

The predominant ..beta..-thalassemia in Sardinia is the ..beta../sup 0/ type in which no ..beta..-globin chains are synthesized in the homozygous state. The authors determined the ..beta..-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same ..beta../sup 39(CAG..-->..TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the ..beta..-globin gene region.

Massively parallel haplotyping on microscopic beads for the high-throughput phase analysis of single molecules.

PubMed

Boulanger, Jérôme; Muresan, Leila; Tiemann-Boege, Irene

2012-01-01

In spite of the many advances in haplotyping methods, it is still very difficult to characterize rare haplotypes in tissues and different environmental samples or to accurately assess the haplotype diversity in large mixtures. This would require a haplotyping method capable of analyzing the phase of single molecules with an unprecedented throughput. Here we describe such a haplotyping method capable of analyzing in parallel hundreds of thousands single molecules in one experiment. In this method, multiple PCR reactions amplify different polymorphic regions of a single DNA molecule on a magnetic bead compartmentalized in an emulsion drop. The allelic states of the amplified polymorphisms are identified with fluorescently labeled probes that are then decoded from images taken of the arrayed beads by a microscope. This method can evaluate the phase of up to 3 polymorphisms separated by up to 5 kilobases in hundreds of thousands single molecules. We tested the sensitivity of the method by measuring the number of mutant haplotypes synthesized by four different commercially available enzymes: Phusion, Platinum Taq, Titanium Taq, and Phire. The digital nature of the method makes it highly sensitive to detecting haplotype ratios of less than 1:10,000. We also accurately quantified chimera formation during the exponential phase of PCR by different DNA polymerases.

Unraveling Haplotype Diversity of the Apical Membrane Antigen-1 Gene in Plasmodium falciparum Populations in Thailand

PubMed Central

Lumkul, Lalita; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn

2018-01-01

Development of an effective vaccine is critically needed for the prevention of malaria. One of the key antigens for malaria vaccines is the apical membrane antigen 1 (AMA-1) of the human malaria parasite Plasmodium falciparum, the surface protein for erythrocyte invasion of the parasite. The gene encoding AMA-1 has been sequenced from populations of P. falciparum worldwide, but the haplotype diversity of the gene in P. falciparum populations in the Greater Mekong Subregion (GMS), including Thailand, remains to be characterized. In the present study, the AMA-1 gene was PCR amplified and sequenced from the genomic DNA of 65 P. falciparum isolates from 5 endemic areas in Thailand. The nearly full-length 1,848 nucleotide sequence of AMA-1 was subjected to molecular analyses, including nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity and neutrality tests. Phylogenetic analysis and pairwise population differentiation (Fst indices) were performed to infer the population structure. The analyses identified 60 single nucleotide polymorphic loci, predominately located in domain I of AMA-1. A total of 31 unique AMA-1 haplotypes were identified, which included 11 novel ones. The phylogenetic tree of the AMA-1 haplotypes revealed multiple clades of AMA-1, each of which contained parasites of multiple geographical origins, consistent with the Fst indices indicating genetic homogeneity or gene flow among geographically distinct populations of P. falciparum in Thailand’s borders with Myanmar, Laos and Cambodia. In summary, the study revealed novel haplotypes and population structure needed for the further advancement of AMA-1-based malaria vaccines in the GMS. PMID:29742870

The Geographic Distribution of Human Y Chromosome Variation

PubMed Central

Hammer, M. F.; Spurdle, A. B.; Karafet, T.; Bonner, M. R.; Wood, E. T.; Novelletto, A.; Malaspina, P.; Mitchell, R. J.; Horai, S.; Jenkins, T.; Zegura, S. L.

1997-01-01

We examined variation on the nonrecombining portion of the human Y chromosome to investigate human evolution during the last 200,000 years. The Y-specific polymorphic sites included the Y Alu insertional polymorphism or ``YAP'' element (DYS287), the poly(A) tail associated with the YAP element, three point mutations in close association with the YAP insertion site, an A-G polymorphic transition (DYS271), and a tetranucleotide microsatellite (DYS19). Global variation at the five bi-allelic sites (DYS271, DYS287, and the three point mutations) gave rise to five ``YAP haplotypes'' in 60 populations from Africa, Europe, Asia, Australasia, and the New World (n = 1500). Combining the multi-allelic variation at the microsatellite loci (poly(A) tail and DYS19) with the YAP haplotypes resulted in a total of 27 ``combination haplotypes''. All five of the YAP haplotypes and 21 of the 27 combination haplotypes were found in African populations, which had greater haplotype diversity than did populations from other geographical locations. Only subsets of the five YAP haplotypes were found outside of Africa. Patterns of observed variation were compatible with a variety of hypotheses, including multiple human migrations and range expansions. PMID:9055088

SORL1 variants and risk of late-onset Alzheimer's disease.

PubMed

Li, Yonghong; Rowland, Charles; Catanese, Joseph; Morris, John; Lovestone, Simon; O'Donovan, Michael C; Goate, Alison; Owen, Michael; Williams, Julie; Grupe, Andrew

2008-02-01

A recent study reported significant association of late-onset Alzheimer's disease (LOAD) with multiple single nucleotide polymorphisms (SNPs) and haplotypes in SORL1, a neuronal sortilin-related receptor protein known to be involved in the trafficking and processing of amyloid precursor protein. Here we attempted to validate this finding in three large, well characterized case-control series. Approximately 2000 samples from the three series were individually genotyped for 12 SNPs, including the 10 reported significant SNPs and 2 that constitute the reported significant haplotypes. A total of 25 allelic and haplotypic association tests were performed. One SNP rs2070045 was marginally replicated in the three sample sets combined (nominal P=0.035); however, this result does not remain significant when accounting for multiple comparisons. Further validation in other sample sets will be required to assess the true effects of SORL1 variants in LOAD.

High-throughput single-molecule telomere characterization.

PubMed

McCaffrey, Jennifer; Young, Eleanor; Lassahn, Katy; Sibert, Justin; Pastor, Steven; Riethman, Harold; Xiao, Ming

2017-11-01

We have developed a novel method that enables global subtelomere and haplotype-resolved analysis of telomere lengths at the single-molecule level. An in vitro CRISPR/Cas9 RNA-directed nickase system directs the specific labeling of human (TTAGGG)n DNA tracts in genomes that have also been barcoded using a separate nickase enzyme that recognizes a 7-bp motif genome-wide. High-throughput imaging and analysis of large DNA single molecules from genomes labeled in this fashion using a nanochannel array system permits mapping through subtelomere repeat element (SRE) regions to unique chromosomal DNA while simultaneously measuring the (TTAGGG)n tract length at the end of each large telomere-terminal DNA segment. The methodology also permits subtelomere and haplotype-resolved analyses of SRE organization and variation, providing a window into the population dynamics and potential functions of these complex and structurally variant telomere-adjacent DNA regions. At its current stage of development, the assay can be used to identify and characterize telomere length distributions of 30-35 discrete telomeres simultaneously and accurately. The assay's utility is demonstrated using early versus late passage and senescent human diploid fibroblasts, documenting the anticipated telomere attrition on a global telomere-by-telomere basis as well as identifying subtelomere-specific biases for critically short telomeres. Similarly, we present the first global single-telomere-resolved analyses of two cancer cell lines. © 2017 McCaffrey et al.; Published by Cold Spring Harbor Laboratory Press.

Genetic variation in CXCR1 haplotypes linked to severity of Streptococcus uberis infection in an experimental challenge model.

PubMed

Siebert, Lydia; Headrick, Susan; Lewis, Mark; Gillespie, Barbara; Young, Charlie; Wojakiewicz, Leszek; Kerro-Dego, Oudessa; Prado, Maria E; Almeida, Raul; Oliver, Stephen P; Pighetti, Gina M

2017-08-01

Mastitis, an inflammation of the mammary gland, costs the dairy industry billions of dollars in lost revenues annually. The prevalence and costs associated with mastitis has made genetic selection methods a target for research. Previous research has identified amino acid changes at positions 122, 207, 245, 327, and 332 in the IL8 receptor, CXCR1, that result in three dominant amino acid haplotypes: VWHKH, VWHRR, and AWQRR. We hypothesize different haplotype combinations influence a cow's resistance, strength, and duration of response to mastitis. To test this, Holstein dairy cows (n=40) were intramammarily challenged with Streptococcus uberis within 3 d post-calving. All cows developed mastitis based on isolation of S. uberis from the challenged quarter at least twice. All cows with the VWHRR x VWHRR (n=5) and AWQRR x VWHRR (n=6) haplotype combinations required antibiotic therapy due to clinical signs of mastitis and tended (P=0.08) to be different from cows with a VWHRR x VWHKH (n=6) haplotype combination where only 33.3% required antibiotic therapy. Cows with a VWHRR homozygous haplotype combination displayed significantly higher responses to challenge indicated by elevated S. uberis counts (4340±5,521.9CFU/mL; P=0.01), mammary scores (1.1±0.18; P=0.03), milk scores (0.9±0.17; P=0.002), and SCC (1,010,832±489,993cells/mL; P=0.03). Contrastingly, AWQRR x VWHRR cows had significantly lower S. uberis counts (15.3±16.46CFU/mL; P=0.01), mammary scores (0.3±0.16; P=0.03), milk scores (0±0.15; P=0.002), and SCC (239,261±92,264.3cells/mL; P=0.03). Cows of the VWHKH x VWHRR haplotype combination displayed responses to challenge statistically comparable to other haplotype combinations, but appeared to have an earlier peak in SCC in comparison to all other haplotype combinations. Haplotype combination did not influence milk yield (P=0.6). Our results suggest using combinations of the SNPs within the CXCR1 gene gives a better indication of a cow's ability to combat S. uberis mastitis and could resolve prior studies' conflicting results focusing on individual SNP. Copyright © 2017 Elsevier B.V. All rights reserved.

Global spread and genetic variants of the two CYP9M10 haplotype forms associated with insecticide resistance in Culex quinquefasciatus Say.

PubMed

Itokawa, K; Komagata, O; Kasai, S; Kawada, H; Mwatele, C; Dida, G O; Njenga, S M; Mwandawiro, C; Tomita, T

2013-09-01

Insecticide resistance develops as a genetic factor (allele) conferring lower susceptibility to insecticides proliferates within a target insect population under strong positive selection. Intriguingly, a resistance allele pre-existing in a population often bears a series of further adaptive allelic variants through new mutations. This phenomenon occasionally results in replacement of the predominating resistance allele by fitter new derivatives, and consequently, development of greater resistance at the population level. The overexpression of the cytochrome P450 gene CYP9M10 is associated with pyrethroid resistance in the southern house mosquito Culex quinquefasciatus. Previously, we have found two genealogically related overexpressing CYP9M10 haplotypes, which differ in gene copy number (duplicated and non-duplicated). The duplicated haplotype was derived from the non-duplicated overproducer probably recently. In the present study, we investigated allelic series of CYP9M10 involved in three C. quinquefasciatus laboratory colonies recently collected from three different localities. Duplicated and non-duplicated overproducing haplotypes coexisted in African and Asian colonies indicating a global distribution of both haplotype lineages. The duplicated haplotypes both in the Asian and African colonies were associated with higher expression levels and stronger resistance than non-duplicated overproducing haplotypes. There were slight variation in expression level among the non-duplicated overproducing haplotypes. The nucleotide sequences in coding and upstream regions among members of this group also showed a little diversity. Non-duplicated overproducing haplotypes with relatively higher expression were genealogically closer to the duplicated haplotypes than the other non-duplicated overproducing haplotypes, suggesting multiple cis-acting mutations before duplication.

Haplotype-based approach to known MS-associated regions increases the amount of explained risk

PubMed Central

Khankhanian, Pouya; Gourraud, Pierre-Antoine; Lizee, Antoine; Goodin, Douglas S

2015-01-01

Genome-wide association studies (GWAS), using single nucleotide polymorphisms (SNPs), have yielded 110 non-human leucocyte antigen genomic regions that are associated with multiple sclerosis (MS). Despite this large number of associations, however, only 28% of MS-heritability can currently be explained. Here we compare the use of multi-SNP-haplotypes to the use of single-SNPs as alternative methods to describe MS genetic risk. SNP-haplotypes (of various lengths from 1 up to 15 contiguous SNPs) were constructed at each of the 110 previously identified, MS-associated, genomic regions. Even after correcting for the larger number of statistical comparisons made when using the haplotype-method, in 32 of the regions, the SNP-haplotype based model was markedly more significant than the single-SNP based model. By contrast, in no region was the single-SNP based model similarly more significant than the SNP-haplotype based model. Moreover, when we included the 932 MS-associated SNP-haplotypes (that we identified from 102 regions) as independent variables into a logistic linear model, the amount of MS-heritability, as assessed by Nagelkerke's R-squared, was 38%, which was considerably better than 29%, which was obtained by using only single-SNPs. This study demonstrates that SNP-haplotypes can be used to fine-map the genetic associations within regions of interest previously identified by single-SNP GWAS. Moreover, the amount of the MS genetic risk explained by the SNP-haplotype associations in the 110 MS-associated genomic regions was considerably greater when using SNP-haplotypes than when using single-SNPs. Also, the use of SNP-haplotypes can lead to the discovery of new regions of interest, which have not been identified by a single-SNP GWAS. PMID:26185143

The putative oncogene Pim-1 in the mouse: its linkage and variation among t haplotypes.

PubMed

Nadeau, J H; Phillips, S J

1987-11-01

Pim-1, a putative oncogene involved in T-cell lymphomagenesis, was mapped between the pseudo-alpha globin gene Hba-4ps and the alpha-crystallin gene Crya-1 on mouse chromosome 17 and therefore within the t complex. Pim-1 restriction fragment variants were identified among t haplotypes. Analysis of restriction fragment sizes obtained with 12 endonucleases demonstrated that the Pim-1 genes in some t haplotypes were indistinguishable from the sizes for the Pim-1b allele in BALB/c inbred mice. There are now three genes, Pim-1, Crya-1 and H-2 I-E, that vary among independently derived t haplotypes and that have indistinguishable alleles in t haplotypes and inbred strains. These genes are closely linked within the distal inversion of the t complex. Because it is unlikely that these variants arose independently in t haplotypes and their wild-type homologues, we propose that an exchange of chromosomal segments, probably through double crossingover, was responsible for indistinguishable Pim-1 genes shared by certain t haplotypes and their wild-type homologues. There was, however, no apparent association between variant alleles of these three genes among t haplotypes as would be expected if a single exchange introduced these alleles into t haplotypes. If these variant alleles can be shown to be identical to the wild-type allele, then lack of association suggests that multiple exchanges have occurred during the evolution of the t complex.

Extensive population structure in San, Khoe, and mixed ancestry populations from southern Africa revealed by 44 short 5-SNP haplotypes.

PubMed

Schlebusch, Carina M; Soodyall, Himlya

2012-12-01

The San and Khoe people currently represent remnant groups of a much larger and widely distributed population of hunter-gatherers and pastoralists who had exclusive occupation of southern Africa before the arrival of Bantu-speaking groups in the past 1,200 years and sea-borne immigrants within the last 350 years. Genetic studies [mitochondrial deoxyribonucleic acid (DNA) and Y-chromosome] conducted on San and Khoe groups revealed that they harbor some of the most divergent lineages found in living peoples throughout the world. Recently, high-density, autosomal, single-nucleotide polymorphism (SNP)-array studies confirmed the early divergence of Khoe-San population groups from all other human populations. The present study made use of 220 autosomal SNP markers (in the format of both haplotypes and genotypes) to examine the population structure of various San and Khoe groups and their relationship to other neighboring groups. Whereas analyses based on the genotypic SNP data only supported the division of the included populations into three main groups-Khoe-San, Bantu-speakers, and non-African populations-haplotype analyses revealed finer structure within Khoe-San populations. By the use of only 44 short SNP haplotypes (compiled from a total of 220 SNPs), most of the Khoe-San groups could be resolved as separate groups by applying STRUCTURE analyses. Therefore, by carefully selecting a few SNPs and combining them into haplotypes, we were able to achieve the same level of population distinction that was achieved previously in high-density SNP studies on the same population groups. Using haplotypes proved to be a very efficient and cost-effective way to study population structure. Copyright © 2013 Wayne State University Press, Detroit, Michigan 48201-1309.

Hapl-o-Mat: open-source software for HLA haplotype frequency estimation from ambiguous and heterogeneous data.

PubMed

Schäfer, Christian; Schmidt, Alexander H; Sauter, Jürgen

2017-05-30

Knowledge of HLA haplotypes is helpful in many settings as disease association studies, population genetics, or hematopoietic stem cell transplantation. Regarding the recruitment of unrelated hematopoietic stem cell donors, HLA haplotype frequencies of specific populations are used to optimize both donor searches for individual patients and strategic donor registry planning. However, the estimation of haplotype frequencies from HLA genotyping data is challenged by the large amount of genotype data, the complex HLA nomenclature, and the heterogeneous and ambiguous nature of typing records. To meet these challenges, we have developed the open-source software Hapl-o-Mat. It estimates haplotype frequencies from population data including an arbitrary number of loci using an expectation-maximization algorithm. Its key features are the processing of different HLA typing resolutions within a given population sample and the handling of ambiguities recorded via multiple allele codes or genotype list strings. Implemented in C++, Hapl-o-Mat facilitates efficient haplotype frequency estimation from large amounts of genotype data. We demonstrate its accuracy and performance on the basis of artificial and real genotype data. Hapl-o-Mat is a versatile and efficient software for HLA haplotype frequency estimation. Its capability of processing various forms of HLA genotype data allows for a straightforward haplotype frequency estimation from typing records usually found in stem cell donor registries.

Evaluation of haplotype diversity of Achatina fulica (Lissachatina) [Bowdich] from Indian sub-continent by means of 16S rDNA sequence and its phylogenetic relationships with other global populations.

PubMed

Ayyagari, Vijaya Sai; Sreerama, Krupanidhi

2017-08-01

Achatina fulica (Lissachatina fulica) is one of the most invasive species found across the globe causing a significant damage to crops, vegetables, and horticultural plants. This terrestrial snail is native to east Africa and spread to different parts of the world by introductions. India, a hot spot for biodiversity of several endemic gastropods, has witnessed an outburst of this snail population in several parts of the country posing a serious threat to crop loss and also to human health. With an objective to evaluate the genetic diversity of this snail, we have sampled this snail from different parts of India and analyzed its haplotype diversity by means of 16S rDNA sequence information. Apart from this, we have studied the phylogenetic relationships of the isolates sequenced in the present study in relation with other global populations by Bayesian and Maximum-likelihood approaches. Of the isolates sequenced, haplotype 'C' is the predominant one. A new haplotype 'S' from the state of Odisha was observed. The isolates sequenced in the present study clustered with its conspecifics from the Indian sub-continent. Haplotype network analyses were also carried out for studying the evolution of different haplotypes. It was observed that haplotype 'S' was associated with a Mauritius haplotype 'H', indicating the possibility of multiple introductions of A. fulica to India.

Theoretical underpinning of the single-molecule-dilution (SMD) method of direct haplotype resolution.

PubMed Central

Stephens, J C; Rogers, J; Ruano, G

1990-01-01

In a recent paper we have shown that DNA haplotypes of multiply heterozygous individuals can be resolved directly by polymerase-chain-reaction (PCR) amplification of a single molecule of genomic template. Our method (the single-molecule-dilution [SMD] method) relies on the stochastic separation of maternal and paternal alleles at high dilution. The stochasticity of separation and the potential for DNA shearing (which could separate the loci of interest) are two factors that can compromise the results of the experiment. This paper explores the consequences of these two factors and shows that the SMD method can be expected to work very reliably even in the presence of a moderate amount of DNA shearing. PMID:2339707

Enhancing the mathematical properties of new haplotype homozygosity statistics for the detection of selective sweeps.

PubMed

Garud, Nandita R; Rosenberg, Noah A

2015-06-01

Soft selective sweeps represent an important form of adaptation in which multiple haplotypes bearing adaptive alleles rise to high frequency. Most statistical methods for detecting selective sweeps from genetic polymorphism data, however, have focused on identifying hard selective sweeps in which a favored allele appears on a single haplotypic background; these methods might be underpowered to detect soft sweeps. Among exceptions is the set of haplotype homozygosity statistics introduced for the detection of soft sweeps by Garud et al. (2015). These statistics, examining frequencies of multiple haplotypes in relation to each other, include H12, a statistic designed to identify both hard and soft selective sweeps, and H2/H1, a statistic that conditional on high H12 values seeks to distinguish between hard and soft sweeps. A challenge in the use of H2/H1 is that its range depends on the associated value of H12, so that equal H2/H1 values might provide different levels of support for a soft sweep model at different values of H12. Here, we enhance the H12 and H2/H1 haplotype homozygosity statistics for selective sweep detection by deriving the upper bound on H2/H1 as a function of H12, thereby generating a statistic that normalizes H2/H1 to lie between 0 and 1. Through a reanalysis of resequencing data from inbred lines of Drosophila, we show that the enhanced statistic both strengthens interpretations obtained with the unnormalized statistic and leads to empirical insights that are less readily apparent without the normalization. Copyright © 2015 Elsevier Inc. All rights reserved.

Human longevity and common variations in the LMNA gene: a meta-analysis

PubMed Central

Conneely, Karen N.; Capell, Brian C.; Erdos, Michael R.; Sebastiani, Paola; Solovieff, Nadia; Swift, Amy J.; Baldwin, Clinton T.; Budagov, Temuri; Barzilai, Nir; Atzmon, Gil; Puca, Annibale A.; Perls, Thomas T.; Geesaman, Bard J.; Boehnke, Michael; Collins, Francis S.

2012-01-01

Summary A mutation in the LMNA gene is responsible for the most dramatic form of premature aging, Hutchinson-Gilford progeria syndrome (HGPS). Several recent studies have suggested that protein products of this gene might have a role in normal physiological cellular senescence. To explore further LMNA's possible role in normal aging, we genotyped 16 SNPs over a span of 75.4 kb of the LMNA gene on a sample of long-lived individuals (US Caucasians with age ≥95 years, N=873) and genetically matched younger controls (N=443). We tested all common non-redundant haplotypes (frequency ≥ 0.05) based on subgroups of these 16 SNPs for association with longevity. The most significant haplotype, based on 4 SNPs, remained significant after adjustment for multiple testing (OR = 1.56, P=2.5×10−5, multiple-testing-adjusted P=0.0045). To attempt to replicate these results, we genotyped 3448 subjects from four independent samples of long-lived individuals and control subjects from 1) the New England Centenarian Study (NECS) (N=738), 2) the Southern Italian Centenarian Study (SICS) (N=905), 3) France (N=1103), and 4) the Einstein Ashkenazi Longevity Study (N=702). We replicated the association with the most significant haplotype from our initial analysis in the NECS sample (OR = 1.60, P=0.0023), but not in the other three samples (P>.15). In a meta-analysis combining all five samples, the best haplotype remained significantly associated with longevity after adjustment for multiple testing in the initial and follow-up samples (OR = 1.18, P=7.5×10−4, multiple-testing-adjusted P=0.037). These results suggest that LMNA variants may play a role in human lifespan. PMID:22340368

Detecting and Characterizing Genomic Signatures of Positive Selection in Global Populations

PubMed Central

Liu, Xuanyao; Ong, Rick Twee-Hee; Pillai, Esakimuthu Nisha; Elzein, Abier M.; Small, Kerrin S.; Clark, Taane G.; Kwiatkowski, Dominic P.; Teo, Yik-Ying

2013-01-01

Natural selection is a significant force that shapes the architecture of the human genome and introduces diversity across global populations. The question of whether advantageous mutations have arisen in the human genome as a result of single or multiple mutation events remains unanswered except for the fact that there exist a handful of genes such as those that confer lactase persistence, affect skin pigmentation, or cause sickle cell anemia. We have developed a long-range-haplotype method for identifying genomic signatures of positive selection to complement existing methods, such as the integrated haplotype score (iHS) or cross-population extended haplotype homozygosity (XP-EHH), for locating signals across the entire allele frequency spectrum. Our method also locates the founder haplotypes that carry the advantageous variants and infers their corresponding population frequencies. This presents an opportunity to systematically interrogate the whole human genome whether a selection signal shared across different populations is the consequence of a single mutation process followed subsequently by gene flow between populations or of convergent evolution due to the occurrence of multiple independent mutation events either at the same variant or within the same gene. The application of our method to data from 14 populations across the world revealed that positive-selection events tend to cluster in populations of the same ancestry. Comparing the founder haplotypes for events that are present across different populations revealed that convergent evolution is a rare occurrence and that the majority of shared signals stem from the same evolutionary event. PMID:23731540

µ-Calpain, calpastatin, and growth hormone receptor genetic effects on preweaning performance, carcass quality traits, and residual variance of tenderness in Angus cattle selected to increase minor haplotype ... frequencies

USDA-ARS?s Scientific Manuscript database

Genetic marker effects and interactions are estimated with poor precision when minor marker allele frequencies are low. An Angus population was subjected to marker assisted selection for multiple years to increase divergent haplotype and minor marker allele frequencies to 1) estimate effect size an...

Homozygous parent affected sib pair method for detecting disease predisposing variants: application to insulin dependent diabetes mellitus.

PubMed

Robinson, W P; Barbosa, J; Rich, S S; Thomson, G

1993-01-01

For complex genetic diseases involving incomplete penetrance, genetic heterogeneity, and multiple disease genes, it is often difficult to determine the molecular variant(s) responsible for the disease pathogenesis. Linkage and association studies may help identify genetic regions and molecular variants suspected of being directly responsible for disease predisposition or protection, but, especially for complex diseases, they are less useful for determining when a predisposing molecular variant has been identified. In this paper, we expand upon the simple concept that if a genetic factor predisposing to disease has been fully identified, then a parent homozygous for this factor should transmit either of his/her copies at random to any affected children. Closely linked markers are used to determine identity by descent values in affected sib pairs from a parent homozygous for a putative disease predisposing factor. The expected deviation of haplotype sharing from 50%, when not all haplotypes carrying this factor are in fact equally predisposing, has been algebraically determined for a single locus general disease model. Equations to determine expected sharing for multiple disease alleles or multiple disease locus models have been formulated. The recessive case is in practice limiting and therefore can be used to estimate the maximum proportion of putative susceptibility haplotypes which are in fact predisposing to disease when the mode of inheritance of a disease is unknown. This method has been applied to 27 DR3/DR3 parents and 50 DR4/DR4 parents who have at least 2 children affected with insulin dependent diabetes mellitus (IDDM). The transmission of both DR3 and DR4 haplotypes is statistically different from 50% (P < 0.05 and P < 0.001, respectively). An upper estimate for the proportion of DR3 haplotypes associated with a high IDDM susceptibility is 49%, and for DR4 haplotypes 38%. Our results show that the joint presence of non-Asp at DQ beta position 57 and Arg at DQ alpha position 52, which has been proposed as a strong IDDM predisposing factor, is insufficient to explain the HLA component of IDDM predisposition.

Phylogeny and Haplotype Analysis of Fungi Within the Fusarium incarnatum-equiseti Species Complex.

PubMed

Ramdial, H; Latchoo, R K; Hosein, F N; Rampersad, S N

2017-01-01

Fusarium spp. are ranked among the top 10 most economically and scientifically important plant-pathogenic fungi in the world and are associated with plant diseases that include fruit decay of a number of crops. Fusarium isolates infecting bell pepper in Trinidad were identified based on sequence comparisons of the translation elongation factor gene (EF-1a) with sequences of Fusarium incarnatum-equiseti species complex (FIESC) verified in the FUSARIUM-ID database. Eighty-two isolates were identified as belonging to one of four phylogenetic species within the subclades FIESC-1, FIESC-15, FIESC-16, and FIESC-26, with the majority of isolates belonging to FIESC-15. A comparison of the level of DNA polymorphism and phylogenetic inference for sequences of the internal transcribed spacer region (ITS1-5.8S-ITS2) and EF-1a sequences for Trinidad and FUSARIUM-ID type species was carried out. The ITS sequences were less informative, had lower haplotype diversity and restricted haplotype distribution, and resulted in poor resolution and taxa placement in the consensus maximum-likelihood tree. EF-1a sequences enabled strongly supported phylogenetic inference with highly resolved branching patterns of the 30 phylogenetic species within the FIESC and placement of representative Trinidad isolates. Therefore, global phylogeny was inferred from EF-1a sequences representing 11 countries, and separation into distinct Incarnatum and Equiseti clades was again evident. In total, 42 haplotypes were identified: 12 were shared and the remaining were unique haplotypes. The most diverse haplotype was represented by sequences from China, Indonesia, Malaysia, and Trinidad and consisted exclusively of F. incarnatum isolates. Spain had the highest haplotype diversity, perhaps because both F. equiseti and F. incarnatum sequences were represented; followed by the United States, which contributed both F. equiseti and F. incarnatum sequences to the data set; then by countries representing Southeast Asia (China, Indonesia, Malaysia, Thailand, and Philippines) and Trinidad; both of these regions were represented by only F. incarnatum sequences. Trinidad shared two haplotypes with China and one haplotype with the United States for only F. incarnatum isolates. The findings of this study are important for devising disease management strategies and for understanding the phylogenetic relationships among members of the FIESC.

Investigating biogeographic boundaries of the Sunda shelf: A phylogenetic analysis of two island populations of Macaca fascicularis.

PubMed

Klegarth, A R; Sanders, S A; Gloss, A D; Lane-deGraaf, K E; Jones-Engel, L; Fuentes, A; Hollocher, H

2017-08-01

Cyclical submergence and re-emergence of the Sunda Shelf throughout the Pleistocene served as a dynamic biogeographic landscape, across which long-tailed macaques (Macaca fascicularis) have migrated and evolved. Here, we tested the integrity of the previously reported continental-insular haplotype divide reported among Y and mitochondrial DNA lineages across multiple studies. The continental-insular haplotype divide was tested by heavily sampling wild macaques from two important biogeographic regions within Sundaland: (1) Singapore, the southernmost tip of continental Asia and (2) Bali, Indonesia, the southeastern edge of the Indonesian archipelago, immediately west of Wallace's line. Y DNA was haplotyped for samples from Bali, deep within the Indonesian archipelago. Mitochondrial D-loop from both islands was analyzed against existing data using Maximum Likelihood and Bayesian approaches. We uncovered both "continental" and "insular" Y DNA haplotypes in Bali. Between Singapore and Bali we found 52 unique mitochondrial haplotypes, none of which had been previously described. Phylogenetic analyses confirmed a major haplogroup division within Singapore and identified five new Singapore subclades and two primary subclades in Bali. While we confirmed the continental-insular divide among mtDNA haplotypes, maintenance of both Y DNA haplotypes on Bali, deep within the Indonesian archipelago calls into question the mechanism by which Y DNA diversity has been maintained. It also suggests the continental-insular designation is less appropriate for Y DNA, leading us to propose geographically neutral Y haplotype designations. © 2017 Wiley Periodicals, Inc.

Detrimental effects of an autosomal selfish genetic element on sperm competitiveness in house mice

PubMed Central

Sutter, Andreas; Lindholm, Anna K.

2015-01-01

Female multiple mating (polyandry) is widespread across many animal taxa and indirect genetic benefits are a major evolutionary force favouring polyandry. An incentive for polyandry arises when multiple mating leads to sperm competition that disadvantages sperm from genetically inferior mates. A reduction in genetic quality is associated with costly selfish genetic elements (SGEs), and studies in invertebrates have shown that males bearing sex ratio distorting SGEs are worse sperm competitors than wild-type males. We used a vertebrate model species to test whether females can avoid an autosomal SGE, the t haplotype, through polyandry. The t haplotype in house mice exhibits strong drive in t heterozygous males by affecting spermatogenesis and is associated with homozygous in utero lethality. We used controlled matings to test the effect of the t haplotype on sperm competitiveness. Regardless of mating order, t heterozygous males sired only 11% of zygotes when competing against wild-type males, suggesting a very strong effect of the t haplotype on sperm quality. We provide, to our knowledge, the first substantial evidence that polyandry ameliorates the harmful effects of an autosomal SGE arising through genetic incompatibility. We discuss potential mechanisms in our study species and the broader implications for the benefits of polyandry. PMID:26136452

ANRIL Genetic Variants in Iranian Breast Cancer Patients

PubMed Central

Khorshidi, Hamid Reza; Taheri, Mohammad; Noroozi, Rezvan; Sarrafzadeh, Shaghayegh; Sayad, Arezou; Ghafouri-Fard, Soudeh

2017-01-01

Objective The genetic variants of the long non-coding RNA ANRIL (an antisense noncoding RNA in the INK4 locus) as well as its expression have been shown to be associated with several human diseases including cancers. The aim of this study was to examine the association of ANRIL variants with breast cancer susceptibility in Iranian patients. Materials and Methods In this case-control study, we genotyped rs1333045, rs4977574, rs1333048 and rs10757278 single nucleotide polymorphisms (SNPs) in 122 breast can- cer patients as well as in 200 normal age-matched subjects by tetra-primer amplification refractory mutation system polymerase chain reaction (T-ARMS-PCR). Results The TT genotype at rs1333045 was significantly over-represented among pa- tients (P=0.038) but did not remain significant after multiple-testing correction. In addi- tion, among all observed haplotypes (with SNP order of rs1333045, rs1333048 rs4977574 and rs10757278), four haplotypes were shown to be associated with breast cancer risk. However, after multiple testing corrections, TCGA was the only haplotype which remained significant. Conclusion These results suggest that breast cancer risk is significantly associated with ANRIL variants. Future work analyzing the expression of different associated ANRIL haplotypes would further shed light on the role of ANRIL in this disease. PMID:28580310

Identification of a functional enhancer variant within the chronic pancreatitis-associated SPINK1 c.101A>G (p.Asn34Ser)-containing haplotype.

PubMed

Boulling, Arnaud; Masson, Emmanuelle; Zou, Wen-Bin; Paliwal, Sumit; Wu, Hao; Issarapu, Prachand; Bhaskar, Seema; Génin, Emmanuelle; Cooper, David N; Li, Zhao-Shen; Chandak, Giriraj R; Liao, Zhuan; Chen, Jian-Min; Férec, Claude

2017-08-01

The haplotype harboring the SPINK1 c.101A>G (p.Asn34Ser) variant (also known as rs17107315:T>C) represents the most important heritable risk factor for idiopathic chronic pancreatitis identified to date. The causal variant contained within this risk haplotype has however remained stubbornly elusive. Herein, we set out to resolve this enigma by employing a hypothesis-driven approach. First, we searched for variants in strong linkage disequilibrium (LD) with rs17107315:T>C using HaploReg v4.1. Second, we identified two candidate SNPs by visual inspection of sequences spanning all 25 SNPs found to be in LD with rs17107315:T>C, guided by prior knowledge of pancreas-specific transcription factors and their cognate binding sites. Third, employing a novel cis-regulatory module (CRM)-guided approach to further filter the two candidate SNPs yielded a solitary candidate causal variant. Finally, combining data from phylogenetic conservation and chromatin accessibility, cotransfection transactivation experiments, and population genetic studies, we suggest that rs142703147:C>A, which disrupts a PTF1L-binding site within an evolutionarily conserved HNF1A-PTF1L CRM located ∼4 kb upstream of the SPINK1 promoter, contributes to the aforementioned chronic pancreatitis risk haplotype. Further studies are required not only to improve the characterization of this functional SNP but also to identify other functional components that might contribute to this high-risk haplotype. © 2017 Wiley Periodicals, Inc.

Recent selective sweeps in North American Drosophila melanogaster show signatures of soft sweeps.

PubMed

Garud, Nandita R; Messer, Philipp W; Buzbas, Erkan O; Petrov, Dmitri A

2015-02-01

Adaptation from standing genetic variation or recurrent de novo mutation in large populations should commonly generate soft rather than hard selective sweeps. In contrast to a hard selective sweep, in which a single adaptive haplotype rises to high population frequency, in a soft selective sweep multiple adaptive haplotypes sweep through the population simultaneously, producing distinct patterns of genetic variation in the vicinity of the adaptive site. Current statistical methods were expressly designed to detect hard sweeps and most lack power to detect soft sweeps. This is particularly unfortunate for the study of adaptation in species such as Drosophila melanogaster, where all three confirmed cases of recent adaptation resulted in soft selective sweeps and where there is evidence that the effective population size relevant for recent and strong adaptation is large enough to generate soft sweeps even when adaptation requires mutation at a specific single site at a locus. Here, we develop a statistical test based on a measure of haplotype homozygosity (H12) that is capable of detecting both hard and soft sweeps with similar power. We use H12 to identify multiple genomic regions that have undergone recent and strong adaptation in a large population sample of fully sequenced Drosophila melanogaster strains from the Drosophila Genetic Reference Panel (DGRP). Visual inspection of the top 50 candidates reveals that in all cases multiple haplotypes are present at high frequencies, consistent with signatures of soft sweeps. We further develop a second haplotype homozygosity statistic (H2/H1) that, in combination with H12, is capable of differentiating hard from soft sweeps. Surprisingly, we find that the H12 and H2/H1 values for all top 50 peaks are much more easily generated by soft rather than hard sweeps. We discuss the implications of these results for the study of adaptation in Drosophila and in species with large census population sizes.

Effects of IL-10 haplotype and atomic bomb radiation exposure on gastric cancer risk.

PubMed

Hayashi, Tomonori; Ito, Reiko; Cologne, John; Maki, Mayumi; Morishita, Yukari; Nagamura, Hiroko; Sasaki, Keiko; Hayashi, Ikue; Imai, Kazue; Yoshida, Kengo; Kajimura, Junko; Kyoizumi, Seishi; Kusunoki, Yoichiro; Ohishi, Waka; Fujiwara, Saeko; Akahoshi, Masazumi; Nakachi, Kei

2013-07-01

Gastric cancer (GC) is one of the cancers that reveal increased risk of mortality and incidence in atomic bomb survivors. The incidence of gastric cancer in the Life Span Study cohort of the Radiation Effects Research Foundation (RERF) increased with radiation dose (gender-averaged excess relative risk per Gy = 0.28) and remains high more than 65 years after exposure. To assess a possible role of gene-environment interaction, we examined the dose response for gastric cancer incidence based on immunosuppression-related IL-10 genotype, in a cohort study with 200 cancer cases (93 intestinal, 96 diffuse and 11 other types) among 4,690 atomic bomb survivors participating in an immunological substudy. Using a single haplotype block composed of four haplotype-tagging SNPs (comprising the major haplotype allele IL-10-ATTA and the minor haplotype allele IL-10-GGCG, which are categorized by IL-10 polymorphisms at -819A>G and -592T>G, +1177T>C and +1589A>G), multiplicative and additive models for joint effects of radiation and this IL-10 haplotyping were examined. The IL-10 minor haplotype allele(s) was a risk factor for intestinal type gastric cancer but not for diffuse type gastric cancer. Radiation was not associated with intestinal type gastric cancer. In diffuse type gastric cancer, the haplotype-specific excess relative risk (ERR) for radiation was statistically significant only in the major homozygote category of IL-10 (ERR = 0.46/Gy, P = 0.037), whereas estimated ERR for radiation with the minor IL-10 homozygotes was close to 0 and nonsignificant. Thus, the minor IL-10 haplotype might act to reduce the radiation related risk of diffuse-type gastric cancer. The results suggest that this IL-10 haplotyping might be involved in development of radiation-associated gastric cancer of the diffuse type, and that IL-10 haplotypes may explain individual differences in the radiation-related risk of gastric cancer. © 2013 by Radiation Research Society

Interrelationships between Amerindian tribes of lower Amazonia as manifest by HLA haplotype disequilibria.

PubMed

Black, F L

1984-11-01

HLA B-C haplotypes exhibit common disequilibria in populations drawn from four continents, indicating that they are subject to broadly active selective forces. However, the A-B and A-C associations we have examined show no consistent disequilibrium pattern, leaving open the possibility that these disequilibria are due to descent from common progenitors. By examining HLA haplotype distributions, I have explored the implications that would follow from the hypothesis that biological selection played no role in determining A-C disequilibria in 10 diverse tribes of the lower Amazon Basin. Certain haplotypes are in strong positive disequilibria across a broad geographic area, suggesting that members of diverse tribes descend from common ancestors. On the basis of the extent of diffusion of the components of these haplotypes, one can estimate that the progenitors lived less than 6,000 years ago. One widely encountered lineage entered the area within the last 1,200 years. When haplotype frequencies are used in genetic distance measurements, they give a pattern of relationships very similar to that obtained by conventional chord measurements based on several genetic markers; but more than that, when individual haplotype disequilibria in the several tribes are compared, multiple origins of a single tribe are discernible and relationships are revealed that correlate more closely to geographic and linguistic patterns than do the genetic distance measurements.

Genetic and Functional Dissection of HTRA1 and LOC387715 in Age-Related Macular Degeneration

PubMed Central

Zeng, Jiexi; Lu, Fang; Sun, Xufang; Zhao, Chao; Wang, Kevin; Davey, Lisa; Chen, Haoyu; London, Nyall; Muramatsu, Daisuke; Salasar, Francesca; Carmona, Ruben; Kasuga, Daniel; Wang, Xiaolei; Bedell, Matthew; Dixie, Manjuxia; Zhao, Peiquan; Yang, Ruifu; Gibbs, Daniel; Liu, Xiaoqi; Li, Yan; Li, Cai; Li, Yuanfeng; Campochiaro, Betsy; Constantine, Ryan; Zack, Donald J.; Campochiaro, Peter; Fu, Yinbin; Li, Dean Y.; Katsanis, Nicholas; Zhang, Kang

2010-01-01

A common haplotype on 10q26 influences the risk of age-related macular degeneration (AMD) and encompasses two genes, LOC387715 and HTRA1. Recent data have suggested that loss of LOC387715, mediated by an insertion/deletion (in/del) that destabilizes its message, is causally related with the disorder. Here we show that loss of LOC387715 is insufficient to explain AMD susceptibility, since a nonsense mutation (R38X) in this gene that leads to loss of its message resides in a protective haplotype. At the same time, the common disease haplotype tagged by the in/del and rs11200638 has an effect on the transcriptional upregulation of the adjacent gene, HTRA1. These data implicate increased HTRA1 expression in the pathogenesis of AMD and highlight the importance of exploring multiple functional consequences of alleles in haplotypes that confer susceptibility to complex traits. PMID:20140183

Measuring and partitioning the high-order linkage disequilibrium by multiple order Markov chains.

PubMed

Kim, Yunjung; Feng, Sheng; Zeng, Zhao-Bang

2008-05-01

A map of the background levels of disequilibrium between nearby markers can be useful for association mapping studies. In order to assess the background levels of linkage disequilibrium (LD), multilocus LD measures are more advantageous than pairwise LD measures because the combined analysis of pairwise LD measures is not adequate to detect simultaneous allele associations among multiple markers. Various multilocus LD measures based on haplotypes have been proposed. However, most of these measures provide a single index of association among multiple markers and does not reveal the complex patterns and different levels of LD structure. In this paper, we employ non-homogeneous, multiple order Markov Chain models as a statistical framework to measure and partition the LD among multiple markers into components due to different orders of marker associations. Using a sliding window of multiple markers on phased haplotype data, we compute corresponding likelihoods for different Markov Chain (MC) orders in each window. The log-likelihood difference between the lowest MC order model (MC0) and the highest MC order model in each window is used as a measure of the total LD or the overall deviation from the gametic equilibrium for the window. Then, we partition the total LD into lower order disequilibria and estimate the effects from two-, three-, and higher order disequilibria. The relationship between different orders of LD and the log-likelihood difference involving two different orders of MC models are explored. By applying our method to the phased haplotype data in the ENCODE regions of the HapMap project, we are able to identify high/low multilocus LD regions. Our results reveal that the most LD in the HapMap data is attributed to the LD between adjacent pairs of markers across the whole region. LD between adjacent pairs of markers appears to be more significant in high multilocus LD regions than in low multilocus LD regions. We also find that as the multilocus total LD increases, the effects of high-order LD tends to get weaker due to the lack of observed multilocus haplotypes. The overall estimates of first, second, third, and fourth order LD across the ENCODE regions are 64, 23, 9, and 3%.

Detecting and characterizing genomic signatures of positive selection in global populations.

PubMed

Liu, Xuanyao; Ong, Rick Twee-Hee; Pillai, Esakimuthu Nisha; Elzein, Abier M; Small, Kerrin S; Clark, Taane G; Kwiatkowski, Dominic P; Teo, Yik-Ying

2013-06-06

Natural selection is a significant force that shapes the architecture of the human genome and introduces diversity across global populations. The question of whether advantageous mutations have arisen in the human genome as a result of single or multiple mutation events remains unanswered except for the fact that there exist a handful of genes such as those that confer lactase persistence, affect skin pigmentation, or cause sickle cell anemia. We have developed a long-range-haplotype method for identifying genomic signatures of positive selection to complement existing methods, such as the integrated haplotype score (iHS) or cross-population extended haplotype homozygosity (XP-EHH), for locating signals across the entire allele frequency spectrum. Our method also locates the founder haplotypes that carry the advantageous variants and infers their corresponding population frequencies. This presents an opportunity to systematically interrogate the whole human genome whether a selection signal shared across different populations is the consequence of a single mutation process followed subsequently by gene flow between populations or of convergent evolution due to the occurrence of multiple independent mutation events either at the same variant or within the same gene. The application of our method to data from 14 populations across the world revealed that positive-selection events tend to cluster in populations of the same ancestry. Comparing the founder haplotypes for events that are present across different populations revealed that convergent evolution is a rare occurrence and that the majority of shared signals stem from the same evolutionary event. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Longitudinal analysis of haplotypes and polymorphisms of the APOA5 and APOC3 genes associated with variation in serum triglyceride levels: the Bogalusa Heart Study.

PubMed

Hallman, D Michael; Srinivasan, Sathanur R; Chen, Wei; Boerwinkle, Eric; Berenson, Gerald S

2006-12-01

Polymorphisms in the APOC3 and APOA5 genes, from the APOA1/APOC3/APOA4/APOA5 gene cluster on chromosome 11q23, have been associated with interindividual variation in plasma triglycerides. APOA5 polymorphisms implicated include 2 in the promoter region (-1131 T/C and -3 A/G) and 1 in exon 2 (+56 C/G). APOC3 polymorphisms implicated include 1 (SstI) in the 3' untranslated region and 1 (-2854 G/T) in the APOC3-APOA4 intergenic region. We analyzed the associations of haplotypes and multilocus genotypes of these polymorphisms on longitudinal serum triglyceride profiles in 360 African American and 823 white subjects from the Bogalusa Heart Study. Subjects were examined from 2 to 8 times (mean +/- SD, 5.4 +/- 1.3) between 1973 and 1996, at ages ranging from 4 to 38 years, with 1978 observations in African Americans and 4465 in whites. Serum triglycerides were significantly higher among whites across all ages. Allele frequencies differed significantly between African Americans and whites at all but the APOA5 +56 C/G locus. Linkage disequilibrium among the loci was higher in whites and haplotype diversity lower: 6 haplotypes had estimated frequencies of more than 1% in African Americans, 5 in whites. Individually, all polymorphisms except APOC3 -2854 G/T showed significant associations with triglyceride levels in the full sample. However, genotype models including all 5 loci showed significant triglyceride associations for only 3 (APOC3 SstI, APOA5 -1131 T/C, and APOA5 +56 C/G); significant interactions among them indicated their effects were not independent. Neither APOC3 -2854 G/T nor APOA5 -3 A/G had significant effects when the other 3 loci were in the models. The EM algorithm was used to estimate haplotype frequencies and assign haplotype probabilities to individuals, which is conditional on their genotypes; individuals' haplotype probability vectors were then used as predictors in multilevel mixed models of longitudinal triglyceride profiles. Of haplotypes comprising, in order, APOC3 SstI and -2854 G/T and APOA5 -1131 T/C, -3 A/G, and +56 C/G, 3 were significantly associated with higher triglycerides, even after adjusting for multiple tests: GGTAG (P = .002), GTTAG (P < .0001), and CGCGC (P = .0002). Each GGTAG haplotype carried would be expected to raise triglyceride levels (relative to those of GTTAC homozygotes) by approximately 19 mg/dL, each GTTAG haplotype by approximately 15 mg/dL, and each CGCGC haplotype by approximately 7 mg/dL. Haplotypes comprising the 3 loci implicated by genotype analyses (SstI, -1131 T/C, and +56 C/G) were also tested: haplotypes C_C_C and G_T_G significantly raised triglycerides, even after adjustment for multiple comparisons (P < .002 for both), with each copy of C_C_C expected to raise triglycerides by approximately 7 mg/dL and each copy of G_T_G by approximately 15 mg/dL. Overall, our findings support those of others in associating specific polymorphisms and haplotypes in the APOA1/C3/A4/A5 gene cluster with higher serum triglyceride levels. However, the degree to which polymorphisms in the APOC3 and APOA5 genes may be independently associated with triglyceride levels remains to be determined.

Mitochondrial DNA variation in bull trout (Salvelinus confluentus) from northwestern North America: implications for zoogeography and conservation.

PubMed

Taylor, E B; Pollard, S; Louie, D

1999-07-01

Bull trout, Salvelinus confluentus (Salmonidae), are distributed in northwestern North America from Nevada to Yukon Territory, largely in interior drainages. The species is of conservation concern owing to declines in abundance, particularly in southern portions of its range. To investigate phylogenetic structure within bull trout that might form the basis for the delineation of major conservation units, we conducted a mitochondrial DNA (mtDNA) survey in bull trout from throughout its range. Restriction fragment length polymorphism (RFLP) analysis of four segments of the mtDNA genome with 11 restriction enzymes resolved 21 composite haplotypes that differed by an average of 0.5% in sequence. One group of haplotypes predominated in 'coastal' areas (west of the coastal mountain ranges) while another predominated in 'interior' regions (east of the coastal mountains). The two putative lineages differed by 0.8% in sequence and were also resolved by sequencing a portion of the ND1 gene in a representative of each RFLP haplotype. Significant variation existed within individual sample sites (12% of total variation) and among sites within major geographical regions (33%), but most variation (55%) was associated with differences between coastal and interior regions. We concluded that: (i) bull trout are subdivided into coastal and interior lineages; (ii) this subdivision reflects recent historical isolation in two refugia south of the Cordilleran ice sheet during the Pleistocene: the Chehalis and Columbia refugia; and (iii) most of the molecular variation resides at the interpopulation and inter-region levels. Conservation efforts, therefore, should focus on maintaining as many populations as possible across as many geographical regions as possible within both coastal and interior lineages.

COI haplotype groups in Mesocriconema (Nematoda: Criconematidae) and their morphospecies associations.

PubMed

Powers, T O; Bernard, E C; Harris, T; Higgins, R; Olson, M; Lodema, M; Mullin, P; Sutton, L; Powers, K S

2014-07-03

Without applying an a priori bias for species boundaries, specimen identities in the plant-parasitic nematode genus Mesocriconema were evaluated by examining mitochondrial COI nucleotide sequences, morphology, and biogeography. A total of 242 specimens that morphologically conformed to the genus were individually photographed, measured, and amplified by a PCR primer set to preserve the linkage between specimen morphology and a specific DNA barcode sequence. Specimens were extracted from soil samples representing 45 locations across 23 ecoregions in North America. Dendrograms constructed by neighbor-joining, maximum likelihood, and Bayesian Inference using a 721-bp COI barcode were used to group COI haplotypes. Each tree-building approach resulted in 24 major haplotype groups within the dataset. The distinctiveness of these groups was evaluated by node support, genetic distance, absence of intermediates, and several measures of distinctiveness included in software used for the exploration of species boundaries. Five of the 24 COI haplotype groups corresponded to morphologically characterized, Linnaean species. Morphospecies conforming to M. discus, Discocriconemella inarata, M. rusticum, M. onoense, and M. kirjanovae were represented by groups composed of multiple closely related or identical COI haplotypes. In other cases, morphospecies names could be equally applied to multiple haplotype groups that were genetically distant from each other. Identification based on morphology alone resulted in M. curvatum and M. ornatum species designations applied to seven and three groups, respectively. Morphological characters typically used for species level identification were demonstrably variable within haplotype groups, suggesting caution in assigning species names based on published compendia that solely consider morphological characters. Morphospecies classified as M. xenoplax formed a monophyletic group composed of seven genetically distinct COI subgroups. The species Discocriconemella inarata is transferred to Mesocriconema inaratum based on its phylogenetic position on the COI tree as well as previous phylogenetic analyses using 18S, ITS1, and cytochrome b nucleotide sequences. This study indicates that some of the species considered cosmopolitan in their distribution are actually multispecies polyphyletic groupings and an accurate assessment of Mesocriconema species distributions will benefit from molecular determination of haplotype relationships. The groups revealed by COI analysis should provide a useful framework for the evaluation of additional Mesocriconema species and will improve the reliability of designating taxonomic units in studies of nematode biodiversity. 

Association analysis of the SLC22A11 (organic anion transporter 4) and SLC22A12 (urate transporter 1) urate transporter locus with gout in New Zealand case-control sample sets reveals multiple ancestral-specific effects

PubMed Central

2013-01-01

Introduction There is inconsistent association between urate transporters SLC22A11 (organic anion transporter 4 (OAT4)) and SLC22A12 (urate transporter 1 (URAT1)) and risk of gout. New Zealand (NZ) Māori and Pacific Island people have higher serum urate and more severe gout than European people. The aim of this study was to test genetic variation across the SLC22A11/SLC22A12 locus for association with risk of gout in NZ sample sets. Methods A total of 12 single nucleotide polymorphism (SNP) variants in four haplotype blocks were genotyped using TaqMan® and Sequenom MassArray in 1003 gout cases and 1156 controls. All cases had gout according to the 1977 American Rheumatism Association criteria. Association analysis of single markers and haplotypes was performed using PLINK and Stata. Results A haplotype block 1 SNP (rs17299124) (upstream of SLC22A11) was associated with gout in less admixed Polynesian sample sets, but not European Caucasian (odds ratio; OR = 3.38, P = 6.1 × 10-4; OR = 0.91, P = 0.40, respectively) sample sets. A protective block 1 haplotype caused the rs17299124 association (OR = 0.28, P = 6.0 × 10-4). Within haplotype block 2 (SLC22A11) we could not replicate previous reports of association of rs2078267 with gout in European Caucasian (OR = 0.98, P = 0.82) sample sets, however this SNP was associated with gout in Polynesian (OR = 1.51, P = 0.022) sample sets. Within haplotype block 3 (including SLC22A12) analysis of haplotypes revealed a haplotype with trans-ancestral protective effects (OR = 0.80, P = 0.004), and a second haplotype conferring protection in less admixed Polynesian sample sets (OR = 0.63, P = 0.028) but risk in European Caucasian samples (OR = 1.33, P = 0.039). Conclusions Our analysis provides evidence for multiple ancestral-specific effects across the SLC22A11/SLC22A12 locus that presumably influence the activity of OAT4 and URAT1 and risk of gout. Further fine mapping of the association signal is needed using trans-ancestral re-sequence data. PMID:24360580

Allelic and haplotypic diversity of HLA-A, -B, -C, -DRB1, and -DQB1 genes in the Korean population.

PubMed

Lee, K W; Oh, D H; Lee, C; Yang, S Y

2005-05-01

High-resolution human leukocyte antigen (HLA) typing exposes the unique patterns of HLA allele and haplotype frequencies in each population. In this study, HLA-A, -B, -C, -DRB1, and -DQB1 genotypes were analyzed in 485 apparently unrelated healthy Korean individuals. A total of 20 HLA-A, 43 HLA-B, 21 HLA-C, 31 HLA-DRB1, and 14 HLA-DQB1 alleles were identified. Eleven alleles (A*0201, A*1101, A*2402, A*3303, B*1501, Cw*0102, Cw*0302, Cw*0303, DQB1*0301, DQB1*0302, and DQB1*0303) were found in more than 10% of the population. In each serologic group, a maximum of three alleles were found with several exceptions (A2, B62, DR4, DR14, and DQ6). In each serologic group exhibiting multiple alleles, two major alleles were present at 62-96% (i.e. A*0201 and A*0206 comprise 85% of A2-positive alleles). Multiple-locus haplotypes estimated by the maximum likelihood method revealed 51 A-C, 43 C-B, 52 B-DRB1, 34 DRB1-DQB1, 48 A-C-B, 42 C-B-DRB1, 46 B-DRB1-DQB1, and 30 A-C-B-DRB1-DQB1 haplotypes with frequencies of more than 0.5%. In spite of their high polymorphism in B and DRB1, identification of relatively small numbers of two-locus (B-C and DRB1-DQB1) haplotypes suggested strong associations of those two loci, respectively. Five-locus haplotypes defined by high-resolution DNA typing correlated well with previously identified serology-based haplotypes in the population. The five most frequent haplotypes were: A*3303-Cw*1403-B*4403-DRB1*1302-DQB1*0604 (4.2%), A*3303-Cw*0701/6-B*4403-DRB1*0701-DQB1*0201/2 (3.0%), A*3303-Cw*0302-B*5801-DRB1*1302-DQB1*0609 (3.0%), A*2402-Cw*0702-B*0702-DRB1*0101-DQB1*0501 (2.9%), and A*3001-Cw*0602-B*1302-DRB1*0701-DQB1*0201/2 (2.7%). Several sets of allele level haplotypes that could not be discriminated by routine HLA-A, -B, and -DRB1 low-resolution typing originated from allelic diversity of A2, B61, DR4, and DR8 serologic groups. Information obtained in this study will be useful for medical and forensic applications as well as in anthropology.

The confounding effects of hybridization on phylogenetic estimation in the New Zealand cicada genus Kikihia.

PubMed

Banker, Sarah E; Wade, Elizabeth J; Simon, Chris

2017-11-01

Phylogenetic studies of multiple independently inherited nuclear genes considered in combination with patterns of inheritance of organelle DNA have provided considerable insight into the history of species evolution. In particular, investigations of cicadas in the New Zealand genus Kikihia have identified interesting cases where mitochondrial DNA (mtDNA) crosses species boundaries in some species pairs but not others. Previous phylogenetic studies focusing on mtDNA largely corroborated Kikihia species groups identified by song, morphology and ecology with the exception of a unique South Island mitochondrial haplotype clade-the Westlandica group. This newly identified group consists of diverse taxa previously classified as belonging to three different sub-generic clades. We sequenced five nuclear loci from multiple individuals from every species of Kikihia to assess the nuclear gene concordance for this newly-identified mtDNA lineage. Bayes Factor analysis of the constrained phylogeny suggests some support for the mtDNA-based hypotheses, despite the fact that neither concatenation nor multiple species tree methods resolve the Westlandica group as monophyletic. The nuclear analyses suggest a geographic distinction between clearly defined monophyletic North Island clades and unresolved South Island clades. We suggest that more extreme habitat modification on South Island during the Pliocene and Pleistocene resulted in secondary contact and hybridization between species pairs and a series of mitochondrial capture events followed by subsequent lineage evolution. Copyright © 2017 Elsevier Inc. All rights reserved.

Genome-wide association studies for multiple diseases of the German Shepherd Dog

PubMed Central

Tsai, Kate L.; Noorai, Rooksana E.; Starr-Moss, Alison N.; Quignon, Pascale; Rinz, Caitlin J.; Ostrander, Elaine A.; Steiner, Jörg M.; Murphy, Keith E.

2012-01-01

The German Shepherd Dog (GSD) is a popular working and companion breed for which over 50 hereditary diseases have been documented. Herein, SNP profiles for 197 GSDs were generated using the Affymetrix v2 canine SNP array for a genome-wide association study to identify loci associated with four diseases: pituitary dwarfism, degenerative myelopathy (DM), congenital megaesophagus (ME), and pancreatic acinar atrophy (PAA). A locus on Chr 9 is strongly associated with pituitary dwarfism and is proximal to a plausible candidate gene, LHX3. Results for DM confirm a major locus encompassing SOD1, in which an associated point mutation was previously identified, but do not suggest modifier loci. Several SNPs on Chr 12 are associated with ME and a 4.7 Mb haplotype block is present in affected dogs. Analysis of additional ME cases for a SNP within the haplotype provides further support for this association. Results for PAA indicate more complex genetic underpinnings. Several regions on multiple chromosomes reach genome-wide significance. However, no major locus is apparent and only two associated haplotype blocks, on Chrs 7 and 12 are observed. These data suggest that PAA may be governed by multiple loci with small effects, or it may be a heterogeneous disorder. PMID:22105877

References for Haplotype Imputation in the Big Data Era

PubMed Central

Li, Wenzhi; Xu, Wei; Li, Qiling; Ma, Li; Song, Qing

2016-01-01

Imputation is a powerful in silico approach to fill in those missing values in the big datasets. This process requires a reference panel, which is a collection of big data from which the missing information can be extracted and imputed. Haplotype imputation requires ethnicity-matched references; a mismatched reference panel will significantly reduce the quality of imputation. However, currently existing big datasets cover only a small number of ethnicities, there is a lack of ethnicity-matched references for many ethnic populations in the world, which has hampered the data imputation of haplotypes and its downstream applications. To solve this issue, several approaches have been proposed and explored, including the mixed reference panel, the internal reference panel and genotype-converted reference panel. This review article provides the information and comparison between these approaches. Increasing evidence showed that not just one or two genetic elements dictate the gene activity and functions; instead, cis-interactions of multiple elements dictate gene activity. Cis-interactions require the interacting elements to be on the same chromosome molecule, therefore, haplotype analysis is essential for the investigation of cis-interactions among multiple genetic variants at different loci, and appears to be especially important for studying the common diseases. It will be valuable in a wide spectrum of applications from academic research, to clinical diagnosis, prevention, treatment, and pharmaceutical industry. PMID:27274952

Dual Origins of Dairy Cattle Farming – Evidence from a Comprehensive Survey of European Y-Chromosomal Variation

PubMed Central

Edwards, Ceiridwen J.; Ginja, Catarina; Kantanen, Juha; Pérez-Pardal, Lucía; Tresset, Anne; Stock, Frauke; Gama, Luis T.; Penedo, M. Cecilia T.; Bradley, Daniel G.; Lenstra, Johannes A.; Nijman, Isaäc J.

2011-01-01

Background Diversity patterns of livestock species are informative to the history of agriculture and indicate uniqueness of breeds as relevant for conservation. So far, most studies on cattle have focused on mitochondrial and autosomal DNA variation. Previous studies of Y-chromosomal variation, with limited breed panels, identified two Bos taurus (taurine) haplogroups (Y1 and Y2; both composed of several haplotypes) and one Bos indicus (indicine/zebu) haplogroup (Y3), as well as a strong phylogeographic structuring of paternal lineages. Methodology and Principal Findings Haplogroup data were collected for 2087 animals from 138 breeds. For 111 breeds, these were resolved further by genotyping microsatellites INRA189 (10 alleles) and BM861 (2 alleles). European cattle carry exclusively taurine haplotypes, with the zebu Y-chromosomes having appreciable frequencies in Southwest Asian populations. Y1 is predominant in northern and north-western Europe, but is also observed in several Iberian breeds, as well as in Southwest Asia. A single Y1 haplotype is predominant in north-central Europe and a single Y2 haplotype in central Europe. In contrast, we found both Y1 and Y2 haplotypes in Britain, the Nordic region and Russia, with the highest Y-chromosomal diversity seen in the Iberian Peninsula. Conclusions We propose that the homogeneous Y1 and Y2 regions reflect founder effects associated with the development and expansion of two groups of dairy cattle, the pied or red breeds from the North Sea and Baltic coasts and the spotted, yellow or brown breeds from Switzerland, respectively. The present Y1-Y2 contrast in central Europe coincides with historic, linguistic, religious and cultural boundaries. PMID:21253012

RENT+: an improved method for inferring local genealogical trees from haplotypes with recombination

PubMed Central

Mirzaei, Sajad; Wu, Yufeng

2017-01-01

Abstract Motivation: Haplotypes from one or multiple related populations share a common genealogical history. If this shared genealogy can be inferred from haplotypes, it can be very useful for many population genetics problems. However, with the presence of recombination, the genealogical history of haplotypes is complex and cannot be represented by a single genealogical tree. Therefore, inference of genealogical history with recombination is much more challenging than the case of no recombination. Results: In this paper, we present a new approach called RENT+ for the inference of local genealogical trees from haplotypes with the presence of recombination. RENT+ builds on a previous genealogy inference approach called RENT, which infers a set of related genealogical trees at different genomic positions. RENT+ represents a significant improvement over RENT in the sense that it is more effective in extracting information contained in the haplotype data about the underlying genealogy than RENT. The key components of RENT+ are several greatly enhanced genealogy inference rules. Through simulation, we show that RENT+ is more efficient and accurate than several existing genealogy inference methods. As an application, we apply RENT+ in the inference of population demographic history from haplotypes, which outperforms several existing methods. Availability and Implementation: RENT+ is implemented in Java, and is freely available for download from: https://github.com/SajadMirzaei/RentPlus. Contacts: sajad@engr.uconn.edu or ywu@engr.uconn.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:28065901

Genetic Diversity of Bactrocera dorsalis (Diptera: Tephritidae) on the Hawaiian Islands: Implications for an Introduction Pathway Into California.

PubMed

Barr, Norman B; Ledezma, Lisa A; Leblanc, Luc; San Jose, Michael; Rubinoff, Daniel; Geib, Scott M; Fujita, Brian; Bartels, David W; Garza, Daniel; Kerr, Peter; Hauser, Martin; Gaimari, Stephen

2014-10-01

Population genetic diversity of the oriental fruit fly, Bactrocera dorsalis (Hendel), on the Hawaiian islands of Oahu, Maui, Kauai, and Hawaii (the Big Island) was estimated using DNA sequences of the mitochondrial cytochrome c oxidase subunit I gene. In total, 932 flies representing 36 sampled sites across the four islands were sequenced for a 1,500-bp fragment of the gene named the C1500 marker. Genetic variation was low on the Hawaiian Islands with >96% of flies having just two haplotypes: C1500-Haplotype 1 (63.2%) or C1500-Haplotype 2 (33.3%). The other 33 flies (3.5%) had haplotypes similar to the two dominant haplotypes. No population structure was detected among the islands or within islands. The two haplotypes were present at similar frequencies at each sample site, suggesting that flies on the various islands can be considered one population. Comparison of the Hawaiian data set to DNA sequences of 165 flies from outbreaks in California between 2006 and 2012 indicates that a single-source introduction pathway of Hawaiian origin cannot explain many of the flies in California. Hawaii, however, could not be excluded as a maternal source for 69 flies. There was no clear geographic association for Hawaiian or non-Hawaiian haplotypes in the Bay Area or Los Angeles Basin over time. This suggests that California experienced multiple, independent introductions from different sources. © 2014 Entomological Society of America.

HAPRAP: a haplotype-based iterative method for statistical fine mapping using GWAS summary statistics.

PubMed

Zheng, Jie; Rodriguez, Santiago; Laurin, Charles; Baird, Denis; Trela-Larsen, Lea; Erzurumluoglu, Mesut A; Zheng, Yi; White, Jon; Giambartolomei, Claudia; Zabaneh, Delilah; Morris, Richard; Kumari, Meena; Casas, Juan P; Hingorani, Aroon D; Evans, David M; Gaunt, Tom R; Day, Ian N M

2017-01-01

Fine mapping is a widely used approach for identifying the causal variant(s) at disease-associated loci. Standard methods (e.g. multiple regression) require individual level genotypes. Recent fine mapping methods using summary-level data require the pairwise correlation coefficients ([Formula: see text]) of the variants. However, haplotypes rather than pairwise [Formula: see text], are the true biological representation of linkage disequilibrium (LD) among multiple loci. In this article, we present an empirical iterative method, HAPlotype Regional Association analysis Program (HAPRAP), that enables fine mapping using summary statistics and haplotype information from an individual-level reference panel. Simulations with individual-level genotypes show that the results of HAPRAP and multiple regression are highly consistent. In simulation with summary-level data, we demonstrate that HAPRAP is less sensitive to poor LD estimates. In a parametric simulation using Genetic Investigation of ANthropometric Traits height data, HAPRAP performs well with a small training sample size (N < 2000) while other methods become suboptimal. Moreover, HAPRAP's performance is not affected substantially by single nucleotide polymorphisms (SNPs) with low minor allele frequencies. We applied the method to existing quantitative trait and binary outcome meta-analyses (human height, QTc interval and gallbladder disease); all previous reported association signals were replicated and two additional variants were independently associated with human height. Due to the growing availability of summary level data, the value of HAPRAP is likely to increase markedly for future analyses (e.g. functional prediction and identification of instruments for Mendelian randomization). The HAPRAP package and documentation are available at http://apps.biocompute.org.uk/haprap/ CONTACT: : jie.zheng@bristol.ac.uk or tom.gaunt@bristol.ac.ukSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

Signatures of soft sweeps across the Dt1 locus underlying determinate growth habit in soya bean [Glycine max (L.) Merr.].

PubMed

Zhong, Limei; Yang, Qiaomei; Yan, Xin; Yu, Chao; Su, Liu; Zhang, Xifeng; Zhu, Youlin

2017-09-01

Determinate growth habit is an agronomically important trait associated with domestication in soya bean. Previous studies have demonstrated that the emergence of determinacy is correlated with artificial selection on four nonsynonymous mutations in the Dt1 gene. To better understand the signatures of the soft sweeps across the Dt1 locus and track the origins of the determinate alleles, we examined patterns of nucleotide variation in Dt1 and the surrounding genomic region of approximately 800 kb. Four local, asymmetrical hard sweeps on four determinate alleles, sized approximately 660, 120, 220 and 150 kb, were identified, which constitute the soft sweeps for the adaptation. These variable-sized sweeps substantially reflected the strength and timing of selection and indicated that the selection on the alleles had been completed rapidly within half a century. Statistics of EHH, iHS, H12 and H2/H1 based on haplotype data had the power to detect the soft sweeps, revealing distinct signatures of extensive long-range LD and haplotype homozygosity, and multiple frequent adaptive haplotypes. A haplotype network constructed for Dt1 and a phylogenetic tree based on its extended haplotype block implied independent sources of the adaptive alleles through de novo mutations or rare standing variation in quick succession during the selective phase, strongly supporting multiple origins of the determinacy. We propose that the adaptation of soya bean determinacy is guided by a model of soft sweeps and that this model might be indispensable during crop domestication or evolution. © 2017 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

Repeated range expansions and inter-/postglacial recolonization routes of Sargentodoxa cuneata (Oliv.) Rehd. et Wils. (Lardizabalaceae) in subtropical China revealed by chloroplast phylogeography.

PubMed

Tian, Shuang; Lei, Shu-Qing; Hu, Wan; Deng, Ling-Li; Li, Bo; Meng, Qing-Lin; Soltis, Douglas E; Soltis, Pamela S; Fan, Deng-Mei; Zhang, Zhi-Yong

2015-04-01

Most plant phylogeographic studies in subtropical China have stressed the importance of multiple refugia and limited admixture among refugia. Little attention has been paid to range expansion and recolonization routes in this region. In this study, we implemented a phylogeographic survey on Sargentodoxa cuneata, a widespread woody deciduous climber in subtropical China to determine if it conforms to the expansion-contraction (EC) model during the Pleistocene. Sequence variation of two chloroplast intergenic spacers (IGSs) in 369 individuals from 54 populations of S. cuneata was examined. Twenty-six chloroplast haplotypes were recovered. One of these (H5) occurred across the range of S. cuneata and was absent from only 13 populations. Sixteen of the 26 haplotypes were connected to H5 by one mutation and displayed a star-like pattern in the haplotype network. All chloroplast haplotypes clustered into two lineages (A and B) in a Bayesian tree, and most haplotypes (18 out of 26) originated during the mid-Pleistocene (0.63-1.07Ma). Demographic analyses detected a recent range expansion that occurred at 95.98ka (CI: 61.7-112.53ka) for Lineage A. The genetic signature of an ancient range expansion after the Middle Pleistocene Transition (MPT) was also evident. Three recolonization routes were identified in subtropical China. The results suggest that temperate plants in subtropical China may conform to the EC model to some extent. However, the genetic signature from multiple historical processes may complicate the phylogeographic patterns of organisms in the region due to the mild Pleistocene climate. This study provides a new perspective for understanding the evolutionary history of temperate plants in subtropical China. Copyright © 2015 Elsevier Inc. All rights reserved.

HLA DPA1, DPB1 alleles and haplotypes contribute to the risk associated with type 1 diabetes: analysis of the type 1 diabetes genetics consortium families.

PubMed

Varney, Michael D; Valdes, Ana Maria; Carlson, Joyce A; Noble, Janelle A; Tait, Brian D; Bonella, Persia; Lavant, Eva; Fear, Anna Lisa; Louey, Anthony; Moonsamy, Priscilla; Mychaleckyj, Josyf C; Erlich, Henry

2010-08-01

To determine the relative risk associated with DPA1 and DPB1 alleles and haplotypes in type 1 diabetes. The frequency of DPA1 and DPB1 alleles and haplotypes in type 1 diabetic patients was compared to the family based control frequency in 1,771 families directly and conditional on HLA (B)-DRB1-DQA1-DQB1 linkage disequilibrium. A relative predispositional analysis (RPA) was performed in the presence or absence of the primary HLA DR-DQ associations and the contribution of DP haplotype to individual DR-DQ haplotype risks examined. Eight DPA1 and thirty-eight DPB1 alleles forming seventy-four DPA1-DPB1 haplotypes were observed; nineteen DPB1 alleles were associated with multiple DPA1 alleles. Following both analyses, type 1 diabetes susceptibility was significantly associated with DPB1*0301 (DPA1*0103-DPB1*0301) and protection with DPB1*0402 (DPA1*0103-DPB1*0402) and DPA1*0103-DPB1*0101 but not DPA1*0201-DPB1*0101. In addition, DPB1*0202 (DPA1*0103-DPB1*0202) and DPB1*0201 (DPA1*0103-DPB1*0201) were significantly associated with susceptibility in the presence of the high risk and protective DR-DQ haplotypes. Three associations (DPB1*0301, *0402, and *0202) remained statistically significant when only the extended HLA-A1-B8-DR3 haplotype was considered, suggesting that DPB1 alone may delineate the risk associated with this otherwise conserved haplotype. HLA DP allelic and haplotypic diversity contributes significantly to the risk for type 1 diabetes; DPB1*0301 (DPA1*0103-DPB1*0301) is associated with susceptibility and DPB1*0402 (DPA1*0103-DPB1*0402) and DPA1*0103-DPB1*0101 with protection. Additional evidence is presented for the susceptibility association of DPB1*0202 (DPA1*0103-DPB1*0202) and for a contributory role of individual amino acids and DPA1 or a gene in linkage disequilibrium in DR3-DPB1*0101 positive haplotypes.

IL7Rα Expression and Upregulation by IFNβ in Dendritic Cell Subsets Is Haplotype-Dependent

PubMed Central

McKay, Fiona C.; Hoe, Edwin; Parnell, Grant; Gatt, Prudence; Schibeci, Stephen D.; Stewart, Graeme J.; Booth, David R.

2013-01-01

The IL7Rα gene is unequivocally associated with susceptibility to multiple sclerosis (MS). Haplotype 2 (Hap 2) confers protection from MS, and T cells and dendritic cells (DCs) of Hap 2 exhibit reduced splicing of exon 6, resulting in production of relatively less soluble receptor, and potentially more response to ligand. We have previously shown in CD4 T cells that IL7Rα haplotypes 1 and 2, but not 4, respond to interferon beta (IFNβ), the most commonly used immunomodulatory drug in MS, and that haplotype 4 (Hap 4) homozygotes have the highest risk of developing MS. We now show that IL7R expression increases in myeloid cells in response to IFNβ, but that the response is haplotype-dependent, with cells from homozygotes for Hap 4 again showing no response. This was shown using freshly derived monocytes, in vitro cultured immature and mature monocyte-derived dendritic cells, and by comparing homozygotes for the common haplotypes, and relative expression of alleles in heterozygotes (Hap 4 vs not Hap 4). As for T cells, in all myeloid cell subsets examined, Hap 2 homozygotes showed a trend for reduced splicing of exon 6 compared to the other haplotypes, significantly so in most conditions. These data are consistent with increased signaling being protective from MS, constitutively and in response to IFNβ. We also demonstrate significant regulation of immune response, chemokine activity and cytokine biosynthesis pathways by IL7Rα signaling in IFNβ -treated myeloid subsets. IFNβ-responsive genes are over-represented amongst genes associated with MS susceptibility. IL7Rα haplotype may contribute to MS susceptibility through reduced capacity for IL7Rα signalling in myeloid cells, especially in the presence of IFNβ, and is currently under investigation as a predictor of therapeutic response. PMID:24147013

Ultraaccurate genome sequencing and haplotyping of single human cells.

PubMed

Chu, Wai Keung; Edge, Peter; Lee, Ho Suk; Bansal, Vikas; Bafna, Vineet; Huang, Xiaohua; Zhang, Kun

2017-11-21

Accurate detection of variants and long-range haplotypes in genomes of single human cells remains very challenging. Common approaches require extensive in vitro amplification of genomes of individual cells using DNA polymerases and high-throughput short-read DNA sequencing. These approaches have two notable drawbacks. First, polymerase replication errors could generate tens of thousands of false-positive calls per genome. Second, relatively short sequence reads contain little to no haplotype information. Here we report a method, which is dubbed SISSOR (single-stranded sequencing using microfluidic reactors), for accurate single-cell genome sequencing and haplotyping. A microfluidic processor is used to separate the Watson and Crick strands of the double-stranded chromosomal DNA in a single cell and to randomly partition megabase-size DNA strands into multiple nanoliter compartments for amplification and construction of barcoded libraries for sequencing. The separation and partitioning of large single-stranded DNA fragments of the homologous chromosome pairs allows for the independent sequencing of each of the complementary and homologous strands. This enables the assembly of long haplotypes and reduction of sequence errors by using the redundant sequence information and haplotype-based error removal. We demonstrated the ability to sequence single-cell genomes with error rates as low as 10 -8 and average 500-kb-long DNA fragments that can be assembled into haplotype contigs with N50 greater than 7 Mb. The performance could be further improved with more uniform amplification and more accurate sequence alignment. The ability to obtain accurate genome sequences and haplotype information from single cells will enable applications of genome sequencing for diverse clinical needs. Copyright © 2017 the Author(s). Published by PNAS.

Associations between mutations and a VNTR in the human phenylalanine hydroxylase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goltsov, A.A.; Eisensmith, R.C.; Woo, S.L.C.

1992-09-01

The HindIII RFLP in the human phenylalanine hydroxylase (PAH) gene is caused by the presence of an AT-rich (70%) minisatellite region. This region contains various multiples of 30-bp tandem repeats and is located 3 kb downstream of the final exon of the gene. PCR-mediated amplification of this region from haplotyped PAH chromosomes indicates that the previously reported 4.0-kb HindIII allele contains three of these repeats, while the 4.4-kb HindIII allele contains 12 of these repeats. The 4.2-kb HindIII fragment can contain six, seven, eight, or nine copies of this repeat. These variations permit more detailed analysis of mutant haplotypes 1,more » 5, 6, and, possibly, others. Kindred analysis in phenylketonuria families demonstrates Mendelian segregation of these VNTR alleles, as well as associations between theses alleles and certain PAH mutations. The R261Q mutation, associated with haplotype 1, is associated almost exclusively with an allele containing eight repeats; the R408W mutation, when occurring on a haplotype 1 background, may also be associated with the eight-repeat VNTR allele. Other PAH mutations associated with haplotype 1, R252W and P281L, do not appear to segregate with specific VNTR alleles. The IVS-10 mutation, when associated with haplotype 6, is associated exclusively with an allele containing seven repeats. The combined use of this VNTR system and the existing RFLP haplotype system will increase the performance of prenatal diagnostic tests based on haplotype analysis. In addition, this VNTR may prove useful in studies concerning the origins and distributions of PAH mutations in different human populations. 32 refs., 3 figs., 3 tabs.« less

Sublocalization of an Ataxia-Telangiectasia Gene Distal to D11S384 by Ancestral Haplotyping In Costa Rican Families

PubMed Central

Uhrhammer, Nancy; Lange, Ethan; Porras, Oscar; Naeim, Arash; Chen, Xiaoguang; Sheikhavandi, Sepideh; Chiplunkar, Sujata; Yang, Lan; Dandekar, Sugandha; Liang, Teresa; Patel, Nima; Teraoka, Sharon; Udar, Nitin; Calvo, Nidia; Concannon, Patrick; Lange, Kenneth; Gatti, Richard A.

1995-01-01

In an effort to localize a gene for ataxia-telangiectasia (A-T), we have genotyped 27 affected Costa Rican families, with 13 markers, in the chromosome 11q22-23 region. Significant linkage disequilibrium was detected for 9/13 markers between D11S1816 and D11S1391. Recombination events observed in these pedigrees places A-T between D11S1819 and D11S1960. One ancestral haplotype is common to 24/54 affected chromosomes and roughly two-thirds of the families. Inferred (ancestral) recombination events involving this common haplotype in earlier generations suggest that A-T is distal to D11S384 and proximal to D11S1960. Several other common haplotypes were identified, consistent with multiple mutations in a single gene. When considered together with all other evidence, this study further sublocalizes the major A-T locus to ≈200 kb, between markers S384 and S535. ImagesFigure 5 PMID:7611278

Extensive paternal mtDNA leakage in natural populations of Drosophila melanogaster.

PubMed

Nunes, Maria D S; Dolezal, Marlies; Schlötterer, Christian

2013-04-01

Strict maternal inheritance is considered a hallmark of animal mtDNA. Although recent reports suggest that paternal leakage occurs in a broad range of species, it is still considered an exceptionally rare event. To evaluate the impact of paternal leakage on the evolution of mtDNA, it is essential to reliably estimate the frequency of paternal leakage in natural populations. Using allele-specific real-time quantitative PCR (RT-qPCR), we show that heteroplasmy is common in natural populations with at least 14% of the individuals carrying multiple mitochondrial haplotypes. However, the average frequency of the minor mtDNA haplotype is low (0.8%), which suggests that this pervasive heteroplasmy has not been noticed before due to a lack of power in sequencing surveys. Based on the distribution of mtDNA haplotypes in the offspring of heteroplasmic mothers, we found no evidence for strong selection against one of the haplotypes. We estimated that the rate of paternal leakage is 6% and that at least 100 generations are required for complete sorting of mtDNA haplotypes. Despite the high proportion of heteroplasmic individuals in natural populations, we found no evidence for recombination between mtDNA molecules, suggesting that either recombination is rare or recombinant haplotypes are counter-selected. Our results indicate that evolutionary studies using mtDNA as a marker might be biased by paternal leakage in this species. © 2013 Blackwell Publishing Ltd.

Chloroplast heterogeneity and historical admixture within the genus Malus.

PubMed

Volk, Gayle M; Henk, Adam D; Baldo, Angela; Fazio, Gennaro; Chao, C Thomas; Richards, Christopher M

2015-07-01

• The genus Malus represents a unique and complex evolutionary context in which to study domestication. Several Malus species have provided novel alleles and traits to the cultivars. The extent of admixture among wild Malus species has not been well described, due in part to limited sampling of individuals within a taxon.• Four chloroplast regions (1681 bp total) were sequenced and aligned for 412 Malus individuals from 30 species. Phylogenetic relationships were reconstructed using maximum parsimony. The distribution of chloroplast haplotypes among species was examined using statistical parsimony, phylogenetic trees, and a median-joining network.• Chloroplast haplotypes are shared among species within Malus. Three major haplotype-sharing networks were identified. One includes species native to China, Western North America, as well as Malus domestica Borkh, and its four primary progenitor species: M. sieversii (Ledeb.) M. Roem., M. orientalis Uglitzk., M. sylvestris (L.) Mill., and M. prunifolia (Willd.) Borkh; another includes five Chinese Malus species, and a third includes the three Malus species native to Eastern North America.• Chloroplast haplotypes found in M. domestica belong to a single, highly admixed network. Haplotypes shared between the domesticated apple and its progenitors may reflect historical introgression or the retention of ancestral polymorphisms. Multiple individuals should be sampled within Malus species to reveal haplotype heterogeneity, if complex maternal contributions to named species are to be recognized. © 2015 Botanical Society of America, Inc.

Autosomal Dominant Retinal Dystrophies Caused by a Founder Splice Site Mutation, c.828+3A>T, in PRPH2 and Protein Haplotypes in trans as Modifiers

PubMed Central

Shankar, Suma P.; Hughbanks-Wheaton, Dianna K.; Birch, David G.; Sullivan, Lori S.; Conneely, Karen N.; Bowne, Sara J.; Stone, Edwin M.; Daiger, Stephen P.

2016-01-01

Purpose We determined the phenotypic variation, disease progression, and potential modifiers of autosomal dominant retinal dystrophies caused by a splice site founder mutation, c.828+3A>T, in the PRPH2 gene. Methods A total of 62 individuals (19 families) harboring the PRPH2 c.828+3A>T mutation, had phenotype analysis by fundus appearance, electrophysiology, and visual fields. The PRPH2 haplotypes in trans were sequenced for potential modifying variants and generalized estimating equations (GEE) used for statistical analysis. Results Several distinct phenotypes caused by the PRPH2 c.828+3A>T mutation were observed and fell into two clinical categories: Group I (N = 44) with mild pattern dystrophies (PD) and Group II (N = 18) with more severe cone-rod dystrophy (CRD), retinitis pigmentosa (RP), and central areolar chorioretinal dystrophy (CACD). The PRPH2 Gln304-Lys310-Asp338 protein haplotype in trans was found in Group I only (29.6% vs. 0%), whereas the Glu304-Lys310-Gly338 haplotype was predominant in Group II (94.4% vs. 70.4%). Generalized estimating equations analysis for PD versus the CRD/CACD/RP phenotypes in individuals over 43 years alone with the PRPH2 haplotypes in trans and age as predictors, adjusted for correlation within families, confirmed a significant effect of haplotype on severity (P = 0.03) with an estimated odds ratio of 7.16 (95% confidence interval [CI] = [2.8, 18.4]). Conclusions The PRPH2 c.828+3A>T mutation results in multiple distinct phenotypes likely modified by protein haplotypes in trans; the odds of having the CACD/RP-like phenotype (versus the PD phenotype) are 7.16 times greater with a Glu304-Lys310-Gly338 haplotype in trans. Further functional studies of the modifying haplotypes in trans and PRPH2 splice variants may offer therapeutic targets. PMID:26842753

Congruence as a measurement of extended haplotype structure across the genome

PubMed Central

2012-01-01

Background Historically, extended haplotypes have been defined using only a few data points, such as alleles for several HLA genes in the MHC. High-density SNP data, and the increasing affordability of whole genome SNP typing, creates the opportunity to define higher resolution extended haplotypes. This drives the need for new tools that support quantification and visualization of extended haplotypes as defined by as many as 2000 SNPs. Confronted with high-density SNP data across the major histocompatibility complex (MHC) for 2,300 complete families, compiled by the Type 1 Diabetes Genetics Consortium (T1DGC), we developed software for studying extended haplotypes. Methods The software, called ExHap (Extended Haplotype), uses a similarity measurement we term congruence to identify and quantify long-range allele identity. Using ExHap, we analyzed congruence in both the T1DGC data and family-phased data from the International HapMap Project. Results Congruent chromosomes from the T1DGC data have between 96.5% and 99.9% allele identity over 1,818 SNPs spanning 2.64 megabases of the MHC (HLA-DRB1 to HLA-A). Thirty-three of 132 DQ-DR-B-A defined haplotype groups have > 50% congruent chromosomes in this region. For example, 92% of chromosomes within the DR3-B8-A1 haplotype are congruent from HLA-DRB1 to HLA-A (99.8% allele identity). We also applied ExHap to all 22 autosomes for both CEU and YRI cohorts from the International HapMap Project, identifying multiple candidate extended haplotypes. Conclusions Long-range congruence is not unique to the MHC region. Patterns of allele identity on phased chromosomes provide a simple, straightforward approach to visually and quantitatively inspect complex long-range structural patterns in the genome. Such patterns aid the biologist in appreciating genetic similarities and differences across cohorts, and can lead to hypothesis generation for subsequent studies. PMID:22369243

RENT+: an improved method for inferring local genealogical trees from haplotypes with recombination.

PubMed

Mirzaei, Sajad; Wu, Yufeng

2017-04-01

: Haplotypes from one or multiple related populations share a common genealogical history. If this shared genealogy can be inferred from haplotypes, it can be very useful for many population genetics problems. However, with the presence of recombination, the genealogical history of haplotypes is complex and cannot be represented by a single genealogical tree. Therefore, inference of genealogical history with recombination is much more challenging than the case of no recombination. : In this paper, we present a new approach called RENT+  for the inference of local genealogical trees from haplotypes with the presence of recombination. RENT+  builds on a previous genealogy inference approach called RENT , which infers a set of related genealogical trees at different genomic positions. RENT+  represents a significant improvement over RENT in the sense that it is more effective in extracting information contained in the haplotype data about the underlying genealogy than RENT . The key components of RENT+  are several greatly enhanced genealogy inference rules. Through simulation, we show that RENT+  is more efficient and accurate than several existing genealogy inference methods. As an application, we apply RENT+  in the inference of population demographic history from haplotypes, which outperforms several existing methods. : RENT+  is implemented in Java, and is freely available for download from: https://github.com/SajadMirzaei/RentPlus . : sajad@engr.uconn.edu or ywu@engr.uconn.edu. : Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Restricted genetic variation in populations of Achatina (Lissachatina) fulica outside of East Africa and the Indian Ocean Islands points to the Indian Ocean Islands as the earliest known common source.

PubMed

Fontanilla, Ian Kendrich C; Sta Maria, Inna Mikaella P; Garcia, James Rainier M; Ghate, Hemant; Naggs, Fred; Wade, Christopher M

2014-01-01

The Giant African Land Snail, Achatina ( =  Lissachatina) fulica Bowdich, 1822, is a tropical crop pest species with a widespread distribution across East Africa, the Indian subcontinent, Southeast Asia, the Pacific, the Caribbean, and North and South America. Its current distribution is attributed primarily to the introduction of the snail to new areas by Man within the last 200 years. This study determined the extent of genetic diversity in global A. fulica populations using the mitochondrial 16S ribosomal RNA gene. A total of 560 individuals were evaluated from 39 global populations obtained from 26 territories. Results reveal 18 distinct A. fulica haplotypes; 14 are found in East Africa and the Indian Ocean islands, but only two haplotypes from the Indian Ocean islands emerged from this region, the C haplotype, now distributed across the tropics, and the D haplotype in Ecuador and Bolivia. Haplotype E from the Philippines, F from New Caledonia and Barbados, O from India and Q from Ecuador are variants of the emergent C haplotype. For the non-native populations, the lack of genetic variation points to founder effects due to the lack of multiple introductions from the native range. Our current data could only point with certainty to the Indian Ocean islands as the earliest known common source of A. fulica across the globe, which necessitates further sampling in East Africa to determine the source populations of the emergent haplotypes.

Restricted Genetic Variation in Populations of Achatina (Lissachatina) fulica outside of East Africa and the Indian Ocean Islands Points to the Indian Ocean Islands as the Earliest Known Common Source

PubMed Central

Fontanilla, Ian Kendrich C.; Sta. Maria, Inna Mikaella P.; Garcia, James Rainier M.; Ghate, Hemant; Naggs, Fred; Wade, Christopher M.

2014-01-01

The Giant African Land Snail, Achatina ( = Lissachatina) fulica Bowdich, 1822, is a tropical crop pest species with a widespread distribution across East Africa, the Indian subcontinent, Southeast Asia, the Pacific, the Caribbean, and North and South America. Its current distribution is attributed primarily to the introduction of the snail to new areas by Man within the last 200 years. This study determined the extent of genetic diversity in global A. fulica populations using the mitochondrial 16S ribosomal RNA gene. A total of 560 individuals were evaluated from 39 global populations obtained from 26 territories. Results reveal 18 distinct A. fulica haplotypes; 14 are found in East Africa and the Indian Ocean islands, but only two haplotypes from the Indian Ocean islands emerged from this region, the C haplotype, now distributed across the tropics, and the D haplotype in Ecuador and Bolivia. Haplotype E from the Philippines, F from New Caledonia and Barbados, O from India and Q from Ecuador are variants of the emergent C haplotype. For the non-native populations, the lack of genetic variation points to founder effects due to the lack of multiple introductions from the native range. Our current data could only point with certainty to the Indian Ocean islands as the earliest known common source of A. fulica across the globe, which necessitates further sampling in East Africa to determine the source populations of the emergent haplotypes. PMID:25203830

Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora).

PubMed

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

PubMed Central

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

Diet and Colorectal Cancer: Analysis of a Candidate Pathway Using SNPS, Haplotypes, and Multi-Gene Assessment

PubMed Central

Slattery, Martha L.; Lundgreen, Abbie; Herrick, Jennifer S.; Caan, Bette J.; Potter, John D.; Wolff, Roger K.

2012-01-01

There is considerable biologic plausibility to the hypothesis that genetic variability in pathways involved in insulin signaling and energy homeostasis may modulate dietary risk associated with colorectal cancer. We utilized data from 2 population-based case-control studies of colon (n = 1,574 cases, 1,970 controls) and rectal (n = 791 cases, 999 controls) cancer to evaluate genetic variation in candidate SNPs identified from 9 genes in a candidate pathway: PDK1, RP6KA1, RPS6KA2, RPS6KB1, RPS6KB2, PTEN, FRAP1 (mTOR), TSC1, TSC2, Akt1, PIK3CA, and PRKAG2 with dietary intake of total energy, carbohydrates, fat, and fiber. We employed SNP, haplotype, and multiple-gene analysis to evaluate associations. PDK1 interacted with dietary fat for both colon and rectal cancer and with dietary carbohydrates for colon cancer. Statistically significant interaction with dietary carbohydrates and rectal cancer was detected by haplotype analysis of PDK1. Evaluation of dietary interactions with multiple genes in this candidate pathway showed several interactions with pairs of genes: Akt1 and PDK1, PDK1 and PTEN, PDK1 and TSC1, and PRKAG2 and PTEN. Analyses show that genetic variation influences risk of colorectal cancer associated with diet and illustrate the importance of evaluating dietary interactions beyond the level of single SNPs or haplotypes when a biologically relevant candidate pathway is examined. PMID:21999454

Absence of the tag polymorphism for the risk haplotype HLA-DR2 for multiple sclerosis in Wixárika subjects from Mexico.

PubMed

González-Enríquez, G V; Torres-Mendoza, B M; Márquez-Pedroza, J; Macías-Islas, M A; Ortiz, G G; Cruz-Ramos, J A

2018-02-03

The HLA-DRB1*15:01 allele has a demonstrated risk for the development of multiple sclerosis (MS) in most populations around the world. The single nucleotide polymorphism (SNP) rs3129934 is found in linkage disequilibrium with the risk haplotype formed by the HLA-DRB1*15:01 and HLA-DQB1*06:02 alleles, and it is considered a reliable marker of the presence of this haplotype. Native Americans have a null or low prevalence of MS. In this study, we sought to identify the frequency of rs3129934 in the Wixárika ethnic group as well as in Mestizo (mixed race) patients with MS and in controls from western Mexico. Through real-time polymerase chain reaction (PCR) using TaqMan probes, we analyzed the allele and genotype frequencies of rs3129934 in Mestizo individuals with and without MS and in 73 Wixárika subjects from the state of Jalisco, Mexico. The Wixárika subjects were homozygote for the C allele of rs3129934. The allele and genotype frequency in Mestizos with MS was similar to that of other MS populations with Caucasian ancestry. The absence of the T risk allele rs3129934 (associated with the haplotype HLA-DRB1*15:01, HLA-DQ1*06:02) in this sample of Wixárika subjects is consistent with the unreported MS in this Amerindian group, related to absence of such paramount genetic risk factor.

Association of ALOX5AP with ischemic stroke: a population-based case-control study.

PubMed

Kaushal, Ritesh; Pal, Prodipto; Alwell, Kathleen; Haverbusch, Mary; Flaherty, Matthew; Moomaw, Charles; Sekar, Padmini; Kissela, Brett; Kleindorfer, Dawn; Chakraborty, Ranajit; Broderick, Joseph; Deka, Ranjan; Woo, Daniel

2007-06-01

Arachidonate 5-lipoxygenase activating protein (ALOX5AP) has been reported to demonstrate linkage and association with ischemic stroke and myocardial infarction. However, replication studies have been conflicting and to date, a significant proportion of blacks have not been studied. We prospectively recruited cases of ischemic stroke from all 16 hospitals in the Greater Cincinnati/Northern Kentucky region and demographically matched them to stroke-free population-based controls. Single nucleotide polymorphisms (SNPs) were selected based on association with ischemic stroke in prior studies. Allelic, genotypic and haplotypic association testing was performed using HAPLOVIEW. Multiple logistic regression was used to control for the presence of traditional risk factors including hypertension, diabetes, hypercholesterolemia and smoking. A total of 357 cases and 482 controls were genotyped. The SNPs, rs9579646 and rs4769874 were found to be significantly associated at both allelic (P=0.019 and P<10(-4), respectively) and genotypic level with ischemic stroke among whites after correction for multiple testing. Haplotype association was identified with ischemic stroke as well as ischemic stroke subtypes among whites. Although an overall haplotype association with ischemic stroke was identified among blacks no evidence of association among individual haplotypes, alleles or genotypes were observed. Allele frequencies for the SNPs examined were markedly different among whites and blacks. In conclusion, we report significant association of variants of ALOX5AP with ischemic stroke and ischemic stroke subtypes among whites. No significant association was identified among blacks.

Heterogeneity of the Stearoyl-CoA desaturase-1 (SCD1) Gene and Metabolic Risk Factors in the EPIC-Potsdam Study

PubMed Central

Arregui, Maria; Buijsse, Brian; Stefan, Norbert; Corella, Dolores; Fisher, Eva; di Giuseppe, Romina; Coltell, Oscar; Knüppel, Sven; Aleksandrova, Krasimira; Joost, Hans-Georg; Boeing, Heiner; Weikert, Cornelia

2012-01-01

Background Stearoyl-CoA desaturase-1 (SCD1) is an enzyme involved in lipid metabolism. In mice and humans its activity has been associated with traits of the metabolic syndrome, but also with the prevention of saturated fatty acids accumulation and subsequent inflammation, whereas for liver fat content inconsistent results have been reported. Thus, variants of the gene encoding SCD1 (SCD1) could potentially modify metabolic risk factors, but few human studies have addressed this question. Methods In a sample of 2157 middle-aged men and women randomly drawn from the Potsdam cohort of the European Prospective Investigation into Cancer and Nutrition, we investigated the impact of 7 SCD1 tagging-single nucleotide polymorphisms (rs1502593, rs522951, rs11190480, rs3071, rs3793767, rs10883463 and rs508384) and 5 inferred haplotypes with frequency >5% describing 90.9% of the genotype combinations in our population, on triglycerides, body mass index (BMI), waist circumference (WC), glycated haemoglobin (HbA1c), high-sensitivity C-reactive protein (hs-CRP), gamma-glutamyltransferase (GGT), alanine aminotransferase (ALT) and fetuin-A. Results No significant associations between any of the SNPs or haplotypes and BMI, WC, fetuin-A and hs-CRP were observed. Associations of rs10883463 with triglycerides, GGT and HbA1c as well as of rs11190480 with ALT activity, were weak and became non-significant after multiple-testing correction. Also associations of the haplotype harbouring the minor allele of rs1502593 with HbA1c levels, the haplotype harbouring the minor alleles of rs11190480 and rs508384 with activity of ALT, and the haplotype harbouring the minor alleles of rs522951, rs10883463 and rs508384 with triglyceride and HbA1C levels and GGT activities did not withstand multiple-testing correction. Conclusion These findings suggest that there are no associations between common variants of SCD1 or its inferred haplotypes and the investigated metabolic risk factors. However, given the results from animal models, heterogeneity of human SCD1 warrants further investigation, in particular with regard to rare variants. PMID:23139775

Haplotype Analysis in Multiple Crosses to Identify a QTL Gene

PubMed Central

Wang, Xiaosong; Korstanje, Ron; Higgins, David; Paigen, Beverly

2004-01-01

Identifying quantitative trait locus (QTL) genes is a challenging task. Herein, we report using a two-step process to identify Apoa2 as the gene underlying Hdlq5, a QTL for plasma high-density lipoprotein cholesterol (HDL) levels on mouse chromosome 1. First, we performed a sequence analysis of the Apoa2 coding region in 46 genetically diverse mouse strains and found five different APOA2 protein variants, which we named APOA2a to APOA2e. Second, we conducted a haplotype analysis of the strains in 21 crosses that have so far detected HDL QTLs; we found that Hdlq5 was detected only in the nine crosses where one parent had the APOA2b protein variant characterized by an Ala61-to-Val61 substitution. We then found that strains with the APOA2b variant had significantly higher (P ≤ 0.002) plasma HDL levels than those with either the APOA2a or the APOA2c variant. These findings support Apoa2 as the underlying Hdlq5 gene and suggest the Apoa2 polymorphisms responsible for the Hdlq5 phenotype. Therefore, haplotype analysis in multiple crosses can be used to support a candidate QTL gene. PMID:15310659

Haplotype analysis in multiple crosses to identify a QTL gene.

PubMed

Wang, Xiaosong; Korstanje, Ron; Higgins, David; Paigen, Beverly

2004-09-01

Identifying quantitative trait locus (QTL) genes is a challenging task. Herein, we report using a two-step process to identify Apoa2 as the gene underlying Hdlq5, a QTL for plasma high-density lipoprotein cholesterol (HDL) levels on mouse chromosome 1. First, we performed a sequence analysis of the Apoa2 coding region in 46 genetically diverse mouse strains and found five different APOA2 protein variants, which we named APOA2a to APOA2e. Second, we conducted a haplotype analysis of the strains in 21 crosses that have so far detected HDL QTLs; we found that Hdlq5 was detected only in the nine crosses where one parent had the APOA2b protein variant characterized by an Ala61-to-Val61 substitution. We then found that strains with the APOA2b variant had significantly higher (P < or = 0.002) plasma HDL levels than those with either the APOA2a or the APOA2c variant. These findings support Apoa2 as the underlying Hdlq5 gene and suggest the Apoa2 polymorphisms responsible for the Hdlq5 phenotype. Therefore, haplotype analysis in multiple crosses can be used to support a candidate QTL gene.

Analysis of Shared Haplotypes amongst Palauans Maps Loci for Psychotic Disorders to 4q28 and 5q23-q31.

PubMed

Bodea, Corneliu A; Middleton, Frank A; Melhem, Nadine M; Klei, Lambertus; Song, Youeun; Tiobech, Josepha; Marumoto, Pearl; Yano, Victor; Faraone, Stephen V; Roeder, Kathryn; Myles-Worsley, Marina; Devlin, Bernie; Byerley, William

2017-02-01

To localize genetic variation affecting risk for psychotic disorders in the population of Palau, we genotyped DNA samples from 203 Palauan individuals diagnosed with psychotic disorders, broadly defined, and 125 control subjects using a genome-wide single nucleotide polymorphism array. Palau has unique features advantageous for this study: due to its population history, Palauans are substantially interrelated; affected individuals often, but not always, cluster in families; and we have essentially complete ascertainment of affected individuals. To localize risk variants to genomic regions, we evaluated long-shared haplotypes, ≥10 Mb, identifying clusters of affected individuals who share such haplotypes. This extensive sharing, typically identical by descent, was significantly greater in cases than population controls, even after controlling for relatedness. Several regions of the genome exhibited substantial excess of shared haplotypes for affected individuals, including 3p21, 3p12, 4q28, and 5q23-q31. Two of these regions, 4q28 and 5q23-q31, showed significant linkage by traditional LOD score analysis and could harbor variants of more sizeable risk for psychosis or a multiplicity of risk variants. The pattern of haplotype sharing in 4q28 highlights PCDH10 , encoding a cadherin-related neuronal receptor, as possibly involved in risk.

When and how did Bos indicus introgress into Mongolian cattle?

PubMed

Yue, Xiangpeng; Li, Ran; Liu, Li; Zhang, Yunsheng; Huang, Jieping; Chang, Zhenhua; Dang, Ruihua; Lan, Xianyong; Chen, Hong; Lei, Chuzhao

2014-03-10

The Mongolian cattle are one of the most widespread breeds with strictly Bos taurus morphological features in northern China. In our current study, we presented a diversity of mitochondrial DNA (mtDNA) D-loop region and Y chromosome SNP markers in 25 male and 8 female samples of Mongolian cattle from the Xinjiang Uygur autonomous region in Western China, and detected 21 B. taurus and four Bos indicus (zebu) mtDNA haplotypes. Among four B. indicus mtDNA haplotypes, two haplotypes belonged to I1 haplogroup and the remaining two haplotypes belonged to I2 haplogroup. In contrast, all 25 male Mongolian cattle samples revealed B. taurus Y chromosome haplotype and no B. indicus haplotypes were found. Historical and archeological records indicate that B. taurus was introduced to Xinjiang during the second millennium BC and B. indicus appeared in this region by the second century AD. The two types of cattle coexisted for many centuries in Xinjiang, as depicted in clay and wooden figurines unearthed in the Astana cemetery in Turfan (3rd-8th century AD). Multiple lines of evidence suggest that the earliest B. indicus introgression in the Mongolian cattle may have occurred during the 2nd-7th centuries AD through the Silk Road around the Xinjiang region. This conclusion differs from the previous hypothesis that zebu introgression to Mongolian cattle happened during the Mongol Empire era in the 13th century. Copyright © 2014 Elsevier B.V. All rights reserved.

Analysis of MHC class I genes across horse MHC haplotypes

PubMed Central

Tallmadge, Rebecca L.; Campbell, Julie A.; Miller, Donald C.; Antczak, Douglas F.

2010-01-01

The genomic sequences of 15 horse Major Histocompatibility Complex (MHC) class I genes and a collection of MHC class I homozygous horses of five different haplotypes were used to investigate the genomic structure and polymorphism of the equine MHC. A combination of conserved and locus-specific primers was used to amplify horse MHC class I genes with classical and non-classical characteristics. Multiple clones from each haplotype identified three to five classical sequences per homozygous animal, and two to three non-classical sequences. Phylogenetic analysis was applied to these sequences and groups were identified which appear to be allelic series, but some sequences were left ungrouped. Sequences determined from MHC class I heterozygous horses and previously described MHC class I sequences were then added, representing a total of ten horse MHC haplotypes. These results were consistent with those obtained from the MHC homozygous horses alone, and 30 classical sequences were assigned to four previously confirmed loci and three new provisional loci. The non-classical genes had few alleles and the classical genes had higher levels of allelic polymorphism. Alleles for two classical loci with the expected pattern of polymorphism were found in the majority of haplotypes tested, but alleles at two other commonly detected loci had more variation outside of the hypervariable region than within. Our data indicate that the equine Major Histocompatibility Complex is characterized by variation in the complement of class I genes expressed in different haplotypes in addition to the expected allelic polymorphism within loci. PMID:20099063

Temporal genetic changes in Plasmodium vivax apical membrane antigen 1 over 19 years of transmission in southern Mexico.

PubMed

Flores-Alanis, Alejandro; González-Cerón, Lilia; Santillán, Frida; Ximenez, Cecilia; Sandoval, Marco A; Cerritos, René

2017-05-02

Mexico advanced to the pre-elimination phase in 2009 due to a significant reduction in malaria cases, and since 2000, Plasmodium vivax is the only species transmitted. During the last two decades, malaria transmission has been mostly local and isolated to a few regions. It is important to gain further insights into the impact of control measures on the parasite population structure. Hence, the aim of the current study was to determine detailed changes in P. vivax genetic diversity and population structure based on analysing the gene that encodes the apical membrane antigen 1 (pvama1). This analysis covered from control to pre-elimination (1993-2011) in a hypo-endemic region in southern Mexico. The 213 pvama1 I-II sequences presently analysed were grouped into six periods of three years each. They showed low genetic diversity, with 15 haplotypes resolved. Among the DNA sequences, there was a gradual decrease in genetic diversity, the number of mixed genotype infections and the intensity of positive selection, in agreement with the parallel decline in malaria cases. At the same time, linkage disequilibrium (R 2 ) increased. The three-dimensional haplotype network revealed that pvama1 I-II haplotypes were separated by 1-11 mutational steps, and between one another by 0-3 unsampled haplotypes. In the temporal network, seven haplotypes were detected in at least two of the six-time layers, and only four distinct haplotypes were evidenced in the pre-elimination phase. Structure analysis indicated that three subpopulations fluctuated over time. Only 8.5% of the samples had mixed ancestry. In the pre-elimination phase, subpopulation P1 was drastically reduced, and the admixture was absent. The results suggest that P. vivax in southern Mexico evolved based on local adaptation into three "pseudoclonal" subpopulations that diversified at the regional level and persisted over time, although with varying frequency. Control measures and climate events influenced the number of malaria cases and the genetic structure. The sharp decrease in parasite diversity and other related genetic parameters during the pre-elimination phase suggests that malaria elimination is possible in the near future. These results are useful for epidemiological surveillance.

Frequency distribution of interleukin-10 haplotypes (-1082 A>G, -819 C>T, and -592 C>A) in a Mexican population.

PubMed

Vázquez-Villamar, M; Palafox-Sánchez, C A; Hernández-Bello, J; Muñoz-Valle, J F; Valle, Y; Cruz, A; Alatorre-Meza, A I; Oregon-Romero, E

2016-11-03

Interleukin 10 (IL-10) is an immunoregulatory cytokine with multiple roles in the immune system. Three single nucleotide polymorphisms at positions -1082 (A>G), -819 (C>T), and -592 (C>A) in the promoter region of the IL10 gene are believed to be associated with different inflammatory, infectious, and autoimmune diseases. These polymorphisms exhibit a strong linkage disequilibrium (LD) and form three principal haplotypes (GCC, ACC, and ATA). The GCC and ATA haplotypes have been associated with high and low levels of IL-10 production, respectively. The aim of this study was to establish the allele and haplotype frequencies of the IL10 polymorphisms in Mestizos from western Mexico. SNPs were analyzed in 340 healthy unrelated Mestizos from western Mexico by polymerase chain reaction-restriction fragment length polymorphism. The studied population presented significant differences, in the distribution of IL10 polymorphisms, from the Asian, African, and European populations. We also observed a strong LD within -1082 A>G, -819 C>T, and -592 C>A (100% pc = 7.735 x 10 -18 ). The haplotypes ACC (45.4%), ATA (22.0%), GTA (14.9%), and GCC (13.9%) were most frequently observed in this population. The haplotype frequencies, however, differed from those reported previously in Mestizos from central Mexico, Asians, Africans, and European Caucasians, suggesting a differential gene flow in the Mexican Mestizo population. This could account for the genetic variability between Mexicans and populations of other ethnicities. The study of these polymorphisms and their haplotypes could help in expanding our knowledge to design future disease-risk studies on the western Mexican population.

Tracing the route of modern humans out of Africa by using 225 human genome sequences from Ethiopians and Egyptians.

PubMed

Pagani, Luca; Schiffels, Stephan; Gurdasani, Deepti; Danecek, Petr; Scally, Aylwyn; Chen, Yuan; Xue, Yali; Haber, Marc; Ekong, Rosemary; Oljira, Tamiru; Mekonnen, Ephrem; Luiselli, Donata; Bradman, Neil; Bekele, Endashaw; Zalloua, Pierre; Durbin, Richard; Kivisild, Toomas; Tyler-Smith, Chris

2015-06-04

The predominantly African origin of all modern human populations is well established, but the route taken out of Africa is still unclear. Two alternative routes, via Egypt and Sinai or across the Bab el Mandeb strait into Arabia, have traditionally been proposed as feasible gateways in light of geographic, paleoclimatic, archaeological, and genetic evidence. Distinguishing among these alternatives has been difficult. We generated 225 whole-genome sequences (225 at 8× depth, of which 8 were increased to 30×; Illumina HiSeq 2000) from six modern Northeast African populations (100 Egyptians and five Ethiopian populations each represented by 25 individuals). West Eurasian components were masked out, and the remaining African haplotypes were compared with a panel of sub-Saharan African and non-African genomes. We showed that masked Northeast African haplotypes overall were more similar to non-African haplotypes and more frequently present outside Africa than were any sets of haplotypes derived from a West African population. Furthermore, the masked Egyptian haplotypes showed these properties more markedly than the masked Ethiopian haplotypes, pointing to Egypt as the more likely gateway in the exodus to the rest of the world. Using five Ethiopian and three Egyptian high-coverage masked genomes and the multiple sequentially Markovian coalescent (MSMC) approach, we estimated the genetic split times of Egyptians and Ethiopians from non-African populations at 55,000 and 65,000 years ago, respectively, whereas that of West Africans was estimated to be 75,000 years ago. Both the haplotype and MSMC analyses thus suggest a predominant northern route out of Africa via Egypt. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Lower frequency of the HLA-G UTR-4 haplotype in women with unexplained recurrent miscarriage.

PubMed

Meuleman, T; Drabbels, J; van Lith, J M M; Dekkers, O M; Rozemuller, E; Cretu-Stancu, M; Claas, F H J; Bloemenkamp, K W M; Eikmans, M

2018-04-01

HLA-G expressed by trophoblasts at the fetal-maternal interface and its soluble form have immunomodulatory effects. HLA-G expression depends on the combination of DNA polymorphisms. We hypothesized that combinations of specific single nucleotide polymorphisms (SNPs) in the 3'untranslated region (3'UTR) of HLA-G play a role in unexplained recurrent miscarriage. In a case control design, 100 cases with at least three unexplained consecutive miscarriages prior to the 20th week of gestation were included. Cases were at time of the third miscarriage younger than 36 years, and they conceived all their pregnancies from the same partner. The control group included 89 women with an uneventful pregnancy. The association of HLA-G 3'UTR SNPs and specific HLA-G haplotype with recurrent miscarriage was studied with logistic regression. Odds ratios (OR) and 95% confidence intervals (95% CI) were reported. Individual SNPs were not significantly associated with recurrent miscarriage after correction for multiple comparisons. However, the presence of the UTR-4 haplotype, which included +3003C, was significantly lower in women with recurrent miscarriage (OR 0.4, 95% CI 0.2-0.8, p = 0.015). In conclusion, this is the first study to perform a comprehensive analysis of HLA-G SNPs and HLA-G haplotypes in a well-defined group of women with recurrent miscarriage and women with uneventful pregnancy. The UTR-4 haplotype was less frequently observed in women with recurrent miscarriage, suggesting an immunoregulatory role of this haplotype for continuation of the pregnancy without complications. Thus, association of HLA-G with recurrent miscarriage is not related to single polymorphisms in the 3'UTR, but is rather dependent on haplotypes. Copyright © 2018 Elsevier B.V. All rights reserved.

In vitro and ex vivo analysis of CHRNA3 and CHRNA5 haplotype expression.

PubMed

Doyle, Glenn A; Wang, Min-Jung; Chou, Andrew D; Oleynick, John U; Arnold, Steven E; Buono, Russell J; Ferraro, Thomas N; Berrettini, Wade H

2011-01-01

Genome-wide association studies implicate variations in CHRNA5 and CHRNA3 as being associated with nicotine addiction (NA). Multiple common haplotypes ("risk", "mixed" and "protective") exist in Europeans; however, high linkage disequilibrium between variations in CHRNA5 and CHRNA3 makes assigning causative allele(s) for NA difficult through genotyping experiments alone. We investigated whether CHRNA5 or CHRNA3 promoter haplotypes, associated previously with NA, might influence allelic expression levels. For in vitro analyses, promoter haplotypes were sub-cloned into a luciferase reporter vector. When assessed in BE(2)-C cells, luciferase expression was equivalent among CHRNA3 haplotypes, but the combination of deletion at rs3841324 and variation at rs503464 decreased CHRNA5 promoter-derived luciferase activity, possibly due to loss of an SP-1 and other site(s). Variation within the CHRNA5 5'UTR at rs55853698 and rs55781567 also altered luciferase expression in BE(2)-C cells. Allelic expression imbalance (AEI) from the "risk" or "protective" haplotypes was assessed in post-mortem brain tissue from individuals heterozygous at coding polymorphisms in CHRNA3 (rs1051730) or CHRNA5 (rs16969968). In most cases, equivalent allelic expression was observed; however, one individual showed CHRNA5 AEI that favored the "protective" allele and that was concordant with heterozygosity at polymorphisms ∼13.5 kb upstream of the CHRNA5 transcription start site. Putative enhancer activity from these distal promoter elements was assessed using heterologous promoter constructs. We observed no differences in promoter activity from the two distal promoter haplotypes examined, but found that the distal promoter region strongly repressed transcription. We conclude that CHRNA5 promoter variants may affect relative risk for NA in some heterozygous individuals.

An unusual haplotype structure on human chromosome 8p23 derived from the inversion polymorphism.

PubMed

Deng, Libin; Zhang, Yuezheng; Kang, Jian; Liu, Tao; Zhao, Hongbin; Gao, Yang; Li, Chaohua; Pan, Hao; Tang, Xiaoli; Wang, Dunmei; Niu, Tianhua; Yang, Huanming; Zeng, Changqing

2008-10-01

Chromosomal inversion is an important type of genomic variations involved in both evolution and disease pathogenesis. Here, we describe the refined genetic structure of a 3.8-Mb inversion polymorphism at chromosome 8p23. Using HapMap data of 1,073 SNPs generated from 209 unrelated samples from CEPH-Utah residents with ancestry from northern and western Europe (CEU); Yoruba in Ibadan, Nigeria (YRI); and Asian (ASN) samples, which were comprised of Han Chinese from Beijing, China (CHB) and Japanese from Tokyo, Japan (JPT)-we successfully deduced the inversion orientations of all their 418 haplotypes. In particular, distinct haplotype subgroups were identified based on principal component analysis (PCA). Such genetic substructures were consistent with clustering patterns based on neighbor-joining tree reconstruction, which revealed a total of four haplotype clades across all samples. Metaphase fluorescence in situ hybridization (FISH) in a subset of 10 HapMap samples verified their inversion orientations predicted by PCA or phylogenetic tree reconstruction. Positioning of the outgroup haplotype within one of YRI clades suggested that Human NCBI Build 36-inverted order is most likely the ancestral orientation. Furthermore, the population differentiation test and the relative extended haplotype homozygosity (REHH) analysis in this region discovered multiple selection signals, also in a population-specific manner. A positive selection signal was detected at XKR6 in the ASN population. These results revealed the correlation of inversion polymorphisms to population-specific genetic structures, and various selection patterns as possible mechanisms for the maintenance of a large chromosomal rearrangement at 8p23 region during evolution. In addition, our study also showed that haplotype-based clustering methods, such as PCA, can be applied in scanning for cryptic inversion polymorphisms at a genome-wide scale.

Sequence-Based Genotyping of Expressed Swine Leukocyte Antigen Class I Alleles by Next-Generation Sequencing Reveal Novel Swine Leukocyte Antigen Class I Haplotypes and Alleles in Belgian, Danish, and Kenyan Fattening Pigs and Göttingen Minipigs.

PubMed

Sørensen, Maria Rathmann; Ilsøe, Mette; Strube, Mikael Lenz; Bishop, Richard; Erbs, Gitte; Hartmann, Sofie Bruun; Jungersen, Gregers

2017-01-01

The need for typing of the swine leukocyte antigen (SLA) is increasing with the expanded use of pigs as models for human diseases and organ-transplantation experiments, their use in infection studies, and for design of veterinary vaccines. Knowledge of SLA sequences is furthermore a prerequisite for the prediction of epitope binding in pigs. The low number of known SLA class I alleles and the limited knowledge of their prevalence in different pig breeds emphasizes the need for efficient SLA typing methods. This study utilizes an SLA class I-typing method based on next-generation sequencing of barcoded PCR amplicons. The amplicons were generated with universal primers and predicted to resolve 68-88% of all known SLA class I alleles dependent on amplicon size. We analyzed the SLA profiles of 72 pigs from four different pig populations; Göttingen minipigs and Belgian, Kenyan, and Danish fattening pigs. We identified 67 alleles, nine previously described haplotypes and 15 novel haplotypes. The highest variation in SLA class I profiles was observed in the Danish pigs and the lowest among the Göttingen minipig population, which also have the highest percentage of homozygote individuals. Highlighting the fact that there are still numerous unknown SLA class I alleles to be discovered, a total of 12 novel SLA class I alleles were identified. Overall, we present new information about known and novel alleles and haplotypes and their prevalence in the tested pig populations.

Variation in oxytocin receptor gene (OXTR) polymorphisms is associated with emotional and behavioral reactions to betrayal.

PubMed

Tabak, Benjamin A; McCullough, Michael E; Carver, Charles S; Pedersen, Eric J; Cuccaro, Michael L

2014-06-01

Variations in the gene that encodes the oxytocin receptor (OXTR) have been associated with many aspects of social cognition as well as several prosocial behaviors. However, potential associations of OXTR variants with reactions to betrayals of trust while cooperating for mutual benefit have not yet been explored. We examined how variations in 10 single-nucleotide polymorphisms on OXTR were associated with behavior and emotional reactions after a betrayal of trust in an iterated Prisoner's Dilemma Game. After correction for multiple testing, one haplotype (C-rs9840864, T-rs2268494) was significantly associated with faster retaliation post-betrayal-an association that appeared to be due to this haplotype's intermediate effect of exacerbating people's anger after they had been betrayed. Furthermore, a second haplotype (A-rs237887, C-rs2268490) was associated with higher levels of post-betrayal satisfaction, and a third haplotype (G-rs237887, C-rs2268490) was associated with lower levels of post-betrayal satisfaction. © The Author (2013). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Resolving a genetic paradox throughout preimplantation genetic diagnosis for autosomal dominant severe congenital neutropenia.

PubMed

Malcov, Mira; Reches, Adi; Ben-Yosef, Dalit; Cohen, Tania; Amit, Ami; Dgany, Orly; Tamary, Hannah; Yaron, Yuval

2010-03-01

Severe congenital neutropenia is an inherited disease characterized by low peripheral blood neutrophils, amenable to bone marrow transplantation. Genetic analysis in the family here described detected a ELA2 splice-site mutation in the affected child and also in his asymptomatic father. The parents requested preimplantation genetic diagnosis (PGD), coupled with HLA matching, to obtain a suitable bone marrow donor for the affected child. A PGD protocol was developed, based on multiplex nested PCR for direct analysis of the ELA2 mutation, flanking polymorphic markers and HLA typing. The amplification efficiency of the mutation was > 90% in single leukocytes from the affected child but only 67% in the father. Analysis of single haploid sperm cells from the father demonstrated three different sperm-cell populations: (1) sperm cells harboring the ELA2 mutation on the 'affected' haplotype, (2) sperm cells without the ELA2 mutation on the 'normal' haplotype, and (3) sperm cells without the ELA2 mutation on the 'affected' haplotype. These data demonstrate that the ELA2 mutation in the father occurred de novo during his embryonic development, resulting in somatic as well as germ-line mosaicism. This conclusion was also taken into consideration when PGD was performed. Copyright (c) 2010 John Wiley & Sons, Ltd.

Genetic differentiation among North Atlantic killer whale populations.

PubMed

Foote, Andrew D; Vilstrup, Julia T; De Stephanis, Renaud; Verborgh, Philippe; Abel Nielsen, Sandra C; Deaville, Robert; Kleivane, Lars; Martín, Vidal; Miller, Patrick J O; Oien, Nils; Pérez-Gil, Monica; Rasmussen, Morten; Reid, Robert J; Robertson, Kelly M; Rogan, Emer; Similä, Tiu; Tejedor, Maria L; Vester, Heike; Víkingsson, Gísli A; Willerslev, Eske; Gilbert, M Thomas P; Piertney, Stuart B

2011-02-01

Population genetic structure of North Atlantic killer whale samples was resolved from differences in allele frequencies of 17 microsatellite loci, mtDNA control region haplotype frequencies and for a subset of samples, using complete mitogenome sequences. Three significantly differentiated populations were identified. Differentiation based on microsatellite allele frequencies was greater between the two allopatric populations than between the two pairs of partially sympatric populations. Spatial clustering of individuals within each of these populations overlaps with the distribution of particular prey resources: herring, mackerel and tuna, which each population has been seen predating. Phylogenetic analyses using complete mitogenomes suggested two populations could have resulted from single founding events and subsequent matrilineal expansion. The third population, which was sampled at lower latitudes and lower density, consisted of maternal lineages from three highly divergent clades. Pairwise population differentiation was greater for estimates based on mtDNA control region haplotype frequencies than for estimates based on microsatellite allele frequencies, and there were no mitogenome haplotypes shared among populations. This suggests low or no female migration and that gene flow was primarily male mediated when populations spatially and temporally overlap. These results demonstrate that genetic differentiation can arise through resource specialization in the absence of physical barriers to gene flow. © 2010 Blackwell Publishing Ltd.

Haplotype analysis of the apolipoprotein A5 gene in obese pediatric patients.

PubMed

Horvatovich, Katalin; Bokor, Szilvia; Baráth, Akos; Maász, Anita; Kisfali, Péter; Járomi, Luca; Polgár, Noémi; Tóth, Dénes; Répásy, Judit; Endreffy, Emoke; Molnár, Dénes; Melegh, Béla

2011-06-01

Apolipoprotein A5 (APOA5) gene variants have been shown to be associated with elevated TG levels; the T-1131C (rs662799) variant has been reported to confer risk for the metabolic syndrome in adult populations. Little is known about the APOA5 variants in pediatric population, no such information is available for pediatric obesity at all. Here we examined four haplotype-tagging polymorphisms (T-1131C, IVS3 + G476A [rs2072560], T1259C [rs2266788] and C56G [rs3135506]) and studied also the frequency of major naturally occurring haplotypes of APOA5 in obese children. The polymorphisms were analyzed in 232 obese children, and in 137 healthy, normal weight controls, using PCR-RFLP methods. In the pediatric patients we could confirm the already known adult subjects based association of -1131C, IVS3 + 476A and 1259C variants with elevated triglyceride concentrations, both in obese patients and in the controls. The prevalence of the APOA5*2 haplotype (containing the minor allele of T-1131C, IVS3 + G476A and T1259C SNPs together) was 15.5% in obese children, and 5.80% in the controls (p<0.001); multiple logistic regression analysis revealed that this haplotype confers susceptibility for development of obesity (OR=2.87; 95% CI: 1.29-6.37; p≤0.01). By contrast, the APOA5*4 haplotype (with -1131C alone) did not show similar associations. Our findings also suggest that the APOA5*5 haplotype (1259C alone) can be protective against obesity (OR=0.25; 95% CI: 0.07-0.80; p<0.05). While previous studies in adults demonstrated, that the APOA5 -1131C minor allele confers risk for adult metabolic syndrome, here we show, that the susceptibility nature of this SNP restricted to the APOA5*2 haplotype in pediatric obese subjects.

The genetic basis of resistance and matching-allele interactions of a host-parasite system: The Daphnia magna-Pasteuria ramosa model

PubMed Central

Fields, Peter D.; Bourgeois, Yann; Du Pasquier, Louis; Ebert, Dieter

2017-01-01

Negative frequency-dependent selection (NFDS) is an evolutionary mechanism suggested to govern host-parasite coevolution and the maintenance of genetic diversity at host resistance loci, such as the vertebrate MHC and R-genes in plants. Matching-allele interactions of hosts and parasites that prevent the emergence of host and parasite genotypes that are universally resistant and infective are a genetic mechanism predicted to underpin NFDS. The underlying genetics of matching-allele interactions are unknown even in host-parasite systems with empirical support for coevolution by NFDS, as is the case for the planktonic crustacean Daphnia magna and the bacterial pathogen Pasteuria ramosa. We fine-map one locus associated with D. magna resistance to P. ramosa and genetically characterize two haplotypes of the Pasteuria resistance (PR-) locus using de novo genome and transcriptome sequencing. Sequence comparison of PR-locus haplotypes finds dramatic structural polymorphisms between PR-locus haplotypes including a large portion of each haplotype being composed of non-homologous sequences resulting in haplotypes differing in size by 66 kb. The high divergence of PR-locus haplotypes suggest a history of multiple, diverse and repeated instances of structural mutation events and restricted recombination. Annotation of the haplotypes reveals striking differences in gene content. In particular, a group of glycosyltransferase genes that is present in the susceptible but absent in the resistant haplotype. Moreover, in natural populations, we find that the PR-locus polymorphism is associated with variation in resistance to different P. ramosa genotypes, pointing to the PR-locus polymorphism as being responsible for the matching-allele interactions that have been previously described for this system. Our results conclusively identify a genetic basis for the matching-allele interaction observed in a coevolving host-parasite system and provide a first insight into its molecular basis. PMID:28222092

The genetic basis of resistance and matching-allele interactions of a host-parasite system: The Daphnia magna-Pasteuria ramosa model.

PubMed

Bento, Gilberto; Routtu, Jarkko; Fields, Peter D; Bourgeois, Yann; Du Pasquier, Louis; Ebert, Dieter

2017-02-01

Negative frequency-dependent selection (NFDS) is an evolutionary mechanism suggested to govern host-parasite coevolution and the maintenance of genetic diversity at host resistance loci, such as the vertebrate MHC and R-genes in plants. Matching-allele interactions of hosts and parasites that prevent the emergence of host and parasite genotypes that are universally resistant and infective are a genetic mechanism predicted to underpin NFDS. The underlying genetics of matching-allele interactions are unknown even in host-parasite systems with empirical support for coevolution by NFDS, as is the case for the planktonic crustacean Daphnia magna and the bacterial pathogen Pasteuria ramosa. We fine-map one locus associated with D. magna resistance to P. ramosa and genetically characterize two haplotypes of the Pasteuria resistance (PR-) locus using de novo genome and transcriptome sequencing. Sequence comparison of PR-locus haplotypes finds dramatic structural polymorphisms between PR-locus haplotypes including a large portion of each haplotype being composed of non-homologous sequences resulting in haplotypes differing in size by 66 kb. The high divergence of PR-locus haplotypes suggest a history of multiple, diverse and repeated instances of structural mutation events and restricted recombination. Annotation of the haplotypes reveals striking differences in gene content. In particular, a group of glycosyltransferase genes that is present in the susceptible but absent in the resistant haplotype. Moreover, in natural populations, we find that the PR-locus polymorphism is associated with variation in resistance to different P. ramosa genotypes, pointing to the PR-locus polymorphism as being responsible for the matching-allele interactions that have been previously described for this system. Our results conclusively identify a genetic basis for the matching-allele interaction observed in a coevolving host-parasite system and provide a first insight into its molecular basis.

Selection Signature Analysis Implicates the PC1/PCSK1 Region for Chicken Abdominal Fat Content

PubMed Central

Wang, Zhipeng; Zhang, Yuandan; Wang, Shouzhi; Wang, Ning; Ma, Li; Leng, Li; Wang, Shengwen; Wang, Qigui; Wang, Yuxiang; Tang, Zhiquan; Li, Ning; Da, Yang; Li, Hui

2012-01-01

We conducted a selection signature analysis using the chicken 60k SNP chip in two chicken lines that had been divergently selected for abdominal fat content (AFC) for 11 generations. The selection signature analysis used multiple signals of selection, including long-range allele frequency differences between the lean and fat lines, long-range heterozygosity changes, linkage disequilibrium, haplotype frequencies, and extended haplotype homozygosity. Multiple signals of selection identified ten signatures on chromosomes 1, 2, 4, 5, 11, 15, 20, 26 and Z. The 0.73 Mb PC1/PCSK1 region of the Z chromosome at 55.43-56.16 Mb was the most heavily selected region. This region had 26 SNP markers and seven genes, Mar-03, SLC12A2, FBN2, ERAP1, CAST, PC1/PCSK1 and ELL2, where PC1/PCSK1 are the chicken/human names for the same gene. The lean and fat lines had two main haplotypes with completely opposite SNP alleles for the 26 SNP markers and were virtually line-specific, and had a recombinant haplotype with nearly equal frequency (0.193 and 0.196) in both lines. Other haplotypes in this region had negligible frequencies. Nine other regions with selection signatures were PAH-IGF1, TRPC4, GJD4-CCNY, NDST4, NOVA1, GALNT9, the ESRP2-GALR1 region with five genes, the SYCP2-CADH4 with six genes, and the TULP1-KIF21B with 14 genes. Genome-wide association analysis showed that nearly all regions with evidence of selection signature had SNP effects with genome-wide significance (P<10–6) on abdominal fat weight and percentage. The results of this study provide specific gene targets for the control of chicken AFC and a potential model of AFC in human obesity. PMID:22792402

Selection signature analysis implicates the PC1/PCSK1 region for chicken abdominal fat content.

PubMed

Zhang, Hui; Hu, Xiaoxiang; Wang, Zhipeng; Zhang, Yuandan; Wang, Shouzhi; Wang, Ning; Ma, Li; Leng, Li; Wang, Shengwen; Wang, Qigui; Wang, Yuxiang; Tang, Zhiquan; Li, Ning; Da, Yang; Li, Hui

2012-01-01

We conducted a selection signature analysis using the chicken 60k SNP chip in two chicken lines that had been divergently selected for abdominal fat content (AFC) for 11 generations. The selection signature analysis used multiple signals of selection, including long-range allele frequency differences between the lean and fat lines, long-range heterozygosity changes, linkage disequilibrium, haplotype frequencies, and extended haplotype homozygosity. Multiple signals of selection identified ten signatures on chromosomes 1, 2, 4, 5, 11, 15, 20, 26 and Z. The 0.73 Mb PC1/PCSK1 region of the Z chromosome at 55.43-56.16 Mb was the most heavily selected region. This region had 26 SNP markers and seven genes, Mar-03, SLC12A2, FBN2, ERAP1, CAST, PC1/PCSK1 and ELL2, where PC1/PCSK1 are the chicken/human names for the same gene. The lean and fat lines had two main haplotypes with completely opposite SNP alleles for the 26 SNP markers and were virtually line-specific, and had a recombinant haplotype with nearly equal frequency (0.193 and 0.196) in both lines. Other haplotypes in this region had negligible frequencies. Nine other regions with selection signatures were PAH-IGF1, TRPC4, GJD4-CCNY, NDST4, NOVA1, GALNT9, the ESRP2-GALR1 region with five genes, the SYCP2-CADH4 with six genes, and the TULP1-KIF21B with 14 genes. Genome-wide association analysis showed that nearly all regions with evidence of selection signature had SNP effects with genome-wide significance (P<10(-6)) on abdominal fat weight and percentage. The results of this study provide specific gene targets for the control of chicken AFC and a potential model of AFC in human obesity.

Association of chemokine receptor gene (CCR2-CCR5) haplotypes with acquisition and control of HIV-1 infection in Zambians

PubMed Central

2011-01-01

Background Polymorphisms in chemokine (C-C motif) receptors 2 and 5 genes (CCR2 and CCR5) have been associated with HIV-1 infection and disease progression. We investigated the impact of CCR2-CCR5 haplotypes on HIV-1 viral load (VL) and heterosexual transmission in an African cohort. Between 1995 and 2006, cohabiting Zambian couples discordant for HIV-1 (index seropositive and HIV-1 exposed seronegative {HESN}) were monitored prospectively to determine the role of host genetic factors in HIV-1 control and heterosexual transmission. Genotyping for eight CCR2 and CCR5 variants resolved nine previously recognized haplotypes. By regression and survival analytic techniques, controlling for non-genetic factors, we estimated the effects of these haplotypic variants on a) index partner VL, b) seroconverter VL, c) HIV-1 transmission by index partners, d) HIV-1 acquisition by HESN partners. Results Among 567 couples, 240 virologically linked transmission events had occurred through 2006. HHF*2 homozygosity was associated with significantly lower VL in seroconverters (mean beta = -0.58, log10 P = 0.027) and the HHD/HHE diplotype was associated with significantly higher VL in the seroconverters (mean beta = 0.54, log10 P = 0.014) adjusted for age and gender in multivariable model. HHD/HHE was associated with more rapid acquisition of infection by the HESNs (HR = 2.0, 95% CI = 1.20-3.43, P = 0.008), after adjustments for index partner VL and the presence of genital ulcer or inflammation in either partner in Cox multivariable models. The HHD/HHE effect was stronger in exposed females (HR = 2.1, 95% CI = 1.14-3.95, P = 0.018). Conclusions Among Zambian discordant couples, HIV-1 coreceptor gene haplotypes and diplotypes appear to modulate HIV-1 VL in seroconverters and alter the rate of HIV-1 acquisition by HESNs. These associations replicate or resemble findings reported in other African and European populations. PMID:21429204

The joint evolutionary histories of Wolbachia and mitochondria in Hypolimnas bolina.

PubMed

Charlat, Sylvain; Duplouy, Anne; Hornett, Emily A; Dyson, Emily A; Davies, Neil; Roderick, George K; Wedell, Nina; Hurst, Gregory D D

2009-03-24

The interaction between the Blue Moon butterfly, Hypolimnas bolina, and Wolbachia has attracted interest because of the high prevalence of male-killing achieved within the species, the ecological consequences of this high prevalence, the intensity of selection on the host to suppress the infection, and the presence of multiple Wolbachia infections inducing different phenotypes. We examined diversity in the co-inherited marker, mtDNA, and the partitioning of this between individuals of different infection status, as a means to investigate the population biology and evolutionary history of the Wolbachia infections. Part of the mitochondrial COI gene was sequenced from 298 individuals of known infection status revealing ten different haplotypes. Despite very strong biological evidence that the sample represents a single species, the ten haplotypes did not fall within a monophyletic clade within the Hypolimnas genus, with one haplotype differing by 5% from the other nine. There were strong associations between infection status and mtDNA haplotype. The presence of wBol1 infection in association with strongly divergent haplotypes prompted closer examination of wBol1 genetic variation. This revealed the existence of two cryptic subtypes, wBol1a and wBol1b. The wBol1a infection, by far the most common, was in strict association with the single divergent mtDNA haplotype. The wBol1b infection was found with two haplotypes that were also observed in uninfected specimens. Finally, the wBol2 infection was associated with a large diversity of mtDNA haplotypes, most often shared with uninfected sympatric butterflies. This data overall supports the hypothesis that high prevalence of male-killing Wolbachia (wBol1) in H. bolina is associated with very high transmission efficiency rather than regular horizontal transmission. It also suggests this infection has undergone a recent selective sweep and was introduced in this species through introgression. In contrast, the sharing of haplotypes between wBol2-infected and uninfected individuals indicates that this strain is not perfectly transmitted and/or shows a significant level of horizontal transmission.

The joint evolutionary histories of Wolbachia and mitochondria in Hypolimnas bolina

PubMed Central

Charlat, Sylvain; Duplouy, Anne; Hornett, Emily A; Dyson, Emily A; Davies, Neil; Roderick, George K; Wedell, Nina; Hurst, Gregory DD

2009-01-01

Background The interaction between the Blue Moon butterfly, Hypolimnas bolina, and Wolbachia has attracted interest because of the high prevalence of male-killing achieved within the species, the ecological consequences of this high prevalence, the intensity of selection on the host to suppress the infection, and the presence of multiple Wolbachia infections inducing different phenotypes. We examined diversity in the co-inherited marker, mtDNA, and the partitioning of this between individuals of different infection status, as a means to investigate the population biology and evolutionary history of the Wolbachia infections. Results Part of the mitochondrial COI gene was sequenced from 298 individuals of known infection status revealing ten different haplotypes. Despite very strong biological evidence that the sample represents a single species, the ten haplotypes did not fall within a monophyletic clade within the Hypolimnas genus, with one haplotype differing by 5% from the other nine. There were strong associations between infection status and mtDNA haplotype. The presence of wBol1 infection in association with strongly divergent haplotypes prompted closer examination of wBol1 genetic variation. This revealed the existence of two cryptic subtypes, wBol1a and wBol1b. The wBol1a infection, by far the most common, was in strict association with the single divergent mtDNA haplotype. The wBol1b infection was found with two haplotypes that were also observed in uninfected specimens. Finally, the wBol2 infection was associated with a large diversity of mtDNA haplotypes, most often shared with uninfected sympatric butterflies. Conclusion This data overall supports the hypothesis that high prevalence of male-killing Wolbachia (wBol1) in H. bolina is associated with very high transmission efficiency rather than regular horizontal transmission. It also suggests this infection has undergone a recent selective sweep and was introduced in this species through introgression. In contrast, the sharing of haplotypes between wBol2-infected and uninfected individuals indicates that this strain is not perfectly transmitted and/or shows a significant level of horizontal transmission. PMID:19317891

Vitamin D receptor gene Alw I, Fok I, Apa I, and Taq I polymorphisms in patients with urinary stone.

PubMed

Seo, Ill Young; Kang, In-Hong; Chae, Soo-Cheon; Park, Seung Chol; Lee, Young-Jin; Yang, Yun Sik; Ryu, Soo Bang; Rim, Joung Sik

2010-04-01

To evaluate vitamin D receptor (VDR) gene polymorphisms in Korean patients so as to identify the candidate genes associated with urinary stones. Urinary stones are a multifactorial disease that includes various genetic factors. A normal control group of 535 healthy subjects and 278 patients with urinary stones was evaluated. Of 125 patients who presented stone samples, 102 had calcium stones on chemical analysis. The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms were evaluated using the polymerase chain reaction-restriction fragment length polymorphism analysis. Allelic and genotypic frequencies were calculated to identify associations in both groups. The haplotype frequencies of the VDR gene polymorphisms for multiple loci were also determined. For the VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms, there was no statistically significant difference between the patients with urinary stones and the healthy controls. There was also no statistically significant difference between the patients with calcium stones and the healthy controls. A novel haplotype (Ht 4; CTTT) was identified in 13.5% of the patients with urinary stones and in 8.3% of the controls (P = .001). The haplotype frequencies were significantly different between the patients with calcium stones and the controls (P = .004). The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms does not seem to be candidate genetic markers for urinary stones in Korean patients. However, 1 novel haplotype of the VDR gene polymorphisms for multiple loci might be a candidate genetic marker. Copyright 2010 Elsevier Inc. All rights reserved.

GWAS-identified schizophrenia risk SNPs at TSPAN18 are highly diverged between Europeans and East Asians.

PubMed

Liu, Jiewei; Li, Ming; Su, Bing

2016-12-01

Genome-wide association studies (GWASs) have identified multiple schizophrenia (SCZ) risk variants for samples of European and East Asian descent, but most of the identified susceptibility variants are population-specific to either Europeans or East Asians. This strong genetic heterogeneity suggests that differential population histories may play a role in SCZ susceptibility. Here, we explored this possibility by examining the allele frequency divergence of 136 previously reported genome-wide SCZ risk SNPs between European and East Asian populations. Our results showed that two SNPs (rs11038167 and rs11038172) at TSPAN18, reported as genome-wide significant SCZ risk variants in Han Chinese, were entirely monomorphic in Europeans, indicating a deep between-population divergence at this gene locus. To explore the evolutionary history of TSPAN18 in East Asians, we conducted population genetic analyses including multiple neutrality tests, the haplotype-based iHS and EHH tests, as well as haplotype bifurcation map and network constructions. We found that the protective allele of rs11038172 (G allele) had a long extended haplotype with much slower decay compared to the A allele. The star-like shape of the G-allele-carrying haplotypes indicates a recent enrichment in East Asians. Together, the evidences suggest that the protective allele of rs11038172 has experienced recent Darwinian positive selection in East Asians. These findings provide new insights that may help explain the strong genetic heterogeneity in SCZ risk and previous inconsistent association results for SCZ among both Europeans and East Asians. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

HLA-DRB1*15:01-DQA1*01:02-DQB1*06:02 Haplotype Protects Autoantibody-Positive Relatives From Type 1 Diabetes Throughout the Stages of Disease Progression

PubMed Central

Boulware, David; Yu, Liping; Babu, Sunanda; Steck, Andrea K.; Becker, Dorothy; Rodriguez, Henry; DiMeglio, Linda; Evans-Molina, Carmella; Harrison, Leonard C.; Schatz, Desmond; Palmer, Jerry P.; Greenbaum, Carla; Eisenbarth, George S.; Sosenko, Jay M.

2016-01-01

The HLA-DRB1*15:01-DQA1*01:02-DQB1*06:02 haplotype is linked to protection from the development of type 1 diabetes (T1D). However, it is not known at which stages in the natural history of T1D development this haplotype affords protection. We examined a cohort of 3,358 autoantibody-positive relatives of T1D patients in the Pathway to Prevention (PTP) Study of the Type 1 Diabetes TrialNet. The PTP study examines risk factors for T1D and disease progression in relatives. HLA typing revealed that 155 relatives carried this protective haplotype. A comparison with 60 autoantibody-negative relatives suggested protection from autoantibody development. Moreover, the relatives with DRB1*15:01-DQA1*01:02-DQB1*06:02 less frequently expressed autoantibodies associated with higher T1D risk, were less likely to have multiple autoantibodies at baseline, and rarely converted from single to multiple autoantibody positivity on follow-up. These relatives also had lower frequencies of metabolic abnormalities at baseline and exhibited no overall metabolic worsening on follow-up. Ultimately, they had a very low 5-year cumulative incidence of T1D. In conclusion, the protective influence of DRB1*15:01-DQA1*01:02-DQB1*06:02 spans from autoantibody development through all stages of progression, and relatives with this allele only rarely develop T1D. PMID:26822082

Multiple Origins of a Mitochondrial Mutation Conferring Deafness

PubMed Central

Hutchin, T. P.; Cortopassi, G. A.

1997-01-01

A point mutation (1555G) in the smaller ribosomal subunit of the mitochondrial DNA (mtDNA) has been associated with maternally inherited traits of hypersensitivity to streptomycin and sensorineural deafness in a number of families from China, Japan, Israel, and Africa. To determine whether this distribution was the result of a single or multiple mutational events, we carried out genetic distance analysis and phylogenetic analysis of 10 independent mtDNA D-loop sequences from Africa and Asia. The mtDNA sequence diversity was high (2.21%). Phylogenetic analysis assigned 1555G-bearing haplotypes at very divergent points in the human mtDNA evolutionary tree, and the 1555G mutations occur in many cases on race-specific mtDNA haplotypes, both facts are inconsistent with a recent introgression of the mutation into these races. The simplest interpretation of the available data is that there have been multiple origins of the 1555G mutation. The genetic distance among mtDNAs bearing the pathogenic 1555G mutation is much larger than among mtDNAs bearing either evolutionarily neutral or weakly deleterious nucleotide substitutions (such as the 4336G mutation). These results are consistent with the view that pathogenic mtDNA haplotypes such as 1555G arise on disparate mtDNA lineages which because of negative natural selection leave relatively few related descendants. The co-existence of the same mutation with deafness in individuals with very different nuclear and mitochondrial genetic backgrounds confirms the pathogenicity of the 1555G mutation. PMID:9055086

High density genotyping of STAT4 gene reveals multiple haplotypic associations with Systemic Lupus Erythematosus in different racial groups

PubMed Central

Namjou, Bahram; Sestak, Andrea L.; Armstrong, Don L.; Zidovetzki, Raphael; Kelly, Jennifer A.; Jacob, Noam; Ciobanu, Voicu; Kaufman, Kenneth M.; Ojwang, Joshua O.; Ziegler, Julie; Quismorio, Francesco; Reiff, Andreas; Myones, Barry L.; Guthridge, Joel M.; Nath, Swapan K.; Bruner, Gail R.; Mehrian-Shai, Ruth; Silverman, Earl; Klein-Gitelman, Marisa; McCurdy, Deborah; Wagner-Weiner, Linda; Nocton, James J.; Putterman, Chaim; Bae, Sang-Cheol; Kim, Yun Jung; Petri, Michelle; Reveille, John D.; Vyse, Timothy J.; Gilkeson, Gary S.; Kamen, Diane L.; Alarcón-Riquelme, Marta E.; Gaffney, Patrick M.; Moser, Kathy L; Merrill, Joan T.; Scofield, R. Hal; James, Judith A.; Langefeld, Carl D.; Harley, John B.; Jacob, Chaim O.

2009-01-01

Objective Systemic lupus erythematosus (SLE) is the prototypic systemic autoimmune disorder with complex etiology and a strong genetic component. Recently, gene products involved in the interferon pathway have been under intense investigation in SLE pathogenesis. STAT1 and STAT4 are transcription factors that play key roles in the interferon and Th1 signaling pathways, making them attractive candidates for SLE susceptibility. Methods Fifty-six single-nucleotide polymorphisms (SNPs) across STAT1 and STAT4 genes on chromosome 2 were genotyped using Illumina platform as a part of extensive association study in a large collection of 9923 lupus cases and controls from different racial groups. DNA from patients and controls was obtained from peripheral blood. Principal component analyses and population based case-control association analyses were performed and the p values, FDR q values and Odds ratios with 95% confidence intervals (95% CIs) were calculated. Results We observed strong genetic associations with SLE and multiple SNPs located within the STAT4 gene in different ethnicities (Fisher combined p= 7.02×10−25). In addition to strong confirmation of the association in the 3rd intronic region of this gene reported previously, we identified additional haplotypic association across STAT4 gene and in particular a common risk haplotype that is found in multiple racial groups. In contrast, only a relatively weak suggestive association was observed with STAT1, probably due to the proximity to STAT4. Conclusion Our findings indicate that the STAT4 gene is likely to be a crucial component in SLE pathogenesis among multiple racial groups. The functional effects of this association, when revealed, might improve our understanding of the disease and provide new therapeutic targets. PMID:19333953

Effects of apolipoprotein A5 haplotypes on the ratio of triglyceride to high-density lipoprotein cholesterol and the risk for metabolic syndrome in Koreans.

PubMed

Cha, Seongwon; Yu, Hyunjoo; Park, Ah Yeon; Song, Kwang Hoon

2014-03-12

Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C-G-A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS.

Effects of apolipoprotein A5 haplotypes on the ratio of triglyceride to high-density lipoprotein cholesterol and the risk for metabolic syndrome in Koreans

PubMed Central

2014-01-01

Background Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. Methods The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). Results The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C–G–A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. Conclusions We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS. PMID:24618354

De novo intrachromosomal gene conversion from OPN1MW to OPN1LW in the male germline results in Blue Cone Monochromacy

PubMed Central

Buena-Atienza, Elena; Rüther, Klaus; Baumann, Britta; Bergholz, Richard; Birch, David; De Baere, Elfride; Dollfus, Helene; Greally, Marie T.; Gustavsson, Peter; Hamel, Christian P.; Heckenlively, John R.; Leroy, Bart P.; Plomp, Astrid S.; Pott, Jan Willem R.; Rose, Katherine; Rosenberg, Thomas; Stark, Zornitza; Verheij, Joke B. G. M.; Weleber, Richard; Zobor, Ditta; Weisschuh, Nicole; Kohl, Susanne; Wissinger, Bernd

2016-01-01

X-linked cone dysfunction disorders such as Blue Cone Monochromacy and X-linked Cone Dystrophy are characterized by complete loss (of) or reduced L- and M- cone function due to defects in the OPN1LW/OPN1MW gene cluster. Here we investigated 24 affected males from 16 families with either a structurally intact gene cluster or at least one intact single (hybrid) gene but harbouring rare combinations of common SNPs in exon 3 in single or multiple OPN1LW and OPN1MW gene copies. We assessed twelve different OPN1LW/MW exon 3 haplotypes by semi-quantitative minigene splicing assay. Nine haplotypes resulted in aberrant splicing of ≥20% of transcripts including the known pathogenic haplotypes (i.e. ‘LIAVA’, ‘LVAVA’) with absent or minute amounts of correctly spliced transcripts, respectively. De novo formation of the ‘LIAVA’ haplotype derived from an ancestral less deleterious ‘LIAVS’ haplotype was observed in one family with strikingly different phenotypes among affected family members. We could establish intrachromosomal gene conversion in the male germline as underlying mechanism. Gene conversion in the OPN1LW/OPN1MW genes has been postulated, however, we are first to demonstrate a de novo gene conversion within the lineage of a pedigree. PMID:27339364

Large variation in mitochondrial DNA of sexual and parthenogenetic Dahlica triquetrella (Lepidoptera: Psychidae) shows multiple origins of parthenogenesis

PubMed Central

2013-01-01

Background Obligate parthenogenesis is relatively rare in animals. Still, in some groups it is quite common and has evolved and persisted multiple times. These groups may provide important clues to help solve the ‘paradox of sex’. Several species in the Psychidae (Lepidoptera) have obligate parthenogenesis. Dahlica triquetrella is one of those species where multiple transitions to parthenogenesis are postulated based on intensive cytological and behavioural studies. This has led to the hypothesis that multiple transitions from sexuals to diploid parthenogens occurred during and after the last glacial period, followed by transitions from parthenogenetic diploids to parthenogenetic tetraploids. Our study is the first to test these hypotheses using a molecular phylogeny based on mtDNA from multiple sexual and parthenogenetic populations from a wide geographic range. Results Parthenogenetic (and sexual) D. triquetrella are not monophyletic, and considerable sequence variation is present suggesting multiple transitions to parthenogenesis. However, we could not establish ancestral sexual haplotypes from our dataset. Our data suggest that some parthenogenetic clades have evolved, indicating origins of parthenogenesis before the last glacial period. Conclusions Multiple transitions to parthenogenesis have taken place in Dahlica triquetrella, confirming previous hypotheses. The number of different parthenogenetic clades, haplotypes and their apparent evolutionary age, clearly show that parthenogenesis has been a very successful reproductive strategy in this species over a long period. PMID:23622052

Large variation in mitochondrial DNA of sexual and parthenogenetic Dahlica triquetrella (Lepidoptera: Psychidae) shows multiple origins of parthenogenesis.

PubMed

Elzinga, Jelmer A; Jokela, Jukka; Shama, Lisa N S

2013-04-26

Obligate parthenogenesis is relatively rare in animals. Still, in some groups it is quite common and has evolved and persisted multiple times. These groups may provide important clues to help solve the 'paradox of sex'. Several species in the Psychidae (Lepidoptera) have obligate parthenogenesis. Dahlica triquetrella is one of those species where multiple transitions to parthenogenesis are postulated based on intensive cytological and behavioural studies. This has led to the hypothesis that multiple transitions from sexuals to diploid parthenogens occurred during and after the last glacial period, followed by transitions from parthenogenetic diploids to parthenogenetic tetraploids. Our study is the first to test these hypotheses using a molecular phylogeny based on mtDNA from multiple sexual and parthenogenetic populations from a wide geographic range. Parthenogenetic (and sexual) D. triquetrella are not monophyletic, and considerable sequence variation is present suggesting multiple transitions to parthenogenesis. However, we could not establish ancestral sexual haplotypes from our dataset. Our data suggest that some parthenogenetic clades have evolved, indicating origins of parthenogenesis before the last glacial period. Multiple transitions to parthenogenesis have taken place in Dahlica triquetrella, confirming previous hypotheses. The number of different parthenogenetic clades, haplotypes and their apparent evolutionary age, clearly show that parthenogenesis has been a very successful reproductive strategy in this species over a long period.

Genomic Analyses Reveal the Influence of Geographic Origin, Migration, and Hybridization on Modern Dog Breed Development.

PubMed

Parker, Heidi G; Dreger, Dayna L; Rimbault, Maud; Davis, Brian W; Mullen, Alexandra B; Carpintero-Ramirez, Gretchen; Ostrander, Elaine A

2017-04-25

There are nearly 400 modern domestic dog breeds with a unique histories and genetic profiles. To track the genetic signatures of breed development, we have assembled the most diverse dataset of dog breeds, reflecting their extensive phenotypic variation and heritage. Combining genetic distance, migration, and genome-wide haplotype sharing analyses, we uncover geographic patterns of development and independent origins of common traits. Our analyses reveal the hybrid history of breeds and elucidate the effects of immigration, revealing for the first time a suggestion of New World dog within some modern breeds. Finally, we used cladistics and haplotype sharing to show that some common traits have arisen more than once in the history of the dog. These analyses characterize the complexities of breed development, resolving longstanding questions regarding individual breed origination, the effect of migration on geographically distinct breeds, and, by inference, transfer of trait and disease alleles among dog breeds. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Brief Note :Variability in the cathelicidin 6 (CATHL-6) gene in Tianzhu white yak from Tibetan area in China.

PubMed

E, G X; Na, R S; Zhao, Y J; Chen, L P; Qiu, X Y; Huang, Y F

2015-04-10

Cathelicidins are a major family of antimicrobial peptides (AMPs), an important component of innate immune system, playing a critical role in host defense and disease resistance in virtually all living species. Polymorphism and functional studies on cathelicidin of Tianzhu white yak contribute to understanding the specific innate immune mechanism in animals living at high altitudes in comparison to cattle and domesticated white yak. Thirty-six individuals of Tianzhu white yak, originating from the area of three ecotypes (Gansu in China), were investigated. The total length of the aligned Yak cathelicidin 6 (CATHL-6) sequences was 1923 bp, including six single nucleotide polymorphisms and one indel. Ten haplotypes were identified, and phylogenetic analyses resolved those 10 haplotypes in two clusters. The results indicate that the white yak originated from two domestication sites. In addition, lack of significant pairwise difference between sequences (Tajima's D = 0.92865, P > 0.10) in the CATHL-6 region indicates absence of population size expansion in current white yak population.

Genetic characterization of Hawaiian isolates of Plasmodium relictum reveals mixed-genotype infections

USGS Publications Warehouse

Jarvi, S.I.; Farias, M.E.M.; Atkinson, C.T.

2008-01-01

Background: The relatively recent introduction of a highly efficient mosquito vector and an avian pathogen (Plasmodium relictum) to an isolated island ecosystem with nai??ve, highly susceptible avian hosts provides a unique opportunity to investigate evolution of virulence in a natural system. Mixed infections can significantly contribute to the uncertainty in host-pathogen dynamics with direct impacts on virulence. Toward further understanding of how host-parasite and parasite-parasite relationships may impact virulence, this study characterizes within-host diversity of malaria parasite populations based on genetic analysis of the trap (thrombospondin-related anonymous protein) gene in isolates originating from Hawaii, Maui and Kauai Islands. Methods: A total of 397 clones were produced by nested PCR amplification and cloning of a 1664 bp fragment of the trap gene from two malarial isolates, K1 (Kauai) and KV115 (Hawaii) that have been used for experimental studies, and from additional isolates from wild birds on Kauai, Maui and Hawaii Islands. Diversity of clones was evaluated initially by RFLP-based screening, followed by complete sequencing of 33 selected clones. Results: RFLP analysis of trap revealed a minimum of 28 distinct RFLP haplotypes among the 397 clones from 18 birds. Multiple trap haplotypes were detected in every bird evaluated, with an average of 5.9 haplotypes per bird. Overall diversity did not differ between the experimental isolates, however, a greater number of unique haplotypes were detected in K1 than in KV115. We detected high levels of clonal diversity with clear delineation between isolates K1 and KV115 in a haplotype network. The patterns of within-host haplotype clustering are consistent with the possibility of a clonal genetic structure and rapid within-host mutation after infection. Conclusion: Avian malaria (P. relictum) and Avipoxvirus are the significant infectious diseases currently affecting the native Hawaiian avifauna. This study shows that clonal diversity of Hawaiian isolates of P. relictum is much higher than previously recognized. Mixed infections can significantly contribute to the uncertainty in host-pathogen dynamics with direct implications for host demographics, disease management strategies, and evolution of virulence. The results of this study indicate a widespread presence of multiple-genotype malaria infections with high clonal diversity in native birds of Hawaii, which when coupled with concurrent infection with Avipoxvirus, may significantly influence evolution of virulence. ?? 2008 Jarvi et al; licensee BioMed Central Ltd.

The α‐synuclein gene in multiple system atrophy

PubMed Central

Ozawa, T; Healy, D G; Abou‐Sleiman, P M; Ahmadi, K R; Quinn, N; Lees, A J; Shaw, K; Wullner, U; Berciano, J; Moller, J C; Kamm, C; Burk, K; Josephs, K A; Barone, P; Tolosa, E; Goldstein, D B; Wenning, G; Geser, F; Holton, J L; Gasser, T; Revesz, T; Wood, N W

2006-01-01

Background The formation of α‐synuclein aggregates may be a critical event in the pathogenesis of multiple system atrophy (MSA). However, the role of this gene in the aetiology of MSA is unknown and untested. Method The linkage disequilibrium (LD) structure of the α‐synuclein gene was established and LD patterns were used to identify a set of tagging single nucleotide polymorphisms (SNPs) that represent 95% of the haplotype diversity across the entire gene. The effect of polymorphisms on the pathological expression of MSA in pathologically confirmed cases was also evaluated. Results and conclusion In 253 Gilman probable or definite MSA patients, 457 possible, probable, and definite MSA cases and 1472 controls, a frequency difference for the individual tagging SNPs or tag‐defined haplotypes was not detected. No effect was observed of polymorphisms on the pathological expression of MSA in pathologically confirmed cases. PMID:16543523

Genome-wide association study for Crohn's disease in the Quebec Founder Population identifies multiple validated disease loci.

PubMed

Raelson, John V; Little, Randall D; Ruether, Andreas; Fournier, Hélène; Paquin, Bruno; Van Eerdewegh, Paul; Bradley, W E C; Croteau, Pascal; Nguyen-Huu, Quynh; Segal, Jonathan; Debrus, Sophie; Allard, René; Rosenstiel, Philip; Franke, Andre; Jacobs, Gunnar; Nikolaus, Susanna; Vidal, Jean-Michel; Szego, Peter; Laplante, Nathalie; Clark, Hilary F; Paulussen, René J; Hooper, John W; Keith, Tim P; Belouchi, Abdelmajid; Schreiber, Stefan

2007-09-11

Genome-wide association (GWA) studies offer a powerful unbiased method for the identification of multiple susceptibility genes for complex diseases. Here we report the results of a GWA study for Crohn's disease (CD) using family trios from the Quebec Founder Population (QFP). Haplotype-based association analyses identified multiple regions associated with the disease that met the criteria for genome-wide significance, with many containing a gene whose function appears relevant to CD. A proportion of these were replicated in two independent German Caucasian samples, including the established CD loci NOD2 and IBD5. The recently described IL23R locus was also identified and replicated. For this region, multiple individuals with all major haplotypes in the QFP were sequenced and extensive fine mapping performed to identify risk and protective alleles. Several additional loci, including a region on 3p21 containing several plausible candidate genes, a region near JAKMIP1 on 4p16.1, and two larger regions on chromosome 17 were replicated. Together with previously published loci, the spectrum of CD genes identified to date involves biochemical networks that affect epithelial defense mechanisms, innate and adaptive immune response, and the repair or remodeling of tissue.

Isolation and characterization of multiple F-box genes linked to the S9- and S10-RNase in apple (Malus × domestica Borkh.).

PubMed

Okada, Kazuma; Moriya, Shigeki; Haji, Takashi; Abe, Kazuyuki

2013-06-01

Using 11 consensus primer pairs designed from S-linked F-box genes of apple and Japanese pear, 10 new F-box genes (MdFBX21 to 30) were isolated from the apple cultivar 'Spartan' (S(9)S(10)). MdFBX21 to 23 and MdFBX24 to 30 were completely linked to the S(9) -RNase and S(10-)RNase, respectively, and showed pollen-specific expression and S-haplotype-specific polymorphisms. Therefore, these 10 F-box genes are good candidates for the pollen determinant of self-incompatibility in apple. Phylogenetic analysis and comparison of deduced amino acid sequences of MdFBX21 to 30 with those of 25 S-linked F-box genes previously isolated from apple showed that a deduced amino acid identity of greater than 88.0 % can be used as the tentative criterion to classify F-box genes into one type. Using this criterion, 31 of 35 F-box genes of apple were classified into 11 types (SFBB1-11). All types included F-box genes derived from S(3-) and S(9-)haplotypes, and seven types included F-box genes derived from S(3-), S(9-), and S(10-)haplotypes. Moreover, comparison of nucleotide sequences of S-RNases and multiple F-box genes among S(3-), S(9-), and S(10-)haplotypes suggested that F-box genes within each type showed high nucleotide identity regardless of the identity of the S-RNase. The large number of F-box genes as candidates for the pollen determinant and the high degree of conservation within each type are consistent with the collaborative non-self-recognition model reported for Petunia. These findings support that the collaborative non-self-recognition system also exists in apple.

An Association Between Functional Polymorphisms of the Interleukin 1 Gene Complex and Schizophrenia Using Transmission Disequilibrium Test.

PubMed

Kapelski, Pawel; Skibinska, Maria; Maciukiewicz, Malgorzata; Pawlak, Joanna; Dmitrzak-Weglarz, Monika; Szczepankiewicz, Aleksandra; Zaremba, Dorota; Twarowska-Hauser, Joanna

2016-12-01

IL1 gene complex has been implicated in the etiology of schizophrenia. To assess whether IL1 gene complex is associated with susceptibility to schizophrenia in Polish population we conducted family-based study. Functional polymorphisms from IL1A (rs1800587, rs17561, rs11677416), IL1B (rs1143634, rs1143643, rs16944, rs4848306, rs1143623, rs1143633, rs1143627) and IL1RN (rs419598, rs315952, rs9005, rs4251961) genes were genotyped in 143 trio with schizophrenia. Statistical analysis was performed using transmission disequilibrium test. We have found a trend toward an association of rs1143627, rs16944, rs1143623 in IL1B gene with the risk of schizophrenia. Our results show a protective effect of allele T of rs4251961 in IL1RN against schizophrenia. We also performed haplotype analysis of IL1 gene complex and found a trend toward an association with schizophrenia of GAGG haplotype (rs1143627, rs16944, rs1143623, rs4848306) in IL1B gene, haplotypes: TG (rs315952, rs9005) and TT (rs4251961, rs419598) in IL1RN. Haplotype CT (rs4251961, rs419598) in IL1RN was found to be associated with schizophrenia. After correction for multiple testing associations did not reach significance level. Our results might support theory that polymorphisms of interleukin 1 complex genes (rs1143627, rs16944, rs1143623, rs4848306 in IL1B gene and rs4251961, rs419598, rs315952, rs9005 in IL1RN gene) are involved in the pathogenesis of schizophrenia, however, none of the results reach significance level after correction for multiple testing.

HLA-DRB1*15:01-DQA1*01:02-DQB1*06:02 Haplotype Protects Autoantibody-Positive Relatives From Type 1 Diabetes Throughout the Stages of Disease Progression.

PubMed

Pugliese, Alberto; Boulware, David; Yu, Liping; Babu, Sunanda; Steck, Andrea K; Becker, Dorothy; Rodriguez, Henry; DiMeglio, Linda; Evans-Molina, Carmella; Harrison, Leonard C; Schatz, Desmond; Palmer, Jerry P; Greenbaum, Carla; Eisenbarth, George S; Sosenko, Jay M

2016-04-01

The HLA-DRB1*15:01-DQA1*01:02-DQB1*06:02 haplotype is linked to protection from the development of type 1 diabetes (T1D). However, it is not known at which stages in the natural history of T1D development this haplotype affords protection. We examined a cohort of 3,358 autoantibody-positive relatives of T1D patients in the Pathway to Prevention (PTP) Study of the Type 1 Diabetes TrialNet. The PTP study examines risk factors for T1D and disease progression in relatives. HLA typing revealed that 155 relatives carried this protective haplotype. A comparison with 60 autoantibody-negative relatives suggested protection from autoantibody development. Moreover, the relatives with DRB1*15:01-DQA1*01:02-DQB1*06:02 less frequently expressed autoantibodies associated with higher T1D risk, were less likely to have multiple autoantibodies at baseline, and rarely converted from single to multiple autoantibody positivity on follow-up. These relatives also had lower frequencies of metabolic abnormalities at baseline and exhibited no overall metabolic worsening on follow-up. Ultimately, they had a very low 5-year cumulative incidence of T1D. In conclusion, the protective influence of DRB1*15:01-DQA1*01:02-DQB1*06:02 spans from autoantibody development through all stages of progression, and relatives with this allele only rarely develop T1D. © 2016 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

Current sequencing technology makes microhaplotypes a powerful new type of genetic marker for forensics.

PubMed

Kidd, Kenneth K; Pakstis, Andrew J; Speed, William C; Lagacé, Robert; Chang, Joseph; Wootton, Sharon; Haigh, Eva; Kidd, Judith R

2014-09-01

SNPs that are molecularly very close (<10kb) will generally have extremely low recombination rates, much less than 10(-4). Multiple haplotypes will often exist because of the history of the origins of the variants at the different sites, rare recombinants, and the vagaries of random genetic drift and/or selection. Such multiallelic haplotype loci are potentially important in forensic work for individual identification, for defining ancestry, and for identifying familial relationships. The new DNA sequencing capabilities currently available make possible continuous runs of a few hundred base pairs so that we can now determine the allelic combination of multiple SNPs on each chromosome of an individual, i.e., the phase, for multiple SNPs within a small segment of DNA. Therefore, we have begun to identify regions, encompassing two to four SNPs with an extent of <200bp that define multiallelic haplotype loci. We have identified candidate regions and have collected pilot data on many candidate microhaplotype loci. Here we present 31 microhaplotype loci that have at least three alleles, have high heterozygosity, are globally informative, and are statistically independent at the population level. This study of microhaplotype loci (microhaps) provides proof of principle that such markers exist and validates their usefulness for ancestry inference, lineage-clan-family inference, and individual identification. The true value of microhaplotypes will come with sequencing methods that can establish alleles unambiguously, including disentangling of mixtures, because a single sequencing run on a single strand of DNA will encompass all of the SNPs. Copyright © 2014 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

Haplotype Analysis Discriminates Genetic Risk for DR3-Associated Endocrine Autoimmunity and Helps Define Extreme Risk for Addison’s Disease

PubMed Central

Baker, Peter R.; Baschal, Erin E.; Fain, Pam R.; Triolo, Taylor M.; Nanduri, Priyaanka; Siebert, Janet C.; Armstrong, Taylor K.; Babu, Sunanda R.; Rewers, Marian J.; Gottlieb, Peter A.; Barker, Jennifer M.; Eisenbarth, George S.

2010-01-01

Context: Multiple autoimmune disorders (e.g. Addison’s disease, type 1 diabetes, celiac disease) are associated with HLA-DR3, but it is likely that alleles of additional genes in linkage disequilibrium with HLA-DRB1 contribute to disease. Objective: The objective of the study was to characterize major histocompatability complex (MHC) haplotypes conferring extreme risk for autoimmune Addison’s disease (AD). Design, Setting, and Participants: Eighty-six 21-hydroxylase autoantibody-positive, nonautoimmune polyendocrine syndrome type 1, Caucasian individuals collected from 1992 to 2009 with clinical AD from 68 families (12 multiplex and 56 simplex) were genotyped for HLA-DRB1, HLA-DQB1, MICA, HLA-B, and HLA-A as well as high density MHC single-nucleotide polymorphism (SNP) analysis for 34. Main Outcome Measures: AD and genotype were measured. Result: Ninety-seven percent of the multiplex individuals had both HLA-DR3 and HLA-B8 vs. 60% of simplex AD patients (P = 9.72 × 10−4) and 13% of general population controls (P = 3.00 × 10−19). The genotype DR3/DR4 with B8 was present in 85% of AD multiplex patients, 24% of simplex patients, and 1.5% of control individuals (P = 4.92 × 10−191). The DR3-B8 haplotype of AD patients had HLA-A1 less often (47%) than controls (81%, P = 7.00 × 10−5) and type 1 diabetes patients (73%, P = 1.93 × 10−3). Analysis of 1228 SNPs across the MHC for individuals with AD revealed a shorter conserved haplotype (3.8) with the loss of the extended conserved 3.8.1 haplotype approximately halfway between HLA-B and HLA-A. Conclusion: Extreme risk for AD, especially in multiplex families, is associated with haplotypic DR3 variants, in particular a portion (3.8) but not all of the conserved 3.8.1 haplotype. PMID:20631027

The clinical application of single-sperm-based SNP haplotyping for PGD of osteogenesis imperfecta.

PubMed

Chen, Linjun; Diao, Zhenyu; Xu, Zhipeng; Zhou, Jianjun; Yan, Guijun; Sun, Haixiang

2018-05-15

Osteogenesis imperfecta (OI) is a genetically heterogeneous disorder, presenting either autosomal dominant, autosomal recessive or X-linked inheritance patterns. The majority of OI cases are autosomal dominant and are caused by heterozygous mutations in either the COL1A1 or COL1A2 gene. In these dominant disorders, allele dropout (ADO) can lead to misdiagnosis in preimplantation genetic diagnosis (PGD). Polymorphic markers linked to the mutated genes have been used to establish haplotypes for identifying ADO and ensuring the accuracy of PGD. However, the haplotype of male patients cannot be determined without data from affected relatives. Here, we developed a method for single-sperm-based single-nucleotide polymorphism (SNP) haplotyping via next-generation sequencing (NGS) for the PGD of OI. After NGS, 10 informative polymorphic SNP markers located upstream and downstream of the COL1A1 gene and its pathogenic mutation site were linked to individual alleles in a single sperm from an affected male. After haplotyping, a normal blastocyst was transferred to the uterus for a subsequent frozen embryo transfer cycle. The accuracy of PGD was confirmed by amniocentesis at 19 weeks of gestation. A healthy infant weighing 4,250 g was born via vaginal delivery at the 40th week of gestation. Single-sperm-based SNP haplotyping can be applied for PGD of any monogenic disorders or de novo mutations in males in whom the haplotype of paternal mutations cannot be determined due to a lack of affected relatives. ADO: allele dropout; DI: dentinogenesis imperfect; ESHRE: European Society of Human Reproduction and Embryology; FET: frozen embryo transfer; gDNA: genomic DNA; ICSI: intracytoplasmic sperm injection; IVF: in vitro fertilization; MDA: multiple displacement amplification; NGS: next-generation sequencing; OI: osteogenesis imperfect; PBS: phosphate buffer saline; PCR: polymerase chain reaction; PGD: preimplantation genetic diagnosis; SNP: single-nucleotide polymorphism; STR: short tandem repeat; TE: trophectoderm; WGA: whole-genome amplification.

Globin haplotypes of human T-cell lymphotropic virus type I-infected individuals in Salvador, Bahia, Brazil, suggest a post-Columbian African origin of this virus.

PubMed

Alcantara, Luiz Carlos; Van Dooren, Sonia; Gonçalves, Marilda Souza; Kashima, Simone; Costa, Maria Cristina Ramos; Santos, Fred Luciano Neves; Bittencourt, Achilea Lisboa; Dourado, Inês; Filho, Antonio Andrade; Covas, Dimas Tadeu; Vandamme, Anne-Mieke; Galvão-Castro, Bernardo

2003-08-01

The city of Salvador, Bahia, Brazil, has sociodemographic characteristics similar to some African cities. Up to now, it has had the highest prevalence of human T-cell lymphotropic virus type I (HTLV-I) infection (1.74%) in the country. To investigate which strains of HTLV-I are circulating in Salvador, we studied isolates from 82 patients infected with HTLV-I: 19 from the general population, 21 from pregnant women, 16 from intravenous drug users, and 26 from patients and their family attending a neurologic clinic. Phylogenetic analysis from part of the LTR fragments showed that most of these isolates belonged to the Transcontinental subgroup of the Cosmopolitan subtype (HTLV-Ia). Only one sample from a pregnant woman was closely related to the Japanese subgroup, suggesting recent introduction of a Japanese HTLV-I lineage into Salvador. betaA-Globin haplotypes were examined in 34 infected individuals and found to be atypical, confirming the racial heterogeneity of this population. A total of 20 chromosomes were characterized as Central African Republic (CAR) haplotype (29.4%), 31 (45.6%) were characterized as Benin (BEN) haplotype, and 17 (25%) were characterized as Senegal (SEN) haplotype. Five patients' genotypes (14.7%) were CAR/CAR; 10 (29,4%), BEN/BEN; 9 (26.5%), CAR/BEN; 2 (5.9%), BEN/SEN; and 7 (20.6%), SEN/SEN. One patient's genotype (2.9%) was CAR/SEN. The betaA-globin haplotype distribution in Salvador is unusual compared with other Brazilian states. Our data support the hypothesis of multiple post-Columbian introductions of African HTLV-Ia strains in Salvador, Bahia, Brazil.

IL5RA polymorphisms, smoking and eczema in Japanese women: the Kyushu Okinawa Maternal and Child Health Study.

PubMed

Miyake, Y; Tanaka, K; Arakawa, M

2015-02-01

The present case-control study examined the relationship between IL5RA SNPs and eczema in young adult Japanese women. Cases and control subjects were selected from pregnant women who participated in the baseline survey of the Kyushu Okinawa Maternal and Child Health Study, which is an ongoing prebirth cohort study. Cases comprised 188 women with eczema in the previous 12 months as defined according to the criteria of the International Study of Asthma and Allergies in Childhood (ISAAC), regardless of the presence of a doctor's diagnosis of atopic eczema. Control subjects comprised 1130 women without eczema as defined according to the ISAAC criteria who also had not been diagnosed with atopic eczema by a doctor. Compared with the AA genotype of IL5RA SNP rs17881144, the AT genotype, but not the TT genotype, was significantly associated with a decreased risk of eczema. The ATTAGA haplotype and the GTAGCA haplotype of rs17882210, rs3804797, rs334809, rs9831572, rs6771148 and rs17881144 were significantly associated with an increased risk of eczema. In contrast, the GCTGCA haplotype was significantly related to a decreased risk of eczema. Multiplicative interactions between IL5RA SNPs rs334809 and rs17881144 and smoking with respect to eczema were marginally significant (P = 0.07 and 0.07, respectively). This is the first study to show significant associations between IL5RA SNP rs17881144, the ATTAGA haplotype, the GTAGCA haplotype, and the GCTGCA haplotype and eczema. Smoking may modify the relationships between SNPs rs334809 and rs17881144 and eczema. © 2014 John Wiley & Sons Ltd.

Genetic deviation in geographically close populations of the dengue vector Aedes aegypti (Diptera: Culicidae): influence of environmental barriers in South India.

PubMed

Vadivalagan, Chithravel; Karthika, Pushparaj; Murugan, Kadarkarai; Panneerselvam, Chellasamy; Paulpandi, Manickam; Madhiyazhagan, Pari; Wei, Hui; Aziz, Al Thabiani; Alsalhi, Mohamad Saleh; Devanesan, Sandhanasamy; Nicoletti, Marcello; Paramasivan, Rajaiah; Dinesh, Devakumar; Benelli, Giovanni

2016-03-01

Mosquitoes are vectors of devastating pathogens and parasites, causing millions of deaths every year. Dengue is a mosquito-borne viral infection found in tropical and subtropical regions around the world. Recently, dengue transmission has strongly increased in urban and semiurban areas, becoming a major international public health concern. Aedes aegypti (Diptera: Culicidae) is a primary vector of dengue. Shedding light on genetic deviation in A. aegypti populations is of crucial importance to fully understand their molecular ecology and evolution. In this research, haplotype and genetic analyses were conducted using individuals of A. aegypti from 31 localities in the north, southeast, northeast and central regions of Tamil Nadu (South India). The mitochondrial DNA region of cytochrome c oxidase 1 (CO1) gene was used as marker for the analyses. Thirty-one haplotypes sequences were submitted to GenBank and authenticated. The complete haplotype set included 64 haplotypes from various geographical regions clustered into three groups (lineages) separated by three fixed mutational steps, suggesting that the South Indian Ae. aegypti populations were pooled and are linked with West Africa, Columbian and Southeast Asian lineages. The genetic and haplotype diversity was low, indicating reduced gene flow among close populations of the vector, due to geographical barriers such as water bodies. Lastly, the negative values for neutrality tests indicated a bottle-neck effect and supported for low frequency of polymorphism among the haplotypes. Overall, our results add basic knowledge to molecular ecology of the dengue vector A. aegypti, providing the first evidence for multiple introductions of Ae. aegypti populations from Columbia and West Africa in South India.

Genetic analysis of autoimmune regulator haplotypes in alopecia areata.

PubMed

Wengraf, D A; McDonagh, A J G; Lovewell, T R J; Vasilopoulos, Y; Macdonald-Hull, S P; Cork, M J; Messenger, A G; Tazi-Ahnini, R

2008-03-01

Alopecia areata is an immune-mediated disorder, occurring with the highest observed frequency in the rare recessive autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) syndrome caused by mutations of the autoimmune regulator (AIRE) gene on chromosome 21q22.3. We have previously detected association between alopecia areata and a single nucleotide polymorphism (SNP) in the AIRE gene in patients without APECED, and we now report the findings of an extended examination of the association of alopecia areata with haplotype analysis including six SNPs in the AIRE gene: C-103T, C4144G, T5238C, G6528A, T7215C and T11787C. In Caucasian groups of 295 patients and 363 controls, we found strong association between the AIRE 7215C allele and AA [P = 3.8 x 10(-8), OR (95% CI): 2.69 (1.8-4.0)]. The previously reported association between AA and the AIRE 4144G allele was no longer significant on correction for multiple testing. The AIRE haplotypes CCTGCT and CGTGCC showed a highly significant association with AA [P = 6.05 x 10(-6), 9.47 (2.91-30.8) and P = 0.001, 3.51 (1.55-7.95), respectively]. To select the haplotypes most informative for analysis, we tagged the polymorphisms using SNPTag software. Employing AIRE C-103T, G6528A, T7215C and T11787C as tag SNPs, two haplotypes were associated with AA; AIRE CGCT and AIRE CGCC [P = 3.84 x 10(-7), 11.40 (3.53-36.9) and P = 3.94 x 10(-4), 2.13 (1.39-3.24) respectively]. The AIRE risk haplotypes identified in this study potentially account for a major component of the genetic risk of developing alopecia areata.

Human neuronal acetylcholine receptor A5-A3-B4 haplotypes are associated with multiple nicotine dependence phenotypes

PubMed Central

Weiss, Robert B.; Bolt, Daniel; von Niederhausern, Andrew; Fiore, Michael C.; Dunn, Diane M.; Piper, Megan E.; Matsunami, Nori; Smith, Stevens S.; Coon, Hilary; McMahon, William M.; Scholand, Mary B.; Singh, Nanda; Hoidal, John R.; Kim, Su-Young; Leppert, Mark F.; Cannon, Dale S.

2009-01-01

Introduction: Previous research revealed significant associations between haplotypes in the CHRNA5-A3-B4 subunit cluster and scores on the Fagerström Test for Nicotine Dependence among individuals reporting daily smoking by age 17. The present study used subsamples of participants from that study to investigate associations between the CHRNA5-A3-B4 haplotypes and an array of phenotypes not analyzed previously (i.e., withdrawal severity, ability to stop smoking, and specific scales on the Wisconsin Inventory of Smoking Dependence Motives (WISDM-68) that reflect loss of control, strong craving, and heavy smoking. Methods: Two cohorts of current or former smokers (N = 886) provided both self-report data and DNA samples. One sample (Wisconsin) comprised smokers making a quit smoking attempt, which permitted the assessment of withdrawal and relapse during the attempt. The other sample (Utah) comprised participants studied for risk factors for nicotine dependence and chronic obstructive pulmonary disease and included individuals originally recruited in the Lung Health Study. Results: The CHRNA5-A3-B4 haplotypes were significantly associated with the targeted WISDM-68 scales (Tolerance, Craving, Loss of Control) in both samples of participants but only among individuals who began smoking early in life. The haplotypes were significantly associated with relapse likelihood and withdrawal severity, but these associations showed no evidence of an interaction with age at daily smoking. Discussion: The CHRNA5-A3-B4 haplotypes are associated with a broad range of nicotine dependence phenotypes, but these associations are not consistently moderated by age at initial smoking. PMID:19436041

Population genetic structure in Sabatieria (Nematoda) reveals intermediary gene flow and admixture between distant cold seeps from the Mediterranean Sea.

PubMed

De Groote, Annelies; Hauquier, Freija; Vanreusel, Ann; Derycke, Sofie

2017-07-01

There is a general lack of information on the dispersal and genetic structuring for populations of small-sized deep-water taxa, including free-living nematodes which inhabit and dominate the seafloor sediments. This is also true for unique and scattered deep-sea habitats such as cold seeps. Given the limited dispersal capacity of marine nematodes, genetic differentiation between such geographically isolated habitat patches is expected to be high. Against this background, we examined genetic variation in both mitochondrial (COI) and nuclear (18S and 28S ribosomal) DNA markers of 333 individuals of the genus Sabatieria, abundantly present in reduced cold-seep sediments. Samples originated from four Eastern Mediterranean cold seeps, separated by hundreds of kilometers, and one seep in the Southeast Atlantic. Individuals from the Mediterranean and Atlantic were divided into two separate but closely-related species clades. Within the Eastern Mediterranean, all specimens belonged to a single species, but with a strong population genetic structure (Φ ST  = 0.149). The haplotype network of COI contained 19 haplotypes with the most abundant haplotype (52% of the specimens) shared between all four seeps. The number of private haplotypes was high (15), but the number of mutations between haplotypes was low (1-8). These results indicate intermediary gene flow among the Mediterranean Sabatieria populations with no evidence of long-term barriers to gene flow. The presence of shared haplotypes and multiple admixture events indicate that Sabatieria populations from disjunct cold seeps are not completely isolated, with gene flow most likely facilitated through water current transportation of individuals and/or eggs. Genetic structure and molecular diversity indices are comparable to those of epiphytic shallow-water marine nematodes, while no evidence of sympatric cryptic species was found for the cold-seep Sabatieria.

High-Density SNP Genotyping to Define β-Globin Locus Haplotypes

PubMed Central

Liu, Li; Muralidhar, Shalini; Singh, Manisha; Sylvan, Caprice; Kalra, Inderdeep S.; Quinn, Charles T.; Onyekwere, Onyinye C.; Pace, Betty S.

2014-01-01

Five major β-globin locus haplotypes have been established in individuals with sickle cell disease (SCD) from the Benin, Bantu, Senegal, Cameroon, and Arab-Indian populations. Historically, β-haplotypes were established using restriction fragment length polymorphism (RFLP) analysis across the β-locus, which consists of five functional β-like globin genes located on chromosome 11. Previous attempts to correlate these haplotypes as robust predictors of clinical phenotypes observed in SCD have not been successful. We speculate that the coverage and distribution of the RFLP sites located proximal to or within the globin genes are not sufficiently dense to accurately reflect the complexity of this region. To test our hypothesis, we performed RFLP analysis and high-density single nucleotide polymorphism (SNP) genotyping across the β-locus using DNA samples from either healthy African Americans with normal hemoglobin A (HbAA) or individuals with homozygous SS (HbSS) disease. Using the genotyping data from 88 SNPs and Haploview analysis, we generated a greater number of haplotypes than that observed with RFLP analysis alone. Furthermore, a unique pattern of long-range linkage disequilibrium between the locus control region and the β-like globin genes was observed in the HbSS group. Interestingly, we observed multiple SNPs within the HindIII restriction site located in the Gγ-globin intervening sequence II which produced the same RFLP pattern. These findings illustrated the inability of RFLP analysis to decipher the complexity of sequence variations that impacts genomic structure in this region. Our data suggest that high density SNP mapping may be required to accurately define β-haplotypes that correlate with the different clinical phenotypes observed in SCD. PMID:18829352

In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

PubMed

Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

2008-12-15

The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (<5 kb) DNA fragments. In the current study, a novel modification was applied to overcome these problems. A limited amount of cellular DNA was carefully released from intact cells into a mildly heated alkaline agarose solution and mixed thoroughly. The solution was then gently aliquoted and allowed to solidify while maintaining the integrity of the diluted DNA. Exogenously provided Phi29 DNA polymerase was used to perform consistent genomic amplification with random hexameric oligonucleotides within the agarose gels. Simple heat melting of the gel allowed recovery of the amplified materials in a solution of the polymerase chain reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

Genetic diversity and natural selection of Plasmodium vivax multi-drug resistant gene (pvmdr1) in Mesoamerica.

PubMed

González-Cerón, Lilia; Montoya, Alberto; Corzo-Gómez, Josselin C; Cerritos, Rene; Santillán, Frida; Sandoval, Marco A

2017-07-01

The Plasmodium vivax multidrug resistant 1 gene (pvmdr1) codes for a transmembrane protein of the parasite's digestive vacuole. It is likely that the pvmdr1 gene mutations occur at different sites by convergent evolution. In here, the genetic variation of pvmdr1 at three sites of the Mesoamerican region was studied. Since 1950s, malarious patients of those areas have been treated only with chloroquine and primaquine. Blood samples from patients infected with P. vivax were obtained in southern Mexico (SMX), in the Northwest (NIC-NW) and in the northeast (NIC-NE) of Nicaragua. Genomic DNA was obtained and fragments of pvmdr1 were amplified and sequenced. The nucleotide and amino acid changes as well as the haplotype frequency in pvmdr1 were determined per strain and per geographic site. The sequences of pvmdr1 obtained from the studied regions were compared with homologous sequences from the GenBank database to explore the P. vivax genetic structure. In 141 parasites, eight nucleotide changes (two changes were synonymous and other six were nonsynonymous) were detected in 1536 bp. The PvMDR1 amino acid changes Y976F, F1076FL were predominant in endemic parasites from NIC-NE and outbreak parasites in NIC-NW but absent in SMX. Thirteen haplotypes were resolved, and found to be closely related, but their frequency at each geographic site was different (P = 0.0001). The pvmdr1 codons 925-1083 gene fragment showed higher genetic and haplotype diversity in parasites from NIC-NE than the other areas outside Latin America. The haplotype networks suggested local diversification of pvmdr1 and no significant departure from neutrality. The F ST values were low to moderate regionally, but high between NIC-NE or NIC-NW and other regions inside and outside Latin America. The pvmdr1 gene might have diversified recently at regional level. In the absence of significant natural, genetic drift might have caused differential pvmdr1 haplotype frequencies at different geographic sites in Mesoamerica. A very recent expansion of divergent pvmdr1 haplotypes in NIC-NE/NIC-NW produced high differentiation between these and parasites from other sites including SMX. These data are useful to set a baseline for epidemiological surveillance.

Comparative phylogeography of two sympatric beeches in subtropical China: Species-specific geographic mosaic of lineages

PubMed Central

Zhang, Zhi-Yong; Wu, Rong; Wang, Qun; Zhang, Zhi-Rong; López-Pujol, Jordi; Fan, Deng-Mei; Li, De-Zhu

2013-01-01

In subtropical China, large-scale phylogeographic comparisons among multiple sympatric plants with similar ecological preferences are scarce, making generalizations about common response to historical events necessarily tentative. A phylogeographic comparison of two sympatric Chinese beeches (Fagus lucida and F. longipetiolata, 21 and 28 populations, respectively) was conducted to test whether they have responded to historical events in a concerted fashion and to determine whether their phylogeographic structure is exclusively due to Quaternary events or it is also associated with pre-Quaternary events. Twenty-three haplotypes were recovered for F. lucida and F. longipetiolata (14 each one and five shared). Both species exhibited a species-specific mosaic distribution of haplotypes, with many of them being range-restricted and even private to populations. The two beeches had comparable total haplotype diversity but F. lucida had much higher within-population diversity than F. longipetiolata. Molecular dating showed that the time to most recent common ancestor of all haplotypes was 6.36 Ma, with most haplotypes differentiating during the Quaternary. [Correction added on 14 October 2013, after first online publication: the timeunit has been corrected to ‘6.36’.] Our results support a late Miocene origin and southwards colonization of Chinese beeches when the aridity in Central Asia intensified and the monsoon climate began to dominate the East Asia. During the Quaternary, long-term isolation in subtropical mountains of China coupled with limited gene flow would have lead to the current species-specific mosaic distribution of lineages. PMID:24340187

Whole-genome sequencing approaches for conservation biology: Advantages, limitations and practical recommendations.

PubMed

Fuentes-Pardo, Angela P; Ruzzante, Daniel E

2017-10-01

Whole-genome resequencing (WGR) is a powerful method for addressing fundamental evolutionary biology questions that have not been fully resolved using traditional methods. WGR includes four approaches: the sequencing of individuals to a high depth of coverage with either unresolved or resolved haplotypes, the sequencing of population genomes to a high depth by mixing equimolar amounts of unlabelled-individual DNA (Pool-seq) and the sequencing of multiple individuals from a population to a low depth (lcWGR). These techniques require the availability of a reference genome. This, along with the still high cost of shotgun sequencing and the large demand for computing resources and storage, has limited their implementation in nonmodel species with scarce genomic resources and in fields such as conservation biology. Our goal here is to describe the various WGR methods, their pros and cons and potential applications in conservation biology. WGR offers an unprecedented marker density and surveys a wide diversity of genetic variations not limited to single nucleotide polymorphisms (e.g., structural variants and mutations in regulatory elements), increasing their power for the detection of signatures of selection and local adaptation as well as for the identification of the genetic basis of phenotypic traits and diseases. Currently, though, no single WGR approach fulfils all requirements of conservation genetics, and each method has its own limitations and sources of potential bias. We discuss proposed ways to minimize such biases. We envision a not distant future where the analysis of whole genomes becomes a routine task in many nonmodel species and fields including conservation biology. © 2017 John Wiley & Sons Ltd.

Early prediction of autoimmune (type 1) diabetes.

PubMed

Regnell, Simon E; Lernmark, Åke

2017-08-01

Underlying type 1 diabetes is a genetic aetiology dominated by the influence of specific HLA haplotypes involving primarily the class II DR-DQ region. In genetically predisposed children with the DR4-DQ8 haplotype, exogenous factors, yet to be identified, are thought to trigger an autoimmune reaction against insulin, signalled by insulin autoantibodies as the first autoantibody to appear. In children with the DR3-DQ2 haplotype, the triggering reaction is primarily against GAD signalled by GAD autoantibodies (GADA) as the first-appearing autoantibody. The incidence rate of insulin autoantibodies as the first-appearing autoantibody peaks during the first years of life and declines thereafter. The incidence rate of GADA as the first-appearing autoantibody peaks later but does not decline. The first autoantibody may variably be followed, in an apparently non-HLA-associated pathogenesis, by a second, third or fourth autoantibody. Although not all persons with a single type of autoantibody progress to diabetes, the presence of multiple autoantibodies seems invariably to be followed by loss of functional beta cell mass and eventually by dysglycaemia and symptoms. Infiltration of mononuclear cells in and around the islets appears to be a late phenomenon appearing in the multiple-autoantibody-positive with dysglycaemia. As our understanding of the aetiology and pathogenesis of type 1 diabetes advances, the improved capability for early prediction should guide new strategies for the prevention of type 1 diabetes.

Patterns of kinship in groups of free-living sperm whales (Physeter macrocephalus) revealed by multiple molecular genetic analyses.

PubMed

Richard, K R; Dillon, M C; Whitehead, H; Wright, J M

1996-08-06

Mature female sperm whales (Physeter macrocephalus) live in socially cohesive groups of 10-30, which include immature animals of both sexes, and within which there is communal care of the young. We examined kinship in such groups using analyses of microsatellite DNA, mitochondrial DNA sequence, and sex-linked markers on samples of sloughed skin collected noninvasively from animals in three groups off the coast of Ecuador. Social groups were defined through photographic identification of individuals. Each group contained about 26 members, mostly female (79%). Relatedness was greater within groups, as compared to between groups. Particular mitochondrial haplotypes were characteristic of groups, but all groups contained more than one haplotype. The data are generally consistent with each group being comprised of several matrillines from which males disperse at about the age of 6 years. There are indications of paternal relatedness among grouped individuals with different mitochondrial haplotypes, suggesting long-term associations between different matrilines.

Patterns of kinship in groups of free-living sperm whales (Physeter macrocephalus) revealed by multiple molecular genetic analyses.

PubMed Central

Richard, K R; Dillon, M C; Whitehead, H; Wright, J M

1996-01-01

Mature female sperm whales (Physeter macrocephalus) live in socially cohesive groups of 10-30, which include immature animals of both sexes, and within which there is communal care of the young. We examined kinship in such groups using analyses of microsatellite DNA, mitochondrial DNA sequence, and sex-linked markers on samples of sloughed skin collected noninvasively from animals in three groups off the coast of Ecuador. Social groups were defined through photographic identification of individuals. Each group contained about 26 members, mostly female (79%). Relatedness was greater within groups, as compared to between groups. Particular mitochondrial haplotypes were characteristic of groups, but all groups contained more than one haplotype. The data are generally consistent with each group being comprised of several matrillines from which males disperse at about the age of 6 years. There are indications of paternal relatedness among grouped individuals with different mitochondrial haplotypes, suggesting long-term associations between different matrilines. PMID:8710951

Genetic diversity and structure in semiwild and domesticated chiles (Capsicum annuum; Solanaceae) from Mexico.

PubMed

Aguilar-Meléndez, Araceli; Morrell, Peter L; Roose, Mikeal L; Kim, Seung-Chul

2009-06-01

The chile of Mesoamerica, Capsicum annuum, is one of five domesticated chiles in the Americas. Among the chiles, it varies the most in size, form, and color of its fruits. Together with maize, C. annuum is one of the principal elements of the neotropical diets of Mesoamerican civilizations. Despite the great economic and cultural importance of C. annuum both worldwide and in Mexico, however, very little is known about its geographic origin and number of domestications. Here we sampled a total of 80 accessions from Mexico (58 semiwild and 22 domesticated) and examined nucleotide sequence diversity at three single- or low-copy nuclear loci, Dhn, G3pdh, and Waxy. Across the three loci, we found an average reduction of ca. 10% in the diversity of domesticates relative to semiwild chiles and geographic structure within Mexican populations. The Yucatan Peninsula contained a large number of haplotypes, many of which were unique, suggesting an important region of chile domestication and center of diversity. The present sampling of loci did not conclusively resolve the number and location of domestications, but several lines of evidence suggest multiple independent domestications from widely distributed progenitor populations.

Genetic structure and evolution of natural populations of viruses causing the tomato yellow leaf curl disease in Spain.

PubMed

Font, María Isabel; Rubio, Luis; Martínez-Culebras, Pedro Vicente; Jordá, Concepción

2007-09-01

The population structure and genetic variation of two begomoviruses: tomato yellow leaf curl Sardinia virus (TYLCSV) and tomato yellow leaf curl virus (TYLCV) in tomato crops of Spain were studied from 1997 until 2001. Restriction digestion of a genomic region comprised of the CP coat protein gene (CPR) of 358 TYLC virus isolates enabled us to classify them into 14 haplotypes. Nucleotide sequences of two genomic regions: CPR, and the surrounding intergenic region (SIR) were determined for at least two isolates per haplotype. SIR was more variable than CPR and showed multiple recombination events whereas no recombination was detected within CPR. In all geographic regions except Murcia, the population was, or evolved to be composed of one predominant haplotype with a low genetic diversity (<0.0180). In Murcia, two successive changes of the predominant haplotype were observed in the best studied population. Phylogenetic analysis showed that the TYLCSV sequences determined clustered with sequences obtained from the GenBank of other TYLCSV Spanish isolates which were clearly separated from TYLCSV Italian isolates. Most of our TYLCV sequences were similar to those of isolates from Japan and Portugal, and the sequences obtained from TYLCV isolates from the Canary island of Lanzarote were similar to those of Caribbean TYLCV isolates.

Genetic alterations within TLR genes in development of Toxoplasma gondii infection among Polish pregnant women.

PubMed

Wujcicka, Wioletta; Wilczyński, Jan; Nowakowska, Dorota

2017-09-01

The research was conducted to evaluate the role of genotypes, haplotypes and multiple-SNP variants in the range of TLR2, TLR4 and TLR9 single nucleotide polymorphisms (SNPs) in the development of Toxoplasma gondii infection among Polish pregnant women. The study was performed for 116 Polish pregnant women, including 51 patients infected with T. gondii, and 65 age-matched control pregnant individuals. Genotypes in TLR2 2258 G>A, TLR4 896 A>G, TLR4 1196 C>T and TLR9 2848 G>A SNPs were estimated by self-designed, nested PCR-RFLP assays. Randomly selected PCR products, representative for distinct genotypes in the studied polymorphisms, were confirmed by sequencing. All the genotypes were calculated for Hardy-Weinberg (H-W) equilibrium and TLR4 variants were tested for linkage disequilibrium. Relationships were assessed between alleles, genotypes, haplotypes or multiple-SNP variants in TLR polymorphisms and the occurrence of T. gondii infection in pregnant women, using a logistic regression model. All the analyzed genotypes preserved the H-W equilibrium among the studied groups of patients (P>0.050). Similar distribution of distinct alleles and individual genotypes in TLR SNPs, as well as of haplotypes in TLR4 polymorphisms, were observed in T. gondii infected and control uninfected pregnant women. However, the GACG multiple-SNP variant, within the range of all the four studied polymorphisms, was correlated with a decreased risk of the parasitic infection (OR 0.52, 95% CI 0.28-0.97; P≤0.050). The polymorphisms, located within TLR2, TLR4 and TLR9 genes, may be involved together in occurrence of T. gondii infection among Polish pregnant women. Copyright © 2017 Medical University of Bialystok. Published by Elsevier B.V. All rights reserved.

Genetic characterization of Hawaiian isolates of Plasmodium relictum reveals mixed-genotype infections

PubMed Central

Jarvi, Susan I; Farias, Margaret EM; Atkinson, Carter T

2008-01-01

Background The relatively recent introduction of a highly efficient mosquito vector and an avian pathogen (Plasmodium relictum) to an isolated island ecosystem with naïve, highly susceptible avian hosts provides a unique opportunity to investigate evolution of virulence in a natural system. Mixed infections can significantly contribute to the uncertainty in host-pathogen dynamics with direct impacts on virulence. Toward further understanding of how host-parasite and parasite-parasite relationships may impact virulence, this study characterizes within-host diversity of malaria parasite populations based on genetic analysis of the trap (thrombospondin-related anonymous protein) gene in isolates originating from Hawaii, Maui and Kauai Islands. Methods A total of 397 clones were produced by nested PCR amplification and cloning of a 1664 bp fragment of the trap gene from two malarial isolates, K1 (Kauai) and KV115 (Hawaii) that have been used for experimental studies, and from additional isolates from wild birds on Kauai, Maui and Hawaii Islands. Diversity of clones was evaluated initially by RFLP-based screening, followed by complete sequencing of 33 selected clones. Results RFLP analysis of trap revealed a minimum of 28 distinct RFLP haplotypes among the 397 clones from 18 birds. Multiple trap haplotypes were detected in every bird evaluated, with an average of 5.9 haplotypes per bird. Overall diversity did not differ between the experimental isolates, however, a greater number of unique haplotypes were detected in K1 than in KV115. We detected high levels of clonal diversity with clear delineation between isolates K1 and KV115 in a haplotype network. The patterns of within-host haplotype clustering are consistent with the possibility of a clonal genetic structure and rapid within-host mutation after infection. Conclusion Avian malaria (P. relictum) and Avipoxvirus are the significant infectious diseases currently affecting the native Hawaiian avifauna. This study shows that clonal diversity of Hawaiian isolates of P. relictum is much higher than previously recognized. Mixed infections can significantly contribute to the uncertainty in host-pathogen dynamics with direct implications for host demographics, disease management strategies, and evolution of virulence. The results of this study indicate a widespread presence of multiple-genotype malaria infections with high clonal diversity in native birds of Hawaii, which when coupled with concurrent infection with Avipoxvirus, may significantly influence evolution of virulence. Reviewers This article was reviewed by Joseph Schall (nominated by Laura Landweber), Daniel Jeffares (nominated by Anthony Poole) and Susan Perkins (nominated by Eugene Koonin). PMID:18578879

Introgression of Neandertal- and Denisovan-like Haplotypes Contributes to Adaptive Variation in Human Toll-like Receptors

PubMed Central

Dannemann, Michael; Andrés, Aida M.; Kelso, Janet

2016-01-01

Pathogens and the diseases they cause have been among the most important selective forces experienced by humans during their evolutionary history. Although adaptive alleles generally arise by mutation, introgression can also be a valuable source of beneficial alleles. Archaic humans, who lived in Europe and Western Asia for more than 200,000 years, were probably well adapted to this environment and its local pathogens. It is therefore conceivable that modern humans entering Europe and Western Asia who admixed with them obtained a substantial immune advantage from the introgression of archaic alleles. Here we document a cluster of three Toll-like receptors (TLR6-TLR1-TLR10) in modern humans that carries three distinct archaic haplotypes, indicating repeated introgression from archaic humans. Two of these haplotypes are most similar to the Neandertal genome, and the third haplotype is most similar to the Denisovan genome. The Toll-like receptors are key components of innate immunity and provide an important first line of immune defense against bacteria, fungi, and parasites. The unusually high allele frequencies and unexpected levels of population differentiation indicate that there has been local positive selection on multiple haplotypes at this locus. We show that the introgressed alleles have clear functional effects in modern humans; archaic-like alleles underlie differences in the expression of the TLR genes and are associated with reduced microbial resistance and increased allergic disease in large cohorts. This provides strong evidence for recurrent adaptive introgression at the TLR6-TLR1-TLR10 locus, resulting in differences in disease phenotypes in modern humans. PMID:26748514

A risk PRODH haplotype affects sensorimotor gating, memory, schizotypy, and anxiety in healthy male subjects.

PubMed

Roussos, Panos; Giakoumaki, Stella G; Bitsios, Panos

2009-06-15

Significant associations have been shown for haplotypes comprising three PRODH single nucleotide polymorphisms (SNPs; 1945T/C, 1766A/G, 1852G/A) located in the 3' region of the gene, suggesting a role of these variants in the etiopathogenesis of schizophrenia. We assessed the relationship between these high-risk PRODH polymorphisms and schizophrenia-related endophenotypes in a large and highly homogeneous cohort of healthy males. Participants (n = 217) were tested in prepulse inhibition (PPI), verbal and working memory, trait anxiety and schizotypy. The QTPHASE from the UNPHASED package was used for the association analysis of each SNP or haplotype data. This procedure revealed significant phenotypic impact of the risk CGA haplotype. Subjects were then divided in two groups; levels of PPI, anxiety, and schizotypy, verbal and working memory were compared with analysis of variance. CGA carriers (n = 32) exhibited attenuated PPI (p < .001) and verbal memory (p < .001) and higher anxiety (p < .004) and schizotypy (p < .008) compared with the noncarriers (n = 185). There were no differences in baseline startle, demographics, and working memory. The main significant correlations were schizotypy x PPI [85-dB, 120-msec trials] in the carriers and schizotypy x anxiety in the entire group and the noncarriers but not the carriers group. Our results strongly support PPI as a valid schizophrenia endophenotype and highlight the importance of examining the role of risk haplotypes on multiple endophenotypes and have implications for understanding the continuum from normality to psychosis, transitional states, and the genetics of schizophrenia-related traits.

No shortcut solution to the problem of Y-STR match probability calculation.

PubMed

Caliebe, Amke; Jochens, Arne; Willuweit, Sascha; Roewer, Lutz; Krawczak, Michael

2015-03-01

Match probability calculation is deemed much more intricate for lineage genetic markers, including Y-chromosomal short tandem repeats (Y-STRs), than for autosomal markers. This is because, owing to the lack of recombination, strong interdependence between markers is likely, which implies that haplotype frequency estimates cannot simply be obtained through the multiplication of allele frequency estimates. As yet, however, the practical relevance of this problem has not been studied in much detail using real data. In fact, such scrutiny appears well warranted because the high mutation rates of Y-STRs and the possibility of backward mutation should have worked against the statistical association of Y-STRs. We examined haplotype data of 21 markers included in the PowerPlex(®)Y23 set (PPY23, Promega Corporation, Madison, WI) originating from six different populations (four European and two Asian). Assessing the conditional entropies of the markers, given different subsets of markers from the same panel, we demonstrate that the PowerPlex(®)Y23 set cannot be decomposed into smaller marker subsets that would be (conditionally) independent. Nevertheless, in all six populations, >94% of the joint entropy of the 21 markers is explained by the seven most rapidly mutating markers. Although this result might render a reduction in marker number a sensible option for practical casework, the partial haplotypes would still be almost as diverse as the full haplotypes. Therefore, match probability calculation remains difficult and calls for the improvement of currently available methods of haplotype frequency estimation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Estimating the age of Hb G-Coushatta [β22(B4)Glu→Ala] mutation by haplotypes of β-globin gene cluster in Denizli, Turkey.

PubMed

Ozturk, Onur; Arikan, Sanem; Atalay, Ayfer; Atalay, Erol O

2018-05-01

Hb G-Coushatta variant was reported from various populations' parts of the world such as Thai, Korea, Algeria, Thailand, China, Japan and Turkey. In our study, we aimed to discuss the possible historical relationships of the Hb G-Coushatta mutation with the possible migration routes of the world. For this purpose, associated haplotypes were determined using polymorphic loci in the beta globin gene cluster of hemoglobin G-Coushatta and normal populations in Denizli, Turkey. We performed statistical analysis such as haplotype analysis, Hardy-Weinberg equilibrium, measurement of genetic diversity and population differentiation parameters, analysis of molecular variance using F-statistics, historical-demographic analyses, mismatch distribution analysis of both populations and applied the test statistics in Arlequin ver. 3.5 software program. The diversity of haplotypes has been shown to indicate different genetic origins for two populations. However, AMOVA results, molecular diversity parameters and population demographic expansion times showed that the Hb G-Coushatta mutation develops on the normal population gene pool. Our estimated τ values showed the average time since the demographic expansion for normal and Hb G-Coushatta populations ranged from approximately 42,000 to 38,000 ybp, respectively. Our data suggest that Hb G-Coushatta population originate in normal population in Denizli, Turkey. These results support the hypothesis that the multiple origin of Hb G-Coushatta and indicate that mutation may have been triggered the formation of new variants on beta globin haplotypes. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Very long haplotype tracts characterized at high resolution from HLA homozygous cell lines

PubMed Central

Norman, Paul J.; Norberg, Steve; Nemat-Gorgani, Neda; Royce, Thomas; Hollenbach, Jill A.; Won, Melissa Shults; Guethlein, Lisbeth A.; Gunderson, Kevin L.; Ronaghi, Mostafa; Parham, Peter

2015-01-01

The HLA region of chromosome 6 contains the most polymorphic genes in humans. Spanning ~5Mbp the densely packed region encompasses approximately 175 expressed genes including the highly polymorphic HLA class I and II loci. Most of the other genes and functional elements are also polymorphic, and many of them are directly implicated in immune function or immune-related disease. For these reasons this complex genomic region is subject to intense scrutiny by researchers with the common goal of aiding further understanding and diagnoses of multiple immune-related diseases and syndromes. To aid assay development and characterization of the classical loci, a panel of cell lines partially or fully homozygous for HLA class I and II was assembled over time by the International Histocompatibility Working Group (IHWG). Containing a minimum of 88 unique HLA haplotypes, we show this panel represents a significant proportion of European HLA allelic and haplotype diversity (60–95%). Using a high-density whole genome array that includes 13,331 HLA region SNPs, we analyzed 99 IHWG cells to map the coordinates of the homozygous tracts at a fine scale. The mean homozygous tract length within chromosome 6 from these individuals is 21Mbp. Within HLA the mean haplotype length is 4.3Mbp, and 65% of the cell lines were shown to be homozygous throughout the entire region. In addition, four cell lines are homozygous throughout the complex KIR region of chromosome 19 (~250kbp). The data we describe will provide a valuable resource for characterizing haplotypes, designing and refining imputation algorithms and developing assay controls. PMID:26198775

Human Leukocyte Antigen-A, B, C, DRB1, and DQB1 Allele and Haplotype Frequencies in a Subset of 237 Donors in the South African Bone Marrow Registry

PubMed Central

Ingram, Charlotte; Schlaphoff, Terry; Borrill, Veronica; Christoffels, Alan

2018-01-01

Human leukocyte antigen- (HLA-) A, HLA-B, HLA-C, HLA-DRB1, and HLA-DQB1 allele and haplotype frequencies were studied in a subset of 237 volunteer bone marrow donors registered at the South African Bone Marrow Registry (SABMR). Hapl-o-Mat software was used to compute allele and haplotype frequencies from individuals typed at various resolutions, with some alleles in multiple allele code (MAC) format. Four hundred and thirty-eight HLA-A, 235 HLA-B, 234 HLA-DRB1, 41 HLA-DQB1, and 29 HLA-C alleles are reported. The most frequent alleles were A∗02:02g (0.096), B∗07:02g (0.082), C∗07:02g (0.180), DQB1∗06:02 (0.157), and DRB1∗15:01 (0.072). The most common haplotype was A∗03:01g~B∗07:02g~C∗07:02g~DQB1∗06:02~DRB1∗15:01 (0.067), which has also been reported in other populations. Deviations from Hardy-Weinberg equilibrium were observed in A, B, and DRB1 loci, with C~DQB1 being the only locus pair in linkage disequilibrium. This study describes allele and haplotype frequencies from a subset of donors registered at SABMR, the only active bone marrow donor registry in Africa. Although the sample size was small, our results form a key resource for future population studies, disease association studies, and donor recruitment strategies. PMID:29850621

Tracking mtDNA heteroplasmy through multiple generations in the North Atlantic right whale (Eubalaena glacialis).

PubMed

McLeod, Brenna A; White, Bradley N

2010-01-01

Mitochondrial heteroplasmy has been identified in a variety of species and can result from either paternal leakage, whereby sperm mitochondria enter the ova during fertilization, or more commonly by the "survival" and proliferation of mutant variants within an organism. From an evolutionary perspective, this process represents the generation of new mitochondrial diversity within a species. Although this has been documented in some mammalian species, it has been reported from relatively few wild mammalian populations and in no wild nonhuman population has the transfer and segregation of mitochondrial heteroplasmy been tracked through multiple generations. We report on the first case of the identification and tracking of mitochondrial control region heteroplasmy through 3 generations in the North Atlantic right whale, Eubalaena glacialis. We also identify the full segregation to the mutant variant within a single generation and thus the development of a new haplotype (haplotype G) in a maternal lineage of this endangered species. Witnessed here is the generation of mitochondrial diversity in a genetically depauperate species.

The society of our “out of Africa” ancestors (I)

PubMed Central

2011-01-01

The “out of Africa” hypothesis proposes that a small group of Homo sapiens left Africa 80,000 years ago, spreading the mitochondrial haplotype L3 throughout the Earth.1–10 Little effort has been made to try to reconstruct the society and culture of the tribe that left Africa to populate the rest of the world.1 Here, I find that hunter-gatherers that belong to mitochondrial haplotypes L0, L1 and L2 do not have a culture of ritualized fights. In contrast to this, almost all L3 derived hunter-gatherers have a more belligerent culture that includes ritualized fights such as wrestling, stick fights or headhunting expeditions. This appears to be independent of their environment because ritualized fights occur in all climates, from the tropics to the arctic. There is also a correlation between mitochondrial haplotypes and warfare propensity or the use of murder and suicide to resolve conflicts. The data implicate that the original human population outside Africa is descended from only two closely related sub-branches that practiced ritual fighting and had a higher propensity towards warfare and the use of murder for conflict resolution. This warfare culture may have given the out of Africa migrants a competitive advantage to colonize the world. But it could also have crucially influenced the subsequent history of The Earth. In the future, it would be interesting to see how we could further reconstruct the society and culture of the “Out of Africa Tribe.” PMID:21655430

Burkholderia pseudomallei sequencing identifies genomic clades with distinct recombination, accessory, and epigenetic profiles

PubMed Central

Nandi, Tannistha; Holden, Matthew T.G.; Didelot, Xavier; Mehershahi, Kurosh; Boddey, Justin A.; Beacham, Ifor; Peak, Ian; Harting, John; Baybayan, Primo; Guo, Yan; Wang, Susana; How, Lee Chee; Sim, Bernice; Essex-Lopresti, Angela; Sarkar-Tyson, Mitali; Nelson, Michelle; Smither, Sophie; Ong, Catherine; Aw, Lay Tin; Hoon, Chua Hui; Michell, Stephen; Studholme, David J.; Titball, Richard; Chen, Swaine L.; Parkhill, Julian

2015-01-01

Burkholderia pseudomallei (Bp) is the causative agent of the infectious disease melioidosis. To investigate population diversity, recombination, and horizontal gene transfer in closely related Bp isolates, we performed whole-genome sequencing (WGS) on 106 clinical, animal, and environmental strains from a restricted Asian locale. Whole-genome phylogenies resolved multiple genomic clades of Bp, largely congruent with multilocus sequence typing (MLST). We discovered widespread recombination in the Bp core genome, involving hundreds of regions associated with multiple haplotypes. Highly recombinant regions exhibited functional enrichments that may contribute to virulence. We observed clade-specific patterns of recombination and accessory gene exchange, and provide evidence that this is likely due to ongoing recombination between clade members. Reciprocally, interclade exchanges were rarely observed, suggesting mechanisms restricting gene flow between clades. Interrogation of accessory elements revealed that each clade harbored a distinct complement of restriction-modification (RM) systems, predicted to cause clade-specific patterns of DNA methylation. Using methylome sequencing, we confirmed that representative strains from separate clades indeed exhibit distinct methylation profiles. Finally, using an E. coli system, we demonstrate that Bp RM systems can inhibit uptake of non-self DNA. Our data suggest that RM systems borne on mobile elements, besides preventing foreign DNA invasion, may also contribute to limiting exchanges of genetic material between individuals of the same species. Genomic clades may thus represent functional units of genetic isolation in Bp, modulating intraspecies genetic diversity. PMID:25236617

H-PoP and H-PoPG: heuristic partitioning algorithms for single individual haplotyping of polyploids.

PubMed

Xie, Minzhu; Wu, Qiong; Wang, Jianxin; Jiang, Tao

2016-12-15

Some economically important plants including wheat and cotton have more than two copies of each chromosome. With the decreasing cost and increasing read length of next-generation sequencing technologies, reconstructing the multiple haplotypes of a polyploid genome from its sequence reads becomes practical. However, the computational challenge in polyploid haplotyping is much greater than that in diploid haplotyping, and there are few related methods. This article models the polyploid haplotyping problem as an optimal poly-partition problem of the reads, called the Polyploid Balanced Optimal Partition model. For the reads sequenced from a k-ploid genome, the model tries to divide the reads into k groups such that the difference between the reads of the same group is minimized while the difference between the reads of different groups is maximized. When the genotype information is available, the model is extended to the Polyploid Balanced Optimal Partition with Genotype constraint problem. These models are all NP-hard. We propose two heuristic algorithms, H-PoP and H-PoPG, based on dynamic programming and a strategy of limiting the number of intermediate solutions at each iteration, to solve the two models, respectively. Extensive experimental results on simulated and real data show that our algorithms can solve the models effectively, and are much faster and more accurate than the recent state-of-the-art polyploid haplotyping algorithms. The experiments also show that our algorithms can deal with long reads and deep read coverage effectively and accurately. Furthermore, H-PoP might be applied to help determine the ploidy of an organism. https://github.com/MinzhuXie/H-PoPG CONTACT: xieminzhu@hotmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Exploring Climate Niches of Ponderosa Pine (Pinus ponderosa Douglas ex Lawson) Haplotypes in the Western United States: Implications for Evolutionary History and Conservation

PubMed Central

Shinneman, Douglas J.; Potter, Kevin M.; Hipkins, Valerie D.

2016-01-01

Ponderosa pine (Pinus ponderosa Douglas ex Lawson) occupies montane environments throughout western North America, where it is both an ecologically and economically important tree species. A recent study using mitochondrial DNA analysis demonstrated substantial genetic variation among ponderosa pine populations in the western U.S., identifying 10 haplotypes with unique evolutionary lineages that generally correspond spatially with distributions of the Pacific (P. p. var. ponderosa) and Rocky Mountain (P. p. var. scopulorum) varieties. To elucidate the role of climate in shaping the phylogeographic history of ponderosa pine, we used nonparametric multiplicative regression to develop predictive climate niche models for two varieties and 10 haplotypes and to hindcast potential distribution of the varieties during the last glacial maximum (LGM), ~22,000 yr BP. Our climate niche models performed well for the varieties, but haplotype models were constrained in some cases by small datasets and unmeasured microclimate influences. The models suggest strong relationships between genetic lineages and climate. Particularly evident was the role of seasonal precipitation balance in most models, with winter- and summer-dominated precipitation regimes strongly associated with P. p. vars. ponderosa and scopulorum, respectively. Indeed, where present-day climate niches overlap between the varieties, introgression of two haplotypes also occurs along a steep clinal divide in western Montana. Reconstructed climate niches for the LGM suggest potentially suitable climate existed for the Pacific variety in the California Floristic province, the Great Basin, and Arizona highlands, while suitable climate for the Rocky Mountain variety may have existed across the southwestern interior highlands. These findings underscore potentially unique phylogeographic origins of modern ponderosa pine evolutionary lineages, including potential adaptations to Pleistocene climates associated with discrete temporary glacial refugia. Our predictive climate niche models may inform strategies for further genetic research (e.g., sampling design) and conservation that promotes haplotype compatibility with projected changes in future climate. PMID:26985674

PAX6 Haplotypes Are Associated with High Myopia in Han Chinese

PubMed Central

Jiang, Bo; Yap, Maurice K. H.; Leung, Kim Hung; Ng, Po Wah; Fung, Wai Yan; Lam, Wai Wa; Gu, Yang-shun; Yip, Shea Ping

2011-01-01

Background The paired box 6 (PAX6) gene is considered as a master gene for eye development. Linkage of myopia to the PAX6 region on chromosome 11p13 was shown in several studies, but the results for association between myopia and PAX6 were inconsistent so far. Methodology/Principal Findings We genotyped 16 single nucleotide polymorphisms (SNPs) in the PAX6 gene and its regulatory regions in an initial study for 300 high myopia cases and 300 controls (Group 1), and successfully replicated the positive results with another independent group of 299 high myopia cases and 299 controls (Group 2). Five SNPs were genotyped in the replication study. The spherical equivalent of subjects with high myopia was ≤−8.0 dioptres. The PLINK package was used for genetic data analysis. No association was found between each of the SNPs and high myopia. However, exhaustive sliding-window haplotype analysis highlighted an important role for rs12421026 because haplotypes containing this SNP were found to be associated with high myopia. The most significant results were given by the 4-SNP haplotype window consisting of rs2071754, rs3026393, rs1506 and rs12421026 (P = 3.54×10−10, 4.06×10−11 and 1.56×10−18 for Group 1, Group 2 and Combined Group, respectively) and the 3-SNP haplotype window composed of rs3026393, rs1506 and rs12421026 (P = 5.48×10−10, 7.93×10−12 and 6.28×10−23 for the three respective groups). The results remained significant after correction for multiple comparisons by permutations. The associated haplotyes found in a previous study were also successfully replicated in this study. Conclusions/Significance PAX6 haplotypes are associated with susceptibility to the development of high myopia in Chinese. The PAX6 locus plays a role in high myopia. PMID:21589860

Exploring Climate Niches of Ponderosa Pine (Pinus ponderosa Douglas ex Lawson) Haplotypes in the Western United States: Implications for Evolutionary History and Conservation.

PubMed

Shinneman, Douglas J; Means, Robert E; Potter, Kevin M; Hipkins, Valerie D

2016-01-01

Ponderosa pine (Pinus ponderosa Douglas ex Lawson) occupies montane environments throughout western North America, where it is both an ecologically and economically important tree species. A recent study using mitochondrial DNA analysis demonstrated substantial genetic variation among ponderosa pine populations in the western U.S., identifying 10 haplotypes with unique evolutionary lineages that generally correspond spatially with distributions of the Pacific (P. p. var. ponderosa) and Rocky Mountain (P. p. var. scopulorum) varieties. To elucidate the role of climate in shaping the phylogeographic history of ponderosa pine, we used nonparametric multiplicative regression to develop predictive climate niche models for two varieties and 10 haplotypes and to hindcast potential distribution of the varieties during the last glacial maximum (LGM), ~22,000 yr BP. Our climate niche models performed well for the varieties, but haplotype models were constrained in some cases by small datasets and unmeasured microclimate influences. The models suggest strong relationships between genetic lineages and climate. Particularly evident was the role of seasonal precipitation balance in most models, with winter- and summer-dominated precipitation regimes strongly associated with P. p. vars. ponderosa and scopulorum, respectively. Indeed, where present-day climate niches overlap between the varieties, introgression of two haplotypes also occurs along a steep clinal divide in western Montana. Reconstructed climate niches for the LGM suggest potentially suitable climate existed for the Pacific variety in the California Floristic province, the Great Basin, and Arizona highlands, while suitable climate for the Rocky Mountain variety may have existed across the southwestern interior highlands. These findings underscore potentially unique phylogeographic origins of modern ponderosa pine evolutionary lineages, including potential adaptations to Pleistocene climates associated with discrete temporary glacial refugia. Our predictive climate niche models may inform strategies for further genetic research (e.g., sampling design) and conservation that promotes haplotype compatibility with projected changes in future climate.

Exploring climate niches of ponderosa pine (Pinus ponderosa Douglas ex Lawson) haplotypes in the western United States: Implications for evolutionary history and conservation

USGS Publications Warehouse

Shinneman, Douglas; Means, Robert E.; Potter, Kevin M.; Hipkins, Valerie D.

2016-01-01

Ponderosa pine (Pinus ponderosa Douglas ex Lawson) occupies montane environments throughout western North America, where it is both an ecologically and economically important tree species. A recent study using mitochondrial DNA analysis demonstrated substantial genetic variation among ponderosa pine populations in the western U.S., identifying 10 haplotypes with unique evolutionary lineages that generally correspond spatially with distributions of the Pacific (P. p. var. ponderosa) and Rocky Mountain (P. p. var. scopulorum) varieties. To elucidate the role of climate in shaping the phylogeographic history of ponderosa pine, we used nonparametric multiplicative regression to develop predictive climate niche models for two varieties and 10 haplotypes and to hindcast potential distribution of the varieties during the last glacial maximum (LGM), ~22,000 yr BP. Our climate niche models performed well for the varieties, but haplotype models were constrained in some cases by small datasets and unmeasured microclimate influences. The models suggest strong relationships between genetic lineages and climate. Particularly evident was the role of seasonal precipitation balance in most models, with winter- and summer-dominated precipitation regimes strongly associated with P. p. vars. ponderosa and scopulorum, respectively. Indeed, where present-day climate niches overlap between the varieties, introgression of two haplotypes also occurs along a steep clinal divide in western Montana. Reconstructed climate niches for the LGM suggest potentially suitable climate existed for the Pacific variety in the California Floristic province, the Great Basin, and Arizona highlands, while suitable climate for the Rocky Mountain variety may have existed across the southwestern interior highlands. These findings underscore potentially unique phylogeographic origins of modern ponderosa pine evolutionary lineages, including potential adaptations to Pleistocene climates associated with discrete temporary glacial refugia. Our predictive climate niche models may inform strategies for further genetic research (e.g., sampling design) and conservation that promotes haplotype compatibility with projected changes in future climate.

Phylogenetic relationship of the Brazilian isolates of the rat lungworm Angiostrongylus cantonensis (Nematoda: Metastrongylidae) employing mitochondrial COI gene sequence data

PubMed Central

2012-01-01

Background The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode’s main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI) gene sequences. Methods The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. Results The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8) from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. Conclusion The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions. PMID:23130987

DNA methylation in a Scottish family multiply affected by bipolar disorder and major depressive disorder.

PubMed

Walker, Rosie May; Christoforou, Andrea Nikie; McCartney, Daniel L; Morris, Stewart W; Kennedy, Nicholas A; Morten, Peter; Anderson, Susan Maguire; Torrance, Helen Scott; Macdonald, Alix; Sussmann, Jessika Elizabeth; Whalley, Heather Clare; Blackwood, Douglas H R; McIntosh, Andrew Mark; Porteous, David John; Evans, Kathryn Louise

2016-01-01

Bipolar disorder (BD) is a severe, familial psychiatric condition. Progress in understanding the aetiology of BD has been hampered by substantial phenotypic and genetic heterogeneity. We sought to mitigate these confounders by studying a multi-generational family multiply affected by BD and major depressive disorder (MDD), who carry an illness-linked haplotype on chromosome 4p. Within a family, aetiological heterogeneity is likely to be reduced, thus conferring greater power to detect illness-related changes. As accumulating evidence suggests that altered DNA methylation confers risk for BD and MDD, we compared genome-wide methylation between (i) affected carriers of the linked haplotype (ALH) and married-in controls (MIs), (ii) well unaffected haplotype carriers (ULH) and MI, (iii) ALH and ULH and (iv) all haplotype carriers (LH) and MI. Nominally significant differences in DNA methylation were observed in all comparisons, with differences withstanding correction for multiple testing when the ALH or LH group was compared to the MIs. In both comparisons, we observed increased methylation at a locus in FANCI, which was accompanied by increased FANCI expression in the ALH group. FANCI is part of the Fanconi anaemia complementation (FANC) gene family, which are mutated in Fanconi anaemia and participate in DNA repair. Interestingly, several FANC genes have been implicated in psychiatric disorders. Regional analyses of methylation differences identified loci implicated in psychiatric illness by genome-wide association studies, including CACNB2 and the major histocompatibility complex. Gene ontology analysis revealed enrichment for methylation differences in neurologically relevant genes. Our results highlight altered DNA methylation as a potential mechanism by which the linked haplotype might confer risk for mood disorders. Differences in the phenotypic outcome of haplotype carriers might, in part, arise from additional changes in DNA methylation that converge on neurologically important pathways. Further work is required to investigate the underlying mechanisms and functional consequences of the observed differences in methylation.

Non-Ceruloplasmin Copper Distincts Subtypes in Alzheimer's Disease: a Genetic Study of ATP7B Frequency.

PubMed

Squitti, Rosanna; Ventriglia, Mariacarla; Gennarelli, Massimo; Colabufo, Nicola A; El Idrissi, Imane Ghafir; Bucossi, Serena; Mariani, Stefania; Rongioletti, Mauro; Zanetti, Orazio; Congiu, Chiara; Rossini, Paolo M; Bonvicini, Cristian

2017-01-01

Meta-analyses show that serum copper non-bound-to-ceruloplasmin (non-Cp-Cu) is higher in patients with Alzheimer's disease (AD). ATP7B gene variants associate with AD, modulating the size of non-Cp-Cu pool. However, a dedicated genetic study comparing AD patients after stratification for a copper biomarker to demonstrate the existence of a copper subtype of AD has not yet been carried out. An independent patient sample of 287 AD patients was assessed for non-Cp-Cu serum concentrations, rs1801243, rs1061472, and rs732774 ATP7B genetic variants and the APOE4 genotype. Patients were stratified into two groups based on a non-Cp-Cu cutoff (1.9 μM). Single-locus and haplotype-group analyses were performed to define their frequencies in dependence of the non-Cp-Cu group. The two AD subgroups did not differ regarding age, sex, MMSE score, or APOE4 frequency allele, while they did differ regarding non-Cp-Cu concentrations in serum, allele, genotype, and haplotype frequencies of rs1061472 A > G and rs732774 C > T after multiple testing corrections. AD patients with a GG genotype had a 1.76-fold higher risk of having a non-Cp-Cu higher than 1.9 μmol/L (p = 0.029), and those with a TT genotype for rs732774 C > T of 1.8-fold (p = 0.018). After 100,000 permutations for multiple testing corrections, the haplotype containing the AC alleles appeared more frequently in AD patients with normal non-Cp-Cu [43 vs. 33 %; Pm = 0.03], while the haplotype containing the GT risk alleles appeared more frequently in the higher non-Cp-Cu AD (66 vs. 55 %; Pm = 0.01). Genetic heterogeneity sustains a copper AD metabolic subtype; non-Cp-Cu is a marker of this copper AD.

Fine Mapping and Functional Analysis of the Multiple Sclerosis Risk Gene CD6

PubMed Central

Swaminathan, Bhairavi; Cuapio, Angélica; Alloza, Iraide; Matesanz, Fuencisla; Alcina, Antonio; García-Barcina, Maria; Fedetz, Maria; Fernández, Óscar; Lucas, Miguel; Órpez, Teresa; Pinto-Medel, Mª Jesus; Otaegui, David; Olascoaga, Javier; Urcelay, Elena; Ortiz, Miguel A.; Arroyo, Rafael; Oksenberg, Jorge R.; Antigüedad, Alfredo; Tolosa, Eva; Vandenbroeck, Koen

2013-01-01

CD6 has recently been identified and validated as risk gene for multiple sclerosis (MS), based on the association of a single nucleotide polymorphism (SNP), rs17824933, located in intron 1. CD6 is a cell surface scavenger receptor involved in T-cell activation and proliferation, as well as in thymocyte differentiation. In this study, we performed a haptag SNP screen of the CD6 gene locus using a total of thirteen tagging SNPs, of which three were non-synonymous SNPs, and replicated the recently reported GWAS SNP rs650258 in a Spanish-Basque collection of 814 controls and 823 cases. Validation of the six most strongly associated SNPs was performed in an independent collection of 2265 MS patients and 2600 healthy controls. We identified association of haplotypes composed of two non-synonymous SNPs [rs11230563 (R225W) and rs2074225 (A257V)] in the 2nd SRCR domain with susceptibility to MS (P max(T) permutation = 1×10−4). The effect of these haplotypes on CD6 surface expression and cytokine secretion was also tested. The analysis showed significantly different CD6 expression patterns in the distinct cell subsets, i.e. – CD4+ naïve cells, P = 0.0001; CD8+ naïve cells, P<0.0001; CD4+ and CD8+ central memory cells, P = 0.01 and 0.05, respectively; and natural killer T (NKT) cells, P = 0.02; with the protective haplotype (RA) showing higher expression of CD6. However, no significant changes were observed in natural killer (NK) cells, effector memory and terminally differentiated effector memory T cells. Our findings reveal that this new MS-associated CD6 risk haplotype significantly modifies expression of CD6 on CD4+ and CD8+ T cells. PMID:23638056

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Opposing effects of the HLA-DRB1*0301-DQB1*0201 haplotype on the risk for multiple sclerosis in diverse Arab populations in Israel.

PubMed

Benedek, G; Paperna, T; Avidan, N; Lejbkowicz, I; Oksenberg, J R; Wang, J; Brautbar, C; Israel, S; Miller, A

2010-07-01

Different multiple sclerosis (MS) prevalence rates were reported for Muslim and Christian Arabs in Israel. In this study, we evaluated whether associations of human leukocyte antigen (HLA) genes with MS may contribute to this prevalence difference. DNA samples from Israeli Arab MS patients (n=109) and controls (n=132) were typed for HLA class I (HLA-A, -B and -C) and II (HLA-DRB1 and -DQB1) genes. Global comparisons of HLA allele frequencies revealed significant differences between Christians and Muslims; therefore, case-control analyses were stratified by religious affiliation. Disease characteristics of Muslim and Christian Arab MS patients were similar to those reported for European populations. Opposing association signals with MS were observed for alleles composing the DRB1*0301-DQB1*0201 haplotype: positive association of the HLA-DRB1*0301 allele in Muslims (P(Bonferroni)=0.004, odds ratio (OR)=3.07), and negative association in Christian Arabs (P(Bonferroni)=0.01, OR=0.12), with similar results obtained for HLA-DQB1*0201. HLA-B*52 was negatively associated with MS only in Muslims (P(Bonferroni)=0.01, OR=0.03). The study presents for the first time a high-resolution HLA gene analysis in clinically well-characterized Arab populations with MS, and shows the population-specific contribution of the DRB1*0301-DQB1*0201 haplotype to disease susceptibility.

Genetic variation in the oxytocin receptor (OXTR) gene is associated with Asperger Syndrome.

PubMed

Di Napoli, Agnese; Warrier, Varun; Baron-Cohen, Simon; Chakrabarti, Bhismadev

2014-01-01

Autism Spectrum Conditions (ASC) are a group of neurodevelopmental conditions characterized by impairments in communication and social interaction, alongside unusually repetitive behaviors and narrow interests. ASC are highly heritable and have complex patterns of inheritance where multiple genes are involved, alongside environmental and epigenetic factors. Asperger Syndrome (AS) is a subgroup of these conditions, where there is no history of language or cognitive delay. Animal models suggest a role for oxytocin (OXT) and oxytocin receptor (OXTR) genes in social-emotional behaviors, and several studies indicate that the oxytocin/oxytocin receptor system is altered in individuals with ASC. Previous studies have reported associations between genetic variations in the OXTR gene and ASC. The present study tested for an association between nine single nucleotide polymorphisms (SNPs) in the OXTR gene and AS in 530 individuals of Caucasian origin, using SNP association test and haplotype analysis. There was a significant association between rs2268493 in OXTR and AS. Multiple haplotypes that include this SNP (rs2268493-rs2254298, rs2268490-rs2268493-rs2254298, rs2268493-rs2254298-rs53576, rs237885-rs2268490-rs2268493-rs2254298, rs2268490-rs2268493-rs2254298-rs53576) were also associated with AS. rs2268493 has been previously associated with ASC and putatively alters several transcription factor-binding sites and regulates chromatin states, either directly or through other variants in linkage disequilibrium (LD). This study reports a significant association of the sequence variant rs2268493 in the OXTR gene and associated haplotypes with AS.

Genotype-Based Association Mapping of Complex Diseases: Gene-Environment Interactions with Multiple Genetic Markers and Measurement Error in Environmental Exposures

PubMed Central

Lobach, Irvna; Fan, Ruzone; Carroll, Raymond T.

2011-01-01

With the advent of dense single nucleotide polymorphism genotyping, population-based association studies have become the major tools for identifying human disease genes and for fine gene mapping of complex traits. We develop a genotype-based approach for association analysis of case-control studies of gene-environment interactions in the case when environmental factors are measured with error and genotype data are available on multiple genetic markers. To directly use the observed genotype data, we propose two genotype-based models: genotype effect and additive effect models. Our approach offers several advantages. First, the proposed risk functions can directly incorporate the observed genotype data while modeling the linkage disequihbrium information in the regression coefficients, thus eliminating the need to infer haplotype phase. Compared with the haplotype-based approach, an estimating procedure based on the proposed methods can be much simpler and significantly faster. In addition, there is no potential risk due to haplotype phase estimation. Further, by fitting the proposed models, it is possible to analyze the risk alleles/variants of complex diseases, including their dominant or additive effects. To model measurement error, we adopt the pseudo-likelihood method by Lobach et al. [2008]. Performance of the proposed method is examined using simulation experiments. An application of our method is illustrated using a population-based case-control study of association between calcium intake with the risk of colorectal adenoma development. PMID:21031455

Phenotypic and genotypic expression of self-incompatibility haplotypes in Arabidopsis lyrata suggests unique origin of alleles in different dominance classes.

PubMed

Prigoda, Nadia L; Nassuth, Annette; Mable, Barbara K

2005-07-01

The highly divergent alleles of the SRK gene in outcrossing Arabidopsis lyrata have provided important insights into the evolutionary history of self-incompatibility (SI) alleles and serve as an ideal model for studies of the evolutionary and molecular interactions between alleles in cell-cell recognition systems in general. One tantalizing question is how new specificities arise in systems that require coordination between male and female components. Allelic recruitment via gene conversion has been proposed as one possibility, based on the division of DNA sequences at the SRK locus into two distinctive groups: (1) sequences whose relationships are not well resolved and display the long branch lengths expected for a gene under balancing selection (Class A); and (2) sequences falling into a well-supported group with shorter branch lengths (Class B) that are closely related to an unlinked paralogous locus. The purpose of this study was to determine if differences in phenotype (site of expression assayed using allele-specific reverse transcription-polymerase chain reaction) or function (dominance relationships assayed through controlled pollinations) accompany the sequence-based classification. Expression of Class A alleles was restricted to floral tissues, as predicted for genes involved in the SI response. In contrast, Class B alleles, despite being tightly linked to the SI phenotype, were unexpectedly expressed in both leaves and floral tissues; the same pattern found for a related unlinked paralogous sequence. Whereas Class A included haplotypes in three different dominance classes, all Class B haplotypes were found to be recessive to all except one Class A haplotype. In addition, mapping of expression and dominance patterns onto an S-domain-based genealogy suggested that allelic dominance may be determined more by evolutionary history than by frequency-dependent selection for lowered dominance as some theories suggest. The possibility that interlocus gene conversion might have contributed to allelic diversity is discussed.

De novo assembly and phasing of a Korean human genome.

PubMed

Seo, Jeong-Sun; Rhie, Arang; Kim, Junsoo; Lee, Sangjin; Sohn, Min-Hwan; Kim, Chang-Uk; Hastie, Alex; Cao, Han; Yun, Ji-Young; Kim, Jihye; Kuk, Junho; Park, Gun Hwa; Kim, Juhyeok; Ryu, Hanna; Kim, Jongbum; Roh, Mira; Baek, Jeonghun; Hunkapiller, Michael W; Korlach, Jonas; Shin, Jong-Yeon; Kim, Changhoon

2016-10-13

Advances in genome assembly and phasing provide an opportunity to investigate the diploid architecture of the human genome and reveal the full range of structural variation across population groups. Here we report the de novo assembly and haplotype phasing of the Korean individual AK1 (ref. 1) using single-molecule real-time sequencing, next-generation mapping, microfluidics-based linked reads, and bacterial artificial chromosome (BAC) sequencing approaches. Single-molecule sequencing coupled with next-generation mapping generated a highly contiguous assembly, with a contig N50 size of 17.9 Mb and a scaffold N50 size of 44.8 Mb, resolving 8 chromosomal arms into single scaffolds. The de novo assembly, along with local assemblies and spanning long reads, closes 105 and extends into 72 out of 190 euchromatic gaps in the reference genome, adding 1.03 Mb of previously intractable sequence. High concordance between the assembly and paired-end sequences from 62,758 BAC clones provides strong support for the robustness of the assembly. We identify 18,210 structural variants by direct comparison of the assembly with the human reference, identifying thousands of breakpoints that, to our knowledge, have not been reported before. Many of the insertions are reflected in the transcriptome and are shared across the Asian population. We performed haplotype phasing of the assembly with short reads, long reads and linked reads from whole-genome sequencing and with short reads from 31,719 BAC clones, thereby achieving phased blocks with an N50 size of 11.6 Mb. Haplotigs assembled from single-molecule real-time reads assigned to haplotypes on phased blocks covered 89% of genes. The haplotigs accurately characterized the hypervariable major histocompatability complex region as well as demonstrating allele configuration in clinically relevant genes such as CYP2D6. This work presents the most contiguous diploid human genome assembly so far, with extensive investigation of unreported and Asian-specific structural variants, and high-quality haplotyping of clinically relevant alleles for precision medicine.

A combined long-range phasing and long haplotype imputation method to impute phase for SNP genotypes

PubMed Central

2011-01-01

Background Knowing the phase of marker genotype data can be useful in genome-wide association studies, because it makes it possible to use analysis frameworks that account for identity by descent or parent of origin of alleles and it can lead to a large increase in data quantities via genotype or sequence imputation. Long-range phasing and haplotype library imputation constitute a fast and accurate method to impute phase for SNP data. Methods A long-range phasing and haplotype library imputation algorithm was developed. It combines information from surrogate parents and long haplotypes to resolve phase in a manner that is not dependent on the family structure of a dataset or on the presence of pedigree information. Results The algorithm performed well in both simulated and real livestock and human datasets in terms of both phasing accuracy and computation efficiency. The percentage of alleles that could be phased in both simulated and real datasets of varying size generally exceeded 98% while the percentage of alleles incorrectly phased in simulated data was generally less than 0.5%. The accuracy of phasing was affected by dataset size, with lower accuracy for dataset sizes less than 1000, but was not affected by effective population size, family data structure, presence or absence of pedigree information, and SNP density. The method was computationally fast. In comparison to a commonly used statistical method (fastPHASE), the current method made about 8% less phasing mistakes and ran about 26 times faster for a small dataset. For larger datasets, the differences in computational time are expected to be even greater. A computer program implementing these methods has been made available. Conclusions The algorithm and software developed in this study make feasible the routine phasing of high-density SNP chips in large datasets. PMID:21388557

High-Resolution Genotyping of the Endemic Salmonella Typhi Population during a Vi (Typhoid) Vaccination Trial in Kolkata

PubMed Central

Manna, Byomkesh; Bhattacharya, Sujit K.; Bhaduri, Barnali; Pickard, Derek J.; Ochiai, R. Leon; Ali, Mohammad; Clemens, John D.; Dougan, Gordon

2012-01-01

Background Typhoid fever, caused by Salmonella enterica serovar Typhi (S. Typhi), is a major health problem especially in developing countries. Vaccines against typhoid are commonly used by travelers but less so by residents of endemic areas. Methodology We used single nucleotide polymorphism (SNP) typing to investigate the population structure of 372 S. Typhi isolated during a typhoid disease burden study and Vi vaccine trial in Kolkata, India. Approximately sixty thousand people were enrolled for fever surveillance for 19 months prior to, and 24 months following, Vi vaccination of one third of the study population (May 2003–December 2006, vaccinations given December 2004). Principal Findings A diverse S. Typhi population was detected, including 21 haplotypes. The most common were of the H58 haplogroup (69%), which included all multidrug resistant isolates (defined as resistance to chloramphenicol, ampicillin and co-trimoxazole). Quinolone resistance was particularly high among H58-G isolates (97% Nalidixic acid resistant, 30% with reduced susceptibility to ciprofloxacin). Multiple typhoid fever episodes were detected in 22 households, however household clustering was not associated with specific S. Typhi haplotypes. Conclusions Typhoid fever in Kolkata is caused by a diverse population of S. Typhi, however H58 haplotypes dominate and are associated with multidrug and quinolone resistance. Vi vaccination did not obviously impact on the haplotype population structure of the S. Typhi circulating during the study period. PMID:22303491

Genetic variants in PNPLA3 and risk of non-alcoholic fatty liver disease in a Han Chinese population.

PubMed

Peng, Xian-E; Wu, Yun-Li; Lin, Shao-Wei; Lu, Qing-Qing; Hu, Zhi-Jian; Lin, Xu

2012-01-01

We investigated the possible association between genetic variants in the Patatin like phospholipase-3 (PNPLA3) gene and nonalcoholic fatty liver disease (NAFLD) in a Han Chinese population. We evaluated twelve tagging single-nucleotide polymorphisms (tSNPs) of the PNPLA3 gene in a frequency matched case-control study from Fuzhou city of China (553 cases, 553 controls). In the multivariate logistic regression analysis, the rs738409 GG or GC, and rs139051 TT genotypes were found to be associated with increased risk of NAFLD, and a significant trend of increased risk with increasing numbers of risk genotype was observed in the cumulative effect analysis of these single nucleotide polymorphisms. Furthermore, haplotype association analysis showed that, compared with the most common haplotype, the CAAGAATGCGTG and CGAAGGTGTCCG haplotypes conferred a statistically significant increased risk for NAFLD, while the CGGGAACCCGCG haplotype decreased the risk of NAFLD. Moreover, rs738409 C>G appeared to have a multiplicative joint effect with tea drinking (P<0.005) and an additive joint effect with obesity (Interaction contrast ratio (ICR) = 2.31, 95% CI: 0.7-8.86), hypertriglyceridemia (ICR = 3.07, 95% CI: 0.98-5.09) or hypertension (ICR = 1.74, 95% CI: 0.52-3.12). Our data suggests that PNPLA3 genetic polymorphisms might influence the susceptibility to NAFLD development independently or jointly in Han Chinese.

Major soybean maturity gene haplotypes revealed by SNPViz analysis of 72 sequenced soybean genomes

USDA-ARS?s Scientific Manuscript database

In this Genomics Era, vast amounts of next generation sequencing data have become publicly-available for multiple genomes across hundreds of species. Analysis of these large-scale datasets can become cumbersome, especially when comparing nucleotide polymorphisms across many samples within a dataset...

Fitness consequences of parental compatibility in the frog Crinia georgiana.

PubMed

Dziminski, Martin A; Roberts, J Dale; Simmons, Leigh W

2008-04-01

Theory suggests that multiple mating by females can evolve as a mechanism for acquiring compatible genes that promote offspring fitness. Genetic compatibility models predict that differences in fitness among offspring arise from interactions between male and female haplotypes. Using a cross-classified breeding design and in vitro fertilization, we raised families of maternal and paternal half-siblings of the frog Crinia georgiana, a species with a polyandrous breeding system and external fertilization. After controlling for variation in maternal provisioning, we found significant effects of interacting parental haplotypes on fertilization success, and nonadditive genetic effects on measures of offspring fitness such as embryo survival, and survival to, size at, and time to metamorphosis. Additive genetic variation due to males and females was negligible, and not statistically significant for any of the fitness traits measured. Combinations of parental haplotypes that resulted in high rates of fertilization produced offspring with higher embryo survival and rapid juvenile development. We suggest that a gamete recognition mechanism for selective fertilization by compatible sperm may promote offspring fitness in this system.

Genetic diversity of Taenia asiatica from Thailand and other geographical locations as revealed by cytochrome c oxidase subunit 1 sequences.

PubMed

Anantaphruti, Malinee Thairungroj; Thaenkham, Urusa; Watthanakulpanich, Dorn; Phuphisut, Orawan; Maipanich, Wanna; Yoonuan, Tippayarat; Nuamtanong, Supaporn; Pubampen, Somjit; Sanguankiat, Surapol

2013-02-01

Twelve 924 bp cytochrome c oxidase subunit 1 (cox1) mitochondrial DNA sequences from Taenia asiatica isolates from Thailand were aligned and compared with multiple sequence isolates from Thailand and 6 other countries from the GenBank database. The genetic divergence of T. asiatica was also compared with Taenia saginata database sequences from 6 different countries in Asia, including Thailand, and 3 countries from other continents. The results showed that there were minor genetic variations within T. asiatica species, while high intraspecies variation was found in T. saginata. There were only 2 haplotypes and 1 polymorphic site found in T. asiatica, but 8 haplotypes and 9 polymorphic sites in T. saginata. Haplotype diversity was very low, 0.067, in T. asiatica and high, 0.700, in T. saginata. The very low genetic diversity suggested that T. asiatica may be at a risk due to the loss of potential adaptive alleles, resulting in reduced viability and decreased responses to environmental changes, which may endanger the species.

Genetic Diversity of Taenia asiatica from Thailand and Other Geographical Locations as Revealed by Cytochrome c Oxidase Subunit 1 Sequences

PubMed Central

Thaenkham, Urusa; Watthanakulpanich, Dorn; Phuphisut, Orawan; Maipanich, Wanna; Yoonuan, Tippayarat; Nuamtanong, Supaporn; Pubampen, Somjit; Sanguankiat, Surapol

2013-01-01

Twelve 924 bp cytochrome c oxidase subunit 1 (cox1) mitochondrial DNA sequences from Taenia asiatica isolates from Thailand were aligned and compared with multiple sequence isolates from Thailand and 6 other countries from the GenBank database. The genetic divergence of T. asiatica was also compared with Taenia saginata database sequences from 6 different countries in Asia, including Thailand, and 3 countries from other continents. The results showed that there were minor genetic variations within T. asiatica species, while high intraspecies variation was found in T. saginata. There were only 2 haplotypes and 1 polymorphic site found in T. asiatica, but 8 haplotypes and 9 polymorphic sites in T. saginata. Haplotype diversity was very low, 0.067, in T. asiatica and high, 0.700, in T. saginata. The very low genetic diversity suggested that T. asiatica may be at a risk due to the loss of potential adaptive alleles, resulting in reduced viability and decreased responses to environmental changes, which may endanger the species. PMID:23467439

HIGH-THROUGHPUT IDENTIFICATION OF THE PREDOMINANT MALARIA PARASITE CLONE IN COMPLEX BLOOD STAGE INFECTIONS USING A MULTI-SNP MOLECULAR HAPLOTYPING ASSAY

PubMed Central

COLE-TOBIAN, JENNIFER L.; ZIMMERMAN, PETER A.; KING, CHRISTOPHER L.

2013-01-01

Individuals living in malaria endemic areas are often infected with multiple parasite clones. Currently used single nucleotide polymorphism (SNP) genotyping methods for malaria parasites are cumbersome; furthermore, few methods currently exist that can rapidly determine the most abundant clone in these complex infections. Here we describe an oligonucleotide ligation assay (OLA) to distinguish SNPs in the Plasmodium vivax Duffy binding protein gene (Pvdbp) at 14 polymorphic residues simultaneously. Allele abundance is determined by the highest mean fluorescent intensity of each allele. Using mixtures of plasmids encoding known haplotypes of the Pvdbp, single clones of P. vivax parasites from infected Aotus monkeys, and well-defined mixed infections from field samples, we were able to identify the predominant Pvdbp genotype with > 93% accuracy when the dominant clone is twice as abundant as a lesser genotype and > 97% of the time if the ratio was 5:1 or greater. Thus, the OLA can accurately, reproducibly, and rapidly determine the predominant parasite haplotype in complex blood stage infections. PMID:17255222

Genetic Variability of the Invasive Species Metcalfa pruinosa (Hemiptera: Flatidae) in the Republic of Korea.

PubMed

Park, Chang-Gyu; Min, Sujeong; Lee, Gwan-Seok; Kim, Sora; Lee, Yerim; Lee, Seunghwan; Hong, Ki-Jeong; Wilson, Stephen W; Akimoto, Shin-Ichi; Lee, Wonhoon

2016-08-01

Metcalfa pruinosa (Say, 1830) (Hemiptera: Flatidae) has caused substantial agricultural damage since its recent introduction to the Republic of Korea; however, the source of this introduction is still unclear. To examine the genetic divergence and phylogenetic relationships among several populations of M. pruinosa from Korea and foreign countries, 251 COI sequences from 251 samples collected from Korea, France, Italy, Spain, Slovenia, and the United States were newly analyzed, together with seven published COI sequences from Canada. In total, 19 haplotypes were detected from the 258 COI sequences, and three haplotypes, H1, H3, and H9, were detected from samples in Korea. The MJ network and Bayesian inference revealed that the three haplotypes of Korea were closely connected with samples of Italy, Spain, Slovenia, France, and the United States. Our study revealed the possibility of multiple invasions of M. pruinosa from Europe and/or North America into Korea. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Family-based association study of ITGB3 in autism spectrum disorder and its endophenotypes.

PubMed

Napolioni, Valerio; Lombardi, Federica; Sacco, Roberto; Curatolo, Paolo; Manzi, Barbara; Alessandrelli, Riccardo; Militerni, Roberto; Bravaccio, Carmela; Lenti, Carlo; Saccani, Monica; Schneider, Cindy; Melmed, Raun; Pascucci, Tiziana; Puglisi-Allegra, Stefano; Reichelt, Karl-Ludvig; Rousseau, Francis; Lewin, Patricia; Persico, Antonio M

2011-03-01

The integrin-β 3 gene (ITGB3), located on human chromosome 17q21.3, was previously identified as a quantitative trait locus (QTL) for 5-HT blood levels and has been implicated as a candidate gene for autism spectrum disorder (ASD). We performed a family-based association study in 281 simplex and 12 multiplex Caucasian families. ITGB3 haplotypes are significantly associated with autism (HBAT, global P=0.038). Haplotype H3 is largely over-transmitted to the affected offspring and doubles the risk of an ASD diagnosis (HBAT P=0.005; odds ratio (OR)=2.000), at the expense of haplotype H1, which is under-transmitted (HBAT P=0.018; OR=0.725). These two common haplotypes differ only at rs12603582 located in intron 11, which reaches a P-value of 0.072 in single-marker FBAT analyses. Interestingly, rs12603582 is strongly associated with pre-term delivery in our ASD patients (P=0.008). On the other hand, it is SNP rs2317385, located at the 5' end of the gene, that significantly affects 5-HT blood levels (Mann-Whitney U-test, P=0.001; multiple regression analysis, P=0.010). No gene-gene interaction between ITGB3 and SLC6A4 has been detected. In conclusion, we identify a significant association between a common ITGB3 haplotype and ASD. Distinct markers, located toward the 5' and 3' ends of the gene, seemingly modulate 5-HT blood levels and autism liability, respectively. Our results also raise interest into ITGB3 influences on feto-maternal immune interactions in autism. © 2011 Macmillan Publishers Limited All rights reserved 1018-4813/11

Family-based association study of ITGB3 in autism spectrum disorder and its endophenotypes

PubMed Central

Napolioni, Valerio; Lombardi, Federica; Sacco, Roberto; Curatolo, Paolo; Manzi, Barbara; Alessandrelli, Riccardo; Militerni, Roberto; Bravaccio, Carmela; Lenti, Carlo; Saccani, Monica; Schneider, Cindy; Melmed, Raun; Pascucci, Tiziana; Puglisi-Allegra, Stefano; Reichelt, Karl-Ludvig; Rousseau, Francis; Lewin, Patricia; Persico, Antonio M

2011-01-01

The integrin-β 3 gene (ITGB3), located on human chromosome 17q21.3, was previously identified as a quantitative trait locus (QTL) for 5-HT blood levels and has been implicated as a candidate gene for autism spectrum disorder (ASD). We performed a family-based association study in 281 simplex and 12 multiplex Caucasian families. ITGB3 haplotypes are significantly associated with autism (HBAT, global P=0.038). Haplotype H3 is largely over-transmitted to the affected offspring and doubles the risk of an ASD diagnosis (HBAT P=0.005; odds ratio (OR)=2.000), at the expense of haplotype H1, which is under-transmitted (HBAT P=0.018; OR=0.725). These two common haplotypes differ only at rs12603582 located in intron 11, which reaches a P-value of 0.072 in single-marker FBAT analyses. Interestingly, rs12603582 is strongly associated with pre-term delivery in our ASD patients (P=0.008). On the other hand, it is SNP rs2317385, located at the 5′ end of the gene, that significantly affects 5-HT blood levels (Mann–Whitney U-test, P=0.001; multiple regression analysis, P=0.010). No gene–gene interaction between ITGB3 and SLC6A4 has been detected. In conclusion, we identify a significant association between a common ITGB3 haplotype and ASD. Distinct markers, located toward the 5′ and 3′ ends of the gene, seemingly modulate 5-HT blood levels and autism liability, respectively. Our results also raise interest into ITGB3 influences on feto–maternal immune interactions in autism. PMID:21102624

Balancing Selection on a Regulatory Region Exhibiting Ancient Variation That Predates Human–Neandertal Divergence

PubMed Central

Iskow, Rebecca C.; Austermann, Christian; Scharer, Christopher D.; Raj, Towfique; Boss, Jeremy M.; Sunyaev, Shamil; Price, Alkes; Stranger, Barbara; Simon, Viviana; Lee, Charles

2013-01-01

Ancient population structure shaping contemporary genetic variation has been recently appreciated and has important implications regarding our understanding of the structure of modern human genomes. We identified a ∼36-kb DNA segment in the human genome that displays an ancient substructure. The variation at this locus exists primarily as two highly divergent haplogroups. One of these haplogroups (the NE1 haplogroup) aligns with the Neandertal haplotype and contains a 4.6-kb deletion polymorphism in perfect linkage disequilibrium with 12 single nucleotide polymorphisms (SNPs) across diverse populations. The other haplogroup, which does not contain the 4.6-kb deletion, aligns with the chimpanzee haplotype and is likely ancestral. Africans have higher overall pairwise differences with the Neandertal haplotype than Eurasians do for this NE1 locus (p<10−15). Moreover, the nucleotide diversity at this locus is higher in Eurasians than in Africans. These results mimic signatures of recent Neandertal admixture contributing to this locus. However, an in-depth assessment of the variation in this region across multiple populations reveals that African NE1 haplotypes, albeit rare, harbor more sequence variation than NE1 haplotypes found in Europeans, indicating an ancient African origin of this haplogroup and refuting recent Neandertal admixture. Population genetic analyses of the SNPs within each of these haplogroups, along with genome-wide comparisons revealed significant FST (p = 0.00003) and positive Tajima's D (p = 0.00285) statistics, pointing to non-neutral evolution of this locus. The NE1 locus harbors no protein-coding genes, but contains transcribed sequences as well as sequences with putative regulatory function based on bioinformatic predictions and in vitro experiments. We postulate that the variation observed at this locus predates Human–Neandertal divergence and is evolving under balancing selection, especially among European populations. PMID:23593015

Autosomal dominant retinitis pigmentosa with macular involvement associated with a disease haplotype that included a novel PRPH2 variant (p.Cys250Gly).

PubMed

Katagiri, Satoshi; Hayashi, Takaaki; Mizobuchi, Kei; Yoshitake, Kazutoshi; Iwata, Takeshi; Nakano, Tadashi

2018-06-01

It is known that PRPH2 variants appear to be rare causes of retinitis pigmentosa (RP) in the Japanese population. The purpose of this study was to describe clinical and genetic features in autosomal dominant RP (adRP) patients with a novel disease-causing variant in the PRHP2 gene. A total of 57 unrelated Japanese probands with adRP were investigated in this study. Comprehensive ophthalmic examinations include fundus photography, fundus autofluorescence imaging, spectral-domain optical coherence tomography, and electroretinography. Whole exome sequencing or Sanger sequencing for 25 targeted exons of multiple genes causing adRP was performed to identify disease-causing variants. Co-segregation and haplotype analyses were performed to determine a disease-causing gene variant and its haplotype. Genetic analysis identified a novel heterozygous PRPH2 variant (c.748T>G, p.Cys250Gly) as disease causing in four probands from four families. The variant co-segregated with the RP phenotype in the eight affected patients in all families. At least three of the four families shared the same haplotype for the variant allele. Clinically, seven of the eight affected patients exhibited typical RP presentation, as well as variable macular involvement including cystoid macular change, vitelliform-like appearance, choroidal neovascularization, and macular atrophy. The same disease haplotype that included a novel PRPH2 variant (p.Cys250Gly) was identified in three of the four Japanese families with adRP, suggesting a founder effect. Our clinical findings indicate that adRP caused by the p.Cys250Gly variant may accompany macular involvement with high frequency.

Age at cancer onset in germline TP53 mutation carriers: association with polymorphisms in predicted G-quadruplex structures

PubMed Central

Hainaut, Pierre

2014-01-01

Germline TP53 mutations predispose to multiple cancers defining Li-Fraumeni/Li-Fraumeni-like syndrome (LFS/LFL), a disease with large individual disparities in cancer profiles and age of onset. G-quadruplexes (G4s) are secondary structural motifs occurring in guanine tracks, with regulatory effects on DNA and RNA. We analyzed 85 polymorphisms within or near five predicted G4s in TP53 in search of modifiers of penetrance of LFS/LFL in Brazilian cancer families with (n = 35) or without (n = 110) TP53 mutations. Statistical analyses stratified on family structure showed that cancer tended to occur ~15 years later in mutation carriers who also carried the variant alleles of two polymorphisms within predicted G4-forming regions, rs17878362 (TP53 PIN3, 16 bp duplication in intron 3; P = 0.082) and rs17880560 (6 bp duplication in 3′ flanking region; P = 0.067). Haplotype analysis showed that this inverse association was driven by the polymorphic status of the remaining wild-type (WT) haplotype in mutation carriers: in carriers with a WT haplotype containing at least one variant allele of rs17878362 or rs17880560, cancer occurred ~15 years later than in carriers with other WT haplotypes (P = 0.019). No effect on age of cancer onset was observed in subjects without a TP53 mutation. The G4 in intron 3 has been shown to regulate alternative p53 messenger RNA splicing, whereas the biological roles of predicted G4s in the 3′ flanking region remain to be elucidated. In conclusion, this study demonstrates that G4 polymorphisms in haplotypes of the WT TP53 allele have an impact on LFS/LFL penetrance in germline TP53 mutation carriers. PMID:24336192

Evolutionary history of the European whitefish Coregonus lavaretus (L.) species complex as inferred from mtDNA phylogeography and gill-raker numbers.

PubMed

Østbye, K; Bernatchez, L; Naesje, T F; Himberg, K-J M; Hindar, K

2005-12-01

We compared mitochondrial DNA and gill-raker number variation in populations of the European whitefish Coregonus lavaretus (L.) species complex to illuminate their evolutionary history, and discuss mechanisms behind diversification. Using single-strand conformation polymorphism (SSCP) and sequencing 528 bp of combined parts of the cytochrome oxidase b (cyt b) and NADH dehydrogenase subunit 3 (ND3) mithochondrial DNA (mtDNA) regions, we documented phylogeographic relationships among populations and phylogeny of mtDNA haplotypes. Demographic events behind geographical distribution of haplotypes were inferred using nested clade analysis (NCA) and mismatch distribution. Concordance between operational taxonomical groups, based on gill-raker numbers, and mtDNA patterns was tested. Three major mtDNA clades were resolved in Europe: a North European clade from northwest Russia to Denmark, a Siberian clade from the Arctic Sea to southwest Norway, and a South European clade from Denmark to the European Alps, reflecting occupation in different glacial refugia. Demographic events inferred from NCA were isolation by distance, range expansion, and fragmentation. Mismatch analysis suggested that clades which colonized Fennoscandia and the Alps expanded in population size 24 500-5800 years before present, with minute female effective population sizes, implying small founder populations during colonization. Gill-raker counts did not commensurate with hierarchical mtDNA clades, and poorly with haplotypes, suggesting recent origin of gill-raker variation. Whitefish designations based on gill-raker numbers were not associated with ancient clades. Lack of congruence in morphology and evolutionary lineages implies that the taxonomy of this species complex should be reconsidered.

Linkage Disequilibrium Mapping in Domestic Dog Breeds Narrows the Progressive Rod-Cone Degeneration (prcd) Interval and Identifies Ancestral Disease Transmitting Chromosome

PubMed Central

Goldstein, Orly; Zangerl, Barbara; Pearce-Kelling, Sue; Sidjanin, Duska J.; Kijas, James W.; Felix, Jeanette; Acland, Gregory M; Aguirre, Gustavo D.

2014-01-01

Canine progressive rod-cone degeneration (prcd) is a retinal disease previously mapped to a broad, gene-rich centromeric region of canine chromosome 9. As allelic disorders are present in multiple breeds, we used linkage disequilibrium (LD) to narrow the ∼6.4 Mb interval candidate region. Multiple dog breeds, each representing genetically isolated populations, were typed for SNPs and other polymorphisms identified from BACs. The candidate region was initially localized to a 1.5 Mb zero recombination interval between growth factor receptor-bound protein 2 (GRB2) and SEC14-like 1 (SEC14L). A fine-scale haplotype of the region was developed which reduced the LD interval to 106 Kb, and identified a conserved haplotype of 98 polymorphisms present in all prcd-affected chromosomes from 14 different dog breeds. The findings strongly suggest that a common ancestor transmitted the prcd disease allele to many of the modern dog breeds, and demonstrate the power of LD approach in the canine model. PMID:16859891

Molecular taxonomic analysis of the plant associations of adult pollen beetles (Nitidulidae: Meligethinae), and the population structure of Brassicogethes aeneus.

PubMed

Ouvrard, Pierre; Hicks, Damien M; Mouland, Molly; Nicholls, James A; Baldock, Katherine C R; Goddard, Mark A; Kunin, William E; Potts, Simon G; Thieme, Thomas; Veromann, Eve; Stone, Graham N

2016-12-01

Pollen beetles (Nitidulidae: Meligethinae) are among the most abundant flower-visiting insects in Europe. While some species damage millions of hectares of crops annually, the biology of many species is little known. We assessed the utility of a 797 base pair fragment of the cytochrome oxidase 1 gene to resolve molecular operational taxonomic units (MOTUs) in 750 adult pollen beetles sampled from flowers of 63 plant species sampled across the UK and continental Europe. We used the same locus to analyse region-scale patterns in population structure and demography in an economically important pest, Brassicogethes aeneus. We identified 44 Meligethinae at ∼2% divergence, 35 of which contained published sequences. A few specimens could not be identified because the MOTUs containing them included published sequences for multiple Linnaean species, suggesting either retention of ancestral haplotype polymorphism or identification errors in published sequences. Over 90% of UK specimens were identifiable as B. aeneus. Plant associations of adult B. aeneus were found to be far wider taxonomically than for their larvae. UK B. aeneus populations showed contrasting affiliations between the north (most similar to Scandinavia and the Baltic) and south (most similar to western continental Europe), with strong signatures of population growth in the south.

Sunflower domestication alleles support single domestication center in eastern North America

PubMed Central

Blackman, Benjamin K.; Scascitelli, Moira; Kane, Nolan C.; Luton, Harry H.; Rasmussen, David A.; Bye, Robert A.; Lentz, David L.; Rieseberg, Loren H.

2011-01-01

Phylogenetic analyses of genes with demonstrated involvement in evolutionary transitions can be an important means of resolving conflicting hypotheses about evolutionary history or process. In sunflower, two genes have previously been shown to have experienced selective sweeps during its early domestication. In the present study, we identified a third candidate early domestication gene and conducted haplotype analyses of all three genes to address a recent, controversial hypothesis about the origin of cultivated sunflower. Although the scientific consensus had long been that sunflower was domesticated once in eastern North America, the discovery of pre-Columbian sunflower remains at archaeological sites in Mexico led to the proposal of a second domestication center in southern Mexico. Previous molecular studies with neutral markers were consistent with the former hypothesis. However, only two indigenous Mexican cultivars were included in these studies, and their provenance and genetic purity have been questioned. Therefore, we sequenced regions of the three candidate domestication genes containing SNPs diagnostic for domestication from large, newly collected samples of Mexican sunflower landraces and Mexican wild populations from a broad geographic range. The new germplasm also was genotyped for 12 microsatellite loci. Our evidence from multiple evolutionarily important loci and from neutral markers supports a single domestication event for extant cultivated sunflower in eastern North America. PMID:21844335

The analysis of APOL1 genetic variation and haplotype diversity provided by 1000 Genomes project.

PubMed

Peng, Ting; Wang, Li; Li, Guisen

2017-08-11

The APOL1 gene variants has been shown to be associated with an increased risk of multiple kinds of diseases, particularly in African Americans, but not in Caucasians and Asians. In this study, we explored the single nucleotide polymorphism (SNP) and haplotype diversity of APOL1 gene in different races provided by 1000 Genomes project. Variants of APOL1 gene in 1000 Genome Project were obtained and SNPs located in the regulatory region or coding region were selected for genetic variation analysis. Total 2504 individuals from 26 populations were classified as four groups that included Africa, Europe, Asia and Admixed populations. Tag SNPs were selected to evaluate the haplotype diversities in the four populations by HaploStats software. APOL1 gene was surrounded by some of the most polymorphic genes in the human genome, variation of APOL1 gene was common, with up to 613 SNP (1000 Genome Project reported) and 99 of them (16.2%) with MAF ≥ 1%. There were 79 SNPs in the URR and 92 SNPs in 3'UTR. Total 12 SNPs in URR and 24 SNPs in 3'UTR were considered as common variants with MAF ≥ 1%. It is worth noting that URR-1 was presents lower frequencies in European populations, while other three haplotypes taken an opposite pattern; 3'UTR presents several high-frequency variation sites in a short segment, and the differences of its haplotypes among different population were significant (P < 0.01), UTR-1 and UTR-5 presented much higher frequency in African population, while UTR-2, UTR-3 and UTR-4 were much lower. APOL1 coding region showed that two SNP of G1 with higher frequency are actually pull down the haplotype H-1 frequency when considering all populations pooled together, and the diversity among the four populations be widen by the G1 two mutation (P 1  = 3.33E-4 vs P 2  = 3.61E-30). The distributions of APOL1 gene variants and haplotypes were significantly different among the different populations, in either regulatory or coding regions. It could provide clues for the future genetic study of APOL1 related diseases.

Software for optimization of SNP and PCR-RFLP genotyping to discriminate many genomes with the fewest assays

PubMed Central

Gardner, Shea N; Wagner, Mark C

2005-01-01

Background Microbial forensics is important in tracking the source of a pathogen, whether the disease is a naturally occurring outbreak or part of a criminal investigation. Results A method and SPR Opt (SNP and PCR-RFLP Optimization) software to perform a comprehensive, whole-genome analysis to forensically discriminate multiple sequences is presented. Tools for the optimization of forensic typing using Single Nucleotide Polymorphism (SNP) and PCR-Restriction Fragment Length Polymorphism (PCR-RFLP) analyses across multiple isolate sequences of a species are described. The PCR-RFLP analysis includes prediction and selection of optimal primers and restriction enzymes to enable maximum isolate discrimination based on sequence information. SPR Opt calculates all SNP or PCR-RFLP variations present in the sequences, groups them into haplotypes according to their co-segregation across those sequences, and performs combinatoric analyses to determine which sets of haplotypes provide maximal discrimination among all the input sequences. Those set combinations requiring that membership in the fewest haplotypes be queried (i.e. the fewest assays be performed) are found. These analyses highlight variable regions based on existing sequence data. These markers may be heterogeneous among unsequenced isolates as well, and thus may be useful for characterizing the relationships among unsequenced as well as sequenced isolates. The predictions are multi-locus. Analyses of mumps and SARS viruses are summarized. Phylogenetic trees created based on SNPs, PCR-RFLPs, and full genomes are compared for SARS virus, illustrating that purported phylogenies based only on SNP or PCR-RFLP variations do not match those based on multiple sequence alignment of the full genomes. Conclusion This is the first software to optimize the selection of forensic markers to maximize information gained from the fewest assays, accepting whole or partial genome sequence data as input. As more sequence data becomes available for multiple strains and isolates of a species, automated, computational approaches such as those described here will be essential to make sense of large amounts of information, and to guide and optimize efforts in the laboratory. The software and source code for SPR Opt is publicly available and free for non-profit use at . PMID:15904493

Genetic Variants in PNPLA3 and Risk of Non-Alcoholic Fatty Liver Disease in a Han Chinese Population

PubMed Central

Lin, Shao-Wei; Lu, Qing-Qing; Hu, Zhi-Jian; Lin, Xu

2012-01-01

We investigated the possible association between genetic variants in the Patatin like phospholipase-3 (PNPLA3) gene and nonalcoholic fatty liver disease (NAFLD) in a Han Chinese population. We evaluated twelve tagging single-nucleotide polymorphisms (tSNPs) of the PNPLA3 gene in a frequency matched case–control study from Fuzhou city of China (553 cases, 553 controls). In the multivariate logistic regression analysis, the rs738409 GG or GC, and rs139051 TT genotypes were found to be associated with increased risk of NAFLD, and a significant trend of increased risk with increasing numbers of risk genotype was observed in the cumulative effect analysis of these single nucleotide polymorphisms. Furthermore, haplotype association analysis showed that, compared with the most common haplotype, the CAAGAATGCGTG and CGAAGGTGTCCG haplotypes conferred a statistically significant increased risk for NAFLD, while the CGGGAACCCGCG haplotype decreased the risk of NAFLD. Moreover, rs738409 C>G appeared to have a multiplicative joint effect with tea drinking (P<0.005) and an additive joint effect with obesity (Interaction contrast ratio (ICR) = 2.31, 95% CI: 0.7–8.86), hypertriglyceridemia (ICR = 3.07, 95% CI: 0.98–5.09) or hypertension (ICR = 1.74, 95% CI: 0.52–3.12). Our data suggests that PNPLA3 genetic polymorphisms might influence the susceptibility to NAFLD development independently or jointly in Han Chinese. PMID:23226254

Mapping of a Major QTL for Ceratocystis Wilt Disease in an F1 Population of Theobroma cacao.

PubMed

Fernandes, Luciel Dos Santos; Royaert, Stefan; Corrêa, Fábio M; Mustiga, Guiliana M; Marelli, Jean-Philippe; Corrêa, Ronan X; Motamayor, Juan C

2018-01-01

Cacao is an important crop, its beans are key raw materials for the chocolate and cosmetic industries. Ceratocystis wilt of cacao (CWC) caused by Ceratocystis cacaofunesta is a lethal disease for the crop. Therefore, the selection of resistant cacao varieties is one of the viable ways to minimize losses in cacao production. In this paper, we described the identification of a major QTL associated with CWC in an F1 mapping population from a cross between a resistant, "TSH 1188," and a susceptible genotype, "CCN 51." A set of 266 trees were genotyped using 3,526 single nucleotide polymorphic markers and then multiple QTL mapping analyses were performed. Two QTLs were identified on chromosomes IV and VI. The major QTL was located at 20 cM from the top position of chromosome VI, accounting for more than 60% of the phenotypic variation. The favorable allele T1, with haplotype GTT, came from the "TSH 1188" parent. It was evident that the haplotype combination T1C2 on chromosome VI was the most significant for resistance, since 93% of resistant trees had this haplotype. The major QTL converged to a genomic region of 739.4 kb that harbored nine candidate genes, including two major classes of resistance genes, which would make them the primary candidates involved in the resistance to CWC. The haplotypes detected are now used to improve the efficiency and precision of the selection of resistant trees in cacao breeding.

Association of Phosphodiesterase 4D with ischemic stroke: a population-based case-control study.

PubMed

Woo, Daniel; Kaushal, Ritesh; Kissela, Brett; Sekar, Padmini; Wolujewicz, Michael; Pal, Prodipto; Alwell, Kathleen; Haverbusch, Mary; Ewing, Irene; Miller, Rosie; Kleindorfer, Dawn; Flaherty, Matthew; Chakraborty, Ranajit; Deka, Ranjan; Broderick, Joseph

2006-02-01

The Phosphodiesterase 4D (PDE4D) gene was reported recently to be associated with ischemic stroke in an Icelandic population. The association was found predominately with large vessel and cardioembolic stroke. However, 2 recent reports were unable to confirm this association, although a trend toward association with cardioembolic stroke was reported. None of the reports included significant proportions of blacks. We tested for genotype and haplotype association of polymorphisms of the PDE4D gene with ischemic stroke in a population-based, biracial, case-control study. A total of 357 cases of ischemic stroke and 482 stroke-free controls from the same community were examined. Single nucleotide polymorphisms (SNPs) were chosen based on significant associations reported previously. Linkage disequilibrium (LD), SNP, and haplotype association analysis was performed using PHASE 2.0 and Haploview 3.2. Although several univariate associations were identified, only 1 SNP (rs2910829) was found to be significantly associated with cardioembolic stroke among both whites and blacks. The rs152312 SNP was associated with cardioembolic stroke among whites after multiple comparison corrections. The same SNP was not associated with cardioembolic stroke among blacks. However, significant haplotype association was identified for both whites and blacks for all ischemic stroke, cardioembolic stroke, and stroke of unknown origin. Haplotype association was identified for small vessel stroke among whites. PDE4D is a risk factor for ischemic stroke and, in particular, for cardioembolic stroke, among whites and blacks. Further study of this gene is warranted.

DNA analysis of ancient dogs of the Americas: identifying possible founding haplotypes and reconstructing population histories.

PubMed

Witt, Kelsey E; Judd, Kathleen; Kitchen, Andrew; Grier, Colin; Kohler, Timothy A; Ortman, Scott G; Kemp, Brian M; Malhi, Ripan S

2015-02-01

As dogs have traveled with humans to every continent, they can potentially serve as an excellent proxy when studying human migration history. Past genetic studies into the origins of Native American dogs have used portions of the hypervariable region (HVR) of mitochondrial DNA (mtDNA) to indicate that prior to European contact the dogs of Native Americans originated in Eurasia. In this study, we summarize past DNA studies of both humans and dogs to discuss their population histories in the Americas. We then sequenced a portion of the mtDNA HVR of 42 pre-Columbian dogs from three sites located in Illinois, coastal British Columbia, and Colorado, and identify four novel dog mtDNA haplotypes. Next, we analyzed a dataset comprised of all available ancient dog sequences from the Americas to infer the pre-Columbian population history of dogs in the Americas. Interestingly, we found low levels of genetic diversity for some populations consistent with the possibility of deliberate breeding practices. Furthermore, we identified multiple putative founding haplotypes in addition to dog haplotypes that closely resemble those of wolves, suggesting admixture with North American wolves or perhaps a second domestication of canids in the Americas. Notably, initial effective population size estimates suggest at least 1000 female dogs likely existed in the Americas at the time of the first known canid burial, and that population size increased gradually over time before stabilizing roughly 1200 years before present. Copyright © 2014 Elsevier Ltd. All rights reserved.

Genetic variants are major determinants of CSF antibody levels in multiple sclerosis

PubMed Central

Pauwels, Ine; Gustavsen, Marte W.; van Son, Brechtje; Hilven, Kelly; Bos, Steffan D.; Celius, Elisabeth Gulowsen; Berg-Hansen, Pål; Aarseth, Jan; Myhr, Kjell-Morten; D’Alfonso, Sandra; Barizzone, Nadia; Leone, Maurizio A.; Martinelli Boneschi, Filippo; Sorosina, Melissa; Liberatore, Giuseppe; Kockum, Ingrid; Olsson, Tomas; Hillert, Jan; Alfredsson, Lars; Bedri, Sahl Khalid; Hemmer, Bernhard; Buck, Dorothea; Berthele, Achim; Knier, Benjamin; Biberacher, Viola; van Pesch, Vincent; Sindic, Christian; Bang Oturai, Annette; Søndergaard, Helle Bach; Sellebjerg, Finn; Jensen, Poul Erik H.; Comabella, Manuel; Montalban, Xavier; Pérez-Boza, Jennifer; Malhotra, Sunny; Lechner-Scott, Jeannette; Broadley, Simon; Slee, Mark; Taylor, Bruce; Kermode, Allan G.; Gourraud, Pierre-Antoine; Sawcer, Stephen J.; Andreassen, Bettina Kullle; Dubois, Bénédicte; Harbo, Hanne F.

2015-01-01

Immunological hallmarks of multiple sclerosis include the production of antibodies in the central nervous system, expressed as presence of oligoclonal bands and/or an increased immunoglobulin G index—the level of immunoglobulin G in the cerebrospinal fluid compared to serum. However, the underlying differences between oligoclonal band-positive and -negative patients with multiple sclerosis and reasons for variability in immunoglobulin G index are not known. To identify genetic factors influencing the variation in the antibody levels in the cerebrospinal fluid in multiple sclerosis, we have performed a genome-wide association screen in patients collected from nine countries for two traits, presence or absence of oligoclonal bands (n = 3026) and immunoglobulin G index levels (n = 938), followed by a replication in 3891 additional patients. We replicate previously suggested association signals for oligoclonal band status in the major histocompatibility complex region for the rs9271640*A-rs6457617*G haplotype, correlated with HLA-DRB1*1501, and rs34083746*G, correlated with HLA-DQA1*0301 (P comparing two haplotypes = 8.88 × 10−16). Furthermore, we identify a novel association signal of rs9807334, near the ELAC1/SMAD4 genes, for oligoclonal band status (P = 8.45 × 10−7). The previously reported association of the immunoglobulin heavy chain locus with immunoglobulin G index reaches strong evidence for association in this data set (P = 3.79 × 10−37). We identify two novel associations in the major histocompatibility complex region with immunoglobulin G index: the rs9271640*A-rs6457617*G haplotype (P = 1.59 × 10−22), shared with oligoclonal band status, and an additional independent effect of rs6457617*G (P = 3.68 × 10−6). Variants identified in this study account for up to 2-fold differences in the odds of being oligoclonal band positive and 7.75% of the variation in immunoglobulin G index. Both traits are associated with clinical features of disease such as female gender, age at onset and severity. This is the largest study population so far investigated for the genetic influence on antibody levels in the cerebrospinal fluid in multiple sclerosis, including 6950 patients. We confirm that genetic factors underlie these antibody levels and identify both the major histocompatibility complex and immunoglobulin heavy chain region as major determinants. PMID:25616667

Salt tolerance underlies the cryptic invasion of North American salt marshes by an introduced haplotype of the common reed Phragmites australis (Poaceae)

USGS Publications Warehouse

Vasquez, Edward A.; Glenn, Edward P.; Brown, J. Jed; Guntenspergen, Glenn R.; Nelson, Stephen G.

2005-01-01

A distinct, non-native haplotype of the common reed Phragmites australis has become invasive in Atlantic coastal Spartina marshes. We compared the salt tolerance and other growth characteristics of the invasive M haplotype with 2 native haplotypes (F and AC) in greenhouse experiments. The M haplotype retained 50% of its growth potential up to 0.4 M NaCl, whereas the F and AC haplotypes did not grow above 0.1 M NaCl. The M haplotype produced more shoots per gram of rhizome tissue and had higher relative growth rates than the native haplotypes on both freshwater and saline water treatments. The M haplotype also differed from the native haplotypes in shoot water content and the biometrics of shoots and rhizomes. The results offer an explanation for how the M haplotype is able to spread in coastal salt marshes and support the conclusion of DNA analyses that the M haplotype is a distinct ecotype of P. australis.

Ancestral Asian source(s) of new world Y-chromosome founder haplotypes.

PubMed Central

Karafet, T M; Zegura, S L; Posukh, O; Osipova, L; Bergen, A; Long, J; Goldman, D; Klitz, W; Harihara, S; de Knijff, P; Wiebe, V; Griffiths, R C; Templeton, A R; Hammer, M F

1999-01-01

Haplotypes constructed from Y-chromosome markers were used to trace the origins of Native Americans. Our sample consisted of 2,198 males from 60 global populations, including 19 Native American and 15 indigenous North Asian groups. A set of 12 biallelic polymorphisms gave rise to 14 unique Y-chromosome haplotypes that were unevenly distributed among the populations. Combining multiallelic variation at two Y-linked microsatellites (DYS19 and DXYS156Y) with the unique haplotypes results in a total of 95 combination haplotypes. Contra previous findings based on Y- chromosome data, our new results suggest the possibility of more than one Native American paternal founder haplotype. We postulate that, of the nine unique haplotypes found in Native Americans, haplotypes 1C and 1F are the best candidates for major New World founder haplotypes, whereas haplotypes 1B, 1I, and 1U may either be founder haplotypes and/or have arrived in the New World via recent admixture. Two of the other four haplotypes (YAP+ haplotypes 4 and 5) are probably present because of post-Columbian admixture, whereas haplotype 1G may have originated in the New World, and the Old World source of the final New World haplotype (1D) remains unresolved. The contrasting distribution patterns of the two major candidate founder haplotypes in Asia and the New World, as well as the results of a nested cladistic analysis, suggest the possibility of more than one paternal migration from the general region of Lake Baikal to the Americas. PMID:10053017

Along for the ride or missing it altogether: exploring the host specificity and diversity of haemogregarines in the Canary Islands.

PubMed

Tomé, Beatriz; Pereira, Ana; Jorge, Fátima; Carretero, Miguel A; Harris, D James; Perera, Ana

2018-03-19

Host-parasite relationships are expected to be strongly shaped by host specificity, a crucial factor in parasite adaptability and diversification. Because whole host communities have to be considered to assess host specificity, oceanic islands are ideal study systems given their simplified biotic assemblages. Previous studies on insular parasites suggest host range broadening during colonization. Here, we investigate the association between one parasite group (haemogregarines) and multiple sympatric hosts (of three lizard genera: Gallotia, Chalcides and Tarentola) in the Canary Islands. Given haemogregarine characteristics and insular conditions, we hypothesized low host specificity and/or occurrence of host-switching events. A total of 825 samples were collected from the three host taxa inhabiting the seven main islands of the Canarian Archipelago, including locations where the different lizards occurred in sympatry. Blood slides were screened to assess prevalence and parasitaemia, while parasite genetic diversity and phylogenetic relationships were inferred from 18S rRNA gene sequences. Infection levels and diversity of haplotypes varied geographically and across host groups. Infections were found in all species of Gallotia across the seven islands, in Tarentola from Tenerife, La Gomera and La Palma, and in Chalcides from Tenerife, La Gomera and El Hierro. Gallotia lizards presented the highest parasite prevalence, parasitaemia and diversity (seven haplotypes), while the other two host groups (Chalcides and Tarentola) harbored one haplotype each, with low prevalence and parasitaemia levels, and very restricted geographical ranges. Host-sharing of the same haemogregarine haplotype was only detected twice, but these rare instances likely represent occasional cross-infections. Our results suggest that: (i) Canarian haemogregarine haplotypes are highly host-specific, which might have restricted parasite host expansion; (ii) haemogregarines most probably reached the Canary Islands in three colonization events with each host genus; and (iii) the high number of parasite haplotypes infecting Gallotia hosts and their restricted geographical distribution suggest co-diversification. These findings contrast with our expectations derived from results on other insular parasites, highlighting how host specificity depends on parasite characteristics and evolutionary history.

µ-Calpain (CAPN1), calpastatin (CAST), and growth hormone receptor (GHR) genetic effects on Angus beef heifer performance traits and reproduction

USDA-ARS?s Scientific Manuscript database

Genetic marker effects and type of inheritance are estimated with poor precision when minor marker allele frequencies are low. An Angus population was subjected to marker assisted selection for multiple years to equalize CAPN1 haplotypes, CAST, and GHR genetic marker frequencies. The objective was t...

International trades, local spread and viral evolution: the case of porcine circovirus type 2 (PCV2) strains heterogeneity in Italy.

PubMed

Franzo, Giovanni; Tucciarone, Claudia M; Dotto, Giorgia; Gigli, Alessandra; Ceglie, Letizia; Drigo, Michele

2015-06-01

Porcine circovirus type 2 is one of the most widespread and economically relevant infections of swine. Four genotypes have been recognized, but currently, only three (PCV2a, PCV2b and PCV2d) are effectively circulating. The widespread livestock trade and rapid viral evolution have contributed to determining the high heterogeneity of PCV2 and the dispersal of potentially more virulent strains. Italian swine farming and the related processing industry are relevant in the national economy. Despite the noteworthy losses associated with direct and control measure costs, no data are currently available on the molecular epidemiology of PCV2 in Italy. Our study, which was intended to fill this gap, considered 75 completed genome PCV2 sequences, which were obtained from samples collected from the highly densely populated area of Northern Italy between 2007 and 2014. Phylogenetic analysis and comparison with reference sequences demonstrated the co-circulation, with different prevalences, of PCV2a, PCV2b and PCV2d within the national borders, with PCV2b being the most prevalent. Recombination between different genotypes was also proven to be frequent. Phylogeographic analysis demonstrated that the marked variability of Italian PCV2 strains can be attributable to multiple introduction events. The comparison of the phylogenetic analysis results, the location of different haplotypes and the international commercial routs of live pigs allow the speculation of several links as well as the role of Italy as both an importer and exporter of PCV2 haplotypes, mainly from and to European and Asian countries. A similarly intricate contact network was demonstrated within national borders, with different haplotypes being detected in the same province and different provinces harbouring the same haplotype. Overall, this paper represents the first description of PCV2 in Italy and demonstrates that the high variability of circulating Italian strains is due to multiple introduction events, wide circulation within national boundaries and rapid viral evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

Association Between Chloroplast DNA and Mitochondrial DNA Haplotypes in Prunus spinosa L. (Rosaceae) Populations across Europe

PubMed Central

MOHANTY, APARAJITA; MARTÍN, JUAN PEDRO; GONZÁLEZ, LUIS MIGUEL; AGUINAGALDE, ITZIAR

2003-01-01

Chloroplast DNA (cpDNA) and mitochondrial DNA (mtDNA) were studied in 24 populations of Prunus spinosa sampled across Europe. The cpDNA and mtDNA fragments were amplified using universal primers and subsequently digested with restriction enzymes to obtain the polymorphisms. Combinations of all the polymorphisms resulted in 33 cpDNA haplotypes and two mtDNA haplotypes. Strict association between the cpDNA haplotypes and the mtDNA haplotypes was detected in most cases, indicating conjoint inheritance of the two genomes. The most frequent and abundant cpDNA haplotype (C20; frequency, 51 %) is always associated with the more frequent and abundant mtDNA haplotype (M1; frequency, 84 %). All but two of the cpDNA haplotypes associated with the less frequent mtDNA haplotype (M2) are private haplotypes. These private haplotypes are phylogenetically related but geographically unrelated. They form a separate cluster on the minimum‐length spanning tree. PMID:14534199

[Construction of haplotype and haplotype block based on tag single nucleotide polymorphisms and their applications in association studies].

PubMed

Gu, Ming-liang; Chu, Jia-you

2007-12-01

Human genome has structures of haplotype and haplotype block which provide valuable information on human evolutionary history and may lead to the development of more efficient strategies to identify genetic variants that increase susceptibility to complex diseases. Haplotype block can be divided into discrete blocks of limited haplotype diversity. In each block, a small fraction of ptag SNPsq can be used to distinguish a large fraction of the haplotypes. These tag SNPs can be potentially useful for construction of haplotype and haplotype block, and association studies in complex diseases. There are two general classes of methods to construct haplotype and haplotype blocks based on genotypes on large pedigrees and statistical algorithms respectively. The author evaluate several construction methods to assess the power of different association tests with a variety of disease models and block-partitioning criteria. The advantages, limitations and applications of each method and the application in the association studies are discussed equitably. With the completion of the HapMap and development of statistical algorithms for addressing haplotype reconstruction, ideas of construction of haplotype based on combination of mathematics, physics, and computer science etc will have profound impacts on population genetics, location and cloning for susceptible genes in complex diseases, and related domain with life science etc.

Phylogeography of the West Indian manatee (Trichechus manatus): How many populations and how many taxa?

USGS Publications Warehouse

Garcia-Rodriguez, A. I.; Bowen, B.W.; Domning, D.; Mignucci-Giannoni, A. A.; Marmontel, M.; Montoya-Ospina, R. A.; Morales-Vela, B.; Rudin, M.; Bonde, R.K.; McGuire, P.M.

1998-01-01

To resolve the population genetic structure and phylogeography of the West Indian manatee (Trichechus manatus), mitochondrial (mt) DNA control region sequences were compared among eight locations across the western Atlantic region. Fifteen haplotypes were identified among 86 individuals from Florida, Puerto Rico, the Dominican Republic, Mexico, Colombia, Venezuela, Guyana and Brazil. Despite the manatee's ability to move thousands of kilometres along continental margins, strong population separations between most locations were demonstrated with significant haplotype frequency shifts. These findings are consistent with tagging studies which indicate that stretches of open water and unsuitable coastal habitats constitute substantial barriers to gene flow and colonization. Low levels of genetic diversity within Florida and Brazilian samples might be explained by recent colonization into high latitudes or bottleneck effects. Three distinctive mtDNA lineages were observed in an intraspecific phylogeny of T. manatus, corresponding approximately to: (i) Florida and the West Indies; (ii) the Gulf of Mexico to the Caribbean rivers of South America; and (iii) the northeast Atlantic coast of South America. These lineages, which are not concordant with previous subspecies designations, are separated by sequence divergence estimates of d = 0.04-0.07, approximately the same level of divergence observed between T. manatus and the Amazonian manatee (T. inunguis, n = 16). Three individuals from Guyana, identified as T. manatus, had mtDNA haplotypes which are affiliated with the endemic Amazon form T. inunguis. The three primary T. manatus lineages and the T. inunguis lineage may represent relatively deep phylogeographic partitions which have been bridged recently due to changes in habitat availability (after the Wisconsin glacial period, 10 000 BP), natural colonization, and human-mediated transplantation.

Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations

PubMed Central

Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

2007-01-01

Background The sickle (βs) mutation in the beta-globin gene (HBB) occurs on five "classical" βs haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the βs allele – a consequence of protection from severe malarial infection afforded by heterozygotes – has been associated with a high degree of extended haplotype similarity. The relationship between classical βs haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical βs haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). Results The most common βs sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the βs mutation. Conclusion Two different classical βs haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of βs haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle cell disease, could lie considerable distances away from β-globin. PMID:17688704

Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations.

PubMed

Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

2007-08-10

The sickle (betas) mutation in the beta-globin gene (HBB) occurs on five "classical" betas haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the betas allele - a consequence of protection from severe malarial infection afforded by heterozygotes - has been associated with a high degree of extended haplotype similarity. The relationship between classical betas haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical betas haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). The most common betas sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the betas mutation. Two different classical betas haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of betas haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle cell disease, could lie considerable distances away from beta-globin.

Genetic variations in the α(2A)-adrenoreceptor are associated with blood pressure response to the agonist dexmedetomidine.

PubMed

Kurnik, Daniel; Muszkat, Mordechai; Li, Chun; Sofowora, Gbenga G; Friedman, Eitan A; Scheinin, Mika; Wood, Alastair J J; Stein, C Michael

2011-04-01

α(2A)-Adrenoceptors (α(2A)-ARs) have important roles in sympathetic cardiovascular regulation. Variants of ADRA2A affect gene transcription and expression and are associated with insulin release and risk for type 2 diabetes. We examined whether ADRA2A variants are also associated with cardiovascular responses to the selective α(2)-AR-agonist dexmedetomidine. Seventy-three healthy subjects participated in a placebo-controlled, single-blind study. After 3 infusions of placebo, subjects received 3 incremental infusions of dexmedetomidine (cumulative dose, 0.4 μg/kg). Primary outcomes were changes in systolic blood pressure (SBP) and plasma norepinephrine concentrations, measured as difference of the area-under-the-curve during placebo and dexmedetomidine infusions (ΔAUC). We used multiple linear regression analysis to examine the associations between 9 ADRA2A tagging variants and 5 inferred haplotypes and ΔAUC after adjustment for covariates. Homozygous carriers of rs553668 and the corresponding haplotype 4, previously associated with increased α(2A)-AR expression, had a 2.2-fold greater decrease in AUC(SBP) after dexmedetomidine (adjusted P=0.006); similarly, the maximum decrease in SBP was 24.7±8.1 mm Hg compared with 13.6±5.9 mm Hg in carriers of the wild-type allele (P=0.007). Carriers of haplotype 3, previously associated with reduced α(2A)-AR expression, had a 44% smaller decrease in AUC(SBP) (P=0.013). Haplotype information significantly improved the model predicting the decrease in SBP (P<0.001). There were similar but nonsignificant trends for diastolic blood pressure and heart rate. Genotypes were not significantly associated with norepinephrine responses. Common ADRA2A variants are associated with the hypotensive response to dexmedetomidine. Effects of specific variants/haplotypes in vivo are compatible with their known effects on gene expression in vitro.

Extensive genetic differentiation detected within a model marsupial, the tammar wallaby (Notamacropus eugenii)

PubMed Central

Miller, Emily J.; Neaves, Linda E.; Zenger, Kyall R.; Herbert, Catherine A.

2017-01-01

The tammar wallaby (Notamacropus eugenii) is one of the most intensively studied of all macropodids and was the first Australasian marsupial to have its genome sequenced. However, comparatively little is known about genetic diversity and differentiation amongst the morphologically distinct allopatric populations of tammar wallabies found in Western (WA) and South Australia (SA). Here we compare autosomal and Y-linked microsatellite genotypes, as well as sequence data (~600 bp) from the mitochondrial DNA (mtDNA) control region (CR) in tammar wallabies from across its distribution. Levels of diversity at autosomal microsatellite loci were typically high in the WA mainland and Kangaroo Island (SA) populations (A = 8.9–10.6; He = 0.77–0.78) but significantly reduced in other endemic island populations (A = 3.8–4.1; He = 0.41–0.48). Autosomal and Y-linked microsatellite loci revealed a pattern of significant differentiation amongst populations, especially between SA and WA. The Kangaroo Island and introduced New Zealand population showed limited differentiation. Multiple divergent mtDNA CR haplotypes were identified within both SA and WA populations. The CR haplotypes of tammar wallabies from SA and WA show reciprocal monophyly and are highly divergent (14.5%), with levels of sequence divergence more typical of different species. Within WA tammar wallabies, island populations each have unique clusters of highly related CR haplotypes and each is most closely related to different WA mainland haplotypes. Y-linked microsatellite haplotypes show a similar pattern of divergence although levels of diversity are lower. In light of these differences, we suggest that two subspecies of tammar wallaby be recognized; Notamacropus eugenii eugenii in SA and N. eugenii derbianus in WA. The extensive neutral genetic diversity and inter-population differentiation identified within tammar wallabies should further increase the species value and usefulness as a model organism. PMID:28257440

[Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

PubMed

Wielandt, Ana María; Vollrath, Valeska; Chianale, José

2004-09-01

There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p<0.005) but similar to that reported in Asian population (p=0.739), probably due to the Asian origin of the Amerindian populations. In addition, the MDR1*l haplotype fequency hin Mestizos was similar to the frequency reported in Caucasians (p=0.49), in agreement with the origin of our population, with a strong influence of Caucasian genes from the Spanish conquerors. The MDR1*2 haplotype distribution, with the three polymoyphisms and probably lower multidrug transporter expression, was similar in the three Chilean populations studied (p>0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

Mitochondrial genomic analysis of late onset Alzheimer's disease reveals protective haplogroups H6A1A/H6A1B: the Cache County Study on Memory in Aging.

PubMed

Ridge, Perry G; Maxwell, Taylor J; Corcoran, Christopher D; Norton, Maria C; Tschanz, Joann T; O'Brien, Elizabeth; Kerber, Richard A; Cawthon, Richard M; Munger, Ronald G; Kauwe, John S K

2012-01-01

Alzheimer's disease (AD) is the most common cause of dementia and AD risk clusters within families. Part of the familial aggregation of AD is accounted for by excess maternal vs. paternal inheritance, a pattern consistent with mitochondrial inheritance. The role of specific mitochondrial DNA (mtDNA) variants and haplogroups in AD risk is uncertain. We determined the complete mitochondrial genome sequence of 1007 participants in the Cache County Study on Memory in Aging, a population-based prospective cohort study of dementia in northern Utah. AD diagnoses were made with a multi-stage protocol that included clinical examination and review by a panel of clinical experts. We used TreeScanning, a statistically robust approach based on haplotype networks, to analyze the mtDNA sequence data. Participants with major mitochondrial haplotypes H6A1A and H6A1B showed a reduced risk of AD (p=0.017, corrected for multiple comparisons). The protective haplotypes were defined by three variants: m.3915G>A, m.4727A>G, and m.9380G>A. These three variants characterize two different major haplogroups. Together m.4727A>G and m.9380G>A define H6A1, and it has been suggested m.3915G>A defines H6A. Additional variants differentiate H6A1A and H6A1B; however, none of these variants had a significant relationship with AD case-control status. Our findings provide evidence of a reduced risk of AD for individuals with mtDNA haplotypes H6A1A and H6A1B. These findings are the results of the largest study to date with complete mtDNA genome sequence data, yet the functional significance of the associated haplotypes remains unknown and replication in others studies is necessary.

Mitochondrial Genomic Analysis of Late Onset Alzheimer’s Disease Reveals Protective Haplogroups H6A1A/H6A1B: The Cache County Study on Memory in Aging

PubMed Central

Ridge, Perry G.; Maxwell, Taylor J.; Corcoran, Christopher D.; Norton, Maria C.; Tschanz, JoAnn T.; O’Brien, Elizabeth; Kerber, Richard A.; Cawthon, Richard M.; Munger, Ronald G.; Kauwe, John S. K.

2012-01-01

Background Alzheimer’s disease (AD) is the most common cause of dementia and AD risk clusters within families. Part of the familial aggregation of AD is accounted for by excess maternal vs. paternal inheritance, a pattern consistent with mitochondrial inheritance. The role of specific mitochondrial DNA (mtDNA) variants and haplogroups in AD risk is uncertain. Methodology/Principal Findings We determined the complete mitochondrial genome sequence of 1007 participants in the Cache County Study on Memory in Aging, a population-based prospective cohort study of dementia in northern Utah. AD diagnoses were made with a multi-stage protocol that included clinical examination and review by a panel of clinical experts. We used TreeScanning, a statistically robust approach based on haplotype networks, to analyze the mtDNA sequence data. Participants with major mitochondrial haplotypes H6A1A and H6A1B showed a reduced risk of AD (p = 0.017, corrected for multiple comparisons). The protective haplotypes were defined by three variants: m.3915G>A, m.4727A>G, and m.9380G>A. These three variants characterize two different major haplogroups. Together m.4727A>G and m.9380G>A define H6A1, and it has been suggested m.3915G>A defines H6A. Additional variants differentiate H6A1A and H6A1B; however, none of these variants had a significant relationship with AD case-control status. Conclusions/Significance Our findings provide evidence of a reduced risk of AD for individuals with mtDNA haplotypes H6A1A and H6A1B. These findings are the results of the largest study to date with complete mtDNA genome sequence data, yet the functional significance of the associated haplotypes remains unknown and replication in others studies is necessary. PMID:23028804

Genetic analysis of invasive Asian Black Carp (Mylopharyngodon piceus) in the Mississippi River Basin: evidence for multiple introductions

USGS Publications Warehouse

Hunter, Margaret E.; Nico, Leo G.

2015-01-01

Invasive Asian Black Carp (Mylopharyngodon piceus) have been present in USA aquaculture facilities since the 1980s and wild Black Carp have been found in the Mississippi River Basin since the early 1990s. This study characterizes the genetic diversity and relatedness of the Basin’s Black Carp and clarifies the introduction history. Analyses focused on three mitochondrial markers (control region, cytochrome-b, and 16S) and seven nuclear microsatellite markers (nDNA), using aquaculture and wild-caught samples collected in the upper and lower Mississippi Basin. Of the three mitochondrial haplotypes, two were shared between the aquaculture and wild populations, while a third was only present in upper Mississippi wild-caught specimens. Due to the presence of diploid and triploid fish, microsatellite markers were scored as pseudodominant and revealed low polymorphism (NA = 4.6, NA Ave = 1.5). Nuclear Bayesian clustering analyses identified two genetically distinct groups and four subclusters, each primarily composed of a unique haplotype. Samples from three aquaculture farms were assigned to group 1, while a fourth farm included samples from both groups 1 and 2. Wild-caught fish from the upper Basin were predominantly group 1, whereas wild samples from the lower Mississippi were assigned to both genetic groups. The presence of divergent haplotypes and distinct nDNA groups, along with geographic distribution patterns, indicate that wild populations in the basin likely resulted from multiple introductions. Genetic similarities between wild and captive populations support claims that aquaculture is the introduction source, but a shortage of samples and a history of repeated transfers among facilities obscure the precise pathway.

Identification of FGF7 as a novel susceptibility locus for chronic obstructive pulmonary disease.

PubMed

Brehm, John M; Hagiwara, Koichi; Tesfaigzi, Yohannes; Bruse, Shannon; Mariani, Thomas J; Bhattacharya, Soumyaroop; Boutaoui, Nadia; Ziniti, John P; Soto-Quiros, Manuel E; Avila, Lydiana; Cho, Michael H; Himes, Blanca; Litonjua, Augusto A; Jacobson, Francine; Bakke, Per; Gulsvik, Amund; Anderson, Wayne H; Lomas, David A; Forno, Erick; Datta, Soma; Silverman, Edwin K; Celedón, Juan C

2011-12-01

Traditional genome-wide association studies (GWASs) of large cohorts of subjects with chronic obstructive pulmonary disease (COPD) have successfully identified novel candidate genes, but several other plausible loci do not meet strict criteria for genome-wide significance after correction for multiple testing. The authors hypothesise that by applying unbiased weights derived from unique populations we can identify additional COPD susceptibility loci. Methods The authors performed a homozygosity haplotype analysis on a group of subjects with and without COPD to identify regions of conserved homozygosity haplotype (RCHHs). Weights were constructed based on the frequency of these RCHHs in case versus controls, and used to adjust the p values from a large collaborative GWAS of COPD. The authors identified 2318 RCHHs, of which 576 were significantly (p<0.05) over-represented in cases. After applying the weights constructed from these regions to a collaborative GWAS of COPD, the authors identified two single nucleotide polymorphisms (SNPs) in a novel gene (fibroblast growth factor-7 (FGF7)) that gained genome-wide significance by the false discovery rate method. In a follow-up analysis, both SNPs (rs12591300 and rs4480740) were significantly associated with COPD in an independent population (combined p values of 7.9E-7 and 2.8E-6, respectively). In another independent population, increased lung tissue FGF7 expression was associated with worse measures of lung function. Weights constructed from a homozygosity haplotype analysis of an isolated population successfully identify novel genetic associations from a GWAS on a separate population. This method can be used to identify promising candidate genes that fail to meet strict correction for multiple testing.

Paraoxonase promoter and intronic variants modify risk of sporadic amyotrophic lateral sclerosis

PubMed Central

Cronin, Simon; Greenway, Matthew J; Prehn, Jochen H M; Hardiman, Orla

2007-01-01

Background The paraoxonases, PON1–3, play a major protective role both against environmental toxins and as part of the antioxidant defence system. Recently, non‐synonymous coding single nucleotide polymorphisms (SNPs), known to lower serum PON activity, have been associated with sporadic ALS (SALS) in a Polish population. A separate trio based study described a detrimental allele at the PON3 intronic variant INS2+3651 (rs10487132). Association between PON gene cluster variants and SALS requires external validation in an independent dataset. Aims To examine the association of the promoter SNPs PON1−162G>A and PON1−108T>C; the non‐synonymous functional SNPs PON1Q192R and L55M and PON2C311S and A148G; and the intronic marker PON3INS2+3651A>G, with SALS in a genetically homogenous population. Methods 221 Irish patients with SALS and 202 unrelated control subjects were genotyped using KASPar chemistries. Statistical analyses and haplotype estimations were conducted using Haploview and Unphased software. Multiple permutation testing, as implemented in Unphased, was applied to haplotype p values to correct for multiple hypotheses. Results Two of the seven SNPs were associated with SALS in the Irish population: PON155M (OR 1.52, p = 0.006) and PON3INS2+3651 G (OR 1.36, p = 0.03). Two locus haplotype analysis showed association only when both of these risk alleles were present (OR 1.7, p = 0.005), suggesting a potential effect modification. Low functioning promoter variants were observed to influence this effect when compared with wild‐type. Conclusions These data provide additional evidence that genetic variation across the paroxanase loci may be common susceptibility factors for SALS. PMID:17702780

Detection of hyper-conserved regions in hepatitis B virus X gene potentially useful for gene therapy.

PubMed

González, Carolina; Tabernero, David; Cortese, Maria Francesca; Gregori, Josep; Casillas, Rosario; Riveiro-Barciela, Mar; Godoy, Cristina; Sopena, Sara; Rando, Ariadna; Yll, Marçal; Lopez-Martinez, Rosa; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco

2018-05-21

To detect hyper-conserved regions in the hepatitis B virus (HBV) X gene ( HBX ) 5' region that could be candidates for gene therapy. The study included 27 chronic hepatitis B treatment-naive patients in various clinical stages (from chronic infection to cirrhosis and hepatocellular carcinoma, both HBeAg-negative and HBeAg-positive), and infected with HBV genotypes A-F and H. In a serum sample from each patient with viremia > 3.5 log IU/mL, the HBX 5' end region [nucleotide (nt) 1255-1611] was PCR-amplified and submitted to next-generation sequencing (NGS). We assessed genotype variants by phylogenetic analysis, and evaluated conservation of this region by calculating the information content of each nucleotide position in a multiple alignment of all unique sequences (haplotypes) obtained by NGS. Conservation at the HBx protein amino acid (aa) level was also analyzed. NGS yielded 1333069 sequences from the 27 samples, with a median of 4578 sequences/sample (2487-9279, IQR 2817). In 14/27 patients (51.8%), phylogenetic analysis of viral nucleotide haplotypes showed a complex mixture of genotypic variants. Analysis of the information content in the haplotype multiple alignments detected 2 hyper-conserved nucleotide regions, one in the HBX upstream non-coding region (nt 1255-1286) and the other in the 5' end coding region (nt 1519-1603). This last region coded for a conserved amino acid region (aa 63-76) that partially overlaps a Kunitz-like domain. Two hyper-conserved regions detected in the HBX 5' end may be of value for targeted gene therapy, regardless of the patients' clinical stage or HBV genotype.

Mapping of a Major QTL for Ceratocystis Wilt Disease in an F1 Population of Theobroma cacao

PubMed Central

Fernandes, Luciel dos Santos; Royaert, Stefan; Corrêa, Fábio M.; Mustiga, Guiliana M.; Marelli, Jean-Philippe; Corrêa, Ronan X.; Motamayor, Juan C.

2018-01-01

Cacao is an important crop, its beans are key raw materials for the chocolate and cosmetic industries. Ceratocystis wilt of cacao (CWC) caused by Ceratocystis cacaofunesta is a lethal disease for the crop. Therefore, the selection of resistant cacao varieties is one of the viable ways to minimize losses in cacao production. In this paper, we described the identification of a major QTL associated with CWC in an F1 mapping population from a cross between a resistant, “TSH 1188,” and a susceptible genotype, “CCN 51.” A set of 266 trees were genotyped using 3,526 single nucleotide polymorphic markers and then multiple QTL mapping analyses were performed. Two QTLs were identified on chromosomes IV and VI. The major QTL was located at 20 cM from the top position of chromosome VI, accounting for more than 60% of the phenotypic variation. The favorable allele T1, with haplotype GTT, came from the “TSH 1188” parent. It was evident that the haplotype combination T1C2 on chromosome VI was the most significant for resistance, since 93% of resistant trees had this haplotype. The major QTL converged to a genomic region of 739.4 kb that harbored nine candidate genes, including two major classes of resistance genes, which would make them the primary candidates involved in the resistance to CWC. The haplotypes detected are now used to improve the efficiency and precision of the selection of resistant trees in cacao breeding. PMID:29491879

A genotype probability index for multiple alleles and haplotypes.

PubMed

Percy, A; Kinghorn, B P

2005-12-01

We use linear algebra to calculate an index of information content in genotype probabilities which has previously been calculated using trigonometry. The new method can be generalized allowing the index to be calculated for loci with more than two alleles. Applications of this index include its use in genotyping strategies, strategies to manage genetic disorders and in estimation of genotype effects.

Immunogenetic Management Software: a new tool for visualization and analysis of complex immunogenetic datasets

PubMed Central

Johnson, Z. P.; Eady, R. D.; Ahmad, S. F.; Agravat, S.; Morris, T; Else, J; Lank, S. M.; Wiseman, R. W.; O’Connor, D. H.; Penedo, M. C. T.; Larsen, C. P.

2012-01-01

Here we describe the Immunogenetic Management Software (IMS) system, a novel web-based application that permitsmultiplexed analysis of complex immunogenetic traits that are necessary for the accurate planning and execution of experiments involving large animal models, including nonhuman primates. IMS is capable of housing complex pedigree relationships, microsatellite-based MHC typing data, as well as MHC pyrosequencing expression analysis of class I alleles. It includes a novel, automated MHC haplotype naming algorithm and has accomplished an innovative visualization protocol that allows users to view multiple familial and MHC haplotype relationships through a single, interactive graphical interface. Detailed DNA and RNA-based data can also be queried and analyzed in a highly accessible fashion, and flexible search capabilities allow experimental choices to be made based on multiple, individualized and expandable immunogenetic factors. This web application is implemented in Java, MySQL, Tomcat, and Apache, with supported browsers including Internet Explorer and Firefox onWindows and Safari on Mac OS. The software is freely available for distribution to noncommercial users by contacting Leslie. kean@emory.edu. A demonstration site for the software is available at http://typing.emory.edu/typing_demo, user name: imsdemo7@gmail.com and password: imsdemo. PMID:22080300

Practical applications of the bioinformatics toolbox for narrowing quantitative trait loci.

PubMed

Burgess-Herbert, Sarah L; Cox, Allison; Tsaih, Shirng-Wern; Paigen, Beverly

2008-12-01

Dissecting the genes involved in complex traits can be confounded by multiple factors, including extensive epistatic interactions among genes, the involvement of epigenetic regulators, and the variable expressivity of traits. Although quantitative trait locus (QTL) analysis has been a powerful tool for localizing the chromosomal regions underlying complex traits, systematically identifying the causal genes remains challenging. Here, through its application to plasma levels of high-density lipoprotein cholesterol (HDL) in mice, we demonstrate a strategy for narrowing QTL that utilizes comparative genomics and bioinformatics techniques. We show how QTL detected in multiple crosses are subjected to both combined cross analysis and haplotype block analysis; how QTL from one species are mapped to the concordant regions in another species; and how genomewide scans associating haplotype groups with their phenotypes can be used to prioritize the narrowed regions. Then we illustrate how these individual methods for narrowing QTL can be systematically integrated for mouse chromosomes 12 and 15, resulting in a significantly reduced number of candidate genes, often from hundreds to <10. Finally, we give an example of how additional bioinformatics resources can be combined with experiments to determine the most likely quantitative trait genes.

Immunogenetic Management Software: a new tool for visualization and analysis of complex immunogenetic datasets.

PubMed

Johnson, Z P; Eady, R D; Ahmad, S F; Agravat, S; Morris, T; Else, J; Lank, S M; Wiseman, R W; O'Connor, D H; Penedo, M C T; Larsen, C P; Kean, L S

2012-04-01

Here we describe the Immunogenetic Management Software (IMS) system, a novel web-based application that permits multiplexed analysis of complex immunogenetic traits that are necessary for the accurate planning and execution of experiments involving large animal models, including nonhuman primates. IMS is capable of housing complex pedigree relationships, microsatellite-based MHC typing data, as well as MHC pyrosequencing expression analysis of class I alleles. It includes a novel, automated MHC haplotype naming algorithm and has accomplished an innovative visualization protocol that allows users to view multiple familial and MHC haplotype relationships through a single, interactive graphical interface. Detailed DNA and RNA-based data can also be queried and analyzed in a highly accessible fashion, and flexible search capabilities allow experimental choices to be made based on multiple, individualized and expandable immunogenetic factors. This web application is implemented in Java, MySQL, Tomcat, and Apache, with supported browsers including Internet Explorer and Firefox on Windows and Safari on Mac OS. The software is freely available for distribution to noncommercial users by contacting Leslie.kean@emory.edu. A demonstration site for the software is available at http://typing.emory.edu/typing_demo , user name: imsdemo7@gmail.com and password: imsdemo.

Detecting local haplotype sharing and haplotype association

USDA-ARS?s Scientific Manuscript database

A novel haplotype association method is presented, and its power is demonstrated. Relying on a statistical model for linkage disequilibrium (LD), the method first infers ancestral haplotypes and their loadings at each marker for each individual. The loadings are then used to quantify local haplotype...

TUMOR HAPLOTYPE ASSEMBLY ALGORITHMS FOR CANCER GENOMICS

PubMed Central

AGUIAR, DEREK; WONG, WENDY S.W.; ISTRAIL, SORIN

2014-01-01

The growing availability of inexpensive high-throughput sequence data is enabling researchers to sequence tumor populations within a single individual at high coverage. But, cancer genome sequence evolution and mutational phenomena like driver mutations and gene fusions are difficult to investigate without first reconstructing tumor haplotype sequences. Haplotype assembly of single individual tumor populations is an exceedingly difficult task complicated by tumor haplotype heterogeneity, tumor or normal cell sequence contamination, polyploidy, and complex patterns of variation. While computational and experimental haplotype phasing of diploid genomes has seen much progress in recent years, haplotype assembly in cancer genomes remains uncharted territory. In this work, we describe HapCompass-Tumor a computational modeling and algorithmic framework for haplotype assembly of copy number variable cancer genomes containing haplotypes at different frequencies and complex variation. We extend our polyploid haplotype assembly model and present novel algorithms for (1) complex variations, including copy number changes, as varying numbers of disjoint paths in an associated graph, (2) variable haplotype frequencies and contamination, and (3) computation of tumor haplotypes using simple cycles of the compass graph which constrain the space of haplotype assembly solutions. The model and algorithm are implemented in the software package HapCompass-Tumor which is available for download from http://www.brown.edu/Research/Istrail_Lab/. PMID:24297529

Canis mtDNA HV1 database: a web-based tool for collecting and surveying Canis mtDNA HV1 haplotype in public database.

PubMed

Thai, Quan Ke; Chung, Dung Anh; Tran, Hoang-Dung

2017-06-26

Canine and wolf mitochondrial DNA haplotypes, which can be used for forensic or phylogenetic analyses, have been defined in various schemes depending on the region analyzed. In recent studies, the 582 bp fragment of the HV1 region is most commonly used. 317 different canine HV1 haplotypes have been reported in the rapidly growing public database GenBank. These reported haplotypes contain several inconsistencies in their haplotype information. To overcome this issue, we have developed a Canis mtDNA HV1 database. This database collects data on the HV1 582 bp region in dog mitochondrial DNA from the GenBank to screen and correct the inconsistencies. It also supports users in detection of new novel mutation profiles and assignment of new haplotypes. The Canis mtDNA HV1 database (CHD) contains 5567 nucleotide entries originating from 15 subspecies in the species Canis lupus. Of these entries, 3646 were haplotypes and grouped into 804 distinct sequences. 319 sequences were recognized as previously assigned haplotypes, while the remaining 485 sequences had new mutation profiles and were marked as new haplotype candidates awaiting further analysis for haplotype assignment. Of the 3646 nucleotide entries, only 414 were annotated with correct haplotype information, while 3232 had insufficient or lacked haplotype information and were corrected or modified before storing in the CHD. The CHD can be accessed at http://chd.vnbiology.com . It provides sequences, haplotype information, and a web-based tool for mtDNA HV1 haplotyping. The CHD is updated monthly and supplies all data for download. The Canis mtDNA HV1 database contains information about canine mitochondrial DNA HV1 sequences with reconciled annotation. It serves as a tool for detection of inconsistencies in GenBank and helps identifying new HV1 haplotypes. Thus, it supports the scientific community in naming new HV1 haplotypes and to reconcile existing annotation of HV1 582 bp sequences.

Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.

PubMed

Guerreiro, J F; Figueiredo, M S; Zago, M A

1994-01-01

We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.

Mitochondrial haplotype variation and phylogeography of Iberian brown trout populations.

PubMed

MacHordom, A; Suárez, J; Almodóvar, A; Bautista, J M

2000-09-01

The biogeographical distribution of brown trout mitochondrial DNA haplotypes throughout the Iberian Peninsula was established by polymerase chain reaction-restriction fragment polymorphism analysis. The study of 507 specimens from 58 localities representing eight widely separated Atlantic-slope (north and west Iberian coasts) and six Mediterranean drainage systems served to identify five main groups of mitochondrial haplotypes: (i) haplotypes corresponding to non-native, hatchery-reared brown trout that were widely distributed but also found in wild populations of northern Spain (Cantabrian slope); (ii) a widespread Atlantic haplotype group; (iii) a haplotype restricted to the Duero Basin; (iv) a haplotype shown by southern Iberian populations; and (v) a Mediterranean haplotype. The Iberian distribution of these haplotypes reflects both the current fishery management policy of introducing non-native brown trout, and Messinian palaeobiogeography. Our findings complement and extend previous allozyme studies on Iberian brown trout and improve present knowledge of glacial refugia and postglacial movement of brown trout lineages.

How Have Self-Incompatibility Haplotypes Diversified? Generation of New Haplotypes during the Evolution of Self-Incompatibility from Self-Compatibility.

PubMed

Sakai, Satoki

2016-08-01

I developed a gametophytic self-incompatibility (SI) model to study the conditions leading to diversification in SI haplotypes. In the model, the SI system is assumed to be incomplete, and the pollen expressing a given specificity is not fully rejected by the pistils expressing the same specificity. I also assumed that mutations can occur that enhance the rejection of pollen by pistils with the same haplotype variant and reduce rejection by pistils with other variants in the same haplotype. I found that if such mutations occur, the new haplotypes (mutant variants) can stably coexist with the ancestral haplotype in which the mutant arose. This is because pollen bearing the new haplotype is most strongly rejected by pistils bearing the same new haplotype among the pistils in the population; hence, negative frequency-dependent selection prevents their fixation. I also performed simulations and found that the nearly complete SI system evolves from completely self-compatible populations and that SI haplotypes can increase to about 40-50 within a few thousand generations. On the basis of my findings, I propose that diversification of SI haplotypes occurred during the evolution of SI from self-compatibility.

The effect of using genealogy-based haplotypes for genomic prediction

PubMed Central

2013-01-01

Background Genomic prediction uses two sources of information: linkage disequilibrium between markers and quantitative trait loci, and additive genetic relationships between individuals. One way to increase the accuracy of genomic prediction is to capture more linkage disequilibrium by regression on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. Methods A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (π) of the haplotype covariates had zero effect, i.e. a Bayesian mixture method. Results About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some cases, decreased the bias of prediction. With the Bayesian method, accuracy of prediction was less sensitive to parameter π when fitting haplotypes compared to fitting markers. Conclusions Use of haplotypes based on genealogy can slightly increase the accuracy of genomic prediction. Improved methods to cluster the haplotypes constructed from local genealogy could lead to additional gains in accuracy. PMID:23496971

The effect of using genealogy-based haplotypes for genomic prediction.

PubMed

Edriss, Vahid; Fernando, Rohan L; Su, Guosheng; Lund, Mogens S; Guldbrandtsen, Bernt

2013-03-06

Genomic prediction uses two sources of information: linkage disequilibrium between markers and quantitative trait loci, and additive genetic relationships between individuals. One way to increase the accuracy of genomic prediction is to capture more linkage disequilibrium by regression on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (π) of the haplotype covariates had zero effect, i.e. a Bayesian mixture method. About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some cases, decreased the bias of prediction. With the Bayesian method, accuracy of prediction was less sensitive to parameter π when fitting haplotypes compared to fitting markers. Use of haplotypes based on genealogy can slightly increase the accuracy of genomic prediction. Improved methods to cluster the haplotypes constructed from local genealogy could lead to additional gains in accuracy.

Recombinant structures expand and contract inter and intragenic diversification at the KIR locus

PubMed Central

2013-01-01

Background The human KIR genes are arranged in at least six major gene-content haplotypes, all of which are combinations of four centromeric and two telomeric motifs. Several less frequent or minor haplotypes also exist, including insertions, deletions, and hybridization of KIR genes derived from the major haplotypes. These haplotype structures and their concomitant linkage disequilibrium among KIR genes suggest that more meaningful correlative data from studies of KIR genetics and complex disease may be achieved by measuring haplotypes of the KIR region in total. Results Towards that end, we developed a KIR haplotyping method that reports unambiguous combinations of KIR gene-content haplotypes, including both phase and copy number for each KIR. A total of 37 different gene content haplotypes were detected from 4,512 individuals and new sequence data was derived from haplotypes where the detailed structure was not previously available. Conclusions These new structures suggest a number of specific recombinant events during the course of KIR evolution, and add to an expanding diversity of potential new KIR haplotypes derived from gene duplication, deletion, and hybridization. PMID:23394822

Contact Zone of Asian and European Wild Boar at North West of Iran

PubMed Central

Khalilzadeh, Parinaz; Rezaei, Hamid Reza; Fadakar, Davoud; Serati, Malihe; Aliabadian, Mansour; Haile, James; Goshtasb, Hamid

2016-01-01

Wild boar (Sus scrofa) are widely distributed throughout the Old World. Most studies have focused on Europe and East Asia with the genetic diversity of West Asia being less well studied. In particular, the genetic variability and genetic structure of the Iranian populations are not yet known; gaps which prevent scientists from resolving the genetic relationships of the Eurasian wild boar. This paper is the first attempt to provide information about genetic relationships among modern Iranian populations of the Eurasian wild boar (S. scrofa) by sequencing 572 bp of the mitochondrial (mt) DNA control region. As a result of this investigation, it was discovered that Iran contains not only Middle Eastern haplotypes, but also shares haplotypes with Europe and East Asia. The Italian clade, which is endemic in Italy, is not identified in Iran, while all other clades, including Asiatic, European, Near East 1, and Near East 2 are found based on the phylogenetic tree and median-joining network. The results of this study illustrate that north west of Iran (specifically Southwest Caspian Sea) is the contact zone between the Asian (Near Eastern and Far Eastern), and the European clades. In light of the fact that the domestication of pigs occurs in Anatolia, this finding is important. PMID:27442074

Morphological and molecular characterization of Fusarium. solani and F. oxysporum associated with crown disease of oil palm.

PubMed

Hafizi, R; Salleh, B; Latiffah, Z

2013-01-01

Crown disease (CD) is infecting oil palm in the early stages of the crop development. Previous studies showed that Fusarium species were commonly associated with CD. However, the identity of the species has not been resolved. This study was carried out to identify and characterize through morphological approaches and to determine the genetic diversity of the Fusarium species. 51 isolates (39%) of Fusarium solani and 40 isolates (31%) of Fusarium oxysporum were recovered from oil palm with typical CD symptoms collected from nine states in Malaysia, together with samples from Padang and Medan, Indonesia. Based on morphological characteristics, isolates in both Fusarium species were classified into two distinct morphotypes; Morphotypes I and II. Molecular characterization based on IGS-RFLP analysis produced 27 haplotypes among the F. solani isolates and 33 haplotypes for F. oxysporum isolates, which indicated high levels of intraspecific variations. From UPGMA cluster analysis, the isolates in both Fusarium species were divided into two main clusters with the percentage of similarity from 87% to 100% for F. solani, and 89% to 100% for F. oxysporum isolates, which was in accordance with the Morphotypes I and II. The results of the present study indicated that F. solani and F. oxysporum associated with CD of oil palm in Malaysia and Indonesia were highly variable.

HLA Type Inference via Haplotypes Identical by Descent

NASA Astrophysics Data System (ADS)

Setty, Manu N.; Gusev, Alexander; Pe'Er, Itsik

The Human Leukocyte Antigen (HLA) genes play a major role in adaptive immune response and are used to differentiate self antigens from non self ones. HLA genes are hyper variable with nearly every locus harboring over a dozen alleles. This variation plays an important role in susceptibility to multiple autoimmune diseases and needs to be matched on for organ transplantation. Unfortunately, HLA typing by serological methods is time consuming and expensive compared to high throughput Single Nucleotide Polymorphism (SNP) data. We present a new computational method to infer per-locus HLA types using shared segments Identical By Descent (IBD), inferred from SNP genotype data. IBD information is modeled as graph where shared haplotypes are explored among clusters of individuals with known and unknown HLA types to identify the latter. We analyze performance of the method in a previously typed subset of the HapMap population, achieving accuracy of 96% in HLA-A, 94% in HLA-B, 95% in HLA-C, 77% in HLA-DR1, 93% in HLA-DQA1 and 90% in HLA-DQB1 genes. We compare our method to a tag SNP based approach and demonstrate higher sensitivity and specificity. Our method demonstrates the power of using shared haplotype segments for large-scale imputation at the HLA locus.

Phylogeography and population structure of the biologically invasive phytopathogen Erwinia amylovora inferred using minisatellites.

PubMed

Bühlmann, Andreas; Dreo, Tanja; Rezzonico, Fabio; Pothier, Joël F; Smits, Theo H M; Ravnikar, Maja; Frey, Jürg E; Duffy, Brion

2014-07-01

Erwinia amylovora causes a major disease of pome fruit trees worldwide, and is regulated as a quarantine organism in many countries. While some diversity of isolates has been observed, molecular epidemiology of this bacterium is hindered by a lack of simple molecular typing techniques with sufficiently high resolution. We report a molecular typing system of E. amylovora based on variable number of tandem repeats (VNTR) analysis. Repeats in the E. amylovora genome were identified with comparative genomic tools, and VNTR markers were developed and validated. A Multiple-Locus VNTR Analysis (MLVA) was applied to E. amylovora isolates from bacterial collections representing global and regional distribution of the pathogen. Based on six repeats, MLVA allowed the distinction of 227 haplotypes among a collection of 833 isolates of worldwide origin. Three geographically separated groups were recognized among global isolates using Bayesian clustering methods. Analysis of regional outbreaks confirmed presence of diverse haplotypes but also high representation of certain haplotypes during outbreaks. MLVA analysis is a practical method for epidemiological studies of E. amylovora, identifying previously unresolved population structure within outbreaks. Knowledge of such structure can increase our understanding on how plant diseases emerge and spread over a given geographical region. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

Mitochondrial population structure and post-glacial dispersal of longnose sucker Catostomus catostomus in Labrador, Canada: evidence for multiple refugial origins and limited ongoing gene flow.

PubMed

Langille, B L; Perry, R; Keefe, D; Barker, O; Marshall, H D

2016-08-01

Two hundred and eighty-seven longnose sucker Catostomus catostomus were collected from 14 lakes in Labrador, 52 from three lakes in Ontario, 43 from two lakes in British Columbia and 32 from a lake in Yukon; a total of 414 in all. The resulting 34 haplotypes (20 in Labrador) contained moderate haplotypic diversity (h = 0·657) and relatively low nucleotide diversity (π = 3·730 × 10(-3) . Mean ϕST (0·453, P < 0·05) over all populations revealed distinct genetic structuring among C. catostomus populations across Canada, based on province, which was validated by the analysis and spatial analysis of molecular variance (c. 80% variation between provinces). These results probably reflect the historical imprint of recolonization from different refugia and possibly indicate limited ongoing gene flow within provinces. A haplotype network revealed one major and two minor clades within Labrador that were assigned to the Atlantic, Beringian and Mississippian refugia, respectively, with tests of neutrality and mismatch distribution indicative of a recent population expansion in Labrador, dated between c. 3500 and 8300 years ago. © 2016 The Fisheries Society of the British Isles.

Nucleotide diversity, natural variation, and evolution of Flexible culm-1 and Strong culm-2 lodging resistance genes in rice.

PubMed

Rashid, Muhammad Abdul Rehman; Zhao, Yan; Zhang, Hongliang; Li, Jinjie; Li, Zichao

2016-07-01

Lodging resistance is one of the vital traits in yield improvement and sustainability. Culm wall thickness, diameter, and strength are different traits that can govern the lodging resistance in rice. The genes SCM2 and FC1 have been isolated for culm thickness, strength, and flexibility, but their functional nucleotide variations were still unknown. We used a 13× deep sequence of 795 diverse genotypes to present the functional variation and SNP diversity in SCM2 and FC1. The major functional variant for the SCM2 gene was at position 27480181 and for the FC1 gene at position 31072992. Haplotype analysis of both genes provided their various allelic differences among haplotypes. SCM2 alleles further presented the evolution of Oryza sativa L. subsp. indica and subsp. japonica genomes from common parent in different geographical zones, while the haplotypes of FC1 suggested their evolution from different strains of the common parent Oryza rufipogon. SCM2 showed purifying selection and functional associations with rare alleles, while FC1 displayed balanced selection favored by multiple heterozygous alleles. Genotypes with an allelic combination of SCM2-3 and FC1-2 in japonica background exhibited striking resistance against lodging, which can be used in further breeding programs.

Accelerating next generation sequencing data analysis with system level optimizations.

PubMed

Kathiresan, Nagarajan; Temanni, Ramzi; Almabrazi, Hakeem; Syed, Najeeb; Jithesh, Puthen V; Al-Ali, Rashid

2017-08-22

Next generation sequencing (NGS) data analysis is highly compute intensive. In-memory computing, vectorization, bulk data transfer, CPU frequency scaling are some of the hardware features in the modern computing architectures. To get the best execution time and utilize these hardware features, it is necessary to tune the system level parameters before running the application. We studied the GATK-HaplotypeCaller which is part of common NGS workflows, that consume more than 43% of the total execution time. Multiple GATK 3.x versions were benchmarked and the execution time of HaplotypeCaller was optimized by various system level parameters which included: (i) tuning the parallel garbage collection and kernel shared memory to simulate in-memory computing, (ii) architecture-specific tuning in the PairHMM library for vectorization, (iii) including Java 1.8 features through GATK source code compilation and building a runtime environment for parallel sorting and bulk data transfer (iv) the default 'on-demand' mode of CPU frequency is over-clocked by using 'performance-mode' to accelerate the Java multi-threads. As a result, the HaplotypeCaller execution time was reduced by 82.66% in GATK 3.3 and 42.61% in GATK 3.7. Overall, the execution time of NGS pipeline was reduced to 70.60% and 34.14% for GATK 3.3 and GATK 3.7 respectively.

The Impact of BDNF Polymorphisms on Suicidality in Treatment-Resistant Major Depressive Disorder: A European Multicenter Study.

PubMed

Schosser, Alexandra; Carlberg, Laura; Calati, Raffaella; Serretti, Alessandro; Massat, Isabel; Spindelegger, Christoph; Linotte, Sylvie; Mendlewicz, Julien; Souery, Daniel; Zohar, Joseph; Montgomery, Stuart; Kasper, Siegfried

2017-10-01

Numerous studies have reported associations between the brain-derived neurotrophic factor (BDNF) gene and psychiatric disorders, including suicidal behavior, although with conflicting results. A total of 250 major depressive disorder patients were collected in the context of a European multicenter resistant depression study and treated with antidepressants at adequate doses for at least 4 weeks. Suicidality was assessed using the Mini International Neuropsychiatric Interview and Hamilton Rating Scale for Depression, and treatment response using the HAM-D. Genotyping was performed for the functional Val66Met polymorphism (rs6265) and 7 additional tagging single nucleotide polymorphisms within the BDNF gene. Neither BDNF single markers nor haplotypes were found to be associated with suicide risk and lifetime history of suicide attempts. Gender-specific analyses revealed nonsignificant single marker (rs908867) and haplotypic association with suicide risk in males after multiple testing correction. Analyzing treatment response phenotypes, the functional Val66Met polymorphism as well as rs10501087 showed significant genotypic and haplotypic association with suicide risk in remitters (n=34, 13.6%). Considering the sample size, the present findings need to be replicated in larger samples to confirm or refute a role of BDNF in the investigated suicidal behavior phenotypes. © The Author 2017. Published by Oxford University Press on behalf of CINP.

Genetic diversity of Plasmodium vivax over time and space: a community-based study in rural Amazonia.

PubMed

Batista, Camilla L; Barbosa, Susana; Da Silva Bastos, Melissa; Viana, Susana Ariane S; Ferreira, Marcelo U

2015-02-01

To examine how community-level genetic diversity of the malaria parasite Plasmodium vivax varies across time and space, we investigated the dynamics of parasite polymorphisms during the early phases of occupation of a frontier settlement in the Amazon Basin of Brazil. Microsatellite characterization of 84 isolates of P. vivax sampled over 3 years revealed a moderate-to-high genetic diversity (mean expected heterozygosity, 0.699), with a large proportion (78.5%) of multiple-clone infections (MCI), but also a strong multilocus linkage disequilibrium (LD) consistent with rare outcrossing. Little temporal and no spatial clustering was observed in the distribution of parasite haplotypes. A single microsatellite haplotype was shared by 3 parasites collected during an outbreak; all other 81 haplotypes were recovered only once. The lowest parasite diversity, with the smallest proportion of MCI and the strongest LD, was observed at the time of the outbreak, providing a clear example of epidemic population structure in a human pathogen. Population genetic parameters returned to pre-outbreak values during last 2 years of study, despite the concomitant decline in malaria incidence. We suggest that parasite genotyping can be useful for tracking the spread of new parasite strains associated with outbreaks in areas approaching malaria elimination.

A Large-Scale Genetic Association Study Confirms IL12B and Leads to the Identification of IL23R as Psoriasis-Risk Genes

PubMed Central

Cargill, Michele ; Schrodi, Steven J. ; Chang, Monica ; Garcia, Veronica E. ; Brandon, Rhonda ; Callis, Kristina P. ; Matsunami, Nori ; Ardlie, Kristin G. ; Civello, Daniel ; Catanese, Joseph J. ; Leong, Diane U. ; Panko, Jackie M. ; McAllister, Linda B. ; Hansen, Christopher B. ; Papenfuss, Jason ; Prescott, Stephen M. ; White, Thomas J. ; Leppert, Mark F. ; Krueger, Gerald G. ; Begovich, Ann B. 

2007-01-01

We performed a multitiered, case-control association study of psoriasis in three independent sample sets of white North American individuals (1,446 cases and 1,432 controls) with 25,215 genecentric single-nucleotide polymorphisms (SNPs) and found a highly significant association with an IL12B 3′-untranslated-region SNP (rs3212227), confirming the results of a small Japanese study. This SNP was significant in all three sample sets (odds ratio [OR]common 0.64, combined P [Pcomb]=7.85×10-10). A Monte Carlo simulation to address multiple testing suggests that this association is not a type I error. The coding regions of IL12B were resequenced in 96 individuals with psoriasis, and 30 additional IL12B-region SNPs were genotyped. Haplotypes were estimated, and genotype-conditioned analyses identified a second risk allele (rs6887695) located ∼60 kb upstream of the IL12B coding region that exhibited association with psoriasis after adjustment for rs3212227. Together, these two SNPs mark a common IL12B risk haplotype (ORcommon 1.40, Pcomb=8.11×10-9) and a less frequent protective haplotype (ORcommon 0.58, Pcomb=5.65×10-12), which were statistically significant in all three studies. Since IL12B encodes the common IL-12p40 subunit of IL-12 and IL-23, we individually genotyped 17 SNPs in the genes encoding the other chains of these cytokines (IL12A and IL23A) and their receptors (IL12RB1, IL12RB2, and IL23R). Haplotype analyses identified two IL23R missense SNPs that together mark a common psoriasis-associated haplotype in all three studies (ORcommon 1.44, Pcomb=3.13×10-6). Individuals homozygous for both the IL12B and the IL23R predisposing haplotypes have an increased risk of disease (ORcommon 1.66, Pcomb=1.33×10-8). These data, and the previous observation that administration of an antibody specific for the IL-12p40 subunit to patients with psoriasis is highly efficacious, suggest that these genes play a fundamental role in psoriasis pathogenesis. PMID:17236132

BCL11A Enhancer Haplotypes and Fetal Hemoglobin in Sickle Cell Anemia

PubMed Central

Sebastiani, P.; Farrell, J.J.; Alsultan, A.; Wang, S.; Edward, H. L.; Shappell, H.; Bae, H.; Milton, J. N.; Baldwin, C.T.; Al-Rubaish, A.M.; Naserullah, Z.; Al-Muhanna, F.; Alsuliman, A.; Patra, P. K.; Farrer, L.A.; Ngo, D.; Vathipadiekal, V.; Chui, D.H.K.; Al-Ali, A.K.; Steinberg, M.H.

2015-01-01

Background Fetal hemoglobin (HbF) levels in sickle cell anemia patients vary. We genotyped polymorphisms in the erythroid-specific enhancer of BCL11A to see if they might account for the very high HbF associated with the Arab-Indian (AI) haplotype and Benin haplotype of sickle cell anemia. Methods and Results Six BCL112A enhancer SNPs and their haplotypes were studied in Saudi Arabs from the Eastern Province and Indian patients with AI haplotype (HbF ~20%), African Americans (HbF ~7%), and Saudi Arabs from the Southwestern Province (HbF ~12%). Four SNPs (rs1427407, rs6706648, rs6738440, and rs7606173) and their haplotypes were consistently associated with HbF levels. The distributions of haplotypes differ in the 3 cohorts but not their genetic effects: the haplotype TCAG was associated with the lowest HbF level and the haplotype GTAC was associated with the highest HbF level and differences in HbF levels between carriers of these haplotypes in all cohorts was approximately 6%. Conclusions Common HbF BCL11A enhancer haplotypes in patients with African origin and AI sickle cell anemia have similar effects on HbF but they do not explain their differences in HbF. PMID:25703683

Novel skeletal muscle ryanodine receptor mutation in a large Brazilian family with malignant hyperthermia.

PubMed

McWilliams, S; Nelson, T; Sudo, R T; Zapata-Sudo, G; Batti, M; Sambuughin, N

2002-07-01

Malignant hyperthermia (MH) is an autosomal dominant disorder that predisposes susceptible individuals to a potentially life-threatening crisis when exposed to commonly used anesthetics. Mutations in the skeletal muscle calcium release channel, ryanodine receptor (RYR1) are associated with MH in over 50% of affected families. Linkage analysis of the RYR1 gene region at 19q13 was performed in a large Brazilian family and a distinct disease co-segregating haplotype was revealed in the majority of members with diagnosis of MH. Subsequent sequencing of RYR1 mutational hot spots revealed a nucleotide substitution of C to T at position 7062, causing a novel amino acid change from Arg2355 to Cys associated with MH in the family. Haplotype analysis of the RYR1 gene area at 19q13 in the family with multiple MH members is an important tool in identification of genetic cause underlying this disease.

CAPN1, CAST, and DGAT1 genetic effects on preweaning performance, carcass quality traits, and residual variance of tenderness in a beef cattle population selected for haplotype and allele equalization

USDA-ARS?s Scientific Manuscript database

Genetic marker effects and type of inheritance are estimated with poor precision when minor marker allele frequencies are low. A stable composite population (MARC III) was subjected to marker assisted selection for multiple years to equalize specific marker frequencies to 1) estimate effect size an...

Population genomic data reveal genes related to important traits of quail.

PubMed

Wu, Yan; Zhang, Yaolei; Hou, Zhuocheng; Fan, Guangyi; Pi, Jinsong; Sun, Shuai; Chen, Jiang; Liu, Huaqiao; Du, Xiao; Shen, Jie; Hu, Gang; Chen, Wenbin; Pan, Ailuan; Yin, Pingping; Chen, Xiaoli; Pu, Yuejin; Zhang, He; Liang, Zhenhua; Jian, Jianbo; Zhang, Hao; Wu, Bin; Sun, Jing; Chen, Jianwei; Tao, Hu; Yang, Ting; Xiao, Hongwei; Yang, Huan; Zheng, Chuanwei; Bai, Mingzhou; Fang, Xiaodong; Burt, David W; Wang, Wen; Li, Qingyi; Xu, Xun; Li, Chengfeng; Yang, Huanming; Wang, Jian; Yang, Ning; Liu, Xin; Du, Jinping

2018-05-01

Japanese quail (Coturnix japonica), a recently domesticated poultry species, is important not only as an agricultural product, but also as a model bird species for genetic research. However, most of the biological questions concerning genomics, phylogenetics, and genetics of some important economic traits have not been answered. It is thus necessary to complete a high-quality genome sequence as well as a series of comparative genomics, evolution, and functional studies. Here, we present a quail genome assembly spanning 1.04 Gb with 86.63% of sequences anchored to 30 chromosomes (28 autosomes and 2 sex chromosomes Z/W). Our genomic data have resolved the long-term debate of phylogeny among Perdicinae (Japanese quail), Meleagridinae (turkey), and Phasianinae (chicken). Comparative genomics and functional genomic data found that four candidate genes involved in early maturation had experienced positive selection, and one of them encodes follicle stimulating hormone beta (FSHβ), which is correlated with different FSHβ levels in quail and chicken. We re-sequenced 31 quails (10 wild, 11 egg-type, and 10 meat-type) and identified 18 and 26 candidate selective sweep regions in the egg-type and meat-type lines, respectively. That only one of them is shared between egg-type and meat-type lines suggests that they were subject to an independent selection. We also detected a haplotype on chromosome Z, which was closely linked with maroon/yellow plumage in quail using population resequencing and a genome-wide association study. This haplotype block will be useful for quail breeding programs. This study provided a high-quality quail reference genome, identified quail-specific genes, and resolved quail phylogeny. We have identified genes related to quail early maturation and a marker for plumage color, which is significant for quail breeding. These results will facilitate biological discovery in quails and help us elucidate the evolutionary processes within the Phasianidae family.

New HLA haplotype frequency reference standards: high-resolution and large sample typing of HLA DR-DQ haplotypes in a sample of European Americans.

PubMed

Klitz, W; Maiers, M; Spellman, S; Baxter-Lowe, L A; Schmeckpeper, B; Williams, T M; Fernandez-Viña, M

2003-10-01

A collaborative study involving a large sample of European Americans was typed for the histocompatibility loci of the HLA DR-DQ region and subjected to intensive typing validation measures in order to accurately determine haplotype composition and frequency. The resulting tables have immediate application to HLA typing and allogeneic transplantation. The loci within the DR-DQ region are especially valuable for such an undertaking because of their tight linkage and high linkage disequilibrium. The 3798 haplotypes, derived from 1899 unrelated individuals, had a total of 75 distinct DRB1-DQA1-DQB1 haplotypes. The frequency distribution of the haplotypes was right skewed with haplotypes occurring at a frequency of less than 1% numbering 59 and yet constituting less than 12% of the total sample. Given DRB1 typing, it was possible to infer the exact DQA1 and DQB1 composition of a haplotype with high confidence (>90% likelihood) in 21 of the 35 high-resolution DRB1 alleles present in the sample. Of the DRB1 alleles without high reliability for DQ haplotype inference, only *0401, *0701 and *1302 were common, the remaining 11 DRB1 alleles constituting less than 5% of the total sample. This approach failed for the 13 serologically equivalent DR alleles in which only 33% of DQ haplotypes could be reliably inferred. The 36 DQA1-DQB1 haplotypes present in the total sample conformed to the known pattern of permissible heterodimers. Four DQA1-DQB1 haplotypes, all rare, are reported here for the first time. The haplotype frequency tables are suitable as a reference standard for HLA typing of the DR and DQ loci in European Americans.

Sparse Tensor Decomposition for Haplotype Assembly of Diploids and Polyploids.

PubMed

Hashemi, Abolfazl; Zhu, Banghua; Vikalo, Haris

2018-03-21

Haplotype assembly is the task of reconstructing haplotypes of an individual from a mixture of sequenced chromosome fragments. Haplotype information enables studies of the effects of genetic variations on an organism's phenotype. Most of the mathematical formulations of haplotype assembly are known to be NP-hard and haplotype assembly becomes even more challenging as the sequencing technology advances and the length of the paired-end reads and inserts increases. Assembly of haplotypes polyploid organisms is considerably more difficult than in the case of diploids. Hence, scalable and accurate schemes with provable performance are desired for haplotype assembly of both diploid and polyploid organisms. We propose a framework that formulates haplotype assembly from sequencing data as a sparse tensor decomposition. We cast the problem as that of decomposing a tensor having special structural constraints and missing a large fraction of its entries into a product of two factors, U and [Formula: see text]; tensor [Formula: see text] reveals haplotype information while U is a sparse matrix encoding the origin of erroneous sequencing reads. An algorithm, AltHap, which reconstructs haplotypes of either diploid or polyploid organisms by iteratively solving this decomposition problem is proposed. The performance and convergence properties of AltHap are theoretically analyzed and, in doing so, guarantees on the achievable minimum error correction scores and correct phasing rate are established. The developed framework is applicable to diploid, biallelic and polyallelic polyploid species. The code for AltHap is freely available from https://github.com/realabolfazl/AltHap . AltHap was tested in a number of different scenarios and was shown to compare favorably to state-of-the-art methods in applications to haplotype assembly of diploids, and significantly outperforms existing techniques when applied to haplotype assembly of polyploids.

Sex differences in TTC12/ANKK1 haplotype associations with daily tobacco smoking in Black and White Americans.

PubMed

David, Sean P; Mezuk, Briana; Zandi, Peter P; Strong, David; Anthony, James C; Niaura, Raymond; Uhl, George R; Eaton, William W

2010-03-01

The 11q23.1 genomic region has been associated with nicotine dependence in Black and White Americans. By conducting linkage disequilibrium analyses of 7 informative single nucleotide polymorphisms (SNPs) within the tetratricopeptide repeat domain 12 (TTC12)/ankyrin repeat and kinase containing 1 (ANKK1)/dopamine (D2) receptor gene cluster, we identified haplotype block structures in 270 Black and 368 White (n = 638) participants, from the Baltimore Epidemiologic Catchment Area cohort study, spanning the TTC12 and ANKK1 genes consisting of three SNPs (rs2303380-rs4938015-rs11604671). Informative haplotypes were examined for sex-specific associations with daily tobacco smoking initiation and cessation using longitudinal data from 1993-1994 and 2004-2005 interviews. There was a Haplotype x Sex interaction such that Black men possessing the GTG haplotype who were smokers in 1993-2004 were more likely to have stopped smoking by 2004-2005 (55.6% GTG vs. 22.0% other haplotypes), while Black women were less likely to have quit smoking if they possessed the GTG (20.8%) versus other haplotypes (24.0%; p = .028). In Whites, the GTG haplotype (vs. other haplotypes) was associated with lifetime history of daily smoking (smoking initiation; odds ratio = 1.6; 95% CI = 1.1-2.4; p = .013). Moreover, there was a Haplotype x Sex interaction such that there was higher prevalence of smoking initiation with GTG (77.6%) versus other haplotypes (57.0%; p = .043). In 2 different ethnic American populations, we observed man-woman variation in the influence of the rs2303380-rs4938015-rs11604671 GTG haplotype on smoking initiation and cessation. These results should be replicated in larger cohorts to establish the relationship among the rs2303380-rs4938015-rs11604671 haplotype block, sex, and smoking behavior.

Population-Specific Haplotype Association of the Postsynaptic Density Gene DLG4 with Schizophrenia, in Family-Based Association Studies

PubMed Central

Balan, Shabeesh; Yamada, Kazuo; Hattori, Eiji; Iwayama, Yoshimi; Toyota, Tomoko; Ohnishi, Tetsuo; Maekawa, Motoko; Toyoshima, Manabu; Iwata, Yasuhide; Suzuki, Katsuaki; Kikuchi, Mitsuru; Yoshikawa, Takeo

2013-01-01

The post-synaptic density (PSD) of glutamatergic synapses harbors a multitude of proteins critical for maintaining synaptic dynamics. Alteration of protein expression levels in this matrix is a marked phenomenon of neuropsychiatric disorders including schizophrenia, where cognitive functions are impaired. To investigate the genetic relationship of genes expressed in the PSD with schizophrenia, a family-based association analysis of genetic variants in PSD genes such as DLG4, DLG1, PICK1 and MDM2, was performed, using Japanese samples (124 pedigrees, n = 376 subjects). Results showed a significant association of the rs17203281 variant from the DLG4 gene, with preferential transmission of the C allele (p = 0.02), although significance disappeared after correction for multiple testing. Replication analysis of this variant, found no association in a Chinese schizophrenia cohort (293 pedigrees, n = 1163 subjects) or in a Japanese case-control sample (n = 4182 subjects). The DLG4 expression levels between postmortem brain samples from schizophrenia patients showed no significant changes from controls. Interestingly, a five marker haplotype in DLG4, involving rs2242449, rs17203281, rs390200, rs222853 and rs222837, was enriched in a population specific manner, where the sequences A-C-C-C-A and G-C-C-C-A accumulated in Japanese (p = 0.0009) and Chinese (p = 0.0007) schizophrenia pedigree samples, respectively. However, this could not be replicated in case-control samples. None of the variants in other examined candidate genes showed any significant association in these samples. The current study highlights a putative role for DLG4 in schizophrenia pathogenesis, evidenced by haplotype association, and warrants further dense screening for variants within these haplotypes. PMID:23936182

The parasite that causes whirling disease, Myxobolus cerebralis, is genetically variable within and across spatial scales.

PubMed

Lodh, Nilanjan; Kerans, Billie L; Stevens, Lori

2012-01-01

Understanding the genetic structure of parasite populations on the natural landscape can reveal important aspects of disease ecology and epidemiology and can indicate parasite dispersal across the landscape. Myxobolus cerebralis (Myxozoa: Myxosporea), the causative agent of whirling disease in the definitive host Tubifex tubifex, is native to Eurasia and has spread to more than 25 states in the USA. The small amounts of data available to date suggest that M. cerebralis has little genetic variability. We examined the genetic variability of parasites infecting the definitive host T. tubifex in the Madison River, MT, and also from other parts of North America and Europe. We cloned and sequenced 18S ribosomal DNA and the internal transcribed spacer-1 (ITS-1) gene. Five oligochaetes were examined for 18S and five for ITS-1, only one individual was examined for both genes. We found two different 18S rRNA haplotypes of M. cerebralis from five worms and both intra- and interworm genetic variation for ITS-1, which showed 16 different haplotypes from among 20 clones. Comparison of our sequences with those from other studies revealed M. cerebralis from MT was similar to the parasite collected from Alaska, Oregon, California, and Virginia in the USA and from Munich, Germany, based on 18S, whereas parasite sequences from West Virginia were very different. Combined with the high haplotype diversity of ITS-1 and uniqueness of ITS-1 haplotypes, our results show that M. cerebralis is more variable than previously thought and raises the possibility of multiple introductions of the parasite into North America. © 2011 The Author(s) Journal of Eukaryotic Microbiology © 2011 International Society of Protistologists.

Genetic dissection of powdery mildew resistance in interspecific half-sib grapevine families using SNP-based maps.

PubMed

Teh, Soon Li; Fresnedo-Ramírez, Jonathan; Clark, Matthew D; Gadoury, David M; Sun, Qi; Cadle-Davidson, Lance; Luby, James J

2017-01-01

Quantitative trait locus (QTL) identification in perennial fruit crops is impeded largely by their lengthy generation time, resulting in costly and labor-intensive maintenance of breeding programs. In a grapevine (genus Vitis ) breeding program, although experimental families are typically unreplicated, the genetic backgrounds may contain similar progenitors previously selected due to their contribution of favorable alleles. In this study, we investigated the utility of joint QTL identification provided by analyzing half-sib families. The genetic control of powdery mildew was studied using two half-sib F 1 families, namely GE0711/1009 (MN1264 × MN1214; N  = 147) and GE1025 (MN1264 × MN1246; N  = 125) with multiple species in their ancestry. Maternal genetic maps consisting of 1077 and 1641 single nucleotide polymorphism (SNP) markers, respectively, were constructed using a pseudo-testcross strategy. Ratings of field resistance to powdery mildew were obtained based on whole-plant evaluation of disease severity. This 2-year analysis uncovered two QTLs that were validated on a consensus map in these half-sib families with improved precision relative to the parental maps. Examination of haplotype combinations based on the two QTL regions identified strong association of haplotypes inherited from 'Seyval blanc', through MN1264, with powdery mildew resistance. This investigation also encompassed the use of microsatellite markers to establish a correlation between 206-bp (UDV-015b) and 357-bp (VViv67) fragment sizes with resistance-carrying haplotypes. Our work is one of the first reports in grapevine demonstrating the use of SNP-based maps and haplotypes for QTL identification and tagging of powdery mildew resistance in half-sib families.

Mitochondrial DNA markers reveal high genetic diversity and strong genetic differentiation in populations of Dendrolimus kikuchii Matsumura (Lepidoptera: Lasiocampidae).

PubMed

Men, Qiulei; Xue, Guoxi; Mu, Dan; Hu, Qingling; Huang, Minyi

2017-01-01

Dendrolimus kikuchii Matsumura, 1927 is a serious forest pest causing great damage to coniferous trees in China. Despite its economic importance, the population genetics of this pest are poorly known. We used three mitochondrial genes (COI, COII and Cytb) to investigate the genetic diversity and genetic differentiation of 15 populations collected from the main distribution regions of D. kikuchii in China. Populations show high haplotype and nucleotide diversity. Haplotype network and phylogenetic analysis divides the populations into three major clades, the central and southeastern China (CC+SEC) clade, the eastern China (EC) clade, and the southwestern China (SWC) clade. Populations collected from adjacent localities share the same clade, which is consistent with the strong relationship of isolation by distance (r = 0.74824, P = 0.00001). AMOVA analysis indicated that the major portion of this molecular genetic variation is found among the three groups of CC+SEC, EC and SWC (61.26%). Of 105 pairwise FST comparisons, 93 show high genetic differentiation. Populations of Puer (PE), Yangshuo (YS) and Leishan (LS) are separated from other populations by a larger genetic distance. Distributions of pairwise differences obtained with single and combined gene data from the overall populations are multimodal, suggesting these populations had no prior population expansion in southern China. The nonsignificant neutral test on the basis of Tajima' D and Fu's Fs, and the lack of a star-shaped haplotype network together with the multiple haplotypes support this hypothesis. Pleistocene climatic fluctuations, combined with the host specificity to Pinus species, made these regions of south China into a refuge for D. kikuchii. The high level of population genetic structuring is related to their weak flight capacity, their variations of life history and the geographic distance among populations.

Haplotypes and gene expression implicate the MAPT region for Parkinson disease

PubMed Central

Tobin, J.E.; Latourelle, J.C.; Lew, M.F.; Klein, C.; Suchowersky, O.; Shill, H.A.; Golbe, L.I.; Mark, M.H.; Growdon, J.H.; Wooten, G.F.; Racette, B.A.; Perlmutter, J.S.; Watts, R.; Guttman, M.; Baker, K.B.; Goldwurm, S.; Pezzoli, G.; Singer, C.; Saint-Hilaire, M.H.; Hendricks, A.E.; Williamson, S.; Nagle, M.W.; Wilk, J.B.; Massood, T.; Laramie, J.M.; DeStefano, A.L.; Litvan, I.; Nicholson, G.; Corbett, A.; Isaacson, S.; Burn, D.J.; Chinnery, P.F.; Pramstaller, P.P.; Sherman, S.; Al-hinti, J.; Drasby, E.; Nance, M.; Moller, A.T.; Ostergaard, K.; Roxburgh, R.; Snow, B.; Slevin, J.T.; Cambi, F.; Gusella, J.F.; Myers, R.H.

2009-01-01

Background Microtubule-associated protein tau (MAPT) has been associated with several neurodegenerative disorders including forms of parkinsonism and Parkinson disease (PD). We evaluated the association of the MAPT region with PD in a large cohort of familial PD cases recruited by the GenePD Study. In addition, postmortem brain samples from patients with PD and neurologically normal controls were used to evaluate whether the expression of the 3-repeat and 4-repeat isoforms of MAPT, and neighboring genes Saitohin (STH) and KIAA1267, are altered in PD cerebellum. Methods Twenty-one single-nucleotide polymorphisms (SNPs) in the region of MAPT on chromosome 17q21 were genotyped in the GenePD Study. Single SNPs and haplotypes, including the H1 haplotype, were evaluated for association to PD. Relative quantification of gene expression was performed using real-time RT-PCR. Results After adjusting for multiple comparisons, SNP rs1800547 was significantly associated with PD affection. While the H1 haplotype was associated with a significantly increased risk for PD, a novel H1 subhaplotype was identified that predicted a greater increased risk for PD. The expression of 4-repeat MAPT, STH, and KIAA1267 was significantly increased in PD brains relative to controls. No difference in expression was observed for 3-repeat MAPT. Conclusions This study supports a role for MAPT in the pathogenesis of familial and idiopathic Parkinson disease (PD). Interestingly, the results of the gene expression studies suggest that other genes in the vicinity of MAPT, specifically STH and KIAA1267, may also have a role in PD and suggest complex effects for the genes in this region on PD risk. PMID:18509094

The Acid Phosphatase-Encoding Gene GmACP1 Contributes to Soybean Tolerance to Low-Phosphorus Stress

PubMed Central

Hao, Derong; Wang, Hui; Kan, Guizhen; Jin, Hangxia; Yu, Deyue

2014-01-01

Phosphorus (P) is essential for all living cells and organisms, and low-P stress is a major factor constraining plant growth and yield worldwide. In plants, P efficiency is a complex quantitative trait involving multiple genes, and the mechanisms underlying P efficiency are largely unknown. Combining linkage analysis, genome-wide and candidate-gene association analyses, and plant transformation, we identified a soybean gene related to P efficiency, determined its favorable haplotypes and developed valuable functional markers. First, six major genomic regions associated with P efficiency were detected by performing genome-wide associations (GWAs) in various environments. A highly significant region located on chromosome 8, qPE8, was identified by both GWAs and linkage mapping and explained 41% of the phenotypic variation. Then, a regional mapping study was performed with 40 surrounding markers in 192 diverse soybean accessions. A strongly associated haplotype (P = 10−7) consisting of the markers Sat_233 and BARC-039899-07603 was identified, and qPE8 was located in a region of approximately 250 kb, which contained a candidate gene GmACP1 that encoded an acid phosphatase. GmACP1 overexpression in soybean hairy roots increased P efficiency by 11–20% relative to the control. A candidate-gene association analysis indicated that six natural GmACP1 polymorphisms explained 33% of the phenotypic variation. The favorable alleles and haplotypes of GmACP1 associated with increased transcript expression correlated with higher enzyme activity. The discovery of the optimal haplotype of GmACP1 will now enable the accurate selection of soybeans with higher P efficiencies and improve our understanding of the molecular mechanisms underlying P efficiency in plants. PMID:24391523

Haplotype-based gene-gene interaction of bone morphogenetic protein 4 and interferon regulatory factor 6 in the etiology of non-syndromic cleft lip with or without cleft palate in a Chilean population.

PubMed

Blanco, Rafael; Colombo, Alicia; Pardo, Rosa; Suazo, José

2017-04-01

Non-syndromic cleft lip with or without cleft palate (NSCL/P) is the most common craniofacial birth defect in humans, the etiology of which can be dependent on the interactions of multiple genes. We previously reported haplotype associations for polymorphic variants of interferon regulatory factor 6 (IRF6), msh homeobox 1 (MSX1), bone morphogenetic protein 4 (BMP4), and transforming growth factor beta 3 (TGFB3) in Chile. Here, we analyzed the haplotype-based gene-gene interaction for markers of these genes and NSCL/P risk in the Chilean population. We genotyped 15 single nucleoptide polymorphisms (SNPs) in 152 Chilean patients and 164 controls. Linkage disequilibrium (LD) blocks were determined using the Haploview software, and phase reconstruction was performed by the Phase program. Haplotype-based interactions were evaluated using the multifactor dimensionality reduction (MDR) method. We detected two LD blocks composed of two SNPs from BMP4 (Block 1) and three SNPs from IRF6 (Block 2). Although MDR showed no statistical significance for the global interaction model involving these blocks, we found four combinations conferring a statistically significantly increased NSCL/P risk (Block 1-Block 2): T-T/T-G C-G-T/G-A-T; T-T/T-G C-G-C/C-G-C; T-T/T-G G-A-T/G-A-T; and T-T/C-G G-A-T/G-A-T. These findings may reflect the presence of a genomic region containing potential causal variants interacting in the etiology of NSCL/P and may contribute to disentangling the complex etiology of this birth defect. © 2017 Eur J Oral Sci.

Variable number of tandem repeat polymorphisms of DRD4: re-evaluation of selection hypothesis and analysis of association with schizophrenia

PubMed Central

Hattori, Eiji; Nakajima, Mizuho; Yamada, Kazuo; Iwayama, Yoshimi; Toyota, Tomoko; Saitou, Naruya; Yoshikawa, Takeo

2009-01-01

Associations have been reported between the variable number of tandem repeat (VNTR) polymorphisms in the exon 3 of dopamine D4 receptor gene gene and multiple psychiatric illnesses/traits. We examined the distribution of VNTR alleles of different length in a Japanese cohort and found that, as reported earlier, the size of allele ‘7R' was much rarer (0.5%) in Japanese than in Caucasian populations (∼20%). This presents a challenge to an earlier proposed hypothesis that positive selection favoring the allele 7R has contributed to its high frequency. To further address the issue of selection, we carried out sequencing of the VNTR region not only from human but also from chimpanzee samples, and made inference on the ancestral repeat motif and haplotype by use of a phylogenetic analysis program. The most common 4R variant was considered to be the ancestral haplotype as earlier proposed. However, in a gene tree of VNTR constructed on the basis of this inferred ancestral haplotype, the allele 7R had five descendent haplotypes in relatively long lineage, where genetic drift can have major influence. We also tested this length polymorphism for association with schizophrenia, studying two Japanese sample sets (one with 570 cases and 570 controls, and the other with 124 pedigrees). No evidence of association between the allele 7R and schizophrenia was found in any of the two data sets. Collectively, this study suggests that the VNTR variation does not have an effect large enough to cause either selection or a detectable association with schizophrenia in a study of samples of moderate size. PMID:19092778

Modeling coverage gaps in haplotype frequencies via Bayesian inference to improve stem cell donor selection.

PubMed

Louzoun, Yoram; Alter, Idan; Gragert, Loren; Albrecht, Mark; Maiers, Martin

2018-05-01

Regardless of sampling depth, accurate genotype imputation is limited in regions of high polymorphism which often have a heavy-tailed haplotype frequency distribution. Many rare haplotypes are thus unobserved. Statistical methods to improve imputation by extending reference haplotype distributions using linkage disequilibrium patterns that relate allele and haplotype frequencies have not yet been explored. In the field of unrelated stem cell transplantation, imputation of highly polymorphic human leukocyte antigen (HLA) genes has an important application in identifying the best-matched stem cell donor when searching large registries totaling over 28,000,000 donors worldwide. Despite these large registry sizes, a significant proportion of searched patients present novel HLA haplotypes. Supporting this observation, HLA population genetic models have indicated that many extant HLA haplotypes remain unobserved. The absent haplotypes are a significant cause of error in haplotype matching. We have applied a Bayesian inference methodology for extending haplotype frequency distributions, using a model where new haplotypes are created by recombination of observed alleles. Applications of this joint probability model offer significant improvement in frequency distribution estimates over the best existing alternative methods, as we illustrate using five-locus HLA frequency data from the National Marrow Donor Program registry. Transplant matching algorithms and disease association studies involving phasing and imputation of rare variants may benefit from this statistical inference framework.

Kullback-Leibler divergence for detection of rare haplotype common disease association.

PubMed

Lin, Shili

2015-11-01

Rare haplotypes may tag rare causal variants of common diseases; hence, detection of such rare haplotypes may also contribute to our understanding of complex disease etiology. Because rare haplotypes frequently result from common single-nucleotide polymorphisms (SNPs), focusing on rare haplotypes is much more economical compared with using rare single-nucleotide variants (SNVs) from sequencing, as SNPs are available and 'free' from already amassed genome-wide studies. Further, associated haplotypes may shed light on the underlying disease causal mechanism, a feat unmatched by SNV-based collapsing methods. In recent years, data mining approaches have been adapted to detect rare haplotype association. However, as they rely on an assumed underlying disease model and require the specification of a null haplotype, results can be erroneous if such assumptions are violated. In this paper, we present a haplotype association method based on Kullback-Leibler divergence (hapKL) for case-control samples. The idea is to compare haplotype frequencies for the cases versus the controls by computing symmetrical divergence measures. An important property of such measures is that both the frequencies and logarithms of the frequencies contribute in parallel, thus balancing the contributions from rare and common, and accommodating both deleterious and protective, haplotypes. A simulation study under various scenarios shows that hapKL has well-controlled type I error rates and good power compared with existing data mining methods. Application of hapKL to age-related macular degeneration (AMD) shows a strong association of the complement factor H (CFH) gene with AMD, identifying several individual rare haplotypes with strong signals.

Evolutionary history of Wolbachia infections in the fire ant Solenopsis invicta

PubMed Central

Ahrens, Michael E; Shoemaker, Dewayne

2005-01-01

Background Wolbachia are endosymbiotic bacteria that commonly infect numerous arthropods. Despite their broad taxonomic distribution, the transmission patterns of these bacteria within and among host species are not well understood. We sequenced a portion of the wsp gene from the Wolbachia genome infecting 138 individuals from eleven geographically distributed native populations of the fire ant Solenopsis invicta. We then compared these wsp sequence data to patterns of mitochondrial DNA (mtDNA) variation of both infected and uninfected host individuals to infer the transmission patterns of Wolbachia in S. invicta. Results Three different Wolbachia (wsp) variants occur within S. invicta, all of which are identical to previously described strains in fire ants. A comparison of the distribution of Wolbachia variants within S. invicta to a phylogeny of mtDNA haplotypes suggests S. invicta has acquired Wolbachia infections on at least three independent occasions. One common Wolbachia variant in S. invicta (wSinvictaB) is associated with two divergent mtDNA haplotype clades. Further, within each of these clades, Wolbachia-infected and uninfected individuals possess virtually identical subsets of mtDNA haplotypes, including both putative derived and ancestral mtDNA haplotypes. The same pattern also holds for wSinvictaA, where at least one and as many as three invasions into S. invicta have occurred. These data suggest that the initial invasions of Wolbachia into host ant populations may be relatively ancient and have been followed by multiple secondary losses of Wolbachia in different infected lineages over time. Finally, our data also provide additional insights into the factors responsible for previously reported variation in Wolbachia prevalence among S. invicta populations. Conclusion The history of Wolbachia infections in S. invicta is rather complex and involves multiple invasions or horizontal transmission events of Wolbachia into this species. Although these Wolbachia infections apparently have been present for relatively long time periods, these data clearly indicate that Wolbachia infections frequently have been secondarily lost within different lineages. Importantly, the uncoupled transmission of the Wolbachia and mtDNA genomes suggests that the presumed effects of Wolbachia on mtDNA evolution within S. invicta are less severe than originally predicted. Thus, the common concern that use of mtDNA markers for studying the evolutionary history of insects is confounded by maternally inherited endosymbionts such as Wolbachia may be somewhat unwarranted in the case of S. invicta. PMID:15927071

Population Structure With Localized Haplotype Clusters

PubMed Central

Browning, Sharon R.; Weir, Bruce S.

2010-01-01

We propose a multilocus version of FST and a measure of haplotype diversity using localized haplotype clusters. Specifically, we use haplotype clusters identified with BEAGLE, which is a program implementing a hidden Markov model for localized haplotype clustering and performing several functions including inference of haplotype phase. We apply this methodology to HapMap phase 3 data. With this haplotype-cluster approach, African populations have highest diversity and lowest divergence from the ancestral population, East Asian populations have lowest diversity and highest divergence, and other populations (European, Indian, and Mexican) have intermediate levels of diversity and divergence. These relationships accord with expectation based on other studies and accepted models of human history. In contrast, the population-specific FST estimates obtained directly from single-nucleotide polymorphisms (SNPs) do not reflect such expected relationships. We show that ascertainment bias of SNPs has less impact on the proposed haplotype-cluster-based FST than on the SNP-based version, which provides a potential explanation for these results. Thus, these new measures of FST and haplotype-cluster diversity provide an important new tool for population genetic analysis of high-density SNP data. PMID:20457877

An analysis of variation in the long-range genomic organization of the human major histocompatibility complex class II region by pulsed-field gel electrophoresis.

PubMed

Dunham, I; Sargent, C A; Dawkins, R L; Campbell, R D

1989-11-01

The class II region of the human major histocompatibility complex in seven common HLA haplotypes has been analyzed using pulsed-field gel electrophoresis, restriction enzymes that cut genomic DNA infrequently, and Southern blotting. This analysis has revealed that there are differences in the amount of DNA present in the DQ and DR subregions dependent on the haplotype. The class II region of the DR3 haplotype spans approximately 750 kb and has the same amount of DNA as the class II region of the DR5 and DR6 haplotypes. However, the DR2 haplotype has approximately 30 kb more DNA within the DR subregion. The DR4 haplotype has an additional approximately 110 kb of DNA within the DQ or DR subregions compared to the DR3, DR5, and DR6 haplotypes. These haplotype-specific differences could have some bearing both on the analysis of disease susceptibility and on the ability of chromosomes possessing different HLA haplotypes to recombine within the DQ/DR subregions.

Novel strategies to mine alcoholism-related haplotypes and genes by combining existing knowledge framework.

PubMed

Zhang, RuiJie; Li, Xia; Jiang, YongShuai; Liu, GuiYou; Li, ChuanXing; Zhang, Fan; Xiao, Yun; Gong, BinSheng

2009-02-01

High-throughout single nucleotide polymorphism detection technology and the existing knowledge provide strong support for mining the disease-related haplotypes and genes. In this study, first, we apply four kinds of haplotype identification methods (Confidence Intervals, Four Gamete Tests, Solid Spine of LD and fusing method of haplotype block) into high-throughout SNP genotype data to identify blocks, then use cluster analysis to verify the effectiveness of the four methods, and select the alcoholism-related SNP haplotypes through risk analysis. Second, we establish a mapping from haplotypes to alcoholism-related genes. Third, we inquire NCBI SNP and gene databases to locate the blocks and identify the candidate genes. In the end, we make gene function annotation by KEGG, Biocarta, and GO database. We find 159 haplotype blocks, which relate to the alcoholism most possibly on chromosome 1 approximately 22, including 227 haplotypes, of which 102 SNP haplotypes may increase the risk of alcoholism. We get 121 alcoholism-related genes and verify their reliability by the functional annotation of biology. In a word, we not only can handle the SNP data easily, but also can locate the disease-related genes precisely by combining our novel strategies of mining alcoholism-related haplotypes and genes with existing knowledge framework.

Variation analysis and gene annotation of eight MHC haplotypes: The MHC Haplotype Project

PubMed Central

Horton, Roger; Gibson, Richard; Coggill, Penny; Miretti, Marcos; Allcock, Richard J.; Almeida, Jeff; Forbes, Simon; Gilbert, James G. R.; Halls, Karen; Harrow, Jennifer L.; Hart, Elizabeth; Howe, Kevin; Jackson, David K.; Palmer, Sophie; Roberts, Anne N.; Sims, Sarah; Stewart, C. Andrew; Traherne, James A.; Trevanion, Steve; Wilming, Laurens; Rogers, Jane; de Jong, Pieter J.; Elliott, John F.; Sawcer, Stephen; Todd, John A.; Trowsdale, John

2008-01-01

The human major histocompatibility complex (MHC) is contained within about 4 Mb on the short arm of chromosome 6 and is recognised as the most variable region in the human genome. The primary aim of the MHC Haplotype Project was to provide a comprehensively annotated reference sequence of a single, human leukocyte antigen-homozygous MHC haplotype and to use it as a basis against which variations could be assessed from seven other similarly homozygous cell lines, representative of the most common MHC haplotypes in the European population. Comparison of the haplotype sequences, including four haplotypes not previously analysed, resulted in the identification of >44,000 variations, both substitutions and indels (insertions and deletions), which have been submitted to the dbSNP database. The gene annotation uncovered haplotype-specific differences and confirmed the presence of more than 300 loci, including over 160 protein-coding genes. Combined analysis of the variation and annotation datasets revealed 122 gene loci with coding substitutions of which 97 were non-synonymous. The haplotype (A3-B7-DR15; PGF cell line) designated as the new MHC reference sequence, has been incorporated into the human genome assembly (NCBI35 and subsequent builds), and constitutes the largest single-haplotype sequence of the human genome to date. The extensive variation and annotation data derived from the analysis of seven further haplotypes have been made publicly available and provide a framework and resource for future association studies of all MHC-associated diseases and transplant medicine. PMID:18193213

Cis-acting mutation and duplication: History of molecular evolution in a P450 haplotype responsible for insecticide resistance in Culex quinquefasciatus.

PubMed

Itokawa, Kentaro; Komagata, Osamu; Kasai, Shinji; Masada, Masahiro; Tomita, Takashi

2011-07-01

A cytochrome P450 gene, Cyp9m10, is more than 200-fold overexpressed in a pyrethroid resistant strain of Culex quinquefasciatus, JPal-per. The haplotype of this strain contains two copies of Cyp9m10 resulted from recent tandem duplication. In this study, we discovered and isolated a Cyp9m10 haplotype closely related to this duplicated Cyp9m10 haplotype from JHB, a strain used for the recent genome project for this mosquito species. The isolated haplotype (JHB-NIID-B haplotype) shared the same insertion of a transposable element upstream of the coding region with JPal-per strain but not duplicated. The JHB-NIID-B haplotype was considered to have diverged from the JPal-per lineage just before the duplication event. Cyp9m10 was moderately overexpressed in larvae with the JHB-NIID-B haplotype. The overexpressions in JHB-NIID-B and JPal-per haplotypes were developmentally regulated in similar pattern indicating both haplotypes share a common cis-acting mutation responsible for the overexpressions. The isolated moderately overexpressed haplotype conferred resistance, however, its efficacy was relatively small. We hypothesized that the first cis-acting mutation modified the consequence of the subsequent duplication in JPal-per lineage to confer stronger phenotypic effect than that if it occurred before the first cis-acting mutation. Copyright © 2011 Elsevier Ltd. All rights reserved.

Multispecies genetic objectives in spatial conservation planning.

PubMed

Nielsen, Erica S; Beger, Maria; Henriques, Romina; Selkoe, Kimberly A; von der Heyden, Sophie

2017-08-01

Growing threats to biodiversity and global alteration of habitats and species distributions make it increasingly necessary to consider evolutionary patterns in conservation decision making. Yet, there is no clear-cut guidance on how genetic features can be incorporated into conservation-planning processes, despite multiple molecular markers and several genetic metrics for each marker type to choose from. Genetic patterns differ between species, but the potential tradeoffs among genetic objectives for multiple species in conservation planning are currently understudied. We compared spatial conservation prioritizations derived from 2 metrics of genetic diversity (nucleotide and haplotype diversity) and 2 metrics of genetic isolation (private haplotypes and local genetic differentiation) in mitochondrial DNA of 5 marine species. We compared outcomes of conservation plans based only on habitat representation with plans based on genetic data and habitat representation. Fewer priority areas were selected for conservation plans based solely on habitat representation than on plans that included habitat and genetic data. All 4 genetic metrics selected approximately similar conservation-priority areas, which is likely a result of prioritizing genetic patterns across a genetically diverse array of species. Largely, our results suggest that multispecies genetic conservation objectives are vital to creating protected-area networks that appropriately preserve community-level evolutionary patterns. © 2016 Society for Conservation Biology.

Screening a UK amyotrophic lateral sclerosis cohort provides evidence of multiple origins of the C9orf72 expansion.

PubMed

Fratta, Pietro; Polke, James M; Newcombe, Jia; Mizielinska, Sarah; Lashley, Tammaryn; Poulter, Mark; Beck, Jon; Preza, Elisavet; Devoy, Anny; Sidle, Katie; Howard, Robin; Malaspina, Andrea; Orrell, Richard W; Clarke, Jan; Lu, Ching-Hua; Mok, Kin; Collins, Toby; Shoaii, Maryam; Nanji, Tina; Wray, Selina; Adamson, Gary; Pittman, Alan; Renton, Alan E; Traynor, Bryan J; Sweeney, Mary G; Revesz, Tamas; Houlden, Henry; Mead, Simon; Isaacs, Adrian M; Fisher, Elizabeth M C

2015-01-01

An expanded hexanucleotide repeat in the C9orf72 gene is the most common genetic cause of amyotrophic lateral sclerosis and frontotemporal dementia (C9ALS/FTD). Although 0-30 hexanucleotide repeats are present in the general population, expansions >500 repeats are associated with C9ALS/FTD. Large C9ALS/FTD expansions share a common haplotype and whether these expansions derive from a single founder or occur more frequently on a predisposing haplotype is yet to be determined and is relevant to disease pathomechanisms. Furthermore, although cases carrying 50-200 repeats have been described, their role and the pathogenic threshold of the expansions remain to be identified and carry importance for diagnostics and genetic counseling. We present clinical and genetic data from a UK ALS cohort and report the detailed molecular study of an atypical somatically unstable expansion of 90 repeats. Our results across different tissues provide evidence for the pathogenicity of this repeat number by showing they can somatically expand in the central nervous system to the well characterized pathogenic range. Our results support the occurrence of multiple expansion events for C9ALS/FTD. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

A Candidate Trans-acting Modulator of Fetal Hemoglobin Gene Expression in the Arab-Indian Haplotype of Sickle Cell Anemia

PubMed Central

Vathipadiekal, Vinod; Farrell, John J.; Wang, Shuai; Edward, Heather L.; Shappell, Heather; Al-Rubaish, A.M.; Al-Muhanna, Fahad; Naserullah, Z.; Alsuliman, A.; Qutub, Hatem Othman; Simkin, Irene; Farrer, Lindsay A.; Jiang, Zhihua; Luo, Hong-Yuan; Huang, Shengwen; Mostoslavsky, Gustavo; Murphy, George J.; Patra, Pradeep.K.; Chui, David H.K.; Alsultan, Abdulrahman; Al-Ali, Amein K.; Sebastiani, Paola.; Steinberg, Martin. H.

2016-01-01

Fetal hemoglobin (HbF) levels are higher in the Arab-Indian (AI) β-globin gene haplotype of sickle cell anemia compared with African-origin haplotypes. To study genetic elements that effect HbF expression in the AI haplotype we completed whole genome sequencing in 14 Saudi AI haplotype sickle hemoglobin homozygotes—seven selected for low HbF (8.2±1.3%) and seven selected for high HbF (23.5±.2.6%). An intronic single nucleotide polymorphism (SNP) in ANTXR1, an anthrax toxin receptor (chromosome 2p13), was associated with HbF. These results were replicated in two independent Saudi AI haplotype cohorts of 120 and 139 patients, but not in 76 Saudi Benin haplotype, 894 African origin haplotype and 44 Arab Indian haplotype patients of Indian descent, suggesting that this association is effective only in the Saudi AI haplotype background. ANTXR1 variants explained 10% of the HbF variability compared with 8% for BCL11A. These two genes had independent, additive effects on HbF and together explained about 15% of HbF variability in Saudi AI sickle cell anemia patients. ANTXR1 was expressed at mRNA and protein levels in erythroid progenitors derived from induced pluripotent stem cells (iPSCs) and CD34+ cells. As CD34+ cells matured and their HbF decreased ANTXR1 expression increased; as iPSCs differentiated and their HbF increased, ANTXR1 expression decreased. Along with elements in cis to the HbF genes, ANTXR1 contributes to the variation in HbF in Saudi AI haplotype sickle cell anemia and is the first gene in trans to HBB that is associated with HbF only in carriers of the Saudi AI haplotype. PMID:27501013

Complement factor H polymorphisms in Japanese population with age-related macular degeneration.

PubMed

Okamoto, Haru; Umeda, Shinsuke; Obazawa, Minoru; Minami, Masayoshi; Noda, Toru; Mizota, Atsushi; Honda, Miki; Tanaka, Minoru; Koyama, Risa; Takagi, Ikue; Sakamoto, Yoshihiro; Saito, Yoshihiro; Miyake, Yozo; Iwata, Takeshi

2006-03-06

To study the frequency of five haplotypes previously reported in the complement factor H (CFH) gene for Japanese patients with age-related macular degeneration (AMD). Genomic DNA was isolated from peripheral blood samples taken from 96 Japanese AMD patients and 89 age-matched controls. All patients were diagnosed as having exudative (wet-type) AMD. The amplified polymerase chain reaction (PCR) products of CFH exons 2, 9, and 13, and intron 6 were analyzed by temperature gradient capillary electrophoresis (TGCE) and by direct sequencing. The haplotypes were identified, and their frequencies were calculated and compared with reported results. Five haplotypes were identified in the Japanese population including four already reported in the American population. The frequencies of these haplotypes were significantly different between Japanese and American in both control and case groups. The haplotype containing Y402H, which was previously reported to be associated with AMD, was only 4% in the control and case population, with a p value of 0.802. However, two other haplotypes were found as risk factors, which gave an increased likelihood of AMD of 1.9 and 2.5 fold (95% CI 1.12-3.69 and 1.42-6.38). One protective haplotype that decreased the likelihood of AMD by 1.6 fold (95% CI 0.26-0.67) was identified. The frequencies for five haplotypes previously identified were analyzed in a Japanese population with AMD. Four previously found haplotypes were identified and one additional haplotype was found. The frequencies of each haplotype were significantly different from that in found Americans affected with AMD. Two of the haplotypes were identified as risk factors and one was considered protective.

Population Structure of Sclerotinia subarctica and Sclerotinia sclerotiorum in England, Scotland and Norway

PubMed Central

Clarkson, John P.; Warmington, Rachel J.; Walley, Peter G.; Denton-Giles, Matthew; Barbetti, Martin J.; Brodal, Guro; Nordskog, Berit

2017-01-01

Sclerotinia species are important fungal pathogens of a wide range of crops and wild host plants. While the biology and population structure of Sclerotinia sclerotiorum has been well-studied, little information is available for the related species S. subarctica. In this study, Sclerotinia isolates were collected from different crop plants and the wild host Ranuculus ficaria (meadow buttercup) in England, Scotland, and Norway to determine the incidence of Sclerotinia subarctica and examine the population structure of this pathogen for the first time. Incidence was very low in England, comprising only 4.3% of isolates while moderate and high incidence of S. subarctica was identified in Scotland and Norway, comprising 18.3 and 48.0% of isolates respectively. Characterization with eight microsatellite markers identified 75 haplotypes within a total of 157 isolates over the three countries with a few haplotypes in Scotland and Norway sampled at a higher frequency than the rest across multiple locations and host plants. In total, eight microsatellite haplotypes were shared between Scotland and Norway while none were shared with England. Bayesian and principal component analyses revealed common ancestry and clustering of Scottish and Norwegian S. subarctica isolates while English isolates were assigned to a separate population cluster and exhibited low diversity indicative of isolation. Population structure was also examined for S. sclerotiorum isolates from England, Scotland, Norway, and Australia using microsatellite data, including some from a previous study in England. In total, 484 haplotypes were identified within 800 S. sclerotiorum isolates with just 15 shared between England and Scotland and none shared between any other countries. Bayesian and principal component analyses revealed a common ancestry and clustering of the English and Scottish isolates while Norwegian and Australian isolates were assigned to separate clusters. Furthermore, sequencing part of the intergenic spacer (IGS) region of the rRNA gene resulted in 26 IGS haplotypes within 870 S. sclerotiorum isolates, nine of which had not been previously identified and two of which were also widely distributed across different countries. S. subarctica therefore has a multiclonal population structure similar to S. sclerotiorum, but has a different ancestry and distribution across England, Scotland, and Norway. PMID:28421039

Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents.

PubMed

Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z

2014-03-01

The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P < 0.05), six significantly downregulated MGMT promoter activity (29-97% decrease; P < 0.05) and one haplotype had no effect. Mechanistic studies conducted support the conclusion that MGMT P/E haplotypes, rather than individual SNPs, differentially regulate MGMT transcription and could thus play a significant role in human sensitivity to environmental and therapeutic alkylating agents.

Haplotype-Based Genotyping in Polyploids.

PubMed

Clevenger, Josh P; Korani, Walid; Ozias-Akins, Peggy; Jackson, Scott

2018-01-01

Accurate identification of polymorphisms from sequence data is crucial to unlocking the potential of high throughput sequencing for genomics. Single nucleotide polymorphisms (SNPs) are difficult to accurately identify in polyploid crops due to the duplicative nature of polyploid genomes leading to low confidence in the true alignment of short reads. Implementing a haplotype-based method in contrasting subgenome-specific sequences leads to higher accuracy of SNP identification in polyploids. To test this method, a large-scale 48K SNP array (Axiom Arachis2) was developed for Arachis hypogaea (peanut), an allotetraploid, in which 1,674 haplotype-based SNPs were included. Results of the array show that 74% of the haplotype-based SNP markers could be validated, which is considerably higher than previous methods used for peanut. The haplotype method has been implemented in a standalone program, HAPLOSWEEP, which takes as input bam files and a vcf file and identifies haplotype-based markers. Haplotype discovery can be made within single reads or span paired reads, and can leverage long read technology by targeting any length of haplotype. Haplotype-based genotyping is applicable in all allopolyploid genomes and provides confidence in marker identification and in silico-based genotyping for polyploid genomics.

Identification of parental line specific effects of MLF2 on resistance to coccidiosis in chickens

PubMed Central

2011-01-01

Background MLF2 was the candidate gene associated with coccidiosis resistance in chickens. Although single marker analysis supported the association between MLF2 and coccidiosis resistance, causative mutation relevant to coccidiosis was not identified yet. Thus, this study suggested segregation analysis of MLF2 haplotype and the association test of the other candidate genes using improved data transformation. Results A haplotype probably originated from one parental line was found out of 4 major haplotypes of MLF2. Frequency of this haplotype was 0.2 in parental chickens and its offspring in 12 families. Allele substitution effect of the MLF2 haplotype originated from a specific line was associated with increased body weight and fecal egg count explaining coccidiosis resistance. Nevertheless Box-Cox transformation was able to improve normality; association test did not produce obvious different results compared with analysis with log transformed phenotype. Conclusion Allele substitution effect analysis and classification of MLF2 haplotype identified the segregation of haplotype associated with coccidiosis resistance. The haplotype originated from a specific parental line was associated with improving disease resistance. Estimating effect of MLF2 haplotype on coccidiosis resistance will provide useful information for selecting animals or lines for future study. PMID:21645301

Detecting structure of haplotypes and local ancestry

USDA-ARS?s Scientific Manuscript database

We present a two-layer hidden Markov model to detect the structure of haplotypes for unrelated individuals. This allows us to model two scales of linkage disequilibrium (one within a group of haplotypes and one between groups), thereby taking advantage of rich haplotype information to infer local an...

Reconstruction of Haplotype-Blocks Selected during Experimental Evolution.

PubMed

Franssen, Susanne U; Barton, Nicholas H; Schlötterer, Christian

2017-01-01

The genetic analysis of experimentally evolving populations typically relies on short reads from pooled individuals (Pool-Seq). While this method provides reliable allele frequency estimates, the underlying haplotype structure remains poorly characterized. With small population sizes and adaptive variants that start from low frequencies, the interpretation of selection signatures in most Evolve and Resequencing studies remains challenging. To facilitate the characterization of selection targets, we propose a new approach that reconstructs selected haplotypes from replicated time series, using Pool-Seq data. We identify selected haplotypes through the correlated frequencies of alleles carried by them. Computer simulations indicate that selected haplotype-blocks of several Mb can be reconstructed with high confidence and low error rates, even when allele frequencies change only by 20% across three replicates. Applying this method to real data from D. melanogaster populations adapting to a hot environment, we identify a selected haplotype-block of 6.93 Mb. We confirm the presence of this haplotype-block in evolved populations by experimental haplotyping, demonstrating the power and accuracy of our haplotype reconstruction from Pool-Seq data. We propose that the combination of allele frequency estimates with haplotype information will provide the key to understanding the dynamics of adaptive alleles. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Native and European haplotypes of Phragmites Australis (common reed) in the central Platte River, Nebraska

USGS Publications Warehouse

Larson, D.L.; Galatowitsch, S.M.; Larson, J.L.

2011-01-01

Phragmites australis (common reed) is known to have occurred along the Platte River historically, but recent rapid increases in both distribution and density have begun to impact habitat for migrating sandhill cranes and nesting piping plovers and least terns. Invasiveness in Phragmites has been associated with the incursion of a European genotype (haplotype M) in other areas; determining the genotype of Phragmites along the central Platte River has implications for proper management of the river system. In 2008 we sampled Phragmites patches along the central Platte River from Lexington to Chapman, NE, stratified by bridge segments, to determine the current distribution of haplotype E (native) and haplotype M genotypes. In addition, we did a retrospective analysis of historical Phragmites collections from the central Platte watershed (1902-2006) at the Bessey Herbarium. Fresh tissue from the 2008 survey and dried tissue from the herbarium specimens were classified as haplotype M or E using the restriction fragment length polymorphism procedure. The European haplotype was predominant in the 2008 samples: only 14 Phragmites shoots were identified as native haplotype E; 224 were non-native haplotype M. The retrospective analysis revealed primarily native haplotype individuals. Only collections made in Lancaster County, near Lincoln, NE, were haplotype M, and the earliest of these was collected in 1973. ?? 2011 Copyright by the Center for Great Plains Studies, University of Nebraska-Lincoln.

Haplotype assembly in polyploid genomes and identical by descent shared tracts.

PubMed

Aguiar, Derek; Istrail, Sorin

2013-07-01

Genome-wide haplotype reconstruction from sequence data, or haplotype assembly, is at the center of major challenges in molecular biology and life sciences. For complex eukaryotic organisms like humans, the genome is vast and the population samples are growing so rapidly that algorithms processing high-throughput sequencing data must scale favorably in terms of both accuracy and computational efficiency. Furthermore, current models and methodologies for haplotype assembly (i) do not consider individuals sharing haplotypes jointly, which reduces the size and accuracy of assembled haplotypes, and (ii) are unable to model genomes having more than two sets of homologous chromosomes (polyploidy). Polyploid organisms are increasingly becoming the target of many research groups interested in the genomics of disease, phylogenetics, botany and evolution but there is an absence of theory and methods for polyploid haplotype reconstruction. In this work, we present a number of results, extensions and generalizations of compass graphs and our HapCompass framework. We prove the theoretical complexity of two haplotype assembly optimizations, thereby motivating the use of heuristics. Furthermore, we present graph theory-based algorithms for the problem of haplotype assembly using our previously developed HapCompass framework for (i) novel implementations of haplotype assembly optimizations (minimum error correction), (ii) assembly of a pair of individuals sharing a haplotype tract identical by descent and (iii) assembly of polyploid genomes. We evaluate our methods on 1000 Genomes Project, Pacific Biosciences and simulated sequence data. HapCompass is available for download at http://www.brown.edu/Research/Istrail_Lab/. Supplementary data are available at Bioinformatics online.

MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

PubMed

Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

2016-10-01

The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

Phylogenetic status of brown trout Salmo trutta populations in five rivers from the southern Caspian Sea and two inland lake basins, Iran: a morphogenetic approach.

PubMed

Hashemzadeh Segherloo, I; Farahmand, H; Abdoli, A; Bernatchez, L; Primmer, C R; Swatdipong, A; Karami, M; Khalili, B

2012-10-01

Interrelationships, origin and phylogenetic affinities of brown trout Salmo trutta populations from the southern Caspian Sea basin, Orumieh and Namak Lake basins in Iran were analysed from complete mtDNA control region sequences, 12 microsatellite loci and morphological characters. Among 129 specimens from six populations, seven haplotypes were observed. Based on mtDNA haplotype data, the Orumieh and southern Caspian populations did not differ significantly, but the Namak basin-Karaj population presented a unique haplotype closely related to the haplotypes of the other populations (0·1% Kimura two-parameter, K2P divergence). All Iranian haplotypes clustered as a distinct group within the Danube phylogenetic grouping, with an average K2P distance of 0·41% relative to other Danubian haplotypes. The Karaj haplotype in the Namak basin was related to a haplotype (Da26) formerly identified in the Tigris basin in Turkey, to a Salmo trutta oxianus haplotype from the Aral Sea basin, and to haplotype Da1a with two mutational steps, as well as to other Iranian haplotypes with one to two mutational steps, which may indicate a centre of origin in the Caspian basin. In contrast to results of the mtDNA analysis, more pronounced differentiation was observed among the populations studied in the morphological and microsatellite DNA data, except for the two populations from the Orumieh basin, which were similar, possibly due to anthropogenic causes. © 2012 The Authors. Journal of Fish Biology © 2012 The Fisheries Society of the British Isles.

Polymorphism at Expressed DQ and DR Loci in Five Common Equine MHC Haplotypes

PubMed Central

Miller, Donald; Tallmadge, Rebecca L.; Binns, Matthew; Zhu, Baoli; Mohamoud, Yasmin Ali; Ahmed, Ayeda; Brooks, Samantha A.; Antczak, Douglas F.

2016-01-01

The polymorphism of Major Histocompatibility Complex (MHC) class II DQ and DR genes in five common Equine Leukocyte Antigen (ELA) haplotypes was determined through sequencing of mRNA transcripts isolated from lymphocytes of eight ELA homozygous horses. Ten expressed MHC class II genes were detected in horses of the ELA-A3 haplotype carried by the donor horses of the equine Bacterial Artificial Chromosome (BAC) library and the reference genome sequence: four DR genes and six DQ genes. The other four ELA haplotypes contained at least eight expressed polymorphic MHC class II loci. Next Generation Sequencing (NGS) of genomic DNA of these four MHC haplotypes revealed stop codons in the DQA3 gene in the ELA-A2, ELA-A5, and ELA-A9 haplotypes. Few NGS reads were obtained for the other MHC class II genes that were not amplified in these horses. The amino acid sequences across haplotypes contained locus-specific residues, and the locus clusters produced by phylogenetic analysis were well supported. The MHC class II alleles within the five tested haplotypes were largely non-overlapping between haplotypes. The complement of equine MHC class II DQ and DR genes appears to be well conserved between haplotypes, in contrast to the recently described variation in class I gene loci between equine MHC haplotypes. The identification of allelic series of equine MHC class II loci will aid comparative studies of mammalian MHC conservation and evolution and may also help to interpret associations between the equine MHC class II region and diseases of the horse. PMID:27889800

Genetic association studies of the FOXP3 gene in Graves' disease and autoimmune Addison's disease in the United Kingdom population.

PubMed

Owen, Catherine J; Eden, James A; Jennings, Claire E; Wilson, Valerie; Cheetham, Tim D; Pearce, Simon H S

2006-08-01

Regulatory T lymphocytes play a crucial role in modulating potentially self-reactive clones, and dysfunction of this cell type contributes to autoimmune disease. FOXP3 is a critical determinant of CD(4+)CD(25+)T regulatory (T(reg)) cell development and function. The aim of this study was to investigate whether genetic polymorphisms at the FOXP3 locus predispose to autoimmune endocrinopathies. Five single nucleotide polymorphisms (SNPs) and two microsatellite polymorphisms were genotyped in our Caucasian cohorts of 633 unrelated Graves' disease (GD) subjects, 104 autoimmune Addison's disease (AAD) subjects and 528 healthy controls. SNP genotyping was performed by either restriction enzyme digestion or by primer-extension-MALDI-TOF (matrix-assisted laser desorption/ionisation time-of-flight) assay. Microsatellites were analysed using fluorescent PCR. Case-control analysis was performed using chi(2) testing on contingency tables for allele frequency. Haplotype analysis was performed using the UNPHASED package. No evidence for disease association was found with any of the seven polymorphisms in either of the GD or AAD subjects as compared with controls (P = 0.26-0.94). Haplotype analysis found a weak evidence for the association of a minor haplotype with GD; this was not significant when corrected for multiple testing. This study has found no robust evidence that FOXP3 gene polymorphism contributes to the susceptibility to GD or AAD in the UK population.

Harbor porpoise Phocoena phocoena strandings on the Dutch coast: No genetic structure, but evidence of inbreeding

NASA Astrophysics Data System (ADS)

van der Plas-Duivesteijn, Suzanne J.; Smit, Femmie J. L.; van Alphen, Jacques J. M.; Kraaijeveld, Ken

2015-03-01

Conservation management in the North Sea is often motivated by the population size of marine mammals, like harbor porpoises Phocoena phocoena. In the Dutch part of the North Sea, sighting and stranding data are used to estimate population sizes, but these data give little insight into genetic structuring of the population. In this study we investigated genetic structure among animals stranded at different locations and times of year. We also tested whether there is a link between stranding and necropsy data, and genetic diversity. We made use of both mitochondrial (mtDNA) and microsatellite DNA analysis of samples from dead stranded porpoises along the Dutch coast during 2007. mtDNA analysis showed 6 variable positions in the control region, defining 3 different haplotypes. mtDNA haplotypes were not randomly distributed along the Dutch coastline. However, microsatellite analysis showed that these mtDNA haplotypes did not represent separate groups on a nuclear level. Furthermore, microsatellite analysis revealed no genotypic differences between seasons, locations or genders. The results of this study indicate that the Dutch population is panmictic. In contrast, heterozygosity levels were low, indicating some level of inbreeding in this population. However, this was not corroborated by other indices of inbreeding. This research provided insight into genetic structuring of stranded porpoises in 2007, but data from multiple years should be included to be able to help estimate population sizes.

Further Evidence of the Association of the Diacylglycerol Kinase Kappa (DGKK) Gene With Hypospadias.

PubMed

Hozyasz, Kamil Konrad; Mostowska, Adrianna; Kowal, Andrzej; Mydlak, Dariusz; Tsibulski, Alexander; Jagodzinski, Pawel P

2018-02-18

Hypospadias is a common developmental anomaly of the male external genitalia. In previous studies conducted on West European, Californian, and Han Chinese populations the relationship between polymorphic variants of the diacylglycerol kinase kappa (DGKK) gene and hypospadias have been reported. The aim was to study the possible associations between polymorphic variants of the DGKK gene and hypospadias using an independent sample of the Polish population. Ten single nucleotide polymorphisms in DGKK, which were reported to have an impact on the risk of hypospadias in other populations, were genotyped using high-resolution melting curve analysis in a group of 166 boys with isolated anterior (66%) and middle (34%) forms of hypospadias and 285 properly matched controls without congenital anomalies. Two DGKK variants rs11091748 and rs12171755 were associated with increased risk of hypospadias in the Polish population. These results were statistically significant, even after applying the Bonferroni correction for multiple comparisons (P < .005). All the tested nucleotide variants were involved in haplotype combinations associated with hypospadias. The global p-values for haplotypes comprising of rs4143304-rs11091748, rs11091748-rs17328236, rs1934179-rs4554617, rs1934183-rs1934179-rs4554617 and rs12171755-rs1934183-rs1934179-rs4554617 were statistically significant, even after the permutation test correction. Our study provides strong evidence of an association between DGKK nucleotide variants, haplotypes and hypospadias susceptibility.

Genome-wide Association Study Identifies HLA 8.1 Ancestral Haplotype Alleles as Major Genetic Risk Factors for Myositis Phenotypes

PubMed Central

Miller, Frederick W.; Chen, Wei; O’Hanlon, Terrance P.; Cooper, Robert G.; Vencovsky, Jiri; Rider, Lisa G.; Danko, Katalin; Wedderburn, Lucy R.; Lundberg, Ingrid E.; Pachman, Lauren M.; Reed, Ann M.; Ytterberg, Steven R.; Padyukov, Leonid; Selva-O’Callaghan, Albert; Radstake, Timothy R.; Isenberg, David A.; Chinoy, Hector; Ollier, William E.R.; Scheet, Paul; Peng, Bo; Lee, Annette; Byun, Jinyoung; Lamb, Janine A.; Gregersen, Peter K.; Amos, Christopher I.

2016-01-01

Autoimmune muscle diseases (myositis) comprise a group of complex phenotypes influenced by genetic and environmental factors. To identify genetic risk factors in patients of European ancestry, we conducted a genome-wide association study (GWAS) of the major myositis phenotypes in a total of 1710 cases, which included 705 adult dermatomyositis; 473 juvenile dermatomyositis; 532 polymyositis; and 202 adult dermatomyositis, juvenile dermatomyositis or polymyositis patients with anti-histidyl tRNA synthetase (anti-Jo-1) autoantibodies, and compared them with 4724 controls. Single-nucleotide polymorphisms showing strong associations (P < 5 × 10−8) in GWAS were identified in the major histocompatibility complex (MHC) region for all myositis phenotypes together, as well as for the four clinical and autoantibody phenotypes studied separately. Imputation and regression analyses found that alleles comprising the human leukocyte antigen (HLA) 8.1 ancestral haplotype (AH8.1) defined essentially all the genetic risk in the phenotypes studied. Although the HLA DRB1*03:01 allele showed slightly stronger associations with adult and juvenile dermatomyositis, and HLA B*08:01 with polymyositis and anti-Jo-1 autoantibody-positive myositis, multiple alleles of AH8.1 were required for the full risk effects. Our findings establish that alleles of the AH8.1haplotype comprise the primary genetic risk factors associated with the major myositis phenotypes in geographically diverse Caucasian populations. PMID:26291516

Genetic diversity and variation of mitochondrial DNA in native and introduced bighead carp

USGS Publications Warehouse

Li, Si-Fa; Yang, Qin-Ling; Xu, Jia-Wei; Wang, Cheng-Hui; Chapman, Duane C.; Lu, Guoping

2010-01-01

The bighead carp Hypophthalmichthys nobilis is native to China but has been introduced to over 70 countries and is established in many large river systems. Genetic diversity and variation in introduced bighead carp have not previously been evaluated, and a systematic comparison among fish from different river systems was unavailable. In this study, 190 bighead carp specimens were sampled from five river systems in three countries (Yangtze, Pearl, and Amur rivers, China; Danube River, Hungary; Mississippi River basin, USA) and their mitochondrial 16S ribosomal RNA gene and D-loop region were sequenced (around 1,345 base pairs). Moderate genetic diversity was found in bighead carp, ranging from 0.0014 to 0.0043 for nucleotide diversity and from 0.6879 to 0.9333 for haplotype diversity. Haplotype analysis provided evidence that (1) multiple haplotype groups might be present among bighead carp, (2) bighead carp probably originated from the Yangtze River, and (3) bighead carp in the Mississippi River basin may have some genetic ancestry in the Danube River. The analysis of molecular variance showed significant genetic differentiation among these five populations but also revealed limited differentiation between the Yangtze and Amur River bighead carp. This large-scale study of bighead carp genetic diversity and variation provides the first global perspective of bighead carp in the context of biodiversity conservation as well as invasive species control and management.

Association of HLA-DQA1 and -DQB1 alleles with type I diabetes in Arabs: a meta-analyses.

PubMed

Hamzeh, A R; Nair, P; Al-Khaja, N; Al Ali, M T

2015-07-01

This study aimed at assessing the nature and significance of associations between various alleles of HLA-DQA1, HLA-DQB1, and type I diabetes (T1D) in Arab populations. Evidence from literature (published before 20 April 2015) was amassed and analysed through multiple meta-analyses, which yielded effect summary odds ratios and 95% confidence intervals for 24 alleles and 4 haplotypes. A total of 1273 cases and 1747 controls from 16 studies were analysed. High levels of significance were obtained to support higher T1D risk when harbouring DQA1*03:01. The alleles DQB1*02:01 and *03:02 and the haplotypes DR3 and DR4 were significant risk factors, albeit with high publication heterogeneity. The protective effects of DQA1*01:01, DQB1*05:03, *06:02, *06:03, and *06:04 were robustly suggested by all indicators of meta-analyses. The haplotypes DR7 and DR11 were strongly suggested to be protective in Arabs. A relatively small number of studies have emerged from Arab countries, mostly with inadequate power on an individual basis. This study fills the gap by providing significant size effect of human leukocyte antigen (HLA) alleles and completes the continuum of global ethnic differences in this context. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Neuronal nitric oxide synthase (NOS1) polymorphisms interact with financial hardship to affect depression risk.

PubMed

Sarginson, Jane E; Deakin, J F William; Anderson, Ian M; Downey, Darragh; Thomas, Emma; Elliott, Rebecca; Juhasz, Gabriella

2014-11-01

There is increasing evidence that genetic factors have a role in differential susceptibility to depression in response to severe or chronic adversity. Studies in animals suggest that nitric oxide (NO) signalling has a key role in depression-like behavioural responses to stress. This study investigated whether genetic variation in the brain-expressed nitric oxide synthase gene NOS1 modifies the relationship between psychosocial stress and current depression score. We recruited a population sample of 1222 individuals who provided DNA and questionnaire data on symptoms and stress. Scores on the List of Life-Threatening Experiences (LTE) questionnaire for the last year and self-rated current financial hardship were used as measures of recent/ongoing psychosocial stress. Twenty SNPs were genotyped. Significant associations between eight NOS1 SNPs, comprising two regional haplotypes, and current depression score were identified that survived correction for multiple testing when current financial hardship was used as the interaction term. A smaller three-SNP haplotypes (rs10507279, rs1004356 and rs3782218) located in a regulatory region of NOS1 showed one of the strongest effects, with the A-C-T haplotype associating with higher depression scores at low adversity levels but lower depression scores at higher adversity levels (p=2.3E-05). These results suggest that NOS1 SNPs interact with exposure to economic and psychosocial stressors to alter individual's susceptibility to depression.

Neuronal Nitric Oxide Synthase (NOS1) Polymorphisms Interact with Financial Hardship to Affect Depression Risk

PubMed Central

Sarginson, Jane E; Deakin, JF William; Anderson, Ian M; Downey, Darragh; Thomas, Emma; Elliott, Rebecca; Juhasz, Gabriella

2014-01-01

There is increasing evidence that genetic factors have a role in differential susceptibility to depression in response to severe or chronic adversity. Studies in animals suggest that nitric oxide (NO) signalling has a key role in depression-like behavioural responses to stress. This study investigated whether genetic variation in the brain-expressed nitric oxide synthase gene NOS1 modifies the relationship between psychosocial stress and current depression score. We recruited a population sample of 1222 individuals who provided DNA and questionnaire data on symptoms and stress. Scores on the List of Life-Threatening Experiences (LTE) questionnaire for the last year and self-rated current financial hardship were used as measures of recent/ongoing psychosocial stress. Twenty SNPs were genotyped. Significant associations between eight NOS1 SNPs, comprising two regional haplotypes, and current depression score were identified that survived correction for multiple testing when current financial hardship was used as the interaction term. A smaller three-SNP haplotypes (rs10507279, rs1004356 and rs3782218) located in a regulatory region of NOS1 showed one of the strongest effects, with the A-C-T haplotype associating with higher depression scores at low adversity levels but lower depression scores at higher adversity levels (p=2.3E-05). These results suggest that NOS1 SNPs interact with exposure to economic and psychosocial stressors to alter individual's susceptibility to depression. PMID:24917196

An omnibus test for family-based association studies with multiple SNPs and multiple phenotypes.

PubMed

Lasky-Su, Jessica; Murphy, Amy; McQueen, Matthew B; Weiss, Scott; Lange, Christoph

2010-06-01

We propose an omnibus family-based association test (MFBAT) that can be applied to multiple markers and multiple phenotypes and that has only one degree of freedom. The proposed test statistic extends current FBAT methodology to incorporate multiple markers as well as multiple phenotypes. Using simulation studies, power estimates for the proposed methodology are compared with the standard methodologies. On the basis of these simulations, we find that MFBAT substantially outperforms other methods, including haplotypic approaches and doing multiple tests with single single-nucleotide polymorphisms (SNPs) and single phenotypes. The practical relevance of the approach is illustrated by an application to asthma in which SNP/phenotype combinations are identified and reach overall significance that would not have been identified using other approaches. This methodology is directly applicable to cases in which there are multiple SNPs, such as candidate gene studies, cases in which there are multiple phenotypes, such as expression data, and cases in which there are multiple phenotypes and genotypes, such as genome-wide association studies that incorporate expression profiles as phenotypes. This program is available in the PBAT analysis package.

Genetic evidence from Indian red jungle fowl corroborates multiple domestication of modern day chicken.

PubMed

Kanginakudru, Sriramana; Metta, Muralidhar; Jakati, R D; Nagaraju, J

2008-06-10

Domestication of chicken is believed to have occurred in Southeast Asia, especially in Indus valley. However, non-inclusion of Indian red jungle fowl (RJF), Gallus gallus murghi in previous studies has left a big gap in understanding the relationship of this major group of birds. In the present study, we addressed this issue by analyzing 76 Indian birds that included 56 G. g. murghi (RJF), 16 G. g. domesticus (domestic chicken) and 4 G. sonneratii (Grey JF) using both microsatellite markers and mitochondrial D-loop sequences. We also compared the D-loop sequences of Indian birds with those of 779 birds obtained from GenBank. Microsatellite marker analyses of Indian birds indicated an average FST of 0.126 within G. g. murghi, and 0.154 within G. g. domesticus while it was more than 0.2 between the two groups. The microsatellite-based phylogenetic trees showed a clear separation of G. g. domesticus from G. g. murghi, and G. sonneratii. Mitochondrial DNA based mismatch distribution analyses showed a lower Harpending's raggedness index in both G. g. murghi (0.001515) and in Indian G. g. domesticus (0.0149) birds indicating population expansion. When meta analysis of global populations of 855 birds was carried out using median joining haplotype network, 43 Indian birds of G. g. domesticus (19 haplotypes) were distributed throughout the network sharing haplotypes with the RJFs of different origins. Our results suggest that the domestication of chicken has occurred independently in different locations of Asia including India. We found evidence for domestication of Indian birds from G. g. spadiceus and G. g. gallus as well as from G. g. murghi, corroborating multiple domestication of Indian and other domestic chicken. In contrast to the commonly held view that RJF and domestic birds hybridize in nature, the present study shows that G. g. murghi is relatively pure. Further, the study also suggested that the chicken populations have undergone population expansion, especially in the Indus valley.

HLA and killer cell immunoglobulin-like receptor (KIRs) genotyping in patients with acute viral encephalitis

PubMed Central

Tuttolomondo, Antonino; Colomba, Claudia; Di Bona, Danilo; Casuccio, Alessandra; Di Raimondo, Domenico; Clemente, Giuseppe; Arnao, Valentina; Pecoraro, Rosaria; Ragonese, Paolo; Aiello, Anna; Accardi, Giulia; Maugeri, Rosario; Maida, Carlo; Simonetta, Irene; Della Corte, Vittoriano; Iacopino, Domenico Gerardo; Caruso, Calogero; Cascio, Antonio; Pinto, Antonio

2018-01-01

Introduction The HLA genes, as well as the innate immune KIR genes, are considered relevant determinants of viral outcomes but no study, to our knowledge, has evaluated their role in the clinical setting of acute viral encephalitis. Results Subjects with acute viral encephalitis in comparison to subjects without acute viral encephalitis showed a significantly higher frequency of 2DL1 KIR gene and AA KIR haplotypes and of HLA-C2 and HLA-A-Bw4 alleles. Subjects without acute viral encephalitis showed a higher frequency of interaction between KIR2DL2 and HLAC1. Multiple logistic regression analysis showed the detrimental effect of HLA-A haplotype and HLA-C1, HLA-A-BW4 HLA-B-BW4T alleles, whereas multiple logistic regression showed a protective effect of AB+BB KIR haplotype and a detrimental effect of interaction between KIR3DL1 and HLA-A-Bw4. Discussion Our findings of a lower frequency of activating receptors in patients with acute encephalitis compared to controls could result in a less efficient response of NK cells. This finding could represent a possible pathogenetic explanation of susceptibility to acute symptomatic encephalitis in patients with viral infection from potentially responsible viruses such as Herpes virus. Materials and Methods 30 Consecutive patients with symptomatic acute viral encephalitis and as controls, 36 consecutive subjects without acute encephalitis were analyzed. The following KIR genes were analyzed, KIR2DL1, 2DL2, 2DL3, 2DL5, 3DL1, 3DL2, 3DL3, 2DL4, 2DS1, 2DS2, 2DS3, 2DS4, 2DS5, 3DS1, 2 pseudogenes (2DP1 and 3DP1) and the common variants of KIR2DL5 (KIR2DL5A, KIR2DL5B). PMID:29707126

Invasion pathway of the Ctenophore Mnemiopsis leidyi in the Mediterranean Sea.

PubMed

Ghabooli, Sara; Shiganova, Tamara A; Briski, Elizabeta; Piraino, Stefano; Fuentes, Veronica; Thibault-Botha, Delphine; Angel, Dror L; Cristescu, Melania E; Macisaac, Hugh J

2013-01-01

Gelatinous zooplankton outbreaks have increased globally owing to a number of human-mediated factors, including food web alterations and species introductions. The invasive ctenophore Mnemiopsis leidyi entered the Black Sea in the early 1980s. The invasion was followed by the Azov, Caspian, Baltic and North Seas, and, most recently, the Mediterranean Sea. Previous studies identified two distinct invasion pathways of M. leidyi from its native range in the western Atlantic Ocean to Eurasia. However, the source of newly established populations in the Mediterranean Sea remains unclear. Here we build upon our previous study and investigate sequence variation in both mitochondrial (Cytochrome c Oxidase subunit I) and nuclear (Internal Transcribed Spacer) markers in M. leidyi, encompassing five native and 11 introduced populations, including four from the Mediterranean Sea. Extant genetic diversity in Mediterranean populations (n = 8, N a = 10) preclude the occurrence of a severe genetic bottleneck or founder effects in the initial colonizing population. Our mitochondrial and nuclear marker surveys revealed two possible pathways of introduction into Mediterranean Sea. In total, 17 haplotypes and 18 alleles were recovered from all surveyed populations. Haplotype and allelic diversity of Mediterranean populations were comparable to populations from which they were likely drawn. The distribution of genetic diversity and pattern of genetic differentiation suggest initial colonization of the Mediterranean from the Black-Azov Seas (pairwise F ST = 0.001-0.028). However, some haplotypes and alleles from the Mediterranean Sea were not detected from the well-sampled Black Sea, although they were found in Gulf of Mexico populations that were also genetically similar to those in the Mediterranean Sea (pairwise F ST = 0.010-0.032), raising the possibility of multiple invasion sources. Multiple introductions from a combination of Black Sea and native region sources could be facilitated by intense local and transcontinental shipping activity, respectively.

Invasion Pathway of the Ctenophore Mnemiopsis leidyi in the Mediterranean Sea

PubMed Central

Ghabooli, Sara; Shiganova, Tamara A.; Briski, Elizabeta; Piraino, Stefano; Fuentes, Veronica; Thibault-Botha, Delphine; Angel, Dror L.; Cristescu, Melania E.; MacIsaac, Hugh J.

2013-01-01

Gelatinous zooplankton outbreaks have increased globally owing to a number of human-mediated factors, including food web alterations and species introductions. The invasive ctenophore Mnemiopsis leidyi entered the Black Sea in the early 1980s. The invasion was followed by the Azov, Caspian, Baltic and North Seas, and, most recently, the Mediterranean Sea. Previous studies identified two distinct invasion pathways of M. leidyi from its native range in the western Atlantic Ocean to Eurasia. However, the source of newly established populations in the Mediterranean Sea remains unclear. Here we build upon our previous study and investigate sequence variation in both mitochondrial (Cytochrome c Oxidase subunit I) and nuclear (Internal Transcribed Spacer) markers in M. leidyi, encompassing five native and 11 introduced populations, including four from the Mediterranean Sea. Extant genetic diversity in Mediterranean populations (n = 8, N a = 10) preclude the occurrence of a severe genetic bottleneck or founder effects in the initial colonizing population. Our mitochondrial and nuclear marker surveys revealed two possible pathways of introduction into Mediterranean Sea. In total, 17 haplotypes and 18 alleles were recovered from all surveyed populations. Haplotype and allelic diversity of Mediterranean populations were comparable to populations from which they were likely drawn. The distribution of genetic diversity and pattern of genetic differentiation suggest initial colonization of the Mediterranean from the Black-Azov Seas (pairwise F ST = 0.001–0.028). However, some haplotypes and alleles from the Mediterranean Sea were not detected from the well-sampled Black Sea, although they were found in Gulf of Mexico populations that were also genetically similar to those in the Mediterranean Sea (pairwise F ST = 0.010–0.032), raising the possibility of multiple invasion sources. Multiple introductions from a combination of Black Sea and native region sources could be facilitated by intense local and transcontinental shipping activity, respectively. PMID:24303030

Role of the human endogenous retrovirus HERV-K18 in autoimmune disease susceptibility: study in the Spanish population and meta-analysis.

PubMed

de la Hera, Belén; Varadé, Jezabel; García-Montojo, Marta; Lamas, José Ramón; de la Encarnación, Ana; Arroyo, Rafael; Fernández-Gutiérrez, Benjamín; Alvarez-Lafuente, Roberto; Urcelay, Elena

2013-01-01

Human endogenous retroviruses (HERVs) are genomic sequences that resulted from ancestral germ-line infections by exogenous retroviruses and therefore are transmitted in a Mendelian fashion. Increased HERV expression and antibodies to HERV antigens have been found in various autoimmune diseases. HERV-K18 in chromosome 1 was previously associated with type one diabetes and multiple sclerosis (MS). The etiology of these complex conditions has not been completely elucidated even after the powerful genome wide association studies (GWAS) performed. Nonetheless, this approach does not scrutinize the repetitive sequences within the genome, and part of the missing heritability could lie behind these sequences. We aimed at evaluating the role of HERV-K18 in chromosome 1 on autoimmune disease susceptibility. Two HERV-K18 SNPs (97Y/C and 154W/Stop substitutions) conforming three haplotypes were genotyped in Spanish cohorts of multiple sclerosis (n = 942), rheumatoid arthritis (n = 462) and ethnically matched controls (n = 601). Our findings were pooled in a meta-analysis including 5312 autoimmune patients and 4032 controls. Significant associations of both HERV-K18 polymorphisms in chromosome 1 with MS patients stratified by HLA-DRB1*15:01 were observed [97Y/C p = 0.02; OR (95% CI) = 1.5 (1.04-2.17) and 154W/Stop: p = 0.001; OR (95% CI) = 1.6 (1.19-2.16)]. Combined meta-analysis of the previously published association studies of HERV-K18 with different autoimmune diseases, together with data derived from Spanish cohorts, yielded a significant association of the HERV-K18.3 haplotype [97Y-154W: p(M-H) = 0.0008; OR(M-H) (95% CI) = 1.22 (1.09-1.38)]. Association of the HERV-K18.3 haplotype in chromosome 1 with autoimmune-disease susceptibility was confirmed through meta-analysis.

Geographic proximity not a prerequisite for invasion: Hawaii not the source of California invasion by light brown apple moth (Epiphyas postvittana).

PubMed

Rubinoff, Daniel; Holland, Brenden S; San Jose, Michael; Powell, Jerry A

2011-01-27

The light brown apple moth (LBAM), Epiphyas postvittana (Walker), is native to Australia but invaded England, New Zealand, and Hawaii more than 100 years ago. In temperate climates, LBAM can be a major agricultural pest. In 2006 LBAM was discovered in California, instigating eradication efforts and quarantine against Hawaiian agriculture, the assumption being that Hawaii was the source of the California infestation. Genetic relationships among populations in Hawaii, California, and New Zealand are crucial to understanding LBAM invasion dynamics across the Pacific. We sequenced mitochondrial DNA (mtDNA) from 1293 LBAM individuals from California (695), Hawaii (448), New Zealand (147), and Australia (3) to examine haplotype diversity and structure among introduced populations, and evaluate the null hypothesis that invasive populations are from a single panmictic source. However, invasive populations in California and New Zealand harbor deep genetic diversity, whereas Hawaii shows low level, shallow diversity. LBAM recently has established itself in California, but was in Hawaii and New Zealand for hundreds of generations, yet California and New Zealand show similar levels of genetic diversity relative to Hawaii. Thus, there is no clear relationship between duration of invasion and genetic structure. Demographic statistics suggest rapid expansion occurring in California and past expansions in New Zealand; multiple introductions of diverse, genetically fragmented lineages could contribute to these patterns. Hawaii and California share no haplotypes, therefore, Hawaii is not the source of the California introduction. Paradoxically, Hawaii and California share multiple haplotypes with New Zealand. New Zealand may be the source for the California and Hawaii infestations, but the introductions were independent, and Hawaii was invaded only once. This has significant implications for quarantine, and suggests that probability of invasion is not directly related to geographic distance. Surprisingly, Hawaiian LBAM populations have much lower genetic diversity than California, despite being older.

Geographic Proximity Not a Prerequisite for Invasion: Hawaii Not the Source of California Invasion by Light Brown Apple Moth (Epiphyas postvittana)

PubMed Central

Rubinoff, Daniel; Holland, Brenden S.; San Jose, Michael; Powell, Jerry A.

2011-01-01

Background The light brown apple moth (LBAM), Epiphyas postvittana (Walker), is native to Australia but invaded England, New Zealand, and Hawaii more than 100 years ago. In temperate climates, LBAM can be a major agricultural pest. In 2006 LBAM was discovered in California, instigating eradication efforts and quarantine against Hawaiian agriculture, the assumption being that Hawaii was the source of the California infestation. Genetic relationships among populations in Hawaii, California, and New Zealand are crucial to understanding LBAM invasion dynamics across the Pacific. Methodology/Principal Findings We sequenced mitochondrial DNA (mtDNA) from 1293 LBAM individuals from California (695), Hawaii (448), New Zealand (147), and Australia (3) to examine haplotype diversity and structure among introduced populations, and evaluate the null hypothesis that invasive populations are from a single panmictic source. However, invasive populations in California and New Zealand harbor deep genetic diversity, whereas Hawaii shows low level, shallow diversity. Conclusions/Significance LBAM recently has established itself in California, but was in Hawaii and New Zealand for hundreds of generations, yet California and New Zealand show similar levels of genetic diversity relative to Hawaii. Thus, there is no clear relationship between duration of invasion and genetic structure. Demographic statistics suggest rapid expansion occurring in California and past expansions in New Zealand; multiple introductions of diverse, genetically fragmented lineages could contribute to these patterns. Hawaii and California share no haplotypes, therefore, Hawaii is not the source of the California introduction. Paradoxically, Hawaii and California share multiple haplotypes with New Zealand. New Zealand may be the source for the California and Hawaii infestations, but the introductions were independent, and Hawaii was invaded only once. This has significant implications for quarantine, and suggests that probability of invasion is not directly related to geographic distance. Surprisingly, Hawaiian LBAM populations have much lower genetic diversity than California, despite being older. PMID:21298019

Genetic evidence from Indian red jungle fowl corroborates multiple domestication of modern day chicken

PubMed Central

2008-01-01

Background Domestication of chicken is believed to have occurred in Southeast Asia, especially in Indus valley. However, non-inclusion of Indian red jungle fowl (RJF), Gallus gallus murghi in previous studies has left a big gap in understanding the relationship of this major group of birds. In the present study, we addressed this issue by analyzing 76 Indian birds that included 56 G. g. murghi (RJF), 16 G. g. domesticus (domestic chicken) and 4 G. sonneratii (Grey JF) using both microsatellite markers and mitochondrial D-loop sequences. We also compared the D-loop sequences of Indian birds with those of 779 birds obtained from GenBank. Results Microsatellite marker analyses of Indian birds indicated an average FST of 0.126 within G. g. murghi, and 0.154 within G. g. domesticus while it was more than 0.2 between the two groups. The microsatellite-based phylogenetic trees showed a clear separation of G. g. domesticus from G. g. murghi, and G. sonneratii. Mitochondrial DNA based mismatch distribution analyses showed a lower Harpending's raggedness index in both G. g. murghi (0.001515) and in Indian G. g. domesticus (0.0149) birds indicating population expansion. When meta analysis of global populations of 855 birds was carried out using median joining haplotype network, 43 Indian birds of G. g. domesticus (19 haplotypes) were distributed throughout the network sharing haplotypes with the RJFs of different origins. Conclusion Our results suggest that the domestication of chicken has occurred independently in different locations of Asia including India. We found evidence for domestication of Indian birds from G. g. spadiceus and G. g. gallus as well as from G. g. murghi, corroborating multiple domestication of Indian and other domestic chicken. In contrast to the commonly held view that RJF and domestic birds hybridize in nature, the present study shows that G. g. murghi is relatively pure. Further, the study also suggested that the chicken populations have undergone population expansion, especially in the Indus valley. PMID:18544161

DNA barcoding of Bemisia tabaci complex (Hemiptera: Aleyrodidae) reveals southerly expansion of the dominant whitefly species on cotton in Pakistan.

PubMed

Ashfaq, Muhammad; Hebert, Paul D N; Mirza, M Sajjad; Khan, Arif M; Mansoor, Shahid; Shah, Ghulam S; Zafar, Yusuf

2014-01-01

Although whiteflies (Bemisia tabaci complex) are an important pest of cotton in Pakistan, its taxonomic diversity is poorly understood. As DNA barcoding is an effective tool for resolving species complexes and analyzing species distributions, we used this approach to analyze genetic diversity in the B. tabaci complex and map the distribution of B. tabaci lineages in cotton growing areas of Pakistan. Sequence diversity in the DNA barcode region (mtCOI-5') was examined in 593 whiteflies from Pakistan to determine the number of whitefly species and their distributions in the cotton-growing areas of Punjab and Sindh provinces. These new records were integrated with another 173 barcode sequences for B. tabaci, most from India, to better understand regional whitefly diversity. The Barcode Index Number (BIN) System assigned the 766 sequences to 15 BINs, including nine from Pakistan. Representative specimens of each Pakistan BIN were analyzed for mtCOI-3' to allow their assignment to one of the putative species in the B. tabaci complex recognized on the basis of sequence variation in this gene region. This analysis revealed the presence of Asia II 1, Middle East-Asia Minor 1, Asia 1, Asia II 5, Asia II 7, and a new lineage "Pakistan". The first two taxa were found in both Punjab and Sindh, but Asia 1 was only detected in Sindh, while Asia II 5, Asia II 7 and "Pakistan" were only present in Punjab. The haplotype networks showed that most haplotypes of Asia II 1, a species implicated in transmission of the cotton leaf curl virus, occurred in both India and Pakistan. DNA barcodes successfully discriminated cryptic species in B. tabaci complex. The dominant haplotypes in the B. tabaci complex were shared by India and Pakistan. Asia II 1 was previously restricted to Punjab, but is now the dominant lineage in southern Sindh; its southward spread may have serious implications for cotton plantations in this region.

Genetic diversity and population structure of Plasmodium vivax in Central China

PubMed Central

2014-01-01

Background In Central China the declining incidence of Plasmodium vivax has been interrupted by epidemic expansions and imported cases. The impact of these changes on the local parasite population, and concurrent risks of future resurgence, was assessed. Methods Plasmodium vivax isolates collected from Anhui and Jiangsu provinces, Central China between 2007 and 2010 were genotyped using capillary electrophoresis at seven polymorphic short tandem repeat markers. Spatial and temporal analyses of within-host and population diversity, population structure, and relatedness were conducted on these isolates. Results Polyclonal infections were infrequent in the 94 isolates from Anhui (4%) and 25 from Jiangsu (12%), with a trend for increasing frequency from 2008 to 2010 (2 to 19%) when combined. Population diversity was high in both provinces and across the years tested (HE = 0.8 – 0.85). Differentiation between Anhui and Jiangsu was modest (F’ ST  = 0.1). Several clusters of isolates with identical multi-locus haplotypes were observed across both Anhui and Jiangsu. Linkage disequilibrium was strong in both populations and in each year tested (IAS = 0.2 – 0.4), but declined two- to four-fold when identical haplotypes were accounted for, indicative of occasional epidemic transmission dynamics. None of five imported isolates shared identical haplotypes to any of the central Chinese isolates. Conclusions The population genetic structure of P. vivax in Central China highlights unstable transmission, with limited barriers to gene flow between the central provinces. Despite low endemicity, population diversity remained high, but the reservoirs sustaining this diversity remain unclear. The challenge of imported cases and risks of resurgence emphasize the need for continued surveillance to detect early warning signals. Although parasite genotyping has potential to inform the management of outbreaks, further studies are required to identify suitable marker panels for resolving local from imported P. vivax isolates. PMID:25008859

The IRF5-TNPO3 association with systemic lupus erythematosus has two components that other autoimmune disorders variably share.

PubMed

Kottyan, Leah C; Zoller, Erin E; Bene, Jessica; Lu, Xiaoming; Kelly, Jennifer A; Rupert, Andrew M; Lessard, Christopher J; Vaughn, Samuel E; Marion, Miranda; Weirauch, Matthew T; Namjou, Bahram; Adler, Adam; Rasmussen, Astrid; Glenn, Stuart; Montgomery, Courtney G; Hirschfield, Gideon M; Xie, Gang; Coltescu, Catalina; Amos, Chris; Li, He; Ice, John A; Nath, Swapan K; Mariette, Xavier; Bowman, Simon; Rischmueller, Maureen; Lester, Sue; Brun, Johan G; Gøransson, Lasse G; Harboe, Erna; Omdal, Roald; Cunninghame-Graham, Deborah S; Vyse, Tim; Miceli-Richard, Corinne; Brennan, Michael T; Lessard, James A; Wahren-Herlenius, Marie; Kvarnström, Marika; Illei, Gabor G; Witte, Torsten; Jonsson, Roland; Eriksson, Per; Nordmark, Gunnel; Ng, Wan-Fai; Anaya, Juan-Manuel; Rhodus, Nelson L; Segal, Barbara M; Merrill, Joan T; James, Judith A; Guthridge, Joel M; Scofield, R Hal; Alarcon-Riquelme, Marta; Bae, Sang-Cheol; Boackle, Susan A; Criswell, Lindsey A; Gilkeson, Gary; Kamen, Diane L; Jacob, Chaim O; Kimberly, Robert; Brown, Elizabeth; Edberg, Jeffrey; Alarcón, Graciela S; Reveille, John D; Vilá, Luis M; Petri, Michelle; Ramsey-Goldman, Rosalind; Freedman, Barry I; Niewold, Timothy; Stevens, Anne M; Tsao, Betty P; Ying, Jun; Mayes, Maureen D; Gorlova, Olga Y; Wakeland, Ward; Radstake, Timothy; Martin, Ezequiel; Martin, Javier; Siminovitch, Katherine; Moser Sivils, Kathy L; Gaffney, Patrick M; Langefeld, Carl D; Harley, John B; Kaufman, Kenneth M

2015-01-15

Exploiting genotyping, DNA sequencing, imputation and trans-ancestral mapping, we used Bayesian and frequentist approaches to model the IRF5-TNPO3 locus association, now implicated in two immunotherapies and seven autoimmune diseases. Specifically, in systemic lupus erythematosus (SLE), we resolved separate associations in the IRF5 promoter (all ancestries) and with an extended European haplotype. We captured 3230 IRF5-TNPO3 high-quality, common variants across 5 ethnicities in 8395 SLE cases and 7367 controls. The genetic effect from the IRF5 promoter can be explained by any one of four variants in 5.7 kb (P-valuemeta = 6 × 10(-49); OR = 1.38-1.97). The second genetic effect spanned an 85.5-kb, 24-variant haplotype that included the genes IRF5 and TNPO3 (P-valuesEU = 10(-27)-10(-32), OR = 1.7-1.81). Many variants at the IRF5 locus with previously assigned biological function are not members of either final credible set of potential causal variants identified herein. In addition to the known biologically functional variants, we demonstrated that the risk allele of rs4728142, a variant in the promoter among the lowest frequentist probability and highest Bayesian posterior probability, was correlated with IRF5 expression and differentially binds the transcription factor ZBTB3. Our analytical strategy provides a novel framework for future studies aimed at dissecting etiological genetic effects. Finally, both SLE elements of the statistical model appear to operate in Sjögren's syndrome and systemic sclerosis whereas only the IRF5-TNPO3 gene-spanning haplotype is associated with primary biliary cirrhosis, demonstrating the nuance of similarity and difference in autoimmune disease risk mechanisms at IRF5-TNPO3. Published by Oxford University Press 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

The IRF5–TNPO3 association with systemic lupus erythematosus has two components that other autoimmune disorders variably share

PubMed Central

Kottyan, Leah C.; Zoller, Erin E.; Bene, Jessica; Lu, Xiaoming; Kelly, Jennifer A.; Rupert, Andrew M.; Lessard, Christopher J.; Vaughn, Samuel E.; Marion, Miranda; Weirauch, Matthew T.; Namjou, Bahram; Adler, Adam; Rasmussen, Astrid; Glenn, Stuart; Montgomery, Courtney G.; Hirschfield, Gideon M.; Xie, Gang; Coltescu, Catalina; Amos, Chris; Li, He; Ice, John A.; Nath, Swapan K.; Mariette, Xavier; Bowman, Simon; Rischmueller, Maureen; Lester, Sue; Brun, Johan G.; Gøransson, Lasse G.; Harboe, Erna; Omdal, Roald; Cunninghame-Graham, Deborah S.; Vyse, Tim; Miceli-Richard, Corinne; Brennan, Michael T.; Lessard, James A.; Wahren-Herlenius, Marie; Kvarnström, Marika; Illei, Gabor G.; Witte, Torsten; Jonsson, Roland; Eriksson, Per; Nordmark, Gunnel; Ng, Wan-Fai; Anaya, Juan-Manuel; Rhodus, Nelson L.; Segal, Barbara M.; Merrill, Joan T.; James, Judith A.; Guthridge, Joel M.; Hal Scofield, R.; Alarcon-Riquelme, Marta; Bae, Sang-Cheol; Boackle, Susan A.; Criswell, Lindsey A.; Gilkeson, Gary; Kamen, Diane L.; Jacob, Chaim O.; Kimberly, Robert; Brown, Elizabeth; Edberg, Jeffrey; Alarcón, Graciela S.; Reveille, John D.; Vilá, Luis M.; Petri, Michelle; Ramsey-Goldman, Rosalind; Freedman, Barry I.; Niewold, Timothy; Stevens, Anne M.; Tsao, Betty P.; Ying, Jun; Mayes, Maureen D.; Gorlova, Olga Y.; Wakeland, Ward; Radstake, Timothy; Martin, Ezequiel; Martin, Javier; Siminovitch, Katherine; Moser Sivils, Kathy L.; Gaffney, Patrick M.; Langefeld, Carl D.; Harley, John B.; Kaufman, Kenneth M.

2015-01-01

Exploiting genotyping, DNA sequencing, imputation and trans-ancestral mapping, we used Bayesian and frequentist approaches to model the IRF5–TNPO3 locus association, now implicated in two immunotherapies and seven autoimmune diseases. Specifically, in systemic lupus erythematosus (SLE), we resolved separate associations in the IRF5 promoter (all ancestries) and with an extended European haplotype. We captured 3230 IRF5–TNPO3 high-quality, common variants across 5 ethnicities in 8395 SLE cases and 7367 controls. The genetic effect from the IRF5 promoter can be explained by any one of four variants in 5.7 kb (P-valuemeta = 6 × 10−49; OR = 1.38–1.97). The second genetic effect spanned an 85.5-kb, 24-variant haplotype that included the genes IRF5 and TNPO3 (P-valuesEU = 10−27–10−32, OR = 1.7–1.81). Many variants at the IRF5 locus with previously assigned biological function are not members of either final credible set of potential causal variants identified herein. In addition to the known biologically functional variants, we demonstrated that the risk allele of rs4728142, a variant in the promoter among the lowest frequentist probability and highest Bayesian posterior probability, was correlated with IRF5 expression and differentially binds the transcription factor ZBTB3. Our analytical strategy provides a novel framework for future studies aimed at dissecting etiological genetic effects. Finally, both SLE elements of the statistical model appear to operate in Sjögren's syndrome and systemic sclerosis whereas only the IRF5–TNPO3 gene-spanning haplotype is associated with primary biliary cirrhosis, demonstrating the nuance of similarity and difference in autoimmune disease risk mechanisms at IRF5–TNPO3. PMID:25205108

IRF5 haplotypes demonstrate diverse serological associations which predict serum interferon alpha activity and explain the majority of the genetic association with systemic lupus erythematosus

PubMed Central

Niewold, Timothy B; Kelly, Jennifer A; Kariuki, Silvia N; Franek, Beverly S; Kumar, Akaash A; Kaufman, Kenneth M; Thomas, Kenaz; Walker, Daniel; Kamp, Stan; Frost, Jacqueline M; Wong, Andrew K; Merrill, Joan T; Alarcón-Riquelme, Marta E; Tikly, Mohammed; Ramsey-Goldman, Rosalind; Reveille, John D; Petri, Michelle A; Edberg, Jeffrey C; Kimberly, Robert P; Alarcón, Graciela S; Kamen, Diane L; Gilkeson, Gary S; Vyse, Timothy J; James, Judith A; Gaffney, Patrick M; Moser, Kathy L; Crow, Mary K; Harley, John B

2012-01-01

Objective High serum interferon α (IFNα) activity is a heritable risk factor for systemic lupus erythematosus (SLE). Auto-antibodies found in SLE form immune complexes which can stimulate IFNα production by activating endosomal Toll-like receptors and interferon regulatory factors (IRFs), including IRF5. Genetic variation in IRF5 is associated with SLE susceptibility; however, it is unclear how IRF5 functional genetic elements contribute to human disease. Methods 1034 patients with SLE and 989 controls of European ancestry, 555 patients with SLE and 679 controls of African–American ancestry, and 73 patients with SLE of South African ancestry were genotyped at IRF5 polymorphisms, which define major haplotypes. Serum IFNα activity was measured using a functional assay. Results In European ancestry subjects, anti-double-stranded DNA (dsDNA) and anti-Ro antibodies were each associated with different haplotypes characterised by a different combination of functional genetic elements (OR > 2.56, p >003C; 1.9×10−14 for both). These IRF5 haplotype-auto-antibody associations strongly predicted higher serum IFNα in patients with SLE and explained > 70% of the genetic risk of SLE due to IRF5. In African–American patients with SLE a similar relationship between serology and IFNα was observed, although the previously described European ancestry-risk haplotype was present at admixture proportions in African–American subjects and absent in African patients with SLE. Conclusions The authors define a novel risk haplotype of IRF5 that is associated with anti-dsDNA antibodies and show that risk of SLE due to IRF5 genotype is largely dependent upon particular auto-antibodies. This suggests that auto-antibodies are directly pathogenic in human SLE, resulting in increased IFNα in cooperation with particular combinations of IRF5 functional genetic elements. SLE is a systemic autoimmune disorder affecting multiple organ systems including the skin, musculoskeletal, renal and haematopoietic systems. Humoral autoimmunity is a hallmark of SLE, and patients frequently have circulating auto-antibodies directed against dsDNA, as well as RNA binding proteins (RBP). Anti-RBP autoantibodies include antibodies which recognize Ro, La, Smith (anti-Sm), and ribonucleoprotein (anti-nRNP), collectively referred to as anti-retinol-binding protein). Anti-retinol-binding protein and anti-dsDNA auto-antibodies are rare in the healthy population.1 These auto-antibodies can be present in sera for years preceding the onset of clinical SLE illness2 and are likely pathogenic in SLE.34 PMID:22088620

Y-SNPs haplotype diversity in four Chinese cattle breeds.

PubMed

Zhang, Runfeng; Cheng, Ming; Li, Xiaofeng; Chen, Fuying; Zheng, Jing; Wang, Xiaofei; Meng, Quanke

2013-01-01

To investigate the genetic diversity of Chinese cattle, 96 male samples of 4 Chinese native cattle breeds were investigated using 5 single nucleotide polymorphisms specific to the bovine Y chromosome. Two previously described haplotypes (taurine Y2 and indicine Y3) were detected in 74 and 22 animals, respectively. The haplotype frequencies varied amongst the four native breeds. The taurine Y2 haplotype dominated in the Qinchuan, Dabieshan, and Yunba breeds. However, the indicine Y3 haplotype occurred in high frequency in the Enshi breed. Among the four native breeds, Yunba had the highest haplotype diversity (0.4330 ± 0.0750), followed by Qinchuan (0.2899 ± 0.1028) and Enshi (0.2222 ± 0.1662), Dabieshan was the least differentiated (0.1079 ± 0.0680). Compared with some foreign cattle breeds, the low level of haplotype diversity was detected in our breeds (0.2633 ± 0.1030).

Genetic variation of 'Candidatus Liberibacter solanacearum' haplotype C and identification of a novel haplotype from Trioza urticae and stinging nettle.

PubMed

Haapalainen, Minna L; Wang, Jinhui; Latvala, Satu; Lehtonen, Mikko T; Pirhonen, Minna; Nissinen, Anne I

2018-03-30

'Candidatus Liberibacter solanacearum' (CLso) haplotype C is associated with disease in carrots and transmitted by the carrot psyllid Trioza apicalis. To identify possible other sources and vectors of this pathogen in Finland, samples were taken of wild plants within and near the carrot fields, the psyllids feeding on these plants, parsnips growing next to carrots, and carrot seeds. For analyzing the genotype of the CLso positive samples, a multi-locus sequence typing (MLST) scheme was developed. CLso haplotype C was detected in 11% of the Trioza anthrisci samples, in 35% of the Anthriscus sylvestris plants with discoloration, and in parsnips showing leaf discoloration. MLST revealed that the CLso in T. anthrisci and most A. sylvestris plants represent different strains than the bacteria found in T. apicalis and the cultivated plants. CLso haplotype D was detected in two of the 34 carrot seed lots tested, but was not detected in the plants grown from these seeds. Phylogenetic analysis by UPGMA clustering suggested that the haplotype D is more closely related to the haplotype A than to C. A novel, sixth haplotype of CLso, most closely related to A and D, was found in the psyllid Trioza urticae and stinging nettle (Urtica dioica, Urticaceae), and named as haplotype U.

Discovery, evaluation and distribution of haplotypes of the wheat Ppd-D1 gene.

PubMed

Guo, Zhiai; Song, Yanxia; Zhou, Ronghua; Ren, Zhenglong; Jia, Jizeng

2010-02-01

Ppd-D1 is one of the most potent genes affecting the photoperiod response of wheat (Triticum aestivum). Only two alleles, insensitive Ppd-D1a and sensitive Ppd-D1b, were known previously, and these did not adequately explain the broad adaptation of wheat to photoperiod variation. In this study, five diagnostic molecular markers were employed to identify Ppd-D1 haplotypes in 492 wheat varieties from diverse geographic locations and 55 accessions of Aegilops tauschii, the D genome donor species of wheat. Six Ppd-D1 haplotypes, designated I-VI, were identified. Types II, V and VI were considered to be more ancient and types I, III and IV were considered to be derived from type II. The transcript abundances of the Ppd-D1 haplotypes showed continuous variation, being highest for haplotype I, lowest for haplotype III, and correlating negatively with varietal differences in heading time. These haplotypes also significantly affected other agronomic traits. The distribution frequency of Ppd-D1 haplotypes showed partial correlations with both latitudes and altitudes of wheat cultivation regions. The evolution, expression and distribution of Ppd-D1 haplotypes were consistent evidentially with each other. What was regarded as a pair of alleles in the past can now be considered a series of alleles leading to continuous variation.

Lemba origins revisited: tracing the ancestry of Y chromosomes in South African and Zimbabwean Lemba.

PubMed

Soodyall, Himla

2013-10-11

Previous historical, anthropological and genetic data provided overwhelming support for the Semitic origins of the Lemba, a Bantu-speaking people in southern Africa. To revisit the question concerning genetic affinities between the Lemba and Jews. Y-chromosome variation was examined in two Lemba groups: one from South Africa (SA) and, for the first time, a group from Zimbabwe (Remba), to re-evaluate the previously reported Jewish link. A sample of 261 males (76 Lemba, 54 Remba, 43 Venda and 88 SA Jews) was initially analysed for 16 bi-allelic and 6 short tandem repeats (STRs) that resulted in the resolution of 102 STR haplotypes distributed across 13 haplogroups. The non-African component in the Lemba and Remba was estimated to be 73.7% and 79.6%, respectively. In addition, a subset of 91 individuals (35 Lemba, 24 Remba, 32 SA Jews) with haplogroup J were resolved further using 6 additional bi-allelic markers and 12 STRs to screen for the extended Cohen modal haplotype (CMH). Although 24 individuals (10 Lemba and 14 SA Jews) were identified as having the original CMH (six STRs), only one SA Jew harboured the extended CMH.CONCLUSIONS. While it was not possible to trace unequivocally the origins of the non-African Y chromosomes in the Lemba and Remba, this study does not support the earlier claims of their Jewish genetic heritage.

[A total of 362 HLA different haplotypes and HLA recombination haplotypes based on analysis of their family pedigree in Chinese partial Han populations].

PubMed

Gao, Su-Qing; Cheng, Xi; Li, Qian; Li, Yu-Zhu; Deng, Zhi-Hui

2009-06-01

This study was aimed to discover the novel HLA recombination haplotypes and investigate the distribution of haplotypes in Chinese Han population. Based on the HLA-A, B, DRB1 typing results of 179 family members, 791 haplotypes were assigned by the mode of inheritance. The results showed that a total of 4 novel recombinant haplotypes in HLA-DRB1 locus region were observed in 4 families, which ratio of paternal to maternal chromosomes was 3:1. The recombination ratio between HLA-DRB1 and HLA-A or B loci was 0.92% (4/433). There were a total of 362 kinds of HLA-A, -B, -DRB1 haplotypes to be confirmed in Chinese Han partial population. A33-B58-DR17, A2-B46-DR9, A30-B13-DR7, A11-B13-DR15, A11-B75-DR12 and A2-B46-DR14 were the most common haplotypes that was consistent with the distribution of HLA alleles in unrelated donors. There were A1-B63-DR12, A29-B46-DR15, A1-B61-DR10, A34-B35-DR9, A29-B54-DR4, A23-B13-DR16 and A34-B62-DR15 haplotypes and so on, which were rare haplotypes not yet reported in Chinese. It is concluded that the HLA-A-B-DRB1 haplotypes would be confirmed by analysis of their family pedigree. The results obtained in this study are basic data for study of Chinese anthropology, organ transplantation and disease correlation analysis.

Haplotype-Based Association Analysis via Variance-Components Score Test

PubMed Central

Tzeng, Jung-Ying ; Zhang, Daowen 

2007-01-01

Haplotypes provide a more informative format of polymorphisms for genetic association analysis than do individual single-nucleotide polymorphisms. However, the practical efficacy of haplotype-based association analysis is challenged by a trade-off between the benefits of modeling abundant variation and the cost of the extra degrees of freedom. To reduce the degrees of freedom, several strategies have been considered in the literature. They include (1) clustering evolutionarily close haplotypes, (2) modeling the level of haplotype sharing, and (3) smoothing haplotype effects by introducing a correlation structure for haplotype effects and studying the variance components (VC) for association. Although the first two strategies enjoy a fair extent of power gain, empirical evidence showed that VC methods may exhibit only similar or less power than the standard haplotype regression method, even in cases of many haplotypes. In this study, we report possible reasons that cause the underpowered phenomenon and show how the power of the VC strategy can be improved. We construct a score test based on the restricted maximum likelihood or the marginal likelihood function of the VC and identify its nontypical limiting distribution. Through simulation, we demonstrate the validity of the test and investigate the power performance of the VC approach and that of the standard haplotype regression approach. With suitable choices for the correlation structure, the proposed method can be directly applied to unphased genotypic data. Our method is applicable to a wide-ranging class of models and is computationally efficient and easy to implement. The broad coverage and the fast and easy implementation of this method make the VC strategy an effective tool for haplotype analysis, even in modern genomewide association studies. PMID:17924336

Mapping of HLA- DQ haplotypes in a group of Danish patients with celiac disease.

PubMed

Lund, Flemming; Hermansen, Mette N; Pedersen, Merete F; Hillig, Thore; Toft-Hansen, Henrik; Sölétormos, György

2015-10-01

A cost-effective identification of HLA- DQ risk haplotypes using the single nucleotide polymorphism (SNP) technique has recently been applied in the diagnosis of celiac disease (CD) in four European populations. The objective of the study was to map risk HLA- DQ haplotypes in a group of Danish CD patients using the SNP technique. Cohort A: Among 65 patients with gastrointestinal symptoms we compared the HLA- DQ2 and HLA- DQ8 risk haplotypes obtained by the SNP technique (method 1) with results based on a sequence specific primer amplification technique (method 2) and a technique used in an assay from BioDiagene (method 3). Cohort B: 128 patients with histologically verified CD were tested for CD risk haplotypes (method 1). Patients with negative results were further tested for sub-haplotypes of HLA- DQ2 (methods 2 and 3). Cohort A: The three applied methods provided the same HLA- DQ2 and HLA- DQ8 results among 61 patients. Four patients were negative for the HLA- DQ2 and HLA- DQ8 haplotypes (method 1) but were positive for the HLA- DQ2.5-trans and HLA- DQ2.2 haplotypes (methods 2 and 3). Cohort B: A total of 120 patients were positive for the HLA- DQ2.5-cis and HLA- DQ8 haplotypes (method 1). The remaining seven patients were positive for HLA- DQ2.5-trans or HLA- DQ2.2 haplotypes (methods 2 and 3). One patient was negative with all three HLA methods. The HLA- DQ risk haplotypes were detected in 93.8% of the CD patients using the SNP technique (method 1). The sensitivity increased to 99.2% by combining methods 1 - 3.

β3 Integrin Haplotype Influences Gene Regulation and Plasma von Willebrand Factor Activity

PubMed Central

Payne, Katie E; Bray, Paul F; Grant, Peter J; Carter, Angela M

2008-01-01

The Leu33Pro polymorphism of the gene encoding β3 integrin (ITGB3) is associated with acute coronary syndromes and influences platelet aggregation. Three common promoter polymorphisms have also been identified. The aims of this study were to (1) investigate the influence of the ITGB3 −400C/A, −425A/C and −468G/A promoter polymorphisms on reporter gene expression and nuclear protein binding and (2) determine genotype and haplotype associations with platelet αIIbβ3 receptor density. Promoter haplotypes were introduced into an ITGB3 promoter-pGL3 construct by site directed mutagenesis and luciferase reporter gene expression analysed in HEL and HMEC-1 cells. Binding of nuclear proteins was assessed by electrophoretic mobility shift assay. The association of ITGB3 haplotype with platelet αIIbβ3 receptor density was determined in 223 subjects. Species conserved motifs were identified in the ITGB3 promoter in the vicinity of the 3 polymorphisms. The GAA, GCC, AAC, AAA and ACC constructs induced ~50% increased luciferase expression relative to the GAC construct in both cell types. Haplotype analysis including Leu33Pro indicated 5 common haplotypes; no associations between ITGB3 haplotypes and receptor density were found. However, the GCC-Pro33 haplotype was associated with significantly higher vWF activity (128.6 [112.1–145.1]%) compared with all other haplotypes (107.1 [101.2–113.0]%, p=0.02). In conclusion, the GCC-Pro33 haplotype was associated with increased vWF activity but not with platelet αIIbβ3 receptor density, which may indicate ITGB3 haplotype influences endothelial function. PMID:18045606

Phylogeography of the Qinghai-Tibetan Plateau endemic Juniperus przewalskii (Cupressaceae) inferred from chloroplast DNA sequence variation.

PubMed

Zhang, Q; Chiang, T Y; George, M; Liu, J Q; Abbott, R J

2005-10-01

The vegetation of the northeast Qinghai-Tibetan Plateau is dominated by alpine meadow and desert-steppe with sparse forests scattered within it. To obtain a better understanding of the phylogeography of one constituent species of the forests in this region, we examined chloroplast trnT-trnF and trnS-trnG sequence variation within Juniperus przewalskii, a key endemic tree species. Sequence data were obtained from 392 trees in 20 populations covering the entire distribution range of the species. Six cpDNA haplotypes were identified. Significant population subdivision was detected (G(ST) = 0.772, N(ST) = 0.834), suggesting low levels of recurrent gene flow among populations and significant phylogeographic structure (N(ST) > G(ST), P < 0.05). Eight of the nine disjunct populations surveyed on the high-elevation northeast plateau were fixed for a single haplotype (A), while the remaining, more westerly population, contained the same haplotype at high frequency together with two low frequency haplotypes (C and F). In contrast, most populations that occurred at lower altitudes at the plateau edge were fixed or nearly fixed for one of two haplotypes, A or E. However, two plateau edge populations had haplotype compositions different from the rest. In one, four haplotypes (A, B, D and E) were present at approximately equivalent frequencies, which might reflect a larger refugium in the area of this population during the last glacial period. Phylogenetic analysis indicated that the most widely distributed haplotype A is not ancestral to other haplotypes. The contrasting phylogeographic structures of the haplotype-rich plateau edge area and the almost haplotype-uniform plateau platform region indicate that the plateau platform was recolonized by J. przewalskii during the most recent postglacial period. This is supported by the findings of a nested clade analysis, which inferred that postglacial range expansion from the plateau edge followed by recent fragmentation is largely responsible for the present-day spatial distribution of cpDNA haplotypes within the species.

Effects of multiple scattering on time- and depth-resolved signals in airborne lidar systems

NASA Technical Reports Server (NTRS)

Punjabi, A.; Venable, D. D.

1986-01-01

A semianalytic Monte Carlo radiative transfer model (SALMON) is employed to probe the effects of multiple-scattering events on the time- and depth-resolved lidar signals from homogeneous aqueous media. The effective total attenuation coefficients in the single-scattering approximation are determined as functions of dimensionless parameters characterizing the lidar system and the medium. Results show that single-scattering events dominate when these parameters are close to their lower bounds and that when their values exceed unity multiple-scattering events dominate.

Nanoscale Characterization of Carrier Dynamic and Surface Passivation in InGaN/GaN Multiple Quantum Wells on GaN Nanorods.

PubMed

Chen, Weijian; Wen, Xiaoming; Latzel, Michael; Heilmann, Martin; Yang, Jianfeng; Dai, Xi; Huang, Shujuan; Shrestha, Santosh; Patterson, Robert; Christiansen, Silke; Conibeer, Gavin

2016-11-23

Using advanced two-photon excitation confocal microscopy, associated with time-resolved spectroscopy, we characterize InGaN/GaN multiple quantum wells on nanorod heterostructures and demonstrate the passivation effect of a KOH treatment. High-quality InGaN/GaN nanorods were fabricated using nanosphere lithography as a candidate material for light-emitting diode devices. The depth- and time-resolved characterization at the nanoscale provides detailed carrier dynamic analysis helpful for understanding the optical properties. The nanoscale spatially resolved images of InGaN quantum well and defects were acquired simultaneously. We demonstrate that nanorod etching improves light extraction efficiency, and a proper KOH treatment has been found to reduce the surface defects efficiently and enhance the luminescence. The optical characterization techniques provide depth-resolved and time-resolved carrier dynamics with nanoscale spatially resolved mapping, which is crucial for a comprehensive and thorough understanding of nanostructured materials and provides novel insight into the improvement of materials fabrication and applications.

Three potato centromeres are associated with distinct haplotypes with or without megabase-sized satellite repeat arrays.

PubMed

Wang, Linsheng; Zeng, Zixian; Zhang, Wenli; Jiang, Jiming

2014-02-01

We report discoveries of different haplotypes associated with the centromeres of three potato chromosomes, including haplotypes composed of long arrays of satellite repeats and haplotypes lacking the same repeats. These results are in favor of the hypothesis that satellite repeat-based centromeres may originate from neocentromeres that lack repeats.

Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.

PubMed

Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R

2001-11-23

Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.

COMT haplotypes, catecholamine metabolites in plasma and clinical response in schizophrenic and bipolar patients.

PubMed

Zumárraga, Mercedes; Arrúe, Aurora; Basterreche, Nieves; Macías, Isabel; Catalán, Ana; Madrazo, Arantza; Bustamante, Sonia; Zamalloa, María I; Erkoreka, Leire; Gordo, Estibaliz; Arnaiz, Ainara; Olivas, Olga; Arroita, Ariane; Marín, Elena; González-Torres, Miguel A

2016-06-01

We examined the association of COMT haplotypes and plasma metabolites of catecholamines in relation to the clinical response to antipsychotics in schizophrenic and bipolar patients. We studied 165 patients before and after four weeks of treatment, and 163 healthy controls. We assessed four COMT haplotypes and the plasma concentrations of HVA, DOPAC and MHPG. Bipolar patients: haplotypes are associated with age at onset and clinical evolution. In schizophrenic patients, an haplotype previously associated with increased risk, is related to better response of negative symptoms. Haplotypes would be good indicators of the clinical status and the treatment response in bipolar and schizophrenic patients. Larger studies are required to elucidate the clinical usefulness of these findings.

Extended Islands of Tractability for Parsimony Haplotyping

NASA Astrophysics Data System (ADS)

Fleischer, Rudolf; Guo, Jiong; Niedermeier, Rolf; Uhlmann, Johannes; Wang, Yihui; Weller, Mathias; Wu, Xi

Parsimony haplotyping is the problem of finding a smallest size set of haplotypes that can explain a given set of genotypes. The problem is NP-hard, and many heuristic and approximation algorithms as well as polynomial-time solvable special cases have been discovered. We propose improved fixed-parameter tractability results with respect to the parameter "size of the target haplotype set" k by presenting an O *(k 4k )-time algorithm. This also applies to the practically important constrained case, where we can only use haplotypes from a given set. Furthermore, we show that the problem becomes polynomial-time solvable if the given set of genotypes is complete, i.e., contains all possible genotypes that can be explained by the set of haplotypes.

Estrogen Receptor 1 ( ESR1) Gene Polymorphisms and Obesity Phenotypes in a Population of Young Adults.

PubMed

Correa-Rodríguez, María; Schmidt-RioValle, Jacqueline; González-Jiménez, Emilio; Rueda-Medina, Blanca

2017-06-01

Obesity is considered an increasingly serious health problem determined by multiple genetic and environmental factors. Estrogens have been found to play a major role in body weight and adiposity regulation through estrogen receptor 1 ( ESR1). The aim of this study was to determine whether genotype and haplotype frequencies of ESR1 polymorphisms are associated with body composition measures in a population of 572 young adults. A lack of significant association between genotypes of ESR1 gene polymorphisms and obesity phenotypes was seen after adjustment for confounding factors. Linkage disequilibrium (LD) analysis identified a single LD block for the ESR1 gene including PvuII and XbaI single-nucleotide polymorphisms (SNPs) (pairwise r 2 = .66). None of the haplotypes identified revealed statistically significant associations with any of the obesity phenotypes. Our results suggest that polymorphisms of the ESR1 gene do not contribute significantly to the genetic risk for obesity phenotypes in a population of young Caucasian adults.

A Gene-Oriented Haplotype Comparison Reveals Recently Selected Genomic Regions in Temperate and Tropical Maize Germplasm

PubMed Central

Zhang, Jie; Li, Yongxiang; Zheng, Jun; Zhang, Hongwei; Yang, Xiaohong; Wang, Jianhua; Wang, Guoying

2017-01-01

The extensive genetic variation present in maize (Zea mays) germplasm makes it possible to detect signatures of positive artificial selection that occurred during temperate and tropical maize improvement. Here we report an analysis of 532,815 polymorphisms from a maize association panel consisting of 368 diverse temperate and tropical inbred lines. We developed a gene-oriented approach adapting exonic polymorphisms to identify recently selected alleles by comparing haplotypes across the maize genome. This analysis revealed evidence of selection for more than 1100 genomic regions during recent improvement, and included regulatory genes and key genes with visible mutant phenotypes. We find that selected candidate target genes in temperate maize are enriched in biosynthetic processes, and further examination of these candidates highlights two cases, sucrose flux and oil storage, in which multiple genes in a common pathway can be cooperatively selected. Finally, based on available parallel gene expression data, we hypothesize that some genes were selected for regulatory variations, resulting in altered gene expression. PMID:28099470

Changes in the intraisolate genetic structure of Beet necrotic yellow vein virus populations associated with plant resistance breakdown.

PubMed

Acosta-Leal, Rodolfo; Fawley, Marvin W; Rush, Charles M

2008-06-20

The causal agent of rhizomania disease, Beet necrotic yellow vein virus (BNYVV), typically produces asymptomatic root-limited infections in sugar beets (Beta vulgaris) carrying the Rz1-allele. Unfortunately, this dominant resistance has been recently overcome. Multiple cDNA clones of the viral pathogenic determinant p25, derived from populations infecting susceptible or resistant plants, were sequenced to identify host effects on the viral population structure. Populations isolated from compatible plant-virus interactions (susceptible plant-wild type virus and resistant plant-resistant breaking variants) were large and relatively homogeneous, whereas those from the incompatible interaction (resistant plant-avirulent type virus) were small and highly heterogeneous. All populations from susceptible plants had the same dominant haplotype, whereas those from resistant cultivars had a different haplotype surrounded by a spectrum of mutants. Selection and diversification analyses suggest an evolutionary trajectory of BNYVV with positive selection for changes required to overcome resistance, followed by elimination of hitchhiking mutations through purifying selection.

Population structure and its effect on haplotype diversity and linkage disequilibrium surrounding the xa5 locus of rice (Oryza sativa L.).

PubMed Central

Garris, Amanda J; McCouch, Susan R; Kresovich, Stephen

2003-01-01

To assess the usefulness of linkage disequilibrium mapping in an autogamous, domesticated species, we have characterized linkage disequilibrium in the candidate region for xa5, a recessive gene conferring race-specific resistance to bacterial blight in rice. This trait and locus have good mapping information, a tractable phenotype, and available sequence data, but no cloned gene. We sampled 13 short segments from the 70-kb candidate region in 114 accessions of Oryza sativa. Five additional segments were sequenced from the adjacent 45-kb region in resistant accessions to estimate the distance at which linkage disequilibrium decays. The data show significant linkage disequilibrium between sites 100 kb apart. The presence of the xa5 resistant reaction in two ecotypes and in accessions with different haplotypes in the candidate region may indicate multiple origins or genetic heterogeneity for resistance. In addition, genetic differentiation between ecotypes emphasizes the need for controlling for population structure in the design of linkage disequilibrium studies in rice. PMID:14573486

Origin of African Physacanthus (Acanthaceae) via wide hybridization.

PubMed

Tripp, Erin A; Fatimah, Siti; Darbyshire, Iain; McDade, Lucinda A

2013-01-01

Gene flow between closely related species is a frequent phenomenon that is known to play important roles in organismal evolution. Less clear, however, is the importance of hybridization between distant relatives. We present molecular and morphological evidence that support origin of the plant genus Physacanthus via "wide hybridization" between members of two distantly related lineages in the large family Acanthaceae. These two lineages are well characterized by very different morphologies yet, remarkably, Physacanthus shares features of both. Chloroplast sequences from six loci indicate that all three species of Physacanthus contain haplotypes from both lineages, suggesting that heteroplasmy likely predated speciation in the genus. Although heteroplasmy is thought to be unstable and thus transient, multiple haplotypes have been maintained through time in Physacanthus. The most likely scenario to explain these data is that Physacanthus originated via an ancient hybridization event that involved phylogenetically distant parents. This wide hybridization has resulted in the establishment of an independently evolving clade of flowering plants.

Origin of African Physacanthus (Acanthaceae) via Wide Hybridization

PubMed Central

Tripp, Erin A.; Fatimah, Siti; Darbyshire, Iain; McDade, Lucinda A.

2013-01-01

Gene flow between closely related species is a frequent phenomenon that is known to play important roles in organismal evolution. Less clear, however, is the importance of hybridization between distant relatives. We present molecular and morphological evidence that support origin of the plant genus Physacanthus via “wide hybridization” between members of two distantly related lineages in the large family Acanthaceae. These two lineages are well characterized by very different morphologies yet, remarkably, Physacanthus shares features of both. Chloroplast sequences from six loci indicate that all three species of Physacanthus contain haplotypes from both lineages, suggesting that heteroplasmy likely predated speciation in the genus. Although heteroplasmy is thought to be unstable and thus transient, multiple haplotypes have been maintained through time in Physacanthus. The most likely scenario to explain these data is that Physacanthus originated via an ancient hybridization event that involved phylogenetically distant parents. This wide hybridization has resulted in the establishment of an independently evolving clade of flowering plants. PMID:23383261

An integrated map of structural variation in 2,504 human genomes.

PubMed

Sudmant, Peter H; Rausch, Tobias; Gardner, Eugene J; Handsaker, Robert E; Abyzov, Alexej; Huddleston, John; Zhang, Yan; Ye, Kai; Jun, Goo; Fritz, Markus Hsi-Yang; Konkel, Miriam K; Malhotra, Ankit; Stütz, Adrian M; Shi, Xinghua; Casale, Francesco Paolo; Chen, Jieming; Hormozdiari, Fereydoun; Dayama, Gargi; Chen, Ken; Malig, Maika; Chaisson, Mark J P; Walter, Klaudia; Meiers, Sascha; Kashin, Seva; Garrison, Erik; Auton, Adam; Lam, Hugo Y K; Mu, Xinmeng Jasmine; Alkan, Can; Antaki, Danny; Bae, Taejeong; Cerveira, Eliza; Chines, Peter; Chong, Zechen; Clarke, Laura; Dal, Elif; Ding, Li; Emery, Sarah; Fan, Xian; Gujral, Madhusudan; Kahveci, Fatma; Kidd, Jeffrey M; Kong, Yu; Lameijer, Eric-Wubbo; McCarthy, Shane; Flicek, Paul; Gibbs, Richard A; Marth, Gabor; Mason, Christopher E; Menelaou, Androniki; Muzny, Donna M; Nelson, Bradley J; Noor, Amina; Parrish, Nicholas F; Pendleton, Matthew; Quitadamo, Andrew; Raeder, Benjamin; Schadt, Eric E; Romanovitch, Mallory; Schlattl, Andreas; Sebra, Robert; Shabalin, Andrey A; Untergasser, Andreas; Walker, Jerilyn A; Wang, Min; Yu, Fuli; Zhang, Chengsheng; Zhang, Jing; Zheng-Bradley, Xiangqun; Zhou, Wanding; Zichner, Thomas; Sebat, Jonathan; Batzer, Mark A; McCarroll, Steven A; Mills, Ryan E; Gerstein, Mark B; Bashir, Ali; Stegle, Oliver; Devine, Scott E; Lee, Charles; Eichler, Evan E; Korbel, Jan O

2015-10-01

Structural variants are implicated in numerous diseases and make up the majority of varying nucleotides among human genomes. Here we describe an integrated set of eight structural variant classes comprising both balanced and unbalanced variants, which we constructed using short-read DNA sequencing data and statistically phased onto haplotype blocks in 26 human populations. Analysing this set, we identify numerous gene-intersecting structural variants exhibiting population stratification and describe naturally occurring homozygous gene knockouts that suggest the dispensability of a variety of human genes. We demonstrate that structural variants are enriched on haplotypes identified by genome-wide association studies and exhibit enrichment for expression quantitative trait loci. Additionally, we uncover appreciable levels of structural variant complexity at different scales, including genic loci subject to clusters of repeated rearrangement and complex structural variants with multiple breakpoints likely to have formed through individual mutational events. Our catalogue will enhance future studies into structural variant demography, functional impact and disease association.

Association of Common Mitochondrial DNA Variants with Multiple Sclerosis and Systemic Lupus Erythematosus

PubMed Central

Vyshkina, Tamara; Sylvester, Andrew; Sadiq, Saud; Bonilla, Eduardo; Canter, Jeff A.; Perl, Andras; Kalman, Bernadette

2008-01-01

Mitochondrial dysfunction has been implicated in the pathogenesis of multiple sclerosis (MS) and systemic lupus erythematosus (SLE). This study re-investigates the roles of previously suggested candidate genes of energy metabolism (Complex I genes located in the nucleus and in the mitochondria) in patients with MS relative to ethnically matched SLE patients and healthy controls. After stringent correction for multiple testing, we reproduce the association of the mitochondrial (mt)DNA haplotype K* with MS, but reject the importance of previously suggested borderline associations with nuclear genes of Complex I. In addition, we detect the association of common variants of the mitochondrial ND2 and ATP6 genes with both MS and SLE, which raises the possibility of a shared mitochondrial genetic background of these two autoimmune diseases. PMID:18708297

Patterns of genic diversity and structure in a species undergoing rapid chromosomal radiation: an allozyme analysis of house mice from the Madeira archipelago.

PubMed

Britton-Davidian, J; Catalan, J; Lopez, J; Ganem, G; Nunes, A C; Ramalhinho, M G; Auffray, J C; Searle, J B; Mathias, M L

2007-10-01

The chromosomal radiation of the house mouse in the island of Madeira most likely involved a human-mediated colonization event followed by within-island geographical isolation and recurrent episodes of genetic drift. The genetic signature of such processes was assessed by an allozyme analysis of the chromosomal races from Madeira. No trace of a decrease in diversity was observed suggesting the possibility of large founder or bottleneck sizes, multiple introductions and/or a high post-colonization expansion rate. The Madeira populations were more closely related to those of Portugal than to other continental regions, in agreement with the documented human colonization of the island. Such a Portuguese origin contrasts with a study indicating a north European source of the mitochondrial haplotypes present in the Madeira mice. This apparent discrepancy may be resolved if not one but two colonization events took place, an initial north European introduction followed by a later one from Portugal. Asymmetrical reproduction between these mice would have resulted in a maternal north European signature with a nuclear Portuguese genome. The extensive chromosomal divergence of the races in Madeira is expected to contribute to their genic divergence. However, there was no significant correlation between chromosomal and allozyme distances. This low apparent chromosomal impact on genic differentiation may be related to the short time since the onset of karyotypic divergence, as the strength of the chromosomal barrier will become significant only at later stages.

Species-wide phylogeography of North American mule deer (Odocoileus hemionus): cryptic glacial refugia and postglacial recolonization.

PubMed

Latch, Emily K; Heffelfinger, James R; Fike, Jennifer A; Rhodes, Olin E

2009-04-01

Quaternary climatic oscillations greatly influenced the present-day population genetic structure of animals and plants. For species with high dispersal and reproductive potential, phylogeographic patterns resulting from historical processes can be cryptic, overshadowed by contemporary processes. Here we report a study of the phylogeography of Odocoileus hemionus, a large, vagile ungulate common throughout western North America. We examined sequence variation of mitochondrial DNA (control region and cytochrome b) within and among 70 natural populations across the entire range of the species. Among the 1766 individual animals surveyed, we recovered 496 haplotypes. Although fine-scale phylogenetic structure was weakly resolved using phylogenetic methods, network analysis clearly revealed the presence of 12 distinct haplogroups. The spatial distribution of haplogroups showed a strong genetic discontinuity between the two morphological types of O. hemionus, mule deer and black-tailed deer, east and west of the Cascade Mountains in the Pacific Northwest. Within the mule deer lineage, we identified several haplogroups that expanded before or during the Last Glacial Maximum, suggesting that mule deer persisted in multiple refugia south of the ice sheets. Patterns of genetic diversity within the black-tailed deer lineage suggest a single refugium along the Pacific Northwest coast, and refute the hypothesis that black-tailed deer persisted in one or more northern refugia. Our data suggest that black-tailed deer recolonized areas in accordance with the pattern of glacial retreat, with initial recolonization northward along a coastal route and secondary recolonization inland.

FamLBL: detecting rare haplotype disease association based on common SNPs using case-parent triads.

PubMed

Wang, Meng; Lin, Shili

2014-09-15

In recent years, there has been an increasing interest in using common single-nucleotide polymorphisms (SNPs) amassed in genome-wide association studies to investigate rare haplotype effects on complex diseases. Evidence has suggested that rare haplotypes may tag rare causal single-nucleotide variants, making SNP-based rare haplotype analysis not only cost effective, but also more valuable for detecting causal variants. Although a number of methods for detecting rare haplotype association have been proposed in recent years, they are population based and thus susceptible to population stratification. We propose family-triad-based logistic Bayesian Lasso (famLBL) for estimating effects of haplotypes on complex diseases using SNP data. By choosing appropriate prior distribution, effect sizes of unassociated haplotypes can be shrunk toward zero, allowing for more precise estimation of associated haplotypes, especially those that are rare, thereby achieving greater detection power. We evaluate famLBL using simulation to gauge its type I error and power. Compared with its population counterpart, LBL, highlights famLBL's robustness property in the presence of population substructure. Further investigation by comparing famLBL with Family-Based Association Test (FBAT) reveals its advantage for detecting rare haplotype association. famLBL is implemented as an R-package available at http://www.stat.osu.edu/∼statgen/SOFTWARE/LBL/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Frequency and origin of haplotypes associated with the beta-globin gene cluster in individuals with trait and sickle cell anemia in the Atlantic and Pacific coastal regions of Colombia

PubMed Central

Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo

2013-01-01

Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events. PMID:24385850

Inheritance of Hetero-Diploid Pollen S-Haplotype in Self-Compatible Tetraploid Chinese Cherry (Prunus pseudocerasus Lindl)

PubMed Central

Gu, Chao; Liu, Qing-Zhong; Yang, Ya-Nan; Zhang, Shu-Jun; Khan, Muhammad Awais; Wu, Jun; Zhang, Shao-Ling

2013-01-01

The breakdown of self-incompatibility, which could result from the accumulation of non-functional S-haplotypes or competitive interaction between two different functional S-haplotypes, has been studied extensively at the molecular level in tetraploid Rosaceae species. In this study, two tetraploid Chinese cherry (Prunus pseudocerasus) cultivars and one diploid sweet cherry (Prunus avium) cultivar were used to investigate the ploidy of pollen grains and inheritance of pollen-S alleles. Genetic analysis of the S-genotypes of two intercross-pollinated progenies showed that the pollen grains derived from Chinese cherry cultivars were hetero-diploid, and that the two S-haplotypes were made up of every combination of two of the four possible S-haplotypes. Moreover, the distributions of single S-haplotypes expressed in self- and intercross-pollinated progenies were in disequilibrium. The number of individuals of the two different S-haplotypes was unequal in two self-pollinated and two intercross-pollinated progenies. Notably, the number of individuals containing two different S-haplotypes (S1- and S5-, S5- and S8-, S1- and S4-haplotype) was larger than that of other individuals in the two self-pollinated progenies, indicating that some of these hetero-diploid pollen grains may have the capability to inactivate stylar S-RNase inside the pollen tube and grow better into the ovaries. PMID:23596519

Relationship of the bovine growth hormone gene to carcass traits in Japanese black cattle.

PubMed

Tatsuda, K; Oka, A; Iwamoto, E; Kuroda, Y; Takeshita, H; Kataoka, H; Kouno, S

2008-02-01

The bovine growth hormone gene (bGH) possesses three haplotypes, A, B and C, that differ by amino acid mutations at positions 127 and 172 in the fifth exon: (leucine 127, threonine 172), (valine 127, threonine 172) and (valine 127, methionine 172) respectively. The correlation between meat quality or carcass weight and these haplotypes was investigated in Japanese black cattle. Altogether, 940 bGH haplotypes were compared with respect to six carcass traits: carcass weight, longissimus muscle area, rib thickness, subcutaneous fat thickness, beef marbling score and beef colour. The frequency of the B haplotype was higher (0.421) than that of A (0.269) and C (0.311). High carcass weight and low beef marbling were associated with haplotype A (p < 0.05 and p < 0.01 respectively), whereas beef marbling was increased by haplotype C (p < 0.05). Estimated regression coefficient of the A haplotype substitution effect for carcass weight and beef marbling score were 5.55 (13.1% of the phenotypic SD) and -0.31 (17.0%) respectively. That of the C haplotype for beef marbling score was 0.20 (11.0%). The other traits showed no relationship to the haplotypes examined. The results of this investigation suggest that information pertaining to bGH polymorphisms in Japanese black cattle could be used to improve the selection of meat traits.

Fetal hemoglobin in sickle cell anemia: The Arab-Indian haplotype and new therapeutic agents.

PubMed

Habara, Alawi H; Shaikho, Elmutaz M; Steinberg, Martin H

2017-11-01

Fetal hemoglobin (HbF) has well-known tempering effects on the symptoms of sickle cell disease and its levels vary among patients with different haplotypes of the sickle hemoglobin gene. Compared with sickle cell anemia haplotypes found in patients of African descent, HbF levels in Saudi and Indian patients with the Arab-Indian (AI) haplotype exceed that in any other haplotype by nearly twofold. Genetic association studies have identified some loci associated with high HbF in the AI haplotype but these observations require functional confirmation. Saudi patients with the Benin haplotype have HbF levels almost twice as high as African patients with this haplotype but this difference is unexplained. Hydroxyurea is still the only FDA approved drug for HbF induction in sickle cell disease. While most patients treated with hydroxyurea have an increase in HbF and some clinical improvement, 10 to 20% of adults show little response to this agent. We review the genetic basis of HbF regulation focusing on sickle cell anemia in Saudi Arabia and discuss new drugs that can induce increased levels of HbF. © 2017 Wiley Periodicals, Inc.

A phased SNP-based classification of sickle cell anemia HBB haplotypes.

PubMed

Shaikho, Elmutaz M; Farrell, John J; Alsultan, Abdulrahman; Qutub, Hatem; Al-Ali, Amein K; Figueiredo, Maria Stella; Chui, David H K; Farrer, Lindsay A; Murphy, George J; Mostoslavsky, Gustavo; Sebastiani, Paola; Steinberg, Martin H

2017-08-11

Sickle cell anemia causes severe complications and premature death. Five common β-globin gene cluster haplotypes are each associated with characteristic fetal hemoglobin (HbF) levels. As HbF is the major modulator of disease severity, classifying patients according to haplotype is useful. The first method of haplotype classification used restriction fragment length polymorphisms (RFLPs) to detect single nucleotide polymorphisms (SNPs) in the β-globin gene cluster. This is labor intensive, and error prone. We used genome-wide SNP data imputed to the 1000 Genomes reference panel to obtain phased data distinguishing parental alleles. We successfully haplotyped 813 sickle cell anemia patients previously classified by RFLPs with a concordance >98%. Four SNPs (rs3834466, rs28440105, rs10128556, and rs968857) marking four different restriction enzyme sites unequivocally defined most haplotypes. We were able to assign a haplotype to 86% of samples that were either partially or misclassified using RFLPs. Phased data using only four SNPs allowed unequivocal assignment of a haplotype that was not always possible using a larger number of RFLPs. Given the availability of genome-wide SNP data, our method is rapid and does not require high computational resources.

Practical interpretation of CYP2D6 haplotypes: Comparison and integration of automated and expert calling.

PubMed

Ruaño, Gualberto; Kocherla, Mohan; Graydon, James S; Holford, Theodore R; Makowski, Gregory S; Goethe, John W

2016-05-01

We describe a population genetic approach to compare samples interpreted with expert calling (EC) versus automated calling (AC) for CYP2D6 haplotyping. The analysis represents 4812 haplotype calls based on signal data generated by the Luminex xMap analyzers from 2406 patients referred to a high-complexity molecular diagnostics laboratory for CYP450 testing. DNA was extracted from buccal swabs. We compared the results of expert calls (EC) and automated calls (AC) with regard to haplotype number and frequency. The ratio of EC to AC was 1:3. Haplotype frequencies from EC and AC samples were convergent across haplotypes, and their distribution was not statistically different between the groups. Most duplications required EC, as only expansions with homozygous or hemizygous haplotypes could be automatedly called. High-complexity laboratories can offer equivalent interpretation to automated calling for non-expanded CYP2D6 loci, and superior interpretation for duplications. We have validated scientific expert calling specified by scoring rules as standard operating procedure integrated with an automated calling algorithm. The integration of EC with AC is a practical strategy for CYP2D6 clinical haplotyping. Copyright © 2016 Elsevier B.V. All rights reserved.

The effects of old and recent migration waves in the distribution of HBB*S globin gene haplotypes

PubMed Central

Lindenau, Juliana D.; Wagner, Sandrine C.; de Castro, Simone M.; Hutz, Mara H.

2016-01-01

Abstract Sickle cell hemoglobin is the result of a mutation at the sixth amino acid position of the beta (β) globin chain. The HBB*S gene is in linkage disequilibrium with five main haplotypes in the β-globin-like gene cluster named according to their ethnic and geographic origins: Bantu (CAR), Benin (BEN), Senegal (SEN), Cameroon (CAM) and Arabian-Indian (ARAB). These haplotypes demonstrated that the sickle cell mutation arose independently at least five times in human history. The distribution of βS haplotypes among Brazilian populations showed a predominance of the CAR haplotype. American populations were clustered in two groups defined by CAR or BEN haplotype frequencies. This scenario is compatible with historical records about the slave trade in the Americas. When all world populations where the sickle cell gene occurs were analyzed, three clusters were disclosed based on CAR, BEN or ARAB haplotype predominance. These patterns may change in the next decades due to recent migrations waves. Since these haplotypes show different clinical characteristics, these recent migrations events raise the necessity to develop optimized public health programs for sickle cell disease screening and management. PMID:27706371

The origins of the Lemba "Black Jews" of southern Africa: evidence from p12F2 and other Y-chromosome markers.

PubMed Central

Spurdle, A. B.; Jenkins, T.

1996-01-01

The Lemba are a southern African Bantu-speaking population claiming Jewish ancestry. Allele frequencies at four different Y-specific polymorphic loci, as well as extended-haplotype frequencies that included data from several loci, were analyzed in an attempt to establish the genetic affinities and origins of the Lemba. The results suggest that > or = 50% of the Lemba Y chromosomes are Semitic in origin, approximately 40% are Negroid, and the ancestry of the remainder cannot be resolved. These Y-specific genetic findings are consistent with Lemba oral tradition, and analysis of the history of Jewish people and their association with Africa indicates that the historical facts are not incompatible with theories concerning the origin of the Lemba. PMID:8900243

The influence of maternal lineages on social affiliations among humpback whales (Megaptera novaeangliae) on their feeding grounds in the southern gulf of Maine.

PubMed

Weinrich, Mason T; Rosenbaum, Howard; Scott Baker, C; Blackmer, Alexis L; Whitehead, Hal

2006-01-01

Humpback whales on their feeding grounds in the Gulf of Maine typically form fluid fission/fusion groups of two to three individuals characterized by noncompetitive and, at times, cooperative behavior. Here we test the hypothesis that, despite the apparent absence of close kinship bonds, the fluid associations between feeding whales are influenced by "maternal lineages" as represented by mtDNA haplotypes. Using skin samples collected with a biopsy dart, variation in the hypervariable segment of the mtDNA control region identified 17 unique haplotypes among 159 individually identified whales from the southern Gulf of Maine. The haplotypes of a further 143 individuals were inferred from known direct maternal (cow-calf) relationships. The frequencies of associations among these 302 individuals were calculated from 21,617 sighting records collected from 1980 to 1995, excluding associations between a cow and her dependent calf. For groups of two where the haplotypes of both individuals were known (n = 3,151), individuals with the same haplotype were together significantly more often (26%) than expected by random association (20%). To account for different group sizes and associations with individuals of unknown haplotype and sex, we used Monte Carlo simulations to test for nonrandom associations in the full data set, as well as known female-only (n = 1,512), male-only (n = 730), and mixed-sex (n = 2,745) groups. Within-haplotype associations were significantly more frequent than expected at random for all groups (P = .002) and female-only groups (P = .011) but not male-only groups, while mixed-sex groups approached significance (P = .062). A Mantel test of individual pairwise association indices and haplotype identity confirmed that within-haplotype associations were more frequent than expected for all sex combinations except male-male associations, with females forming within-haplotype associations 1.7 times more often than expected by random assortment. Partial matrix correlations and permutation analyses indicated that the skew toward within-haplotype associations could not be accounted for by short-term temporal co-occurrence or fine-scale spatial distributions of individuals with shared haplotypes. While the mechanism by which individuals with a common mtDNA haplotype assort remains unknown, our results strongly suggest an influence of maternal lineages on the social organization of humpback whales within a regional feeding ground.

DLA Class II Alleles Are Associated with Risk for Canine Symmetrical Lupoid Onychodystropy (SLO)

PubMed Central

Wilbe, Maria; Ziener, Martine Lund; Aronsson, Anita; Harlos, Charlotte; Sundberg, Katarina; Norberg, Elin; Andersson, Lisa; Lindblad-Toh, Kerstin; Hedhammar, Åke; Andersson, Göran; Lingaas, Frode

2010-01-01

Symmetrical lupoid onychodystrophy (SLO) is an immune-mediated disease in dogs affecting the claws with a suggested autoimmune aethiology. Sequence-based genotyping of the polymorphic exon 2 from DLA-DRB1, -DQA1, and -DQB1 class II loci were performed in a total of 98 SLO Gordon setter cases and 98 healthy controls. A risk haplotype (DRB1*01801/DQA1*00101/DQB1*00802) was present in 53% of cases and 34% of controls and conferred an elevated risk of developing SLO with an odds ratio (OR) of 2.1. When dogs homozygous for the risk haplotype were compared to all dogs not carrying the haplotype the OR was 5.4. However, a stronger protective haplotype (DRB1*02001/DQA1*00401/DQB1*01303, OR = 0.03, 1/OR = 33) was present in 16.8% of controls, but only in a single case (0.5%). The effect of the protective haplotype was clearly stronger than the risk haplotype, since 11.2% of the controls were heterozygous for the risk and protective haplotypes, whereas this combination was absent from cases. When the dogs with the protective haplotype were excluded, an OR of 2.5 was obtained when dogs homozygous for the risk haplotype were compared to those heterozygous for the risk haplotype, suggesting a co-dominant effect of the risk haplotype. In smaller sample sizes of the bearded collie and giant schnauzer breeds we found the same or similar haplotypes, sharing the same DQA1 allele, over-represented among the cases suggesting that the risk is associated primarily with DLA-DQ. We obtained conclusive results that DLA class II is significantly associated with risk of developing SLO in Gordon setters, thus supporting that SLO is an immune-mediated disease. Further studies of SLO in dogs may provide important insight into immune privilege of the nail apparatus and also knowledge about a number of inflammatory disorders of the nail apparatus like lichen planus, psoriasis, alopecia areata and onycholysis. PMID:20808798

Role of a Novel Human Leukocyte Antigen-DQA1*01:02;DRB1*15:01 Mixed Isotype Heterodimer in the Pathogenesis of “Humanized” Multiple Sclerosis-like Disease*

PubMed Central

Kaushansky, Nathali; Eisenstein, Miriam; Boura-Halfon, Sigalit; Hansen, Bjarke Endel; Nielsen, Claus Henrik; Milo, Ron; Zeilig, Gabriel; Lassmann, Hans; Altmann, Daniel M.; Ben-Nun, Avraham

2015-01-01

Gene-wide association and candidate gene studies indicate that the greatest effect on multiple sclerosis (MS) risk is driven by the HLA-DRB1*15:01 allele within the HLA-DR15 haplotype (HLA-DRB1*15:01-DQA1*01:02-DQB1*0602-DRB5*01:01). Nevertheless, linkage disequilibrium makes it difficult to define, without functional studies, whether the functionally relevant effect derives from DRB1*15:01 only, from its neighboring DQA1*01:02-DQB1*06:02 or DRB5*01:01 genes of HLA-DR15 haplotype, or from their combinations or epistatic interactions. Here, we analyzed the impact of the different HLA-DR15 haplotype alleles on disease susceptibility in a new “humanized” model of MS induced in HLA-transgenic (Tg) mice by human oligodendrocyte-specific protein (OSP)/claudin-11 (hOSP), one of the bona fide potential primary target antigens in MS. We show that the hOSP-associated MS-like disease is dominated by the DRB1*15:01 allele not only as the DRA1*01:01;DRB1*15:01 isotypic heterodimer but also, unexpectedly, as a functional DQA1*01:02;DRB1*15:01 mixed isotype heterodimer. The contribution of HLA-DQA1/DRB1 mixed isotype heterodimer to OSP pathogenesis was revealed in (DRB1*1501xDQB1*0602)F1 double-Tg mice immunized with hOSP(142–161) peptide, where the encephalitogenic potential of prevalent DRB1*1501/hOSP(142–161)-reactive Th1/Th17 cells is hindered due to a single amino acid difference in the OSP(142–161) region between humans and mice; this impedes binding of DRB1*1501 to the mouse OSP(142–161) epitope in the mouse CNS while exposing functional binding of mouse OSP(142–161) to DQA1*01:02;DRB1*15:01 mixed isotype heterodimer. This study, which shows for the first time a functional HLA-DQA1/DRB1 mixed isotype heterodimer and its potential association with disease susceptibility, provides a rationale for a potential effect on MS risk from DQA1*01:02 through functional DQA1*01:02;DRB1*15:01 antigen presentation. Furthermore, it highlights a potential contribution to MS risk also from interisotypic combination between products of neighboring HLA-DR15 haplotype alleles, in this case the DQA1/DRB1 combination. PMID:25911099

Phylogenetic analysis reveals multiple introductions of Cynodon species in Australia.

PubMed

Jewell, M; Frère, C H; Harris-Shultz, K; Anderson, W F; Godwin, I D; Lambrides, C J

2012-11-01

The distinction between native and introduced flora within isolated land masses presents unique challenges. The geological and colonisation history of Australia, the world's largest island, makes it a valuable system for studying species endemism, introduction, and phylogeny. Using this strategy we investigated Australian cosmopolitan grasses belonging to the genus Cynodon. While it is believed that seven species of Cynodon are present in Australia, no genetic analyses have investigated the origin, diversity and phylogenetic history of Cynodon within Australia. To address this gap, 147 samples (92 from across Australia and 55 representing global distribution) were sequenced for a total of 3336bp of chloroplast DNA spanning six genes. Data showed the presence of at least six putatively introduced Cynodon species (C. transvaalensis, C. incompletus, C. hirsutus, C. radiatus, C. plectostachyus and C. dactylon) in Australia and suggested multiple recent introductions. C. plectostachyus, a species often confused with C. nlemfuensis, was not previously considered to be present in Australia. Most significantly, we identified two common haplotypes that formed a monophyletic clade diverging from previously identified Cynodon species. We hypothesise that these two haplotypes may represent a previously undescribed species of Cynodon. We provide further evidence that two Australian native species, Brachyachne tenella and B. convergens belong in the genus Cynodon and, therefore, argue for the taxonomic revision of the genus Cynodon. Copyright © 2012 Elsevier Inc. All rights reserved.

Temporal fluctuation in North East Baltic Sea region cattle population revealed by mitochondrial and Y-chromosomal DNA analyses.

PubMed

Niemi, Marianna; Bläuer, Auli; Iso-Touru, Terhi; Harjula, Janne; Nyström Edmark, Veronica; Rannamäe, Eve; Lõugas, Lembi; Sajantila, Antti; Lidén, Kerstin; Taavitsainen, Jussi-Pekka

2015-01-01

Ancient DNA analysis offers a way to detect changes in populations over time. To date, most studies of ancient cattle have focused on their domestication in prehistory, while only a limited number of studies have analysed later periods. Conversely, the genetic structure of modern cattle populations is well known given the undertaking of several molecular and population genetic studies. Bones and teeth from ancient cattle populations from the North-East Baltic Sea region dated to the Prehistoric (Late Bronze and Iron Age, 5 samples), Medieval (14), and Post-Medieval (26) periods were investigated by sequencing 667 base pairs (bp) from the mitochondrial DNA (mtDNA) and 155 bp of intron 19 in the Y-chromosomal UTY gene. Comparison of maternal (mtDNA haplotypes) genetic diversity in ancient cattle (45 samples) with modern cattle populations in Europe and Asia (2094 samples) revealed 30 ancient mtDNA haplotypes, 24 of which were shared with modern breeds, while 6 were unique to the ancient samples. Of seven Y-chromosomal sequences determined from ancient samples, six were Y2 and one Y1 haplotype. Combined data including Swedish samples from the same periods (64 samples) was compared with the occurrence of Y-chromosomal haplotypes in modern cattle (1614 samples). The diversity of haplogroups was highest in the Prehistoric samples, where many haplotypes were unique. The Medieval and Post-Medieval samples also show a high diversity with new haplotypes. Some of these haplotypes have become frequent in modern breeds in the Nordic Countries and North-Western Russia while other haplotypes have remained in only a few local breeds or seem to have been lost. A temporal shift in Y-chromosomal haplotypes from Y2 to Y1 was detected that corresponds with the appearance of new mtDNA haplotypes in the Medieval and Post-Medieval period. This suggests a replacement of the Prehistoric mtDNA and Y chromosomal haplotypes by new types of cattle.

Temporal Fluctuation in North East Baltic Sea Region Cattle Population Revealed by Mitochondrial and Y-Chromosomal DNA Analyses

PubMed Central

Niemi, Marianna; Bläuer, Auli; Iso-Touru, Terhi; Harjula, Janne; Nyström Edmark, Veronica; Rannamäe, Eve; Lõugas, Lembi; Sajantila, Antti; Lidén, Kerstin; Taavitsainen, Jussi-Pekka

2015-01-01

Background Ancient DNA analysis offers a way to detect changes in populations over time. To date, most studies of ancient cattle have focused on their domestication in prehistory, while only a limited number of studies have analysed later periods. Conversely, the genetic structure of modern cattle populations is well known given the undertaking of several molecular and population genetic studies. Results Bones and teeth from ancient cattle populations from the North-East Baltic Sea region dated to the Prehistoric (Late Bronze and Iron Age, 5 samples), Medieval (14), and Post-Medieval (26) periods were investigated by sequencing 667 base pairs (bp) from the mitochondrial DNA (mtDNA) and 155 bp of intron 19 in the Y-chromosomal UTY gene. Comparison of maternal (mtDNA haplotypes) genetic diversity in ancient cattle (45 samples) with modern cattle populations in Europe and Asia (2094 samples) revealed 30 ancient mtDNA haplotypes, 24 of which were shared with modern breeds, while 6 were unique to the ancient samples. Of seven Y-chromosomal sequences determined from ancient samples, six were Y2 and one Y1 haplotype. Combined data including Swedish samples from the same periods (64 samples) was compared with the occurrence of Y-chromosomal haplotypes in modern cattle (1614 samples). Conclusions The diversity of haplogroups was highest in the Prehistoric samples, where many haplotypes were unique. The Medieval and Post-Medieval samples also show a high diversity with new haplotypes. Some of these haplotypes have become frequent in modern breeds in the Nordic Countries and North-Western Russia while other haplotypes have remained in only a few local breeds or seem to have been lost. A temporal shift in Y-chromosomal haplotypes from Y2 to Y1 was detected that corresponds with the appearance of new mtDNA haplotypes in the Medieval and Post-Medieval period. This suggests a replacement of the Prehistoric mtDNA and Y chromosomal haplotypes by new types of cattle. PMID:25992976

SLC22A1-ABCB1 haplotype profiles predict imatinib pharmacokinetics in Asian patients with chronic myeloid leukemia.

PubMed

Singh, Onkar; Chan, Jason Yongsheng; Lin, Keegan; Heng, Charles Chuah Thuan; Chowbay, Balram

2012-01-01

This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM) pharmacokinetics in Asian patients with chronic myeloid leukemia (CML). Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each) and CML patients (n = 38) were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h)) and clearance (CL) were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM) to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T), to be significantly associated with IM clearance (p = 0.013). Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2) L/hr/mg): CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h) than patients carrying 0 or 1 copy [CL (10(-2) L/hr/mg): 2.19 vs 3.29, p = 0.026; C(0h) (10(-6) 1/ml): 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h) (p = 0.002 and 0.009, respectively). This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.

Molecular identification and first report of mitochondrial COI gene haplotypes in the hawksbill turtle Eretmochelys imbricata (Testudines: Cheloniidae) in the Colombian Caribbean nesting colonies.

PubMed

Daza-Criado, L; Hernández-Fernández, J

2014-02-21

Hawksbill sea turtles Eretmochelys imbricata are found extensively around the world, including the Atlantic, Pacific, and Indian Oceans; the Persian Gulf, and the Red and Mediterranean Seas. Populations of this species are affected by international trafficking of their shields, meat, and eggs, making it a critically endangered animal. We determined the haplotypes of 17 hawksbill foraging turtles of Islas del Rosario (Bolivar) and of the nesting beach Don Diego (Magdalena) in the Colombian Caribbean based on amplification and sequencing of the mitochondrial gene cytochrome oxidase c subunit I (COI). We identified 5 haplotypes, including EI-A1 previously reported in Puerto Rico, which was similar to 10 of the study samples. To our knowledge, the remaining 4 haplotypes have not been described. Samples EICOI11 and EICOI3 showed 0.2% divergence from EI-A1, by a single nucleotide change, and were classified as the EI-A2 haplotype. EICOI6, EICOI14, and EICOI12 samples showed 0.2% divergence from EI-A1 and 0.3% divergence from EI-A2 and were classified as EI-A3 haplotype. Samples EICOI16 and EICOI15 presented 5 nucleotide changes each and were classified as 2 different haplotypes, EI-A4 and EI-A5, respectively. The last 2 haplotypes had higher nucleotide diversity (K2P=1.7%) than that by the first 3 haplotypes. EI-A1 and EI-A2 occurred in nesting individuals, and EI-A2, EI-A3, EI-A4, and EI-A5 occurred in foraging individuals. The description of the haplotypes may be associated with reproductive migrations or foraging and could support the hypothesis of natal homing. Furthermore, they can be used in phylogeographic studies.

A DRD1 haplotype is associated with risk for autism spectrum disorders in male-only affected sib-pair families.

PubMed

Hettinger, Joe A; Liu, Xudong; Schwartz, Charles E; Michaelis, Ron C; Holden, Jeanette J A

2008-07-05

Individuals with autism spectrum disorders (ASDs) have impairments in executive function and social cognition, with males generally being more severely affected in these areas than females. Because the dopamine D1 receptor (encoded by DRD1) is integral to the neural circuitry mediating these processes, we examined the DRD1 gene for its role in susceptibility to ASDs by performing single marker and haplotype case-control comparisons, family-based association tests, and genotype-phenotype assessments (quantitative transmission disequilibrium tests: QTDT) using three DRD1 polymorphisms, rs265981C/T, rs4532A/G, and rs686T/C. Our previous findings suggested that the dopaminergic system may be more integrally involved in families with affected males only than in other families. We therefore restricted our study to families with two or more affected males (N = 112). There was over-transmission of rs265981-C and rs4532-A in these families (P = 0.040, P = 0.038), with haplotype TDT analysis showing over-transmission of the C-A-T haplotype (P = 0.022) from mothers to affected sons (P = 0.013). In addition, haplotype case-control comparisons revealed an increase of this putative risk haplotype in affected individuals relative to a comparison group (P = 0.004). QTDT analyses showed associations of the rs265981-C, rs4532-A, rs686-T alleles, and the C-A-T haplotype with more severe problems in social interaction, greater difficulties with nonverbal communication and increased stereotypies compared to individuals with other haplotypes. Preferential haplotype transmission of markers at the DRD1 locus and an increased frequency of a specific haplotype support the DRD1 gene as a risk gene for core symptoms of ASD in families having only affected males. Copyright 2008 Wiley-Liss, Inc.

Performance of Single Nucleotide Polymorphisms versus Haplotypes for Genome-Wide Association Analysis in Barley

PubMed Central

Jannink, Jean-Luc

2010-01-01

Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933

Molecular phylogenetic identification of Fasciola flukes in Nepal.

PubMed

Shoriki, Takuya; Ichikawa-Seki, Madoka; Devkota, Bhuminand; Rana, Hari B; Devkota, Shiva P; Humagain, Sudeep K; Itagaki, Tadashi

2014-12-01

Eighty-one Fasciola flukes collected from 8 districts in Nepal were analyzed for their species identification on the basis of their spermatogenic status and nuclear ribosomal internal transcribed spacer 1 (ITS1) and for their phylogenetic relation with Fasciola flukes from other Asian countries on the basis of the mitochondrial NADH dehydrogenase subunit 1 (nad1) gene. Sixty-one flukes (75.3%) were aspermic Fasciola sp., and 20 flukes (24.7%) were identified as Fasciola gigantica. All of the aspermic flukes displayed the Fh/Fg type in ITS1, which was predominant in aspermic Fasciola sp. from China, and most (60 flukes) displayed the Fsp-ND1-N1 haplotype in the nad1, which had an identical nucleotide sequence to the major haplotype (Fg-C2) of the aspermic flukes from China. These results suggest that aspermic Fasciola sp. was introduced into Nepal from China. Furthermore, the results of the diversity indices, neutrality indices, and median-joining network analysis with reference haplotypes from Asian countries suggest that aspermic Fasciola sp. rapidly expanded its distribution. In contrasts, F. gigantica displayed 10 nad1 haplotypes, which showed higher population diversity indices than the haplotypes of aspermic flukes, indicating that the F. gigantica population was clearly distributed in Nepal earlier than the aspermic Fasciola population. Although the F. gigantica haplotypes from Nepal formed a star-like phylogeny consisting of a main founder haplotype (Fg-ND1-N1), together with some F. gigantica haplotypes from Myanmar and Thailand, the Nepal population differed genetically from F. gigantica populations of neighboring countries as each country had distinct founder haplotype(s). Copyright © 2014 Elsevier Inc. All rights reserved.

β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil.

PubMed

Dos Santos Silva, Wellington; de Nazaré Klautau-Guimarães, Maria; Grisolia, Cesar Koppe

2010-07-01

Five restriction site polymorphisms in the β-globin gene cluster (HincII-5' ε, HindIII-(G) γ, HindIII-(A) γ, HincII- ψβ1 and HincII-3' ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the β(A) chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.

β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil

PubMed Central

2010-01-01

Five restriction site polymorphisms in the β-globin gene cluster (HincII-5‘ ε, HindIII-G γ, HindIII-A γ, HincII- ψβ1 and HincII-3‘ ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the “quilombo community”, from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the βA chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil. PMID:21637405

Phylogeography and genetic structure of a Tertiary relict tree species, Tapiscia sinensis (Tapisciaceae): implications for conservation

PubMed Central

Zhang, Jinju; Li, Zuozhou; Fritsch, Peter W.; Tian, Hua; Yang, Aihong; Yao, Xiaohong

2015-01-01

Background and Aims The phylogeography of plant species in sub-tropical China remains largely unclear. This study used Tapiscia sinensis, an endemic and endangered tree species widely but disjunctly distributed in sub-tropical China, as a model to reveal the patterns of genetic diversity and phylogeographical history of Tertiary relict plant species in this region. The implications of the results are discussed in relation to its conservation management. Methods Samples were taken from 24 populations covering the natural geographical distribution of T. sinensis. Genetic structure was investigated by analysis of molecular variance (AMOVA) and spatial analysis of molecular variance (SAMOVA). Phylogenetic relationships among haplotypes were constructed with maximum parsimony and haplotype network methods. Historical population expansion events were tested with pairwise mismatch distribution analysis and neutrality tests. Species potential range was deduced by ecological niche modelling (ENM). Key Results A low level of genetic diversity was detected at the population level. A high level of genetic differentiation and a significant phylogeographical structure were revealed. The mean divergence time of the haplotypes was approx. 1·33 million years ago. Recent range expansion in this species is suggested by a star-like haplotype network and by the results from the mismatch distribution analysis and neutrality tests. Conclusions Climatic oscillations during the Pleistocene have had pronounced effects on the extant distribution of Tapiscia relative to the Last Glacial Maximum (LGM). Spatial patterns of molecular variation and ENM suggest that T. sinensis may have retreated in south-western and central China and colonized eastern China prior to the LGM. Multiple montane refugia for T. sinense existing during the LGM are inferred in central and western China. The populations adjacent to or within these refugia of T. sinense should be given high priority in the development of conservation policies and management strategies for this endangered species. PMID:26187222

Beyond the MHC: A canine model of dermatomyositis shows a complex pattern of genetic risk involving novel loci

PubMed Central

Evans, Jacquelyn M.; Hill, Cody M.; Anderson, Kendall J.

2017-01-01

Juvenile dermatomyositis (JDM) is a chronic inflammatory myopathy and vasculopathy driven by genetic and environmental influences. Here, we investigated the genetic underpinnings of an analogous, spontaneous disease of dogs also termed dermatomyositis (DMS). As in JDM, we observed a significant association with a haplotype of the major histocompatibility complex (MHC) (DLA-DRB1*002:01/-DQA1*009:01/-DQB1*001:01), particularly in homozygosity (P-val = 0.0001). However, the high incidence of the haplotype among healthy dogs indicated that additional genetic risk factors are likely involved in disease progression. We conducted genome-wide association studies in two modern breeds having common ancestry and detected strong associations with novel loci on canine chromosomes 10 (P-val = 2.3X10-12) and 31 (P-val = 3.95X10-8). Through whole genome resequencing, we identified primary candidate polymorphisms in conserved regions of PAN2 (encoding p.Arg492Cys) and MAP3K7CL (c.383_392ACTCCACAAA>GACT) on chromosomes 10 and 31, respectively. Analyses of these polymorphisms and the MHC haplotypes revealed that nine of 27 genotypic combinations confer high or moderate probability of disease and explain 93% of cases studied. The pattern of disease risk across PAN2 and MAP3K7CL genotypes provided clear evidence for a significant epistatic foundation for this disease, a risk further impacted by MHC haplotypes. We also observed a genotype-phenotype correlation wherein an earlier age of onset is correlated with an increased number of risk alleles at PAN2 and MAP3K7CL. High frequencies of multiple genetic risk factors are unique to affected breeds and likely arose coincident with artificial selection for desirable phenotypes. Described herein is the first three-locus association with a complex canine disease and two novel loci that provide targets for exploration in JDM and related immunological dysfunction. PMID:28158183

Fine mapping of chromosome 15q25.1 lung cancer susceptibility in African-Americans.

PubMed

Hansen, Helen M; Xiao, Yuanyuan; Rice, Terri; Bracci, Paige M; Wrensch, Margaret R; Sison, Jennette D; Chang, Jeffery S; Smirnov, Ivan V; Patoka, Joseph; Seldin, Michael F; Quesenberry, Charles P; Kelsey, Karl T; Wiencke, John K

2010-09-15

Several genome-wide association studies identified the chr15q25.1 region, which includes three nicotinic cholinergic receptor genes (CHRNA5-B4) and the cell proliferation gene (PSMA4), for its association with lung cancer risk in Caucasians. A haplotype and its tagging single nucleotide polymorphisms (SNPs) encompassing six genes from IREB2 to CHRNB4 were most strongly associated with lung cancer risk (OR = 1.3; P < 10(-20)). In order to narrow the region of association and identify potential causal variations, we performed a fine-mapping study using 77 SNPs in a 194 kb segment of the 15q25.1 region in a sample of 448 African-American lung cancer cases and 611 controls. Four regions, two SNPs and two distinct haplotypes from sliding window analyses, were associated with lung cancer. CHRNA5 rs17486278 G had OR = 1.28, 95% CI 1.07-1.54 and P = 0.008, whereas CHRNB4 rs7178270 G had OR = 0.78, 95% CI 0.66-0.94 and P = 0.008 for lung cancer risk. Lung cancer associations remained significant after pack-year adjustment. Rs7178270 decreased lung cancer risk in women but not in men; gender interaction P = 0.009. For two SNPs (rs7168796 A/G and rs7164594 A/G) upstream of PSMA4, lung cancer risks for people with haplotypes GG and AA were reduced compared with those with AG (OR = 0.56, 95% CI 0.38-0.82; P = 0.003 and OR = 0.73, 95% CI 0.59-0.90, P = 0.004, respectively). A four-SNP haplotype spanning CHRNA5 (rs11637635 C, rs17408276 T, rs16969968 G) and CHRNA3 (rs578776 G) was associated with increased lung cancer risk (P = 0.002). The identified regions contain SNPs predicted to affect gene regulation. There are multiple lung cancer risk loci in the 15q25.1 region in African-Americans.

The Population Genetics of Cultivation: Domestication of a Traditional Chinese Medicine, Scrophularia ningpoensis Hemsl. (Scrophulariaceae)

PubMed Central

Chen, Chuan; Li, Pan; Wang, Rui-Hong; Schaal, Barbara A.; Fu, Cheng-Xin

2014-01-01

Background Domestic cultivation of medicinal plants is an important strategy for protecting these species from over harvesting. Some species of medicinal plants have been brought into cultivation for more than hundreds years. Concerns about severe loss of genetic diversity and sustainable cultivation can potentially limit future use of these valuable plants. Genetic studies with comprehensive sampling of multiple medicinal species by molecular markers will allow for assessment and management of these species. Here we examine the population genetic consequences of cultivation and domestication in Scrophularia ningpoensis Hemsl. We used chloroplast DNA and genomic AFLP markers to clarify not only the effects of domestication on genetic diversity, but also determine the geographic origins of cultivars and their genetic divergence from native populations. These results will allow both better management of cultivated populations, but also provide insights for crop improvement. Results Twenty-one cpDNA haplotypes of S. ningpoensis were identified. Wild populations contain all haplotypes, whereas only three haplotypes were found in cultivated populations with wild populations having twice the haplotype diversity of cultivated populations. Genetic differentiation between cultivated populations and wild populations was significant. Genomic AFLP markers revealed similar genetic diversity patterns. Furthermore, Structure analysis grouped all wild populations into two gene pools; two of which shared the same gene pool with cultivated S. ningpoensis. The result of Neighbor-Joining analysis was consistent with the structure analysis. In principal coordinate analysis, three cultivated populations from Zhejiang Province grouped together and were separated from other cultivated populations. Conclusions These results suggest that cultivated S. ningpoensis has experienced dramatic loss of genetic diversity under anthropogenic influence. We postulate that strong artificial selection for medicinal quality has resulted in genetic differentiation between cultivated and wild populations. Furthermore, it appears that wild populations in Jiangxi-Hunan area were involved in the origin of cultivated S. ningpoensis. PMID:25157628

Haplotype analysis indicates an association between the DOPA decarboxylase (DDC) gene and nicotine dependence.

PubMed

Ma, Jennie Z; Beuten, Joke; Payne, Thomas J; Dupont, Randolph T; Elston, Robert C; Li, Ming D

2005-06-15

DOPA decarboxylase (DDC; also known as L-amino acid decarboxylase; AADC) is involved in the synthesis of dopamine, norepinephrine and serotonin. Because the mesolimbic dopaminergic system is implicated in the reinforcing effects of many drugs, including nicotine, the DDC gene is considered a plausible candidate for involvement in the development of vulnerability to nicotine dependence (ND). Further, this gene is located within the 7p11 region that showed a 'suggestive linkage' to ND in our previous genome-wide scan in the Framingham Heart Study population. In the present study, we tested eight single nucleotide polymorphisms (SNPs) within DDC for association with ND, which was assessed by smoking quantity (SQ), the heaviness of smoking index (HSI) and the Fagerstrom test for ND (FTND) score, in a total of 2037 smokers and non-smokers from 602 nuclear families of African- or European-American (AA or EA, respectively) ancestry. Association analysis for individual SNPs using the PBAT-GEE program indicated that SNP rs921451 was significantly associated with two of the three adjusted ND measures in the EA sample (P=0.01-0.04). Haplotype-based association analysis revealed a protective T-G-T-G haplotype for rs921451-rs3735273-rs1451371-rs2060762 in the AA sample, which was significantly associated with all three adjusted ND measures after correction for multiple testing (min Z=-2.78, P=0.006 for HSI). In contrast, we found a high-risk T-G-T-G haplotype for a different SNP combination in the EA sample, rs921451-rs3735273-rs1451371-rs3757472, which showed a significant association after Bonferroni correction with the SQ and FTND score (max Z=2.73, P=0.005 for FTND). In summary, our findings provide the first evidence for the involvement of DDC in the susceptibility to ND and, further, reveal the racial specificity of its impact.

Phylogeography and genetic structure of a Tertiary relict tree species, Tapiscia sinensis (Tapisciaceae): implications for conservation.

PubMed

Zhang, Jinju; Li, Zuozhou; Fritsch, Peter W; Tian, Hua; Yang, Aihong; Yao, Xiaohong

2015-10-01

The phylogeography of plant species in sub-tropical China remains largely unclear. This study used Tapiscia sinensis, an endemic and endangered tree species widely but disjunctly distributed in sub-tropical China, as a model to reveal the patterns of genetic diversity and phylogeographical history of Tertiary relict plant species in this region. The implications of the results are discussed in relation to its conservation management. Samples were taken from 24 populations covering the natural geographical distribution of T. sinensis. Genetic structure was investigated by analysis of molecular variance (AMOVA) and spatial analysis of molecular variance (SAMOVA). Phylogenetic relationships among haplotypes were constructed with maximum parsimony and haplotype network methods. Historical population expansion events were tested with pairwise mismatch distribution analysis and neutrality tests. Species potential range was deduced by ecological niche modelling (ENM). A low level of genetic diversity was detected at the population level. A high level of genetic differentiation and a significant phylogeographical structure were revealed. The mean divergence time of the haplotypes was approx. 1·33 million years ago. Recent range expansion in this species is suggested by a star-like haplotype network and by the results from the mismatch distribution analysis and neutrality tests. Climatic oscillations during the Pleistocene have had pronounced effects on the extant distribution of Tapiscia relative to the Last Glacial Maximum (LGM). Spatial patterns of molecular variation and ENM suggest that T. sinensis may have retreated in south-western and central China and colonized eastern China prior to the LGM. Multiple montane refugia for T. sinense existing during the LGM are inferred in central and western China. The populations adjacent to or within these refugia of T. sinense should be given high priority in the development of conservation policies and management strategies for this endangered species. © The Author 2015. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A new variation in the promoter region, the -604 C>T, and the Leu72Met polymorphism of the ghrelin gene are associated with protection to insulin resistance.

PubMed

Zavarella, S; Petrone, A; Zampetti, S; Gueorguiev, M; Spoletini, M; Mein, C A; Leto, G; Korbonits, M; Buzzetti, R

2008-04-01

Previous studies suggested that polymorphisms in the coding region of the preproghrelin were involved in the etiology of obesity and might modulate glucose-induced insulin secretion. We evaluated the association of a new variation, -604C>T, in the promoter region of the ghrelin gene, of Leu72Met (247C>A) and of Gln90Leu (265A>T), all haplotype-tagging single nucleotide polymorphisms (SNPs), with measures of insulin sensitivity in 1420 adult individuals. The three SNPs were genotyped using ABI PRISM 7900 HT Sequence Detection System. We used multiple linear regression analysis for quantitative traits and THESIAS software for haplotype analysis. We observed a protective effect exerted by Met72 variant of Leu72Met SNP on insulin resistance parameters; a significant decreasing trend from Leu/Leu to Leu/Met and to Met/Met homozygous subjects in triglycerides, fasting insulin levels and HOMA-IR index (P=0.02, 0.01 and 0.003, respectively), and, consistently, an increase in ghrelin levels (P=0.003) was found. A significant decrease from CC to TC and to TT genotypes in insulin levels and HOMA-IR index was also detected (P=0.00l for both), but only in subjects homozygous for Leu72, where the protective effect of Met72 was not present. The haplotype analysis results supported the data obtained by the evaluation of each single SNP, showing the highest value of insulin levels and HOMA-IR index in the -604(c)247(c) haplotype intermediate value in -604(T)247(C) and lowest value in -604(C)247(A). Our observations suggest a protective role of the Met72 variant and of -604 T allele in modulating insulin resistance. These SNPs or an unknown functional variant in linkage disequilibrium could increase ghrelin levels and probably insulin sensitivity.

Significant association of full-thickness rotator cuff tears and estrogen-related receptor-β (ESRRB).

PubMed

Teerlink, Craig C; Cannon-Albright, Lisa A; Tashjian, Robert Z

2015-02-01

The precise etiology of rotator cuff disease is unknown, but prior evidence suggests a role for genetic factors. Variants of estrogen-related receptor-β (ESRRB) have been previously associated with rotator cuff disease. The purpose of the present study was to confirm the association between multiple candidate genes, including ESRRB, and rotator cuff disease in an independent set of patients with rotator cuff tear. The Illumina 5M (Illumina Inc, San Diego, CA, USA) single nucleotide polymorphism (SNP) platform was used to genotype 175 patients with rotator cuff tear. Genotypes were used to select a set of 2595 genetically matched Caucasian controls available from the Illumina iControls database. Tests of association were performed with Genome-wide Efficient Mixed Model Association (GEMMA) software at 69 SNPs that fell within 20 kb of 6 candidate genes (DEFB1, DENND2C, ESRRB, FGF3, FGF10, and FGFR1). Tests of association revealed 1 significantly associated SNP occurring in ESRRB (rs17583842; P = 4.4E-4). Another SNP within ESRRB (rs7157192) had a nominal P value of 7.8E-3. FastPHASE software estimated 2 frequent haplotypes among 54 individuals who carried both risk alleles at these 2 SNPs. The first haplotype had a frequency of 13.9% (n = 15) in risk-allele carriers and only 2.2% in controls (odds ratio, 6.9; 95% confidence interval, 3.9-2.2). The second haplotype had a frequency of 12.9% in risk-allele carriers and only 2.7% in controls (odds ratio, 5.3; 95% confidence interval, 3.0-9.5). The significant association and the presence of high-risk haplotypes identified in the ESRRB gene confirm the association of variants in ESRRB and rotator cuff disease. Copyright © 2015 Journal of Shoulder and Elbow Surgery Board of Trustees. All rights reserved.

Selective sweep at the Rpv3 locus during grapevine breeding for downy mildew resistance.

PubMed

Di Gaspero, Gabriele; Copetti, Dario; Coleman, Courtney; Castellarin, Simone Diego; Eibach, Rudolf; Kozma, Pál; Lacombe, Thierry; Gambetta, Gregory; Zvyagin, Andrey; Cindrić, Petar; Kovács, László; Morgante, Michele; Testolin, Raffaele

2012-02-01

The Rpv3 locus is a major determinant of downy mildew resistance in grapevine (Vitis spp.). A selective sweep at this locus was revealed by the DNA genotyping of 580 grapevines, which include a highly diverse set of 265 European varieties that predated the spread of North American mildews, 82 accessions of wild species, and 233 registered breeding lines with North American ancestry produced in the past 150 years. Artificial hybridisation and subsequent phenotypic selection favoured a few Rpv3 haplotypes that were introgressed from wild vines and retained in released varieties. Seven conserved haplotypes in five descent groups of resistant varieties were traced back to their founders: (1) 'Munson', a cross between two of Hermann Jaeger's selections of V. rupestris and V. lincecumii made in the early 1880s in Missouri, (2) V. rupestris 'Ganzin', first utilised for breeding in 1879 by Victor Ganzin in France, (3) 'Noah', selected in 1869 from intermingled accessions of V. riparia and V. labrusca by Otto Wasserzieher in Illinois, (4) 'Bayard', a V. rupestris × V. labrusca offspring generated in 1882 by George Couderc in France, and (5) a wild form closely related to V. rupestris accessions in the Midwestern United States and introgressed into 'Seibel 4614' in the 1880s by Albert Seibel in France. Persistence of these Rpv3 haplotypes across many of the varieties generated by human intervention indicates that a handful of vines with prominent resistance have laid the foundation for modern grape breeding. A rampant hot spot of NB-LRR genes at the Rpv3 locus has provided a distinctive advantage for the adaptation of native North American grapevines to withstand downy mildew. The coexistence of multiple resistance alleles or paralogues in the same chromosomal region but in different haplotypes counteracts efforts to pyramidise them in a diploid individual via conventional breeding.

Comparative Analyses of Plastid Sequences between Native and Introduced Populations of Aquatic Weeds Elodea canadensis and E. nuttallii

PubMed Central

Huotari, Tea; Korpelainen, Helena

2013-01-01

Non-indigenous species (NIS) are species living outside their historic or native range. Invasive NIS often cause severe environmental impacts, and may have large economical and social consequences. Elodea (Hydrocharitaceae) is a New World genus with at least five submerged aquatic angiosperm species living in fresh water environments. Our aim was to survey the geographical distribution of cpDNA haplotypes within the native and introduced ranges of invasive aquatic weeds Elodea canadensis and E. nuttallii and to reconstruct the spreading histories of these invasive species. In order to reveal informative chloroplast (cp) genome regions for phylogeographic analyses, we compared the plastid sequences of native and introduced individuals of E. canadensis. In total, we found 235 variable sites (186 SNPs, 47 indels and two inversions) between the two plastid sequences consisting of 112,193 bp and developed primers flanking the most variable genomic areas. These 29 primer pairs were used to compare the level and pattern of intraspecific variation within E. canadensis to interspecific variation between E. canadensis and E. nuttallii. Nine potentially informative primer pairs were used to analyze the phylogeographic structure of both Elodea species, based on 70 E. canadensis and 25 E. nuttallii individuals covering native and introduced distributions. On the whole, the level of variation between the two Elodea species was 53% higher than that within E. canadensis. In our phylogeographic analysis, only a single haplotype was found in the introduced range in both species. These haplotypes H1 (E. canadensis) and A (E. nuttallii) were also widespread in the native range, covering the majority of native populations analyzed. Therefore, we were not able to identify either the geographic origin of the introduced populations or test the hypothesis of single versus multiple introductions. The divergence between E. canadensis haplotypes was surprisingly high, and future research may clarify mechanisms that structure native E. canadensis populations. PMID:23620722

Genetic diversity and epidemiology of infectious hematopoietic necrosis virus in Alaska

USGS Publications Warehouse

Emmenegger, E.G; Meyers, T.R.; Burton, T.O.; Kurath, G.

2000-01-01

Forty-two infectious hematopoietic necrosis virus (IHNV) isolates from Alaska were analyzed using the ribonuclease protection assay (RPA) and nucleotide sequencing. RPA analyses, utilizing 4 probes, N5, N3 (N gene), GF (G gene), and NV (NV gene), determined that the haplotypes of all 3 genes demonstrated a consistent spatial pattern. Virus isolates belonging to the most common haplotype groups were distributed throughout Alaska, whereas isolates in small haplotype groups were obtained from only 1 site (hatchery, lake, etc.). The temporal pattern of the GF haplotypes suggested a 'genetic acclimation' of the G gene, possibly due to positive selection on the glycoprotein. A pairwise comparison of the sequence data determined that the maximum nucleotide diversity of the isolates was 2.75% (10 mismatches) for the NV gene, and 1.99% (6 mismatches) for a 301 base pair region of the G gene, indicating that the genetic diversity of IHNV within Alaska is notably lower than in the more southern portions of the IHNV North American range. Phylogenetic analysis of representative Alaskan sequences and sequences of 12 previously characterized IHNV strains from Washington, Oregon, Idaho, California (USA) and British Columbia (Canada) distinguished the isolates into clusters that correlated with geographic origin and indicated that the Alaskan and British Columbia isolates may have a common viral ancestral lineage. Comparisons of multiple isolates from the same site provided epidemiological insights into viral transmission patterns and indicated that viral evolution, viral introduction, and genetic stasis were the mechanisms involved with IHN virus population dynamics in Alaska. The examples of genetic stasis and the overall low sequence heterogeneity of the Alaskan isolates suggested that they are evolutionarily constrained. This study establishes a baseline of genetic fingerprint patterns and sequence groups representing the genetic diversity of Alaskan IHNV isolates. This information could be used to determine the source of an IHN outbreak and to facilitate decisions in fisheries management of Alaskan salmonid stocks.

Genetic reconstruction of a bullfrog invasion to elucidate vectors of introduction and secondary spread

USGS Publications Warehouse

Kamath, Pauline L.; Sepulveda, Adam; Layhee, Megan J.

2016-01-01

Reconstructing historical colonization pathways of an invasive species is critical for uncovering factors that determine invasion success and for designing management strategies. The American bullfrog (Lithobates catesbeianus) is endemic to eastern North America, but now has a global distribution and is considered to be one of the worst invaders in the world. In Montana, several introduced populations have been reported, but little is known of their sources and vectors of introduction and secondary spread. We evaluated the genetic composition of introduced populations at local (Yellowstone River floodplain) and regional (Montana and Wyoming) scales in contrast to native range populations. Our objectives were to (1) estimate the number of introductions, (2) identify probable native sources, (3) evaluate genetic variation relative to sources, and (4) characterize properties of local- and regional-scale spread. We sequenced 937 bp of the mitochondrial cytochrome b locus in 395 tadpoles collected along 100 km of the Yellowstone River, from three additional sites in MT and a proximate site in WY. Pairwise ΦST revealed high divergence among nonnative populations, suggesting at least four independent introductions into MT from diverse sources. Three cyt b haplotypes were identical to native haplotypes distributed across the Midwest and Great Lakes regions, and AMOVA confirmed the western native region as a likely source. While haplotype (Hd = 0.69) and nucleotide diversity (π = 0.005) were low in introduced bullfrogs, the levels of diversity did not differ significantly from source populations. In the Yellowstone, two identified haplotypes implied few introduction vectors and a significant relationship between genetic and river distance was found. Evidence for multiple invasions and lack of subsequent regional spread emphasizes the importance of enforcing legislation prohibiting bullfrog importation and the need for continuing public education to prevent transport of bullfrogs in MT. More broadly, this study demonstrates how genetic approaches can reveal key properties of a biological invasion to inform management strategies.

Association between variations in the TLR4 gene and incident type 2 diabetes is modified by the ratio of total cholesterol to HDL-cholesterol

PubMed Central

Kolz, Melanie; Baumert, Jens; Müller, Martina; Khuseyinova, Natalie; Klopp, Norman; Thorand, Barbara; Meisinger, Christine; Herder, Christian; Koenig, Wolfgang; Illig, Thomas

2008-01-01

Background Toll-like receptor 4 (TLR4), the signaling receptor for lipopolysaccharides, is an important member of the innate immunity system. Since several studies have suggested that type 2 diabetes might be associated with changes in the innate immune response, we sought to investigate the association between genetic variants in the TLR4 gene and incident type 2 diabetes. Methods A case-cohort study was conducted in initially healthy, middle-aged subjects from the MONICA/KORA Augsburg studies including 498 individuals with incident type 2 diabetes and 1,569 non-cases. Seven SNPs were systematically selected in the TLR4 gene and haplotypes were reconstructed. Results The effect of TLR4 SNPs on incident type 2 diabetes was modified by the ratio of total cholesterol to high-density lipoprotein cholesterol (TC/HDL-C). In men, four out of seven TLR4 variants showed significant interaction with TC/HDL-C after correction for multiple testing (p < 0.01). The influence of the minor alleles of those variants on the incidence of type 2 diabetes was observed particularly for male patients with high values of TC/HDL-C. Consistent with these findings, haplotype-based analyses also revealed that the effect of two haplotypes on incident type 2 diabetes was modified by TC/HDL-C in men (p < 10-3). However, none of the investigated variants or haplotypes was associated with type 2 diabetes in main effect models without assessment of effect modifications. Conclusion We conclude that minor alleles of several TLR4 variants, although not directly associated with type 2 diabetes might increase the risk for type 2 diabetes in subjects with high TC/HDL-C. Additionally, our results confirm previous studies reporting sex-related dissimilarities in the development of type 2 diabetes. PMID:18298826

High variation and strong phylogeographic pattern among cpDNA haplotypes in Taxus wallichiana (Taxaceae) in China and North Vietnam.

PubMed

Gao, L M; Möller, M; Zhang, X-M; Hollingsworth, M L; Liu, J; Mill, R R; Gibby, M; Li, D-Z

2007-11-01

We studied the phylogeography of Chinese yew (Taxus wallichiana), a tree species distributed over most of southern China and adjacent regions. A total of 1235 individuals from 50 populations from China and North Vietnam were analysed for chloroplast DNA variation using polymerase chain reaction-restriction fragment length polymorphism of the trnL-F intron-spacer region. A total of 19 different haplotypes were distinguished. We found a very high level of population differentiation and a strong phylogeographic pattern, suggesting low levels of recurrent gene flow among populations. Haplotype differentiation was most marked along the boundary between the Sino-Himalayan and Sino-Japanese Forest floristic subkingdoms, with only one haplotype being shared among these two subkingdoms. The Malesian and Sino-Himalayan Forest subkingdoms had five and 10 haplotypes, respectively, while the relatively large Sino-Japanese Forest subkingdom had only eight. The strong geography-haplotype correlation persisted at the regional floristic level, with most regions possessing a unique set of haplotypes, except for the central China region. Strong landscape effects were observed in the Hengduan and Dabashan mountains, where steep mountains and valleys might have been natural dispersal barriers. The molecular phylogenetic data, together with the geographic distribution of the haplotypes, suggest the existence of several localized refugia during the last glaciation from which the present-day distribution may be derived. The pattern of haplotype distribution across China and North Vietnam corresponded well with the current taxonomic delineation of the three intraspecific varieties of T. wallichiana.

Origin and diversification of Hibiscus glaber, species endemic to the oceanic Bonin Islands, revealed by chloroplast DNA polymorphism.

PubMed

Takayama, Koji; Ohi-Toma, Tetsuo; Kudoh, Hiroshi; Kato, Hidetoshi

2005-04-01

Abstract Two woody Hibiscus species co-occur in the Bonin Islands of the northwestern Pacific Ocean: Hibiscus glaber Matsum. is endemic to the islands, and its putative ancestral species, Hibiscus tiliaceus L., is widely distributed in coastal areas of the tropics and subtropics. To infer isolating mechanisms that led to speciation of H. glaber and the processes that resulted in co-occurrence of the two closely related species on the Bonin Islands, we conducted molecular phylogenetic analyses on chloroplast DNA (cpDNA) sequences. Materials collected from a wide area of the Pacific and Indian Oceans were used, and two closely related species, Hibiscus hamabo Siebold Zucc. and Hibiscus macrophyllus Roxb., were also included in the analyses. The constructed tree suggested that H. glaber has been derived from H. tiliaceus, and that most of the modern Bonin populations of H. tiliaceus did not share most recent ancestry with H. glaber. Geographic isolation appears to be the most important mechanism in the speciation of H. glaber. The co-occurrence of the two species can be attributed to multiple migrations of different lineages into the islands. While a wide and overlapping geographical distribution of haplotypes was found in H. tiliaceus, localized geographical distribution of haplotypes was detected in H. glaber. It is hypothesized that a shift to inland habitats may have affected the mode of seed dispersal from ocean currents to gravity and hence resulted in geographical structuring of H. glaber haplotypes.

A Single Crossing-Over Event in Voltage-Sensitive Na+ Channel Genes May Cause Critical Failure of Dengue Mosquito Control by Insecticides

PubMed Central

Hirata, Koichi; Komagata, Osamu; Itokawa, Kentaro; Yamamoto, Atsushi; Tomita, Takashi; Kasai, Shinji

2014-01-01

The voltage-sensitive sodium (Na+) channel (Vssc) is the target site of pyrethroid insecticides. Pest insects develop resistance to this class of insecticide by acquisition of one or multiple amino acid substitution(s) in this channel. In Southeast Asia, two major Vssc types confer pyrethroid resistance in the dengue mosquito vector Aedes aegypti, namely, S989P+V1016G and F1534C. We expressed several types of Vssc in Xenopus oocytes and examined the effect of amino acid substitutions in Vssc on pyrethroid susceptibilities. S989P+V1016G and F1534C haplotypes reduced the channel sensitivity to permethrin by 100- and 25-fold, respectively, while S989P+V1016G+F1534C triple mutations reduced the channel sensitivity to permethrin by 1100-fold. S989P+V1016G and F1534C haplotypes reduced the channel sensitivity to deltamethrin by 10- and 1-fold (no reduction), respectively, but S989P+V1016G+F1534C triple mutations reduced the channel sensitivity to deltamethrin by 90-fold. These results imply that pyrethroid insecticides are highly likely to lose their effectiveness against A. aegypti if such a Vssc haplotype emerges as the result of a single crossing-over event; thus, this may cause failure to control this key mosquito vector. Here, we strongly emphasize the importance of monitoring the occurrence of triple mutations in Vssc in the field population of A. aegypti. PMID:25166902

Vitamin D receptor gene polymorphisms and risk of polycystic ovary syndrome in South Indian women.

PubMed

Siddamalla, Swapna; Reddy, Tumu Venkat; Govatati, Suresh; Erram, Nagendram; Deenadayal, Mamata; Shivaji, Sisinthy; Bhanoori, Manjula

2018-02-01

Polycystic ovary syndrome (PCOS) is the most common endocrine disorder of reproductive age women. Emerging evidence suggests that Vitamin D Receptor (VDR) might be a causal factor for characteristics associated with PCOS such as obesity and type 2 diabetes. Present study investigated association between VDR gene BsmI A/G (rs1544410), ApaI A/C (rs7975232) and TaqI T/C (rs731236) single nucleotide polymorphisms and PCOS risk in South Indian women. Genotyping of VDR gene SNPs was carried out in PCOS patients (n = 95) and controls (n = 130) by PCR-RFLP method and confirmed by sequencing analysis. Haplotype frequencies for multiple loci and the standardized disequilibrium coefficient (D') for pairwise linkage disequilibrium (LD) were assessed by Haploview software. Results showed significantly increased frequencies of BsmI G/G (p = .0197), ApaI C/C (p = .048), TaqI C/C (p = .044) genotypes and BsmI G (p = .0181), ApaI C (p = .0092), TaqI C (p = .0066) alleles in patients compared to controls. In addition, the frequency of the 'BsmI G, ApaI C, TaqI C' haplotype was also significantly elevated in patients (p = .0087). In conclusion, the VDR gene BsmI A/G ApaI A/C TaqI T/C and haplotype may constitute an inheritable risk factor for PCOS in South Indian women.

Founded: Genetic Reconstruction of Lineage Diversity and Kinship Informs Ex situ Conservation of Cuban Amazon Parrots (Amazona leucocephala).

PubMed

Milián-García, Yoamel; Jensen, Evelyn L; Madsen, Jeanette; Álvarez Alonso, Suleiky; Serrano Rodríguez, Aryamne; Espinosa López, Georgina; Russello, Michael A

2015-01-01

Captive breeding is a widespread conservation strategy, yet such programs rarely include empirical genetic data for assessing management assumptions and meeting conservation goals. Cuban Amazon parrots (Amazona leucocephala) are considered vulnerable, and multiple on-island captive populations have been established from wild-caught and confiscated individuals of unknown ancestry. Here, we used mitochondrial haplotypic and nuclear genotypic data at 9 microsatellite loci to quantify the extent and distribution of genetic variation within and among captive populations in Zapata Swamp and Managua, Cuba, and to estimate kinship among breeders (n = 88). Using Bayesian clustering analysis, we detected 2 distinct clusters within the Zapata population, one of which was shared with Managua. Individuals from the cluster unique to Zapata possessed mitochondrial haplotypes with affinities to Cuban subspecies (A. l. leucocephala, A. l. palmarum); the shared cluster was similar, but also included haplotypes closely related to the subspecies restricted to Cayman Brac (A. l. hesterna). Overall mean kinship was low within each captive population (-0.026 to -0.012), with 19 and 11 recommended breeding pairs in Zapata and Managua, respectively, ranked according to mean kinship and informed by molecular sexing. Our results highlight the importance of understanding population history within ex situ management programs, while providing genetic information to directly inform Cuban parrot conservation. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Variation and Functional Impact of Neanderthal Ancestry in Western Asia

PubMed Central

Taskent, Recep Ozgur; Alioglu, Nursen Duha; Fer, Evrim

2017-01-01

Abstract Neanderthals contributed genetic material to modern humans via multiple admixture events. Initial admixture events presumably occurred in Western Asia shortly after humans migrated out of Africa. Despite being a focal point of admixture, earlier studies indicate lower Neanderthal introgression rates in some Western Asian populations as compared with other Eurasian populations. To better understand the genome-wide and phenotypic impact of Neanderthal introgression in the region, we sequenced whole genomes of nine present-day Europeans, Africans, and the Western Asian Druze at high depth, and analyzed available whole genome data from various other populations, including 16 genomes from present-day Turkey. Our results confirmed previous observations that contemporary Western Asian populations, on an average, have lower levels of Neanderthal-introgressed DNA relative to other Eurasian populations. Modern Western Asians also show comparatively high variability in Neanderthal ancestry, which may be attributed to the complex demographic history of the region. We further replicated the previously described depletion of putatively functional sequences among Neanderthal-introgressed haplotypes. Still, we find dozens of common Neanderthal-introgressed haplotypes in the Turkish sample associated with human phenotypes, including anthropometric and metabolic traits, as well as the immune response. One of these haplotypes is unusually long and harbors variants that affect the expression of members of the CCR gene family and are associated with celiac disease. Overall, our results paint a complex first picture of the genomic impact of Neanderthal introgression in the Western Asian populations. PMID:29040546

Recommendations for Accurate Resolution of Gene and Isoform Allele-Specific Expression in RNA-Seq Data

PubMed Central

Wood, David L. A.; Nones, Katia; Steptoe, Anita; Christ, Angelika; Harliwong, Ivon; Newell, Felicity; Bruxner, Timothy J. C.; Miller, David; Cloonan, Nicole; Grimmond, Sean M.

2015-01-01

Genetic variation modulates gene expression transcriptionally or post-transcriptionally, and can profoundly alter an individual’s phenotype. Measuring allelic differential expression at heterozygous loci within an individual, a phenomenon called allele-specific expression (ASE), can assist in identifying such factors. Massively parallel DNA and RNA sequencing and advances in bioinformatic methodologies provide an outstanding opportunity to measure ASE genome-wide. In this study, matched DNA and RNA sequencing, genotyping arrays and computationally phased haplotypes were integrated to comprehensively and conservatively quantify ASE in a single human brain and liver tissue sample. We describe a methodological evaluation and assessment of common bioinformatic steps for ASE quantification, and recommend a robust approach to accurately measure SNP, gene and isoform ASE through the use of personalized haplotype genome alignment, strict alignment quality control and intragenic SNP aggregation. Our results indicate that accurate ASE quantification requires careful bioinformatic analyses and is adversely affected by sample specific alignment confounders and random sampling even at moderate sequence depths. We identified multiple known and several novel ASE genes in liver, including WDR72, DSP and UBD, as well as genes that contained ASE SNPs with imbalance direction discordant with haplotype phase, explainable by annotated transcript structure, suggesting isoform derived ASE. The methods evaluated in this study will be of use to researchers performing highly conservative quantification of ASE, and the genes and isoforms identified as ASE of interest to researchers studying those loci. PMID:25965996

Family-based association testing strongly implicates DRD2 as a risk gene for schizophrenia in Han Chinese from Taiwan

PubMed Central

Glatt, SJ; Faraone, SV; Lasky-Su, JA; Kanazawa, T; Hwu, H-G; Tsuang, MT

2009-01-01

The gene that codes for dopamine receptor D2 (DRD2 on chromosome 11q23) has long been a prime functional and positional candidate risk gene for schizophrenia. Collectively, prior case–control studies found a reliable effect of the Ser311Cys DRD2 polymorphism (rs1801028) on risk for schizophrenia, but few other polymorphisms in the gene had ever been evaluated and no adequately powered family-based association study has been performed to date. Our objective was to test 21 haplotype-tagging and all three known nonsynonymous single-nucleotide polymorphisms (SNPs) in DRD2 for association with schizophrenia in a family-based study of 2408 Han Chinese, including 1214 affected individuals from 616 families. We did not find a significant effect of rs1801028, but we did find significant evidence for association of schizophrenia with two multi-marker haplotypes spanning blocks of strong linkage disequilibrium (LD) and nine individual SNPs (Ps < 0.05). Importantly, two SNPs (rs1079727 and rs2283265) and both multi-marker haplotypes spanning entire LD blocks (including one that contained rs1801028) remained significant after correcting for multiple testing. These results further add to the body of data implicating DRD2 as a schizophrenia risk gene; however, a causal variant(s) in DRD2 remains to be elucidated by further fine mapping of the gene, with particular attention given to the area surrounding the third through fifth exons. PMID:18332877

DNA barcoding reveals high diversity of deep-sea octocorals on Hawaiian seamounts

NASA Astrophysics Data System (ADS)

Baco-Taylor, A.; Morgan, N.; LaBelle, B.; Figueroa, D.; Ormos, A.; Cairns, S.; Driskell, A.

2016-02-01

Globally, studies of deep-sea octocoral distribution and diversity have been hampered by a lack of keys and a plethora of unidentified specimens. Even in areas where intensive morphological work has been done, as many as half of the specimens remain unidentified to species or even genus. Recently, a suite of genetic markers have been identified as barcoding proxies for octocorals. Here, we make one of the first attempts at broad-scale application of 3 of these markers, to recent and museum collections of octocorals of approximately 1000 specimens from the Hawaiian Archipelago, to gain a better understanding of the diversity and distribution of deep-sea octocorals there. Sequence results for all 3 markers show a greater number of haplotypes than morphological species. Each of these markers as taken alone has been shown to underestimate species richness. Extrapolating from this we show that morphological work to date on these specimens underestimates species richness by 30-40%, suggesting the diversity of octocorals in the Hawaiian Archipelago is substantially greater than previously thought. The large percentage of haplotypes represented by single individuals suggests that the full diversity of deep-sea octocorals in Hawaii remains drastically undersampled. This work also shows that species ranges based on current species designations are overestimated, with multiple smaller-range haplotypes for given morphological operational taxonomic units. We evaluate these results to assess the usefulness of application of these markers to understanding deep-sea coral distributions in the broader Pacific and beyond.

Genetic diversity and geographical structure of the pitcher plant Nepenthes vieillardii in New Caledonia: A chloroplast DNA haplotype analysis.

PubMed

Kurata, Kaoruko; Jaffré, Tanguy; Setoguchi, Hiroaki

2008-12-01

Among the many species that grow in New Caledonia, the pitcher plant Nepenthes vieillardii (Nepenthaceae) has a high degree of morphological variation. In this study, we present the patterns of genetic differentiation of pitcher plant populations based on chloroplast DNA haplotype analysis using the sequences of five spacers. We analyzed 294 samples from 16 populations covering the entire range of the species, using 4660 bp of sequence. Our analysis identified 17 haplotypes, including one that is widely distributed across the islands, as well as regional and private haplotypes. The greatest haplotype diversity was detected on the eastern coast of the largest island and included several private haplotypes, while haplotype diversity was low in the southern plains region. The parsimony network analysis of the 17 haplotypes suggested that the genetic divergence is the result of long-term isolation of individual populations. Results from a spatial analysis of molecular variance and a cluster analysis suggest that the plants once covered the entire serpentine area of New Caledonia and that subsequent regional fragmentation resulted in the isolation of each population and significantly restricted seed flow. This isolation may have been an important factor in the development of the morphological and genetic variation among pitcher plants in New Caledonia.

A Genome-Wide Scan for Breast Cancer Risk Haplotypes among African American Women

PubMed Central

Song, Chi; Chen, Gary K.; Millikan, Robert C.; Ambrosone, Christine B.; John, Esther M.; Bernstein, Leslie; Zheng, Wei; Hu, Jennifer J.; Ziegler, Regina G.; Nyante, Sarah; Bandera, Elisa V.; Ingles, Sue A.; Press, Michael F.; Deming, Sandra L.; Rodriguez-Gil, Jorge L.; Chanock, Stephen J.; Wan, Peggy; Sheng, Xin; Pooler, Loreall C.; Van Den Berg, David J.; Le Marchand, Loic; Kolonel, Laurence N.; Henderson, Brian E.; Haiman, Chris A.; Stram, Daniel O.

2013-01-01

Genome-wide association studies (GWAS) simultaneously investigating hundreds of thousands of single nucleotide polymorphisms (SNP) have become a powerful tool in the investigation of new disease susceptibility loci. Haplotypes are sometimes thought to be superior to SNPs and are promising in genetic association analyses. The application of genome-wide haplotype analysis, however, is hindered by the complexity of haplotypes themselves and sophistication in computation. We systematically analyzed the haplotype effects for breast cancer risk among 5,761 African American women (3,016 cases and 2,745 controls) using a sliding window approach on the genome-wide scale. Three regions on chromosomes 1, 4 and 18 exhibited moderate haplotype effects. Furthermore, among 21 breast cancer susceptibility loci previously established in European populations, 10p15 and 14q24 are likely to harbor novel haplotype effects. We also proposed a heuristic of determining the significance level and the effective number of independent tests by the permutation analysis on chromosome 22 data. It suggests that the effective number was approximately half of the total (7,794 out of 15,645), thus the half number could serve as a quick reference to evaluating genome-wide significance if a similar sliding window approach of haplotype analysis is adopted in similar populations using similar genotype density. PMID:23468962

β-globin gene cluster haplotypes in ethnic minority populations of southwest China

PubMed Central

Sun, Hao; Liu, Hongxian; Huang, Kai; Lin, Keqin; Huang, Xiaoqin; Chu, Jiayou; Ma, Shaohui; Yang, Zhaoqing

2017-01-01

The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5′ sites and 3′ sites of the β-globin gene cluster. 5′ haplotypes 2 (+−−−), 6 (−++−+), 9 (−++++) and 3′ haplotype FW3 (−+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China. PMID:28205625

Ancient mitochondrial haplotypes and evidence for intragenic recombination in a gynodioecious plant.

PubMed

Städler, Thomas; Delph, Lynda F

2002-09-03

Because of their extremely low nucleotide mutation rates, plant mitochondrial genes are generally not expected to show variation within species. Remarkably, we found nine distinct cytochrome b sequence haplotypes in the gynodioecious alpine plant Silene acaulis, with two or more haplotypes coexisting locally in each of three sampled regions. Moreover, there is evidence for intragenic recombination in the history of the haplotype sample, implying at least transient heteroplasmy of mitochondrial DNA (mtDNA). Heteroplasmy might be achieved by one of two potential mechanisms, either continuous coexistence of subgenomic fragments in low stoichiometry, or occasional paternal leakage of mtDNA. On the basis of levels of synonymous nucleotide substitutions, the average divergence time between haplotypes is estimated to be at least 15 million years. Ancient coalescence of extant haplotypes is further indicated by the paucity of fixed differences in haplotypes obtained from related species, a pattern expected under trans-specific evolution. Our data are consistent with models of frequency-dependent selection on linked cytoplasmic male-sterility factors, the putative molecular basis of females in gynodioecious populations. However, associations between marker loci and the inferred male-sterility genes can be maintained only with very low rates of recombination. Heteroplasmy and recombination between divergent haplotypes imply unexplored consequences for the evolutionary dynamics of gynodioecy, a widespread plant breeding system.

Identification and genetic effect of haplotype in the bovine BMP7 gene.

PubMed

Huang, Yong-Zhen; Wang, Xin-Lei; He, Hua; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong

2013-12-15

Bone morphogenetic proteins (BMPs) are peptide growth factors belonging to the transforming growth factor-beta (TGF-β) superfamily, and some members of the BMP family support white adipocyte differentiation. In this study, we focused on the BMP7 which singularly promotes the differentiation of brown preadipocytes. Haplotypes involving 5 single nucleotide polymorphism (SNP) sites in the bovine BMP7 gene were identified and their effect on body weight was analyzed. 16 haplotypes and 18 combined haplotypes were revealed and the linkage disequilibrium was assessed in the cattle population with 602 individuals representing three main cattle breeds from China. The results showed that haplotypes 3, 10 and 14 were predominant and accounted for 75.64%, 69.85%, and 83.36% in Nanyang, Qinchuan and Jiaxian cattle breeds, respectively. The statistical analyses indicated that the SNP 1, 4, and 5 are associated with the body weight, body length, and heart girth at 12 and 24 months in Nanyang cattle population (P<0.05), whereas there is no significant association between their 16 haplotypes and 18 combined haplotypes. Our results provide evidence that some SNPs and haplotypes in BMP7 are associated with growth traits, and may be utilized as a genetic marker in marker-assisted selection for beef cattle breeding programs. Copyright © 2013. Published by Elsevier B.V.

The JAK2 GGCC (46/1) Haplotype in Myeloproliferative Neoplasms: Causal or Random?

PubMed

Anelli, Luisa; Zagaria, Antonella; Specchia, Giorgina; Albano, Francesco

2018-04-11

The germline JAK2 haplotype known as "GGCC or 46/1 haplotype" (haplotype GGCC_46/1 ) consists of a combination of single nucleotide polymorphisms (SNPs) mapping in a region of about 250 kb, extending from the JAK2 intron 10 to the Insulin-like 4 ( INLS4 ) gene. Four main SNPs (rs3780367, rs10974944, rs12343867, and rs1159782) generating a "GGCC" combination are more frequently indicated to represent the JAK2 haplotype. These SNPs are inherited together and are frequently associated with the onset of myeloproliferative neoplasms (MPN) positive for both JAK2 V617 and exon 12 mutations. The association between the JAK2 haplotype GGCC_46/1 and mutations in other genes, such as thrombopoietin receptor ( MPL ) and calreticulin ( CALR ), or the association with triple negative MPN, is still controversial. This review provides an overview of the frequency and the role of the JAK2 haplotype GGCC_46/1 in the pathogenesis of different myeloid neoplasms and describes the hypothetical mechanisms at the basis of the association with JAK2 gene mutations. Moreover, possible clinical implications are discussed, as different papers reported contrasting data about the correlation between the JAK2 haplotype GGCC_46/1 and blood cell count, survival, or disease progression.

Characterization of swine leukocyte antigen alleles and haplotypes on a novel miniature pig line, Microminipig.

PubMed

Ando, A; Imaeda, N; Ohshima, S; Miyamoto, A; Kaneko, N; Takasu, M; Shiina, T; Kulski, J K; Inoko, H; Kitagawa, H

2014-12-01

Microminipigs are extremely small-sized, novel miniature pigs that were recently developed for medical research. The inbred Microminipigs with defined swine leukocyte antigen (SLA) haplotypes are expected to be useful for allo- and xenotransplantation studies and also for association analyses between SLA haplotypes and immunological traits. To establish SLA-defined Microminipig lines, we characterized the polymorphic SLA alleles for three class I (SLA-1, SLA-2 and SLA-3) and two class II (SLA-DRB1 and SLA-DQB1) genes of 14 parental Microminipigs using a high-resolution nucleotide sequence-based typing method. Eleven class I and II haplotypes, including three recombinant haplotypes, were found in the offspring of the parental Microminipigs. Two class I and class II haplotypes, Hp-31.0 (SLA-1*1502-SLA-3*070102-SLA-2*1601) and Hp-0.37 (SLA-DRB1*0701-SLA-DQB1*0502), are novel and have not so far been reported in other pig breeds. Crossover regions were defined by the analysis of 22 microsatellite markers within the SLA class III region of three recombinant haplotypes. The SLA allele and haplotype information of Microminipigs in this study will be useful to establish SLA homozygous lines including three recombinants for transplantation and immunological studies. © 2014 Stichting International Foundation for Animal Genetics.

Genomic evolution in domestic cattle: ancestral haplotypes and healthy beef.

PubMed

Williamson, Joseph F; Steele, Edward J; Lester, Susan; Kalai, Oscar; Millman, John A; Wolrige, Lindsay; Bayard, Dominic; McLure, Craig; Dawkins, Roger L

2011-05-01

We have identified numerous Ancestral Haplotypes encoding a 14-Mb region of Bota C19. Three are frequent in Simmental, Angus and Wagyu and have been conserved since common progenitor populations. Others are more relevant to the differences between these 3 breeds including fat content and distribution in muscle. SREBF1 and Growth Hormone, which have been implicated in the production of healthy beef, are included within these haplotypes. However, we conclude that alleles at these 2 loci are less important than other sequences within the haplotypes. Identification of breeds and hybrids is improved by using haplotypes rather than individual alleles. Copyright © 2010 Elsevier Inc. All rights reserved.

Y-STR haplotypes of Native American populations from the Brazilian Amazon region.

PubMed

Palha, Teresinha Jesus Brabo Ferreira; Rodrigues, Elzemar Martins Ribeiro; dos Santos, Sidney Emanuel Batista

2010-10-01

The allele and haplotype frequencies of nine Y-STRs (DYS19, DYS389 I, DYS389 II, DYS390, DYS391, DYS392, DYS393, DYS385 I/II) were determined in a sample of six native tribes from the Brazilian Amazon (Tiriyó, Awa-Guajá, Waiãpi, Urubu-Kaapor, Zoé and Parakanã). Forty-eight different haplotypes were identified, 28 of which unique. Five haplotypes are very frequent and were shared by over 10 individuals. The estimated haplotype diversity (0.9114) was very low compared to other geographic groups, including Africans, Europeans and Asians. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Single nucleotide polymorphisms and microsatellites in the canine glutathione S-transferase pi 1 (GSTP1) gene promoter.

PubMed

Sacco, James; Mann, Sarah; Toral, Keller

2017-01-01

Genetic polymorphisms within the glutathione S-transferase P1 ( GSTP1 ) gene affect the elimination of toxic xenobiotics by the GSTP1 enzyme. In dogs, exposure to environmental chemicals that may be GSTP1 substrates is associated with cancer. The objectives of this study were to investigate the genetic variability in the GSTP1 promoter in a diverse population of 278 purebred dogs, compare the incidence of any variants found between breeds, and predict their effects on gene expression. To provide information on ancestral alleles, a number of wolves, coyotes, and foxes were also sequenced. Fifteen single nucleotide polymorphisms (SNPs) and two microsatellites were discovered. Three of these loci were only polymorphic in dogs while three other SNPs were unique to wolves and coyotes. The major allele at c.-46 is T in dogs but is C in the wild canids. The c.-185 delT variant was unique to dogs. The microsatellite located in the 5' untranslated region (5'UTR) was a highly polymorphic GCC tandem repeat, consisting of simple and compound alleles that varied in size from 10 to 22-repeat units. The most common alleles consisted of 11, 16, and 17-repeats. The 11-repeat allele was found in 10% of dogs but not in the other canids. Unequal recombination and replication slippage between similar and distinct alleles may be the mechanism for the multiple microsatellites observed. Twenty-eight haplotypes were constructed in the dog, and an additional 8 were observed in wolves and coyotes. While the most common haplotype acrossbreeds was the wild-type *1A(17), other prevalent haplotypes included *3A(11) in Greyhounds, *6A(16) in Labrador Retrievers, *9A(16) in Golden Retrievers, and *8A(19) in Standard Poodles. Boxers and Siberian Huskies exhibited minimal haplotypic diversity. Compared to the simple 16*1 allele, the compound 16*2 allele (found in 12% of dogs) may interfere with transcription factor binding and/or the stability of the GSTP1 transcript. Dogs and other canids exhibit extensive variation in the GSTP1 promoter. Genetic polymorphisms within distinct haplotypes prevalent in certain breeds can affect GSTP1 expression and carcinogen detoxification, and thus may be useful as genetic markers for cancer in dogs.

Cloud computing-based TagSNP selection algorithm for human genome data.

PubMed

Hung, Che-Lun; Chen, Wen-Pei; Hua, Guan-Jie; Zheng, Huiru; Tsai, Suh-Jen Jane; Lin, Yaw-Ling

2015-01-05

Single nucleotide polymorphisms (SNPs) play a fundamental role in human genetic variation and are used in medical diagnostics, phylogeny construction, and drug design. They provide the highest-resolution genetic fingerprint for identifying disease associations and human features. Haplotypes are regions of linked genetic variants that are closely spaced on the genome and tend to be inherited together. Genetics research has revealed SNPs within certain haplotype blocks that introduce few distinct common haplotypes into most of the population. Haplotype block structures are used in association-based methods to map disease genes. In this paper, we propose an efficient algorithm for identifying haplotype blocks in the genome. In chromosomal haplotype data retrieved from the HapMap project website, the proposed algorithm identified longer haplotype blocks than an existing algorithm. To enhance its performance, we extended the proposed algorithm into a parallel algorithm that copies data in parallel via the Hadoop MapReduce framework. The proposed MapReduce-paralleled combinatorial algorithm performed well on real-world data obtained from the HapMap dataset; the improvement in computational efficiency was proportional to the number of processors used.

iXora: exact haplotype inferencing and trait association.

PubMed

Utro, Filippo; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar E; Royaert, Stefan; Schnell, Raymond J; Motamayor, Juan Carlos; Kuhn, David N; Parida, Laxmi

2013-06-06

We address the task of extracting accurate haplotypes from genotype data of individuals of large F1 populations for mapping studies. While methods for inferring parental haplotype assignments on large F1 populations exist in theory, these approaches do not work in practice at high levels of accuracy. We have designed iXora (Identifying crossovers and recombining alleles), a robust method for extracting reliable haplotypes of a mapping population, as well as parental haplotypes, that runs in linear time. Each allele in the progeny is assigned not just to a parent, but more precisely to a haplotype inherited from the parent. iXora shows an improvement of at least 15% in accuracy over similar systems in literature. Furthermore, iXora provides an easy-to-use, comprehensive environment for association studies and hypothesis checking in populations of related individuals. iXora provides detailed resolution in parental inheritance, along with the capability of handling very large populations, which allows for accurate haplotype extraction and trait association. iXora is available for non-commercial use from http://researcher.ibm.com/project/3430.

Cloud Computing-Based TagSNP Selection Algorithm for Human Genome Data

PubMed Central

Hung, Che-Lun; Chen, Wen-Pei; Hua, Guan-Jie; Zheng, Huiru; Tsai, Suh-Jen Jane; Lin, Yaw-Ling

2015-01-01

Single nucleotide polymorphisms (SNPs) play a fundamental role in human genetic variation and are used in medical diagnostics, phylogeny construction, and drug design. They provide the highest-resolution genetic fingerprint for identifying disease associations and human features. Haplotypes are regions of linked genetic variants that are closely spaced on the genome and tend to be inherited together. Genetics research has revealed SNPs within certain haplotype blocks that introduce few distinct common haplotypes into most of the population. Haplotype block structures are used in association-based methods to map disease genes. In this paper, we propose an efficient algorithm for identifying haplotype blocks in the genome. In chromosomal haplotype data retrieved from the HapMap project website, the proposed algorithm identified longer haplotype blocks than an existing algorithm. To enhance its performance, we extended the proposed algorithm into a parallel algorithm that copies data in parallel via the Hadoop MapReduce framework. The proposed MapReduce-paralleled combinatorial algorithm performed well on real-world data obtained from the HapMap dataset; the improvement in computational efficiency was proportional to the number of processors used. PMID:25569088

VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

1994-09-01

The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception ofmore » closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.« less

A novel haplotype of spinocerebellar ataxia type 6 contributes to the highest prevalence in western Japan.

PubMed

Terasawa, Hideo; Oda, Masaya; Morino, Hiroyuki; Miyachi, Takafumi; Izumi, Yuishin; Maruyama, Hirofumi; Matsumoto, Masayasu; Kawakami, Hideshi

2004-03-25

The highest prevalence rate of spinocerebellar ataxia type 6 (SCA6) in the worldwide population is in the Chugoku and Kansai areas of Western Japan, but the reason of this geographic characteristics is unclear. We investigated the predisposing haplotypes and their geographic distribution. Genotyping of five microsatellite markers and three single nucleotide polymorphisms linked to the CACNA1A gene in 150 Japanese SCA6 patients from unrelated 118 families revealed three major haplotypes, carrying a pool of one common haplotype core. A founder chromosome was thought to have historically diverged into at least three types. One of the major haplotypes newly identified showed a strong geographical cluster around the Seto Inland Sea in the Chugoku and Kansai areas of Western Japan, whereas the others were widely distributed throughout Japan. The distribution of predisposing haplotypes contributes to the geographical differences in prevalence of SCA6.

Integrating sequence and array data to create an improved 1000 Genomes Project haplotype reference panel.

PubMed

Delaneau, Olivier; Marchini, Jonathan

2014-06-13

A major use of the 1000 Genomes Project (1000 GP) data is genotype imputation in genome-wide association studies (GWAS). Here we develop a method to estimate haplotypes from low-coverage sequencing data that can take advantage of single-nucleotide polymorphism (SNP) microarray genotypes on the same samples. First the SNP array data are phased to build a backbone (or 'scaffold') of haplotypes across each chromosome. We then phase the sequence data 'onto' this haplotype scaffold. This approach can take advantage of relatedness between sequenced and non-sequenced samples to improve accuracy. We use this method to create a new 1000 GP haplotype reference set for use by the human genetic community. Using a set of validation genotypes at SNP and bi-allelic indels we show that these haplotypes have lower genotype discordance and improved imputation performance into downstream GWAS samples, especially at low-frequency variants.

Near East mtDNA haplotype variants in Roman cattle from Augusta Raurica, Switzerland, and in the Swiss Evolène breed.

PubMed

Schlumbaum, A; Turgay, M; Schibler, J

2006-08-01

Typical Near East mitochondrial haplotypes of the T2 lineage were found in one cattle metacarpus sample from the Roman period and in two present-day Evolène cattle in Switzerland. Sequences from eight additional Evolène and four Raetian Grey aligned to the European haplotype T3. Analysis of nucleotide diversity within the mitochondrial D-loop of both studied Swiss cattle breeds revealed high haplotype diversity and similar diversity to a European cattle reference group. Mitochondrial T3 haplotypes radiated star-like from two similarly frequent haplotypes, possibly indicating two different expansion routes. The breed structure of Evolène cattle can be explained either by an introduction of diverse female lineages from the domestication centre or by later admixture. The introduction of the Near East lineage to Switzerland must have happened during the Roman time or earlier.

Depth-resolved monitoring of diffusion of hyperosmotic agents in normal and malignant human esophagus tissues using optical coherence tomography in-vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao Qingliang; Guo Zhouyi; Wei Huajiang

2011-10-31

Depth-resolved monitoring with differentiation and quantification of glucose diffusion in healthy and abnormal esophagus tissues has been studied in vitro. Experiments have been performed using human normal esophagus and esophageal squamous cell carcinoma (ESCC) tissues by the optical coherence tomography (OCT). The images have been continuously acquired for 120 min in the experiments, and the depth-resolved and average permeability coefficients of the 40 % glucose solution have been calculated by the OCT amplitude (OCTA) method. We demonstrate the capability of the OCT technique for depth-resolved monitoring, differentiation, and quantifying of glucose diffusion in normal esophagus and ESCC tissues. It ismore » found that the permeability coefficients of the 40 % glucose solution are not uniform throughout the normal esophagus and ESCC tissues and increase from (3.30 {+-} 0.09) Multiplication-Sign 10{sup -6} and (1.57 {+-} 0.05) Multiplication-Sign 10{sup -5} cm s{sup -1} at the mucous membrane of normal esophagus and ESCC tissues to (1.82 {+-} 0.04) Multiplication-Sign 10{sup -5} and (3.53 {+-} 0.09) Multiplication-Sign 10{sup -5} cm s{sup -1} at the submucous layer approximately 742 {mu}m away from the epithelial surface of normal esophagus and ESCC tissues, respectively. (optical coherence tomography)« less

Founder haplotype analysis of Fanconi anemia in the Korean population finds common ancestral haplotypes for a FANCG variant.

PubMed

Park, Joonhong; Kim, Myungshin; Jang, Woori; Chae, Hyojin; Kim, Yonggoo; Chung, Nack-Gyun; Lee, Jae-Wook; Cho, Bin; Jeong, Dae-Chul; Park, In Yang; Park, Mi Sun

2015-05-01

A common ancestral haplotype is strongly suggested in the Korean and Japanese patients with Fanconi anemia (FA), because common mutations have been frequently found: c.2546delC and c.3720_3724delAAACA of FANCA; c.307+1G>C, c.1066C>T, and c.1589_1591delATA of FANCG. Our aim in this study was to investigate the origin of these common mutations of FANCA and FANCG. We genotyped 13 FA patients consisting of five FA-A patients and eight FA-G patients from the Korean FA population. Microsatellite markers used for haplotype analysis included four CA repeat markers which are closely linked with FANCA and eight CA repeat markers which are contiguous with FANCG. As a result, Korean FA-A patients carrying c.2546delC or c.3720_3724delAAACA did not share the same haplotypes. However, three unique haplotypes carrying c.307+1G>C, c.1066C > T, or c.1589_1591delATA, that consisted of eight polymorphic loci covering a flanking region were strongly associated with Korean FA-G, consistent with founder haplotypes reported previously in the Japanese FA-G population. Our finding confirmed the common ancestral haplotypes on the origins of the East Asian FA-G patients, which will improve our understanding of the molecular population genetics of FA-G. To the best of our knowledge, this is the first report on the association between disease-linked mutations and common ancestral haplotypes in the Korean FA population. © 2015 John Wiley & Sons Ltd/University College London.

Mitochondrial DNA haplotype distribution patterns in Pinus ponderosa (Pinaceae): range-wide evolutionary history and implications for conservation.

PubMed

Potter, Kevin M; Hipkins, Valerie D; Mahalovich, Mary F; Means, Robert E

2013-08-01

Ponderosa pine (Pinus ponderosa Douglas ex P. Lawson & C. Lawson) exhibits complicated patterns of morphological and genetic variation across its range in western North America. This study aims to clarify P. ponderosa evolutionary history and phylogeography using a highly polymorphic mitochondrial DNA marker, with results offering insights into how geographical and climatological processes drove the modern evolutionary structure of tree species in the region. We amplified the mtDNA nad1 second intron minisatellite region for 3,100 trees representing 104 populations, and sequenced all length variants. We estimated population-level haplotypic diversity and determined diversity partitioning among varieties, races and populations. After aligning sequences of minisatellite repeat motifs, we evaluated evolutionary relationships among haplotypes. The geographical structuring of the 10 haplotypes corresponded with division between Pacific and Rocky Mountain varieties. Pacific haplotypes clustered with high bootstrap support, and appear to have descended from Rocky Mountain haplotypes. A greater proportion of diversity was partitioned between Rocky Mountain races than between Pacific races. Areas of highest haplotypic diversity were the southern Sierra Nevada mountain range in California, northwestern California, and southern Nevada. Pinus ponderosa haplotype distribution patterns suggest a complex phylogeographic history not revealed by other genetic and morphological data, or by the sparse paleoecological record. The results appear consistent with long-term divergence between the Pacific and Rocky Mountain varieties, along with more recent divergences not well-associated with race. Pleistocene refugia may have existed in areas of high haplotypic diversity, as well as the Great Basin, Southwestern United States/northern Mexico, and the High Plains.

Haplotypes composed of minor frequency single nucleotide polymorphisms of the TNF gene protect from progression into sepsis: A study using the new sepsis classification.

PubMed

Retsas, Theodoros; Huse, Klaus; Lazaridis, Lazaros-Dimitrios; Karampela, Niki; Bauer, Michael; Platzer, Matthias; Kolonia, Virginia; Papageorgiou, Eirini; Giamarellos-Bourboulis, Evangelos J; Dimopoulos, George

2018-02-01

Several articles have provided conflicting results regarding the role of single nucleotide polymorphisms (SNPs) in the promoter region of the TNF gene in susceptibility to sepsis. Former articles have been based on previous definitions of sepsis. This study investigated the influence of TNF haplotypes on the development of sepsis using the new Sepsis-3 definitions. DNA was isolated from patients suffering from infection and systemic inflammatory response syndrome. Haplotyping was performed for six SNPs of TNF. The serum levels of tumour necrosis factor alpha (TNF-α) of these patients were measured using an enzyme immunosorbent assay. Patients were classified into infection and sepsis categories using the Sepsis-3 definitions. Associations between the TNF haplotypes and the clinical characteristics and serum TNF-α levels of the patients were examined. The most common TNF haplotype h1 was composed of major alleles of the studied SNPs. Carriage of haplotypes composed of minor frequency alleles was associated with a lower risk of developing sepsis (odds ratio 0.41, 95% confidence interval 0.19-0.88, p=0.022), but this did not affect the 28-day outcome. Serum TNF-α levels were significantly higher among patients homozygous for h1 haplotypes who developed sepsis compared to infection (p=0.032); a similar result was not observed for patients carrying other haplotypes. Haplotypes containing minor frequency SNP alleles of TNF protect against the development of sepsis without affecting the outcome. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Mitochondrial Haplotype Diversity in Zambian Lions: Bridging a Gap in the Biogeography of an Iconic Species

PubMed Central

Curry, Caitlin J.; White, Paula A.; Derr, James N.

2015-01-01

Analysis of DNA sequence diversity at the 12S to 16S mitochondrial genes of 165 African lions (Panthera leo) from five main areas in Zambia has uncovered haplotypes which link Southern Africa with East Africa. Phylogenetic analysis suggests Zambia may serve as a bridge connecting the lion populations in southern Africa to eastern Africa, supporting earlier hypotheses that eastern-southern Africa may represent the evolutionary cradle for the species. Overall gene diversity throughout the Zambian lion population was 0.7319 +/- 0.0174 with eight haplotypes found; three haplotypes previously described and the remaining five novel. The addition of these five novel haplotypes, so far only found within Zambia, nearly doubles the number of haplotypes previously reported for any given geographic location of wild lions. However, based on an AMOVA analysis of these haplotypes, there is little to no matrilineal gene flow (Fst = 0.47) when the eastern and western regions of Zambia are considered as two regional sub-populations. Crossover haplotypes (H9, H11, and Z1) appear in both populations as rare in one but common in the other. This pattern is a possible result of the lion mating system in which predominately males disperse, as all individuals with crossover haplotypes were male. The determination and characterization of lion sub-populations, such as done in this study for Zambia, represent a higher-resolution of knowledge regarding both the genetic health and connectivity of lion populations, which can serve to inform conservation and management of this iconic species. PMID:26674533

The targetable A1 Huntington disease haplotype has distinct Amerindian and European origins in Latin America

PubMed Central

Kay, Chris; Tirado-Hurtado, Indira; Cornejo-Olivas, Mario; Collins, Jennifer A; Wright, Galen; Inca-Martinez, Miguel; Veliz-Otani, Diego; Ketelaar, Maria E; Slama, Ramy A; Ross, Colin J; Mazzetti, Pilar; Hayden, Michael R

2017-01-01

Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin (HTT) gene. HD occurs worldwide, but the causative mutation is found on different HTT haplotypes in distinct ethnic groups. In Latin America, HD is thought to have European origins, but indigenous Amerindian ancestry has not been investigated. Here, we report dense HTT haplotypes in 62 mestizo Peruvian HD families, 17 HD families from across Latin America, and 42 controls of defined Peruvian Amerindian ethnicity to determine the origin of HD in populations of admixed Amerindian and European descent. HD in Peru occurs most frequently on the A1 HTT haplotype (73%), as in Europe, but on an unexpected indigenous variant also found in Amerindian controls. This Amerindian A1 HTT haplotype predominates over the European A1 variant among geographically disparate Latin American controls and in HD families from across Latin America, supporting an indigenous origin of the HD mutation in mestizo American populations. We also show that a proportion of HD mutations in Peru occur on a C1 HTT haplotype of putative Amerindian origin (14%). The majority of HD mutations in Latin America may therefore occur on haplotypes of Amerindian ancestry rather than on haplotypes resulting from European admixture. Despite the distinct ethnic ancestry of Amerindian and European A1 HTT, alleles on the parent A1 HTT haplotype allow for development of identical antisense molecules to selectively silence the HD mutation in the greatest proportion of patients in both Latin American and European populations. PMID:28000697

Mitochondrial Haplotype Diversity in Zambian Lions: Bridging a Gap in the Biogeography of an Iconic Species.

PubMed

Curry, Caitlin J; White, Paula A; Derr, James N

2015-01-01

Analysis of DNA sequence diversity at the 12S to 16S mitochondrial genes of 165 African lions (Panthera leo) from five main areas in Zambia has uncovered haplotypes which link Southern Africa with East Africa. Phylogenetic analysis suggests Zambia may serve as a bridge connecting the lion populations in southern Africa to eastern Africa, supporting earlier hypotheses that eastern-southern Africa may represent the evolutionary cradle for the species. Overall gene diversity throughout the Zambian lion population was 0.7319 +/- 0.0174 with eight haplotypes found; three haplotypes previously described and the remaining five novel. The addition of these five novel haplotypes, so far only found within Zambia, nearly doubles the number of haplotypes previously reported for any given geographic location of wild lions. However, based on an AMOVA analysis of these haplotypes, there is little to no matrilineal gene flow (Fst = 0.47) when the eastern and western regions of Zambia are considered as two regional sub-populations. Crossover haplotypes (H9, H11, and Z1) appear in both populations as rare in one but common in the other. This pattern is a possible result of the lion mating system in which predominately males disperse, as all individuals with crossover haplotypes were male. The determination and characterization of lion sub-populations, such as done in this study for Zambia, represent a higher-resolution of knowledge regarding both the genetic health and connectivity of lion populations, which can serve to inform conservation and management of this iconic species.

Reproductive status of overwintering potato psyllid: absence of photoperiod effects

USDA-ARS?s Scientific Manuscript database

We examined the effects of photoperiod on reproductive diapause of three haplotypes of potato psyllid, Bactericera cockerelli (Hemiptera: Triozidae), collected from three geographic locations: south Texas (Central haplotype), California (Western haplotype), and Washington State (Northwestern haploty...

MtDNA diversity among four Portuguese autochthonous dog breeds: a fine-scale characterisation

PubMed Central

van Asch, Barbara; Pereira, Luísa; Pereira, Filipe; Santa-Rita, Pedro; Lima, Manuela; Amorim, António

2005-01-01

Background The picture of dog mtDNA diversity, as obtained from geographically wide samplings but from a small number of individuals per region or breed, has revealed weak geographic correlation and high degree of haplotype sharing between very distant breeds. We aimed at a more detailed picture through extensive sampling (n = 143) of four Portuguese autochthonous breeds – Castro Laboreiro Dog, Serra da Estrela Mountain Dog, Portuguese Sheepdog and Azores Cattle Dog-and comparatively reanalysing published worldwide data. Results Fifteen haplotypes belonging to four major haplogroups were found in these breeds, of which five are newly reported. The Castro Laboreiro Dog presented a 95% frequency of a new A haplotype, while all other breeds contained a diverse pool of existing lineages. The Serra da Estrela Mountain Dog, the most heterogeneous of the four Portuguese breeds, shared haplotypes with the other mainland breeds, while Azores Cattle Dog shared no haplotypes with the other Portuguese breeds. A review of mtDNA haplotypes in dogs across the world revealed that: (a) breeds tend to display haplotypes belonging to different haplogroups; (b) haplogroup A is present in all breeds, and even uncommon haplogroups are highly dispersed among breeds and continental areas; (c) haplotype sharing between breeds of the same region is lower than between breeds of different regions and (d) genetic distances between breeds do not correlate with geography. Conclusion MtDNA haplotype sharing occurred between Serra da Estrela Mountain dogs (with putative origin in the centre of Portugal) and two breeds in the north and south of the country-with the Castro Laboreiro Dog (which behaves, at the mtDNA level, as a sub-sample of the Serra da Estrela Mountain Dog) and the southern Portuguese Sheepdog. In contrast, the Azores Cattle Dog did not share any haplotypes with the other Portuguese breeds, but with dogs sampled in Northern Europe. This suggested that the Azores Cattle Dog descended maternally from Northern European dogs rather than Portuguese mainland dogs. A review of published mtDNA haplotypes identified thirteen non-Portuguese breeds with sufficient data for comparison. Comparisons between these thirteen breeds, and the four Portuguese breeds, demonstrated widespread haplotype sharing, with the greatest diversity among Asian dogs, in accordance with the central role of Asia in canine domestication. PMID:15972107

Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Jisen; Sharma, Anupma; Yu, Qingyi

Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can be used for identifying the origin of S. spontaneum and S. officinarum haplotype in Saccharum hybrids. Comparison of exon splitting among the homologous haplotypes suggested that the genome rearrangements in Saccharum hybrids S. officinarum would be sufficient for proper genome assembly of this autopolyploid genome. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence may allow sequencing and assembling the autopolyploid Saccharum genomes and the auto-allopolyploid hybrid genomes using whole genome shotgun sequencing.« less

Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum

DOE PAGES

Zhang, Jisen; Sharma, Anupma; Yu, Qingyi; ...

2016-06-10

Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can be used for identifying the origin of S. spontaneum and S. officinarum haplotype in Saccharum hybrids. Comparison of exon splitting among the homologous haplotypes suggested that the genome rearrangements in Saccharum hybrids S. officinarum would be sufficient for proper genome assembly of this autopolyploid genome. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence may allow sequencing and assembling the autopolyploid Saccharum genomes and the auto-allopolyploid hybrid genomes using whole genome shotgun sequencing.« less

The influence of H-2 genetic factors on the development of benign monoclonal gammopathy in ageing H-2 congenic C57BL and BALB mice.

PubMed Central

van den Akker, T W; Tio-Gillen, A P; Benner, R; Zurcher, C; Radl, J

1987-01-01

The role of H-2 genetic factors in the development of benign monoclonal gammopathy (BMG) was investigated in six H-2 congenic C57BL and BALB strains (C57BL/10.ScSn and BALB.B: H-2b; B10.D2 and BALB/c: H-2d; B10.BR and BALB.K: H-2k) during ageing. The frequencies of homogeneous immunoglobulins (H-Ig), both single and multiple, in the three C57BL strains were higher than those in the corresponding three BALB strains. No relationship was found with a particular H-2 haplotype. The most frequent H-Ig isotype within the C57BL strains was IgG2a, within BALB.B and BALB.K mice IgG3 and in BALB/c mice IgG1. Categorization of the monoclonal gammopathies (MG) on the basis of their origin showed a single transient monoclonal B-cell proliferation in 2-5% and 3-9% of the C57BL and BALB mice positive for H-Ig, respectively. Multiple myeloma or B-cell lymphoma were found to be responsible for about 1% of the paraproteinaemias in all strains. Persistent, non-progressive MG, most likely BMG, was detected in 70-81% and 39-46% of the C57BL and BALB mice positive for H-Ig, respectively. The remaining 14-24% and 50-58% of the, respectively, C57BL and BALB mice positive for H-Ig could not be evaluated in time. The H-2 haplotypes under investigation were not associated with the onset, occurrence, multiplicity, persistence or isotype of the MG developing in these H-2 congenic C57BL and BALB strains during ageing. PMID:3443448

Genetic differences in the two main groups of the Japanese population based on autosomal SNPs and haplotypes.

PubMed

Yamaguchi-Kabata, Yumi; Tsunoda, Tatsuhiko; Kumasaka, Natsuhiko; Takahashi, Atsushi; Hosono, Naoya; Kubo, Michiaki; Nakamura, Yusuke; Kamatani, Naoyuki

2012-05-01

Although the Japanese population has a rather low genetic diversity, we recently confirmed the presence of two main clusters (the Hondo and Ryukyu clusters) through principal component analysis of genome-wide single-nucleotide polymorphism (SNP) genotypes. Understanding the genetic differences between the two main clusters requires further genome-wide analyses based on a dense SNP set and comparison of haplotype frequencies. In the present study, we determined haplotypes for the Hondo cluster of the Japanese population by detecting SNP homozygotes with 388,591 autosomal SNPs from 18,379 individuals and estimated the haplotype frequencies. Haplotypes for the Ryukyu cluster were inferred by a statistical approach using the genotype data from 504 individuals. We then compared the haplotype frequencies between the Hondo and Ryukyu clusters. In most genomic regions, the haplotype frequencies in the Hondo and Ryukyu clusters were very similar. However, in addition to the human leukocyte antigen region on chromosome 6, other genomic regions (chromosomes 3, 4, 5, 7, 10 and 12) showed dissimilarities in haplotype frequency. These regions were enriched for genes involved in the immune system, cell-cell adhesion and the intracellular signaling cascade. These differentiated genomic regions between the Hondo and Ryukyu clusters are of interest because they (1) should be examined carefully in association studies and (2) likely contain genes responsible for morphological or physiological differences between the two groups.

Two families from New England with usher syndrome type IC with distinct haplotypes.

PubMed

DeAngelis, M M; McGee, T L; Keats, B J; Slim, R; Berson, E L; Dryja, T P

2001-03-01

To search for patients with Usher syndrome type IC among those with Usher syndrome type I who reside in New England. Genotype analysis of microsatellite markers closely linked to the USH1C locus was done using the polymerase chain reaction. We compared the haplotype of our patients who were homozygous in the USH1C region with the haplotypes found in previously reported USH1C Acadian families who reside in southwestern Louisiana and from a single family residing in Lebanon. Of 46 unrelated cases of Usher syndrome type I residing in New England, two were homozygous at genetic markers in the USH1C region. Of these, one carried the Acadian USH1C haplotype and had Acadian ancestors (that is, from Nova Scotia) who did not participate in the 1755 migration of Acadians to Louisiana. The second family had a haplotype that proved to be the same as that of a family with USH1C residing in Lebanon. Each of the two families had haplotypes distinct from the other. This is the first report that some patients residing in New England have Usher syndrome type IC. Patients with Usher syndrome type IC can have the Acadian haplotype or the Lebanese haplotype compatible with the idea that at least two independently arising pathogenic mutations have occurred in the yet-to-be identified USH1C gene.

Factor IX gene haplotypes in Amerindians.

PubMed

Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S

1997-02-01

We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.

Spatial and temporal distribution of the neutral polymorphisms in the last ZFX intron: analysis of the haplotype structure and genealogy.

PubMed Central

Jaruzelska, J; Zietkiewicz, E; Batzer, M; Cole, D E; Moisan, J P; Scozzari, R; Tavaré, S; Labuda, D

1999-01-01

With 10 segregating sites (simple nucleotide polymorphisms) in the last intron (1089 bp) of the ZFX gene we have observed 11 haplotypes in 336 chromosomes representing a worldwide array of 15 human populations. Two haplotypes representing 77% of all chromosomes were distributed almost evenly among four continents. Five of the remaining haplotypes were detected in Africa and 4 others were restricted to Eurasia and the Americas. Using the information about the ancestral state of the segregating positions (inferred from human-great ape comparisons), we applied coalescent analysis to estimate the age of the polymorphisms and the resulting haplotypes. The oldest haplotype, with the ancestral alleles at all the sites, was observed at low frequency only in two groups of African origin. Its estimated age of 740 to 1100 kyr corresponded to the time to the most recent common ancestor. The two most frequent worldwide distributed haplotypes were estimated at 550 to 840 and 260 to 400 kyr, respectively, while the age of the continentally restricted polymorphisms was 120 to 180 kyr and smaller. Comparison of spatial and temporal distribution of the ZFX haplotypes suggests that modern humans diverged from the common ancestral stock in the Middle Paleolithic era. Subsequent range expansion prevented substantial gene flow among continents, separating African groups from populations that colonized Eurasia and the New World. PMID:10388827

Spatial and temporal distribution of the neutral polymorphisms in the last ZFX intron: analysis of the haplotype structure and genealogy.

PubMed

Jaruzelska, J; Zietkiewicz, E; Batzer, M; Cole, D E; Moisan, J P; Scozzari, R; Tavaré, S; Labuda, D

1999-07-01

With 10 segregating sites (simple nucleotide polymorphisms) in the last intron (1089 bp) of the ZFX gene we have observed 11 haplotypes in 336 chromosomes representing a worldwide array of 15 human populations. Two haplotypes representing 77% of all chromosomes were distributed almost evenly among four continents. Five of the remaining haplotypes were detected in Africa and 4 others were restricted to Eurasia and the Americas. Using the information about the ancestral state of the segregating positions (inferred from human-great ape comparisons), we applied coalescent analysis to estimate the age of the polymorphisms and the resulting haplotypes. The oldest haplotype, with the ancestral alleles at all the sites, was observed at low frequency only in two groups of African origin. Its estimated age of 740 to 1100 kyr corresponded to the time to the most recent common ancestor. The two most frequent worldwide distributed haplotypes were estimated at 550 to 840 and 260 to 400 kyr, respectively, while the age of the continentally restricted polymorphisms was 120 to 180 kyr and smaller. Comparison of spatial and temporal distribution of the ZFX haplotypes suggests that modern humans diverged from the common ancestral stock in the Middle Paleolithic era. Subsequent range expansion prevented substantial gene flow among continents, separating African groups from populations that colonized Eurasia and the New World.

Mineralocorticoid receptor haplotype moderates the effects of oral contraceptives and menstrual cycle on emotional information processing.

PubMed

Hamstra, Danielle A; de Kloet, E Ronald; Tollenaar, Marieke; Verkuil, Bart; Manai, Meriem; Putman, Peter; Van der Does, Willem

2016-10-01

The processing of emotional information is affected by menstrual cycle phase and by the use of oral contraceptives (OCs). The stress hormone cortisol is known to affect emotional information processing via the limbic mineralocorticoid receptor (MR). We investigated in an exploratory study whether the MR-genotype moderates the effect of both OC-use and menstrual cycle phase on emotional cognition. Healthy premenopausal volunteers (n=93) of West-European descent completed a battery of emotional cognition tests. Forty-nine participants were OC users and 44 naturally cycling, 21 of whom were tested in the early follicular (EF) and 23 in the mid-luteal (ML) phase of the menstrual cycle. In MR-haplotype 1/3 carriers, ML women gambled more than EF women when their risk to lose was relatively small. In MR-haplotype 2, ML women gambled more than EF women, regardless of their odds of winning. OC-users with MR-haplotype 1/3 recognised fewer facial expressions than ML women with MR-haplotype 1/3. MR-haplotype 1/3 carriers may be more sensitive to the influence of their female hormonal status. MR-haplotype 2 carriers showed more risky decision-making. As this may reflect optimistic expectations, this finding may support previous observations in female carriers of MR-haplotype 2 in a naturalistic cohort study. © The Author(s) 2016.

A TNF region haplotype offers protection from typhoid fever in Vietnamese patients

PubMed Central

2009-01-01

The genomic region surrounding the TNF locus on human chromosome 6 has previously been associated with typhoid fever in Vietnam. We used a haplotypic approach to understand this association further. Eighty single nucleotide polymorphisms (SNPs) spanning a 150 kb region were genotyped in 95 Vietnamese individuals (typhoid case/mother/father trios). A subset of data from 33 SNPs with a minor allele frequency of >4.3% was used to construct haplotypes. Fifteen SNPs, which tagged the 42 constructed haplotypes were selected. The haplotype tagging SNPs (T1-T15) were genotyped in 380 confirmed typhoid cases and 380 Vietnamese ethnically matched controls. Allelic frequencies of seven SNPs (T1, T2, T3, T5, T6, T7, T8) were significantly different between typhoid cases and controls. Logistic regression results support the hypothesis that there is just one signal associated with disease at this locus. Haplotype-based analysis of the tag SNPs provided positive evidence of association with typhoid (posterior probability 0.821). The analysis highlighted a low-risk cluster of haplotypes that each carry the minor allele of T1 or T7, but not both, and otherwise carry the combination of alleles *12122*1111 at T1-T11, further supporting the one associated signal hypothesis. Finally, individuals that carry the typhoid fever protective haplotype *12122*1111 also produce a relatively low TNF-α response to LPS. PMID:17503085

Mineralocorticoid receptor haplotypes sex-dependently moderate depression susceptibility following childhood maltreatment.

PubMed

Vinkers, Christiaan H; Joëls, Marian; Milaneschi, Yuri; Gerritsen, Lotte; Kahn, René S; Penninx, Brenda W J H; Boks, Marco P M

2015-04-01

The MR is an important regulator of the hypothalamic-pituitary-adrenal (HPA) axis and a prime target for corticosteroids. There is increasing evidence from both clinical and preclinical studies that the MR has different effects on behavior and mood in males and females. To investigate the hypothesis that the MR sex-dependently influences the relation between childhood maltreatment and depression, we investigated three common and functional MR haplotypes (GA, CA, and CG haplotype, based on rs5522 and rs2070951) in a population-based cohort (N = 665) and an independent clinical cohort from the Netherlands Study of Depression and Anxiety (NESDA) (N = 1639). The CA haplotype sex-dependently moderated the relation between childhood maltreatment and depressive symptoms both in the population-based sample (sex × maltreatment × haplotype: β = -4.07, P = 0.029) and in the clinical sample (sex × maltreatment × haplotype, β = -2.40, P = 0.011). Specifically, female individuals in the population-based sample were protected (β = -4.58, P = 2.0 e(-5)), whereas males in the clinical sample were at increased risk (β = 2.54, P = 0.0022). In line with these results, female GA haplotype carriers displayed increased vulnerability in the population-based sample (β = 4.58, P = 7.5 e(-5)) whereas male CG-carriers showed increased resilience in the clinical sample (β = -2.71, P = 0.016). Consistently, we found a decreased lifetime MDD risk for male GA haplotype carriers following childhood maltreatment but an increased risk for male CA haplotype carriers in the clinical sample. In both samples, sex-dependent effects were observed for GA-GA diplotype carriers. In summary, sex plays an important role in determining whether functional genetic variation in MR is beneficial or detrimental, with an apparent female advantage for the CA haplotype but male advantage for the GA and CG haplotype. These sex-dependent effects of MR on depression susceptibility following childhood maltreatment are relevant in light of the increased prevalence of mood disorders in women and point to a sex-specific role of MR in the etiology of depression following childhood maltreatment. Copyright © 2015 Elsevier Ltd. All rights reserved.

Taxonomic revision and phylogenetic analyses of rubber powdery mildew fungi.

PubMed

Liyanage, K K; Khan, Sehroon; Brooks, Siraprapa; Mortimer, Peter E; Karunarathna, Samantha C; Xu, Jianchu; Hyde, Kevin D

2017-04-01

Powdery mildew is a fungal disease that infects a wide range of plants, including rubber trees, which results in a reduction of latex yields of up to 45%. The causal agent of powdery mildew of rubber was first described as Oidium heveae, but later morpho-molecular research suggested that in the past, O. heveae has been confused with Erysiphe quercicola. However, it is still under debate whether the causal agent should be classified as a species of the genus Erysiphe emend. or Golovinomyces and Podosphaera, respectively. Therefore, the aim of this study was to undertake the morpho-molecular characterization of powdery mildew species associated with rubber trees, thus resolving these taxonomic issues. Morphological observation under light and scanning electron microscopes (SEM) clearly identified two morphotypes of the rubber powdery mildew. With the support of morphological and phylogenetic data, one of the two morphotypes was identified as the asexual morph of E. quercicola, while the second morphotype is still insufficiently known and according to the morphological results obtained we assume that it might belong to the genus Golovinomyces. More collections and additional molecular data are required for final conclusions regarding the exact taxonomic position of the second morphotype of rubber powdery mildew and its relation to the name O. heveae. The haplotype analysis identified eight haplotype groups of E. quercicola indicating the high genetic diversity of the species. Copyright © 2017 Elsevier Ltd. All rights reserved.

Biological impact of α genes, β haplotypes, and G6PD activity in sickle cell anemia at baseline and with hydroxyurea

PubMed Central

Arnaud, Cécile; Kamdem, Annie; Hau, Isabelle; Lelong, Françoise; Epaud, Ralph; Pondarré, Corinne; Pissard, Serge

2018-01-01

Sickle cell anemia (SCA), albeit monogenic, has heterogeneous phenotypic expression, mainly related to the level of hemoglobin F (HbF). No large cohort studies have ever compared biological parameters in patients with major β-globin haplotypes; ie, Senegal (SEN), Benin (BEN), and Bantu/Central African Republic (CAR). The aim of this study was to evaluate the biological impact of α genes, β haplotypes, and glucose-6-phosphate dehydrogenase (G6PD) activity at baseline and with hydroxyurea (HU). Homozygous HbS patients from the Créteil pediatric cohort with available α-gene and β-haplotype data were included (n = 580; 301 females and 279 males) in this retrospective study. Homozygous β-haplotype patients represented 74% of cases (37.4% CAR/CAR, 24.3% BEN/BEN, and 12.1% SEN/SEN). HU was given to 168 cohort SCA children. Hematological parameters were recorded when HbF was maximal, and changes (ΔHU-T0) were calculated. At baseline, CAR-haplotype and α-gene numbers were independently and negatively correlated with Hb and positively correlated with lactate dehydrogenase. HbF was negatively correlated with CAR-haplotype numbers and positively with BEN- and SEN-haplotype numbers. The BCL11A/rs1427407 “T” allele, which is favorable for HbF expression, was positively correlated with BEN- and negatively correlated with CAR-haplotype numbers. With HU treatment, Δ and HbF values were positively correlated with the BEN-haplotype number. BEN/BEN patients had higher HbF and Hb levels than CAR/CAR and SEN/SEN patients. In conclusion, we show that BEN/BEN patients have the best response on HU and suggest that this could be related to the higher prevalence of the favorable BCL11A/rs1427407/T/allele for HbF expression in these patients. PMID:29555644

A comprehensive literature review of haplotyping software and methods for use with unrelated individuals.

PubMed

Salem, Rany M; Wessel, Jennifer; Schork, Nicholas J

2005-03-01

Interest in the assignment and frequency analysis of haplotypes in samples of unrelated individuals has increased immeasurably as a result of the emphasis placed on haplotype analyses by, for example, the International HapMap Project and related initiatives. Although there are many available computer programs for haplotype analysis applicable to samples of unrelated individuals, many of these programs have limitations and/or very specific uses. In this paper, the key features of available haplotype analysis software for use with unrelated individuals, as well as pooled DNA samples from unrelated individuals, are summarised. Programs for haplotype analysis were identified through keyword searches on PUBMED and various internet search engines, a review of citations from retrieved papers and personal communications, up to June 2004. Priority was given to functioning computer programs, rather than theoretical models and methods. The available software was considered in light of a number of factors: the algorithm(s) used, algorithm accuracy, assumptions, the accommodation of genotyping error, implementation of hypothesis testing, handling of missing data, software characteristics and web-based implementations. Review papers comparing specific methods and programs are also summarised. Forty-six haplotyping programs were identified and reviewed. The programs were divided into two groups: those designed for individual genotype data (a total of 43 programs) and those designed for use with pooled DNA samples (a total of three programs). The accuracy of programs using various criteria are assessed and the programs are categorised and discussed in light of: algorithm and method, accuracy, assumptions, genotyping error, hypothesis testing, missing data, software characteristics and web implementation. Many available programs have limitations (eg some cannot accommodate missing data) and/or are designed with specific tasks in mind (eg estimating haplotype frequencies rather than assigning most likely haplotypes to individuals). It is concluded that the selection of an appropriate haplotyping program for analysis purposes should be guided by what is known about the accuracy of estimation, as well as by the limitations and assumptions built into a program.

Phylogeography and connectivity of molluscan parasites: Perkinsus spp. in Panama and beyond.

PubMed

Pagenkopp Lohan, Katrina M; Hill-Spanik, Kristina M; Torchin, Mark E; Fleischer, Robert C; Carnegie, Ryan B; Reece, Kimberly S; Ruiz, Gregory M

2018-02-01

Panama is a major hub for commercial shipping between two oceans, making it an ideal location to examine parasite biogeography, potential invasions, and the spread of infectious agents. Our goals were to (i) characterise the diversity and genetic connectivity of Perkinsus spp. haplotypes across the Panamanian Isthmus and (ii) combine these data with sequences from around the world to evaluate the current phylogeography and genetic connectivity of these widespread molluscan parasites. We collected 752 bivalves from 12 locations along the coast of Panama including locations around the Bocas del Toro archipelago and the Caribbean and Pacific entrances to the Panama Canal, from December 2012 to February 2013. We used molecular genetic methods to screen for Perkinsus spp. and obtained internal transcribed spacer region (ITS) ribosomal DNA (rDNA) sequences for all positive samples. Our sequence data were used to evaluate regional haplotype diversity and distribution across both coasts of Panama, and were then combined with publicly available sequences to create global haplotype networks. We found 26 ITS haplotypes from four Perkinsus spp. (1-12 haplotypes per species) in Panama. Perkinsus beihaiensis haplotypes had the highest genetic diversity, were the most regionally widespread, and were associated with the greatest number of hosts. On a global scale, network analyses demonstrated that some haplotypes found in Panama were cosmopolitan (Perkinsus chesapeaki, Perkinsus marinus), while others were more geographically restricted (Perkinsus olseni, P. beihaiensis), indicating different levels of genetic connectivity and dispersal. We found some Perkinsus haplotypes were shared across the Isthmus of Panama and several regions around the world, including across ocean basins. We also found that haplotype diversity is currently underestimated and directly related to the number of sequences. Nevertheless, our results demonstrate long-range dispersal and global connectivity for many haplotypes, suggesting that dispersal through shipping probably contributes to these biogeographical patterns. Published by Elsevier Ltd.

Variation in the prion protein sequence in Dutch goat breeds.

PubMed

Windig, J J; Hoving, R A H; Priem, J; Bossers, A; van Keulen, L J M; Langeveld, J P M

2016-10-01

Scrapie is a neurodegenerative disease occurring in goats and sheep. Several haplotypes of the prion protein increase resistance to scrapie infection and may be used in selective breeding to help eradicate scrapie. In this study, frequencies of the allelic variants of the PrP gene are determined for six goat breeds in the Netherlands. Overall frequencies in Dutch goats were determined from 768 brain tissue samples in 2005, 766 in 2008 and 300 in 2012, derived from random sampling for the national scrapie surveillance without knowledge of the breed. Breed specific frequencies were determined in the winter 2013/2014 by sampling 300 breeding animals from the main breeders of the different breeds. Detailed analysis of the scrapie-resistant K222 haplotype was carried out in 2014 for 220 Dutch Toggenburger goats and in 2015 for 942 goats from the Saanen derived White Goat breed. Nine haplotypes were identified in the Dutch breeds. Frequencies for non-wild type haplotypes were generally low. Exception was the K222 haplotype in the Dutch Toggenburger (29%) and the S146 haplotype in the Nubian and Boer breeds (respectively 7 and 31%). The frequency of the K222 haplotype in the Toggenburger was higher than for any other breed reported in literature, while for the White Goat breed it was with 3.1% similar to frequencies of other Saanen or Saanen derived breeds. Further evidence was found for the existence of two M142 haplotypes, M142 /S240 and M142 /P240 . Breeds vary in haplotype frequencies but frequencies of resistant genotypes are generally low and consequently selective breeding for scrapie resistance can only be slow but will benefit from animals identified in this study. The unexpectedly high frequency of the K222 haplotype in the Dutch Toggenburger underlines the need for conservation of rare breeds in order to conserve genetic diversity rare or absent in other breeds. © 2016 Blackwell Verlag GmbH.

Contribution of HLA-A/B/C/DRB1/DQB1 common haplotypes to donor search outcome in unrelated hematopoietic stem cell transplantation.

PubMed

Pédron, Béatrice; Guérin-El Khourouj, Valérie; Dalle, Jean-Hugues; Ouachée-Chardin, Marie; Yakouben, Karima; Corroyez, France; Auvrignon, Anne; Petit, Arnaud; Landman-Parker, Judith; Leverger, Guy; Baruchel, André; Sterkers, Ghislaine

2011-11-01

In unrelated hematopoietic stem cell transplantation (HSCT), the prediction of donor search outcome at the time of search initiation is of great value for the physicians to delineate the strategy of patient care. The probability of finding an unrelated donor is high for patients who carry at least 1 of the 10 most common HLA haplotypes in Caucasians. As only 10% to 20% patients respond to this criterion, here we aimed at finding additional common haplotypes to improve the prediction of a successful search. HLA broad HLA-A/B/DRB1 haplotypes that were observed with frequencies ≥0.19% in patient families of European origin and that split into ≤2 predominant 4-digit HLA-A/B/C/DRB1/DQB1 haplotypes were considered as common. Carriage of at least 1 of those in 168 patients of various geographic areas with no family donor was confronted to the chance of finding ≥9/10 HLA-matched unrelated donors. Fifty common 4-digit haplotypes were identified. A higher (P < 5 × 10(-6)) chance of finding a suitable donor was found for 55 of 170 (32%) recipients that carried at least 1 of these common haplotypes. Up to now, estimates classified patients into ≥3 groups of probability with ≥1 intermediate group of poor utility for the clinicians. Considering carriage of these common haplotypes together with the frequencies of alleles and of B/C and DRB1/DQB1 associations, which are carried by patient HLA haplotypes, we could classify the patients into 2 groups of probability with a 98% and 26% chance of finding a donor, respectively. Prediction of search outcome could be improved by including the 50 most common HLA haplotypes in the current approaches. Copyright © 2011 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.

Association between platelet P2Y12 haplotype and risk of cardiovascular events in chronic coronary disease.

PubMed

Schettert, Isolmar T; Pereira, Alexandre C; Lopes, Neuza H; Hueb, Whady A; Krieger, Jose E

2006-01-01

A positive association was recently described between P2Y12 platelet receptor H1 and H2 haplotypes and peripheral artery disease. We tested the described P2Y12 receptor haplotypes in a group of patients with coronary artery disease. The P2Y12 platelet receptor H1 and H2 haplotypes was tested in a group of 540 patients enrolled in the Medical, Angioplasty, or Surgery Study II (MASS II), a randomized trial comparing treatments for patients with coronary artery disease (CAD) and preserved left ventricular function. After a 3-year follow-up period, the incidence of the composite end point of cardiac death, myocardial infarction, and refractory angina requiring revascularization was determined in the H1/H1, H1/H2 and H2/H2 haplotype groups. We used Student's t-test and the chi-square test to analyze the differences among groups and Kaplan-Meier method to calculate survival curves. Risk was assessed with the use of a Cox proportional-hazards model. The frequency of haplotypes among studied patients were 410 (75.9%) H1/H1, 119 (22.0%) H1/H2 and 11 (2.1%) H2/H2. The baseline clinical characteristics, mean clinical follow-up time and received treatment of each genotype group were similar. We did not disclose any association between haplotype groups regarding the incidence of any of the studied cardiovascular end-points. This is the first report studying the association of P2Y12 platelet receptor H1 and H2 haplotype and cardiovascular events. Our findings do not provide evidence for a strong association between H1/H1 and H1/H2 haplotypes and a increased risk of cardiovascular events in a population with CAD. Future works should address the role of the H2/H2 haplotype as a genetic marker for cardiovascular events.

Association of KIR genotypes and haplotypes with susceptibility to chronic hepatitis B virus infection in Chinese Han population.

PubMed

Lu, Zhiming; Zhang, Bingchang; Chen, Shijun; Gai, Zhongtao; Feng, Zhaolei; Liu, Xiangdong; Liu, Yiqing; Wen, Xin; Li, Li; Jiao, Yulian; Ma, Chunyan; Shao, Song; Cui, Xiangfa; Chen, Guojian; Li, Jianfeng; Zhao, Yueran

2008-12-01

Killer immunoglobulin-like receptor (KIR) genes can regulate the activation of NK and T cells upon interaction with HLA class I molecules. Hepatitis B virus (HBV) infection has been regarded as a multi-factorial disorder disease. Previous studies revealed that KIRs were involved in HCV and HIV infection or clearance. The aim of this study was to explore the possibility of the inheritance of KIR genotypes and haplotypes as a candidate for susceptibility to persistent HBV infection or HBV clearance. The sequence specific primer polymerase chain reaction (SSP-PCR) was employed to identify the KIR genes and pseudogenes in 150 chronic hepatitis B (CHB) patients, 251 spontaneously recovered (SR) controls, and 412 healthy controls. The frequencies of genotype G, M, FZ1 increased in CHB patients compared with healthy control subjects. The frequency of genotype AH was higher in SR controls than that in both CHB patients and healthy controls. The carriage frequencies of genotype G and AH were higher; while, the frequencies of AF and AJ were lower in SR controls than those in healthy control subjects. The frequency of A haplotype was lower, whereas, the frequency of B haplotype was higher in CHB patients and SR controls than those in healthy controls. In healthy controls, haplotype 4 was found lower compared with that in CHB patients and SR controls and the frequency of haplotype 5 was higher in SR controls than that in other two groups. Based on these findings, it seems that the genotypes M and FZ1 are HBV susceptive genotypes; AH, on the other hand, may be protective genotypes that facilitate the clearance of HBV. It appears that the haplotype 4 is HBV susceptive haplotype, whereas, haplotype 5 may be the protective haplotype that facilitates the clearance of HBV.

Impacts of TNF-LTA SNPs/Haplotypes and Lifestyle Factors on Oral Carcinoma in an Indian Population.

PubMed

Bandil, Kapil; Singhal, Pallavi; Sharma, Upma; Hussain, Showket; Basu, Surojit; Parashari, Aditya; Singh, Veena; Sehgal, Ashok; Shivam, Animesh; Ahuja, Puneet; Bharadwaj, Mausumi; Banerjee, Basu Dev; Mehrotra, Ravi

2016-10-01

To investigate a potential association between single-nucleotide polymorphisms (SNPs) and  haplotypes at the TNFA-LTA locus and the development of oral cancer in an Indian population. In this study, 150 oral precancer/cancer samples (50 precancer and 100 cancer), along with an equal number of control samples, were genotyped. Six SNPs at the TNF-LTA locus (i.e., -238G/A, -308G/A, -857C/T, -863C/A, -1031T/C, and +252A/G) were analyzed by use of a polymerase chain reaction-restriction fragment length polymorphism method, the assay was validated by sequencing 10 % of samples. The allelic frequencies of TNFA and LTA SNPs were found to be significantly associated with the risk of oral cancer and precancerous lesions in comparison with controls (P < 0.0003). Further haplotypic analysis showed that two haplotypes (ATCTGG and ACACGG) served as risk haplotypes for oral cancer. These haplotypes were also found to be significantly and positively associated with lifestyle habits (tobacco chewing P = 0.04, odds ratio [OR] 3.4) and socioeconomic status (P = 0.01, OR 3.4). We noticed an increased percentage of risk haplotypes correlating with the aggressiveness of oral cancer. The percentages of risk haplotypes were found to be threefold higher in precancer and fourfold higher in advanced stages of oral cancer in comparison with controls. Five SNPs at the TNF-LTA locus (i.e., -308G>A, -857C>T, -863C>A, -1031T>C, and +252A>G) were found to be associated with the development of oral cancer. Two haplotypes (ATCTGG and ACACGG) emerged as major risk haplotypes for oral carcinoma progression and were also found to be associated with lifestyle factors and clinical aggressiveness. These findings make the TNF-LTA locus a suitable candidate for a future biomarker, which may be used either for early detection or for helping to improve treatment efficacy and effectiveness.

Molecular tracing of confiscated pangolin scales for conservation and illegal trade monitoring in Southeast Asia

USGS Publications Warehouse

Zhang, Huarong; Miller, Mark P.; Yang, Feng; Chan, Hon Ki; Gaubert, Philippe; Ades, Gary; Fischer, Gunter A

2015-01-01

Despite being protected by both international and national regulations, pangolins are threatened by illegal trade. Here we report mitochondrial DNA identification and haplotype richness estimation, using 239 pangolin scale samples from two confiscations in Hong Kong. We found a total of 13 genetically distinct cytochrome c oxidase I (COI) haplotypes in two confiscations (13 and ten haplotypes respectively, with ten shared haplotypes between confiscations). These haplotypes clustered in two distinct clades with one clade representing the Sunda pangolin (Manisjavanica). The other clade did not match with any known Asian pangolin sequences, and likely represented a cryptic pangolin lineage in Asia. By fitting sample coverage and rarefaction/regression models to our sample data, we predicted that the total number of COI haplotypes in two confiscations were 14.86 and 11.06 respectively, suggesting that our sampling caught the majority of haplotypes and that we had adequately characterized each confiscation. We detected substantial sequence divergence among the seized scales, likely evidencing that the Sunda pangolins were harvested over wide geographical areas across Southeast Asia. Our study illustrates the value of applying DNA forensics for illegal wildlife trade monitoring.

Whole-loop mitochondrial DNA D-loop sequence variability in Egyptian Arabian equine matrilines

PubMed Central

Hudson, William

2017-01-01

Background Egyptian Arabian horses have been maintained in a state of genetic isolation for over a hundred years. There is only limited genetic proof that the studbook records of female lines of Egyptian Arabian pedigrees are reliable. This study characterized the mitochondrial DNA (mtDNA) signatures of 126 horses representing 14 matrilines in the Egyptian Agricultural Organization (EAO) horse-breeding program. Findings Analysis of the whole D-loop sequence yielded additional information compared to hypervariable region-1 (HVR1) analysis alone, with 42 polymorphic sites representing ten haplotypes compared to 16 polymorphic sites representing nine haplotypes, respectively. Most EAO haplotypes belonged to ancient haplogroups, suggesting origin from a wide geographical area over many thousands of years, although one haplotype was novel. Conclusions Historical families share haplotypes and some individuals from different strains belonged to the same haplogroup: the classical EAO strain designation is not equivalent to modern monophyletic matrilineal groups. Phylogenetic inference showed that the foundation mares of the historical haplotypes were highly likely to have the same haplotypes as the animals studied (p > 0.998 in all cases), confirming the reliability of EAO studbook records and providing the opportunity for breeders to confirm the ancestry of their horses. PMID:28859174

MHC Class II haplotypes of Colombian Amerindian tribes

PubMed Central

Yunis, Juan J.; Yunis, Edmond J.; Yunis, Emilio

2013-01-01

We analyzed 1041 individuals belonging to 17 Amerindian tribes of Colombia, Chimila, Bari and Tunebo (Chibcha linguistic family), Embera, Waunana (Choco linguistic family), Puinave and Nukak (Maku-Puinave linguistic families), Cubeo, Guanano, Tucano, Desano and Piratapuyo (Tukano linguistic family), Guahibo and Guayabero (Guayabero Linguistic Family), Curripaco and Piapoco (Arawak linguistic family) and Yucpa (Karib linguistic family). for MHC class II haplotypes (HLA-DRB1, DQA1, DQB1). Approximately 90% of the MHC class II haplotypes found among these tribes are haplotypes frequently encountered in other Amerindian tribes. Nonetheless, striking differences were observed among Chibcha and non-Chibcha speaking tribes. The DRB1*04:04, DRB1*04:11, DRB1*09:01 carrying haplotypes were frequently found among non-Chibcha speaking tribes, while the DRB1*04:07 haplotype showed significant frequencies among Chibcha speaking tribes, and only marginal frequencies among non-Chibcha speaking tribes. Our results suggest that the differences in MHC class II haplotype frequency found among Chibcha and non-Chibcha speaking tribes could be due to genetic differentiation in Mesoamerica of the ancestral Amerindian population into Chibcha and non-Chibcha speaking populations before they entered into South America. PMID:23885196

Speckle Interferometry at the Blanco and SOAR Telescopes in 2008 and 2009

NASA Technical Reports Server (NTRS)

Tokovinin, Andrei; Mason, Brian D.; Hartkopf, William I.

2010-01-01

The results of speckle interferometric measurements of binary and multiple stars conducted in 2008 and 2009 at the Blanco and Southern Astrophysical Research (SOAR) 4 m telescopes in Chile are presented. A tot al of 1898 measurements of 1189 resolved pairs or sub-systems and 394 observations of 285 un-resolved targets are listed. We resolved for the first time 48 new pairs, 21 of which are new sub-systems in close visual multiple stars. Typical internal measurement precision is 0.3 mas in both coordinates, typical companion detection capability is delta m approximately 4.2 at 0.15 degree separation. These data were obtained with a new electron-multiplication CCD camera; data processing is described in detail, including estimation of magnitude difference, observational errors, detection limits, and analysis of artifacts. We comment on some newly discovered pairs and objects of special interest.

SPECKLE INTERFEROMETRY AT THE BLANCO AND SOAR TELESCOPES IN 2008 AND 2009

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tokovinin, Andrei; Mason, Brian D.; Hartkopf, William I.

2010-02-15

The results of speckle interferometric measurements of binary and multiple stars conducted in 2008 and 2009 at the Blanco and SOAR 4 m telescopes in Chile are presented. A total of 1898 measurements of 1189 resolved pairs or sub-systems and 394 observations of 285 un-resolved targets are listed. We resolved for the first time 48 new pairs, 21 of which are new sub-systems in close visual multiple stars. Typical internal measurement precision is 0.3 mas in both coordinates, typical companion detection capability is {delta}m {approx} 4.2 at 0.''15 separation. These data were obtained with a new electron-multiplication CCD camera; datamore » processing is described in detail, including estimation of magnitude difference, observational errors, detection limits, and analysis of artifacts. We comment on some newly discovered pairs and objects of special interest.« less

Molecular analysis and association with clinical and laboratory manifestations in children with sickle cell anemia

PubMed Central

Camilo-Araújo, Roberta Faria; Amancio, Olga Maria Silverio; Figueiredo, Maria Stella; Cabanãs-Pedro, Ana Carolina; Braga, Josefina Aparecida Pellegrini

2014-01-01

Objectives To analyze the frequency of βS-globin haplotypes and alpha-thalassemia, and their influence on clinical manifestations and the hematological profile of children with sickle cell anemia. Method The frequency of βS-globin haplotypes and alpha-thalassemia and any association with clinical and laboratorial manifestations were determined in 117 sickle cell anemia children aged 3–71 months. The confirmation of hemoglobin SS and determination of the haplotypes were achieved by polymerase chain reaction-restriction fragment length polymorphism, and alpha-thalassemia genotyping was by multiplex polymerase chain reaction (single-tube multiplex-polymerase chain reaction). Results The genotype distribution of haplotypes was 43 (36.7%) Central African Republic/Benin, 41 (35.0%) Central African Republic/Central African Republic, 20 (17.0%) Rare/atypical, and 13 (11.1%) Benin/Benin. The frequency of the α3.7 deletion was 1.71% as homozygous (−α3.7/−α3.7) and 11.9% as heterozygous (−α3.7/αα). The only significant association in respect to haplotypes was related to the mean corpuscular volume. The presence of alpha-thalassemia was significantly associated to decreases in mean corpuscular volume, mean corpuscular hemoglobin and reticulocyte count and to an increase in the red blood cell count. There were no significant associations of βS-globin haplotypes and alpha-thalassemia with clinical manifestations. Conclusions In the study population, the frequency of alpha-thalassemia was similar to published data in Brazil with the Central African Republic haplotype being the most common, followed by the Benin haplotype. βS-globin haplotypes and interaction between alpha-thalassemia and sickle cell anemia did not influence fetal hemoglobin concentrations or the number of clinical manifestations. PMID:25305165

The "Sardinian" HLA-A30,B18,DR3,DQw2 haplotype constantly lacks the 21-OHA and C4B genes. Is it an ancestral haplotype without duplication?

PubMed

Contu, L; Carcassi, C; Dausset, J

1989-01-01

The C4 and 21-OH loci of the class III HLA have been studied by specific DNA probes and the restriction enzyme Taq 1 in 24 unrelated Sardinian individuals selected from completely HLA-typed families. All 24 individuals had the HLA extended haplotype A30,Cw5,B18, BfF1,DR3,DRw52,DQw2, named "Sardinian" in the present paper because of its frequency of 15% in the Sardinian population. Eighteen of these were homozygous for the entire haplotype, and six were heterozygous at the A locus and blank (or homozygous) at all the other loci. In all completely homozygous cells and in four heterozygous cells at the A locus, the restriction fragments of the 21-OHA (3.2 kb) and C4B (5.8 kb or 5.4 kb) genes were absent, and the fragments of the C4A (7.0 kb) and 21-OHB (3.7 kb) genes were present. It is suggested that the "Sardinian" haplotype is an ancestral haplotype without duplication of the C4 and 21-OH genes, practically always identical in its structure, also in unrelated individuals. The diversity of this haplotype in the class III region (about 30 kb less) may be at least partially responsible for its misalignment with most haplotypes, which have duplicated C4 and 21-OH genes, and therefore also for its decreased probability to recombine. This can help explain its high stability and frequency in the Sardinian population. The same conclusion can be suggested for the Caucasian extended haplotype A1,B8,DR3 that always seems to lack the C4A and 21-OHA genes.

Assessing transmission of ‘Candidatus Liberibacter solanacearum’ haplotypes through seed potato

USDA-ARS?s Scientific Manuscript database

Conflicting data has previously been reported concerning the impact of zebra chip disease transmission through seed tubers. These discrepancies may be due to the experimental design of each study, whereby different pathogen haplotypes, insect vector haplotypes, and potato plant varieties were used....

A new mathematical modeling for pure parsimony haplotyping problem.

PubMed

Feizabadi, R; Bagherian, M; Vaziri, H R; Salahi, M

2016-11-01

Pure parsimony haplotyping (PPH) problem is important in bioinformatics because rational haplotyping inference plays important roles in analysis of genetic data, mapping complex genetic diseases such as Alzheimer's disease, heart disorders and etc. Haplotypes and genotypes are m-length sequences. Although several integer programing models have already been presented for PPH problem, its NP-hardness characteristic resulted in ineffectiveness of those models facing the real instances especially instances with many heterozygous sites. In this paper, we assign a corresponding number to each haplotype and genotype and based on those numbers, we set a mixed integer programing model. Using numbers, instead of sequences, would lead to less complexity of the new model in comparison with previous models in a way that there are neither constraints nor variables corresponding to heterozygous nucleotide sites in it. Experimental results approve the efficiency of the new model in producing better solution in comparison to two state-of-the art haplotyping approaches. Copyright © 2016 Elsevier Inc. All rights reserved.

Mathematical properties and bounds on haplotyping populations by pure parsimony.

PubMed

Wang, I-Lin; Chang, Chia-Yuan

2011-06-01

Although the haplotype data can be used to analyze the function of DNA, due to the significant efforts required in collecting the haplotype data, usually the genotype data is collected and then the population haplotype inference (PHI) problem is solved to infer haplotype data from genotype data for a population. This paper investigates the PHI problem based on the pure parsimony criterion (HIPP), which seeks the minimum number of distinct haplotypes to infer a given genotype data. We analyze the mathematical structure and properties for the HIPP problem, propose techniques to reduce the given genotype data into an equivalent one of much smaller size, and analyze the relations of genotype data using a compatible graph. Based on the mathematical properties in the compatible graph, we propose a maximal clique heuristic to obtain an upper bound, and a new polynomial-sized integer linear programming formulation to obtain a lower bound for the HIPP problem. Copyright © 2011 Elsevier Inc. All rights reserved.

Association between endothelin type A receptor haplotypes and mortality in coronary heart disease.

PubMed

Ellis, Katrina L; Pilbrow, Anna P; Potter, Howard C; Frampton, Chris M; Doughty, Rob N; Whalley, Gillian A; Ellis, Chris J; Palmer, Barry R; Skelton, Lorraine; Yandle, Tim G; Troughton, Richard W; Richards, A Mark; A Cameron, Vicky

2012-05-01

The endothelin type A receptor, encoded by EDNRA, mediates the effects of endothelin-1 to promote vasoconstriction, vascular cell growth, adhesion, fibrosis and thrombosis. We investigated the association between EDNRA haplotype and cardiovascular outcomes in patients with coronary artery disease. Coronary disease patients (n = 1007) were genotyped for the His323His (rs5333) variant and one tag SNP from each of the major EDNRA haplotype blocks (rs6537484, rs1568136, rs5335 and rs10003447). EDNRA haplotype associations with clinical history, natriuretic peptides cardiac function and cardiovascular outcomes were tested over a median 3.8 years. Univariate analysis identified a 'low-risk' EDNRA haplotype associated with later age of Type 2 diabetes onset (p = 0.004) smaller BMI (p = 0.021), and reduced mortality (log rank p = 0.001). Cox proportional hazards analysis including established cardiovascular risk factors revealed an independent association between haplotype and mortality (p < 0.0001). These data highlight the potential importance of the endothelin system, and in particular EDNRA in coronary disease.

Association analysis of the chromosome 4p-located G protein-coupled receptor 78 (GPR78) gene in bipolar affective disorder and schizophrenia.

PubMed

Underwood, S L; Christoforou, A; Thomson, P A; Wray, N R; Tenesa, A; Whittaker, J; Adams, R A; Le Hellard, S; Morris, S W; Blackwood, D H R; Muir, W J; Porteous, D J; Evans, K L

2006-04-01

The orphan G protein-coupled receptor 78 (GPR78) gene lies within a region of chromosome 4p where we have previously shown linkage to bipolar affective disorder (BPAD) in a large Scottish family. GPR78 was screened for single-nucleotide polymorphisms (SNPs) and a linkage disequilibrium map was constructed. Six tagging SNPs were selected and tested for association on a sample of 377 BPAD, 392 schizophrenia (SCZ) and 470 control individuals. Using standard chi(2) statistics and a backwards logistic regression approach to adjust for the effect of sex, SNP rs1282, located approximately 3 kb upstream of the coding region, was identified as a potentially important variant in SCZ (chi(2) P=0.044; LRT P=0.065). When the analysis was restricted to females, the strength of association increased to an uncorrected allele P-value of 0.015 (odds ratios (OR)=1.688, 95% confidence intervals (CI): 1.104-2.581) and uncorrected genotype P-value of 0.015 (OR=5.991, 95% CI: 1.545-23.232). Under the recessive model, the genotype P-value improved further to 0.005 (OR=5.618, 95% CI: 1.460-21.617) and remained significant after correcting for multiple testing (P=0.017). No single-marker association was detected in the SCZ males, in the BPAD individuals or with any other SNP. Haplotype analysis of the case-control samples revealed several global and individual haplotypes, with P-values <0.05, all but one of which contained SNP rs1282. After correcting for multiple testing, two haplotypes remained significant in both the female BPAD individuals (P=0.038 and 0.032) and in the full sample of affected female individuals (P=0.044 and 0.033). Our results provide preliminary evidence for the involvement of GPR78 in susceptibility to BPAD and SCZ in the Scottish population. Molecular Psychiatry (2006) 11, 384-394. doi:10.1038/sj.mp.4001786; published online 3 January 2006.

Linkage Disequilibrium and Haplotype Diversity in the Genes of the Renin–Angiotensin System: Findings From the Family Blood Pressure Program

PubMed Central

Zhu, Xiaofeng; Yan, Denise; Cooper, Richard S.; Luke, Amy; Ikeda, Morna A.; Chang, Yen-Pei C.; Weder, Alan; Chakravarti, Aravinda

2003-01-01

Association studies of candidate genes with complex traits have generally used one or a few single nucleotide polymorphisms (SNPs), although variation in the extent of linkage disequilibrium (LD) within genes markedly influences the sensitivity and precision of association studies. The extent of LD and the underlying haplotype structure for most candidate genes are still unavailable. We sampled 193 blacks (African-Americans) and 160 whites (European-Americans) and estimated the intragenic LD and the haplotype structure in four genes of the renin–angiotensin system. We genotyped 25 SNPs, with all but one of the pairs spaced between 1 and 20 kb, thus providing resolution at small scale. The pattern of LD within a gene was very heterogeneous. Using a robust method to define haplotype blocks, blocks of limited haplotype diversity were identified at each locus; between these blocks, LD was lost owing to the history of recombination events. As anticipated, there was less LD among blacks, the number of haplotypes was substantially larger, and shorter haplotype segments were found, compared with whites. These findings have implications for candidate-gene association studies and indicate that variation between populations of European and African origin in haplotype diversity is characteristic of most genes. [The sequence data described in this paper are available in GenBank under the following accession nos: AGT, MIM 106150; Renin, MIM 179820; ACE, MIM 106180; Angiotensin receptor I, MIM 106165. Supplementary material is available online at http://www.genome.org.] PMID:12566395

Alpha-globin gene haplotypes in South American Indians.

PubMed

Zago, M A; Melo Santos, E J; Clegg, J B; Guerreiro, J F; Martinson, J J; Norwich, J; Figueiredo, M S

1995-08-01

The haplotypes of the alpha-globin gene cluster were determined for 99 Indians from the Brazilian Amazon region who belong to 5 tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Three predominant haplotypes were identified: Ia (present in 38.9% of chromosomes), IIIa (25.8%), and IIe (22.1%). The only alpha-globin gene rearrangement detected was alpha alpha alpha 3.7 I gene triplication associated with haplotype IIIa, found in high frequencies (5.6% and 10.6%) in two tribes and absent in the others. alpha-Globin gene deletions that cause alpha-thalassemia were not seen, supporting the argument that malaria was absent in these populations until recently. The heterogeneous distribution of alpha-globin gene haplotypes and rearrangements among the different tribes differs markedly from the homogeneous distribution of beta-globin gene cluster haplotypes and reflects the action of various genetic mechanisms (genetic drift, founder effect, consanguinity) on small isolated population groups with a complicated history of divergence-fusion events. The alpha-globin gene haplotype distribution has some similarities to distributions observed in Southeast Asian and Pacific Island populations, indicating that these populations have considerable genetic affinities. However, the absence of several features of the alpha-globin gene cluster that are consistently present among the Pacific Islanders suggests that the similarity of haplotypes between Brazilian Indians and people from Polynesia, Micronesia, and Melanesia is more likely to result of ancient common ancestry rather than the consequence of recent direct genetic contribution through immigration.

Tryptophan Hydroxylase 2 haplotype association with borderline personality disorder and aggression in a sample of patients with personality disorders and healthy controls

PubMed Central

Perez-Rodriguez, M. Mercedes; Weinstein, Shauna; New, Antonia S.; Bevilacqua, Laura; Yuan, Qiaoping; Zhou, Zhifeng; Hodgkinson, Colin; Goodman, Marianne; Koenigsberg, Harold W.; Goldman, David; Siever, Larry J.

2010-01-01

Background There is decreased serotonergic function in impulsive aggression and borderline personality disorder (BPD), and genetic association studies suggest a role of serotonergic genes in impulsive aggression and BPD. Only one study has analyzed the association between the tryptophan-hydroxylase 2 (TPH2) gene and BPD. A TPH2 “risk” haplotype has been described that is associated with anxiety, depression and suicidal behavior. Methods We assessed the relationship between the previously identified “risk” haplotype at the TPH2 locus and BPD diagnosis, impulsive aggression, affective lability, and suicidal/parasuicidal behaviors, in a well-characterized clinical sample of 103 healthy controls (HCs) and 251 patients with personality disorders (109 with BPD). A logistic regression including measures of depression, affective lability and aggression scores in predicting “risk” haplotype was conducted. Results The prevalence of the “risk” haplotype was significantly higher in patients with BPD compared to HCs. Those with the “risk” haplotype have higher aggression and affect lability scores and more suicidal/parasuicidal behaviors than those without it. In the logistic regression model, affect lability was the only significant predictor and it correctly classified 83.1% of the subjects as “risk” or “non-risk” haplotype carriers. Conclusions We found an association between the previously described TPH2 “risk” haplotype and BPD diagnosis, affective lability, suicidal/parasuicidal behavior, and aggression scores. PMID:20451217

A spatial haplotype copying model with applications to genotype imputation.

PubMed

Yang, Wen-Yun; Hormozdiari, Farhad; Eskin, Eleazar; Pasaniuc, Bogdan

2015-05-01

Ever since its introduction, the haplotype copy model has proven to be one of the most successful approaches for modeling genetic variation in human populations, with applications ranging from ancestry inference to genotype phasing and imputation. Motivated by coalescent theory, this approach assumes that any chromosome (haplotype) can be modeled as a mosaic of segments copied from a set of chromosomes sampled from the same population. At the core of the model is the assumption that any chromosome from the sample is equally likely to contribute a priori to the copying process. Motivated by recent works that model genetic variation in a geographic continuum, we propose a new spatial-aware haplotype copy model that jointly models geography and the haplotype copying process. We extend hidden Markov models of haplotype diversity such that at any given location, haplotypes that are closest in the genetic-geographic continuum map are a priori more likely to contribute to the copying process than distant ones. Through simulations starting from the 1000 Genomes data, we show that our model achieves superior accuracy in genotype imputation over the standard spatial-unaware haplotype copy model. In addition, we show the utility of our model in selecting a small personalized reference panel for imputation that leads to both improved accuracy as well as to a lower computational runtime than the standard approach. Finally, we show our proposed model can be used to localize individuals on the genetic-geographical map on the basis of their genotype data.

Genetic variability of populations of Nyssomyia neivai in the Northern State of Paraná, Brazil

PubMed Central

Gasparotto, Jaqueline de Carvalho; da Costa-Ribeiro, Magda Clara Vieira; Thomaz-Soccol, Vanete; Liebel, Sandra Mara Rodrigues da Silva; Neitzke-Abreu, Herintha Coeto; Reinhold-Castro, Kárin Rosi; Cristovão, Edilson Colhera; Teodoro, Ueslei

2017-01-01

ABSTRACT The genetic study of sandfly populations needs to be further explored given the importance of these insects for public health. Were sequenced the NDH4 mitochondrial gene from populations of Nyssomyia neivai from Doutor Camargo, Lobato, Japira, and Porto Rico, municipalities in the State of Paraná, Brazil, to understand the genetic structure and gene flow. Eighty specimens of Ny. Neivai were sequenced, 20 from each municipality, and 269 base pairs were obtained. A total of 27 haplotypes and 28 polymorphic sites were found, along with a haplotypic diversity of 0.80696 and a nucleotide diversity of 0.00567. Haplotype H5, with 33 specimens, was the most common among the four populations. Only haplotypes H5 and H7 were present in all four populations. The population from Doutor Camargo showed the highest genetic diversity, and only this population shared haplotypes with those from the other municipalities. The highest number of haplotypes was sheared with Lobato which also had the highest number of unique haplotypes. This probably occurred because of constant anthropic changes that happened in the environment during the first half of the twentieth century, mainly after 1998. There was no significant correlation between genetic and geographical distances regarding these populations. However, the highest genetic and geographical distances, and the lowest gene flow were observed between Japira and Porto Rico. Geographical distance is a possible barrier between these municipalities through the blocking of haplotype sharing. PMID:28380111

Mutation Analysis in Classical Phenylketonuria Patients Followed by Detecting Haplotypes Linked to Some PAH Mutations.

PubMed

Dehghanian, Fatemeh; Silawi, Mohammad; Tabei, Seyed M B

2017-02-01

Deficiency of phenylalanine hydroxylase (PAH) enzyme and elevation of phenylalanine in body fluids cause phenylketonuria (PKU). The gold standard for confirming PKU and PAH deficiency is detecting causal mutations by direct sequencing of the coding exons and splicing involved sequences of the PAH gene. Furthermore, haplotype analysis could be considered as an auxiliary approach for detecting PKU causative mutations before direct sequencing of the PAH gene by making comparisons between prior detected mutation linked-haplotypes and new PKU case haplotypes with undetermined mutations. In this study, 13 unrelated classical PKU patients took part in the study detecting causative mutations. Mutations were identified by polymerase chain reaction (PCR) and direct sequencing in all patients. After that, haplotype analysis was performed by studying VNTR and PAHSTR markers (linked genetic markers of the PAH gene) through application of PCR and capillary electrophoresis (CE). Mutation analysis was performed successfully and the detected mutations were as follows: c.782G>A, c.754C>T, c.842C>G, c.113-115delTCT, c.688G>A, and c.696A>G. Additionally, PAHSTR/VNTR haplotypes were detected to discover haplotypes linked to each mutation. Mutation detection is the best approach for confirming PAH enzyme deficiency in PKU patients. Due to the relatively large size of the PAH gene and high cost of the direct sequencing in developing countries, haplotype analysis could be used before DNA sequencing and mutation detection for a faster and cheaper way via identifying probable mutated exons.

Mitochondrial phylogeography of a Beringian relict: the endemic freshwater genus of blackfish Dallia (Esociformes).

PubMed

Campbell, M A; Lopéz, J A

2014-02-01

Mitochondrial genetic variability among populations of the blackfish genus Dallia (Esociformes) across Beringia was examined. Levels of divergence and patterns of geographic distribution of mitochondrial DNA lineages were characterized using phylogenetic inference, median-joining haplotype networks, Bayesian skyline plots, mismatch analysis and spatial analysis of molecular variance (SAMOVA) to infer genealogical relationships and to assess patterns of phylogeography among extant mitochondrial lineages in populations of species of Dallia. The observed variation includes extensive standing mitochondrial genetic diversity and patterns of distinct spatial segregation corresponding to historical and contemporary barriers with minimal or no mixing of mitochondrial haplotypes between geographic areas. Mitochondrial diversity is highest in the common delta formed by the Yukon and Kuskokwim Rivers where they meet the Bering Sea. Other regions sampled in this study host comparatively low levels of mitochondrial diversity. The observed levels of mitochondrial diversity and the spatial distribution of that diversity are consistent with persistence of mitochondrial lineages in multiple refugia through the last glacial maximum. © 2014 The Fisheries Society of the British Isles.

Linear time algorithms to construct populations fitting multiple constraint distributions at genomic scales.

PubMed

Siragusa, Enrico; Haiminen, Niina; Utro, Filippo; Parida, Laxmi

2017-10-09

Computer simulations can be used to study population genetic methods, models and parameters, as well as to predict potential outcomes. For example, in plant populations, predicting the outcome of breeding operations can be studied using simulations. In-silico construction of populations with pre-specified characteristics is an important task in breeding optimization and other population genetic studies. We present two linear time Simulation using Best-fit Algorithms (SimBA) for two classes of problems where each co-fits two distributions: SimBA-LD fits linkage disequilibrium and minimum allele frequency distributions, while SimBA-hap fits founder-haplotype and polyploid allele dosage distributions. An incremental gap-filling version of previously introduced SimBA-LD is here demonstrated to accurately fit the target distributions, allowing efficient large scale simulations. SimBA-hap accuracy and efficiency is demonstrated by simulating tetraploid populations with varying numbers of founder haplotypes, we evaluate both a linear time greedy algoritm and an optimal solution based on mixed-integer programming. SimBA is available on http://researcher.watson.ibm.com/project/5669.

Apolipoprotein A5: A newly identified gene impacting plasmatriglyceride levels in humans and mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pennacchio, Len A.; Rubin, Edward M.

2002-09-15

Apolipoprotein A5 (APOA5) is a newly described member of theapolipoprotein gene family whose initial discovery arose from comparativesequence analysis of the mammalian APOA1/C3/A4 gene cluster. Functionalstudies in mice indicated that alteration in the level of APOA5significantly impacted plasma triglyceride concentrations. Miceover-expressing human APOA5 displayed significantly reducedtriglycerides, while mice lacking apoA5 had a large increase in thislipid parameter. Studies in humans have also suggested an important rolefor APOA5 in determining plasma triglyceride concentrations. In theseexperiments, polymorphisms in the human gene were found to define severalcommon haplotypes that were associated with significant changes intriglyceride concentrations in multiple populations. Several separateclinical studies havemore » provided consistent and strong support for theeffect with 24 percent of Caucasians, 35 percent of African-Americans and53 percent of Hispanics carrying APOA5 haplotypes associated withincreased plasma triglyceride levels. In summary, APOA5 represents anewly discovered gene involved in triglyceride metabolism in both humansand mice whose mechanism of action remains to be deciphered.« less

The interaction between vitamin D receptor polymorphisms and sun exposure around time of diagnosis influences melanoma survival.

PubMed

Orlow, Irene; Shi, Yang; Kanetsky, Peter A; Thomas, Nancy E; Luo, Li; Corrales-Guerrero, Sergio; Cust, Anne E; Sacchetto, Lidia; Zanetti, Roberto; Rosso, Stefano; Armstrong, Bruce K; Dwyer, Terence; Venn, Alison; Gallagher, Richard P; Gruber, Stephen B; Marrett, Loraine D; Anton-Culver, Hoda; Busam, Klaus; Begg, Colin B; Berwick, Marianne

2018-03-01

Evidence on the relationship between the vitamin D pathway and outcomes in melanoma is growing, although it is not always clear. We investigated the impact of measured levels of sun exposure at diagnosis on associations of vitamin D receptor gene (VDR) polymorphisms and melanoma death in 3336 incident primary melanoma cases. Interactions between six SNPs and a common 3'-end haplotype were significant (p < .05). These SNPs, and a haplotype, had a statistically significant association with survival among subjects exposed to high UVB in multivariable regression models and exerted their effect in the opposite direction among those with low UVB. SNPs rs1544410/BsmI and rs731236/TaqI remained significant after adjustment for multiple testing. These results suggest that the association between VDR and melanoma-specific survival is modified by sun exposure around diagnosis, and require validation in an independent study. Whether the observed effects are dependent or independent of vitamin D activation remains to be determined. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Common variants of xeroderma pigmentosum genes and prostate cancer risk.

PubMed

Mirecka, Aneta; Paszkowska-Szczur, Katarzyna; Scott, Rodney J; Górski, Bohdan; van de Wetering, Thierry; Wokołorczyk, Dominika; Gromowski, Tomasz; Serrano-Fernandez, Pablo; Cybulski, Cezary; Kashyap, Aniruddh; Gupta, Satish; Gołąb, Adam; Słojewski, Marcin; Sikorski, Andrzej; Lubiński, Jan; Dębniak, Tadeusz

2014-08-10

The genetic basis of prostate cancer (PC) is complex and appears to involve multiple susceptibility genes. A number of studies have evaluated a possible correlation between several NER gene polymorphisms and PC risk, but most of them evaluated only single SNPs among XP genes and the results remain inconsistent. Out of 94 SNPs located in seven XP genes (XPA-XPG) a total of 15 SNPs were assayed in 720 unselected patients with PC and compared to 1121 healthy adults. An increased risk of disease was associated with the XPD SNP, rs1799793 (Asp312Asn) AG genotype (OR=2.60; p<0.001) and with the AA genotype (OR=531; p<0.0001) compared to the control population. Haplotype analysis of XPD revealed one protective haplotype and four associated with an increased disease risk, which showed that the A allele (XPD rs1799793) appeared to drive the main effect on promoting prostate cancer risk. Polymorphism in XPD gene appears to be associated with the risk of prostate cancer. Copyright © 2014. Published by Elsevier B.V.

BSG and MCT1 Genetic Variants Influence Survival in Multiple Myeloma Patients.

PubMed

Łacina, Piotr; Butrym, Aleksandra; Mazur, Grzegorz; Bogunia-Kubik, Katarzyna

2018-04-24

Multiple myeloma (MM) is a haematologic malignancy characterized by the presence of atypical plasma cells. Basigin (BSG, CD147) controls lactate export through the monocarboxylic acid transporter 1 (MCT1, SLC16A1) and supports MM survival and proliferation. Additionally, BSG is implicated in response to treatment with immunomodulatory drugs (thalidomide and its derivatives). We investigated the role of single nucleotide polymorphisms (SNPs) in the gene coding for BSG and SLC16A1 in MM. Following an in silico analysis, eight SNPs (four in BSG and four in SLC16A1 ) predicted to have a functional effect were selected and analyzed in 135 MM patients and 135 healthy individuals. Alleles rs4919859 C, rs8637 G, and haplotype CG were associated with worse progression-free survival ( p = 0.006, p = 0.017, p = 0.002, respectively), while rs7556664 A, rs7169 T and rs1049434 A (all in linkage disequilibrium (LD), r ² > 0.98) were associated with better overall survival ( p = 0.021). Similar relationships were observed in thalidomide-treated patients. Moreover, rs4919859 C, rs8637 G, rs8259 A and the CG haplotype were more common in patients in stages II⁻III of the International Staging System ( p < 0.05), while rs8259 A correlated with higher levels of β-2-microglobulin and creatinine ( p < 0.05). Taken together, our results show that BSG and SLC16A1 variants affect survival, and may play an important role in MM.

Globally intertwined evolutionary history of giant barrel sponges

NASA Astrophysics Data System (ADS)

Swierts, Thomas; Peijnenburg, Katja T. C. A.; de Leeuw, Christiaan A.; Breeuwer, Johannes A. J.; Cleary, Daniel F. R.; de Voogd, Nicole J.

2017-09-01

Three species of giant barrel sponge are currently recognized in two distinct geographic regions, the tropical Atlantic and the Indo-Pacific. In this study, we used molecular techniques to study populations of giant barrel sponges across the globe and assessed whether the genetic structure of these populations agreed with current taxonomic consensus or, in contrast, whether there was evidence of cryptic species. Using molecular data, we assessed whether giant barrel sponges in each oceanic realm represented separate monophyletic lineages. Giant barrel sponges from 17 coral reef systems across the globe were sequenced for mitochondrial (partial CO1 and ATP6 genes) and nuclear (ATPsβ intron) DNA markers. In total, we obtained 395 combined sequences of the mitochondrial CO1 and ATP6 markers, which resulted in 17 different haplotypes. We compared a phylogenetic tree constructed from 285 alleles of the nuclear intron ATPsβ to the 17 mitochondrial haplotypes. Congruent patterns between mitochondrial and nuclear gene trees of giant barrel sponges provided evidence for the existence of multiple reproductively isolated species, particularly where they occurred in sympatry. The species complexes in the tropical Atlantic and the Indo-Pacific, however, do not form separate monophyletic lineages. This rules out the scenario that one species of giant barrel sponge developed into separate species complexes following geographic separation and instead suggests that multiple species of giant barrel sponges already existed prior to the physical separation of the Indo-Pacific and tropical Atlantic.

Domestication of a Mesoamerican cultivated fruit tree, Spondias purpurea.

PubMed

Miller, Allison; Schaal, Barbara

2005-09-06

Contemporary patterns of genetic variation in crops reflect historical processes associated with domestication, such as the geographic origin(s) of cultivated populations. Although significant progress has been made in identifying several global centers of domestication, few studies have addressed the issue of multiple origins of cultivated plant populations from different geographic regions within a domestication center. This study investigates the domestication history of jocote (Spondias purpurea), a Mesoamerican cultivated fruit tree. Sequences of the chloroplast spacer trnG-trnS were obtained for cultivated and wild S. purpurea trees, two sympatric taxa (Spondias mombin var. mombin and Spondias radlkoferi), and two outgroups (S. mombin var. globosa and Spondias testudinus). A phylogeographic approach was used and statistically significant associations of clades and geographical location were tested with a nested clade analysis. The sequences confirm that wild populations of S. purpurea are the likely progenitors of cultivated jocote trees. This study provides phylogeographic evidence of multiple domestications of this Mesoamerican cultivated fruit tree. Haplotypes detected in S. purpurea trees form two clusters, each of which includes alleles recovered in both cultivated and wild populations from distinct geographic regions. Cultivated S. purpurea populations have fewer unique trnG-trnS alleles than wild populations; however, five haplotypes were absent in the wild. The presence of unique alleles in cultivation may reflect contemporary extinction of the tropical dry forests of Mesoamerica. These data indicate that some agricultural habitats may be functioning as reservoirs of genetic variation in S. purpurea.

Domestication of a Mesoamerican cultivated fruit tree, Spondias purpurea

PubMed Central

Miller, Allison; Schaal, Barbara

2005-01-01

Contemporary patterns of genetic variation in crops reflect historical processes associated with domestication, such as the geographic origin(s) of cultivated populations. Although significant progress has been made in identifying several global centers of domestication, few studies have addressed the issue of multiple origins of cultivated plant populations from different geographic regions within a domestication center. This study investigates the domestication history of jocote (Spondias purpurea), a Mesoamerican cultivated fruit tree. Sequences of the chloroplast spacer trnG–trnS were obtained for cultivated and wild S. purpurea trees, two sympatric taxa (Spondias mombin var. mombin and Spondias radlkoferi), and two outgroups (S. mombin var. globosa and Spondias testudinus). A phylogeographic approach was used and statistically significant associations of clades and geographical location were tested with a nested clade analysis. The sequences confirm that wild populations of S. purpurea are the likely progenitors of cultivated jocote trees. This study provides phylogeographic evidence of multiple domestications of this Mesoamerican cultivated fruit tree. Haplotypes detected in S. purpurea trees form two clusters, each of which includes alleles recovered in both cultivated and wild populations from distinct geographic regions. Cultivated S. purpurea populations have fewer unique trnG–trnS alleles than wild populations; however, five haplotypes were absent in the wild. The presence of unique alleles in cultivation may reflect contemporary extinction of the tropical dry forests of Mesoamerica. These data indicate that some agricultural habitats may be functioning as reservoirs of genetic variation in S. purpurea. PMID:16126899

SNPs and Haplotypes in Native American Populations

PubMed Central

Kidd, Judith R.; Friedlaender, Françoise; Pakstis, Andrew J.; Furtado, Manohar; Fang, Rixun; Wang, Xudong; Nievergelt, Caroline M.; Kidd, Kenneth K.

2013-01-01

Autosomal DNA polymorphisms can provide new information and understanding of both the origins of and relationships among modern Native American populations. At the same time that autosomal markers can be highly informative, they are also susceptible to ascertainment biases in the selection of the markers to use. Identifying markers that can be used for ancestry inference among Native American populations can be considered separate from identifying markers to further the quest for history. In the current study we are using data on nine Native American populations to compare the results based on a large haplotype-based dataset with relatively small independent sets of SNPs. We are interested in what types of limited datasets an individual laboratory might be able to collect are best for addressing two different questions of interest. First, how well can we differentiate the Native American populations and/or infer ancestry by assigning an individual to her population(s) of origin? Second, how well can we infer the historical/evolutionary relationships among Native American populations and their Eurasian origins. We conclude that only a large comprehensive dataset involving multiple autosomal markers on multiple populations will be able to answer both questions; different small sets of markers are able to answer only one or the other of these questions. Using our largest dataset we see a general increasing distance from Old World populations from North to South in the New World except for an unexplained close relationship between our Maya and Quechua samples. PMID:21913176

Phylogeny and temporal diversification of darters (Percidae: Etheostomatinae).

PubMed

Near, Thomas J; Bossu, Christen M; Bradburd, Gideon S; Carlson, Rose L; Harrington, Richard C; Hollingsworth, Phillip R; Keck, Benjamin P; Etnier, David A

2011-10-01

Discussions aimed at resolution of the Tree of Life are most often focused on the interrelationships of major organismal lineages. In this study, we focus on the resolution of some of the most apical branches in the Tree of Life through exploration of the phylogenetic relationships of darters, a species-rich clade of North American freshwater fishes. With a near-complete taxon sampling of close to 250 species, we aim to investigate strategies for efficient multilocus data sampling and the estimation of divergence times using relaxed-clock methods when a clade lacks a fossil record. Our phylogenetic data set comprises a single mitochondrial DNA (mtDNA) gene and two nuclear genes sampled from 245 of the 248 darter species. This dense sampling allows us to determine if a modest amount of nuclear DNA sequence data can resolve relationships among closely related animal species. Darters lack a fossil record to provide age calibration priors in relaxed-clock analyses. Therefore, we use a near-complete species-sampled phylogeny of the perciform clade Centrarchidae, which has a rich fossil record, to assess two distinct strategies of external calibration in relaxed-clock divergence time estimates of darters: using ages inferred from the fossil record and molecular evolutionary rate estimates. Comparison of Bayesian phylogenies inferred from mtDNA and nuclear genes reveals that heterospecific mtDNA is present in approximately 12.5% of all darter species. We identify three patterns of mtDNA introgression in darters: proximal mtDNA transfer, which involves the transfer of mtDNA among extant and sympatric darter species, indeterminate introgression, which involves the transfer of mtDNA from a lineage that cannot be confidently identified because the introgressed haplotypes are not clearly referable to mtDNA haplotypes in any recognized species, and deep introgression, which is characterized by species diversification within a recipient clade subsequent to the transfer of heterospecific mtDNA. The results of our analyses indicate that DNA sequences sampled from single-copy nuclear genes can provide appreciable phylogenetic resolution for closely related animal species. A well-resolved near-complete species-sampled phylogeny of darters was estimated with Bayesian methods using a concatenated mtDNA and nuclear gene data set with all identified heterospecific mtDNA haplotypes treated as missing data. The relaxed-clock analyses resulted in very similar posterior age estimates across the three sampled genes and methods of calibration and therefore offer a viable strategy for estimating divergence times for clades that lack a fossil record. In addition, an informative rank-free clade-based classification of darters that preserves the rich history of nomenclature in the group and provides formal taxonomic communication of darter clades was constructed using the mtDNA and nuclear gene phylogeny. On the whole, the appeal of mtDNA for phylogeny inference among closely related animal species is diminished by the observations of extensive mtDNA introgression and by finding appreciable phylogenetic signal in a modest sampling of nuclear genes in our phylogenetic analyses of darters.

Genetic diversity of transmission-blocking vaccine candidate Pvs48/45 in Plasmodium vivax populations in China.

PubMed

Feng, Hui; Gupta, Bhavna; Wang, Meilian; Zheng, Wenqi; Zheng, Li; Zhu, Xiaotong; Yang, Yimei; Fang, Qiang; Luo, Enjie; Fan, Qi; Tsuboi, Takafumi; Cao, Yaming; Cui, Liwang

2015-12-01

The male gamete fertilization factor P48/45 in malaria parasites is a prime transmission-blocking vaccine (TBV) candidate. Efforts to develop antimalarial vaccines are often thwarted by genetic diversity of the target antigens. Here we evaluated the genetic diversity of Pvs48/45 gene in global Plasmodium vivax populations. We determined 200 Pvs48/45 sequences collected from temperate and subtropical parasite populations in China. Population genetic and evolutionary analyses were performed to determine the levels of genetic diversity, potential signature of selection, and population differentiation. Analysis of the Pvs48/45 sequences from 200 P. vivax parasites collected in a temperate and a tropical region revealed a low level of genetic diversity (π = 0.0012) with 14 single nucleotide polymorphisms, of which 11 were nonsynonymous. Analysis of 344 Pvs48/45 sequences from nine worldwide P. vivax populations detected a total of 38 haplotypes, of which 13 haplotypes were present only once. Multiple tests for selection confirmed a signature of positive selection on Pvs48/45 with selection skewed to the second cysteine domain. Haplotype network analysis and Wright's fixation index showed large geographical differentiation with the presence of continent-or region-specific mutations in this gene. Pvs48/45 displays low levels of genetic diversity with the presence of region-specific mutations. Some of the mutations may be potential epitope targets based on their positions in the predicted structure, highlighting the need for future evaluation of these mutations in designing Pvs48/45-based TBV.

GC Gene Polymorphisms and Vitamin D-Binding Protein Levels Are Related to the Risk of Generalized Aggressive Periodontitis

PubMed Central

Song, Wenli; Wang, Xian'e; Tian, Yu; Zhang, Xin; Lu, Ruifang

2016-01-01

Objective. To explore whether GC (group-specific component) rs17467825, rs4588, and rs7041 polymorphisms are associated with generalized aggressive periodontitis. Methods. This case-control study recruited 372 patients with generalized aggressive periodontitis (group AgP) and 133 periodontal healthy subjects (group HP). GC rs17467825, rs4588, and rs7041 genotypes and plasmatic vitamin D-binding protein (DBP) were measured. Analysis of single SNP and multiple SNPs was performed and relevance between plasmatic DBP and haplotypes was analyzed. Results. GC rs17467825 GG genotype was statistically associated with lower risk for generalized aggressive periodontitis under the recessive model (OR = 0.52, 95% CI: 0.30–0.92, p = 0.028). GC rs17467825 and rs4588 had strong linkage disequilibrium with r 2 ≥ 0.8 and D′ ≥ 0.8. Haplotype (GC rs17467825, rs4588) GC was associated with the less risk for generalized aggressive periodontitis (OR = 0.29, 95% CI: 0.09–0.96, p = 0.043). In group AgP, individuals with combined genotype (GC rs17467825, rs4588) AG+CA had significantly lower plasmatic DBP level than those with the other two combined genotypes (AG+CA versus AA+CC p = 0.007; AG+CA versus GG+AA p = 0.026). Conclusions. GC rs17467825 genotype GG and haplotype (GC rs17467825, rs4588) GC are associated with generalized aggressive periodontitis. The association may be acquired through regulating DBP levels. The functions of GC gene and DBP in inflammatory disease need to be further studied. PMID:28018430

Polymorphisms in aryl hydrocarbon receptor gene are associated with idiopathic male factor infertility.

PubMed

Safarinejad, Mohammad Reza; Shafiei, Nayyer; Safarinejad, Saba

2013-12-01

We wanted to determine whether genetic polymorphisms of aryl hydrocarbon receptor (AhR) gene are associated with susceptibility to male infertility. This study comprised 176 men with idiopathic infertility and 352 healthy fertile men who served as controls. Seven single-nucleotide polymorphisms (SNPs) of the AhR gene (rs2066853, rs1476080, rs10250822, rs10247158, rs2282885, rs6960165, and rs7811989) were selected and genotyped by the polymerase chain reaction-restriction fragment length polymorphism analysis. The serum levels of reproductive and thyroid hormones and inhibin B were also measured. After multiple regression analysis, 2 of the 7 studied SNPs were significantly associated with the occurrence of male infertility. Men with rs2066853 AA genotype had 33% decreased risk of being infertile (odds ratio [OR] = 0.67, 95% confidence interval [CI]: 0.46-0.87; P = .003). The C allele of rs2282885 was significantly associated with infertility risk, with an OR of 2.14 (95% CI: 1.64-3.72) for heterozygotes and 3.54 (95% CI: 2.25-5.84) for homozygotes. When haplotypes were composed of 7 AhR SNP sites, patients with AACACAG haplotype harbored more than 75% decreased risk of being infertile (OR = 0.21, 95% CI: 0.11-0.32; P = .001). Conversely, carriers of the AACACGA haplotype had more than 12-fold increased risk of being infertile (OR = 12.62, 95% CI: 2.77-52.74; P = .00001). Homozygosity for the rs2066853 A allele and rs2282885 C allele decreases and increases the risk of developing male infertility, respectively.

Multiple SNPs in Intron 41 of Thyroglobulin Gene Are Associated with Autoimmune Thyroid Disease in the Japanese Population

PubMed Central

Ban, Yoshiyuki; Tozaki, Teruaki; Taniyama, Matsuo; Skrabanek, Luce; Nakano, Yasuko; Ban, Yoshio; Hirano, Tsutomu

2012-01-01

Background The etiology of the autoimmune thyroid diseases (AITDs), Graves' disease (GD) and Hashimoto's thyroiditis (HT), is largely unknown. However, genetic susceptibility is believed to play a major role. Two whole genome scans from Japan and from the US identified a locus on chromosome 8q24 that showed evidence for linkage with AITD and HT. Recent studies have demonstrated an association between thyroglobulin (Tg) polymorphisms and AITD in Caucasians, suggesting that Tg is a susceptibility gene on 8q24. Objectives The objective of the study was to refine Tg association with AITD, by analyzing a panel of 25 SNPs across an extended 260 kb region of the Tg. Methods We studied 458 Japanese AITD patients (287 GD and 171 HT patients) and 221 matched Japanese control subjects in association studies. Case-control association studies were performed using 25 Tg single nucleotide polymorphisms (SNPs) chosen from a database of the Single Nucleotide Polymorphism Database (dbSNP). Haplotype analysis was undertaken using the computer program SNPAlyze version 7.0. Principal Findings and Conclusions In total, 5 SNPs revealed association with GD (P<0.05), with the strongest SNP associations at rs2256366 (P = 0.002) and rs2687836 (P = 0.0077), both located in intron 41 of the Tg gene. Because of the strong LD between these two strongest associated variants, we performed the haplotype analysis, and identified a major protective haplotype for GD (P = 0.001).These results suggested that the Tg gene is involved in susceptibility for GD and AITD in the Japanese. PMID:22662162

Evaluation of the Association Between Common Genetic Variants Near the ABCA1 Gene and Primary Angle Closure Glaucoma in a Han Chinese Population.

PubMed

Luo, Huaichao; Chen, Yuhong; Ye, Zimeng; Sun, Xinghuai; Shi, Yi; Luo, Qian; Gong, Bo; Shuai, Ping; Yang, Jiyun; Zhou, Yu; Liu, Xiaoqi; Zhang, Kaijiong; Tan, Chang; Li, Yuanfeng; Lin, Ying; Yang, Zhenglin

2015-10-01

Recently, three large genome-wide association studies have identified multiple variants associated with primary open angle glaucoma (POAG) near the ABCA1 gene. Considering that POAG and primary angle closure glaucoma (PACG) share many similar clinical manifestations, the present study was conducted to investigate whether these genetic variants were also associated with PACG in a Han Chinese population. A case-control association study of 1122 cases (PACG/PAC) and 1311 normal, matched controls was undertaken. Seven single-nucleotide polymorphisms (SNPs) near the ABCA1 gene, including rs2422493, rs2487042, rs2472496, rs2472493, rs2487032, rs2472459, and rs2472519, were genotyped. Genotype and allele frequencies were assessed using χ² tests. Linkage disequilibrium (LD) structure was analyzed by computer software. Among the SNPs genotyped, no association was observed between these SNPs and PACG. However, we discovered that two haplotypes, CATTTAC (corrected P = 0.048) and CGCCCGC (corrected P = 0.048), remained significantly associated with PACG/PAC after Bonferroni correction. Subjects with the CATTTAC haplotype have a 1.71-fold increased possibility of having PACG/PAC, whereas subjects with the CGCCCGC haplotype have 0.47-fold decreased possibility of developing PACG. Our findings suggest that the genetic backgrounds of PACG and POAG might be different. However, whether or not ABCA1 plays a role in the development of PACG is still not made certain by this study. Thus, further research is needed to find the role of ABCA1 in the progress of PACG.

CHRNA7 Polymorphisms and Dementia Risk: Interactions with Apolipoprotein ε4 and Cigarette Smoking

PubMed Central

Weng, Pei-Hsuan; Chen, Jen-Hau; Chen, Ta-Fu; Sun, Yu; Wen, Li-Li; Yip, Ping-Keung; Chu, Yi-Min; Chen, Yen-Ching

2016-01-01

α7 nicotinic acetylcholine receptor (α7nAChR, encoded by CHRNA7) is involved in dementia pathogenesis through cholinergic neurotransmission, neuroprotection and interactions with amyloid-β. Smoking promotes atherosclerosis and increases dementia risk, but nicotine exerts neuroprotective effect via α7nAChR in preclinical studies. No studies explored the gene-gene, gene-environment interactions between CHRNA7 polymorphism, apolipoprotein E (APOE) ε4 status and smoking on dementia risk. This case-control study recruited 254 late-onset Alzheimer’s disease (LOAD) and 115 vascular dementia (VaD) cases (age ≥65) from the neurology clinics of three teaching hospitals in Taiwan during 2007–2010. Controls (N = 435) were recruited from health checkup programs and volunteers during the same period. Nine CHRNA7 haplotype-tagging single nucleotide polymorphisms representative for Taiwanese were genotyped. Among APOE ε4 non-carriers, CHRNA7 rs7179008 variant carriers had significantly decreased LOAD risk after correction for multiple tests (GG + AG vs. AA: adjusted odds ratio = 0.29, 95% confidence interval = 0.13–0.64, P = 0.002). Similar findings were observed for carriers of GT haplotype in CHRNA7 block4. A significant interaction was found between rs7179008, GT haplotype in block4 and APOE ε4 on LOAD risk. rs7179008 variant also reduced the detrimental effect of smoking on LOAD risk. No significant association was found between CHRNA7 and VaD. These findings help to understand dementia pathogenesis. PMID:27249957

Variation and Functional Impact of Neanderthal Ancestry in Western Asia.

PubMed

Taskent, Recep Ozgur; Alioglu, Nursen Duha; Fer, Evrim; Melike Donertas, Handan; Somel, Mehmet; Gokcumen, Omer

2017-12-01

Neanderthals contributed genetic material to modern humans via multiple admixture events. Initial admixture events presumably occurred in Western Asia shortly after humans migrated out of Africa. Despite being a focal point of admixture, earlier studies indicate lower Neanderthal introgression rates in some Western Asian populations as compared with other Eurasian populations. To better understand the genome-wide and phenotypic impact of Neanderthal introgression in the region, we sequenced whole genomes of nine present-day Europeans, Africans, and the Western Asian Druze at high depth, and analyzed available whole genome data from various other populations, including 16 genomes from present-day Turkey. Our results confirmed previous observations that contemporary Western Asian populations, on an average, have lower levels of Neanderthal-introgressed DNA relative to other Eurasian populations. Modern Western Asians also show comparatively high variability in Neanderthal ancestry, which may be attributed to the complex demographic history of the region. We further replicated the previously described depletion of putatively functional sequences among Neanderthal-introgressed haplotypes. Still, we find dozens of common Neanderthal-introgressed haplotypes in the Turkish sample associated with human phenotypes, including anthropometric and metabolic traits, as well as the immune response. One of these haplotypes is unusually long and harbors variants that affect the expression of members of the CCR gene family and are associated with celiac disease. Overall, our results paint a complex first picture of the genomic impact of Neanderthal introgression in the Western Asian populations. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

The Genomic Impacts of Drift and Selection for Hybrid Performance in Maize

PubMed Central

Gerke, Justin P.; Edwards, Jode W.; Guill, Katherine E.; Ross-Ibarra, Jeffrey; McMullen, Michael D.

2015-01-01

Although maize is naturally an outcrossing organism, modern breeding utilizes highly inbred lines in controlled crosses to produce hybrids. The U.S. Department of Agriculture’s reciprocal recurrent selection experiment between the Iowa Stiff Stalk Synthetic (BSSS) and the Iowa Corn Borer Synthetic No. 1 (BSCB1) populations represents one of the longest running experiments to understand the response to selection for hybrid performance. To investigate the genomic impact of this selection program, we genotyped the progenitor lines and >600 individuals across multiple cycles of selection using a genome-wide panel of ∼40,000 SNPs. We confirmed previous results showing a steady temporal decrease in genetic diversity within populations and a corresponding increase in differentiation between populations. Thanks to detailed historical information on experimental design, we were able to perform extensive simulations using founder haplotypes to replicate the experiment in the absence of selection. These simulations demonstrate that while most of the observed reduction in genetic diversity can be attributed to genetic drift, heterozygosity in each population has fallen more than expected. We then took advantage of our high-density genotype data to identify extensive regions of haplotype fixation and trace haplotype ancestry to single founder inbred lines. The vast majority of regions showing such evidence of selection differ between the two populations, providing evidence for the dominance model of heterosis. We discuss how this pattern is likely to occur during selection for hybrid performance and how it poses challenges for dissecting the impacts of modern breeding and selection on the maize genome. PMID:26385980

Comparative sequence analysis of domain I of Plasmodium falciparum apical membrane antigen 1 from Saudi Arabia and worldwide isolates.

PubMed

Al-Qahtani, Ahmed A; Abdel-Muhsin, Abdel-Muhsin A; Dajem, Saad M Bin; AlSheikh, Adel Ali H; Bohol, Marie Fe F; Al-Ahdal, Mohammed N; Putaporntip, Chaturong; Jongwutiwes, Somchai

2016-04-01

The apical membrane antigen 1 of Plasmodium falciparum (PfAMA1) plays a crucial role in erythrocyte invasion and is a target of protective antibodies. Although domain I of PfAMA1 has been considered a promising vaccine component, extensive sequence diversity in this domain could compromise an effective vaccine design. To explore the extent of sequence diversity in domain I of PfAMA1, P. falciparum-infected blood samples from Saudi Arabia collected between 2007 and 2009 were analyzed and compared with those from worldwide parasite populations. Forty-six haplotypes and a novel codon change (M190V) were found among Saudi Arabian isolates. The haplotype diversity (0.948±0.004) and nucleotide diversity (0.0191±0.0008) were comparable to those from African hyperendemic countries. Positive selection in domain I of PfAMA1 among Saudi Arabian parasite population was observed because nonsynonymous nucleotide substitutions per nonsynonymous site (dN) significantly exceeded synonymous nucleotide substitutions per synonymous site (dS) and Tajima's D and its related statistics significantly deviated from neutrality in the positive direction. Despite a relatively low prevalence of malaria in Saudi Arabia, a minimum of 17 recombination events occurred in domain I. Genetic differentiation was significant between P. falciparum in Saudi Arabia and parasites from other geographic origins. Several shared or closely related haplotypes were found among parasites from different geographic areas, suggesting that vaccine derived from multiple shared epitopes could be effective across endemic countries. Copyright © 2016 Elsevier B.V. All rights reserved.

Common inversion polymorphism at 17q21.31 affects expression of multiple genes in tissue-specific manner.

PubMed

de Jong, Simone; Chepelev, Iouri; Janson, Esther; Strengman, Eric; van den Berg, Leonard H; Veldink, Jan H; Ophoff, Roel A

2012-09-06

Chromosome 17q21.31 contains a common inversion polymorphism of approximately 900 kb in populations with European ancestry. Two divergent MAPT haplotypes, H1 and H2 are described with distinct linkage disequilibrium patterns across the region reflecting the inversion status at this locus. The MAPT H1 haplotype has been associated with progressive supranuclear palsy, corticobasal degeneration, Parkinson's disease and Alzheimer's disease, while the H2 is linked to recurrent deletion events associated with the 17q21.31 microdeletion syndrome, a disease characterized by developmental delay and learning disability. In this study, we investigate the effect of the inversion on the expression of genes in the 17q21.31 region. We find the expression of several genes in and at the borders of the inversion to be affected; specific either to whole blood or different regions of the human brain. The H1 haplotype was found to be associated with an increased expression of LRRC37A4, PLEKH1M and MAPT. In contrast, a decreased expression of MGC57346, LRRC37A and CRHR1 was associated with H1. Studies thus far have focused on the expression of MAPT in the inversion region. However, our results show that the inversion status affects expression of other genes in the 17q21.31 region as well. Given the link between the inversion status and different neurological diseases, these genes may also be involved in disease pathology, possibly in a tissue-specific manner.

Missing data imputation and haplotype phase inference for genome-wide association studies

PubMed Central

Browning, Sharon R.

2009-01-01

Imputation of missing data and the use of haplotype-based association tests can improve the power of genome-wide association studies (GWAS). In this article, I review methods for haplotype inference and missing data imputation, and discuss their application to GWAS. I discuss common features of the best algorithms for haplotype phase inference and missing data imputation in large-scale data sets, as well as some important differences between classes of methods, and highlight the methods that provide the highest accuracy and fastest computational performance. PMID:18850115

BAsE-Seq: a method for obtaining long viral haplotypes from short sequence reads.

PubMed

Hong, Lewis Z; Hong, Shuzhen; Wong, Han Teng; Aw, Pauline P K; Cheng, Yan; Wilm, Andreas; de Sessions, Paola F; Lim, Seng Gee; Nagarajan, Niranjan; Hibberd, Martin L; Quake, Stephen R; Burkholder, William F

2014-01-01

We present a method for obtaining long haplotypes, of over 3 kb in length, using a short-read sequencer, Barcode-directed Assembly for Extra-long Sequences (BAsE-Seq). BAsE-Seq relies on transposing a template-specific barcode onto random segments of the template molecule and assembling the barcoded short reads into complete haplotypes. We applied BAsE-Seq on mixed clones of hepatitis B virus and accurately identified haplotypes occurring at frequencies greater than or equal to 0.4%, with >99.9% specificity. Applying BAsE-Seq to a clinical sample, we obtained over 9,000 viral haplotypes, which provided an unprecedented view of hepatitis B virus population structure during chronic infection. BAsE-Seq is readily applicable for monitoring quasispecies evolution in viral diseases.

Short communication: casein haplotype variability in sicilian dairy goat breeds.

PubMed

Gigli, I; Maizon, D O; Riggio, V; Sardina, M T; Portolano, B

2008-09-01

In the Mediterranean region, goat milk production is an important economic activity. In the present study, 4 casein genes were genotyped in 5 Sicilian goat breeds to 1) identify casein haplotypes present in the Argentata dell'Etna, Girgentana, Messinese, Derivata di Siria, and Maltese goat breeds; and 2) describe the structure of the Sicilian goat breeds based on casein haplotypes and allele frequencies. In a sample of 540 dairy goats, 67 different haplotypes with frequency >or=0.01 and 27 with frequency >or=0.03 were observed. The most common CSN1S1-CSN2-CSN1S2-CSN3 haplotype for Derivata di Siria and Maltese was FCFB (0.17 and 0.22, respectively), whereas for Argentata dell'Etna, Girgentana and Messinese was ACAB (0.06, 0.23, and 0.10, respectively). According to the haplotype reconstruction, Argentata dell'Etna, Girgentana, and Messinese breeds presented the most favorable haplotype for cheese production, because the casein concentration in milk of these breeds might be greater than that in Derivata di Siria and Maltese breeds. Based on a cluster analysis, the breeds formed 2 main groups: Derivata di Siria, and Maltese in one group, and Argentata dell'Etna and Messinese in the other; the Girgentana breed was between these groups but closer to the latter.

The JAK2 GGCC (46/1) Haplotype in Myeloproliferative Neoplasms: Causal or Random?

PubMed Central

Anelli, Luisa; Zagaria, Antonella; Specchia, Giorgina

2018-01-01

The germline JAK2 haplotype known as “GGCC or 46/1 haplotype” (haplotypeGGCC_46/1) consists of a combination of single nucleotide polymorphisms (SNPs) mapping in a region of about 250 kb, extending from the JAK2 intron 10 to the Insulin-like 4 (INLS4) gene. Four main SNPs (rs3780367, rs10974944, rs12343867, and rs1159782) generating a “GGCC” combination are more frequently indicated to represent the JAK2 haplotype. These SNPs are inherited together and are frequently associated with the onset of myeloproliferative neoplasms (MPN) positive for both JAK2 V617 and exon 12 mutations. The association between the JAK2 haplotypeGGCC_46/1 and mutations in other genes, such as thrombopoietin receptor (MPL) and calreticulin (CALR), or the association with triple negative MPN, is still controversial. This review provides an overview of the frequency and the role of the JAK2 haplotypeGGCC_46/1 in the pathogenesis of different myeloid neoplasms and describes the hypothetical mechanisms at the basis of the association with JAK2 gene mutations. Moreover, possible clinical implications are discussed, as different papers reported contrasting data about the correlation between the JAK2 haplotypeGGCC_46/1 and blood cell count, survival, or disease progression. PMID:29641446

Genetic polymorphisms in MDR1 and CYP3A4 genes in Asians and the influence of MDR1 haplotypes on cyclosporin disposition in heart transplant recipients.

PubMed

Chowbay, Balram; Cumaraswamy, Sivathasan; Cheung, Yin Bun; Zhou, Qingyu; Lee, Edmund J D

2003-02-01

Intestinal cytochrome P450 3A4 (CYP3A4) and P-glycoprotein (P-gp) both play a vital role in the metabolism of oral cyclosporine (CsA). We investigated the genetic polymorphisms in CYP3A4(promoter region and exons 5, 7 and 9) and MDR1 (exons 12, 21 and 26) genes and the impact of these polymorphisms on the pharmacokinetics of oral CsA in stable heart transplant patients (n = 14). CYP3A4 polymorphisms were rare in the Asian population and transplant patients. Haplotype analysis revealed 12 haplotypes in the Chinese, eight in the Malays and 10 in the Indians. T-T-T was the most common haplotype in all ethnic groups. The frequency of the homozygous mutant genotype at all three loci (TT-TT-TT) was highest in the Indians (31%) compared to 19% and 15% in the Chinese and Malays, respectively. In heart transplant patients, CsA exposure (AUC(0-4 h), AUC(0-12 h) and C(max)) was high in patients with the T-T-T haplotypes compared to those with C-G-C haplotypes. These findings suggest that haplotypes rather than genotypes influence CsA disposition in transplant patients.

Haplotype frequency distribution for 7 microsatellites in chromosome 8 and 11 in relation to the metabolic syndrome in four ethnic groups: Tehran Lipid and Glucose Study.

PubMed

Daneshpour, Maryam Sadat; Hosseinzadeh, Nima; Zarkesh, Maryam; Azizi, Fereidoun

2012-03-01

Different variants of haplotype frequencies may lead to various frequencies of the same variants in individuals with drug resistance and disease susceptibility at the population level. In this study, the haplotype frequencies of 4 STR loci including the D8S1132, D8S1779, D8S514 and D8S1743, and 3 STR loci including D11S1304, D11S1998 and D11S934 were investigated in 563 individuals of four Iranian ethnic groups in the capital city of Iran, Tehran. One hundred thirty subjects had the metabolic syndrome. Haplotype frequencies of all markers were calculated. There were significant differences in the haplotype frequencies in short and long alleles between the metabolic affected subjects and controls. In addition, haplotype frequencies were significant in the four ethnic groups in both chromosomes 8 and 11. Our findings show a relation between the short allele of D8S1743 in all related haplotype frequencies of subjects with metabolic syndrome. These findings may require more studies of some candidate genes, including the lipoprotein lipase gene, in this chromosomal region. Copyright © 2011. Published by Elsevier B.V.

Huntingtin Haplotypes Provide Prioritized Target Panels for Allele-specific Silencing in Huntington Disease Patients of European Ancestry

PubMed Central

Kay, Chris; Collins, Jennifer A; Skotte, Niels H; Southwell, Amber L; Warby, Simon C; Caron, Nicholas S; Doty, Crystal N; Nguyen, Betty; Griguoli, Annamaria; Ross, Colin J; Squitieri, Ferdinando; Hayden, Michael R

2015-01-01

Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin gene (HTT). Heterozygous polymorphisms in cis with the mutation allow for allele-specific suppression of the pathogenic HTT transcript as a therapeutic strategy. To prioritize target selection, precise heterozygosity estimates are needed across diverse HD patient populations. Here we present the first comprehensive investigation of all common target alleles across the HTT gene, using 738 reference haplotypes from the 1000 Genomes Project and 2364 haplotypes from HD patients and relatives in Canada, Sweden, France, and Italy. The most common HD haplotypes (A1, A2, and A3a) define mutually exclusive sets of polymorphisms for allele-specific therapy in the greatest number of patients. Across all four populations, a maximum of 80% are treatable using these three target haplotypes. We identify a novel deletion found exclusively on the A1 haplotype, enabling potent and selective silencing of mutant HTT in approximately 40% of the patients. Antisense oligonucleotides complementary to the deletion reduce mutant A1 HTT mRNA by 78% in patient cells while sparing wild-type HTT expression. By suppressing specific haplotypes on which expanded CAG occurs, we demonstrate a rational approach to the development of allele-specific therapy for a monogenic disorder. PMID:26201449

DNA Barcoding of Bemisia tabaci Complex (Hemiptera: Aleyrodidae) Reveals Southerly Expansion of the Dominant Whitefly Species on Cotton in Pakistan

PubMed Central

Ashfaq, Muhammad; Hebert, Paul D. N.; Mirza, M. Sajjad; Khan, Arif M.; Mansoor, Shahid; Shah, Ghulam S.; Zafar, Yusuf

2014-01-01

Background Although whiteflies (Bemisia tabaci complex) are an important pest of cotton in Pakistan, its taxonomic diversity is poorly understood. As DNA barcoding is an effective tool for resolving species complexes and analyzing species distributions, we used this approach to analyze genetic diversity in the B. tabaci complex and map the distribution of B. tabaci lineages in cotton growing areas of Pakistan. Methods/Principal Findings Sequence diversity in the DNA barcode region (mtCOI-5′) was examined in 593 whiteflies from Pakistan to determine the number of whitefly species and their distributions in the cotton-growing areas of Punjab and Sindh provinces. These new records were integrated with another 173 barcode sequences for B. tabaci, most from India, to better understand regional whitefly diversity. The Barcode Index Number (BIN) System assigned the 766 sequences to 15 BINs, including nine from Pakistan. Representative specimens of each Pakistan BIN were analyzed for mtCOI-3′ to allow their assignment to one of the putative species in the B. tabaci complex recognized on the basis of sequence variation in this gene region. This analysis revealed the presence of Asia II 1, Middle East-Asia Minor 1, Asia 1, Asia II 5, Asia II 7, and a new lineage “Pakistan”. The first two taxa were found in both Punjab and Sindh, but Asia 1 was only detected in Sindh, while Asia II 5, Asia II 7 and “Pakistan” were only present in Punjab. The haplotype networks showed that most haplotypes of Asia II 1, a species implicated in transmission of the cotton leaf curl virus, occurred in both India and Pakistan. Conclusions DNA barcodes successfully discriminated cryptic species in B. tabaci complex. The dominant haplotypes in the B. tabaci complex were shared by India and Pakistan. Asia II 1 was previously restricted to Punjab, but is now the dominant lineage in southern Sindh; its southward spread may have serious implications for cotton plantations in this region. PMID:25099936

Identification and phylogenetic relationship of Iranian strains of various Leishmania species isolated from cutaneous and visceral cases of leishmaniasis based on N-acetylglucosamine-1-phosphate transferase gene.

PubMed

Hajjaran, Homa; Mohebali, Mehdi; Teimouri, Aref; Oshaghi, Mohammad Ali; Mirjalali, Hamed; Kazemi-Rad, Elham; Shiee, Mohammad Reza; Naddaf, Saied Reza

2014-08-01

The identity of Iranian Leishmania species has been resolved to some extent by some genetic markers. In this study, based on N-acetylglucosamine-1-phosphate transferase (nagt) gene, we further elucidated the identity and phylogeny of the prevalent species in this country. DNAs of 121 isolates belonging to cutaneous leishmaniasis (CL) patients, canine visceral leishmaniasis (CVL) cases, and Rhombomys opimus rodents were amplified by targeting a partial sequence of nagt gene. All the amplicons were analyzed with restriction fragment length polymorphism (RFLP) using Acc1 enzyme, and 49 amplicons representing different reservoir hosts were sequenced and aligned with similar sequences from GenBank database. The RFLP analysis revealed that 41 CL patients were infected Leishmania tropica and 36 with Leishmania major. Among 10 CVL isolates, 6 were identified as Leishmania infantum and 4 as L. tropica. Amongst 34 rodents' isolates, 11 and 23 isolates exhibited patterns similar to those of L. major, and L. tropica/Leishmania turanica, respectively. The sequencing results from all CL patients, CVL cases, and 4 reservoir rodents were in agreement with RFLP analysis and showed 99-100% homologies with the registered species of L. major, L. tropica, and L. infantum from Turkey, Tunisia, Iraq and Israel. Of the 7 rodent isolates exhibiting RFLP patterns similar to L. tropica/L. turanica, 3 exhibited the highest homologies (99-100%) with L. turanica and 4 with Leishmania gerbilli. The 49 nagt DNA sequences were grouped into five clusters representing L. major, L. tropica, L. infantum, L. turanica and L. gerbilli species, encompassing 19 haplotypes. No correlation was observed between intraspecies divergence and geographic distribution of haplotypes. The L. tropica haplotypes exhibited more homologies with those of L. infantum than L. major (97.2% vs. 96.9%), a probable indication to the potential ability of L. tropica to visceralize. Characterization of Iranian Leishmania isolates using nagt gene allowed unambiguous identification of five prevalent species with a high-resolution phylogeny. Copyright © 2014 Elsevier B.V. All rights reserved.

HLA-A, -B, -C, -DRB1 and -DQB1 allele and haplotype frequencies in the Serbian population.

PubMed

Andric, Zorana; Popadic, Dusan; Jovanovic, Barbara; Jaglicic, Ivana; Bojic, Svetlana; Simonovic, Ruzica

2014-03-01

This study provides the first published detailed analysis of five loci polymorphisms as well as reports of two, three and five loci haplotype frequencies in the Serbian population in a sample of 1992 volunteer bone marrow donors recruited from different part of the country. Typing was performed by PCR SSO method combined with PCR SSP techniques to resolve ambiguities. In total, 16 HLA-A, 28 HLA-B, 14 HLA-C, 13 HLA-DRB1 and 5 HLA-DQB1 allelic groups were identified. The most frequent in allele groups are HLA-A(∗)02 (29.5%), HLA-A(∗)01 (14.2%), HLA-B(∗)35 (13.1%), HLA-B(∗)51 (12.8%), HLA-C(∗)07 (24.8%), HLA-DRB1(∗)11 (16.9%), HLA-DRB1(∗)13 (13.2%), HLA-DQB1(∗)03 (33.3%) and DQB1(∗)05 (33.0%). The most frequent three- and five-loci haplotypes were A(∗)01-B(∗)08-DRB1(∗)03 (5.9%) and A(∗)02-B(∗)18-DRB1(∗)11 (1.9%), A(∗)01-B(∗)08-C(∗)07-DRB1(∗)03-DQB1(∗)02 (6.6%) followed by A(∗)02-B(∗)18-C(∗)07-DRB1(∗)11-DQB1(∗)03 (2.5%), then A(∗)33-B(∗)14-C(∗)08-DRB1(∗)01-DQB1(∗)05 and A(∗)02-B(∗)35-C(∗)04-DRB1(∗)16-DQB1(∗)05 (2.2% both), respectively. The results of cluster analysis showed that the Serbian population is closely related to the populations living in central Balkan and neighboring European regions. The level of allelic diversity found in this study are relevant to facilitate searching for unrelated matched donor and provide a healthy control population from our region that should be useful in the future disease association study. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

High Speed Intact Protein Characterization Using 4X Frequency Multiplication, Ion Trap Harmonization, and 21 Tesla FTICR-MS.

PubMed

Shaw, Jared B; Gorshkov, Mikhail V; Wu, Qinghao; Paša-Tolić, Ljiljana

2018-05-01

Mass spectrometric characterization of large biomolecules, such as intact proteins, requires the specificity afforded by ultrahigh resolution mass measurements performed at both the intact mass and product ion levels. Although the performance of time-of-flight mass analyzers is steadily increasing, the choice of mass analyzer for large biomolecules (e.g., proteins >50 kDa) is generally limited to the Fourier transform family of mass analyzers such as Orbitrap and ion cyclotron resonance (FTICR-MS), with the latter providing unmatched mass resolving power and measurement accuracy. Yet, protein analyses using FTMS are largely hindered by the low acquisition rates of spectra with ultrahigh resolving power. Frequency multiple detection schemes enable FTICR-MS to overcome this fundamental barrier and achieve resolving powers and acquisition speeds 4× greater than the limits imposed by magnetic field strength. Here we expand upon earlier work on the implementation of this technique for biomolecular characterization. We report the coupling of 21T FTICR-MS, 4X frequency multiplication, ion trapping field harmonization technology, and spectral data processing methods to achieve unprecedented acquisition rates and resolving power in mass spectrometry of large intact proteins. Isotopically resolved spectra of multiply charged ubiquitin ions were acquired using detection periods as short as 12 ms. Large proteins such as apo-transferrin (MW = 78 kDa) and monoclonal antibody (MW = 150 kDa) were isotopically resolved with detection periods of 384 and 768 ms, respectively. These results illustrate the future capability of accurate characterization of large proteins on time scales compatible with online separations.

Young inversion with multiple linked QTLs under selection in a hybrid zone.

PubMed

Lee, Cheng-Ruei; Wang, Baosheng; Mojica, Julius P; Mandáková, Terezie; Prasad, Kasavajhala V S K; Goicoechea, Jose Luis; Perera, Nadeesha; Hellsten, Uffe; Hundley, Hope N; Johnson, Jenifer; Grimwood, Jane; Barry, Kerrie; Fairclough, Stephen; Jenkins, Jerry W; Yu, Yeisoo; Kudrna, Dave; Zhang, Jianwei; Talag, Jayson; Golser, Wolfgang; Ghattas, Kathryn; Schranz, M Eric; Wing, Rod; Lysak, Martin A; Schmutz, Jeremy; Rokhsar, Daniel S; Mitchell-Olds, Thomas

2017-04-03

Fixed chromosomal inversions can reduce gene flow and promote speciation in two ways: by suppressing recombination and by carrying locally favoured alleles at multiple loci. However, it is unknown whether favoured mutations slowly accumulate on older inversions or if young inversions spread because they capture pre-existing adaptive quantitative trait loci (QTLs). By genetic mapping, chromosome painting and genome sequencing, we have identified a major inversion controlling ecologically important traits in Boechera stricta. The inversion arose since the last glaciation and subsequently reached local high frequency in a hybrid speciation zone. Furthermore, the inversion shows signs of positive directional selection. To test whether the inversion could have captured existing, linked QTLs, we crossed standard, collinear haplotypes from the hybrid zone and found multiple linked phenology QTLs within the inversion region. These findings provide the first direct evidence that linked, locally adapted QTLs may be captured by young inversions during incipient speciation.

Young inversion with multiple linked QTLs under selection in a hybrid zone

PubMed Central

Lee, Cheng-Ruei; Wang, Baosheng; Mojica, Julius; Mandáková, Terezie; Prasad, Kasavajhala V. S. K.; Goicoechea, Jose Luis; Perera, Nadeesha; Hellsten, Uffe; Hundley, Hope N.; Johnson, Jenifer; Grimwood, Jane; Barry, Kerrie; Fairclough, Stephen; Jenkins, Jerry W.; Yu, Yeisoo; Kudrna, Dave; Zhang, Jianwei; Talag, Jayson; Golser, Wolfgang; Ghattas, Katherine; Schranz, M. Eric; Wing, Rod; Lysak, Martin A.; Schmutz, Jeremy; Rokhsar, Daniel S.; Mitchell-Olds, Thomas

2017-01-01

Fixed chromosomal inversions can reduce gene flow and promote speciation in two ways: by suppressing recombination and by carrying locally favored alleles at multiple loci. However, it is unknown whether favored mutations slowly accumulate on older inversions or if young inversions spread because they capture preexisting adaptive Quantitative Trait Loci (QTLs). By genetic mapping, chromosome painting and genome sequencing we have identified a major inversion controlling ecologically important traits in Boechera stricta. The inversion arose since the last glaciation and subsequently reached local high frequency in a hybrid speciation zone. Furthermore, the inversion shows signs of positive directional selection. To test whether the inversion could have captured existing, linked QTLs, we crossed standard, collinear haplotypes from the hybrid zone and found multiple linked phenology QTLs within the inversion region. These findings provide the first direct evidence that linked, locally adapted QTLs may be captured by young inversions during incipient speciation. PMID:28812690

Ignoring heterozygous sites biases phylogenomic estimates of divergence times: implications for the evolutionary history of microtus voles.

PubMed

Lischer, Heidi E L; Excoffier, Laurent; Heckel, Gerald

2014-04-01

Phylogenetic reconstruction of the evolutionary history of closely related organisms may be difficult because of the presence of unsorted lineages and of a relatively high proportion of heterozygous sites that are usually not handled well by phylogenetic programs. Genomic data may provide enough fixed polymorphisms to resolve phylogenetic trees, but the diploid nature of sequence data remains analytically challenging. Here, we performed a phylogenomic reconstruction of the evolutionary history of the common vole (Microtus arvalis) with a focus on the influence of heterozygosity on the estimation of intraspecific divergence times. We used genome-wide sequence information from 15 voles distributed across the European range. We provide a novel approach to integrate heterozygous information in existing phylogenetic programs by repeated random haplotype sampling from sequences with multiple unphased heterozygous sites. We evaluated the impact of the use of full, partial, or no heterozygous information for tree reconstructions on divergence time estimates. All results consistently showed four deep and strongly supported evolutionary lineages in the vole data. These lineages undergoing divergence processes split only at the end or after the last glacial maximum based on calibration with radiocarbon-dated paleontological material. However, the incorporation of information from heterozygous sites had a significant impact on absolute and relative branch length estimations. Ignoring heterozygous information led to an overestimation of divergence times between the evolutionary lineages of M. arvalis. We conclude that the exclusion of heterozygous sites from evolutionary analyses may cause biased and misleading divergence time estimates in closely related taxa.