Sample records for haplotypes resolve multiple

  1. De novo assembly of a haplotype-resolved human genome.

    PubMed

    Cao, Hongzhi; Wu, Honglong; Luo, Ruibang; Huang, Shujia; Sun, Yuhui; Tong, Xin; Xie, Yinlong; Liu, Binghang; Yang, Hailong; Zheng, Hancheng; Li, Jian; Li, Bo; Wang, Yu; Yang, Fang; Sun, Peng; Liu, Siyang; Gao, Peng; Huang, Haodong; Sun, Jing; Chen, Dan; He, Guangzhu; Huang, Weihua; Huang, Zheng; Li, Yue; Tellier, Laurent C A M; Liu, Xiao; Feng, Qiang; Xu, Xun; Zhang, Xiuqing; Bolund, Lars; Krogh, Anders; Kristiansen, Karsten; Drmanac, Radoje; Drmanac, Snezana; Nielsen, Rasmus; Li, Songgang; Wang, Jian; Yang, Huanming; Li, Yingrui; Wong, Gane Ka-Shu; Wang, Jun

    2015-06-01

    The human genome is diploid, and knowledge of the variants on each chromosome is important for the interpretation of genomic information. Here we report the assembly of a haplotype-resolved diploid genome without using a reference genome. Our pipeline relies on fosmid pooling together with whole-genome shotgun strategies, based solely on next-generation sequencing and hierarchical assembly methods. We applied our sequencing method to the genome of an Asian individual and generated a 5.15-Gb assembled genome with a haplotype N50 of 484 kb. Our analysis identified previously undetected indels and 7.49 Mb of novel coding sequences that could not be aligned to the human reference genome, which include at least six predicted genes. This haplotype-resolved genome represents the most complete de novo human genome assembly to date. Application of our approach to identify individual haplotype differences should aid in translating genotypes to phenotypes for the development of personalized medicine.

  2. Single-molecule dilution and multiple displacement amplification for molecular haplotyping.

    PubMed

    Paul, Philip; Apgar, Josh

    2005-04-01

    Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.

  3. A comprehensively molecular haplotype-resolved genome of a European individual

    PubMed Central

    Suk, Eun-Kyung; McEwen, Gayle K.; Duitama, Jorge; Nowick, Katja; Schulz, Sabrina; Palczewski, Stefanie; Schreiber, Stefan; Holloway, Dustin T.; McLaughlin, Stephen; Peckham, Heather; Lee, Clarence; Huebsch, Thomas; Hoehe, Margret R.

    2011-01-01

    Independent determination of both haplotype sequences of an individual genome is essential to relate genetic variation to genome function, phenotype, and disease. To address the importance of phase, we have generated the most complete haplotype-resolved genome to date, “Max Planck One” (MP1), by fosmid pool-based next generation sequencing. Virtually all SNPs (>99%) and 80,000 indels were phased into haploid sequences of up to 6.3 Mb (N50 ∼1 Mb). The completeness of phasing allowed determination of the concrete molecular haplotype pairs for the vast majority of genes (81%) including potential regulatory sequences, of which >90% were found to be constituted by two different molecular forms. A subset of 159 genes with potentially severe mutations in either cis or trans configurations exemplified in particular the role of phase for gene function, disease, and clinical interpretation of personal genomes (e.g., BRCA1). Extended genomic regions harboring manifold combinations of physically and/or functionally related genes and regulatory elements were resolved into their underlying “haploid landscapes,” which may define the functional genome. Moreover, the majority of genes and functional sequences were found to contain individual or rare SNPs, which cannot be phased from population data alone, emphasizing the importance of molecular phasing for characterizing a genome in its molecular individuality. Our work provides the foundation to understand that the distinction of molecular haplotypes is essential to resolve the (inherently individual) biology of genes, genomes, and disease, establishing a reference point for “phase-sensitive” personal genomics. MP1's annotated haploid genomes are available as a public resource. PMID:21813624

  4. cFinder: definition and quantification of multiple haplotypes in a mixed sample.

    PubMed

    Niklas, Norbert; Hafenscher, Julia; Barna, Agnes; Wiesinger, Karin; Pröll, Johannes; Dreiseitl, Stephan; Preuner-Stix, Sandra; Valent, Peter; Lion, Thomas; Gabriel, Christian

    2015-09-07

    Next-generation sequencing allows for determining the genetic composition of a mixed sample. For instance, when performing resistance testing for BCR-ABL1 it is necessary to identify clones and define compound mutations; together with an exact quantification this may complement diagnosis and therapy decisions with additional information. Moreover, that applies not only to oncological issues but also determination of viral, bacterial or fungal infection. The efforts to retrieve multiple haplotypes (more than two) and proportion information from data with conventional software are difficult, cumbersome and demand multiple manual steps. Therefore, we developed a tool called cFinder that is capable of automatic detection of haplotypes and their accurate quantification within one sample. BCR-ABL1 samples containing multiple clones were used for testing and our cFinder could identify all previously found clones together with their abundance and even refine some results. Additionally, reads were simulated using GemSIM with multiple haplotypes, the detection was very close to linear (R(2) = 0.96). Our aim is not to deduce haploblocks over statistics, but to characterize one sample's composition precisely. As a result the cFinder reports the connections of variants (haplotypes) with their readcount and relative occurrence (percentage). Download is available at http://sourceforge.net/projects/cfinder/. Our cFinder is implemented in an efficient algorithm that can be run on a low-performance desktop computer. Furthermore, it considers paired-end information (if available) and is generally open for any current next-generation sequencing technology and alignment strategy. To our knowledge, this is the first software that enables researchers without extensive bioinformatic support to designate multiple haplotypes and how they constitute to a sample.

  5. Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR.

    PubMed

    Tyson, Jess; Armour, John A L

    2012-12-11

    Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.

  6. Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR

    PubMed Central

    2012-01-01

    Background Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. Results In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. Conclusion This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example. PMID:23231411

  7. A powerful approach reveals numerous expression quantitative trait haplotypes in multiple tissues.

    PubMed

    Ying, Dingge; Li, Mulin Jun; Sham, Pak Chung; Li, Miaoxin

    2018-04-26

    Recently many studies showed single nucleotide polymorphisms (SNPs) affect gene expression and contribute to development of complex traits/diseases in a tissue context-dependent manner. However, little is known about haplotype's influence on gene expression and complex traits, which reflects the interaction effect between SNPs. In the present study, we firstly proposed a regulatory region guided eQTL haplotype association analysis approach, and then systematically investigate the expression quantitative trait loci (eQTL) haplotypes in 20 different tissues by the approach. The approach has a powerful design of reducing computational burden by the utilization of regulatory predictions for candidate SNP selection and multiple testing corrections on non-independent haplotypes. The application results in multiple tissues showed that haplotype-based eQTLs not only increased the number of eQTL genes in a tissue specific manner, but were also enriched in loci that associated with complex traits in a tissue-matched manner. In addition, we found that tag SNPs of eQTL haplotypes from whole blood were selectively enriched in certain combination of regulatory elements (e.g. promoters and enhancers) according to predicted chromatin states. In summary, this eQTL haplotype detection approach, together with the application results, shed insights into synergistic effect of sequence variants on gene expression and their susceptibility to complex diseases. The executable application "eHaplo" is implemented in Java and is publicly available at http://grass.cgs.hku.hk/limx/ehaplo/. jonsonfox@gmail.com, limiaoxin@mail.sysu.edu.cn. Supplementary data are available at Bioinformatics online.

  8. Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood.

    PubMed

    Hammer, Michael F; Behar, Doron M; Karafet, Tatiana M; Mendez, Fernando L; Hallmark, Brian; Erez, Tamar; Zhivotovsky, Lev A; Rosset, Saharon; Skorecki, Karl

    2009-11-01

    It has been known for over a decade that a majority of men who self report as members of the Jewish priesthood (Cohanim) carry a characteristic Y chromosome haplotype termed the Cohen Modal Haplotype (CMH). The CMH has since been used to trace putative Jewish ancestral origins of various populations. However, the limited number of binary and STR Y chromosome markers used previously did not provide the phylogenetic resolution needed to infer the number of independent paternal lineages that are encompassed within the Cohanim or their coalescence times. Accordingly, we have genotyped 75 binary markers and 12 Y-STRs in a sample of 215 Cohanim from diverse Jewish communities, 1,575 Jewish men from across the range of the Jewish Diaspora, and 2,099 non-Jewish men from the Near East, Europe, Central Asia, and India. While Cohanim from diverse backgrounds carry a total of 21 Y chromosome haplogroups, 5 haplogroups account for 79.5% of Cohanim Y chromosomes. The most frequent Cohanim lineage (46.1%) is marked by the recently reported P58 T->C mutation, which is prevalent in the Near East. Based on genotypes at 12 Y-STRs, we identify an extended CMH on the J-P58* background that predominates in both Ashkenazi and non-Ashkenazi Cohanim and is remarkably absent in non-Jews. The estimated divergence time of this lineage based on 17 STRs is 3,190 +/- 1,090 years. Notably, the second most frequent Cohanim lineage (J-M410*, 14.4%) contains an extended modal haplotype that is also limited to Ashkenazi and non-Ashkenazi Cohanim and is estimated to be 4.2 +/- 1.3 ky old. These results support the hypothesis of a common origin of the CMH in the Near East well before the dispersion of the Jewish people into separate communities, and indicate that the majority of contemporary Jewish priests descend from a limited number of paternal lineages.

  9. Genetic Dissection of the Human Leukocyte Antigen Region by Use of Haplotypes of Tasmanians with Multiple Sclerosis

    PubMed Central

    Rubio, Justin P.; Bahlo, Melanie; Butzkueven, Helmut; van der Mei, Ingrid A. F.; Sale, Michèle M.; Dickinson, Joanne L.; Groom, Patricia; Johnson, Laura J.; Simmons, Rex D.; Tait, Brian; Varney, Mike; Taylor, Bruce; Dwyer, Terence; Williamson, Robert; Gough, Nicholas M.; Kilpatrick, Trevor J.; Speed, Terence P.; Foote, Simon J.

    2002-01-01

    Association of multiple sclerosis (MS) with the human leukocyte antigen (HLA) class II haplotype DRB1*1501-DQB1*0602 is the most consistently replicated finding of genetic studies of the disease. However, the high level of linkage disequilibrium (LD) in the HLA region has hindered the identification of other loci that single-marker tests for association are unlikely to resolve. In order to address this issue, we generated haplotypes spanning 14.754 Mb (5 cM) across the entire HLA region. The haplotypes, which were inferred by genotyping relatives of 152 patients with MS and 105 unaffected control subjects of Tasmanian ancestry, define a genomic segment from D6S276 to D6S291, including 13 microsatellite markers integrated with allele-typing data for DRB1 and DQB1. Association to the DRB1*1501-DQB1*0602 haplotype was replicated. In addition, we found that the class I/extended class I region, defined by a genomic segment of ∼400 kb between MOGCA and D6S265, harbors genes that independently increase risk of, or provide protection from, MS. Log-linear modeling analysis of constituent haplotypes that represent genomic regions containing class I (MOGCA-D6S265), class III (TNFa-TNFd-D6S273), and class II (DRB1-DQB1) genes indicated that having class I and class II susceptibility variants on the same haplotype provides an additive effect on risk. Moreover, we found no evidence for a disease locus in the class III region defined by a 150-kb genomic segment containing the TNF locus and 14 other genes. A global overview of LD performed using GOLD identified two discrete blocks of LD in the HLA region that correspond well with previous findings. We propose that the analysis of haplotypes, by use of the types of approaches outlined in the present article, should make it possible to more accurately define the contribution of the HLA to MS. PMID:11923913

  10. Intrahaplotypic Variants Differentiate Complex Linkage Disequilibrium within Human MHC Haplotypes

    PubMed Central

    Lam, Tze Hau; Tay, Matthew Zirui; Wang, Bei; Xiao, Ziwei; Ren, Ee Chee

    2015-01-01

    Distinct regions of long-range genetic fixation in the human MHC region, known as conserved extended haplotypes (CEHs), possess unique genomic characteristics and are strongly associated with numerous diseases. While CEHs appear to be homogeneous by SNP analysis, the nature of fine variations within their genomic structure is unknown. Using multiple, MHC-homozygous cell lines, we demonstrate extensive sequence conservation in two common Asian MHC haplotypes: A33-B58-DR3 and A2-B46-DR9. However, characterization of phase-resolved MHC haplotypes revealed unique intra-CEH patterns of variation and uncovered 127 single nucleotide variants (SNVs) which are missing from public databases. We further show that the strong linkage disequilibrium structure within the human MHC that typically confounds precise identification of genetic features can be resolved using intra-CEH variants, as evidenced by rs3129063 and rs448489, which affect expression of ZFP57, a gene important in methylation and epigenetic regulation. This study demonstrates an improved strategy that can be used towards genetic dissection of diseases. PMID:26593880

  11. The haplotype-resolved genome and epigenome of the aneuploid HeLa cancer cell line.

    PubMed

    Adey, Andrew; Burton, Joshua N; Kitzman, Jacob O; Hiatt, Joseph B; Lewis, Alexandra P; Martin, Beth K; Qiu, Ruolan; Lee, Choli; Shendure, Jay

    2013-08-08

    The HeLa cell line was established in 1951 from cervical cancer cells taken from a patient, Henrietta Lacks. This was the first successful attempt to immortalize human-derived cells in vitro. The robust growth and unrestricted distribution of HeLa cells resulted in its broad adoption--both intentionally and through widespread cross-contamination--and for the past 60 years it has served a role analogous to that of a model organism. The cumulative impact of the HeLa cell line on research is demonstrated by its occurrence in more than 74,000 PubMed abstracts (approximately 0.3%). The genomic architecture of HeLa remains largely unexplored beyond its karyotype, partly because like many cancers, its extensive aneuploidy renders such analyses challenging. We carried out haplotype-resolved whole-genome sequencing of the HeLa CCL-2 strain, examined point- and indel-mutation variations, mapped copy-number variations and loss of heterozygosity regions, and phased variants across full chromosome arms. We also investigated variation and copy-number profiles for HeLa S3 and eight additional strains. We find that HeLa is relatively stable in terms of point variation, with few new mutations accumulating after early passaging. Haplotype resolution facilitated reconstruction of an amplified, highly rearranged region of chromosome 8q24.21 at which integration of the human papilloma virus type 18 (HPV-18) genome occurred and that is likely to be the event that initiated tumorigenesis. We combined these maps with RNA-seq and ENCODE Project data sets to phase the HeLa epigenome. This revealed strong, haplotype-specific activation of the proto-oncogene MYC by the integrated HPV-18 genome approximately 500 kilobases upstream, and enabled global analyses of the relationship between gene dosage and expression. These data provide an extensively phased, high-quality reference genome for past and future experiments relying on HeLa, and demonstrate the value of haplotype resolution for

  12. Recent Advances in Experimental Whole Genome Haplotyping Methods

    PubMed Central

    Huang, Mengting; Lu, Zuhong

    2017-01-01

    Haplotype plays a vital role in diverse fields; however, the sequencing technologies cannot resolve haplotype directly. Pioneers demonstrated several approaches to resolve haplotype in the early years, which was extensively reviewed. Since then, numerous methods have been developed recently that have significantly improved phasing performance. Here, we review experimental methods that have emerged mainly over the past five years, and categorize them into five classes according to their maximum scale of contiguity: (i) encapsulation, (ii) 3D structure capture and construction, (iii) compartmentalization, (iv) fluorography, (v) long-read sequencing. Several subsections of certain methods are attached to each class as instances. We also discuss the relative advantages and disadvantages of different classes and make comparisons among representative methods of each class. PMID:28891974

  13. Haplotyping for disease association: a combinatorial approach.

    PubMed

    Lancia, Giuseppe; Ravi, R; Rizzi, Romeo

    2008-01-01

    We consider a combinatorial problem derived from haplotyping a population with respect to a genetic disease, either recessive or dominant. Given a set of individuals, partitioned into healthy and diseased, and the corresponding sets of genotypes, we want to infer "bad'' and "good'' haplotypes to account for these genotypes and for the disease. Assume e.g. the disease is recessive. Then, the resolving haplotypes must consist of bad and good haplotypes, so that (i) each genotype belonging to a diseased individual is explained by a pair of bad haplotypes and (ii) each genotype belonging to a healthy individual is explained by a pair of haplotypes of which at least one is good. We prove that the associated decision problem is NP-complete. However, we also prove that there is a simple solution, provided the data satisfy a very weak requirement.

  14. Efficient algorithms for polyploid haplotype phasing.

    PubMed

    He, Dan; Saha, Subrata; Finkers, Richard; Parida, Laxmi

    2018-05-09

    Inference of haplotypes, or the sequence of alleles along the same chromosomes, is a fundamental problem in genetics and is a key component for many analyses including admixture mapping, identifying regions of identity by descent and imputation. Haplotype phasing based on sequencing reads has attracted lots of attentions. Diploid haplotype phasing where the two haplotypes are complimentary have been studied extensively. In this work, we focused on Polyploid haplotype phasing where we aim to phase more than two haplotypes at the same time from sequencing data. The problem is much more complicated as the search space becomes much larger and the haplotypes do not need to be complimentary any more. We proposed two algorithms, (1) Poly-Harsh, a Gibbs Sampling based algorithm which alternatively samples haplotypes and the read assignments to minimize the mismatches between the reads and the phased haplotypes, (2) An efficient algorithm to concatenate haplotype blocks into contiguous haplotypes. Our experiments showed that our method is able to improve the quality of the phased haplotypes over the state-of-the-art methods. To our knowledge, our algorithm for haplotype blocks concatenation is the first algorithm that leverages the shared information across multiple individuals to construct contiguous haplotypes. Our experiments showed that it is both efficient and effective.

  15. Haplotype Analysis in Multiple Crosses to Identify a QTL Gene

    PubMed Central

    Wang, Xiaosong; Korstanje, Ron; Higgins, David; Paigen, Beverly

    2004-01-01

    Identifying quantitative trait locus (QTL) genes is a challenging task. Herein, we report using a two-step process to identify Apoa2 as the gene underlying Hdlq5, a QTL for plasma high-density lipoprotein cholesterol (HDL) levels on mouse chromosome 1. First, we performed a sequence analysis of the Apoa2 coding region in 46 genetically diverse mouse strains and found five different APOA2 protein variants, which we named APOA2a to APOA2e. Second, we conducted a haplotype analysis of the strains in 21 crosses that have so far detected HDL QTLs; we found that Hdlq5 was detected only in the nine crosses where one parent had the APOA2b protein variant characterized by an Ala61-to-Val61 substitution. We then found that strains with the APOA2b variant had significantly higher (P ≤ 0.002) plasma HDL levels than those with either the APOA2a or the APOA2c variant. These findings support Apoa2 as the underlying Hdlq5 gene and suggest the Apoa2 polymorphisms responsible for the Hdlq5 phenotype. Therefore, haplotype analysis in multiple crosses can be used to support a candidate QTL gene. PMID:15310659

  16. Haplotype analysis in multiple crosses to identify a QTL gene.

    PubMed

    Wang, Xiaosong; Korstanje, Ron; Higgins, David; Paigen, Beverly

    2004-09-01

    Identifying quantitative trait locus (QTL) genes is a challenging task. Herein, we report using a two-step process to identify Apoa2 as the gene underlying Hdlq5, a QTL for plasma high-density lipoprotein cholesterol (HDL) levels on mouse chromosome 1. First, we performed a sequence analysis of the Apoa2 coding region in 46 genetically diverse mouse strains and found five different APOA2 protein variants, which we named APOA2a to APOA2e. Second, we conducted a haplotype analysis of the strains in 21 crosses that have so far detected HDL QTLs; we found that Hdlq5 was detected only in the nine crosses where one parent had the APOA2b protein variant characterized by an Ala61-to-Val61 substitution. We then found that strains with the APOA2b variant had significantly higher (P < or = 0.002) plasma HDL levels than those with either the APOA2a or the APOA2c variant. These findings support Apoa2 as the underlying Hdlq5 gene and suggest the Apoa2 polymorphisms responsible for the Hdlq5 phenotype. Therefore, haplotype analysis in multiple crosses can be used to support a candidate QTL gene.

  17. Haplotype Phasing and Inheritance of Copy Number Variants in Nuclear Families

    PubMed Central

    Palta, Priit; Kaplinski, Lauris; Nagirnaja, Liina; Veidenberg, Andres; Möls, Märt; Nelis, Mari; Esko, Tõnu; Metspalu, Andres; Laan, Maris; Remm, Maido

    2015-01-01

    DNA copy number variants (CNVs) that alter the copy number of a particular DNA segment in the genome play an important role in human phenotypic variability and disease susceptibility. A number of CNVs overlapping with genes have been shown to confer risk to a variety of human diseases thus highlighting the relevance of addressing the variability of CNVs at a higher resolution. So far, it has not been possible to deterministically infer the allelic composition of different haplotypes present within the CNV regions. We have developed a novel computational method, called PiCNV, which enables to resolve the haplotype sequence composition within CNV regions in nuclear families based on SNP genotyping microarray data. The algorithm allows to i) phase normal and CNV-carrying haplotypes in the copy number variable regions, ii) resolve the allelic copies of rearranged DNA sequence within the haplotypes and iii) infer the heritability of identified haplotypes in trios or larger nuclear families. To our knowledge this is the first program available that can deterministically phase null, mono-, di-, tri- and tetraploid genotypes in CNV loci. We applied our method to study the composition and inheritance of haplotypes in CNV regions of 30 HapMap Yoruban trios and 34 Estonian families. For 93.6% of the CNV loci, PiCNV enabled to unambiguously phase normal and CNV-carrying haplotypes and follow their transmission in the corresponding families. Furthermore, allelic composition analysis identified the co-occurrence of alternative allelic copies within 66.7% of haplotypes carrying copy number gains. We also observed less frequent transmission of CNV-carrying haplotypes from parents to children compared to normal haplotypes and identified an emergence of several de novo deletions and duplications in the offspring. PMID:25853576

  18. Haplotype phasing and inheritance of copy number variants in nuclear families.

    PubMed

    Palta, Priit; Kaplinski, Lauris; Nagirnaja, Liina; Veidenberg, Andres; Möls, Märt; Nelis, Mari; Esko, Tõnu; Metspalu, Andres; Laan, Maris; Remm, Maido

    2015-01-01

    DNA copy number variants (CNVs) that alter the copy number of a particular DNA segment in the genome play an important role in human phenotypic variability and disease susceptibility. A number of CNVs overlapping with genes have been shown to confer risk to a variety of human diseases thus highlighting the relevance of addressing the variability of CNVs at a higher resolution. So far, it has not been possible to deterministically infer the allelic composition of different haplotypes present within the CNV regions. We have developed a novel computational method, called PiCNV, which enables to resolve the haplotype sequence composition within CNV regions in nuclear families based on SNP genotyping microarray data. The algorithm allows to i) phase normal and CNV-carrying haplotypes in the copy number variable regions, ii) resolve the allelic copies of rearranged DNA sequence within the haplotypes and iii) infer the heritability of identified haplotypes in trios or larger nuclear families. To our knowledge this is the first program available that can deterministically phase null, mono-, di-, tri- and tetraploid genotypes in CNV loci. We applied our method to study the composition and inheritance of haplotypes in CNV regions of 30 HapMap Yoruban trios and 34 Estonian families. For 93.6% of the CNV loci, PiCNV enabled to unambiguously phase normal and CNV-carrying haplotypes and follow their transmission in the corresponding families. Furthermore, allelic composition analysis identified the co-occurrence of alternative allelic copies within 66.7% of haplotypes carrying copy number gains. We also observed less frequent transmission of CNV-carrying haplotypes from parents to children compared to normal haplotypes and identified an emergence of several de novo deletions and duplications in the offspring.

  19. Haplotype diversity in 11 candidate genes across four populations.

    PubMed

    Beaty, T H; Fallin, M D; Hetmanski, J B; McIntosh, I; Chong, S S; Ingersoll, R; Sheng, X; Chakraborty, R; Scott, A F

    2005-09-01

    Analysis of haplotypes based on multiple single-nucleotide polymorphisms (SNP) is becoming common for both candidate gene and fine-mapping studies. Before embarking on studies of haplotypes from genetically distinct populations, however, it is important to consider variation both in linkage disequilibrium (LD) and in haplotype frequencies within and across populations, as both vary. Such diversity will influence the choice of "tagging" SNPs for candidate gene or whole-genome association studies because some markers will not be polymorphic in all samples and some haplotypes will be poorly represented or completely absent. Here we analyze 11 genes, originally chosen as candidate genes for oral clefts, where multiple markers were genotyped on individuals from four populations. Estimated haplotype frequencies, measures of pairwise LD, and genetic diversity were computed for 135 European-Americans, 57 Chinese-Singaporeans, 45 Malay-Singaporeans, and 46 Indian-Singaporeans. Patterns of pairwise LD were compared across these four populations and haplotype frequencies were used to assess genetic variation. Although these populations are fairly similar in allele frequencies and overall patterns of LD, both haplotype frequencies and genetic diversity varied significantly across populations. Such haplotype diversity has implications for designing studies of association involving samples from genetically distinct populations.

  20. A parsimonious tree-grow method for haplotype inference.

    PubMed

    Li, Zhenping; Zhou, Wenfeng; Zhang, Xiang-Sun; Chen, Luonan

    2005-09-01

    Haplotype information has become increasingly important in analyzing fine-scale molecular genetics data, such as disease genes mapping and drug design. Parsimony haplotyping is one of haplotyping problems belonging to NP-hard class. In this paper, we aim to develop a novel algorithm for the haplotype inference problem with the parsimony criterion, based on a parsimonious tree-grow method (PTG). PTG is a heuristic algorithm that can find the minimum number of distinct haplotypes based on the criterion of keeping all genotypes resolved during tree-grow process. In addition, a block-partitioning method is also proposed to improve the computational efficiency. We show that the proposed approach is not only effective with a high accuracy, but also very efficient with the computational complexity in the order of O(m2n) time for n single nucleotide polymorphism sites in m individual genotypes. The software is available upon request from the authors, or from http://zhangroup.aporc.org/bioinfo/ptg/ chen@elec.osaka-sandai.ac.jp Supporting materials is available from http://zhangroup.aporc.org/bioinfo/ptg/bti572supplementary.pdf

  1. Detecting disease-predisposing variants: the haplotype method.

    PubMed Central

    Valdes, A M; Thomson, G

    1997-01-01

    For many HLA-associated diseases, multiple alleles-- and, in some cases, multiple loci--have been suggested as the causative agents. The haplotype method for identifying disease-predisposing amino acids in a genetic region is a stratification analysis. We show that, for each haplotype combination containing all the amino acid sites involved in the disease process, the relative frequencies of amino acid variants at sites not involved in disease but in linkage disequilibrium with the disease-predisposing sites are expected to be the same in patients and controls. The haplotype method is robust to mode of inheritance and penetrance of the disease and can be used to determine unequivocally whether all amino acid sites involved in the disease have not been identified. Using a resampling technique, we developed a statistical test that takes account of the nonindependence of the sites sampled. Further, when multiple sites in the genetic region are involved in disease, the test statistic gives a closer fit to the null expectation when some--compared with none--of the true predisposing factors are included in the haplotype analysis. Although the haplotype method cannot distinguish between very highly correlated sites in one population, ethnic comparisons may help identify the true predisposing factors. The haplotype method was applied to insulin-dependent diabetes mellitus (IDDM) HLA class II DQA1-DQB1 data from Caucasian, African, and Japanese populations. Our results indicate that the combination DQA1#52 (Arg predisposing) DQB1#57 (Asp protective), which has been proposed as an important IDDM agent, does not include all the predisposing elements. With rheumatoid arthritis HLA class II DRB1 data, the results were consistent with the shared-epitope hypothesis. PMID:9042931

  2. Detecting local haplotype sharing and haplotype association

    USDA-ARS?s Scientific Manuscript database

    A novel haplotype association method is presented, and its power is demonstrated. Relying on a statistical model for linkage disequilibrium (LD), the method first infers ancestral haplotypes and their loadings at each marker for each individual. The loadings are then used to quantify local haplotype...

  3. HaploForge: a comprehensive pedigree drawing and haplotype visualization web application.

    PubMed

    Tekman, Mehmet; Medlar, Alan; Mozere, Monika; Kleta, Robert; Stanescu, Horia

    2017-12-15

    Haplotype reconstruction is an important tool for understanding the aetiology of human disease. Haplotyping infers the most likely phase of observed genotypes conditional on constraints imposed by the genotypes of other pedigree members. The results of haplotype reconstruction, when visualized appropriately, show which alleles are identical by descent despite the presence of untyped individuals. When used in concert with linkage analysis, haplotyping can help delineate a locus of interest and provide a succinct explanation for the transmission of the trait locus. Unfortunately, the design choices made by existing haplotype visualization programs do not scale to large numbers of markers. Indeed, following haplotypes from generation to generation requires excessive scrolling back and forth. In addition, the most widely used program for haplotype visualization produces inconsistent recombination artefacts for the X chromosome. To resolve these issues, we developed HaploForge, a novel web application for haplotype visualization and pedigree drawing. HaploForge takes advantage of HTML5 to be fast, portable and avoid the need for local installation. It can accurately visualize autosomal and X-linked haplotypes from both outbred and consanguineous pedigrees. Haplotypes are coloured based on identity by descent using a novel A* search algorithm and we provide a flexible viewing mode to aid visual inspection. HaploForge can currently process haplotype reconstruction output from Allegro, GeneHunter, Merlin and Simwalk. HaploForge is licensed under GPLv3 and is hosted and maintained via GitHub. https://github.com/mtekman/haploforge. r.kleta@ucl.ac.uk. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  4. Haplotype Reconstruction in Large Pedigrees with Many Untyped Individuals

    NASA Astrophysics Data System (ADS)

    Li, Xin; Li, Jing

    Haplotypes, as they specify the linkage patterns between dispersed genetic variations, provide important information for understanding the genetics of human traits. However haplotypes are not directly available from current genotyping platforms, and hence there are extensive investigations of computational methods to recover such information. Two major computational challenges arising in current family-based disease studies are large family sizes and many ungenotyped family members. Traditional haplotyping methods can neither handle large families nor families with missing members. In this paper, we propose a method which addresses these issues by integrating multiple novel techniques. The method consists of three major components: pairwise identical-bydescent (IBD) inference, global IBD reconstruction and haplotype restoring. By reconstructing the global IBD of a family from pairwise IBD and then restoring the haplotypes based on the inferred IBD, this method can scale to large pedigrees, and more importantly it can handle families with missing members. Compared with existing methods, this method demonstrates much higher power to recover haplotype information, especially in families with many untyped individuals.

  5. Development of an Italian RM Y-STR haplotype database: Results of the 2013 GEFI collaborative exercise.

    PubMed

    Robino, C; Ralf, A; Pasino, S; De Marchi, M R; Ballantyne, K N; Barbaro, A; Bini, C; Carnevali, E; Casarino, L; Di Gaetano, C; Fabbri, M; Ferri, G; Giardina, E; Gonzalez, A; Matullo, G; Nutini, A L; Onofri, V; Piccinini, A; Piglionica, M; Ponzano, E; Previderè, C; Resta, N; Scarnicci, F; Seidita, G; Sorçaburu-Cigliero, S; Turrina, S; Verzeletti, A; Kayser, M

    2015-03-01

    Recently introduced rapidly mutating Y-chromosomal short tandem repeat (RM Y-STR) loci, displaying a multiple-fold higher mutation rate relative to any other Y-STRs, including those conventionally used in forensic casework, have been demonstrated to improve the resolution of male lineage differentiation and to allow male relative separation usually impossible with standard Y-STRs. However, large and geographically-detailed frequency haplotype databases are required to estimate the statistical weight of RM Y-STR haplotype matches if observed in forensic casework. With this in mind, the Italian Working Group (GEFI) of the International Society for Forensic Genetics launched a collaborative exercise aimed at generating an Italian quality controlled forensic RM Y-STR haplotype database. Overall 1509 male individuals from 13 regional populations covering northern, central and southern areas of the Italian peninsula plus Sicily were collected, including both "rural" and "urban" samples classified according to population density in the sampling area. A subset of individuals was additionally genotyped for Y-STR loci included in the Yfiler and PowerPlex Y23 (PPY23) systems (75% and 62%, respectively), allowing the comparison of RM and conventional Y-STRs. Considering the whole set of 13 RM Y-STRs, 1501 unique haplotypes were observed among the 1509 sampled Italian men with a haplotype diversity of 0.999996, largely superior to Yfiler and PPY23 with 0.999914 and 0.999950, respectively. AMOVA indicated that 99.996% of the haplotype variation was within populations, confirming that genetic-geographic structure is almost undetected by RM Y-STRs. Haplotype sharing among regional Italian populations was not observed at all with the complete set of 13 RM Y-STRs. Haplotype sharing within Italian populations was very rare (0.27% non-unique haplotypes), and lower in urban (0.22%) than rural (0.29%) areas. Additionally, 422 father-son pairs were investigated, and 20.1% of them could

  6. Phylogeographic study of Chinese seabuckthorn (Hippophae rhamnoides subsp. sinensis Rousi) reveals two distinct haplotype groups and multiple microrefugia on the Qinghai-Tibet Plateau

    PubMed Central

    Wang, Hongfang; Liu, Han; Yang, Mingbo; Bao, Lei; Ge, Jianping

    2014-01-01

    Historical climate change can shape the genetic pattern of a species. Studies on this phenomenon provide great advantage in predicting the response of species to current and future global climate change. Chinese seabuckthorn (Hippophae rhamnoides subsp. sinensis) is one of the most important cultivated plants in Northwest China. However, the subspecies history and the potential genetic resources within the subspecies range remain unclear. In this study, we utilized two intergenic chloroplast regions to characterize the spatial genetic distribution of the species. We found 19 haplotypes in total, 12 of which were unique to the Chinese seabuckthorn. The populations observed on the Qinghai-Tibet Plateau (QTP) consisted of most of the haplotypes, while in the northeast of the range of the subspecies, an area not on the QTP, only four haplotypes were detected. Our study also revealed two distinct haplotype groups of the subspecies with a sharp transition region located in the south of the Zoige Basin. 89.96% of the genetic variation located between the regions. Mismatch analysis indicated old expansions of these two haplotype groups, approximately around the early stage of Pleistocene. Additional morphological proofs from existing studies and habitat differentiation supported a long independent colonization history among the two regions. Potential adaptation probably occurred but needs more genome and morphology data in future. Chinese seabuckthorn have an older population expansion compared with subspecies in Europe. The lack of large land ice sheets and the heterogeneous landscape of the QTP could have provided extensive microrefugia for Chinese seabuckthorn during the glaciation period. Multiple localities sustaining high-frequency private haplotypes support this hypothesis. Our study gives clear insight into the distribution of genetic resources and the evolutionary history of Chinese seabuckthorn. PMID:25540697

  7. Next generation haplotyping to decipher nuclear genomic interspecific admixture in Citrus species: analysis of chromosome 2.

    PubMed

    Curk, Franck; Ancillo, Gema; Garcia-Lor, Andres; Luro, François; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Navarro, Luis; Ollitrault, Patrick

    2014-12-29

    The most economically important Citrus species originated by natural interspecific hybridization between four ancestral taxa (Citrus reticulata, Citrus maxima, Citrus medica, and Citrus micrantha) and from limited subsequent interspecific recombination as a result of apomixis and vegetative propagation. Such reticulate evolution coupled with vegetative propagation results in mosaic genomes with large chromosome fragments from the basic taxa in frequent interspecific heterozygosity. Modern breeding of these species is hampered by their complex heterozygous genomic structures that determine species phenotype and are broken by sexual hybridisation. Nevertheless, a large amount of diversity is present in the citrus gene pool, and breeding to allow inclusion of desirable traits is of paramount importance. However, the efficient mobilization of citrus biodiversity in innovative breeding schemes requires previous understanding of Citrus origins and genomic structures. Haplotyping of multiple gene fragments along the whole genome is a powerful approach to reveal the admixture genomic structure of current species and to resolve the evolutionary history of the gene pools. In this study, the efficiency of parallel sequencing with 454 methodology to decipher the hybrid structure of modern citrus species was assessed by analysis of 16 gene fragments on chromosome 2. 454 amplicon libraries were established using the Fluidigm array system for 48 genotypes and 16 gene fragments from chromosome 2. Haplotypes were established from the reads of each accession and phylogenetic analyses were performed using the haplotypic data for each gene fragment. The length of 454 reads and the level of differentiation between the ancestral taxa of modern citrus allowed efficient haplotype phylogenetic assignations for 12 of the 16 gene fragments. The analysis of the mixed genomic structure of modern species and cultivars (i) revealed C. maxima introgressions in modern mandarins, (ii) was

  8. Variation analysis and gene annotation of eight MHC haplotypes: The MHC Haplotype Project

    PubMed Central

    Horton, Roger; Gibson, Richard; Coggill, Penny; Miretti, Marcos; Allcock, Richard J.; Almeida, Jeff; Forbes, Simon; Gilbert, James G. R.; Halls, Karen; Harrow, Jennifer L.; Hart, Elizabeth; Howe, Kevin; Jackson, David K.; Palmer, Sophie; Roberts, Anne N.; Sims, Sarah; Stewart, C. Andrew; Traherne, James A.; Trevanion, Steve; Wilming, Laurens; Rogers, Jane; de Jong, Pieter J.; Elliott, John F.; Sawcer, Stephen; Todd, John A.; Trowsdale, John

    2008-01-01

    The human major histocompatibility complex (MHC) is contained within about 4 Mb on the short arm of chromosome 6 and is recognised as the most variable region in the human genome. The primary aim of the MHC Haplotype Project was to provide a comprehensively annotated reference sequence of a single, human leukocyte antigen-homozygous MHC haplotype and to use it as a basis against which variations could be assessed from seven other similarly homozygous cell lines, representative of the most common MHC haplotypes in the European population. Comparison of the haplotype sequences, including four haplotypes not previously analysed, resulted in the identification of >44,000 variations, both substitutions and indels (insertions and deletions), which have been submitted to the dbSNP database. The gene annotation uncovered haplotype-specific differences and confirmed the presence of more than 300 loci, including over 160 protein-coding genes. Combined analysis of the variation and annotation datasets revealed 122 gene loci with coding substitutions of which 97 were non-synonymous. The haplotype (A3-B7-DR15; PGF cell line) designated as the new MHC reference sequence, has been incorporated into the human genome assembly (NCBI35 and subsequent builds), and constitutes the largest single-haplotype sequence of the human genome to date. The extensive variation and annotation data derived from the analysis of seven further haplotypes have been made publicly available and provide a framework and resource for future association studies of all MHC-associated diseases and transplant medicine. PMID:18193213

  9. Ultraaccurate genome sequencing and haplotyping of single human cells.

    PubMed

    Chu, Wai Keung; Edge, Peter; Lee, Ho Suk; Bansal, Vikas; Bafna, Vineet; Huang, Xiaohua; Zhang, Kun

    2017-11-21

    Accurate detection of variants and long-range haplotypes in genomes of single human cells remains very challenging. Common approaches require extensive in vitro amplification of genomes of individual cells using DNA polymerases and high-throughput short-read DNA sequencing. These approaches have two notable drawbacks. First, polymerase replication errors could generate tens of thousands of false-positive calls per genome. Second, relatively short sequence reads contain little to no haplotype information. Here we report a method, which is dubbed SISSOR (single-stranded sequencing using microfluidic reactors), for accurate single-cell genome sequencing and haplotyping. A microfluidic processor is used to separate the Watson and Crick strands of the double-stranded chromosomal DNA in a single cell and to randomly partition megabase-size DNA strands into multiple nanoliter compartments for amplification and construction of barcoded libraries for sequencing. The separation and partitioning of large single-stranded DNA fragments of the homologous chromosome pairs allows for the independent sequencing of each of the complementary and homologous strands. This enables the assembly of long haplotypes and reduction of sequence errors by using the redundant sequence information and haplotype-based error removal. We demonstrated the ability to sequence single-cell genomes with error rates as low as 10 -8 and average 500-kb-long DNA fragments that can be assembled into haplotype contigs with N50 greater than 7 Mb. The performance could be further improved with more uniform amplification and more accurate sequence alignment. The ability to obtain accurate genome sequences and haplotype information from single cells will enable applications of genome sequencing for diverse clinical needs. Copyright © 2017 the Author(s). Published by PNAS.

  10. Resolvent-Techniques for Multiple Exercise Problems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Christensen, Sören, E-mail: christensen@math.uni-kiel.de; Lempa, Jukka, E-mail: jukka.lempa@hioa.no

    2015-02-15

    We study optimal multiple stopping of strong Markov processes with random refraction periods. The refraction periods are assumed to be exponentially distributed with a common rate and independent of the underlying dynamics. Our main tool is using the resolvent operator. In the first part, we reduce infinite stopping problems to ordinary ones in a general strong Markov setting. This leads to explicit solutions for wide classes of such problems. Starting from this result, we analyze problems with finitely many exercise rights and explain solution methods for some classes of problems with underlying Lévy and diffusion processes, where the optimal characteristicsmore » of the problems can be identified more explicitly. We illustrate the main results with explicit examples.« less

  11. Haplotype-Based Genotyping in Polyploids.

    PubMed

    Clevenger, Josh P; Korani, Walid; Ozias-Akins, Peggy; Jackson, Scott

    2018-01-01

    Accurate identification of polymorphisms from sequence data is crucial to unlocking the potential of high throughput sequencing for genomics. Single nucleotide polymorphisms (SNPs) are difficult to accurately identify in polyploid crops due to the duplicative nature of polyploid genomes leading to low confidence in the true alignment of short reads. Implementing a haplotype-based method in contrasting subgenome-specific sequences leads to higher accuracy of SNP identification in polyploids. To test this method, a large-scale 48K SNP array (Axiom Arachis2) was developed for Arachis hypogaea (peanut), an allotetraploid, in which 1,674 haplotype-based SNPs were included. Results of the array show that 74% of the haplotype-based SNP markers could be validated, which is considerably higher than previous methods used for peanut. The haplotype method has been implemented in a standalone program, HAPLOSWEEP, which takes as input bam files and a vcf file and identifies haplotype-based markers. Haplotype discovery can be made within single reads or span paired reads, and can leverage long read technology by targeting any length of haplotype. Haplotype-based genotyping is applicable in all allopolyploid genomes and provides confidence in marker identification and in silico-based genotyping for polyploid genomics.

  12. High density genotyping of STAT4 gene reveals multiple haplotypic associations with Systemic Lupus Erythematosus in different racial groups

    PubMed Central

    Namjou, Bahram; Sestak, Andrea L.; Armstrong, Don L.; Zidovetzki, Raphael; Kelly, Jennifer A.; Jacob, Noam; Ciobanu, Voicu; Kaufman, Kenneth M.; Ojwang, Joshua O.; Ziegler, Julie; Quismorio, Francesco; Reiff, Andreas; Myones, Barry L.; Guthridge, Joel M.; Nath, Swapan K.; Bruner, Gail R.; Mehrian-Shai, Ruth; Silverman, Earl; Klein-Gitelman, Marisa; McCurdy, Deborah; Wagner-Weiner, Linda; Nocton, James J.; Putterman, Chaim; Bae, Sang-Cheol; Kim, Yun Jung; Petri, Michelle; Reveille, John D.; Vyse, Timothy J.; Gilkeson, Gary S.; Kamen, Diane L.; Alarcón-Riquelme, Marta E.; Gaffney, Patrick M.; Moser, Kathy L; Merrill, Joan T.; Scofield, R. Hal; James, Judith A.; Langefeld, Carl D.; Harley, John B.; Jacob, Chaim O.

    2009-01-01

    Objective Systemic lupus erythematosus (SLE) is the prototypic systemic autoimmune disorder with complex etiology and a strong genetic component. Recently, gene products involved in the interferon pathway have been under intense investigation in SLE pathogenesis. STAT1 and STAT4 are transcription factors that play key roles in the interferon and Th1 signaling pathways, making them attractive candidates for SLE susceptibility. Methods Fifty-six single-nucleotide polymorphisms (SNPs) across STAT1 and STAT4 genes on chromosome 2 were genotyped using Illumina platform as a part of extensive association study in a large collection of 9923 lupus cases and controls from different racial groups. DNA from patients and controls was obtained from peripheral blood. Principal component analyses and population based case-control association analyses were performed and the p values, FDR q values and Odds ratios with 95% confidence intervals (95% CIs) were calculated. Results We observed strong genetic associations with SLE and multiple SNPs located within the STAT4 gene in different ethnicities (Fisher combined p= 7.02×10−25). In addition to strong confirmation of the association in the 3rd intronic region of this gene reported previously, we identified additional haplotypic association across STAT4 gene and in particular a common risk haplotype that is found in multiple racial groups. In contrast, only a relatively weak suggestive association was observed with STAT1, probably due to the proximity to STAT4. Conclusion Our findings indicate that the STAT4 gene is likely to be a crucial component in SLE pathogenesis among multiple racial groups. The functional effects of this association, when revealed, might improve our understanding of the disease and provide new therapeutic targets. PMID:19333953

  13. COI haplotype groups in Mesocriconema (Nematoda: Criconematidae) and their morphospecies associations.

    PubMed

    Powers, T O; Bernard, E C; Harris, T; Higgins, R; Olson, M; Lodema, M; Mullin, P; Sutton, L; Powers, K S

    2014-07-03

    Without applying an a priori bias for species boundaries, specimen identities in the plant-parasitic nematode genus Mesocriconema were evaluated by examining mitochondrial COI nucleotide sequences, morphology, and biogeography. A total of 242 specimens that morphologically conformed to the genus were individually photographed, measured, and amplified by a PCR primer set to preserve the linkage between specimen morphology and a specific DNA barcode sequence. Specimens were extracted from soil samples representing 45 locations across 23 ecoregions in North America. Dendrograms constructed by neighbor-joining, maximum likelihood, and Bayesian Inference using a 721-bp COI barcode were used to group COI haplotypes. Each tree-building approach resulted in 24 major haplotype groups within the dataset. The distinctiveness of these groups was evaluated by node support, genetic distance, absence of intermediates, and several measures of distinctiveness included in software used for the exploration of species boundaries. Five of the 24 COI haplotype groups corresponded to morphologically characterized, Linnaean species. Morphospecies conforming to M. discus, Discocriconemella inarata, M. rusticum, M. onoense, and M. kirjanovae were represented by groups composed of multiple closely related or identical COI haplotypes. In other cases, morphospecies names could be equally applied to multiple haplotype groups that were genetically distant from each other. Identification based on morphology alone resulted in M. curvatum and M. ornatum species designations applied to seven and three groups, respectively. Morphological characters typically used for species level identification were demonstrably variable within haplotype groups, suggesting caution in assigning species names based on published compendia that solely consider morphological characters. Morphospecies classified as M. xenoplax formed a monophyletic group composed of seven genetically distinct COI subgroups. The species

  14. References for Haplotype Imputation in the Big Data Era

    PubMed Central

    Li, Wenzhi; Xu, Wei; Li, Qiling; Ma, Li; Song, Qing

    2016-01-01

    Imputation is a powerful in silico approach to fill in those missing values in the big datasets. This process requires a reference panel, which is a collection of big data from which the missing information can be extracted and imputed. Haplotype imputation requires ethnicity-matched references; a mismatched reference panel will significantly reduce the quality of imputation. However, currently existing big datasets cover only a small number of ethnicities, there is a lack of ethnicity-matched references for many ethnic populations in the world, which has hampered the data imputation of haplotypes and its downstream applications. To solve this issue, several approaches have been proposed and explored, including the mixed reference panel, the internal reference panel and genotype-converted reference panel. This review article provides the information and comparison between these approaches. Increasing evidence showed that not just one or two genetic elements dictate the gene activity and functions; instead, cis-interactions of multiple elements dictate gene activity. Cis-interactions require the interacting elements to be on the same chromosome molecule, therefore, haplotype analysis is essential for the investigation of cis-interactions among multiple genetic variants at different loci, and appears to be especially important for studying the common diseases. It will be valuable in a wide spectrum of applications from academic research, to clinical diagnosis, prevention, treatment, and pharmaceutical industry. PMID:27274952

  15. [Construction of haplotype and haplotype block based on tag single nucleotide polymorphisms and their applications in association studies].

    PubMed

    Gu, Ming-liang; Chu, Jia-you

    2007-12-01

    Human genome has structures of haplotype and haplotype block which provide valuable information on human evolutionary history and may lead to the development of more efficient strategies to identify genetic variants that increase susceptibility to complex diseases. Haplotype block can be divided into discrete blocks of limited haplotype diversity. In each block, a small fraction of ptag SNPsq can be used to distinguish a large fraction of the haplotypes. These tag SNPs can be potentially useful for construction of haplotype and haplotype block, and association studies in complex diseases. There are two general classes of methods to construct haplotype and haplotype blocks based on genotypes on large pedigrees and statistical algorithms respectively. The author evaluate several construction methods to assess the power of different association tests with a variety of disease models and block-partitioning criteria. The advantages, limitations and applications of each method and the application in the association studies are discussed equitably. With the completion of the HapMap and development of statistical algorithms for addressing haplotype reconstruction, ideas of construction of haplotype based on combination of mathematics, physics, and computer science etc will have profound impacts on population genetics, location and cloning for susceptible genes in complex diseases, and related domain with life science etc.

  16. Population Structure With Localized Haplotype Clusters

    PubMed Central

    Browning, Sharon R.; Weir, Bruce S.

    2010-01-01

    We propose a multilocus version of FST and a measure of haplotype diversity using localized haplotype clusters. Specifically, we use haplotype clusters identified with BEAGLE, which is a program implementing a hidden Markov model for localized haplotype clustering and performing several functions including inference of haplotype phase. We apply this methodology to HapMap phase 3 data. With this haplotype-cluster approach, African populations have highest diversity and lowest divergence from the ancestral population, East Asian populations have lowest diversity and highest divergence, and other populations (European, Indian, and Mexican) have intermediate levels of diversity and divergence. These relationships accord with expectation based on other studies and accepted models of human history. In contrast, the population-specific FST estimates obtained directly from single-nucleotide polymorphisms (SNPs) do not reflect such expected relationships. We show that ascertainment bias of SNPs has less impact on the proposed haplotype-cluster-based FST than on the SNP-based version, which provides a potential explanation for these results. Thus, these new measures of FST and haplotype-cluster diversity provide an important new tool for population genetic analysis of high-density SNP data. PMID:20457877

  17. TUMOR HAPLOTYPE ASSEMBLY ALGORITHMS FOR CANCER GENOMICS

    PubMed Central

    AGUIAR, DEREK; WONG, WENDY S.W.; ISTRAIL, SORIN

    2014-01-01

    The growing availability of inexpensive high-throughput sequence data is enabling researchers to sequence tumor populations within a single individual at high coverage. But, cancer genome sequence evolution and mutational phenomena like driver mutations and gene fusions are difficult to investigate without first reconstructing tumor haplotype sequences. Haplotype assembly of single individual tumor populations is an exceedingly difficult task complicated by tumor haplotype heterogeneity, tumor or normal cell sequence contamination, polyploidy, and complex patterns of variation. While computational and experimental haplotype phasing of diploid genomes has seen much progress in recent years, haplotype assembly in cancer genomes remains uncharted territory. In this work, we describe HapCompass-Tumor a computational modeling and algorithmic framework for haplotype assembly of copy number variable cancer genomes containing haplotypes at different frequencies and complex variation. We extend our polyploid haplotype assembly model and present novel algorithms for (1) complex variations, including copy number changes, as varying numbers of disjoint paths in an associated graph, (2) variable haplotype frequencies and contamination, and (3) computation of tumor haplotypes using simple cycles of the compass graph which constrain the space of haplotype assembly solutions. The model and algorithm are implemented in the software package HapCompass-Tumor which is available for download from http://www.brown.edu/Research/Istrail_Lab/. PMID:24297529

  18. Phylogeny and Haplotype Analysis of Fungi Within the Fusarium incarnatum-equiseti Species Complex.

    PubMed

    Ramdial, H; Latchoo, R K; Hosein, F N; Rampersad, S N

    2017-01-01

    Fusarium spp. are ranked among the top 10 most economically and scientifically important plant-pathogenic fungi in the world and are associated with plant diseases that include fruit decay of a number of crops. Fusarium isolates infecting bell pepper in Trinidad were identified based on sequence comparisons of the translation elongation factor gene (EF-1a) with sequences of Fusarium incarnatum-equiseti species complex (FIESC) verified in the FUSARIUM-ID database. Eighty-two isolates were identified as belonging to one of four phylogenetic species within the subclades FIESC-1, FIESC-15, FIESC-16, and FIESC-26, with the majority of isolates belonging to FIESC-15. A comparison of the level of DNA polymorphism and phylogenetic inference for sequences of the internal transcribed spacer region (ITS1-5.8S-ITS2) and EF-1a sequences for Trinidad and FUSARIUM-ID type species was carried out. The ITS sequences were less informative, had lower haplotype diversity and restricted haplotype distribution, and resulted in poor resolution and taxa placement in the consensus maximum-likelihood tree. EF-1a sequences enabled strongly supported phylogenetic inference with highly resolved branching patterns of the 30 phylogenetic species within the FIESC and placement of representative Trinidad isolates. Therefore, global phylogeny was inferred from EF-1a sequences representing 11 countries, and separation into distinct Incarnatum and Equiseti clades was again evident. In total, 42 haplotypes were identified: 12 were shared and the remaining were unique haplotypes. The most diverse haplotype was represented by sequences from China, Indonesia, Malaysia, and Trinidad and consisted exclusively of F. incarnatum isolates. Spain had the highest haplotype diversity, perhaps because both F. equiseti and F. incarnatum sequences were represented; followed by the United States, which contributed both F. equiseti and F. incarnatum sequences to the data set; then by countries representing Southeast

  19. Absence of the tag polymorphism for the risk haplotype HLA-DR2 for multiple sclerosis in Wixárika subjects from Mexico.

    PubMed

    González-Enríquez, G V; Torres-Mendoza, B M; Márquez-Pedroza, J; Macías-Islas, M A; Ortiz, G G; Cruz-Ramos, J A

    2018-02-03

    The HLA-DRB1*15:01 allele has a demonstrated risk for the development of multiple sclerosis (MS) in most populations around the world. The single nucleotide polymorphism (SNP) rs3129934 is found in linkage disequilibrium with the risk haplotype formed by the HLA-DRB1*15:01 and HLA-DQB1*06:02 alleles, and it is considered a reliable marker of the presence of this haplotype. Native Americans have a null or low prevalence of MS. In this study, we sought to identify the frequency of rs3129934 in the Wixárika ethnic group as well as in Mestizo (mixed race) patients with MS and in controls from western Mexico. Through real-time polymerase chain reaction (PCR) using TaqMan probes, we analyzed the allele and genotype frequencies of rs3129934 in Mestizo individuals with and without MS and in 73 Wixárika subjects from the state of Jalisco, Mexico. The Wixárika subjects were homozygote for the C allele of rs3129934. The allele and genotype frequency in Mestizos with MS was similar to that of other MS populations with Caucasian ancestry. The absence of the T risk allele rs3129934 (associated with the haplotype HLA-DRB1*15:01, HLA-DQ1*06:02) in this sample of Wixárika subjects is consistent with the unreported MS in this Amerindian group, related to absence of such paramount genetic risk factor.

  20. Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations.

    PubMed

    Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

    2007-08-10

    The sickle (betas) mutation in the beta-globin gene (HBB) occurs on five "classical" betas haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the betas allele - a consequence of protection from severe malarial infection afforded by heterozygotes - has been associated with a high degree of extended haplotype similarity. The relationship between classical betas haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical betas haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). The most common betas sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the betas mutation. Two different classical betas haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of betas haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle

  1. Congruence as a measurement of extended haplotype structure across the genome

    PubMed Central

    2012-01-01

    Background Historically, extended haplotypes have been defined using only a few data points, such as alleles for several HLA genes in the MHC. High-density SNP data, and the increasing affordability of whole genome SNP typing, creates the opportunity to define higher resolution extended haplotypes. This drives the need for new tools that support quantification and visualization of extended haplotypes as defined by as many as 2000 SNPs. Confronted with high-density SNP data across the major histocompatibility complex (MHC) for 2,300 complete families, compiled by the Type 1 Diabetes Genetics Consortium (T1DGC), we developed software for studying extended haplotypes. Methods The software, called ExHap (Extended Haplotype), uses a similarity measurement we term congruence to identify and quantify long-range allele identity. Using ExHap, we analyzed congruence in both the T1DGC data and family-phased data from the International HapMap Project. Results Congruent chromosomes from the T1DGC data have between 96.5% and 99.9% allele identity over 1,818 SNPs spanning 2.64 megabases of the MHC (HLA-DRB1 to HLA-A). Thirty-three of 132 DQ-DR-B-A defined haplotype groups have > 50% congruent chromosomes in this region. For example, 92% of chromosomes within the DR3-B8-A1 haplotype are congruent from HLA-DRB1 to HLA-A (99.8% allele identity). We also applied ExHap to all 22 autosomes for both CEU and YRI cohorts from the International HapMap Project, identifying multiple candidate extended haplotypes. Conclusions Long-range congruence is not unique to the MHC region. Patterns of allele identity on phased chromosomes provide a simple, straightforward approach to visually and quantitatively inspect complex long-range structural patterns in the genome. Such patterns aid the biologist in appreciating genetic similarities and differences across cohorts, and can lead to hypothesis generation for subsequent studies. PMID:22369243

  2. Massively parallel haplotyping on microscopic beads for the high-throughput phase analysis of single molecules.

    PubMed

    Boulanger, Jérôme; Muresan, Leila; Tiemann-Boege, Irene

    2012-01-01

    In spite of the many advances in haplotyping methods, it is still very difficult to characterize rare haplotypes in tissues and different environmental samples or to accurately assess the haplotype diversity in large mixtures. This would require a haplotyping method capable of analyzing the phase of single molecules with an unprecedented throughput. Here we describe such a haplotyping method capable of analyzing in parallel hundreds of thousands single molecules in one experiment. In this method, multiple PCR reactions amplify different polymorphic regions of a single DNA molecule on a magnetic bead compartmentalized in an emulsion drop. The allelic states of the amplified polymorphisms are identified with fluorescently labeled probes that are then decoded from images taken of the arrayed beads by a microscope. This method can evaluate the phase of up to 3 polymorphisms separated by up to 5 kilobases in hundreds of thousands single molecules. We tested the sensitivity of the method by measuring the number of mutant haplotypes synthesized by four different commercially available enzymes: Phusion, Platinum Taq, Titanium Taq, and Phire. The digital nature of the method makes it highly sensitive to detecting haplotype ratios of less than 1:10,000. We also accurately quantified chimera formation during the exponential phase of PCR by different DNA polymerases.

  3. How Have Self-Incompatibility Haplotypes Diversified? Generation of New Haplotypes during the Evolution of Self-Incompatibility from Self-Compatibility.

    PubMed

    Sakai, Satoki

    2016-08-01

    I developed a gametophytic self-incompatibility (SI) model to study the conditions leading to diversification in SI haplotypes. In the model, the SI system is assumed to be incomplete, and the pollen expressing a given specificity is not fully rejected by the pistils expressing the same specificity. I also assumed that mutations can occur that enhance the rejection of pollen by pistils with the same haplotype variant and reduce rejection by pistils with other variants in the same haplotype. I found that if such mutations occur, the new haplotypes (mutant variants) can stably coexist with the ancestral haplotype in which the mutant arose. This is because pollen bearing the new haplotype is most strongly rejected by pistils bearing the same new haplotype among the pistils in the population; hence, negative frequency-dependent selection prevents their fixation. I also performed simulations and found that the nearly complete SI system evolves from completely self-compatible populations and that SI haplotypes can increase to about 40-50 within a few thousand generations. On the basis of my findings, I propose that diversification of SI haplotypes occurred during the evolution of SI from self-compatibility.

  4. Haplotype-based approach to known MS-associated regions increases the amount of explained risk

    PubMed Central

    Khankhanian, Pouya; Gourraud, Pierre-Antoine; Lizee, Antoine; Goodin, Douglas S

    2015-01-01

    Genome-wide association studies (GWAS), using single nucleotide polymorphisms (SNPs), have yielded 110 non-human leucocyte antigen genomic regions that are associated with multiple sclerosis (MS). Despite this large number of associations, however, only 28% of MS-heritability can currently be explained. Here we compare the use of multi-SNP-haplotypes to the use of single-SNPs as alternative methods to describe MS genetic risk. SNP-haplotypes (of various lengths from 1 up to 15 contiguous SNPs) were constructed at each of the 110 previously identified, MS-associated, genomic regions. Even after correcting for the larger number of statistical comparisons made when using the haplotype-method, in 32 of the regions, the SNP-haplotype based model was markedly more significant than the single-SNP based model. By contrast, in no region was the single-SNP based model similarly more significant than the SNP-haplotype based model. Moreover, when we included the 932 MS-associated SNP-haplotypes (that we identified from 102 regions) as independent variables into a logistic linear model, the amount of MS-heritability, as assessed by Nagelkerke's R-squared, was 38%, which was considerably better than 29%, which was obtained by using only single-SNPs. This study demonstrates that SNP-haplotypes can be used to fine-map the genetic associations within regions of interest previously identified by single-SNP GWAS. Moreover, the amount of the MS genetic risk explained by the SNP-haplotype associations in the 110 MS-associated genomic regions was considerably greater when using SNP-haplotypes than when using single-SNPs. Also, the use of SNP-haplotypes can lead to the discovery of new regions of interest, which have not been identified by a single-SNP GWAS. PMID:26185143

  5. Interrelationships between Amerindian tribes of lower Amazonia as manifest by HLA haplotype disequilibria.

    PubMed

    Black, F L

    1984-11-01

    HLA B-C haplotypes exhibit common disequilibria in populations drawn from four continents, indicating that they are subject to broadly active selective forces. However, the A-B and A-C associations we have examined show no consistent disequilibrium pattern, leaving open the possibility that these disequilibria are due to descent from common progenitors. By examining HLA haplotype distributions, I have explored the implications that would follow from the hypothesis that biological selection played no role in determining A-C disequilibria in 10 diverse tribes of the lower Amazon Basin. Certain haplotypes are in strong positive disequilibria across a broad geographic area, suggesting that members of diverse tribes descend from common ancestors. On the basis of the extent of diffusion of the components of these haplotypes, one can estimate that the progenitors lived less than 6,000 years ago. One widely encountered lineage entered the area within the last 1,200 years. When haplotype frequencies are used in genetic distance measurements, they give a pattern of relationships very similar to that obtained by conventional chord measurements based on several genetic markers; but more than that, when individual haplotype disequilibria in the several tribes are compared, multiple origins of a single tribe are discernible and relationships are revealed that correlate more closely to geographic and linguistic patterns than do the genetic distance measurements.

  6. Analysis of MHC class I genes across horse MHC haplotypes

    PubMed Central

    Tallmadge, Rebecca L.; Campbell, Julie A.; Miller, Donald C.; Antczak, Douglas F.

    2010-01-01

    The genomic sequences of 15 horse Major Histocompatibility Complex (MHC) class I genes and a collection of MHC class I homozygous horses of five different haplotypes were used to investigate the genomic structure and polymorphism of the equine MHC. A combination of conserved and locus-specific primers was used to amplify horse MHC class I genes with classical and non-classical characteristics. Multiple clones from each haplotype identified three to five classical sequences per homozygous animal, and two to three non-classical sequences. Phylogenetic analysis was applied to these sequences and groups were identified which appear to be allelic series, but some sequences were left ungrouped. Sequences determined from MHC class I heterozygous horses and previously described MHC class I sequences were then added, representing a total of ten horse MHC haplotypes. These results were consistent with those obtained from the MHC homozygous horses alone, and 30 classical sequences were assigned to four previously confirmed loci and three new provisional loci. The non-classical genes had few alleles and the classical genes had higher levels of allelic polymorphism. Alleles for two classical loci with the expected pattern of polymorphism were found in the majority of haplotypes tested, but alleles at two other commonly detected loci had more variation outside of the hypervariable region than within. Our data indicate that the equine Major Histocompatibility Complex is characterized by variation in the complement of class I genes expressed in different haplotypes in addition to the expected allelic polymorphism within loci. PMID:20099063

  7. Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations

    PubMed Central

    Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

    2007-01-01

    Background The sickle (βs) mutation in the beta-globin gene (HBB) occurs on five "classical" βs haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the βs allele – a consequence of protection from severe malarial infection afforded by heterozygotes – has been associated with a high degree of extended haplotype similarity. The relationship between classical βs haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical βs haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). Results The most common βs sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the βs mutation. Conclusion Two different classical βs haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of βs haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence

  8. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  9. Human neuronal acetylcholine receptor A5-A3-B4 haplotypes are associated with multiple nicotine dependence phenotypes

    PubMed Central

    Weiss, Robert B.; Bolt, Daniel; von Niederhausern, Andrew; Fiore, Michael C.; Dunn, Diane M.; Piper, Megan E.; Matsunami, Nori; Smith, Stevens S.; Coon, Hilary; McMahon, William M.; Scholand, Mary B.; Singh, Nanda; Hoidal, John R.; Kim, Su-Young; Leppert, Mark F.; Cannon, Dale S.

    2009-01-01

    Introduction: Previous research revealed significant associations between haplotypes in the CHRNA5-A3-B4 subunit cluster and scores on the Fagerström Test for Nicotine Dependence among individuals reporting daily smoking by age 17. The present study used subsamples of participants from that study to investigate associations between the CHRNA5-A3-B4 haplotypes and an array of phenotypes not analyzed previously (i.e., withdrawal severity, ability to stop smoking, and specific scales on the Wisconsin Inventory of Smoking Dependence Motives (WISDM-68) that reflect loss of control, strong craving, and heavy smoking. Methods: Two cohorts of current or former smokers (N = 886) provided both self-report data and DNA samples. One sample (Wisconsin) comprised smokers making a quit smoking attempt, which permitted the assessment of withdrawal and relapse during the attempt. The other sample (Utah) comprised participants studied for risk factors for nicotine dependence and chronic obstructive pulmonary disease and included individuals originally recruited in the Lung Health Study. Results: The CHRNA5-A3-B4 haplotypes were significantly associated with the targeted WISDM-68 scales (Tolerance, Craving, Loss of Control) in both samples of participants but only among individuals who began smoking early in life. The haplotypes were significantly associated with relapse likelihood and withdrawal severity, but these associations showed no evidence of an interaction with age at daily smoking. Discussion: The CHRNA5-A3-B4 haplotypes are associated with a broad range of nicotine dependence phenotypes, but these associations are not consistently moderated by age at initial smoking. PMID:19436041

  10. The putative oncogene Pim-1 in the mouse: its linkage and variation among t haplotypes.

    PubMed

    Nadeau, J H; Phillips, S J

    1987-11-01

    Pim-1, a putative oncogene involved in T-cell lymphomagenesis, was mapped between the pseudo-alpha globin gene Hba-4ps and the alpha-crystallin gene Crya-1 on mouse chromosome 17 and therefore within the t complex. Pim-1 restriction fragment variants were identified among t haplotypes. Analysis of restriction fragment sizes obtained with 12 endonucleases demonstrated that the Pim-1 genes in some t haplotypes were indistinguishable from the sizes for the Pim-1b allele in BALB/c inbred mice. There are now three genes, Pim-1, Crya-1 and H-2 I-E, that vary among independently derived t haplotypes and that have indistinguishable alleles in t haplotypes and inbred strains. These genes are closely linked within the distal inversion of the t complex. Because it is unlikely that these variants arose independently in t haplotypes and their wild-type homologues, we propose that an exchange of chromosomal segments, probably through double crossingover, was responsible for indistinguishable Pim-1 genes shared by certain t haplotypes and their wild-type homologues. There was, however, no apparent association between variant alleles of these three genes among t haplotypes as would be expected if a single exchange introduced these alleles into t haplotypes. If these variant alleles can be shown to be identical to the wild-type allele, then lack of association suggests that multiple exchanges have occurred during the evolution of the t complex.

  11. Genetic analysis of autoimmune regulator haplotypes in alopecia areata.

    PubMed

    Wengraf, D A; McDonagh, A J G; Lovewell, T R J; Vasilopoulos, Y; Macdonald-Hull, S P; Cork, M J; Messenger, A G; Tazi-Ahnini, R

    2008-03-01

    Alopecia areata is an immune-mediated disorder, occurring with the highest observed frequency in the rare recessive autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) syndrome caused by mutations of the autoimmune regulator (AIRE) gene on chromosome 21q22.3. We have previously detected association between alopecia areata and a single nucleotide polymorphism (SNP) in the AIRE gene in patients without APECED, and we now report the findings of an extended examination of the association of alopecia areata with haplotype analysis including six SNPs in the AIRE gene: C-103T, C4144G, T5238C, G6528A, T7215C and T11787C. In Caucasian groups of 295 patients and 363 controls, we found strong association between the AIRE 7215C allele and AA [P = 3.8 x 10(-8), OR (95% CI): 2.69 (1.8-4.0)]. The previously reported association between AA and the AIRE 4144G allele was no longer significant on correction for multiple testing. The AIRE haplotypes CCTGCT and CGTGCC showed a highly significant association with AA [P = 6.05 x 10(-6), 9.47 (2.91-30.8) and P = 0.001, 3.51 (1.55-7.95), respectively]. To select the haplotypes most informative for analysis, we tagged the polymorphisms using SNPTag software. Employing AIRE C-103T, G6528A, T7215C and T11787C as tag SNPs, two haplotypes were associated with AA; AIRE CGCT and AIRE CGCC [P = 3.84 x 10(-7), 11.40 (3.53-36.9) and P = 3.94 x 10(-4), 2.13 (1.39-3.24) respectively]. The AIRE risk haplotypes identified in this study potentially account for a major component of the genetic risk of developing alopecia areata.

  12. Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data.

    PubMed

    Excoffier, L; Smouse, P E; Quattro, J M

    1992-06-01

    We present here a framework for the study of molecular variation within a single species. Information on DNA haplotype divergence is incorporated into an analysis of variance format, derived from a matrix of squared-distances among all pairs of haplotypes. This analysis of molecular variance (AMOVA) produces estimates of variance components and F-statistic analogs, designated here as phi-statistics, reflecting the correlation of haplotypic diversity at different levels of hierarchical subdivision. The method is flexible enough to accommodate several alternative input matrices, corresponding to different types of molecular data, as well as different types of evolutionary assumptions, without modifying the basic structure of the analysis. The significance of the variance components and phi-statistics is tested using a permutational approach, eliminating the normality assumption that is conventional for analysis of variance but inappropriate for molecular data. Application of AMOVA to human mitochondrial DNA haplotype data shows that population subdivisions are better resolved when some measure of molecular differences among haplotypes is introduced into the analysis. At the intraspecific level, however, the additional information provided by knowing the exact phylogenetic relations among haplotypes or by a nonlinear translation of restriction-site change into nucleotide diversity does not significantly modify the inferred population genetic structure. Monte Carlo studies show that site sampling does not fundamentally affect the significance of the molecular variance components. The AMOVA treatment is easily extended in several different directions and it constitutes a coherent and flexible framework for the statistical analysis of molecular data.

  13. RENT+: an improved method for inferring local genealogical trees from haplotypes with recombination

    PubMed Central

    Mirzaei, Sajad; Wu, Yufeng

    2017-01-01

    Abstract Motivation: Haplotypes from one or multiple related populations share a common genealogical history. If this shared genealogy can be inferred from haplotypes, it can be very useful for many population genetics problems. However, with the presence of recombination, the genealogical history of haplotypes is complex and cannot be represented by a single genealogical tree. Therefore, inference of genealogical history with recombination is much more challenging than the case of no recombination. Results: In this paper, we present a new approach called RENT+ for the inference of local genealogical trees from haplotypes with the presence of recombination. RENT+ builds on a previous genealogy inference approach called RENT, which infers a set of related genealogical trees at different genomic positions. RENT+ represents a significant improvement over RENT in the sense that it is more effective in extracting information contained in the haplotype data about the underlying genealogy than RENT. The key components of RENT+ are several greatly enhanced genealogy inference rules. Through simulation, we show that RENT+ is more efficient and accurate than several existing genealogy inference methods. As an application, we apply RENT+ in the inference of population demographic history from haplotypes, which outperforms several existing methods. Availability and Implementation: RENT+ is implemented in Java, and is freely available for download from: https://github.com/SajadMirzaei/RentPlus. Contacts: sajad@engr.uconn.edu or ywu@engr.uconn.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:28065901

  14. High-Density SNP Genotyping to Define β-Globin Locus Haplotypes

    PubMed Central

    Liu, Li; Muralidhar, Shalini; Singh, Manisha; Sylvan, Caprice; Kalra, Inderdeep S.; Quinn, Charles T.; Onyekwere, Onyinye C.; Pace, Betty S.

    2014-01-01

    Five major β-globin locus haplotypes have been established in individuals with sickle cell disease (SCD) from the Benin, Bantu, Senegal, Cameroon, and Arab-Indian populations. Historically, β-haplotypes were established using restriction fragment length polymorphism (RFLP) analysis across the β-locus, which consists of five functional β-like globin genes located on chromosome 11. Previous attempts to correlate these haplotypes as robust predictors of clinical phenotypes observed in SCD have not been successful. We speculate that the coverage and distribution of the RFLP sites located proximal to or within the globin genes are not sufficiently dense to accurately reflect the complexity of this region. To test our hypothesis, we performed RFLP analysis and high-density single nucleotide polymorphism (SNP) genotyping across the β-locus using DNA samples from either healthy African Americans with normal hemoglobin A (HbAA) or individuals with homozygous SS (HbSS) disease. Using the genotyping data from 88 SNPs and Haploview analysis, we generated a greater number of haplotypes than that observed with RFLP analysis alone. Furthermore, a unique pattern of long-range linkage disequilibrium between the locus control region and the β-like globin genes was observed in the HbSS group. Interestingly, we observed multiple SNPs within the HindIII restriction site located in the Gγ-globin intervening sequence II which produced the same RFLP pattern. These findings illustrated the inability of RFLP analysis to decipher the complexity of sequence variations that impacts genomic structure in this region. Our data suggest that high density SNP mapping may be required to accurately define β-haplotypes that correlate with the different clinical phenotypes observed in SCD. PMID:18829352

  15. Diversity of mitochondrial large subunit rDNA haplotypes of Glomus intraradices in two agricultural field experiments and two semi-natural grasslands.

    PubMed

    Börstler, Boris; Thiéry, Odile; Sýkorová, Zuzana; Berner, Alfred; Redecker, Dirk

    2010-04-01

    Glomus intraradices, an arbuscular mycorrhizal fungus (AMF), is frequently found in a surprisingly wide range of ecosystems all over the world. It is used as model organism for AMF and its genome is being sequenced. Despite the ecological importance of AMF, little has been known about their population structure, because no adequate molecular markers have been available. In the present study we analyse for the first time the intraspecific genetic structure of an AMF directly from colonized roots in the field. A recently developed PCR-RFLP approach for the mitochondrial rRNA large subunit gene (mtLSU) of these obligate symbionts was used and complemented by sequencing and primers specific for a particularly frequent mtLSU haplotype. We analysed root samples from two agricultural field experiments in Switzerland and two semi-natural grasslands in France and Switzerland. RFLP type composition of G. intraradices (phylogroup GLOM A-1) differed strongly between agricultural and semi-natural sites and the G. intraradices populations of the two agricultural sites were significantly differentiated. RFLP type richness was higher in the agricultural sites compared with the grasslands. Detailed sequence analyses which resolved multiple sequence haplotypes within some RFLP types even revealed that there was no overlap of haplotypes among any of the study sites except between the two grasslands. Our results demonstrate a surprisingly high differentiation among semi-natural and agricultural field sites for G. intraradices. These findings will have major implications on our views of processes of adaptation and specialization in these plant/fungus associations.

  16. Factor IX gene haplotypes in Amerindians.

    PubMed

    Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S

    1997-02-01

    We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.

  17. Effects of IL-10 haplotype and atomic bomb radiation exposure on gastric cancer risk.

    PubMed

    Hayashi, Tomonori; Ito, Reiko; Cologne, John; Maki, Mayumi; Morishita, Yukari; Nagamura, Hiroko; Sasaki, Keiko; Hayashi, Ikue; Imai, Kazue; Yoshida, Kengo; Kajimura, Junko; Kyoizumi, Seishi; Kusunoki, Yoichiro; Ohishi, Waka; Fujiwara, Saeko; Akahoshi, Masazumi; Nakachi, Kei

    2013-07-01

    Gastric cancer (GC) is one of the cancers that reveal increased risk of mortality and incidence in atomic bomb survivors. The incidence of gastric cancer in the Life Span Study cohort of the Radiation Effects Research Foundation (RERF) increased with radiation dose (gender-averaged excess relative risk per Gy = 0.28) and remains high more than 65 years after exposure. To assess a possible role of gene-environment interaction, we examined the dose response for gastric cancer incidence based on immunosuppression-related IL-10 genotype, in a cohort study with 200 cancer cases (93 intestinal, 96 diffuse and 11 other types) among 4,690 atomic bomb survivors participating in an immunological substudy. Using a single haplotype block composed of four haplotype-tagging SNPs (comprising the major haplotype allele IL-10-ATTA and the minor haplotype allele IL-10-GGCG, which are categorized by IL-10 polymorphisms at -819A>G and -592T>G, +1177T>C and +1589A>G), multiplicative and additive models for joint effects of radiation and this IL-10 haplotyping were examined. The IL-10 minor haplotype allele(s) was a risk factor for intestinal type gastric cancer but not for diffuse type gastric cancer. Radiation was not associated with intestinal type gastric cancer. In diffuse type gastric cancer, the haplotype-specific excess relative risk (ERR) for radiation was statistically significant only in the major homozygote category of IL-10 (ERR = 0.46/Gy, P = 0.037), whereas estimated ERR for radiation with the minor IL-10 homozygotes was close to 0 and nonsignificant. Thus, the minor IL-10 haplotype might act to reduce the radiation related risk of diffuse-type gastric cancer. The results suggest that this IL-10 haplotyping might be involved in development of radiation-associated gastric cancer of the diffuse type, and that IL-10 haplotypes may explain individual differences in the radiation-related risk of gastric cancer. © 2013 by Radiation Research Society

  18. The distribution of HLA haplotypes in the ethnic groups that make up the Brazilian Bone Marrow Volunteer Donor Registry (REDOME).

    PubMed

    Halagan, Michael; Oliveira, Danielli Cristina; Maiers, Martin; Fabreti-Oliveira, Raquel A; Moraes, Maria Elisa Hue; Visentainer, Jeane Eliete Laguila; Pereira, Noemi Farah; Romero, Matilde; Cardoso, Juliana Fernandes; Porto, Luís Cristóvão

    2018-04-26

    The Registries of Bone Marrow Donors around the world include more than 30 million volunteer donors from 57 different countries, and were responsible for over 17,000 hematopoietic stem cell transplants in 2016. The Brazilian Bone Marrow Volunteer Donor Registry (REDOME) was established in 1993 and is the third largest registry in the world with more than 4.3 million donors. We characterized HLA allele and haplotypes frequencies from REDOME comparing them with the donor self-reported race group classification. Five-locus haplotype frequencies (A~C~B~DRB1~DQB1) were estimated for each of the six race groups, resolving phase and allelic ambiguity using the expectation-maximization (EM) algorithm. The top 100 haplotypes in the race groups were separated into eight clusters of haplotypes, based on haplotype similarity, using CLUTO. We present HLA allele and haplotype frequency data from six race groups from 2,938,259 individuals from REDOME. The most frequent haplotype was the same for all groups: A*01:01g~C*07:01g~B*08:01g~DRB1*03:01g~DQB1*02:01g. Some frequent haplotypes such as A*02:01g~C*16:01g~B*44:03~DRB1*07:01g~DQB1*02:01g was not found in people with Preta (Sub-Saharan African descent). A cluster including Branca (European) and Parda or non-informed (admixed) could be distinguished from both Preta (SubSaharan) and Indígena (Amerindian) groups, and from the Amarela (Asian) ones, which clustered with their original population. These results have implications on cross-population matching and can help in donor searches and population-based recruitment strategies.

  19. Detecting structure of haplotypes and local ancestry

    USDA-ARS?s Scientific Manuscript database

    We present a two-layer hidden Markov model to detect the structure of haplotypes for unrelated individuals. This allows us to model two scales of linkage disequilibrium (one within a group of haplotypes and one between groups), thereby taking advantage of rich haplotype information to infer local an...

  20. Extended Islands of Tractability for Parsimony Haplotyping

    NASA Astrophysics Data System (ADS)

    Fleischer, Rudolf; Guo, Jiong; Niedermeier, Rolf; Uhlmann, Johannes; Wang, Yihui; Weller, Mathias; Wu, Xi

    Parsimony haplotyping is the problem of finding a smallest size set of haplotypes that can explain a given set of genotypes. The problem is NP-hard, and many heuristic and approximation algorithms as well as polynomial-time solvable special cases have been discovered. We propose improved fixed-parameter tractability results with respect to the parameter "size of the target haplotype set" k by presenting an O *(k 4k )-time algorithm. This also applies to the practically important constrained case, where we can only use haplotypes from a given set. Furthermore, we show that the problem becomes polynomial-time solvable if the given set of genotypes is complete, i.e., contains all possible genotypes that can be explained by the set of haplotypes.

  1. Hapl-o-Mat: open-source software for HLA haplotype frequency estimation from ambiguous and heterogeneous data.

    PubMed

    Schäfer, Christian; Schmidt, Alexander H; Sauter, Jürgen

    2017-05-30

    Knowledge of HLA haplotypes is helpful in many settings as disease association studies, population genetics, or hematopoietic stem cell transplantation. Regarding the recruitment of unrelated hematopoietic stem cell donors, HLA haplotype frequencies of specific populations are used to optimize both donor searches for individual patients and strategic donor registry planning. However, the estimation of haplotype frequencies from HLA genotyping data is challenged by the large amount of genotype data, the complex HLA nomenclature, and the heterogeneous and ambiguous nature of typing records. To meet these challenges, we have developed the open-source software Hapl-o-Mat. It estimates haplotype frequencies from population data including an arbitrary number of loci using an expectation-maximization algorithm. Its key features are the processing of different HLA typing resolutions within a given population sample and the handling of ambiguities recorded via multiple allele codes or genotype list strings. Implemented in C++, Hapl-o-Mat facilitates efficient haplotype frequency estimation from large amounts of genotype data. We demonstrate its accuracy and performance on the basis of artificial and real genotype data. Hapl-o-Mat is a versatile and efficient software for HLA haplotype frequency estimation. Its capability of processing various forms of HLA genotype data allows for a straightforward haplotype frequency estimation from typing records usually found in stem cell donor registries.

  2. Novel full-length major histocompatibility complex class I allele discovery and haplotype definition in pig-tailed macaques.

    PubMed

    Semler, Matthew R; Wiseman, Roger W; Karl, Julie A; Graham, Michael E; Gieger, Samantha M; O'Connor, David H

    2018-06-01

    Pig-tailed macaques (Macaca nemestrina, Mane) are important models for human immunodeficiency virus (HIV) studies. Their infectability with minimally modified HIV makes them a uniquely valuable animal model to mimic human infection with HIV and progression to acquired immunodeficiency syndrome (AIDS). However, variation in the pig-tailed macaque major histocompatibility complex (MHC) and the impact of individual transcripts on the pathogenesis of HIV and other infectious diseases is understudied compared to that of rhesus and cynomolgus macaques. In this study, we used Pacific Biosciences single-molecule real-time circular consensus sequencing to describe full-length MHC class I (MHC-I) transcripts for 194 pig-tailed macaques from three breeding centers. We then used the full-length sequences to infer Mane-A and Mane-B haplotypes containing groups of MHC-I transcripts that co-segregate due to physical linkage. In total, we characterized full-length open reading frames (ORFs) for 313 Mane-A, Mane-B, and Mane-I sequences that defined 86 Mane-A and 106 Mane-B MHC-I haplotypes. Pacific Biosciences technology allows us to resolve these Mane-A and Mane-B haplotypes to the level of synonymous allelic variants. The newly defined haplotypes and transcript sequences containing full-length ORFs provide an important resource for infectious disease researchers as certain MHC haplotypes have been shown to provide exceptional control of simian immunodeficiency virus (SIV) replication and prevention of AIDS-like disease in nonhuman primates. The increased allelic resolution provided by Pacific Biosciences sequencing also benefits transplant research by allowing researchers to more specifically match haplotypes between donors and recipients to the level of nonsynonymous allelic variation, thus reducing the risk of graft-versus-host disease.

  3. RENT+: an improved method for inferring local genealogical trees from haplotypes with recombination.

    PubMed

    Mirzaei, Sajad; Wu, Yufeng

    2017-04-01

    : Haplotypes from one or multiple related populations share a common genealogical history. If this shared genealogy can be inferred from haplotypes, it can be very useful for many population genetics problems. However, with the presence of recombination, the genealogical history of haplotypes is complex and cannot be represented by a single genealogical tree. Therefore, inference of genealogical history with recombination is much more challenging than the case of no recombination. : In this paper, we present a new approach called RENT+  for the inference of local genealogical trees from haplotypes with the presence of recombination. RENT+  builds on a previous genealogy inference approach called RENT , which infers a set of related genealogical trees at different genomic positions. RENT+  represents a significant improvement over RENT in the sense that it is more effective in extracting information contained in the haplotype data about the underlying genealogy than RENT . The key components of RENT+  are several greatly enhanced genealogy inference rules. Through simulation, we show that RENT+  is more efficient and accurate than several existing genealogy inference methods. As an application, we apply RENT+  in the inference of population demographic history from haplotypes, which outperforms several existing methods. : RENT+  is implemented in Java, and is freely available for download from: https://github.com/SajadMirzaei/RentPlus . : sajad@engr.uconn.edu or ywu@engr.uconn.edu. : Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  4. Enhancing the mathematical properties of new haplotype homozygosity statistics for the detection of selective sweeps.

    PubMed

    Garud, Nandita R; Rosenberg, Noah A

    2015-06-01

    Soft selective sweeps represent an important form of adaptation in which multiple haplotypes bearing adaptive alleles rise to high frequency. Most statistical methods for detecting selective sweeps from genetic polymorphism data, however, have focused on identifying hard selective sweeps in which a favored allele appears on a single haplotypic background; these methods might be underpowered to detect soft sweeps. Among exceptions is the set of haplotype homozygosity statistics introduced for the detection of soft sweeps by Garud et al. (2015). These statistics, examining frequencies of multiple haplotypes in relation to each other, include H12, a statistic designed to identify both hard and soft selective sweeps, and H2/H1, a statistic that conditional on high H12 values seeks to distinguish between hard and soft sweeps. A challenge in the use of H2/H1 is that its range depends on the associated value of H12, so that equal H2/H1 values might provide different levels of support for a soft sweep model at different values of H12. Here, we enhance the H12 and H2/H1 haplotype homozygosity statistics for selective sweep detection by deriving the upper bound on H2/H1 as a function of H12, thereby generating a statistic that normalizes H2/H1 to lie between 0 and 1. Through a reanalysis of resequencing data from inbred lines of Drosophila, we show that the enhanced statistic both strengthens interpretations obtained with the unnormalized statistic and leads to empirical insights that are less readily apparent without the normalization. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Unraveling Haplotype Diversity of the Apical Membrane Antigen-1 Gene in Plasmodium falciparum Populations in Thailand

    PubMed Central

    Lumkul, Lalita; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn

    2018-01-01

    Development of an effective vaccine is critically needed for the prevention of malaria. One of the key antigens for malaria vaccines is the apical membrane antigen 1 (AMA-1) of the human malaria parasite Plasmodium falciparum, the surface protein for erythrocyte invasion of the parasite. The gene encoding AMA-1 has been sequenced from populations of P. falciparum worldwide, but the haplotype diversity of the gene in P. falciparum populations in the Greater Mekong Subregion (GMS), including Thailand, remains to be characterized. In the present study, the AMA-1 gene was PCR amplified and sequenced from the genomic DNA of 65 P. falciparum isolates from 5 endemic areas in Thailand. The nearly full-length 1,848 nucleotide sequence of AMA-1 was subjected to molecular analyses, including nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity and neutrality tests. Phylogenetic analysis and pairwise population differentiation (Fst indices) were performed to infer the population structure. The analyses identified 60 single nucleotide polymorphic loci, predominately located in domain I of AMA-1. A total of 31 unique AMA-1 haplotypes were identified, which included 11 novel ones. The phylogenetic tree of the AMA-1 haplotypes revealed multiple clades of AMA-1, each of which contained parasites of multiple geographical origins, consistent with the Fst indices indicating genetic homogeneity or gene flow among geographically distinct populations of P. falciparum in Thailand’s borders with Myanmar, Laos and Cambodia. In summary, the study revealed novel haplotypes and population structure needed for the further advancement of AMA-1-based malaria vaccines in the GMS. PMID:29742870

  6. Haplotype analysis of the apolipoprotein A5 gene in obese pediatric patients.

    PubMed

    Horvatovich, Katalin; Bokor, Szilvia; Baráth, Akos; Maász, Anita; Kisfali, Péter; Járomi, Luca; Polgár, Noémi; Tóth, Dénes; Répásy, Judit; Endreffy, Emoke; Molnár, Dénes; Melegh, Béla

    2011-06-01

    Apolipoprotein A5 (APOA5) gene variants have been shown to be associated with elevated TG levels; the T-1131C (rs662799) variant has been reported to confer risk for the metabolic syndrome in adult populations. Little is known about the APOA5 variants in pediatric population, no such information is available for pediatric obesity at all. Here we examined four haplotype-tagging polymorphisms (T-1131C, IVS3 + G476A [rs2072560], T1259C [rs2266788] and C56G [rs3135506]) and studied also the frequency of major naturally occurring haplotypes of APOA5 in obese children. The polymorphisms were analyzed in 232 obese children, and in 137 healthy, normal weight controls, using PCR-RFLP methods. In the pediatric patients we could confirm the already known adult subjects based association of -1131C, IVS3 + 476A and 1259C variants with elevated triglyceride concentrations, both in obese patients and in the controls. The prevalence of the APOA5*2 haplotype (containing the minor allele of T-1131C, IVS3 + G476A and T1259C SNPs together) was 15.5% in obese children, and 5.80% in the controls (p<0.001); multiple logistic regression analysis revealed that this haplotype confers susceptibility for development of obesity (OR=2.87; 95% CI: 1.29-6.37; p≤0.01). By contrast, the APOA5*4 haplotype (with -1131C alone) did not show similar associations. Our findings also suggest that the APOA5*5 haplotype (1259C alone) can be protective against obesity (OR=0.25; 95% CI: 0.07-0.80; p<0.05). While previous studies in adults demonstrated, that the APOA5 -1131C minor allele confers risk for adult metabolic syndrome, here we show, that the susceptibility nature of this SNP restricted to the APOA5*2 haplotype in pediatric obese subjects.

  7. Reconstruction of Haplotype-Blocks Selected during Experimental Evolution.

    PubMed

    Franssen, Susanne U; Barton, Nicholas H; Schlötterer, Christian

    2017-01-01

    The genetic analysis of experimentally evolving populations typically relies on short reads from pooled individuals (Pool-Seq). While this method provides reliable allele frequency estimates, the underlying haplotype structure remains poorly characterized. With small population sizes and adaptive variants that start from low frequencies, the interpretation of selection signatures in most Evolve and Resequencing studies remains challenging. To facilitate the characterization of selection targets, we propose a new approach that reconstructs selected haplotypes from replicated time series, using Pool-Seq data. We identify selected haplotypes through the correlated frequencies of alleles carried by them. Computer simulations indicate that selected haplotype-blocks of several Mb can be reconstructed with high confidence and low error rates, even when allele frequencies change only by 20% across three replicates. Applying this method to real data from D. melanogaster populations adapting to a hot environment, we identify a selected haplotype-block of 6.93 Mb. We confirm the presence of this haplotype-block in evolved populations by experimental haplotyping, demonstrating the power and accuracy of our haplotype reconstruction from Pool-Seq data. We propose that the combination of allele frequency estimates with haplotype information will provide the key to understanding the dynamics of adaptive alleles. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Founder haplotype analysis of Fanconi anemia in the Korean population finds common ancestral haplotypes for a FANCG variant.

    PubMed

    Park, Joonhong; Kim, Myungshin; Jang, Woori; Chae, Hyojin; Kim, Yonggoo; Chung, Nack-Gyun; Lee, Jae-Wook; Cho, Bin; Jeong, Dae-Chul; Park, In Yang; Park, Mi Sun

    2015-05-01

    A common ancestral haplotype is strongly suggested in the Korean and Japanese patients with Fanconi anemia (FA), because common mutations have been frequently found: c.2546delC and c.3720_3724delAAACA of FANCA; c.307+1G>C, c.1066C>T, and c.1589_1591delATA of FANCG. Our aim in this study was to investigate the origin of these common mutations of FANCA and FANCG. We genotyped 13 FA patients consisting of five FA-A patients and eight FA-G patients from the Korean FA population. Microsatellite markers used for haplotype analysis included four CA repeat markers which are closely linked with FANCA and eight CA repeat markers which are contiguous with FANCG. As a result, Korean FA-A patients carrying c.2546delC or c.3720_3724delAAACA did not share the same haplotypes. However, three unique haplotypes carrying c.307+1G>C, c.1066C > T, or c.1589_1591delATA, that consisted of eight polymorphic loci covering a flanking region were strongly associated with Korean FA-G, consistent with founder haplotypes reported previously in the Japanese FA-G population. Our finding confirmed the common ancestral haplotypes on the origins of the East Asian FA-G patients, which will improve our understanding of the molecular population genetics of FA-G. To the best of our knowledge, this is the first report on the association between disease-linked mutations and common ancestral haplotypes in the Korean FA population. © 2015 John Wiley & Sons Ltd/University College London.

  9. Genetic variation of 'Candidatus Liberibacter solanacearum' haplotype C and identification of a novel haplotype from Trioza urticae and stinging nettle.

    PubMed

    Haapalainen, Minna L; Wang, Jinhui; Latvala, Satu; Lehtonen, Mikko T; Pirhonen, Minna; Nissinen, Anne I

    2018-03-30

    'Candidatus Liberibacter solanacearum' (CLso) haplotype C is associated with disease in carrots and transmitted by the carrot psyllid Trioza apicalis. To identify possible other sources and vectors of this pathogen in Finland, samples were taken of wild plants within and near the carrot fields, the psyllids feeding on these plants, parsnips growing next to carrots, and carrot seeds. For analyzing the genotype of the CLso positive samples, a multi-locus sequence typing (MLST) scheme was developed. CLso haplotype C was detected in 11% of the Trioza anthrisci samples, in 35% of the Anthriscus sylvestris plants with discoloration, and in parsnips showing leaf discoloration. MLST revealed that the CLso in T. anthrisci and most A. sylvestris plants represent different strains than the bacteria found in T. apicalis and the cultivated plants. CLso haplotype D was detected in two of the 34 carrot seed lots tested, but was not detected in the plants grown from these seeds. Phylogenetic analysis by UPGMA clustering suggested that the haplotype D is more closely related to the haplotype A than to C. A novel, sixth haplotype of CLso, most closely related to A and D, was found in the psyllid Trioza urticae and stinging nettle (Urtica dioica, Urticaceae), and named as haplotype U.

  10. Effects of multiple scattering on time- and depth-resolved signals in airborne lidar systems

    NASA Technical Reports Server (NTRS)

    Punjabi, A.; Venable, D. D.

    1986-01-01

    A semianalytic Monte Carlo radiative transfer model (SALMON) is employed to probe the effects of multiple-scattering events on the time- and depth-resolved lidar signals from homogeneous aqueous media. The effective total attenuation coefficients in the single-scattering approximation are determined as functions of dimensionless parameters characterizing the lidar system and the medium. Results show that single-scattering events dominate when these parameters are close to their lower bounds and that when their values exceed unity multiple-scattering events dominate.

  11. New HLA haplotype frequency reference standards: high-resolution and large sample typing of HLA DR-DQ haplotypes in a sample of European Americans.

    PubMed

    Klitz, W; Maiers, M; Spellman, S; Baxter-Lowe, L A; Schmeckpeper, B; Williams, T M; Fernandez-Viña, M

    2003-10-01

    A collaborative study involving a large sample of European Americans was typed for the histocompatibility loci of the HLA DR-DQ region and subjected to intensive typing validation measures in order to accurately determine haplotype composition and frequency. The resulting tables have immediate application to HLA typing and allogeneic transplantation. The loci within the DR-DQ region are especially valuable for such an undertaking because of their tight linkage and high linkage disequilibrium. The 3798 haplotypes, derived from 1899 unrelated individuals, had a total of 75 distinct DRB1-DQA1-DQB1 haplotypes. The frequency distribution of the haplotypes was right skewed with haplotypes occurring at a frequency of less than 1% numbering 59 and yet constituting less than 12% of the total sample. Given DRB1 typing, it was possible to infer the exact DQA1 and DQB1 composition of a haplotype with high confidence (>90% likelihood) in 21 of the 35 high-resolution DRB1 alleles present in the sample. Of the DRB1 alleles without high reliability for DQ haplotype inference, only *0401, *0701 and *1302 were common, the remaining 11 DRB1 alleles constituting less than 5% of the total sample. This approach failed for the 13 serologically equivalent DR alleles in which only 33% of DQ haplotypes could be reliably inferred. The 36 DQA1-DQB1 haplotypes present in the total sample conformed to the known pattern of permissible heterodimers. Four DQA1-DQB1 haplotypes, all rare, are reported here for the first time. The haplotype frequency tables are suitable as a reference standard for HLA typing of the DR and DQ loci in European Americans.

  12. The effect of using genealogy-based haplotypes for genomic prediction.

    PubMed

    Edriss, Vahid; Fernando, Rohan L; Su, Guosheng; Lund, Mogens S; Guldbrandtsen, Bernt

    2013-03-06

    Genomic prediction uses two sources of information: linkage disequilibrium between markers and quantitative trait loci, and additive genetic relationships between individuals. One way to increase the accuracy of genomic prediction is to capture more linkage disequilibrium by regression on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (π) of the haplotype covariates had zero effect, i.e. a Bayesian mixture method. About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some cases, decreased the bias of prediction. With the Bayesian method, accuracy of prediction was less sensitive to parameter π when fitting haplotypes compared to fitting markers. Use of haplotypes based on genealogy can slightly increase the accuracy of genomic prediction. Improved methods to cluster the haplotypes constructed from local genealogy could lead to additional gains in accuracy.

  13. iXora: exact haplotype inferencing and trait association.

    PubMed

    Utro, Filippo; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar E; Royaert, Stefan; Schnell, Raymond J; Motamayor, Juan Carlos; Kuhn, David N; Parida, Laxmi

    2013-06-06

    We address the task of extracting accurate haplotypes from genotype data of individuals of large F1 populations for mapping studies. While methods for inferring parental haplotype assignments on large F1 populations exist in theory, these approaches do not work in practice at high levels of accuracy. We have designed iXora (Identifying crossovers and recombining alleles), a robust method for extracting reliable haplotypes of a mapping population, as well as parental haplotypes, that runs in linear time. Each allele in the progeny is assigned not just to a parent, but more precisely to a haplotype inherited from the parent. iXora shows an improvement of at least 15% in accuracy over similar systems in literature. Furthermore, iXora provides an easy-to-use, comprehensive environment for association studies and hypothesis checking in populations of related individuals. iXora provides detailed resolution in parental inheritance, along with the capability of handling very large populations, which allows for accurate haplotype extraction and trait association. iXora is available for non-commercial use from http://researcher.ibm.com/project/3430.

  14. Ancestral Asian source(s) of new world Y-chromosome founder haplotypes.

    PubMed Central

    Karafet, T M; Zegura, S L; Posukh, O; Osipova, L; Bergen, A; Long, J; Goldman, D; Klitz, W; Harihara, S; de Knijff, P; Wiebe, V; Griffiths, R C; Templeton, A R; Hammer, M F

    1999-01-01

    Haplotypes constructed from Y-chromosome markers were used to trace the origins of Native Americans. Our sample consisted of 2,198 males from 60 global populations, including 19 Native American and 15 indigenous North Asian groups. A set of 12 biallelic polymorphisms gave rise to 14 unique Y-chromosome haplotypes that were unevenly distributed among the populations. Combining multiallelic variation at two Y-linked microsatellites (DYS19 and DXYS156Y) with the unique haplotypes results in a total of 95 combination haplotypes. Contra previous findings based on Y- chromosome data, our new results suggest the possibility of more than one Native American paternal founder haplotype. We postulate that, of the nine unique haplotypes found in Native Americans, haplotypes 1C and 1F are the best candidates for major New World founder haplotypes, whereas haplotypes 1B, 1I, and 1U may either be founder haplotypes and/or have arrived in the New World via recent admixture. Two of the other four haplotypes (YAP+ haplotypes 4 and 5) are probably present because of post-Columbian admixture, whereas haplotype 1G may have originated in the New World, and the Old World source of the final New World haplotype (1D) remains unresolved. The contrasting distribution patterns of the two major candidate founder haplotypes in Asia and the New World, as well as the results of a nested cladistic analysis, suggest the possibility of more than one paternal migration from the general region of Lake Baikal to the Americas. PMID:10053017

  15. Single Marker and Haplotype-Based Association Analysis of Semolina and Pasta Colour in Elite Durum Wheat Breeding Lines Using a High-Density Consensus Map.

    PubMed

    N'Diaye, Amidou; Haile, Jemanesh K; Cory, Aron T; Clarke, Fran R; Clarke, John M; Knox, Ron E; Pozniak, Curtis J

    2017-01-01

    Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype

  16. Single Marker and Haplotype-Based Association Analysis of Semolina and Pasta Colour in Elite Durum Wheat Breeding Lines Using a High-Density Consensus Map

    PubMed Central

    Haile, Jemanesh K.; Cory, Aron T.; Clarke, Fran R.; Clarke, John M.; Knox, Ron E.; Pozniak, Curtis J.

    2017-01-01

    Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype

  17. Transcriptome analysis reveals the same 17 S-locus F-box genes in two haplotypes of the self-incompatibility locus of Petunia inflata.

    PubMed

    Williams, Justin S; Der, Joshua P; dePamphilis, Claude W; Kao, Teh-Hui

    2014-07-01

    Petunia possesses self-incompatibility, by which pistils reject self-pollen but accept non-self-pollen for fertilization. Self-/non-self-recognition between pollen and pistil is regulated by the pistil-specific S-RNase gene and by multiple pollen-specific S-locus F-box (SLF) genes. To date, 10 SLF genes have been identified by various methods, and seven have been shown to be involved in pollen specificity. For a given S-haplotype, each SLF interacts with a subset of its non-self S-RNases, and an as yet unknown number of SLFs are thought to collectively mediate ubiquitination and degradation of all non-self S-RNases to allow cross-compatible pollination. To identify a complete suite of SLF genes of P. inflata, we used a de novo RNA-seq approach to analyze the pollen transcriptomes of S2-haplotype and S3-haplotype, as well as the leaf transcriptome of the S3S3 genotype. We searched for genes that fit several criteria established from the properties of the known SLF genes and identified the same seven new SLF genes in S2-haplotype and S3-haplotype, suggesting that a total of 17 SLF genes constitute pollen specificity in each S-haplotype. This finding lays the foundation for understanding how multiple SLF genes evolved and the biochemical basis for differential interactions between SLF proteins and S-RNases. © 2014 American Society of Plant Biologists. All rights reserved.

  18. Simulation of multi-photon emission isotopes using time-resolved SimSET multiple photon history generator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chiang, Chih-Chieh; Lin, Hsin-Hon; Lin, Chang-Shiun

    Abstract-Multiple-photon emitters, such as In-111 or Se-75, have enormous potential in the field of nuclear medicine imaging. For example, Se-75 can be used to investigate the bile acid malabsorption and measure the bile acid pool loss. The simulation system for emission tomography (SimSET) is a well-known Monte Carlo simulation (MCS) code in nuclear medicine for its high computational efficiency. However, current SimSET cannot simulate these isotopes due to the lack of modeling of complex decay scheme and the time-dependent decay process. To extend the versatility of SimSET for simulation of those multi-photon emission isotopes, a time-resolved multiple photon history generatormore » based on SimSET codes is developed in present study. For developing the time-resolved SimSET (trSimSET) with radionuclide decay process, the new MCS model introduce new features, including decay time information and photon time-of-flight information, into this new code. The half-life of energy states were tabulated from the Evaluated Nuclear Structure Data File (ENSDF) database. The MCS results indicate that the overall percent difference is less than 8.5% for all simulation trials as compared to GATE. To sum up, we demonstrated that time-resolved SimSET multiple photon history generator can have comparable accuracy with GATE and keeping better computational efficiency. The new MCS code is very useful to study the multi-photon imaging of novel isotopes that needs the simulation of lifetime and the time-of-fight measurements. (authors)« less

  19. Mitochondrial haplotype variation and phylogeography of Iberian brown trout populations.

    PubMed

    MacHordom, A; Suárez, J; Almodóvar, A; Bautista, J M

    2000-09-01

    The biogeographical distribution of brown trout mitochondrial DNA haplotypes throughout the Iberian Peninsula was established by polymerase chain reaction-restriction fragment polymorphism analysis. The study of 507 specimens from 58 localities representing eight widely separated Atlantic-slope (north and west Iberian coasts) and six Mediterranean drainage systems served to identify five main groups of mitochondrial haplotypes: (i) haplotypes corresponding to non-native, hatchery-reared brown trout that were widely distributed but also found in wild populations of northern Spain (Cantabrian slope); (ii) a widespread Atlantic haplotype group; (iii) a haplotype restricted to the Duero Basin; (iv) a haplotype shown by southern Iberian populations; and (v) a Mediterranean haplotype. The Iberian distribution of these haplotypes reflects both the current fishery management policy of introducing non-native brown trout, and Messinian palaeobiogeography. Our findings complement and extend previous allozyme studies on Iberian brown trout and improve present knowledge of glacial refugia and postglacial movement of brown trout lineages.

  20. Haplotype-Based Association Analysis via Variance-Components Score Test

    PubMed Central

    Tzeng, Jung-Ying ; Zhang, Daowen 

    2007-01-01

    Haplotypes provide a more informative format of polymorphisms for genetic association analysis than do individual single-nucleotide polymorphisms. However, the practical efficacy of haplotype-based association analysis is challenged by a trade-off between the benefits of modeling abundant variation and the cost of the extra degrees of freedom. To reduce the degrees of freedom, several strategies have been considered in the literature. They include (1) clustering evolutionarily close haplotypes, (2) modeling the level of haplotype sharing, and (3) smoothing haplotype effects by introducing a correlation structure for haplotype effects and studying the variance components (VC) for association. Although the first two strategies enjoy a fair extent of power gain, empirical evidence showed that VC methods may exhibit only similar or less power than the standard haplotype regression method, even in cases of many haplotypes. In this study, we report possible reasons that cause the underpowered phenomenon and show how the power of the VC strategy can be improved. We construct a score test based on the restricted maximum likelihood or the marginal likelihood function of the VC and identify its nontypical limiting distribution. Through simulation, we demonstrate the validity of the test and investigate the power performance of the VC approach and that of the standard haplotype regression approach. With suitable choices for the correlation structure, the proposed method can be directly applied to unphased genotypic data. Our method is applicable to a wide-ranging class of models and is computationally efficient and easy to implement. The broad coverage and the fast and easy implementation of this method make the VC strategy an effective tool for haplotype analysis, even in modern genomewide association studies. PMID:17924336

  1. The effect of using genealogy-based haplotypes for genomic prediction

    PubMed Central

    2013-01-01

    Background Genomic prediction uses two sources of information: linkage disequilibrium between markers and quantitative trait loci, and additive genetic relationships between individuals. One way to increase the accuracy of genomic prediction is to capture more linkage disequilibrium by regression on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. Methods A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (π) of the haplotype covariates had zero effect, i.e. a Bayesian mixture method. Results About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some cases, decreased the bias of prediction. With the Bayesian method, accuracy of prediction was less sensitive to parameter π when fitting haplotypes compared to fitting markers. Conclusions Use of haplotypes based on genealogy can slightly increase the accuracy of genomic prediction. Improved methods to cluster the haplotypes constructed from local genealogy could lead to additional gains in accuracy. PMID:23496971

  2. IL7Rα Expression and Upregulation by IFNβ in Dendritic Cell Subsets Is Haplotype-Dependent

    PubMed Central

    McKay, Fiona C.; Hoe, Edwin; Parnell, Grant; Gatt, Prudence; Schibeci, Stephen D.; Stewart, Graeme J.; Booth, David R.

    2013-01-01

    The IL7Rα gene is unequivocally associated with susceptibility to multiple sclerosis (MS). Haplotype 2 (Hap 2) confers protection from MS, and T cells and dendritic cells (DCs) of Hap 2 exhibit reduced splicing of exon 6, resulting in production of relatively less soluble receptor, and potentially more response to ligand. We have previously shown in CD4 T cells that IL7Rα haplotypes 1 and 2, but not 4, respond to interferon beta (IFNβ), the most commonly used immunomodulatory drug in MS, and that haplotype 4 (Hap 4) homozygotes have the highest risk of developing MS. We now show that IL7R expression increases in myeloid cells in response to IFNβ, but that the response is haplotype-dependent, with cells from homozygotes for Hap 4 again showing no response. This was shown using freshly derived monocytes, in vitro cultured immature and mature monocyte-derived dendritic cells, and by comparing homozygotes for the common haplotypes, and relative expression of alleles in heterozygotes (Hap 4 vs not Hap 4). As for T cells, in all myeloid cell subsets examined, Hap 2 homozygotes showed a trend for reduced splicing of exon 6 compared to the other haplotypes, significantly so in most conditions. These data are consistent with increased signaling being protective from MS, constitutively and in response to IFNβ. We also demonstrate significant regulation of immune response, chemokine activity and cytokine biosynthesis pathways by IL7Rα signaling in IFNβ -treated myeloid subsets. IFNβ-responsive genes are over-represented amongst genes associated with MS susceptibility. IL7Rα haplotype may contribute to MS susceptibility through reduced capacity for IL7Rα signalling in myeloid cells, especially in the presence of IFNβ, and is currently under investigation as a predictor of therapeutic response. PMID:24147013

  3. MHC Class II haplotypes of Colombian Amerindian tribes

    PubMed Central

    Yunis, Juan J.; Yunis, Edmond J.; Yunis, Emilio

    2013-01-01

    We analyzed 1041 individuals belonging to 17 Amerindian tribes of Colombia, Chimila, Bari and Tunebo (Chibcha linguistic family), Embera, Waunana (Choco linguistic family), Puinave and Nukak (Maku-Puinave linguistic families), Cubeo, Guanano, Tucano, Desano and Piratapuyo (Tukano linguistic family), Guahibo and Guayabero (Guayabero Linguistic Family), Curripaco and Piapoco (Arawak linguistic family) and Yucpa (Karib linguistic family). for MHC class II haplotypes (HLA-DRB1, DQA1, DQB1). Approximately 90% of the MHC class II haplotypes found among these tribes are haplotypes frequently encountered in other Amerindian tribes. Nonetheless, striking differences were observed among Chibcha and non-Chibcha speaking tribes. The DRB1*04:04, DRB1*04:11, DRB1*09:01 carrying haplotypes were frequently found among non-Chibcha speaking tribes, while the DRB1*04:07 haplotype showed significant frequencies among Chibcha speaking tribes, and only marginal frequencies among non-Chibcha speaking tribes. Our results suggest that the differences in MHC class II haplotype frequency found among Chibcha and non-Chibcha speaking tribes could be due to genetic differentiation in Mesoamerica of the ancestral Amerindian population into Chibcha and non-Chibcha speaking populations before they entered into South America. PMID:23885196

  4. Y-SNPs haplotype diversity in four Chinese cattle breeds.

    PubMed

    Zhang, Runfeng; Cheng, Ming; Li, Xiaofeng; Chen, Fuying; Zheng, Jing; Wang, Xiaofei; Meng, Quanke

    2013-01-01

    To investigate the genetic diversity of Chinese cattle, 96 male samples of 4 Chinese native cattle breeds were investigated using 5 single nucleotide polymorphisms specific to the bovine Y chromosome. Two previously described haplotypes (taurine Y2 and indicine Y3) were detected in 74 and 22 animals, respectively. The haplotype frequencies varied amongst the four native breeds. The taurine Y2 haplotype dominated in the Qinchuan, Dabieshan, and Yunba breeds. However, the indicine Y3 haplotype occurred in high frequency in the Enshi breed. Among the four native breeds, Yunba had the highest haplotype diversity (0.4330 ± 0.0750), followed by Qinchuan (0.2899 ± 0.1028) and Enshi (0.2222 ± 0.1662), Dabieshan was the least differentiated (0.1079 ± 0.0680). Compared with some foreign cattle breeds, the low level of haplotype diversity was detected in our breeds (0.2633 ± 0.1030).

  5. Genetic variation in CXCR1 haplotypes linked to severity of Streptococcus uberis infection in an experimental challenge model.

    PubMed

    Siebert, Lydia; Headrick, Susan; Lewis, Mark; Gillespie, Barbara; Young, Charlie; Wojakiewicz, Leszek; Kerro-Dego, Oudessa; Prado, Maria E; Almeida, Raul; Oliver, Stephen P; Pighetti, Gina M

    2017-08-01

    Mastitis, an inflammation of the mammary gland, costs the dairy industry billions of dollars in lost revenues annually. The prevalence and costs associated with mastitis has made genetic selection methods a target for research. Previous research has identified amino acid changes at positions 122, 207, 245, 327, and 332 in the IL8 receptor, CXCR1, that result in three dominant amino acid haplotypes: VWHKH, VWHRR, and AWQRR. We hypothesize different haplotype combinations influence a cow's resistance, strength, and duration of response to mastitis. To test this, Holstein dairy cows (n=40) were intramammarily challenged with Streptococcus uberis within 3 d post-calving. All cows developed mastitis based on isolation of S. uberis from the challenged quarter at least twice. All cows with the VWHRR x VWHRR (n=5) and AWQRR x VWHRR (n=6) haplotype combinations required antibiotic therapy due to clinical signs of mastitis and tended (P=0.08) to be different from cows with a VWHRR x VWHKH (n=6) haplotype combination where only 33.3% required antibiotic therapy. Cows with a VWHRR homozygous haplotype combination displayed significantly higher responses to challenge indicated by elevated S. uberis counts (4340±5,521.9CFU/mL; P=0.01), mammary scores (1.1±0.18; P=0.03), milk scores (0.9±0.17; P=0.002), and SCC (1,010,832±489,993cells/mL; P=0.03). Contrastingly, AWQRR x VWHRR cows had significantly lower S. uberis counts (15.3±16.46CFU/mL; P=0.01), mammary scores (0.3±0.16; P=0.03), milk scores (0±0.15; P=0.002), and SCC (239,261±92,264.3cells/mL; P=0.03). Cows of the VWHKH x VWHRR haplotype combination displayed responses to challenge statistically comparable to other haplotype combinations, but appeared to have an earlier peak in SCC in comparison to all other haplotype combinations. Haplotype combination did not influence milk yield (P=0.6). Our results suggest using combinations of the SNPs within the CXCR1 gene gives a better indication of a cow's ability to combat S

  6. Sparse Tensor Decomposition for Haplotype Assembly of Diploids and Polyploids.

    PubMed

    Hashemi, Abolfazl; Zhu, Banghua; Vikalo, Haris

    2018-03-21

    Haplotype assembly is the task of reconstructing haplotypes of an individual from a mixture of sequenced chromosome fragments. Haplotype information enables studies of the effects of genetic variations on an organism's phenotype. Most of the mathematical formulations of haplotype assembly are known to be NP-hard and haplotype assembly becomes even more challenging as the sequencing technology advances and the length of the paired-end reads and inserts increases. Assembly of haplotypes polyploid organisms is considerably more difficult than in the case of diploids. Hence, scalable and accurate schemes with provable performance are desired for haplotype assembly of both diploid and polyploid organisms. We propose a framework that formulates haplotype assembly from sequencing data as a sparse tensor decomposition. We cast the problem as that of decomposing a tensor having special structural constraints and missing a large fraction of its entries into a product of two factors, U and [Formula: see text]; tensor [Formula: see text] reveals haplotype information while U is a sparse matrix encoding the origin of erroneous sequencing reads. An algorithm, AltHap, which reconstructs haplotypes of either diploid or polyploid organisms by iteratively solving this decomposition problem is proposed. The performance and convergence properties of AltHap are theoretically analyzed and, in doing so, guarantees on the achievable minimum error correction scores and correct phasing rate are established. The developed framework is applicable to diploid, biallelic and polyallelic polyploid species. The code for AltHap is freely available from https://github.com/realabolfazl/AltHap . AltHap was tested in a number of different scenarios and was shown to compare favorably to state-of-the-art methods in applications to haplotype assembly of diploids, and significantly outperforms existing techniques when applied to haplotype assembly of polyploids.

  7. In vitro and ex vivo analysis of CHRNA3 and CHRNA5 haplotype expression.

    PubMed

    Doyle, Glenn A; Wang, Min-Jung; Chou, Andrew D; Oleynick, John U; Arnold, Steven E; Buono, Russell J; Ferraro, Thomas N; Berrettini, Wade H

    2011-01-01

    Genome-wide association studies implicate variations in CHRNA5 and CHRNA3 as being associated with nicotine addiction (NA). Multiple common haplotypes ("risk", "mixed" and "protective") exist in Europeans; however, high linkage disequilibrium between variations in CHRNA5 and CHRNA3 makes assigning causative allele(s) for NA difficult through genotyping experiments alone. We investigated whether CHRNA5 or CHRNA3 promoter haplotypes, associated previously with NA, might influence allelic expression levels. For in vitro analyses, promoter haplotypes were sub-cloned into a luciferase reporter vector. When assessed in BE(2)-C cells, luciferase expression was equivalent among CHRNA3 haplotypes, but the combination of deletion at rs3841324 and variation at rs503464 decreased CHRNA5 promoter-derived luciferase activity, possibly due to loss of an SP-1 and other site(s). Variation within the CHRNA5 5'UTR at rs55853698 and rs55781567 also altered luciferase expression in BE(2)-C cells. Allelic expression imbalance (AEI) from the "risk" or "protective" haplotypes was assessed in post-mortem brain tissue from individuals heterozygous at coding polymorphisms in CHRNA3 (rs1051730) or CHRNA5 (rs16969968). In most cases, equivalent allelic expression was observed; however, one individual showed CHRNA5 AEI that favored the "protective" allele and that was concordant with heterozygosity at polymorphisms ∼13.5 kb upstream of the CHRNA5 transcription start site. Putative enhancer activity from these distal promoter elements was assessed using heterologous promoter constructs. We observed no differences in promoter activity from the two distal promoter haplotypes examined, but found that the distal promoter region strongly repressed transcription. We conclude that CHRNA5 promoter variants may affect relative risk for NA in some heterozygous individuals.

  8. PAX6 Haplotypes Are Associated with High Myopia in Han Chinese

    PubMed Central

    Jiang, Bo; Yap, Maurice K. H.; Leung, Kim Hung; Ng, Po Wah; Fung, Wai Yan; Lam, Wai Wa; Gu, Yang-shun; Yip, Shea Ping

    2011-01-01

    Background The paired box 6 (PAX6) gene is considered as a master gene for eye development. Linkage of myopia to the PAX6 region on chromosome 11p13 was shown in several studies, but the results for association between myopia and PAX6 were inconsistent so far. Methodology/Principal Findings We genotyped 16 single nucleotide polymorphisms (SNPs) in the PAX6 gene and its regulatory regions in an initial study for 300 high myopia cases and 300 controls (Group 1), and successfully replicated the positive results with another independent group of 299 high myopia cases and 299 controls (Group 2). Five SNPs were genotyped in the replication study. The spherical equivalent of subjects with high myopia was ≤−8.0 dioptres. The PLINK package was used for genetic data analysis. No association was found between each of the SNPs and high myopia. However, exhaustive sliding-window haplotype analysis highlighted an important role for rs12421026 because haplotypes containing this SNP were found to be associated with high myopia. The most significant results were given by the 4-SNP haplotype window consisting of rs2071754, rs3026393, rs1506 and rs12421026 (P = 3.54×10−10, 4.06×10−11 and 1.56×10−18 for Group 1, Group 2 and Combined Group, respectively) and the 3-SNP haplotype window composed of rs3026393, rs1506 and rs12421026 (P = 5.48×10−10, 7.93×10−12 and 6.28×10−23 for the three respective groups). The results remained significant after correction for multiple comparisons by permutations. The associated haplotyes found in a previous study were also successfully replicated in this study. Conclusions/Significance PAX6 haplotypes are associated with susceptibility to the development of high myopia in Chinese. The PAX6 locus plays a role in high myopia. PMID:21589860

  9. Prion gene haplotypes of U.S. cattle

    PubMed Central

    Clawson, Michael L; Heaton, Michael P; Keele, John W; Smith, Timothy PL; Harhay, Gregory P; Laegreid, William W

    2006-01-01

    Background Bovine spongiform encephalopathy (BSE) is a fatal neurological disorder characterized by abnormal deposits of a protease-resistant isoform of the prion protein. Characterizing linkage disequilibrium (LD) and haplotype networks within the bovine prion gene (PRNP) is important for 1) testing rare or common PRNP variation for an association with BSE and 2) interpreting any association of PRNP alleles with BSE susceptibility. The objective of this study was to identify polymorphisms and haplotypes within PRNP from the promoter region through the 3'UTR in a diverse sample of U.S. cattle genomes. Results A 25.2-kb genomic region containing PRNP was sequenced from 192 diverse U.S. beef and dairy cattle. Sequence analyses identified 388 total polymorphisms, of which 287 have not previously been reported. The polymorphism alleles define PRNP by regions of high and low LD. High LD is present between alleles in the promoter region through exon 2 (6.7 kb). PRNP alleles within the majority of intron 2, the entire coding sequence and the untranslated region of exon 3 are in low LD (18.0 kb). Two haplotype networks, one representing the region of high LD and the other the region of low LD yielded nineteen different combinations that represent haplotypes spanning PRNP. The haplotype combinations are tagged by 19 polymorphisms (htSNPS) which characterize variation within and across PRNP. Conclusion The number of polymorphisms in the prion gene region of U.S. cattle is nearly four times greater than previously described. These polymorphisms define PRNP haplotypes that may influence BSE susceptibility in cattle. PMID:17092337

  10. [A total of 362 HLA different haplotypes and HLA recombination haplotypes based on analysis of their family pedigree in Chinese partial Han populations].

    PubMed

    Gao, Su-Qing; Cheng, Xi; Li, Qian; Li, Yu-Zhu; Deng, Zhi-Hui

    2009-06-01

    This study was aimed to discover the novel HLA recombination haplotypes and investigate the distribution of haplotypes in Chinese Han population. Based on the HLA-A, B, DRB1 typing results of 179 family members, 791 haplotypes were assigned by the mode of inheritance. The results showed that a total of 4 novel recombinant haplotypes in HLA-DRB1 locus region were observed in 4 families, which ratio of paternal to maternal chromosomes was 3:1. The recombination ratio between HLA-DRB1 and HLA-A or B loci was 0.92% (4/433). There were a total of 362 kinds of HLA-A, -B, -DRB1 haplotypes to be confirmed in Chinese Han partial population. A33-B58-DR17, A2-B46-DR9, A30-B13-DR7, A11-B13-DR15, A11-B75-DR12 and A2-B46-DR14 were the most common haplotypes that was consistent with the distribution of HLA alleles in unrelated donors. There were A1-B63-DR12, A29-B46-DR15, A1-B61-DR10, A34-B35-DR9, A29-B54-DR4, A23-B13-DR16 and A34-B62-DR15 haplotypes and so on, which were rare haplotypes not yet reported in Chinese. It is concluded that the HLA-A-B-DRB1 haplotypes would be confirmed by analysis of their family pedigree. The results obtained in this study are basic data for study of Chinese anthropology, organ transplantation and disease correlation analysis.

  11. Alpha-globin gene haplotypes in South American Indians.

    PubMed

    Zago, M A; Melo Santos, E J; Clegg, J B; Guerreiro, J F; Martinson, J J; Norwich, J; Figueiredo, M S

    1995-08-01

    The haplotypes of the alpha-globin gene cluster were determined for 99 Indians from the Brazilian Amazon region who belong to 5 tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Three predominant haplotypes were identified: Ia (present in 38.9% of chromosomes), IIIa (25.8%), and IIe (22.1%). The only alpha-globin gene rearrangement detected was alpha alpha alpha 3.7 I gene triplication associated with haplotype IIIa, found in high frequencies (5.6% and 10.6%) in two tribes and absent in the others. alpha-Globin gene deletions that cause alpha-thalassemia were not seen, supporting the argument that malaria was absent in these populations until recently. The heterogeneous distribution of alpha-globin gene haplotypes and rearrangements among the different tribes differs markedly from the homogeneous distribution of beta-globin gene cluster haplotypes and reflects the action of various genetic mechanisms (genetic drift, founder effect, consanguinity) on small isolated population groups with a complicated history of divergence-fusion events. The alpha-globin gene haplotype distribution has some similarities to distributions observed in Southeast Asian and Pacific Island populations, indicating that these populations have considerable genetic affinities. However, the absence of several features of the alpha-globin gene cluster that are consistently present among the Pacific Islanders suggests that the similarity of haplotypes between Brazilian Indians and people from Polynesia, Micronesia, and Melanesia is more likely to result of ancient common ancestry rather than the consequence of recent direct genetic contribution through immigration.

  12. In Vivo Characterization of Human APOA5 Haplotypes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahituv, Nadav; Akiyama, Jennifer; Chapman-Helleboid, Audrey

    2006-10-01

    Increased plasma triglycerides concentrations are an independent risk factor for cardiovascular disease. Numerous studies support a reproducible genetic association between two minor haplotypes in the human apolipoprotein A5 gene (APOA5) and increased plasma triglyceride concentrations. We thus sought to investigate the effect of these minor haplotypes (APOA5*2 and APOA5*3) on ApoAV plasma levels through the precise insertion of single-copy intact APOA5 haplotypes at a targeted location in the mouse genome. While we found no difference in the amount of human plasma ApoAV in mice containing the common APOA5*1 and minor APOA5*2 haplotype, the introduction of the single APOA5*3 defining allelemore » (19W) resulted in 3-fold lower ApoAV plasma levels consistent with existing genetic association studies. These results indicate that S19W polymorphism is likely to be functional and explain the strong association of this variant with plasma triglycerides supporting the value of sensitive in vivo assays to define the functional nature of human haplotypes.« less

  13. Global spread and genetic variants of the two CYP9M10 haplotype forms associated with insecticide resistance in Culex quinquefasciatus Say.

    PubMed

    Itokawa, K; Komagata, O; Kasai, S; Kawada, H; Mwatele, C; Dida, G O; Njenga, S M; Mwandawiro, C; Tomita, T

    2013-09-01

    Insecticide resistance develops as a genetic factor (allele) conferring lower susceptibility to insecticides proliferates within a target insect population under strong positive selection. Intriguingly, a resistance allele pre-existing in a population often bears a series of further adaptive allelic variants through new mutations. This phenomenon occasionally results in replacement of the predominating resistance allele by fitter new derivatives, and consequently, development of greater resistance at the population level. The overexpression of the cytochrome P450 gene CYP9M10 is associated with pyrethroid resistance in the southern house mosquito Culex quinquefasciatus. Previously, we have found two genealogically related overexpressing CYP9M10 haplotypes, which differ in gene copy number (duplicated and non-duplicated). The duplicated haplotype was derived from the non-duplicated overproducer probably recently. In the present study, we investigated allelic series of CYP9M10 involved in three C. quinquefasciatus laboratory colonies recently collected from three different localities. Duplicated and non-duplicated overproducing haplotypes coexisted in African and Asian colonies indicating a global distribution of both haplotype lineages. The duplicated haplotypes both in the Asian and African colonies were associated with higher expression levels and stronger resistance than non-duplicated overproducing haplotypes. There were slight variation in expression level among the non-duplicated overproducing haplotypes. The nucleotide sequences in coding and upstream regions among members of this group also showed a little diversity. Non-duplicated overproducing haplotypes with relatively higher expression were genealogically closer to the duplicated haplotypes than the other non-duplicated overproducing haplotypes, suggesting multiple cis-acting mutations before duplication.

  14. HAPRAP: a haplotype-based iterative method for statistical fine mapping using GWAS summary statistics.

    PubMed

    Zheng, Jie; Rodriguez, Santiago; Laurin, Charles; Baird, Denis; Trela-Larsen, Lea; Erzurumluoglu, Mesut A; Zheng, Yi; White, Jon; Giambartolomei, Claudia; Zabaneh, Delilah; Morris, Richard; Kumari, Meena; Casas, Juan P; Hingorani, Aroon D; Evans, David M; Gaunt, Tom R; Day, Ian N M

    2017-01-01

    Fine mapping is a widely used approach for identifying the causal variant(s) at disease-associated loci. Standard methods (e.g. multiple regression) require individual level genotypes. Recent fine mapping methods using summary-level data require the pairwise correlation coefficients ([Formula: see text]) of the variants. However, haplotypes rather than pairwise [Formula: see text], are the true biological representation of linkage disequilibrium (LD) among multiple loci. In this article, we present an empirical iterative method, HAPlotype Regional Association analysis Program (HAPRAP), that enables fine mapping using summary statistics and haplotype information from an individual-level reference panel. Simulations with individual-level genotypes show that the results of HAPRAP and multiple regression are highly consistent. In simulation with summary-level data, we demonstrate that HAPRAP is less sensitive to poor LD estimates. In a parametric simulation using Genetic Investigation of ANthropometric Traits height data, HAPRAP performs well with a small training sample size (N < 2000) while other methods become suboptimal. Moreover, HAPRAP's performance is not affected substantially by single nucleotide polymorphisms (SNPs) with low minor allele frequencies. We applied the method to existing quantitative trait and binary outcome meta-analyses (human height, QTc interval and gallbladder disease); all previous reported association signals were replicated and two additional variants were independently associated with human height. Due to the growing availability of summary level data, the value of HAPRAP is likely to increase markedly for future analyses (e.g. functional prediction and identification of instruments for Mendelian randomization). The HAPRAP package and documentation are available at http://apps.biocompute.org.uk/haprap/ CONTACT: : jie.zheng@bristol.ac.uk or tom.gaunt@bristol.ac.ukSupplementary information: Supplementary data are available at

  15. Lower frequency of the HLA-G UTR-4 haplotype in women with unexplained recurrent miscarriage.

    PubMed

    Meuleman, T; Drabbels, J; van Lith, J M M; Dekkers, O M; Rozemuller, E; Cretu-Stancu, M; Claas, F H J; Bloemenkamp, K W M; Eikmans, M

    2018-04-01

    HLA-G expressed by trophoblasts at the fetal-maternal interface and its soluble form have immunomodulatory effects. HLA-G expression depends on the combination of DNA polymorphisms. We hypothesized that combinations of specific single nucleotide polymorphisms (SNPs) in the 3'untranslated region (3'UTR) of HLA-G play a role in unexplained recurrent miscarriage. In a case control design, 100 cases with at least three unexplained consecutive miscarriages prior to the 20th week of gestation were included. Cases were at time of the third miscarriage younger than 36 years, and they conceived all their pregnancies from the same partner. The control group included 89 women with an uneventful pregnancy. The association of HLA-G 3'UTR SNPs and specific HLA-G haplotype with recurrent miscarriage was studied with logistic regression. Odds ratios (OR) and 95% confidence intervals (95% CI) were reported. Individual SNPs were not significantly associated with recurrent miscarriage after correction for multiple comparisons. However, the presence of the UTR-4 haplotype, which included +3003C, was significantly lower in women with recurrent miscarriage (OR 0.4, 95% CI 0.2-0.8, p = 0.015). In conclusion, this is the first study to perform a comprehensive analysis of HLA-G SNPs and HLA-G haplotypes in a well-defined group of women with recurrent miscarriage and women with uneventful pregnancy. The UTR-4 haplotype was less frequently observed in women with recurrent miscarriage, suggesting an immunoregulatory role of this haplotype for continuation of the pregnancy without complications. Thus, association of HLA-G with recurrent miscarriage is not related to single polymorphisms in the 3'UTR, but is rather dependent on haplotypes. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. An unusual haplotype structure on human chromosome 8p23 derived from the inversion polymorphism.

    PubMed

    Deng, Libin; Zhang, Yuezheng; Kang, Jian; Liu, Tao; Zhao, Hongbin; Gao, Yang; Li, Chaohua; Pan, Hao; Tang, Xiaoli; Wang, Dunmei; Niu, Tianhua; Yang, Huanming; Zeng, Changqing

    2008-10-01

    Chromosomal inversion is an important type of genomic variations involved in both evolution and disease pathogenesis. Here, we describe the refined genetic structure of a 3.8-Mb inversion polymorphism at chromosome 8p23. Using HapMap data of 1,073 SNPs generated from 209 unrelated samples from CEPH-Utah residents with ancestry from northern and western Europe (CEU); Yoruba in Ibadan, Nigeria (YRI); and Asian (ASN) samples, which were comprised of Han Chinese from Beijing, China (CHB) and Japanese from Tokyo, Japan (JPT)-we successfully deduced the inversion orientations of all their 418 haplotypes. In particular, distinct haplotype subgroups were identified based on principal component analysis (PCA). Such genetic substructures were consistent with clustering patterns based on neighbor-joining tree reconstruction, which revealed a total of four haplotype clades across all samples. Metaphase fluorescence in situ hybridization (FISH) in a subset of 10 HapMap samples verified their inversion orientations predicted by PCA or phylogenetic tree reconstruction. Positioning of the outgroup haplotype within one of YRI clades suggested that Human NCBI Build 36-inverted order is most likely the ancestral orientation. Furthermore, the population differentiation test and the relative extended haplotype homozygosity (REHH) analysis in this region discovered multiple selection signals, also in a population-specific manner. A positive selection signal was detected at XKR6 in the ASN population. These results revealed the correlation of inversion polymorphisms to population-specific genetic structures, and various selection patterns as possible mechanisms for the maintenance of a large chromosomal rearrangement at 8p23 region during evolution. In addition, our study also showed that haplotype-based clustering methods, such as PCA, can be applied in scanning for cryptic inversion polymorphisms at a genome-wide scale.

  17. Kullback-Leibler divergence for detection of rare haplotype common disease association.

    PubMed

    Lin, Shili

    2015-11-01

    Rare haplotypes may tag rare causal variants of common diseases; hence, detection of such rare haplotypes may also contribute to our understanding of complex disease etiology. Because rare haplotypes frequently result from common single-nucleotide polymorphisms (SNPs), focusing on rare haplotypes is much more economical compared with using rare single-nucleotide variants (SNVs) from sequencing, as SNPs are available and 'free' from already amassed genome-wide studies. Further, associated haplotypes may shed light on the underlying disease causal mechanism, a feat unmatched by SNV-based collapsing methods. In recent years, data mining approaches have been adapted to detect rare haplotype association. However, as they rely on an assumed underlying disease model and require the specification of a null haplotype, results can be erroneous if such assumptions are violated. In this paper, we present a haplotype association method based on Kullback-Leibler divergence (hapKL) for case-control samples. The idea is to compare haplotype frequencies for the cases versus the controls by computing symmetrical divergence measures. An important property of such measures is that both the frequencies and logarithms of the frequencies contribute in parallel, thus balancing the contributions from rare and common, and accommodating both deleterious and protective, haplotypes. A simulation study under various scenarios shows that hapKL has well-controlled type I error rates and good power compared with existing data mining methods. Application of hapKL to age-related macular degeneration (AMD) shows a strong association of the complement factor H (CFH) gene with AMD, identifying several individual rare haplotypes with strong signals.

  18. Allelic and haplotypic diversity of HLA-A, -B, -C, -DRB1, and -DQB1 genes in the Korean population.

    PubMed

    Lee, K W; Oh, D H; Lee, C; Yang, S Y

    2005-05-01

    High-resolution human leukocyte antigen (HLA) typing exposes the unique patterns of HLA allele and haplotype frequencies in each population. In this study, HLA-A, -B, -C, -DRB1, and -DQB1 genotypes were analyzed in 485 apparently unrelated healthy Korean individuals. A total of 20 HLA-A, 43 HLA-B, 21 HLA-C, 31 HLA-DRB1, and 14 HLA-DQB1 alleles were identified. Eleven alleles (A*0201, A*1101, A*2402, A*3303, B*1501, Cw*0102, Cw*0302, Cw*0303, DQB1*0301, DQB1*0302, and DQB1*0303) were found in more than 10% of the population. In each serologic group, a maximum of three alleles were found with several exceptions (A2, B62, DR4, DR14, and DQ6). In each serologic group exhibiting multiple alleles, two major alleles were present at 62-96% (i.e. A*0201 and A*0206 comprise 85% of A2-positive alleles). Multiple-locus haplotypes estimated by the maximum likelihood method revealed 51 A-C, 43 C-B, 52 B-DRB1, 34 DRB1-DQB1, 48 A-C-B, 42 C-B-DRB1, 46 B-DRB1-DQB1, and 30 A-C-B-DRB1-DQB1 haplotypes with frequencies of more than 0.5%. In spite of their high polymorphism in B and DRB1, identification of relatively small numbers of two-locus (B-C and DRB1-DQB1) haplotypes suggested strong associations of those two loci, respectively. Five-locus haplotypes defined by high-resolution DNA typing correlated well with previously identified serology-based haplotypes in the population. The five most frequent haplotypes were: A*3303-Cw*1403-B*4403-DRB1*1302-DQB1*0604 (4.2%), A*3303-Cw*0701/6-B*4403-DRB1*0701-DQB1*0201/2 (3.0%), A*3303-Cw*0302-B*5801-DRB1*1302-DQB1*0609 (3.0%), A*2402-Cw*0702-B*0702-DRB1*0101-DQB1*0501 (2.9%), and A*3001-Cw*0602-B*1302-DRB1*0701-DQB1*0201/2 (2.7%). Several sets of allele level haplotypes that could not be discriminated by routine HLA-A, -B, and -DRB1 low-resolution typing originated from allelic diversity of A2, B61, DR4, and DR8 serologic groups. Information obtained in this study will be useful for medical and forensic applications as well as in anthropology.

  19. HLA Type Inference via Haplotypes Identical by Descent

    NASA Astrophysics Data System (ADS)

    Setty, Manu N.; Gusev, Alexander; Pe'Er, Itsik

    The Human Leukocyte Antigen (HLA) genes play a major role in adaptive immune response and are used to differentiate self antigens from non self ones. HLA genes are hyper variable with nearly every locus harboring over a dozen alleles. This variation plays an important role in susceptibility to multiple autoimmune diseases and needs to be matched on for organ transplantation. Unfortunately, HLA typing by serological methods is time consuming and expensive compared to high throughput Single Nucleotide Polymorphism (SNP) data. We present a new computational method to infer per-locus HLA types using shared segments Identical By Descent (IBD), inferred from SNP genotype data. IBD information is modeled as graph where shared haplotypes are explored among clusters of individuals with known and unknown HLA types to identify the latter. We analyze performance of the method in a previously typed subset of the HapMap population, achieving accuracy of 96% in HLA-A, 94% in HLA-B, 95% in HLA-C, 77% in HLA-DR1, 93% in HLA-DQA1 and 90% in HLA-DQB1 genes. We compare our method to a tag SNP based approach and demonstrate higher sensitivity and specificity. Our method demonstrates the power of using shared haplotype segments for large-scale imputation at the HLA locus.

  20. Opposing effects of the HLA-DRB1*0301-DQB1*0201 haplotype on the risk for multiple sclerosis in diverse Arab populations in Israel.

    PubMed

    Benedek, G; Paperna, T; Avidan, N; Lejbkowicz, I; Oksenberg, J R; Wang, J; Brautbar, C; Israel, S; Miller, A

    2010-07-01

    Different multiple sclerosis (MS) prevalence rates were reported for Muslim and Christian Arabs in Israel. In this study, we evaluated whether associations of human leukocyte antigen (HLA) genes with MS may contribute to this prevalence difference. DNA samples from Israeli Arab MS patients (n=109) and controls (n=132) were typed for HLA class I (HLA-A, -B and -C) and II (HLA-DRB1 and -DQB1) genes. Global comparisons of HLA allele frequencies revealed significant differences between Christians and Muslims; therefore, case-control analyses were stratified by religious affiliation. Disease characteristics of Muslim and Christian Arab MS patients were similar to those reported for European populations. Opposing association signals with MS were observed for alleles composing the DRB1*0301-DQB1*0201 haplotype: positive association of the HLA-DRB1*0301 allele in Muslims (P(Bonferroni)=0.004, odds ratio (OR)=3.07), and negative association in Christian Arabs (P(Bonferroni)=0.01, OR=0.12), with similar results obtained for HLA-DQB1*0201. HLA-B*52 was negatively associated with MS only in Muslims (P(Bonferroni)=0.01, OR=0.03). The study presents for the first time a high-resolution HLA gene analysis in clinically well-characterized Arab populations with MS, and shows the population-specific contribution of the DRB1*0301-DQB1*0201 haplotype to disease susceptibility.

  1. A new mathematical modeling for pure parsimony haplotyping problem.

    PubMed

    Feizabadi, R; Bagherian, M; Vaziri, H R; Salahi, M

    2016-11-01

    Pure parsimony haplotyping (PPH) problem is important in bioinformatics because rational haplotyping inference plays important roles in analysis of genetic data, mapping complex genetic diseases such as Alzheimer's disease, heart disorders and etc. Haplotypes and genotypes are m-length sequences. Although several integer programing models have already been presented for PPH problem, its NP-hardness characteristic resulted in ineffectiveness of those models facing the real instances especially instances with many heterozygous sites. In this paper, we assign a corresponding number to each haplotype and genotype and based on those numbers, we set a mixed integer programing model. Using numbers, instead of sequences, would lead to less complexity of the new model in comparison with previous models in a way that there are neither constraints nor variables corresponding to heterozygous nucleotide sites in it. Experimental results approve the efficiency of the new model in producing better solution in comparison to two state-of-the art haplotyping approaches. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. The clinical application of single-sperm-based SNP haplotyping for PGD of osteogenesis imperfecta.

    PubMed

    Chen, Linjun; Diao, Zhenyu; Xu, Zhipeng; Zhou, Jianjun; Yan, Guijun; Sun, Haixiang

    2018-05-15

    Osteogenesis imperfecta (OI) is a genetically heterogeneous disorder, presenting either autosomal dominant, autosomal recessive or X-linked inheritance patterns. The majority of OI cases are autosomal dominant and are caused by heterozygous mutations in either the COL1A1 or COL1A2 gene. In these dominant disorders, allele dropout (ADO) can lead to misdiagnosis in preimplantation genetic diagnosis (PGD). Polymorphic markers linked to the mutated genes have been used to establish haplotypes for identifying ADO and ensuring the accuracy of PGD. However, the haplotype of male patients cannot be determined without data from affected relatives. Here, we developed a method for single-sperm-based single-nucleotide polymorphism (SNP) haplotyping via next-generation sequencing (NGS) for the PGD of OI. After NGS, 10 informative polymorphic SNP markers located upstream and downstream of the COL1A1 gene and its pathogenic mutation site were linked to individual alleles in a single sperm from an affected male. After haplotyping, a normal blastocyst was transferred to the uterus for a subsequent frozen embryo transfer cycle. The accuracy of PGD was confirmed by amniocentesis at 19 weeks of gestation. A healthy infant weighing 4,250 g was born via vaginal delivery at the 40th week of gestation. Single-sperm-based SNP haplotyping can be applied for PGD of any monogenic disorders or de novo mutations in males in whom the haplotype of paternal mutations cannot be determined due to a lack of affected relatives. ADO: allele dropout; DI: dentinogenesis imperfect; ESHRE: European Society of Human Reproduction and Embryology; FET: frozen embryo transfer; gDNA: genomic DNA; ICSI: intracytoplasmic sperm injection; IVF: in vitro fertilization; MDA: multiple displacement amplification; NGS: next-generation sequencing; OI: osteogenesis imperfect; PBS: phosphate buffer saline; PCR: polymerase chain reaction; PGD: preimplantation genetic diagnosis; SNP: single-nucleotide polymorphism; STR

  3. Asian population frequencies and haplotype distribution of killer cell immunoglobulin-like receptor (KIR) genes among Chinese, Malay, and Indian in Singapore.

    PubMed

    Lee, Yi Chuan; Chan, Soh Ha; Ren, Ee Chee

    2008-11-01

    Killer cell immunoglobulin-like receptors (KIR) gene frequencies have been shown to be distinctly different between populations and contribute to functional variation in the immune response. We have investigated KIR gene frequencies in 370 individuals representing three Asian populations in Singapore and report here the distribution of 14 KIR genes (2DL1, 2DL2, 2DL3, 2DL4, 2DL5, 2DS1, 2DS2, 2DS3, 2DS4, 2DS5, 3DL1, 3DL2, 3DL3, 3DS1) with two pseudogenes (2DP1, 3DP1) among Singapore Chinese (n = 210); Singapore Malay (n = 80), and Singapore Indian (n = 80). Four framework genes (KIR3DL3, 3DP1, 2DL4, 3DL2) and a nonframework pseudogene 2DP1 were detected in all samples while KIR2DS2, 2DL2, 2DL5, and 2DS5 had the greatest significant variation across the three populations. Fifteen significant linkage patterns, consistent with associations between genes of A and B haplotypes, were observed. Eighty-four distinct KIR profiles were determined in our populations, 38 of which had not been described in other populations. KIR haplotype studies were performed using nine Singapore Chinese families comprising 34 individuals. All genotypes could be resolved into corresponding pairs of existing haplotypes with eight distinct KIR genotypes and eight different haplotypes. The haplotype A2 with frequency of 63.9% was dominant in Singapore Chinese, comparable to that reported in Korean and Chinese Han. The A haplotypes predominate in Singapore Chinese, with ratio of A to B haplotypes of approximately 3:1. Comparison with KIR frequencies in other populations showed that Singapore Chinese shared similar distributions with Chinese Han, Japanese, and Korean; Singapore Indian was found to be comparable with North Indian Hindus while Singapore Malay resembled the Thai.

  4. Extensive population structure in San, Khoe, and mixed ancestry populations from southern Africa revealed by 44 short 5-SNP haplotypes.

    PubMed

    Schlebusch, Carina M; Soodyall, Himlya

    2012-12-01

    The San and Khoe people currently represent remnant groups of a much larger and widely distributed population of hunter-gatherers and pastoralists who had exclusive occupation of southern Africa before the arrival of Bantu-speaking groups in the past 1,200 years and sea-borne immigrants within the last 350 years. Genetic studies [mitochondrial deoxyribonucleic acid (DNA) and Y-chromosome] conducted on San and Khoe groups revealed that they harbor some of the most divergent lineages found in living peoples throughout the world. Recently, high-density, autosomal, single-nucleotide polymorphism (SNP)-array studies confirmed the early divergence of Khoe-San population groups from all other human populations. The present study made use of 220 autosomal SNP markers (in the format of both haplotypes and genotypes) to examine the population structure of various San and Khoe groups and their relationship to other neighboring groups. Whereas analyses based on the genotypic SNP data only supported the division of the included populations into three main groups-Khoe-San, Bantu-speakers, and non-African populations-haplotype analyses revealed finer structure within Khoe-San populations. By the use of only 44 short SNP haplotypes (compiled from a total of 220 SNPs), most of the Khoe-San groups could be resolved as separate groups by applying STRUCTURE analyses. Therefore, by carefully selecting a few SNPs and combining them into haplotypes, we were able to achieve the same level of population distinction that was achieved previously in high-density SNP studies on the same population groups. Using haplotypes proved to be a very efficient and cost-effective way to study population structure. Copyright © 2013 Wayne State University Press, Detroit, Michigan 48201-1309.

  5. Haplotype assembly in polyploid genomes and identical by descent shared tracts.

    PubMed

    Aguiar, Derek; Istrail, Sorin

    2013-07-01

    Genome-wide haplotype reconstruction from sequence data, or haplotype assembly, is at the center of major challenges in molecular biology and life sciences. For complex eukaryotic organisms like humans, the genome is vast and the population samples are growing so rapidly that algorithms processing high-throughput sequencing data must scale favorably in terms of both accuracy and computational efficiency. Furthermore, current models and methodologies for haplotype assembly (i) do not consider individuals sharing haplotypes jointly, which reduces the size and accuracy of assembled haplotypes, and (ii) are unable to model genomes having more than two sets of homologous chromosomes (polyploidy). Polyploid organisms are increasingly becoming the target of many research groups interested in the genomics of disease, phylogenetics, botany and evolution but there is an absence of theory and methods for polyploid haplotype reconstruction. In this work, we present a number of results, extensions and generalizations of compass graphs and our HapCompass framework. We prove the theoretical complexity of two haplotype assembly optimizations, thereby motivating the use of heuristics. Furthermore, we present graph theory-based algorithms for the problem of haplotype assembly using our previously developed HapCompass framework for (i) novel implementations of haplotype assembly optimizations (minimum error correction), (ii) assembly of a pair of individuals sharing a haplotype tract identical by descent and (iii) assembly of polyploid genomes. We evaluate our methods on 1000 Genomes Project, Pacific Biosciences and simulated sequence data. HapCompass is available for download at http://www.brown.edu/Research/Istrail_Lab/. Supplementary data are available at Bioinformatics online.

  6. BCL11A Enhancer Haplotypes and Fetal Hemoglobin in Sickle Cell Anemia

    PubMed Central

    Sebastiani, P.; Farrell, J.J.; Alsultan, A.; Wang, S.; Edward, H. L.; Shappell, H.; Bae, H.; Milton, J. N.; Baldwin, C.T.; Al-Rubaish, A.M.; Naserullah, Z.; Al-Muhanna, F.; Alsuliman, A.; Patra, P. K.; Farrer, L.A.; Ngo, D.; Vathipadiekal, V.; Chui, D.H.K.; Al-Ali, A.K.; Steinberg, M.H.

    2015-01-01

    Background Fetal hemoglobin (HbF) levels in sickle cell anemia patients vary. We genotyped polymorphisms in the erythroid-specific enhancer of BCL11A to see if they might account for the very high HbF associated with the Arab-Indian (AI) haplotype and Benin haplotype of sickle cell anemia. Methods and Results Six BCL112A enhancer SNPs and their haplotypes were studied in Saudi Arabs from the Eastern Province and Indian patients with AI haplotype (HbF ~20%), African Americans (HbF ~7%), and Saudi Arabs from the Southwestern Province (HbF ~12%). Four SNPs (rs1427407, rs6706648, rs6738440, and rs7606173) and their haplotypes were consistently associated with HbF levels. The distributions of haplotypes differ in the 3 cohorts but not their genetic effects: the haplotype TCAG was associated with the lowest HbF level and the haplotype GTAC was associated with the highest HbF level and differences in HbF levels between carriers of these haplotypes in all cohorts was approximately 6%. Conclusions Common HbF BCL11A enhancer haplotypes in patients with African origin and AI sickle cell anemia have similar effects on HbF but they do not explain their differences in HbF. PMID:25703683

  7. Very long haplotype tracts characterized at high resolution from HLA homozygous cell lines

    PubMed Central

    Norman, Paul J.; Norberg, Steve; Nemat-Gorgani, Neda; Royce, Thomas; Hollenbach, Jill A.; Won, Melissa Shults; Guethlein, Lisbeth A.; Gunderson, Kevin L.; Ronaghi, Mostafa; Parham, Peter

    2015-01-01

    The HLA region of chromosome 6 contains the most polymorphic genes in humans. Spanning ~5Mbp the densely packed region encompasses approximately 175 expressed genes including the highly polymorphic HLA class I and II loci. Most of the other genes and functional elements are also polymorphic, and many of them are directly implicated in immune function or immune-related disease. For these reasons this complex genomic region is subject to intense scrutiny by researchers with the common goal of aiding further understanding and diagnoses of multiple immune-related diseases and syndromes. To aid assay development and characterization of the classical loci, a panel of cell lines partially or fully homozygous for HLA class I and II was assembled over time by the International Histocompatibility Working Group (IHWG). Containing a minimum of 88 unique HLA haplotypes, we show this panel represents a significant proportion of European HLA allelic and haplotype diversity (60–95%). Using a high-density whole genome array that includes 13,331 HLA region SNPs, we analyzed 99 IHWG cells to map the coordinates of the homozygous tracts at a fine scale. The mean homozygous tract length within chromosome 6 from these individuals is 21Mbp. Within HLA the mean haplotype length is 4.3Mbp, and 65% of the cell lines were shown to be homozygous throughout the entire region. In addition, four cell lines are homozygous throughout the complex KIR region of chromosome 19 (~250kbp). The data we describe will provide a valuable resource for characterizing haplotypes, designing and refining imputation algorithms and developing assay controls. PMID:26198775

  8. Modeling haplotype block variation using Markov chains.

    PubMed

    Greenspan, G; Geiger, D

    2006-04-01

    Models of background variation in genomic regions form the basis of linkage disequilibrium mapping methods. In this work we analyze a background model that groups SNPs into haplotype blocks and represents the dependencies between blocks by a Markov chain. We develop an error measure to compare the performance of this model against the common model that assumes that blocks are independent. By examining data from the International Haplotype Mapping project, we show how the Markov model over haplotype blocks is most accurate when representing blocks in strong linkage disequilibrium. This contrasts with the independent model, which is rendered less accurate by linkage disequilibrium. We provide a theoretical explanation for this surprising property of the Markov model and relate its behavior to allele diversity.

  9. Modeling Haplotype Block Variation Using Markov Chains

    PubMed Central

    Greenspan, G.; Geiger, D.

    2006-01-01

    Models of background variation in genomic regions form the basis of linkage disequilibrium mapping methods. In this work we analyze a background model that groups SNPs into haplotype blocks and represents the dependencies between blocks by a Markov chain. We develop an error measure to compare the performance of this model against the common model that assumes that blocks are independent. By examining data from the International Haplotype Mapping project, we show how the Markov model over haplotype blocks is most accurate when representing blocks in strong linkage disequilibrium. This contrasts with the independent model, which is rendered less accurate by linkage disequilibrium. We provide a theoretical explanation for this surprising property of the Markov model and relate its behavior to allele diversity. PMID:16361244

  10. Evidence of triple mutant Pfdhps ISGNGA haplotype in Plasmodium falciparum isolates from North-east India: An analysis of sulfadoxine resistant haplotype selection.

    PubMed

    Das, Manuj K; Chetry, Sumi; Kalita, Mohan C; Dutta, Prafulla

    2016-12-01

    North-east region of India has consistent role in the spread of multi drug resistant Plasmodium (P.) falciparum to other parts of Southeast Asia. After rapid clinical treatment failure of Artemisinin based combination therapy-Sulphadoxine/Pyrimethamine (ACT-SP) chemoprophylaxis, Artemether-Lumefantrine (ACT-AL) combination therapy was introduced in the year 2012 in this region for the treatment of uncomplicated P. falciparum malaria. In a DNA sequencing based polymorphism analysis, seven codons of P. falciparum dihydropteroate synthetase ( Pf dhps) gene were screened in a total of 127 P. falciparum isolates collected from Assam, Arunachal Pradesh and Tripura of North-east India during the year 2014 and 2015 to document current sulfadoxine resistant haplotypes. Sequences were analyzed to rearrange both nucleotide and protein haplotypes. Molecular diversity indices were analyzed in DNA Sequence Polymorphism software (DnaSP) on the basis of Pf dhps gene sequences. Disappearance from selective neutrality was assessed based on the ratio of non-synonomous to synonomous nucleotide substitutions [dN/dS ratio]. Moreover, two-tailed Z test was performed in search of the significance for probability of rejecting null hypothesis of strict neutrality [dN = dS]. Presence of mutant P. falciparum multidrug resistance protein1 ( Pf mdr1) was also checked in those isolates that were present with new Pf dhps haplotypes. Phylogenetic relationship based on Pf dhps gene was reconstructed in Molecular Evolutionary Genetics Analysis (MEGA). Among eight different sulfadoxine resistant haplotypes found, IS GNG A haplotype was documented in a total of five isolates from Tripura with association of a new mutant M538 R allele. Sequence analysis of Pf mdr1 gene in these five isolates came to notice that not all but only one isolate was mutant at codon 86 (N86 Y ; Y YSND) in the multidrug resistance protein. Molecular diversity based on Pf dhps haplotypes revealed that P. falciparum

  11. Theoretical underpinning of the single-molecule-dilution (SMD) method of direct haplotype resolution.

    PubMed Central

    Stephens, J C; Rogers, J; Ruano, G

    1990-01-01

    In a recent paper we have shown that DNA haplotypes of multiply heterozygous individuals can be resolved directly by polymerase-chain-reaction (PCR) amplification of a single molecule of genomic template. Our method (the single-molecule-dilution [SMD] method) relies on the stochastic separation of maternal and paternal alleles at high dilution. The stochasticity of separation and the potential for DNA shearing (which could separate the loci of interest) are two factors that can compromise the results of the experiment. This paper explores the consequences of these two factors and shows that the SMD method can be expected to work very reliably even in the presence of a moderate amount of DNA shearing. PMID:2339707

  12. Mineralocorticoid receptor haplotype, oral contraceptives and emotional information processing.

    PubMed

    Hamstra, D A; de Kloet, E R; van Hemert, A M; de Rijk, R H; Van der Does, A J W

    2015-02-12

    Oral contraceptives (OCs) affect mood in some women and may have more subtle effects on emotional information processing in many more users. Female carriers of mineralocorticoid receptor (MR) haplotype 2 have been shown to be more optimistic and less vulnerable to depression. To investigate the effects of oral contraceptives on emotional information processing and a possible moderating effect of MR haplotype. Cross-sectional study in 85 healthy premenopausal women of West-European descent. We found significant main effects of oral contraceptives on facial expression recognition, emotional memory and decision-making. Furthermore, carriers of MR haplotype 1 or 3 were sensitive to the impact of OCs on the recognition of sad and fearful faces and on emotional memory, whereas MR haplotype 2 carriers were not. Different compounds of OCs were included. No hormonal measures were taken. Most naturally cycling participants were assessed in the luteal phase of their menstrual cycle. Carriers of MR haplotype 2 may be less sensitive to depressogenic side-effects of OCs. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  13. Mineralocorticoid receptor haplotype, estradiol, progesterone and emotional information processing.

    PubMed

    Hamstra, Danielle A; de Kloet, E Ronald; Quataert, Ina; Jansen, Myrthe; Van der Does, Willem

    2017-02-01

    Carriers of MR-haplotype 1 and 3 (GA/CG; rs5522 and rs2070951) are more sensitive to the influence of oral contraceptives (OC) and menstrual cycle phase on emotional information processing than MR-haplotype 2 (CA) carriers. We investigated whether this effect is associated with estradiol (E2) and/or progesterone (P4) levels. Healthy MR-genotyped premenopausal women were tested twice in a counterbalanced design. Naturally cycling (NC) women were tested in the early-follicular and mid-luteal phase and OC-users during OC-intake and in the pill-free week. At both sessions E2 and P4 were assessed in saliva. Tests included implicit and explicit positive and negative affect, attentional blink accuracy, emotional memory, emotion recognition, and risky decision-making (gambling). MR-haplotype 2 homozygotes had higher implicit happiness scores than MR-haplotype 2 heterozygotes (p=0.031) and MR-haplotype 1/3 carriers (p<0.001). MR-haplotype 2 homozygotes also had longer reaction times to happy faces in an emotion recognition test than MR-haplotype 1/3 (p=0.001). Practice effects were observed for most measures. The pattern of correlations between information processing and P4 or E2 differed between sessions, as well as the moderating effects of the MR genotype. In the first session the MR-genotype moderated the influence of P4 on implicit anxiety (sr=-0.30; p=0.005): higher P4 was associated with reduction in implicit anxiety, but only in MR-haplotype 2 homozygotes (sr=-0.61; p=0.012). In the second session the MR-genotype moderated the influence of E2 on the recognition of facial expressions of happiness (sr=-0.21; p=0.035): only in MR-haplotype 1/3 higher E2 was correlated with happiness recognition (sr=0.29; p=0.005). In the second session higher E2 and P4 were negatively correlated with accuracy in lag2 trials of the attentional blink task (p<0.001). Thus NC women, compared to OC-users, performed worse on lag 2 trials (p=0.041). The higher implicit happiness scores of MR-haplotype

  14. Diet and Colorectal Cancer: Analysis of a Candidate Pathway Using SNPS, Haplotypes, and Multi-Gene Assessment

    PubMed Central

    Slattery, Martha L.; Lundgreen, Abbie; Herrick, Jennifer S.; Caan, Bette J.; Potter, John D.; Wolff, Roger K.

    2012-01-01

    There is considerable biologic plausibility to the hypothesis that genetic variability in pathways involved in insulin signaling and energy homeostasis may modulate dietary risk associated with colorectal cancer. We utilized data from 2 population-based case-control studies of colon (n = 1,574 cases, 1,970 controls) and rectal (n = 791 cases, 999 controls) cancer to evaluate genetic variation in candidate SNPs identified from 9 genes in a candidate pathway: PDK1, RP6KA1, RPS6KA2, RPS6KB1, RPS6KB2, PTEN, FRAP1 (mTOR), TSC1, TSC2, Akt1, PIK3CA, and PRKAG2 with dietary intake of total energy, carbohydrates, fat, and fiber. We employed SNP, haplotype, and multiple-gene analysis to evaluate associations. PDK1 interacted with dietary fat for both colon and rectal cancer and with dietary carbohydrates for colon cancer. Statistically significant interaction with dietary carbohydrates and rectal cancer was detected by haplotype analysis of PDK1. Evaluation of dietary interactions with multiple genes in this candidate pathway showed several interactions with pairs of genes: Akt1 and PDK1, PDK1 and PTEN, PDK1 and TSC1, and PRKAG2 and PTEN. Analyses show that genetic variation influences risk of colorectal cancer associated with diet and illustrate the importance of evaluating dietary interactions beyond the level of single SNPs or haplotypes when a biologically relevant candidate pathway is examined. PMID:21999454

  15. A phased SNP-based classification of sickle cell anemia HBB haplotypes.

    PubMed

    Shaikho, Elmutaz M; Farrell, John J; Alsultan, Abdulrahman; Qutub, Hatem; Al-Ali, Amein K; Figueiredo, Maria Stella; Chui, David H K; Farrer, Lindsay A; Murphy, George J; Mostoslavsky, Gustavo; Sebastiani, Paola; Steinberg, Martin H

    2017-08-11

    Sickle cell anemia causes severe complications and premature death. Five common β-globin gene cluster haplotypes are each associated with characteristic fetal hemoglobin (HbF) levels. As HbF is the major modulator of disease severity, classifying patients according to haplotype is useful. The first method of haplotype classification used restriction fragment length polymorphisms (RFLPs) to detect single nucleotide polymorphisms (SNPs) in the β-globin gene cluster. This is labor intensive, and error prone. We used genome-wide SNP data imputed to the 1000 Genomes reference panel to obtain phased data distinguishing parental alleles. We successfully haplotyped 813 sickle cell anemia patients previously classified by RFLPs with a concordance >98%. Four SNPs (rs3834466, rs28440105, rs10128556, and rs968857) marking four different restriction enzyme sites unequivocally defined most haplotypes. We were able to assign a haplotype to 86% of samples that were either partially or misclassified using RFLPs. Phased data using only four SNPs allowed unequivocal assignment of a haplotype that was not always possible using a larger number of RFLPs. Given the availability of genome-wide SNP data, our method is rapid and does not require high computational resources.

  16. Genomic evolution in domestic cattle: ancestral haplotypes and healthy beef.

    PubMed

    Williamson, Joseph F; Steele, Edward J; Lester, Susan; Kalai, Oscar; Millman, John A; Wolrige, Lindsay; Bayard, Dominic; McLure, Craig; Dawkins, Roger L

    2011-05-01

    We have identified numerous Ancestral Haplotypes encoding a 14-Mb region of Bota C19. Three are frequent in Simmental, Angus and Wagyu and have been conserved since common progenitor populations. Others are more relevant to the differences between these 3 breeds including fat content and distribution in muscle. SREBF1 and Growth Hormone, which have been implicated in the production of healthy beef, are included within these haplotypes. However, we conclude that alleles at these 2 loci are less important than other sequences within the haplotypes. Identification of breeds and hybrids is improved by using haplotypes rather than individual alleles. Copyright © 2010 Elsevier Inc. All rights reserved.

  17. TNF-alpha SNP haplotype frequencies in equidae.

    PubMed

    Brown, J J; Ollier, W E R; Thomson, W; Matthews, J B; Carter, S D; Binns, M; Pinchbeck, G; Clegg, P D

    2006-05-01

    Tumour necrosis factor alpha (TNF-alpha) is a pro-inflammatory cytokine that plays a crucial role in the regulation of inflammatory and immune responses. In all vertebrate species the genes encoding TNF-alpha are located within the major histocompatability complex. In the horse TNF-alpha has been ascribed a role in a variety of important disease processes. Previously two single nucleotide polymorphisms (SNPs) have been reported within the 5' un-translated region of the equine TNF-alpha gene. We have examined the equine TNF-alpha promoter region further for additional SNPs by analysing DNA from 131 horses (Equus caballus), 19 donkeys (E. asinus), 2 Grant's zebras (E. burchellii boehmi) and one onager (E. hemionus). Two further SNPs were identified at nucleotide positions 24 (T/G) and 452 (T/C) relative to the first nucleotide of the 522 bp polymerase chain reaction product. A sequence variant at position 51 was observed between equidae. SNaPSHOT genotyping assays for these and the two previously reported SNPs were performed on 457 horses comprising seven different breeds and 23 donkeys to determine the gene frequencies. SNP frequencies varied considerably between different horse breeds and also between the equine species. In total, nine different TNF-alpha promoter SNP haplotypes and their frequencies were established amongst the various equidae examined, with some haplotypes being found only in horses and others only in donkeys or zebras. The haplotype frequencies observed varied greatly between different horse breeds. Such haplotypes may relate to levels of TNF-alpha production and disease susceptibility and further investigation is required to identify associations between particular haplotypes and altered risk of disease.

  18. Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.

    PubMed

    Guerreiro, J F; Figueiredo, M S; Zago, M A

    1994-01-01

    We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.

  19. A spatial haplotype copying model with applications to genotype imputation.

    PubMed

    Yang, Wen-Yun; Hormozdiari, Farhad; Eskin, Eleazar; Pasaniuc, Bogdan

    2015-05-01

    Ever since its introduction, the haplotype copy model has proven to be one of the most successful approaches for modeling genetic variation in human populations, with applications ranging from ancestry inference to genotype phasing and imputation. Motivated by coalescent theory, this approach assumes that any chromosome (haplotype) can be modeled as a mosaic of segments copied from a set of chromosomes sampled from the same population. At the core of the model is the assumption that any chromosome from the sample is equally likely to contribute a priori to the copying process. Motivated by recent works that model genetic variation in a geographic continuum, we propose a new spatial-aware haplotype copy model that jointly models geography and the haplotype copying process. We extend hidden Markov models of haplotype diversity such that at any given location, haplotypes that are closest in the genetic-geographic continuum map are a priori more likely to contribute to the copying process than distant ones. Through simulations starting from the 1000 Genomes data, we show that our model achieves superior accuracy in genotype imputation over the standard spatial-unaware haplotype copy model. In addition, we show the utility of our model in selecting a small personalized reference panel for imputation that leads to both improved accuracy as well as to a lower computational runtime than the standard approach. Finally, we show our proposed model can be used to localize individuals on the genetic-geographical map on the basis of their genotype data.

  20. APC Yin-Yang haplotype associated with colorectal cancer risk

    PubMed Central

    GARRE, P.; DE LA HOYA, M.; INIESTA, P.; ROMERA, A.; LLOVET, P.; GONZALEZ, S.; PEREZ-SEGURA, P.; CAPELLA, G.; DIAZ-RUBIO, E.; CALDES, T.

    2010-01-01

    The Yin-Yang haplotype is defined as two mismatched haplotypes (Yin and Yang) representing the majority of the existing haplotypes in a particular genomic region. The human adenomatous polyposis coli (APC) gene shows a Yin-Yang haplotype pattern accounting for 84% of all of the haplotypes existing in the Spanish population. Several association studies have been published regarding APC gene variants (SNPs and haplotypes) and colorectal cancer (CRC) risk. However, no studies concerning diplotype structure and CRC risk have been conducted. The aim of the present study was to investigate whether the APC Yin-Yang homozygote diplotype is over-represented in patients with sporadic CRC when compared to its distribution in controls, and its association with CRC risk. TaqMan® assays were used to genotype three tagSNPs selected across the APC Yin-Yang region. Frequencies of the APC Yin-Yang tagSNP alleles, haplotype and diplotype of 378 CRC cases and 642 controls were compared. Two Spanish CRC group samples were included [Hospital Clínico San Carlos in Madrid (HCSC) and Instituto Catalán de Oncología in Barcelona (ICO)]. Analysis of 157 consecutive CRC patients and 405 control subjects from HCSC showed a significative effect for the risk of CRC (OR=1.93; 95% CI 1.32–2.81; P=0.001). However, this effect was not confirmed in 221 CRC patients and 237 control subjects from ICO (OR=0.89; 95% CI 0.61–1.28; P=0.521). We found a significant association between the APC homozygote Yin-Yang diplotype and the risk of colorectal cancer in the HCSC samples. However, we did not observe this association in the ICO samples. These observations suggest that a study with a larger Spanish cohort is necessary to confirm the effects of the APC Yin-Yang diplotype on the risk of CRC. PMID:22993613

  1. APC Yin-Yang haplotype associated with colorectal cancer risk.

    PubMed

    Garre, P; DE LA Hoya, M; Iniesta, P; Romera, A; Llovet, P; Gonzalez, S; Perez-Segura, P; Capella, G; Diaz-Rubio, E; Caldes, T

    2010-09-01

    The Yin-Yang haplotype is defined as two mismatched haplotypes (Yin and Yang) representing the majority of the existing haplotypes in a particular genomic region. The human adenomatous polyposis coli (APC) gene shows a Yin-Yang haplotype pattern accounting for 84% of all of the haplotypes existing in the Spanish population. Several association studies have been published regarding APC gene variants (SNPs and haplotypes) and colorectal cancer (CRC) risk. However, no studies concerning diplotype structure and CRC risk have been conducted. The aim of the present study was to investigate whether the APC Yin-Yang homozygote diplotype is over-represented in patients with sporadic CRC when compared to its distribution in controls, and its association with CRC risk. TaqMan(®) assays were used to genotype three tagSNPs selected across the APC Yin-Yang region. Frequencies of the APC Yin-Yang tagSNP alleles, haplotype and diplotype of 378 CRC cases and 642 controls were compared. Two Spanish CRC group samples were included [Hospital Clínico San Carlos in Madrid (HCSC) and Instituto Catalán de Oncología in Barcelona (ICO)]. Analysis of 157 consecutive CRC patients and 405 control subjects from HCSC showed a significative effect for the risk of CRC (OR=1.93; 95% CI 1.32-2.81; P=0.001). However, this effect was not confirmed in 221 CRC patients and 237 control subjects from ICO (OR=0.89; 95% CI 0.61-1.28; P=0.521). We found a significant association between the APC homozygote Yin-Yang diplotype and the risk of colorectal cancer in the HCSC samples. However, we did not observe this association in the ICO samples. These observations suggest that a study with a larger Spanish cohort is necessary to confirm the effects of the APC Yin-Yang diplotype on the risk of CRC.

  2. Mathematical properties and bounds on haplotyping populations by pure parsimony.

    PubMed

    Wang, I-Lin; Chang, Chia-Yuan

    2011-06-01

    Although the haplotype data can be used to analyze the function of DNA, due to the significant efforts required in collecting the haplotype data, usually the genotype data is collected and then the population haplotype inference (PHI) problem is solved to infer haplotype data from genotype data for a population. This paper investigates the PHI problem based on the pure parsimony criterion (HIPP), which seeks the minimum number of distinct haplotypes to infer a given genotype data. We analyze the mathematical structure and properties for the HIPP problem, propose techniques to reduce the given genotype data into an equivalent one of much smaller size, and analyze the relations of genotype data using a compatible graph. Based on the mathematical properties in the compatible graph, we propose a maximal clique heuristic to obtain an upper bound, and a new polynomial-sized integer linear programming formulation to obtain a lower bound for the HIPP problem. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Origin and Diversification Dynamics of Self-Incompatibility Haplotypes

    PubMed Central

    Gervais, Camille E.; Castric, Vincent; Ressayre, Adrienne; Billiard, Sylvain

    2011-01-01

    Self-incompatibility (SI) is a genetic system found in some hermaphrodite plants. Recognition of pollen by pistils expressing cognate specificities at two linked genes leads to rejection of self pollen and pollen from close relatives, i.e., to avoidance of self-fertilization and inbred matings, and thus increased outcrossing. These genes generally have many alleles, yet the conditions allowing the evolution of new alleles remain mysterious. Evolutionary changes are clearly necessary in both genes, since any mutation affecting only one of them would result in a nonfunctional self-compatible haplotype. Here, we study diversification at the S-locus (i.e., a stable increase in the total number of SI haplotypes in the population, through the incorporation of new SI haplotypes), both deterministically (by investigating analytically the fate of mutations in an infinite population) and by simulations of finite populations. We show that the conditions allowing diversification are far less stringent in finite populations with recurrent mutations of the pollen and pistil genes, suggesting that diversification is possible in a panmictic population. We find that new SI haplotypes emerge fastest in populations with few SI haplotypes, and we discuss some implications for empirical data on S-alleles. However, allele numbers in our simulations never reach values as high as observed in plants whose SI systems have been studied, and we suggest extensions of our models that may reconcile the theory and data. PMID:21515570

  4. Ancestral inference from haplotypes and mutations.

    PubMed

    Griffiths, Robert C; Tavaré, Simon

    2018-04-25

    We consider inference about the history of a sample of DNA sequences, conditional upon the haplotype counts and the number of segregating sites observed at the present time. After deriving some theoretical results in the coalescent setting, we implement rejection sampling and importance sampling schemes to perform the inference. The importance sampling scheme addresses an extension of the Ewens Sampling Formula for a configuration of haplotypes and the number of segregating sites in the sample. The implementations include both constant and variable population size models. The methods are illustrated by two human Y chromosome datasets. Copyright © 2018. Published by Elsevier Inc.

  5. PWHATSHAP: efficient haplotyping for future generation sequencing.

    PubMed

    Bracciali, Andrea; Aldinucci, Marco; Patterson, Murray; Marschall, Tobias; Pisanti, Nadia; Merelli, Ivan; Torquati, Massimo

    2016-09-22

    Haplotype phasing is an important problem in the analysis of genomics information. Given a set of DNA fragments of an individual, it consists of determining which one of the possible alleles (alternative forms of a gene) each fragment comes from. Haplotype information is relevant to gene regulation, epigenetics, genome-wide association studies, evolutionary and population studies, and the study of mutations. Haplotyping is currently addressed as an optimisation problem aiming at solutions that minimise, for instance, error correction costs, where costs are a measure of the confidence in the accuracy of the information acquired from DNA sequencing. Solutions have typically an exponential computational complexity. WHATSHAP is a recent optimal approach which moves computational complexity from DNA fragment length to fragment overlap, i.e., coverage, and is hence of particular interest when considering sequencing technology's current trends that are producing longer fragments. Given the potential relevance of efficient haplotyping in several analysis pipelines, we have designed and engineered PWHATSHAP, a parallel, high-performance version of WHATSHAP. PWHATSHAP is embedded in a toolkit developed in Python and supports genomics datasets in standard file formats. Building on WHATSHAP, PWHATSHAP exhibits the same complexity exploring a number of possible solutions which is exponential in the coverage of the dataset. The parallel implementation on multi-core architectures allows for a relevant reduction of the execution time for haplotyping, while the provided results enjoy the same high accuracy as that provided by WHATSHAP, which increases with coverage. Due to its structure and management of the large datasets, the parallelisation of WHATSHAP posed demanding technical challenges, which have been addressed exploiting a high-level parallel programming framework. The result, PWHATSHAP, is a freely available toolkit that improves the efficiency of the analysis of genomics

  6. Frequency distribution of interleukin-10 haplotypes (-1082 A>G, -819 C>T, and -592 C>A) in a Mexican population.

    PubMed

    Vázquez-Villamar, M; Palafox-Sánchez, C A; Hernández-Bello, J; Muñoz-Valle, J F; Valle, Y; Cruz, A; Alatorre-Meza, A I; Oregon-Romero, E

    2016-11-03

    Interleukin 10 (IL-10) is an immunoregulatory cytokine with multiple roles in the immune system. Three single nucleotide polymorphisms at positions -1082 (A>G), -819 (C>T), and -592 (C>A) in the promoter region of the IL10 gene are believed to be associated with different inflammatory, infectious, and autoimmune diseases. These polymorphisms exhibit a strong linkage disequilibrium (LD) and form three principal haplotypes (GCC, ACC, and ATA). The GCC and ATA haplotypes have been associated with high and low levels of IL-10 production, respectively. The aim of this study was to establish the allele and haplotype frequencies of the IL10 polymorphisms in Mestizos from western Mexico. SNPs were analyzed in 340 healthy unrelated Mestizos from western Mexico by polymerase chain reaction-restriction fragment length polymorphism. The studied population presented significant differences, in the distribution of IL10 polymorphisms, from the Asian, African, and European populations. We also observed a strong LD within -1082 A>G, -819 C>T, and -592 C>A (100% pc = 7.735 x 10 -18 ). The haplotypes ACC (45.4%), ATA (22.0%), GTA (14.9%), and GCC (13.9%) were most frequently observed in this population. The haplotype frequencies, however, differed from those reported previously in Mestizos from central Mexico, Asians, Africans, and European Caucasians, suggesting a differential gene flow in the Mexican Mestizo population. This could account for the genetic variability between Mexicans and populations of other ethnicities. The study of these polymorphisms and their haplotypes could help in expanding our knowledge to design future disease-risk studies on the western Mexican population.

  7. Honey bee-inspired algorithms for SNP haplotype reconstruction problem

    NASA Astrophysics Data System (ADS)

    PourkamaliAnaraki, Maryam; Sadeghi, Mehdi

    2016-03-01

    Reconstructing haplotypes from SNP fragments is an important problem in computational biology. There have been a lot of interests in this field because haplotypes have been shown to contain promising data for disease association research. It is proved that haplotype reconstruction in Minimum Error Correction model is an NP-hard problem. Therefore, several methods such as clustering techniques, evolutionary algorithms, neural networks and swarm intelligence approaches have been proposed in order to solve this problem in appropriate time. In this paper, we have focused on various evolutionary clustering techniques and try to find an efficient technique for solving haplotype reconstruction problem. It can be referred from our experiments that the clustering methods relying on the behaviour of honey bee colony in nature, specifically bees algorithm and artificial bee colony methods, are expected to result in more efficient solutions. An application program of the methods is available at the following link. http://www.bioinf.cs.ipm.ir/software/haprs/

  8. HERC1 polymorphisms: population-specific variations in haplotype composition.

    PubMed

    Yuasa, Isao; Umetsu, Kazuo; Nishimukai, Hiroaki; Fukumori, Yasuo; Harihara, Shinji; Saitou, Naruya; Jin, Feng; Chattopadhyay, Prasanta K; Henke, Lotte; Henke, Jürgen

    2009-08-01

    Human HERC1 is one of six HERC proteins and may play an important role in intracellular membrane trafficking. The human HERC1 gene is suggested to have been affected by local positive selection. To assess the global frequency distributions of coding and non-coding single nucleotide polymorphisms (SNPs) in the HERC1 gene, we developed a new simultaneous genotyping method for four SNPs, and applied this method to investigate 1213 individuals from 12 global populations. The results confirmed remarked differences in the allele and haplotype frequencies between East Asian and non-East Asian populations. One of the three common haplotypes observed was found to be characteristic of East Asians, who showed a relatively uniform distribution of haplotypes. Information on haplotypes would be useful for testing the function of polymorphisms in the HERC1 gene. This is the first study to investigate the distribution of HERC1 polymorphisms in various populations. (c) 2009 John Wiley & Sons, Ltd.

  9. Short communication: casein haplotype variability in sicilian dairy goat breeds.

    PubMed

    Gigli, I; Maizon, D O; Riggio, V; Sardina, M T; Portolano, B

    2008-09-01

    In the Mediterranean region, goat milk production is an important economic activity. In the present study, 4 casein genes were genotyped in 5 Sicilian goat breeds to 1) identify casein haplotypes present in the Argentata dell'Etna, Girgentana, Messinese, Derivata di Siria, and Maltese goat breeds; and 2) describe the structure of the Sicilian goat breeds based on casein haplotypes and allele frequencies. In a sample of 540 dairy goats, 67 different haplotypes with frequency >or=0.01 and 27 with frequency >or=0.03 were observed. The most common CSN1S1-CSN2-CSN1S2-CSN3 haplotype for Derivata di Siria and Maltese was FCFB (0.17 and 0.22, respectively), whereas for Argentata dell'Etna, Girgentana and Messinese was ACAB (0.06, 0.23, and 0.10, respectively). According to the haplotype reconstruction, Argentata dell'Etna, Girgentana, and Messinese breeds presented the most favorable haplotype for cheese production, because the casein concentration in milk of these breeds might be greater than that in Derivata di Siria and Maltese breeds. Based on a cluster analysis, the breeds formed 2 main groups: Derivata di Siria, and Maltese in one group, and Argentata dell'Etna and Messinese in the other; the Girgentana breed was between these groups but closer to the latter.

  10. Sublocalization of an Ataxia-Telangiectasia Gene Distal to D11S384 by Ancestral Haplotyping In Costa Rican Families

    PubMed Central

    Uhrhammer, Nancy; Lange, Ethan; Porras, Oscar; Naeim, Arash; Chen, Xiaoguang; Sheikhavandi, Sepideh; Chiplunkar, Sujata; Yang, Lan; Dandekar, Sugandha; Liang, Teresa; Patel, Nima; Teraoka, Sharon; Udar, Nitin; Calvo, Nidia; Concannon, Patrick; Lange, Kenneth; Gatti, Richard A.

    1995-01-01

    In an effort to localize a gene for ataxia-telangiectasia (A-T), we have genotyped 27 affected Costa Rican families, with 13 markers, in the chromosome 11q22-23 region. Significant linkage disequilibrium was detected for 9/13 markers between D11S1816 and D11S1391. Recombination events observed in these pedigrees places A-T between D11S1819 and D11S1960. One ancestral haplotype is common to 24/54 affected chromosomes and roughly two-thirds of the families. Inferred (ancestral) recombination events involving this common haplotype in earlier generations suggest that A-T is distal to D11S384 and proximal to D11S1960. Several other common haplotypes were identified, consistent with multiple mutations in a single gene. When considered together with all other evidence, this study further sublocalizes the major A-T locus to ≈200 kb, between markers S384 and S535. ImagesFigure 5 PMID:7611278

  11. Mineralocorticoid receptor haplotypes sex-dependently moderate depression susceptibility following childhood maltreatment.

    PubMed

    Vinkers, Christiaan H; Joëls, Marian; Milaneschi, Yuri; Gerritsen, Lotte; Kahn, René S; Penninx, Brenda W J H; Boks, Marco P M

    2015-04-01

    The MR is an important regulator of the hypothalamic-pituitary-adrenal (HPA) axis and a prime target for corticosteroids. There is increasing evidence from both clinical and preclinical studies that the MR has different effects on behavior and mood in males and females. To investigate the hypothesis that the MR sex-dependently influences the relation between childhood maltreatment and depression, we investigated three common and functional MR haplotypes (GA, CA, and CG haplotype, based on rs5522 and rs2070951) in a population-based cohort (N = 665) and an independent clinical cohort from the Netherlands Study of Depression and Anxiety (NESDA) (N = 1639). The CA haplotype sex-dependently moderated the relation between childhood maltreatment and depressive symptoms both in the population-based sample (sex × maltreatment × haplotype: β = -4.07, P = 0.029) and in the clinical sample (sex × maltreatment × haplotype, β = -2.40, P = 0.011). Specifically, female individuals in the population-based sample were protected (β = -4.58, P = 2.0 e(-5)), whereas males in the clinical sample were at increased risk (β = 2.54, P = 0.0022). In line with these results, female GA haplotype carriers displayed increased vulnerability in the population-based sample (β = 4.58, P = 7.5 e(-5)) whereas male CG-carriers showed increased resilience in the clinical sample (β = -2.71, P = 0.016). Consistently, we found a decreased lifetime MDD risk for male GA haplotype carriers following childhood maltreatment but an increased risk for male CA haplotype carriers in the clinical sample. In both samples, sex-dependent effects were observed for GA-GA diplotype carriers. In summary, sex plays an important role in determining whether functional genetic variation in MR is beneficial or detrimental, with an apparent female advantage for the CA haplotype but male advantage for the GA and CG haplotype. These sex-dependent effects of MR on depression susceptibility following childhood

  12. A risk PRODH haplotype affects sensorimotor gating, memory, schizotypy, and anxiety in healthy male subjects.

    PubMed

    Roussos, Panos; Giakoumaki, Stella G; Bitsios, Panos

    2009-06-15

    Significant associations have been shown for haplotypes comprising three PRODH single nucleotide polymorphisms (SNPs; 1945T/C, 1766A/G, 1852G/A) located in the 3' region of the gene, suggesting a role of these variants in the etiopathogenesis of schizophrenia. We assessed the relationship between these high-risk PRODH polymorphisms and schizophrenia-related endophenotypes in a large and highly homogeneous cohort of healthy males. Participants (n = 217) were tested in prepulse inhibition (PPI), verbal and working memory, trait anxiety and schizotypy. The QTPHASE from the UNPHASED package was used for the association analysis of each SNP or haplotype data. This procedure revealed significant phenotypic impact of the risk CGA haplotype. Subjects were then divided in two groups; levels of PPI, anxiety, and schizotypy, verbal and working memory were compared with analysis of variance. CGA carriers (n = 32) exhibited attenuated PPI (p < .001) and verbal memory (p < .001) and higher anxiety (p < .004) and schizotypy (p < .008) compared with the noncarriers (n = 185). There were no differences in baseline startle, demographics, and working memory. The main significant correlations were schizotypy x PPI [85-dB, 120-msec trials] in the carriers and schizotypy x anxiety in the entire group and the noncarriers but not the carriers group. Our results strongly support PPI as a valid schizophrenia endophenotype and highlight the importance of examining the role of risk haplotypes on multiple endophenotypes and have implications for understanding the continuum from normality to psychosis, transitional states, and the genetics of schizophrenia-related traits.

  13. Fitchi: haplotype genealogy graphs based on the Fitch algorithm.

    PubMed

    Matschiner, Michael

    2016-04-15

    : In population genetics and phylogeography, haplotype genealogy graphs are important tools for the visualization of population structure based on sequence data. In this type of graph, node sizes are often drawn in proportion to haplotype frequencies and edge lengths represent the minimum number of mutations separating adjacent nodes. I here present Fitchi, a new program that produces publication-ready haplotype genealogy graphs based on the Fitch algorithm. http://www.evoinformatics.eu/fitchi.htm : michaelmatschiner@mac.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. H-PoP and H-PoPG: heuristic partitioning algorithms for single individual haplotyping of polyploids.

    PubMed

    Xie, Minzhu; Wu, Qiong; Wang, Jianxin; Jiang, Tao

    2016-12-15

    Some economically important plants including wheat and cotton have more than two copies of each chromosome. With the decreasing cost and increasing read length of next-generation sequencing technologies, reconstructing the multiple haplotypes of a polyploid genome from its sequence reads becomes practical. However, the computational challenge in polyploid haplotyping is much greater than that in diploid haplotyping, and there are few related methods. This article models the polyploid haplotyping problem as an optimal poly-partition problem of the reads, called the Polyploid Balanced Optimal Partition model. For the reads sequenced from a k-ploid genome, the model tries to divide the reads into k groups such that the difference between the reads of the same group is minimized while the difference between the reads of different groups is maximized. When the genotype information is available, the model is extended to the Polyploid Balanced Optimal Partition with Genotype constraint problem. These models are all NP-hard. We propose two heuristic algorithms, H-PoP and H-PoPG, based on dynamic programming and a strategy of limiting the number of intermediate solutions at each iteration, to solve the two models, respectively. Extensive experimental results on simulated and real data show that our algorithms can solve the models effectively, and are much faster and more accurate than the recent state-of-the-art polyploid haplotyping algorithms. The experiments also show that our algorithms can deal with long reads and deep read coverage effectively and accurately. Furthermore, H-PoP might be applied to help determine the ploidy of an organism. https://github.com/MinzhuXie/H-PoPG CONTACT: xieminzhu@hotmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. Polymorphism at Expressed DQ and DR Loci in Five Common Equine MHC Haplotypes

    PubMed Central

    Miller, Donald; Tallmadge, Rebecca L.; Binns, Matthew; Zhu, Baoli; Mohamoud, Yasmin Ali; Ahmed, Ayeda; Brooks, Samantha A.; Antczak, Douglas F.

    2016-01-01

    The polymorphism of Major Histocompatibility Complex (MHC) class II DQ and DR genes in five common Equine Leukocyte Antigen (ELA) haplotypes was determined through sequencing of mRNA transcripts isolated from lymphocytes of eight ELA homozygous horses. Ten expressed MHC class II genes were detected in horses of the ELA-A3 haplotype carried by the donor horses of the equine Bacterial Artificial Chromosome (BAC) library and the reference genome sequence: four DR genes and six DQ genes. The other four ELA haplotypes contained at least eight expressed polymorphic MHC class II loci. Next Generation Sequencing (NGS) of genomic DNA of these four MHC haplotypes revealed stop codons in the DQA3 gene in the ELA-A2, ELA-A5, and ELA-A9 haplotypes. Few NGS reads were obtained for the other MHC class II genes that were not amplified in these horses. The amino acid sequences across haplotypes contained locus-specific residues, and the locus clusters produced by phylogenetic analysis were well supported. The MHC class II alleles within the five tested haplotypes were largely non-overlapping between haplotypes. The complement of equine MHC class II DQ and DR genes appears to be well conserved between haplotypes, in contrast to the recently described variation in class I gene loci between equine MHC haplotypes. The identification of allelic series of equine MHC class II loci will aid comparative studies of mammalian MHC conservation and evolution and may also help to interpret associations between the equine MHC class II region and diseases of the horse. PMID:27889800

  16. The analysis of APOL1 genetic variation and haplotype diversity provided by 1000 Genomes project.

    PubMed

    Peng, Ting; Wang, Li; Li, Guisen

    2017-08-11

    The APOL1 gene variants has been shown to be associated with an increased risk of multiple kinds of diseases, particularly in African Americans, but not in Caucasians and Asians. In this study, we explored the single nucleotide polymorphism (SNP) and haplotype diversity of APOL1 gene in different races provided by 1000 Genomes project. Variants of APOL1 gene in 1000 Genome Project were obtained and SNPs located in the regulatory region or coding region were selected for genetic variation analysis. Total 2504 individuals from 26 populations were classified as four groups that included Africa, Europe, Asia and Admixed populations. Tag SNPs were selected to evaluate the haplotype diversities in the four populations by HaploStats software. APOL1 gene was surrounded by some of the most polymorphic genes in the human genome, variation of APOL1 gene was common, with up to 613 SNP (1000 Genome Project reported) and 99 of them (16.2%) with MAF ≥ 1%. There were 79 SNPs in the URR and 92 SNPs in 3'UTR. Total 12 SNPs in URR and 24 SNPs in 3'UTR were considered as common variants with MAF ≥ 1%. It is worth noting that URR-1 was presents lower frequencies in European populations, while other three haplotypes taken an opposite pattern; 3'UTR presents several high-frequency variation sites in a short segment, and the differences of its haplotypes among different population were significant (P < 0.01), UTR-1 and UTR-5 presented much higher frequency in African population, while UTR-2, UTR-3 and UTR-4 were much lower. APOL1 coding region showed that two SNP of G1 with higher frequency are actually pull down the haplotype H-1 frequency when considering all populations pooled together, and the diversity among the four populations be widen by the G1 two mutation (P 1  = 3.33E-4 vs P 2  = 3.61E-30). The distributions of APOL1 gene variants and haplotypes were significantly different among the different populations, in either regulatory or coding regions. It could provide

  17. Identification of a functional enhancer variant within the chronic pancreatitis-associated SPINK1 c.101A>G (p.Asn34Ser)-containing haplotype.

    PubMed

    Boulling, Arnaud; Masson, Emmanuelle; Zou, Wen-Bin; Paliwal, Sumit; Wu, Hao; Issarapu, Prachand; Bhaskar, Seema; Génin, Emmanuelle; Cooper, David N; Li, Zhao-Shen; Chandak, Giriraj R; Liao, Zhuan; Chen, Jian-Min; Férec, Claude

    2017-08-01

    The haplotype harboring the SPINK1 c.101A>G (p.Asn34Ser) variant (also known as rs17107315:T>C) represents the most important heritable risk factor for idiopathic chronic pancreatitis identified to date. The causal variant contained within this risk haplotype has however remained stubbornly elusive. Herein, we set out to resolve this enigma by employing a hypothesis-driven approach. First, we searched for variants in strong linkage disequilibrium (LD) with rs17107315:T>C using HaploReg v4.1. Second, we identified two candidate SNPs by visual inspection of sequences spanning all 25 SNPs found to be in LD with rs17107315:T>C, guided by prior knowledge of pancreas-specific transcription factors and their cognate binding sites. Third, employing a novel cis-regulatory module (CRM)-guided approach to further filter the two candidate SNPs yielded a solitary candidate causal variant. Finally, combining data from phylogenetic conservation and chromatin accessibility, cotransfection transactivation experiments, and population genetic studies, we suggest that rs142703147:C>A, which disrupts a PTF1L-binding site within an evolutionarily conserved HNF1A-PTF1L CRM located ∼4 kb upstream of the SPINK1 promoter, contributes to the aforementioned chronic pancreatitis risk haplotype. Further studies are required not only to improve the characterization of this functional SNP but also to identify other functional components that might contribute to this high-risk haplotype. © 2017 Wiley Periodicals, Inc.

  18. Association of HLA haplotype with alopecia areata in Chinese Hans.

    PubMed

    Xiao, F-L; Ye, D-Q; Yang, S; Zhou, F-S; Zhou, S-M; Zhu, Y-G; Liang, Y-H; Ren, Y-Q; Zhang, X-J

    2006-11-01

    Some studies have shown discrepancies in human leucocyte antigen (HLA) associated with alopecia areata (AA) between different ethnic populations. To investigate whether HLA-I, -DQA1 and -DQB1 alleles and the HLA haplotype are associated with AA, and the correlation between the HLA haplotype profile, age of onset and severity of AA in Chinese Hans. The polymerase chain reaction-sequence specific primer (PCR-SSP) method was used to analyse the frequencies of HLA class I, -DQA1 and -DQB1 alleles in 192 patients with AA and 252 controls in Chinese Hans. The linkage disequilibrium was calculated using the 2 x 2 table. The 24 two-locus haplotypes [including A*02-B*18, A*02-B*27, A*02-B*52, A*02-Cw*0704, A*02-DQA1*0104, A*02-DQB1*0604, A*02-DQB1*0606, B*18-Cw*0704, B*18-DQA1*0104, B*18-DQA1*0302, B*18-DQB1*0606, B*27-Cw*0704, B*27-DQA1*0104, B*27-DQA1*0302, B*52-Cw*0704, B*52-DQA1*0104, B*52-DQA1*0302, B52-DQB1*0606, Cw*0704-DQA1*0104, Cw*0704-DQA1*0302, Cw*0704-DQB1*0606, DQA1*0104-DQB1*0604, DQA1*0104-DQB1*0606, DQA1*0302-DQB1*0606 (P<0.05)] were associated with AA, while eight extended haplotypes (A*02-B*18-DQA1*0104, A*02-B*27-DQA1*0104, A*02-B*52-DQA1*0104, A*02-B*52-DQA1*0302, A*02-B*52-DQB1*0606, B*52-Cw*0704-DQA1*0104, B*52-Cw*0704-DQA1*0302, A*02-B*52-DQA1*0302-DQB1*0606) were found to be related to AA in Chinese Hans. Through stratified analysis, we found that the extended haplotype B*52-Cw*0704-DQA1*0302 was related to early onset of AA, and no haplotype was only associated with severe AA. This is the first detailed report to elucidate HLA haplotypes associated with AA and that demonstrates the significant HLA haplotypes in Chinese Hans AA. The haplotype B*52-Cw*0704-DQA1*0302 was identified to be related to early onset of AA. Our results provide some information for future research on predisposing genes in HLA regions in Chinese Hans.

  19. Dimensional Anxiety Mediates Linkage of GABRA2 Haplotypes With Alcoholism

    PubMed Central

    Enoch, Mary-Anne; Schwartz, Lori; Albaugh, Bernard; Virkkunen, Matti; Goldman, David

    2015-01-01

    The GABAAα2 receptor gene (GABRA2) modulates anxiety and stress response. Three recent association studies implicate GABRA2 in alcoholism, however in these papers both common, opposite-configuration haplotypes in the region distal to intron3 predict risk. We have now replicated the GABRA2 association with alcoholism in 331 Plains Indian men and women and 461 Finnish Caucasian men. Using a dimensional measure of anxiety, harm avoidance (HA), we also found that the association with alcoholism is mediated, or moderated, by anxiety. Nine SNPs were genotyped revealing two haplotype blocks. Within the previously implicated block 2 region, we identified the two common, opposite-configuration risk haplotypes, A and B. Their frequencies differed markedly in Finns and Plains Indians. In both populations, most block 2 SNPs were significantly associated with alcoholism. The associations were due to increased frequencies of both homozygotes in alcoholics, indicating the possibility of alcoholic subtypes with opposite genotypes. Congruently, there was no significant haplotype association. Using HA as an indicator variable for anxiety, we found haplotype linkage to alcoholism with high and low dimensional anxiety, and to HA itself, in both populations. High HA alcoholics had the highest frequency of the more abundant haplotype (A in Finns, B in Plains Indians); low HA alcoholics had the highest frequency of the less abundant haplotype (B in Finns, A in Plains Indians) (Finns: P α0.007, OR α2.1, Plains Indians: P α0.040, OR α1.9). Non-alcoholics had intermediate frequencies. Our results suggest that within the distal GABRA2 region is a functional locus or loci that may differ between populations but that alters risk for alcoholism via the mediating action of anxiety. PMID:16874763

  20. Haplotypes and gene expression implicate the MAPT region for Parkinson disease

    PubMed Central

    Tobin, J.E.; Latourelle, J.C.; Lew, M.F.; Klein, C.; Suchowersky, O.; Shill, H.A.; Golbe, L.I.; Mark, M.H.; Growdon, J.H.; Wooten, G.F.; Racette, B.A.; Perlmutter, J.S.; Watts, R.; Guttman, M.; Baker, K.B.; Goldwurm, S.; Pezzoli, G.; Singer, C.; Saint-Hilaire, M.H.; Hendricks, A.E.; Williamson, S.; Nagle, M.W.; Wilk, J.B.; Massood, T.; Laramie, J.M.; DeStefano, A.L.; Litvan, I.; Nicholson, G.; Corbett, A.; Isaacson, S.; Burn, D.J.; Chinnery, P.F.; Pramstaller, P.P.; Sherman, S.; Al-hinti, J.; Drasby, E.; Nance, M.; Moller, A.T.; Ostergaard, K.; Roxburgh, R.; Snow, B.; Slevin, J.T.; Cambi, F.; Gusella, J.F.; Myers, R.H.

    2009-01-01

    Background Microtubule-associated protein tau (MAPT) has been associated with several neurodegenerative disorders including forms of parkinsonism and Parkinson disease (PD). We evaluated the association of the MAPT region with PD in a large cohort of familial PD cases recruited by the GenePD Study. In addition, postmortem brain samples from patients with PD and neurologically normal controls were used to evaluate whether the expression of the 3-repeat and 4-repeat isoforms of MAPT, and neighboring genes Saitohin (STH) and KIAA1267, are altered in PD cerebellum. Methods Twenty-one single-nucleotide polymorphisms (SNPs) in the region of MAPT on chromosome 17q21 were genotyped in the GenePD Study. Single SNPs and haplotypes, including the H1 haplotype, were evaluated for association to PD. Relative quantification of gene expression was performed using real-time RT-PCR. Results After adjusting for multiple comparisons, SNP rs1800547 was significantly associated with PD affection. While the H1 haplotype was associated with a significantly increased risk for PD, a novel H1 subhaplotype was identified that predicted a greater increased risk for PD. The expression of 4-repeat MAPT, STH, and KIAA1267 was significantly increased in PD brains relative to controls. No difference in expression was observed for 3-repeat MAPT. Conclusions This study supports a role for MAPT in the pathogenesis of familial and idiopathic Parkinson disease (PD). Interestingly, the results of the gene expression studies suggest that other genes in the vicinity of MAPT, specifically STH and KIAA1267, may also have a role in PD and suggest complex effects for the genes in this region on PD risk. PMID:18509094

  1. African-American mitochondrial DNAs often match mtDNAs found in multiple African ethnic groups

    PubMed Central

    Ely, Bert; Wilson, Jamie Lee; Jackson, Fatimah; Jackson, Bruce A

    2006-01-01

    Background Mitochondrial DNA (mtDNA) haplotypes have become popular tools for tracing maternal ancestry, and several companies offer this service to the general public. Numerous studies have demonstrated that human mtDNA haplotypes can be used with confidence to identify the continent where the haplotype originated. Ideally, mtDNA haplotypes could also be used to identify a particular country or ethnic group from which the maternal ancestor emanated. However, the geographic distribution of mtDNA haplotypes is greatly influenced by the movement of both individuals and population groups. Consequently, common mtDNA haplotypes are shared among multiple ethnic groups. We have studied the distribution of mtDNA haplotypes among West African ethnic groups to determine how often mtDNA haplotypes can be used to reconnect Americans of African descent to a country or ethnic group of a maternal African ancestor. The nucleotide sequence of the mtDNA hypervariable segment I (HVS-I) usually provides sufficient information to assign a particular mtDNA to the proper haplogroup, and it contains most of the variation that is available to distinguish a particular mtDNA haplotype from closely related haplotypes. In this study, samples of general African-American and specific Gullah/Geechee HVS-I haplotypes were compared with two databases of HVS-I haplotypes from sub-Saharan Africa, and the incidence of perfect matches recorded for each sample. Results When two independent African-American samples were analyzed, more than half of the sampled HVS-I mtDNA haplotypes exactly matched common haplotypes that were shared among multiple African ethnic groups. Another 40% did not match any sequence in the database, and fewer than 10% were an exact match to a sequence from a single African ethnic group. Differences in the regional distribution of haplotypes were observed in the African database, and the African-American haplotypes were more likely to match haplotypes found in ethnic groups from

  2. HLA-G Haplotypes Are Differentially Associated with Asthmatic Features.

    PubMed

    Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie

    2018-01-01

    Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA - G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter

  3. HLA-G Haplotypes Are Differentially Associated with Asthmatic Features

    PubMed Central

    Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie

    2018-01-01

    Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA-G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter

  4. β3 Integrin Haplotype Influences Gene Regulation and Plasma von Willebrand Factor Activity

    PubMed Central

    Payne, Katie E; Bray, Paul F; Grant, Peter J; Carter, Angela M

    2008-01-01

    The Leu33Pro polymorphism of the gene encoding β3 integrin (ITGB3) is associated with acute coronary syndromes and influences platelet aggregation. Three common promoter polymorphisms have also been identified. The aims of this study were to (1) investigate the influence of the ITGB3 −400C/A, −425A/C and −468G/A promoter polymorphisms on reporter gene expression and nuclear protein binding and (2) determine genotype and haplotype associations with platelet αIIbβ3 receptor density. Promoter haplotypes were introduced into an ITGB3 promoter-pGL3 construct by site directed mutagenesis and luciferase reporter gene expression analysed in HEL and HMEC-1 cells. Binding of nuclear proteins was assessed by electrophoretic mobility shift assay. The association of ITGB3 haplotype with platelet αIIbβ3 receptor density was determined in 223 subjects. Species conserved motifs were identified in the ITGB3 promoter in the vicinity of the 3 polymorphisms. The GAA, GCC, AAC, AAA and ACC constructs induced ~50% increased luciferase expression relative to the GAC construct in both cell types. Haplotype analysis including Leu33Pro indicated 5 common haplotypes; no associations between ITGB3 haplotypes and receptor density were found. However, the GCC-Pro33 haplotype was associated with significantly higher vWF activity (128.6 [112.1–145.1]%) compared with all other haplotypes (107.1 [101.2–113.0]%, p=0.02). In conclusion, the GCC-Pro33 haplotype was associated with increased vWF activity but not with platelet αIIbβ3 receptor density, which may indicate ITGB3 haplotype influences endothelial function. PMID:18045606

  5. Novel strategies to mine alcoholism-related haplotypes and genes by combining existing knowledge framework.

    PubMed

    Zhang, RuiJie; Li, Xia; Jiang, YongShuai; Liu, GuiYou; Li, ChuanXing; Zhang, Fan; Xiao, Yun; Gong, BinSheng

    2009-02-01

    High-throughout single nucleotide polymorphism detection technology and the existing knowledge provide strong support for mining the disease-related haplotypes and genes. In this study, first, we apply four kinds of haplotype identification methods (Confidence Intervals, Four Gamete Tests, Solid Spine of LD and fusing method of haplotype block) into high-throughout SNP genotype data to identify blocks, then use cluster analysis to verify the effectiveness of the four methods, and select the alcoholism-related SNP haplotypes through risk analysis. Second, we establish a mapping from haplotypes to alcoholism-related genes. Third, we inquire NCBI SNP and gene databases to locate the blocks and identify the candidate genes. In the end, we make gene function annotation by KEGG, Biocarta, and GO database. We find 159 haplotype blocks, which relate to the alcoholism most possibly on chromosome 1 approximately 22, including 227 haplotypes, of which 102 SNP haplotypes may increase the risk of alcoholism. We get 121 alcoholism-related genes and verify their reliability by the functional annotation of biology. In a word, we not only can handle the SNP data easily, but also can locate the disease-related genes precisely by combining our novel strategies of mining alcoholism-related haplotypes and genes with existing knowledge framework.

  6. Association Between Chloroplast DNA and Mitochondrial DNA Haplotypes in Prunus spinosa L. (Rosaceae) Populations across Europe

    PubMed Central

    MOHANTY, APARAJITA; MARTÍN, JUAN PEDRO; GONZÁLEZ, LUIS MIGUEL; AGUINAGALDE, ITZIAR

    2003-01-01

    Chloroplast DNA (cpDNA) and mitochondrial DNA (mtDNA) were studied in 24 populations of Prunus spinosa sampled across Europe. The cpDNA and mtDNA fragments were amplified using universal primers and subsequently digested with restriction enzymes to obtain the polymorphisms. Combinations of all the polymorphisms resulted in 33 cpDNA haplotypes and two mtDNA haplotypes. Strict association between the cpDNA haplotypes and the mtDNA haplotypes was detected in most cases, indicating conjoint inheritance of the two genomes. The most frequent and abundant cpDNA haplotype (C20; frequency, 51 %) is always associated with the more frequent and abundant mtDNA haplotype (M1; frequency, 84 %). All but two of the cpDNA haplotypes associated with the less frequent mtDNA haplotype (M2) are private haplotypes. These private haplotypes are phylogenetically related but geographically unrelated. They form a separate cluster on the minimum‐length spanning tree. PMID:14534199

  7. Identification and genetic effect of haplotype in the bovine BMP7 gene.

    PubMed

    Huang, Yong-Zhen; Wang, Xin-Lei; He, Hua; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong

    2013-12-15

    Bone morphogenetic proteins (BMPs) are peptide growth factors belonging to the transforming growth factor-beta (TGF-β) superfamily, and some members of the BMP family support white adipocyte differentiation. In this study, we focused on the BMP7 which singularly promotes the differentiation of brown preadipocytes. Haplotypes involving 5 single nucleotide polymorphism (SNP) sites in the bovine BMP7 gene were identified and their effect on body weight was analyzed. 16 haplotypes and 18 combined haplotypes were revealed and the linkage disequilibrium was assessed in the cattle population with 602 individuals representing three main cattle breeds from China. The results showed that haplotypes 3, 10 and 14 were predominant and accounted for 75.64%, 69.85%, and 83.36% in Nanyang, Qinchuan and Jiaxian cattle breeds, respectively. The statistical analyses indicated that the SNP 1, 4, and 5 are associated with the body weight, body length, and heart girth at 12 and 24 months in Nanyang cattle population (P<0.05), whereas there is no significant association between their 16 haplotypes and 18 combined haplotypes. Our results provide evidence that some SNPs and haplotypes in BMP7 are associated with growth traits, and may be utilized as a genetic marker in marker-assisted selection for beef cattle breeding programs. Copyright © 2013. Published by Elsevier B.V.

  8. β-globin gene cluster haplotypes in ethnic minority populations of southwest China

    PubMed Central

    Sun, Hao; Liu, Hongxian; Huang, Kai; Lin, Keqin; Huang, Xiaoqin; Chu, Jiayou; Ma, Shaohui; Yang, Zhaoqing

    2017-01-01

    The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5′ sites and 3′ sites of the β-globin gene cluster. 5′ haplotypes 2 (+−−−), 6 (−++−+), 9 (−++++) and 3′ haplotype FW3 (−+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China. PMID:28205625

  9. Ancient mitochondrial haplotypes and evidence for intragenic recombination in a gynodioecious plant.

    PubMed

    Städler, Thomas; Delph, Lynda F

    2002-09-03

    Because of their extremely low nucleotide mutation rates, plant mitochondrial genes are generally not expected to show variation within species. Remarkably, we found nine distinct cytochrome b sequence haplotypes in the gynodioecious alpine plant Silene acaulis, with two or more haplotypes coexisting locally in each of three sampled regions. Moreover, there is evidence for intragenic recombination in the history of the haplotype sample, implying at least transient heteroplasmy of mitochondrial DNA (mtDNA). Heteroplasmy might be achieved by one of two potential mechanisms, either continuous coexistence of subgenomic fragments in low stoichiometry, or occasional paternal leakage of mtDNA. On the basis of levels of synonymous nucleotide substitutions, the average divergence time between haplotypes is estimated to be at least 15 million years. Ancient coalescence of extant haplotypes is further indicated by the paucity of fixed differences in haplotypes obtained from related species, a pattern expected under trans-specific evolution. Our data are consistent with models of frequency-dependent selection on linked cytoplasmic male-sterility factors, the putative molecular basis of females in gynodioecious populations. However, associations between marker loci and the inferred male-sterility genes can be maintained only with very low rates of recombination. Heteroplasmy and recombination between divergent haplotypes imply unexplored consequences for the evolutionary dynamics of gynodioecy, a widespread plant breeding system.

  10. Introgression of Neandertal- and Denisovan-like Haplotypes Contributes to Adaptive Variation in Human Toll-like Receptors

    PubMed Central

    Dannemann, Michael; Andrés, Aida M.; Kelso, Janet

    2016-01-01

    Pathogens and the diseases they cause have been among the most important selective forces experienced by humans during their evolutionary history. Although adaptive alleles generally arise by mutation, introgression can also be a valuable source of beneficial alleles. Archaic humans, who lived in Europe and Western Asia for more than 200,000 years, were probably well adapted to this environment and its local pathogens. It is therefore conceivable that modern humans entering Europe and Western Asia who admixed with them obtained a substantial immune advantage from the introgression of archaic alleles. Here we document a cluster of three Toll-like receptors (TLR6-TLR1-TLR10) in modern humans that carries three distinct archaic haplotypes, indicating repeated introgression from archaic humans. Two of these haplotypes are most similar to the Neandertal genome, and the third haplotype is most similar to the Denisovan genome. The Toll-like receptors are key components of innate immunity and provide an important first line of immune defense against bacteria, fungi, and parasites. The unusually high allele frequencies and unexpected levels of population differentiation indicate that there has been local positive selection on multiple haplotypes at this locus. We show that the introgressed alleles have clear functional effects in modern humans; archaic-like alleles underlie differences in the expression of the TLR genes and are associated with reduced microbial resistance and increased allergic disease in large cohorts. This provides strong evidence for recurrent adaptive introgression at the TLR6-TLR1-TLR10 locus, resulting in differences in disease phenotypes in modern humans. PMID:26748514

  11. Geographic distribution of haplotype diversity at the bovine casein locus

    PubMed Central

    Jann, Oliver C; Ibeagha-Awemu, Eveline M; Özbeyaz, Ceyhan; Zaragoza, Pilar; Williams, John L; Ajmone-Marsan, Paolo; Lenstra, Johannes A; Moazami-Goudarzi, Katy; Erhardt, Georg

    2004-01-01

    The genetic diversity of the casein locus in cattle was studied on the basis of haplotype analysis. Consideration of recently described genetic variants of the casein genes which to date have not been the subject of diversity studies, allowed the identification of new haplotypes. Genotyping of 30 cattle breeds from four continents revealed a geographically associated distribution of haplotypes, mainly defined by frequencies of alleles at CSN1S1 and CSN3. The genetic diversity within taurine breeds in Europe was found to decrease significantly from the south to the north and from the east to the west. Such geographic patterns of cattle genetic variation at the casein locus may be a result of the domestication process of modern cattle as well as geographically differentiated natural or artificial selection. The comparison of African Bos taurus and Bos indicus breeds allowed the identification of several Bos indicus specific haplotypes (CSN1S1*C-CSN2*A2-CSN3*AI/CSN3*H) that are not found in pure taurine breeds. The occurrence of such haplotypes in southern European breeds also suggests that an introgression of indicine genes into taurine breeds could have contributed to the distribution of the genetic variation observed. PMID:15040901

  12. Discovery, evaluation and distribution of haplotypes of the wheat Ppd-D1 gene.

    PubMed

    Guo, Zhiai; Song, Yanxia; Zhou, Ronghua; Ren, Zhenglong; Jia, Jizeng

    2010-02-01

    Ppd-D1 is one of the most potent genes affecting the photoperiod response of wheat (Triticum aestivum). Only two alleles, insensitive Ppd-D1a and sensitive Ppd-D1b, were known previously, and these did not adequately explain the broad adaptation of wheat to photoperiod variation. In this study, five diagnostic molecular markers were employed to identify Ppd-D1 haplotypes in 492 wheat varieties from diverse geographic locations and 55 accessions of Aegilops tauschii, the D genome donor species of wheat. Six Ppd-D1 haplotypes, designated I-VI, were identified. Types II, V and VI were considered to be more ancient and types I, III and IV were considered to be derived from type II. The transcript abundances of the Ppd-D1 haplotypes showed continuous variation, being highest for haplotype I, lowest for haplotype III, and correlating negatively with varietal differences in heading time. These haplotypes also significantly affected other agronomic traits. The distribution frequency of Ppd-D1 haplotypes showed partial correlations with both latitudes and altitudes of wheat cultivation regions. The evolution, expression and distribution of Ppd-D1 haplotypes were consistent evidentially with each other. What was regarded as a pair of alleles in the past can now be considered a series of alleles leading to continuous variation.

  13. Haplotype estimation using sequencing reads.

    PubMed

    Delaneau, Olivier; Howie, Bryan; Cox, Anthony J; Zagury, Jean-François; Marchini, Jonathan

    2013-10-03

    High-throughput sequencing technologies produce short sequence reads that can contain phase information if they span two or more heterozygote genotypes. This information is not routinely used by current methods that infer haplotypes from genotype data. We have extended the SHAPEIT2 method to use phase-informative sequencing reads to improve phasing accuracy. Our model incorporates the read information in a probabilistic model through base quality scores within each read. The method is primarily designed for high-coverage sequence data or data sets that already have genotypes called. One important application is phasing of single samples sequenced at high coverage for use in medical sequencing and studies of rare diseases. Our method can also use existing panels of reference haplotypes. We tested the method by using a mother-father-child trio sequenced at high-coverage by Illumina together with the low-coverage sequence data from the 1000 Genomes Project (1000GP). We found that use of phase-informative reads increases the mean distance between switch errors by 22% from 274.4 kb to 328.6 kb. We also used male chromosome X haplotypes from the 1000GP samples to simulate sequencing reads with varying insert size, read length, and base error rate. When using short 100 bp paired-end reads, we found that using mixtures of insert sizes produced the best results. When using longer reads with high error rates (5-20 kb read with 4%-15% error per base), phasing performance was substantially improved. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  14. MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

    PubMed

    Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

    2016-10-01

    The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

  15. Y-STR haplotypes of Native American populations from the Brazilian Amazon region.

    PubMed

    Palha, Teresinha Jesus Brabo Ferreira; Rodrigues, Elzemar Martins Ribeiro; dos Santos, Sidney Emanuel Batista

    2010-10-01

    The allele and haplotype frequencies of nine Y-STRs (DYS19, DYS389 I, DYS389 II, DYS390, DYS391, DYS392, DYS393, DYS385 I/II) were determined in a sample of six native tribes from the Brazilian Amazon (Tiriyó, Awa-Guajá, Waiãpi, Urubu-Kaapor, Zoé and Parakanã). Forty-eight different haplotypes were identified, 28 of which unique. Five haplotypes are very frequent and were shared by over 10 individuals. The estimated haplotype diversity (0.9114) was very low compared to other geographic groups, including Africans, Europeans and Asians. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  16. A TNF region haplotype offers protection from typhoid fever in Vietnamese patients

    PubMed Central

    2009-01-01

    The genomic region surrounding the TNF locus on human chromosome 6 has previously been associated with typhoid fever in Vietnam. We used a haplotypic approach to understand this association further. Eighty single nucleotide polymorphisms (SNPs) spanning a 150 kb region were genotyped in 95 Vietnamese individuals (typhoid case/mother/father trios). A subset of data from 33 SNPs with a minor allele frequency of >4.3% was used to construct haplotypes. Fifteen SNPs, which tagged the 42 constructed haplotypes were selected. The haplotype tagging SNPs (T1-T15) were genotyped in 380 confirmed typhoid cases and 380 Vietnamese ethnically matched controls. Allelic frequencies of seven SNPs (T1, T2, T3, T5, T6, T7, T8) were significantly different between typhoid cases and controls. Logistic regression results support the hypothesis that there is just one signal associated with disease at this locus. Haplotype-based analysis of the tag SNPs provided positive evidence of association with typhoid (posterior probability 0.821). The analysis highlighted a low-risk cluster of haplotypes that each carry the minor allele of T1 or T7, but not both, and otherwise carry the combination of alleles *12122*1111 at T1-T11, further supporting the one associated signal hypothesis. Finally, individuals that carry the typhoid fever protective haplotype *12122*1111 also produce a relatively low TNF-α response to LPS. PMID:17503085

  17. Modeling coverage gaps in haplotype frequencies via Bayesian inference to improve stem cell donor selection.

    PubMed

    Louzoun, Yoram; Alter, Idan; Gragert, Loren; Albrecht, Mark; Maiers, Martin

    2018-05-01

    Regardless of sampling depth, accurate genotype imputation is limited in regions of high polymorphism which often have a heavy-tailed haplotype frequency distribution. Many rare haplotypes are thus unobserved. Statistical methods to improve imputation by extending reference haplotype distributions using linkage disequilibrium patterns that relate allele and haplotype frequencies have not yet been explored. In the field of unrelated stem cell transplantation, imputation of highly polymorphic human leukocyte antigen (HLA) genes has an important application in identifying the best-matched stem cell donor when searching large registries totaling over 28,000,000 donors worldwide. Despite these large registry sizes, a significant proportion of searched patients present novel HLA haplotypes. Supporting this observation, HLA population genetic models have indicated that many extant HLA haplotypes remain unobserved. The absent haplotypes are a significant cause of error in haplotype matching. We have applied a Bayesian inference methodology for extending haplotype frequency distributions, using a model where new haplotypes are created by recombination of observed alleles. Applications of this joint probability model offer significant improvement in frequency distribution estimates over the best existing alternative methods, as we illustrate using five-locus HLA frequency data from the National Marrow Donor Program registry. Transplant matching algorithms and disease association studies involving phasing and imputation of rare variants may benefit from this statistical inference framework.

  18. A Genome-Wide Scan for Breast Cancer Risk Haplotypes among African American Women

    PubMed Central

    Song, Chi; Chen, Gary K.; Millikan, Robert C.; Ambrosone, Christine B.; John, Esther M.; Bernstein, Leslie; Zheng, Wei; Hu, Jennifer J.; Ziegler, Regina G.; Nyante, Sarah; Bandera, Elisa V.; Ingles, Sue A.; Press, Michael F.; Deming, Sandra L.; Rodriguez-Gil, Jorge L.; Chanock, Stephen J.; Wan, Peggy; Sheng, Xin; Pooler, Loreall C.; Van Den Berg, David J.; Le Marchand, Loic; Kolonel, Laurence N.; Henderson, Brian E.; Haiman, Chris A.; Stram, Daniel O.

    2013-01-01

    Genome-wide association studies (GWAS) simultaneously investigating hundreds of thousands of single nucleotide polymorphisms (SNP) have become a powerful tool in the investigation of new disease susceptibility loci. Haplotypes are sometimes thought to be superior to SNPs and are promising in genetic association analyses. The application of genome-wide haplotype analysis, however, is hindered by the complexity of haplotypes themselves and sophistication in computation. We systematically analyzed the haplotype effects for breast cancer risk among 5,761 African American women (3,016 cases and 2,745 controls) using a sliding window approach on the genome-wide scale. Three regions on chromosomes 1, 4 and 18 exhibited moderate haplotype effects. Furthermore, among 21 breast cancer susceptibility loci previously established in European populations, 10p15 and 14q24 are likely to harbor novel haplotype effects. We also proposed a heuristic of determining the significance level and the effective number of independent tests by the permutation analysis on chromosome 22 data. It suggests that the effective number was approximately half of the total (7,794 out of 15,645), thus the half number could serve as a quick reference to evaluating genome-wide significance if a similar sliding window approach of haplotype analysis is adopted in similar populations using similar genotype density. PMID:23468962

  19. The JAK2 GGCC (46/1) Haplotype in Myeloproliferative Neoplasms: Causal or Random?

    PubMed

    Anelli, Luisa; Zagaria, Antonella; Specchia, Giorgina; Albano, Francesco

    2018-04-11

    The germline JAK2 haplotype known as "GGCC or 46/1 haplotype" (haplotype GGCC_46/1 ) consists of a combination of single nucleotide polymorphisms (SNPs) mapping in a region of about 250 kb, extending from the JAK2 intron 10 to the Insulin-like 4 ( INLS4 ) gene. Four main SNPs (rs3780367, rs10974944, rs12343867, and rs1159782) generating a "GGCC" combination are more frequently indicated to represent the JAK2 haplotype. These SNPs are inherited together and are frequently associated with the onset of myeloproliferative neoplasms (MPN) positive for both JAK2 V617 and exon 12 mutations. The association between the JAK2 haplotype GGCC_46/1 and mutations in other genes, such as thrombopoietin receptor ( MPL ) and calreticulin ( CALR ), or the association with triple negative MPN, is still controversial. This review provides an overview of the frequency and the role of the JAK2 haplotype GGCC_46/1 in the pathogenesis of different myeloid neoplasms and describes the hypothetical mechanisms at the basis of the association with JAK2 gene mutations. Moreover, possible clinical implications are discussed, as different papers reported contrasting data about the correlation between the JAK2 haplotype GGCC_46/1 and blood cell count, survival, or disease progression.

  20. HLA-A*02 allele frequencies and haplotypic associations in Koreans.

    PubMed

    Park, M H; Whang, D H; Kang, S J; Han, K S

    2000-03-01

    We have investigated the frequencies of HLA-A*02 alleles and their haplotypic associations with HLA-B and -DRB1 loci in 439 healthy unrelated Koreans, including 214 parents from 107 families. All of the 227 samples (51.7%) typed as A2 by serology were analyzed for A*02 alleles using polymerase chain reaction (PCR)-low ionic strength-single-strand conformation polymorphism (LIS-SSCP) method. A total of six different A*02 alleles were detected (A*02 allele frequency 29.6%): A*0201/9 (16.6%), *0203 (0.5%), *0206 (9.3%), *0207 (3.0%), and one each case of *0210 and *02 undetermined type. Two characteristic haplotypes showing the strongest linkage disequilibrium were A*0203-B38-DRB]*1502 and A*0207-B46-DRB1*0803. Besides these strong associations, significant two-locus associations (P<0.001) were observed for A*0201 with B61, DRB1*0901 and DRB1*1401, and for A*0206 with B48 and B61. HLA haplotypes carrying HLA-A2 showed a variable distribution of A*02 alleles, and all of the eight most common A2-B-DR haplotypes occurring at frequencies of > or =1% were variably associated with two different A*02 alleles. These results demonstrate that substantial heterogeneity is present in the distribution of HLA-A*02 alleles and related haplotypes in Koreans.

  1. Patterns of linkage disequilibrium and haplotype distribution in disease candidate genes.

    PubMed

    Long, Ji-Rong; Zhao, Lan-Juan; Liu, Peng-Yuan; Lu, Yan; Dvornyk, Volodymyr; Shen, Hui; Liu, Yong-Jun; Zhang, Yuan-Yuan; Xiong, Dong-Hai; Xiao, Peng; Deng, Hong-Wen

    2004-05-24

    The adequacy of association studies for complex diseases depends critically on the existence of linkage disequilibrium (LD) between functional alleles and surrounding SNP markers. We examined the patterns of LD and haplotype distribution in eight candidate genes for osteoporosis and/or obesity using 31 SNPs in 1,873 subjects. These eight genes are apolipoprotein E (APOE), type I collagen alpha1 (COL1A1), estrogen receptor-alpha (ER-alpha), leptin receptor (LEPR), parathyroid hormone (PTH)/PTH-related peptide receptor type 1 (PTHR1), transforming growth factor-beta1 (TGF-beta1), uncoupling protein 3 (UCP3), and vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR). Yin yang haplotypes, two high-frequency haplotypes composed of completely mismatching SNP alleles, were examined. To quantify LD patterns, two common measures of LD, D' and r2, were calculated for the SNPs within the genes. The haplotype distribution varied in the different genes. Yin yang haplotypes were observed only in PTHR1 and UCP3. D' ranged from 0.020 to 1.000 with the average of 0.475, whereas the average r2 was 0.158 (ranging from 0.000 to 0.883). A decay of LD was observed as the intermarker distance increased, however, there was a great difference in LD characteristics of different genes or even in different regions within gene. The differences in haplotype distributions and LD patterns among the genes underscore the importance of characterizing genomic regions of interest prior to association studies.

  2. VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

    1994-09-01

    The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception ofmore » closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.« less

  3. Analysis of Shared Haplotypes amongst Palauans Maps Loci for Psychotic Disorders to 4q28 and 5q23-q31.

    PubMed

    Bodea, Corneliu A; Middleton, Frank A; Melhem, Nadine M; Klei, Lambertus; Song, Youeun; Tiobech, Josepha; Marumoto, Pearl; Yano, Victor; Faraone, Stephen V; Roeder, Kathryn; Myles-Worsley, Marina; Devlin, Bernie; Byerley, William

    2017-02-01

    To localize genetic variation affecting risk for psychotic disorders in the population of Palau, we genotyped DNA samples from 203 Palauan individuals diagnosed with psychotic disorders, broadly defined, and 125 control subjects using a genome-wide single nucleotide polymorphism array. Palau has unique features advantageous for this study: due to its population history, Palauans are substantially interrelated; affected individuals often, but not always, cluster in families; and we have essentially complete ascertainment of affected individuals. To localize risk variants to genomic regions, we evaluated long-shared haplotypes, ≥10 Mb, identifying clusters of affected individuals who share such haplotypes. This extensive sharing, typically identical by descent, was significantly greater in cases than population controls, even after controlling for relatedness. Several regions of the genome exhibited substantial excess of shared haplotypes for affected individuals, including 3p21, 3p12, 4q28, and 5q23-q31. Two of these regions, 4q28 and 5q23-q31, showed significant linkage by traditional LOD score analysis and could harbor variants of more sizeable risk for psychosis or a multiplicity of risk variants. The pattern of haplotype sharing in 4q28 highlights PCDH10 , encoding a cadherin-related neuronal receptor, as possibly involved in risk.

  4. Longitudinal analysis of haplotypes and polymorphisms of the APOA5 and APOC3 genes associated with variation in serum triglyceride levels: the Bogalusa Heart Study.

    PubMed

    Hallman, D Michael; Srinivasan, Sathanur R; Chen, Wei; Boerwinkle, Eric; Berenson, Gerald S

    2006-12-01

    , in order, APOC3 SstI and -2854 G/T and APOA5 -1131 T/C, -3 A/G, and +56 C/G, 3 were significantly associated with higher triglycerides, even after adjusting for multiple tests: GGTAG (P = .002), GTTAG (P < .0001), and CGCGC (P = .0002). Each GGTAG haplotype carried would be expected to raise triglyceride levels (relative to those of GTTAC homozygotes) by approximately 19 mg/dL, each GTTAG haplotype by approximately 15 mg/dL, and each CGCGC haplotype by approximately 7 mg/dL. Haplotypes comprising the 3 loci implicated by genotype analyses (SstI, -1131 T/C, and +56 C/G) were also tested: haplotypes C_C_C and G_T_G significantly raised triglycerides, even after adjustment for multiple comparisons (P < .002 for both), with each copy of C_C_C expected to raise triglycerides by approximately 7 mg/dL and each copy of G_T_G by approximately 15 mg/dL. Overall, our findings support those of others in associating specific polymorphisms and haplotypes in the APOA1/C3/A4/A5 gene cluster with higher serum triglyceride levels. However, the degree to which polymorphisms in the APOC3 and APOA5 genes may be independently associated with triglyceride levels remains to be determined.

  5. Mapping of HLA- DQ haplotypes in a group of Danish patients with celiac disease.

    PubMed

    Lund, Flemming; Hermansen, Mette N; Pedersen, Merete F; Hillig, Thore; Toft-Hansen, Henrik; Sölétormos, György

    2015-10-01

    A cost-effective identification of HLA- DQ risk haplotypes using the single nucleotide polymorphism (SNP) technique has recently been applied in the diagnosis of celiac disease (CD) in four European populations. The objective of the study was to map risk HLA- DQ haplotypes in a group of Danish CD patients using the SNP technique. Cohort A: Among 65 patients with gastrointestinal symptoms we compared the HLA- DQ2 and HLA- DQ8 risk haplotypes obtained by the SNP technique (method 1) with results based on a sequence specific primer amplification technique (method 2) and a technique used in an assay from BioDiagene (method 3). Cohort B: 128 patients with histologically verified CD were tested for CD risk haplotypes (method 1). Patients with negative results were further tested for sub-haplotypes of HLA- DQ2 (methods 2 and 3). Cohort A: The three applied methods provided the same HLA- DQ2 and HLA- DQ8 results among 61 patients. Four patients were negative for the HLA- DQ2 and HLA- DQ8 haplotypes (method 1) but were positive for the HLA- DQ2.5-trans and HLA- DQ2.2 haplotypes (methods 2 and 3). Cohort B: A total of 120 patients were positive for the HLA- DQ2.5-cis and HLA- DQ8 haplotypes (method 1). The remaining seven patients were positive for HLA- DQ2.5-trans or HLA- DQ2.2 haplotypes (methods 2 and 3). One patient was negative with all three HLA methods. The HLA- DQ risk haplotypes were detected in 93.8% of the CD patients using the SNP technique (method 1). The sensitivity increased to 99.2% by combining methods 1 - 3.

  6. Assessing transmission of ‘Candidatus Liberibacter solanacearum’ haplotypes through seed potato

    USDA-ARS?s Scientific Manuscript database

    Conflicting data has previously been reported concerning the impact of zebra chip disease transmission through seed tubers. These discrepancies may be due to the experimental design of each study, whereby different pathogen haplotypes, insect vector haplotypes, and potato plant varieties were used....

  7. COMT haplotypes, catecholamine metabolites in plasma and clinical response in schizophrenic and bipolar patients.

    PubMed

    Zumárraga, Mercedes; Arrúe, Aurora; Basterreche, Nieves; Macías, Isabel; Catalán, Ana; Madrazo, Arantza; Bustamante, Sonia; Zamalloa, María I; Erkoreka, Leire; Gordo, Estibaliz; Arnaiz, Ainara; Olivas, Olga; Arroita, Ariane; Marín, Elena; González-Torres, Miguel A

    2016-06-01

    We examined the association of COMT haplotypes and plasma metabolites of catecholamines in relation to the clinical response to antipsychotics in schizophrenic and bipolar patients. We studied 165 patients before and after four weeks of treatment, and 163 healthy controls. We assessed four COMT haplotypes and the plasma concentrations of HVA, DOPAC and MHPG. Bipolar patients: haplotypes are associated with age at onset and clinical evolution. In schizophrenic patients, an haplotype previously associated with increased risk, is related to better response of negative symptoms. Haplotypes would be good indicators of the clinical status and the treatment response in bipolar and schizophrenic patients. Larger studies are required to elucidate the clinical usefulness of these findings.

  8. A combined long-range phasing and long haplotype imputation method to impute phase for SNP genotypes

    PubMed Central

    2011-01-01

    Background Knowing the phase of marker genotype data can be useful in genome-wide association studies, because it makes it possible to use analysis frameworks that account for identity by descent or parent of origin of alleles and it can lead to a large increase in data quantities via genotype or sequence imputation. Long-range phasing and haplotype library imputation constitute a fast and accurate method to impute phase for SNP data. Methods A long-range phasing and haplotype library imputation algorithm was developed. It combines information from surrogate parents and long haplotypes to resolve phase in a manner that is not dependent on the family structure of a dataset or on the presence of pedigree information. Results The algorithm performed well in both simulated and real livestock and human datasets in terms of both phasing accuracy and computation efficiency. The percentage of alleles that could be phased in both simulated and real datasets of varying size generally exceeded 98% while the percentage of alleles incorrectly phased in simulated data was generally less than 0.5%. The accuracy of phasing was affected by dataset size, with lower accuracy for dataset sizes less than 1000, but was not affected by effective population size, family data structure, presence or absence of pedigree information, and SNP density. The method was computationally fast. In comparison to a commonly used statistical method (fastPHASE), the current method made about 8% less phasing mistakes and ran about 26 times faster for a small dataset. For larger datasets, the differences in computational time are expected to be even greater. A computer program implementing these methods has been made available. Conclusions The algorithm and software developed in this study make feasible the routine phasing of high-density SNP chips in large datasets. PMID:21388557

  9. Two families from New England with usher syndrome type IC with distinct haplotypes.

    PubMed

    DeAngelis, M M; McGee, T L; Keats, B J; Slim, R; Berson, E L; Dryja, T P

    2001-03-01

    To search for patients with Usher syndrome type IC among those with Usher syndrome type I who reside in New England. Genotype analysis of microsatellite markers closely linked to the USH1C locus was done using the polymerase chain reaction. We compared the haplotype of our patients who were homozygous in the USH1C region with the haplotypes found in previously reported USH1C Acadian families who reside in southwestern Louisiana and from a single family residing in Lebanon. Of 46 unrelated cases of Usher syndrome type I residing in New England, two were homozygous at genetic markers in the USH1C region. Of these, one carried the Acadian USH1C haplotype and had Acadian ancestors (that is, from Nova Scotia) who did not participate in the 1755 migration of Acadians to Louisiana. The second family had a haplotype that proved to be the same as that of a family with USH1C residing in Lebanon. Each of the two families had haplotypes distinct from the other. This is the first report that some patients residing in New England have Usher syndrome type IC. Patients with Usher syndrome type IC can have the Acadian haplotype or the Lebanese haplotype compatible with the idea that at least two independently arising pathogenic mutations have occurred in the yet-to-be identified USH1C gene.

  10. HLA DPA1, DPB1 alleles and haplotypes contribute to the risk associated with type 1 diabetes: analysis of the type 1 diabetes genetics consortium families.

    PubMed

    Varney, Michael D; Valdes, Ana Maria; Carlson, Joyce A; Noble, Janelle A; Tait, Brian D; Bonella, Persia; Lavant, Eva; Fear, Anna Lisa; Louey, Anthony; Moonsamy, Priscilla; Mychaleckyj, Josyf C; Erlich, Henry

    2010-08-01

    To determine the relative risk associated with DPA1 and DPB1 alleles and haplotypes in type 1 diabetes. The frequency of DPA1 and DPB1 alleles and haplotypes in type 1 diabetic patients was compared to the family based control frequency in 1,771 families directly and conditional on HLA (B)-DRB1-DQA1-DQB1 linkage disequilibrium. A relative predispositional analysis (RPA) was performed in the presence or absence of the primary HLA DR-DQ associations and the contribution of DP haplotype to individual DR-DQ haplotype risks examined. Eight DPA1 and thirty-eight DPB1 alleles forming seventy-four DPA1-DPB1 haplotypes were observed; nineteen DPB1 alleles were associated with multiple DPA1 alleles. Following both analyses, type 1 diabetes susceptibility was significantly associated with DPB1*0301 (DPA1*0103-DPB1*0301) and protection with DPB1*0402 (DPA1*0103-DPB1*0402) and DPA1*0103-DPB1*0101 but not DPA1*0201-DPB1*0101. In addition, DPB1*0202 (DPA1*0103-DPB1*0202) and DPB1*0201 (DPA1*0103-DPB1*0201) were significantly associated with susceptibility in the presence of the high risk and protective DR-DQ haplotypes. Three associations (DPB1*0301, *0402, and *0202) remained statistically significant when only the extended HLA-A1-B8-DR3 haplotype was considered, suggesting that DPB1 alone may delineate the risk associated with this otherwise conserved haplotype. HLA DP allelic and haplotypic diversity contributes significantly to the risk for type 1 diabetes; DPB1*0301 (DPA1*0103-DPB1*0301) is associated with susceptibility and DPB1*0402 (DPA1*0103-DPB1*0402) and DPA1*0103-DPB1*0101 with protection. Additional evidence is presented for the susceptibility association of DPB1*0202 (DPA1*0103-DPB1*0202) and for a contributory role of individual amino acids and DPA1 or a gene in linkage disequilibrium in DR3-DPB1*0101 positive haplotypes.

  11. Fetal hemoglobin in sickle cell anemia: The Arab-Indian haplotype and new therapeutic agents.

    PubMed

    Habara, Alawi H; Shaikho, Elmutaz M; Steinberg, Martin H

    2017-11-01

    Fetal hemoglobin (HbF) has well-known tempering effects on the symptoms of sickle cell disease and its levels vary among patients with different haplotypes of the sickle hemoglobin gene. Compared with sickle cell anemia haplotypes found in patients of African descent, HbF levels in Saudi and Indian patients with the Arab-Indian (AI) haplotype exceed that in any other haplotype by nearly twofold. Genetic association studies have identified some loci associated with high HbF in the AI haplotype but these observations require functional confirmation. Saudi patients with the Benin haplotype have HbF levels almost twice as high as African patients with this haplotype but this difference is unexplained. Hydroxyurea is still the only FDA approved drug for HbF induction in sickle cell disease. While most patients treated with hydroxyurea have an increase in HbF and some clinical improvement, 10 to 20% of adults show little response to this agent. We review the genetic basis of HbF regulation focusing on sickle cell anemia in Saudi Arabia and discuss new drugs that can induce increased levels of HbF. © 2017 Wiley Periodicals, Inc.

  12. Two Orangutan Species Have Evolved Different KIR Alleles and Haplotypes1

    PubMed Central

    Guethlein, Lisbeth A.; Norman, Paul J.; Heijmans, Corinne M. C.; de Groot, Natasja G.; Hilton, Hugo G.; Babrzadeh, Farbod; Abi-Rached, Laurent; Bontrop, Ronald E.; Parham, Peter

    2017-01-01

    The immune and reproductive functions of human Natural Killer (NK) cells are regulated by interactions of the C1 and C2 epitopes of HLA-C with C1-specific and C2-specific lineage III killer cell immunoglobulin-like receptors (KIR). This rapidly evolving and diverse system of ligands and receptors is restricted to humans and great apes. In this context, the orangutan has particular relevance because it represents an evolutionary intermediate, one having the C1 epitope and corresponding KIR, but lacking the C2 epitope. Through a combination of direct sequencing, KIR genotyping and data mining from the Great Ape Genome Project (GAGP) we characterized the KIR alleles and haplotypes for panels of ten Bornean orangutans and 19 Sumatran orangutans. The orangutan KIR haplotypes have between five and ten KIR genes. The seven orangutan lineage III KIR genes all locate to the centromeric region of the KIR locus, whereas their human counterparts also populate the telomeric region. One lineage III KIR gene is Bornean-specific, one is Sumatran-specific and five are shared. Of twelve KIR gene-content haplotypes five are Bornean-specific, five are Sumatran-specific and two are shared. The haplotypes have different combinations of genes encoding activating and inhibitory C1 receptors that can be of higher or lower affinity. All haplotypes encode an inhibitory C1 receptor, but only some haplotypes encode an activating C1 receptor. Of 130 KIR alleles, 55 are Bornean-specific, 65 are Sumatran specific and ten are shared. PMID:28264973

  13. Evaluation of haplotype diversity of Achatina fulica (Lissachatina) [Bowdich] from Indian sub-continent by means of 16S rDNA sequence and its phylogenetic relationships with other global populations.

    PubMed

    Ayyagari, Vijaya Sai; Sreerama, Krupanidhi

    2017-08-01

    Achatina fulica (Lissachatina fulica) is one of the most invasive species found across the globe causing a significant damage to crops, vegetables, and horticultural plants. This terrestrial snail is native to east Africa and spread to different parts of the world by introductions. India, a hot spot for biodiversity of several endemic gastropods, has witnessed an outburst of this snail population in several parts of the country posing a serious threat to crop loss and also to human health. With an objective to evaluate the genetic diversity of this snail, we have sampled this snail from different parts of India and analyzed its haplotype diversity by means of 16S rDNA sequence information. Apart from this, we have studied the phylogenetic relationships of the isolates sequenced in the present study in relation with other global populations by Bayesian and Maximum-likelihood approaches. Of the isolates sequenced, haplotype 'C' is the predominant one. A new haplotype 'S' from the state of Odisha was observed. The isolates sequenced in the present study clustered with its conspecifics from the Indian sub-continent. Haplotype network analyses were also carried out for studying the evolution of different haplotypes. It was observed that haplotype 'S' was associated with a Mauritius haplotype 'H', indicating the possibility of multiple introductions of A. fulica to India.

  14. Native and European haplotypes of Phragmites Australis (common reed) in the central Platte River, Nebraska

    USGS Publications Warehouse

    Larson, D.L.; Galatowitsch, S.M.; Larson, J.L.

    2011-01-01

    Phragmites australis (common reed) is known to have occurred along the Platte River historically, but recent rapid increases in both distribution and density have begun to impact habitat for migrating sandhill cranes and nesting piping plovers and least terns. Invasiveness in Phragmites has been associated with the incursion of a European genotype (haplotype M) in other areas; determining the genotype of Phragmites along the central Platte River has implications for proper management of the river system. In 2008 we sampled Phragmites patches along the central Platte River from Lexington to Chapman, NE, stratified by bridge segments, to determine the current distribution of haplotype E (native) and haplotype M genotypes. In addition, we did a retrospective analysis of historical Phragmites collections from the central Platte watershed (1902-2006) at the Bessey Herbarium. Fresh tissue from the 2008 survey and dried tissue from the herbarium specimens were classified as haplotype M or E using the restriction fragment length polymorphism procedure. The European haplotype was predominant in the 2008 samples: only 14 Phragmites shoots were identified as native haplotype E; 224 were non-native haplotype M. The retrospective analysis revealed primarily native haplotype individuals. Only collections made in Lancaster County, near Lincoln, NE, were haplotype M, and the earliest of these was collected in 1973. ?? 2011 Copyright by the Center for Great Plains Studies, University of Nebraska-Lincoln.

  15. Haplotype-Based Genome-Wide Prediction Models Exploit Local Epistatic Interactions Among Markers

    PubMed Central

    Jiang, Yong; Schmidt, Renate H.; Reif, Jochen C.

    2018-01-01

    Genome-wide prediction approaches represent versatile tools for the analysis and prediction of complex traits. Mostly they rely on marker-based information, but scenarios have been reported in which models capitalizing on closely-linked markers that were combined into haplotypes outperformed marker-based models. Detailed comparisons were undertaken to reveal under which circumstances haplotype-based genome-wide prediction models are superior to marker-based models. Specifically, it was of interest to analyze whether and how haplotype-based models may take local epistatic effects between markers into account. Assuming that populations consisted of fully homozygous individuals, a marker-based model in which local epistatic effects inside haplotype blocks were exploited (LEGBLUP) was linearly transformable into a haplotype-based model (HGBLUP). This theoretical derivation formally revealed that haplotype-based genome-wide prediction models capitalize on local epistatic effects among markers. Simulation studies corroborated this finding. Due to its computational efficiency the HGBLUP model promises to be an interesting tool for studies in which ultra-high-density SNP data sets are studied. Applying the HGBLUP model to empirical data sets revealed higher prediction accuracies than for marker-based models for both traits studied using a mouse panel. In contrast, only a small subset of the traits analyzed in crop populations showed such a benefit. Cases in which higher prediction accuracies are observed for HGBLUP than for marker-based models are expected to be of immediate relevance for breeders, due to the tight linkage a beneficial haplotype will be preserved for many generations. In this respect the inheritance of local epistatic effects very much resembles the one of additive effects. PMID:29549092

  16. Haplotype-Based Genome-Wide Prediction Models Exploit Local Epistatic Interactions Among Markers.

    PubMed

    Jiang, Yong; Schmidt, Renate H; Reif, Jochen C

    2018-05-04

    Genome-wide prediction approaches represent versatile tools for the analysis and prediction of complex traits. Mostly they rely on marker-based information, but scenarios have been reported in which models capitalizing on closely-linked markers that were combined into haplotypes outperformed marker-based models. Detailed comparisons were undertaken to reveal under which circumstances haplotype-based genome-wide prediction models are superior to marker-based models. Specifically, it was of interest to analyze whether and how haplotype-based models may take local epistatic effects between markers into account. Assuming that populations consisted of fully homozygous individuals, a marker-based model in which local epistatic effects inside haplotype blocks were exploited (LEGBLUP) was linearly transformable into a haplotype-based model (HGBLUP). This theoretical derivation formally revealed that haplotype-based genome-wide prediction models capitalize on local epistatic effects among markers. Simulation studies corroborated this finding. Due to its computational efficiency the HGBLUP model promises to be an interesting tool for studies in which ultra-high-density SNP data sets are studied. Applying the HGBLUP model to empirical data sets revealed higher prediction accuracies than for marker-based models for both traits studied using a mouse panel. In contrast, only a small subset of the traits analyzed in crop populations showed such a benefit. Cases in which higher prediction accuracies are observed for HGBLUP than for marker-based models are expected to be of immediate relevance for breeders, due to the tight linkage a beneficial haplotype will be preserved for many generations. In this respect the inheritance of local epistatic effects very much resembles the one of additive effects. Copyright © 2018 Jiang et al.

  17. Performance of Single Nucleotide Polymorphisms versus Haplotypes for Genome-Wide Association Analysis in Barley

    PubMed Central

    Jannink, Jean-Luc

    2010-01-01

    Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933

  18. The "Sardinian" HLA-A30,B18,DR3,DQw2 haplotype constantly lacks the 21-OHA and C4B genes. Is it an ancestral haplotype without duplication?

    PubMed

    Contu, L; Carcassi, C; Dausset, J

    1989-01-01

    The C4 and 21-OH loci of the class III HLA have been studied by specific DNA probes and the restriction enzyme Taq 1 in 24 unrelated Sardinian individuals selected from completely HLA-typed families. All 24 individuals had the HLA extended haplotype A30,Cw5,B18, BfF1,DR3,DRw52,DQw2, named "Sardinian" in the present paper because of its frequency of 15% in the Sardinian population. Eighteen of these were homozygous for the entire haplotype, and six were heterozygous at the A locus and blank (or homozygous) at all the other loci. In all completely homozygous cells and in four heterozygous cells at the A locus, the restriction fragments of the 21-OHA (3.2 kb) and C4B (5.8 kb or 5.4 kb) genes were absent, and the fragments of the C4A (7.0 kb) and 21-OHB (3.7 kb) genes were present. It is suggested that the "Sardinian" haplotype is an ancestral haplotype without duplication of the C4 and 21-OH genes, practically always identical in its structure, also in unrelated individuals. The diversity of this haplotype in the class III region (about 30 kb less) may be at least partially responsible for its misalignment with most haplotypes, which have duplicated C4 and 21-OH genes, and therefore also for its decreased probability to recombine. This can help explain its high stability and frequency in the Sardinian population. The same conclusion can be suggested for the Caucasian extended haplotype A1,B8,DR3 that always seems to lack the C4A and 21-OHA genes.

  19. Haplotypes of CYP3A4 and their close linkage with CYP3A5 haplotypes in a Japanese population.

    PubMed

    Fukushima-Uesaka, Hiromi; Saito, Yoshiro; Watanabe, Hidemi; Shiseki, Kisho; Saeki, Mayumi; Nakamura, Takahiro; Kurose, Kouichi; Sai, Kimie; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Kitakaze, Masafumi; Hanai, Sotaro; Nakajima, Toshiharu; Matsumoto, Kenji; Saito, Hirohisa; Goto, Yu-ichi; Kimura, Hideo; Katoh, Masaaki; Sugai, Kenji; Minami, Narihiro; Shirao, Kuniaki; Tamura, Tomohide; Yamamoto, Noboru; Minami, Hironobu; Ohtsu, Atsushi; Yoshida, Teruhiko; Saijo, Nagahiro; Kitamura, Yutaka; Kamatani, Naoyuki; Ozawa, Shogo; Sawada, Jun-ichi

    2004-01-01

    In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A4 in a Japanese population, the distal enhancer and proximal promoter regions, all exons, and the surrounding introns were sequenced from genomic DNA of 416 Japanese subjects. We found 24 SNPs, including 17 novel ones: two in the distal enhancer, four in the proximal promoter, one in the 5'-untranslated region (UTR), seven in the introns, and three in the 3'-UTR. The most common SNP was c.1026+12G>A (IVS10+12G>A), with a 0.249 frequency. Four non-synonymous SNPs, c.554C>G (p.T185S, CYP3A4(*)16), c.830_831insA (p.E277fsX8, (*)6), c.878T>C (p.L293P, (*)18), and c.1088 C>T (p.T363M, (*)11) were found with frequencies of 0.014, 0.001, 0.028, and 0.002, respectively. No SNP was found in the known nuclear transcriptional factor-binding sites in the enhancer and promoter regions. Using these 24 SNPs, 16 haplotypes were unambiguously identified, and nine haplotypes were inferred by aid of an expectation-maximization-based program. In addition, using data from 186 subjects enabled a close linkage to be found between CYP3A4 and CYP3A5 SNPs, especially among the SNPs at c.1026+12 in CYP3A4 and c.219-237 (IVS3-237, a key SNP site for CYP3A5(*)3), c.865+77 (IVS9+77) and c.1523 in CYP3A5. This result suggested that CYP3A4 and CYP3A5 are within the same gene block. Haplotype analysis between CYP3A4 and CYP3A5 revealed several major haplotype combinations in the CYP3A4-CYP3A5 block. Our findings provide fundamental and useful information for genotyping CYP3A4 (and CYP3A5) in the Japanese, and probably Asian populations. Copyright 2003 Wiley-Liss, Inc.

  20. Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.

    PubMed

    Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R

    2001-11-23

    Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.

  1. Autosomal Dominant Retinal Dystrophies Caused by a Founder Splice Site Mutation, c.828+3A>T, in PRPH2 and Protein Haplotypes in trans as Modifiers

    PubMed Central

    Shankar, Suma P.; Hughbanks-Wheaton, Dianna K.; Birch, David G.; Sullivan, Lori S.; Conneely, Karen N.; Bowne, Sara J.; Stone, Edwin M.; Daiger, Stephen P.

    2016-01-01

    Purpose We determined the phenotypic variation, disease progression, and potential modifiers of autosomal dominant retinal dystrophies caused by a splice site founder mutation, c.828+3A>T, in the PRPH2 gene. Methods A total of 62 individuals (19 families) harboring the PRPH2 c.828+3A>T mutation, had phenotype analysis by fundus appearance, electrophysiology, and visual fields. The PRPH2 haplotypes in trans were sequenced for potential modifying variants and generalized estimating equations (GEE) used for statistical analysis. Results Several distinct phenotypes caused by the PRPH2 c.828+3A>T mutation were observed and fell into two clinical categories: Group I (N = 44) with mild pattern dystrophies (PD) and Group II (N = 18) with more severe cone-rod dystrophy (CRD), retinitis pigmentosa (RP), and central areolar chorioretinal dystrophy (CACD). The PRPH2 Gln304-Lys310-Asp338 protein haplotype in trans was found in Group I only (29.6% vs. 0%), whereas the Glu304-Lys310-Gly338 haplotype was predominant in Group II (94.4% vs. 70.4%). Generalized estimating equations analysis for PD versus the CRD/CACD/RP phenotypes in individuals over 43 years alone with the PRPH2 haplotypes in trans and age as predictors, adjusted for correlation within families, confirmed a significant effect of haplotype on severity (P = 0.03) with an estimated odds ratio of 7.16 (95% confidence interval [CI] = [2.8, 18.4]). Conclusions The PRPH2 c.828+3A>T mutation results in multiple distinct phenotypes likely modified by protein haplotypes in trans; the odds of having the CACD/RP-like phenotype (versus the PD phenotype) are 7.16 times greater with a Glu304-Lys310-Gly338 haplotype in trans. Further functional studies of the modifying haplotypes in trans and PRPH2 splice variants may offer therapeutic targets. PMID:26842753

  2. Multiple distant origins for green sea turtles aggregating off Gorgona Island in the Colombian eastern Pacific.

    PubMed

    Amorocho, Diego F; Abreu-Grobois, F Alberto; Dutton, Peter H; Reina, Richard D

    2012-01-01

    Mitochondrial DNA analyses have been useful for resolving maternal lineages and migratory behavior to foraging grounds (FG) in sea turtles. However, little is known about source rookeries and haplotype composition of foraging green turtle aggregations in the southeastern Pacific. We used mitochondrial DNA control region sequences to identify the haplotype composition of 55 green turtles, Chelonia mydas, captured in foraging grounds of Gorgona National Park in the Colombian Pacific. Amplified fragments of the control region (457 bp) revealed the presence of seven haplotypes, with haplotype (h) and nucleotide (π) diversities of h = 0.300±0.080 and π = 0.009±0.005 respectively. The most common haplotype was CMP4 observed in 83% of individuals, followed by CMP22 (5%). The genetic composition of the Gorgona foraging population primarily comprised haplotypes that have been found at eastern Pacific rookeries including Mexico and the Galapagos, as well as haplotypes of unknown stock origin that likely originated from more distant western Pacific rookeries. Mixed stock analysis suggests that the Gorgona FG population is comprised mostly of animals from the Galapagos rookery (80%). Lagrangian drifter data showed that movement of turtles along the eastern Pacific coast and eastward from distant western and central Pacific sites was possible through passive drift. Our results highlight the importance of this protected area for conservation management of green turtles recruited from distant sites along the eastern Pacific Ocean.

  3. Multiple Distant Origins for Green Sea Turtles Aggregating off Gorgona Island in the Colombian Eastern Pacific

    PubMed Central

    Amorocho, Diego F.; Abreu-Grobois, F. Alberto; Dutton, Peter H.; Reina, Richard D.

    2012-01-01

    Mitochondrial DNA analyses have been useful for resolving maternal lineages and migratory behavior to foraging grounds (FG) in sea turtles. However, little is known about source rookeries and haplotype composition of foraging green turtle aggregations in the southeastern Pacific. We used mitochondrial DNA control region sequences to identify the haplotype composition of 55 green turtles, Chelonia mydas, captured in foraging grounds of Gorgona National Park in the Colombian Pacific. Amplified fragments of the control region (457 bp) revealed the presence of seven haplotypes, with haplotype (h) and nucleotide (π) diversities of h = 0.300±0.080 and π = 0.009±0.005 respectively. The most common haplotype was CMP4 observed in 83% of individuals, followed by CMP22 (5%). The genetic composition of the Gorgona foraging population primarily comprised haplotypes that have been found at eastern Pacific rookeries including Mexico and the Galapagos, as well as haplotypes of unknown stock origin that likely originated from more distant western Pacific rookeries. Mixed stock analysis suggests that the Gorgona FG population is comprised mostly of animals from the Galapagos rookery (80%). Lagrangian drifter data showed that movement of turtles along the eastern Pacific coast and eastward from distant western and central Pacific sites was possible through passive drift. Our results highlight the importance of this protected area for conservation management of green turtles recruited from distant sites along the eastern Pacific Ocean. PMID:22319635

  4. Missing data imputation and haplotype phase inference for genome-wide association studies

    PubMed Central

    Browning, Sharon R.

    2009-01-01

    Imputation of missing data and the use of haplotype-based association tests can improve the power of genome-wide association studies (GWAS). In this article, I review methods for haplotype inference and missing data imputation, and discuss their application to GWAS. I discuss common features of the best algorithms for haplotype phase inference and missing data imputation in large-scale data sets, as well as some important differences between classes of methods, and highlight the methods that provide the highest accuracy and fastest computational performance. PMID:18850115

  5. Association between endothelin type A receptor haplotypes and mortality in coronary heart disease.

    PubMed

    Ellis, Katrina L; Pilbrow, Anna P; Potter, Howard C; Frampton, Chris M; Doughty, Rob N; Whalley, Gillian A; Ellis, Chris J; Palmer, Barry R; Skelton, Lorraine; Yandle, Tim G; Troughton, Richard W; Richards, A Mark; A Cameron, Vicky

    2012-05-01

    The endothelin type A receptor, encoded by EDNRA, mediates the effects of endothelin-1 to promote vasoconstriction, vascular cell growth, adhesion, fibrosis and thrombosis. We investigated the association between EDNRA haplotype and cardiovascular outcomes in patients with coronary artery disease. Coronary disease patients (n = 1007) were genotyped for the His323His (rs5333) variant and one tag SNP from each of the major EDNRA haplotype blocks (rs6537484, rs1568136, rs5335 and rs10003447). EDNRA haplotype associations with clinical history, natriuretic peptides cardiac function and cardiovascular outcomes were tested over a median 3.8 years. Univariate analysis identified a 'low-risk' EDNRA haplotype associated with later age of Type 2 diabetes onset (p = 0.004) smaller BMI (p = 0.021), and reduced mortality (log rank p = 0.001). Cox proportional hazards analysis including established cardiovascular risk factors revealed an independent association between haplotype and mortality (p < 0.0001). These data highlight the potential importance of the endothelin system, and in particular EDNRA in coronary disease.

  6. Better ILP models for haplotype assembly.

    PubMed

    Etemadi, Maryam; Bagherian, Mehri; Chen, Zhi-Zhong; Wang, Lusheng

    2018-02-19

    The haplotype assembly problem for diploid is to find a pair of haplotypes from a given set of aligned Single Nucleotide Polymorphism (SNP) fragments (reads). It has many applications in association studies, drug design, and genetic research. Since this problem is computationally hard, both heuristic and exact algorithms have been designed for it. Although exact algorithms are much slower, they are still of great interest because they usually output significantly better solutions than heuristic algorithms in terms of popular measures such as the Minimum Error Correction (MEC) score, the number of switch errors, and the QAN50 score. Exact algorithms are also valuable because they can be used to witness how good a heuristic algorithm is. The best known exact algorithm is based on integer linear programming (ILP) and it is known that ILP can also be used to improve the output quality of every heuristic algorithm with a little decline in speed. Therefore, faster ILP models for the problem are highly demanded. As in previous studies, we consider not only the general case of the problem but also its all-heterozygous case where we assume that if a column of the input read matrix contains at least one 0 and one 1, then it corresponds to a heterozygous SNP site. For both cases, we design new ILP models for the haplotype assembly problem which aim at minimizing the MEC score. The new models are theoretically better because they contain significantly fewer constraints. More importantly, our experimental results show that for both simulated and real datasets, the new model for the all-heterozygous (respectively, general) case can usually be solved via CPLEX (an ILP solver) at least 5 times (respectively, twice) faster than the previous bests. Indeed, the running time can sometimes be 41 times better. This paper proposes a new ILP model for the haplotype assembly problem and its all-heterozygous case, respectively. Experiments with both real and simulated datasets show that the

  7. Application of the multiple PRF technique to resolve Doppler centroid estimation ambiguity for spaceborne SAR

    NASA Technical Reports Server (NTRS)

    Chang, C. Y.; Curlander, J. C.

    1992-01-01

    Estimation of the Doppler centroid ambiguity is a necessary element of the signal processing for SAR systems with large antenna pointing errors. Without proper resolution of the Doppler centroid estimation (DCE) ambiguity, the image quality will be degraded in the system impulse response function and the geometric fidelity. Two techniques for resolution of DCE ambiguity for the spaceborne SAR are presented; they include a brief review of the range cross-correlation technique and presentation of a new technique using multiple pulse repetition frequencies (PRFs). For SAR systems, where other performance factors control selection of the PRF's, an algorithm is devised to resolve the ambiguity that uses PRF's of arbitrary numerical values. The performance of this multiple PRF technique is analyzed based on a statistical error model. An example is presented that demonstrates for the Shuttle Imaging Radar-C (SIR-C) C-band SAR, the probability of correct ambiguity resolution is higher than 95 percent for antenna attitude errors as large as 3 deg.

  8. Molecular pathology and haplotype analysis of Wilson disease in Mediterranean populations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Figus, A.; Farcia, A.M.G.; Nurchi, A.

    1995-12-01

    We analyzed mutations and defined the chromosomal haplotype in 127 patients of Mediterranean descent who were affected in Wilson disease (WD): 39 Sardinians, 49 Italians, 33 Turks, and 6 Albanians. Haplotypes were derived by use of the microsatellite markers D13S301, D13S296, D13S297, and D13S298, which are linked to the WD locus. There were five common haplotypes in Sardinians, three in Italians, and two in Turks, which accounted for 85%, 32%, and 30% of the WD chromosomes, respectively. We identified 16 novel mutations: 8 frameshifts, 7 missense mutations, and 1 splicing defect. In addition, we detected the previously described mutations: 2302insC,more » 3404delC, Arg1320ter, Gly944Ser, and His1070Gin. Of the new mutations detected, two, the 1515insT on haplotype I and 2464delC on haplotype XVI, accounted for 6% and 13%, respectively, of the mutations in WD chromsomes in the Sardinian populations. Mutations H1070Q, 2302insC, and 2533delA represented 13%, 8%, and 8%, respectively, of the mutations in WD chromsomes in other Mediterranean populations. The remaining mutations were rare and limited to one or two patients from different populations. Thus, WD results from some frequent mutations and many rare defects. 28 refs., 1 fig., 3 tabs.« less

  9. Haplotype analysis of the apolipoprotein gene cluster on human chromosome 11

    PubMed Central

    Olivier, Michael; Wang, Xujing; Cole, Regina; Gau, Brian; Kim, Jessica; Rubin, Edward M.; Pennacchio, Len A.

    2009-01-01

    Members of the apolipoprotein gene cluster (APOA1/C3/A4/A5) on human chromosome 11q23 play an important role in lipid metabolism. Polymorphisms in both APOA5 and APOC3 are strongly associated with plasma triglyceride concentrations. The close genomic locations of these two genes as well as their functional similarity have hindered efforts to define whether each gene independently influences human triglyceride concentrations. In this study, we examined the linkage disequilibrium and haplotype structure of 49 SNPs in a 150-kb region spanning the gene cluster. We identified a total of five common APOA5 haplotypes with a frequency of greater than 8% in samples of northern European origin. The APOA5 haplotype block did not extend past the 7 SNPs in the gene and was separated from the other apolipoprotein gene in the cluster by a region of significantly increased recombination. Furthermore, one previously identified triglyceride risk haplotype of APOA5 (APOA5*3) showed no association with three APOC3 SNPs previously associated with triglyceride concentrations, in contrast to the other risk haplotype (APOA5*2), which was associated with all three minor APOC3 SNP alleles. These results highlight the complex genetic relationship between APOA5 and APOC3 and support the notion that APOA5 represents an independent risk gene affecting plasma triglyceride concentrations in humans. PMID:15081120

  10. The JAK2 GGCC (46/1) Haplotype in Myeloproliferative Neoplasms: Causal or Random?

    PubMed Central

    Anelli, Luisa; Zagaria, Antonella; Specchia, Giorgina

    2018-01-01

    The germline JAK2 haplotype known as “GGCC or 46/1 haplotype” (haplotypeGGCC_46/1) consists of a combination of single nucleotide polymorphisms (SNPs) mapping in a region of about 250 kb, extending from the JAK2 intron 10 to the Insulin-like 4 (INLS4) gene. Four main SNPs (rs3780367, rs10974944, rs12343867, and rs1159782) generating a “GGCC” combination are more frequently indicated to represent the JAK2 haplotype. These SNPs are inherited together and are frequently associated with the onset of myeloproliferative neoplasms (MPN) positive for both JAK2 V617 and exon 12 mutations. The association between the JAK2 haplotypeGGCC_46/1 and mutations in other genes, such as thrombopoietin receptor (MPL) and calreticulin (CALR), or the association with triple negative MPN, is still controversial. This review provides an overview of the frequency and the role of the JAK2 haplotypeGGCC_46/1 in the pathogenesis of different myeloid neoplasms and describes the hypothetical mechanisms at the basis of the association with JAK2 gene mutations. Moreover, possible clinical implications are discussed, as different papers reported contrasting data about the correlation between the JAK2 haplotypeGGCC_46/1 and blood cell count, survival, or disease progression. PMID:29641446

  11. Mendel-GPU: haplotyping and genotype imputation on graphics processing units

    PubMed Central

    Chen, Gary K.; Wang, Kai; Stram, Alex H.; Sobel, Eric M.; Lange, Kenneth

    2012-01-01

    Motivation: In modern sequencing studies, one can improve the confidence of genotype calls by phasing haplotypes using information from an external reference panel of fully typed unrelated individuals. However, the computational demands are so high that they prohibit researchers with limited computational resources from haplotyping large-scale sequence data. Results: Our graphics processing unit based software delivers haplotyping and imputation accuracies comparable to competing programs at a fraction of the computational cost and peak memory demand. Availability: Mendel-GPU, our OpenCL software, runs on Linux platforms and is portable across AMD and nVidia GPUs. Users can download both code and documentation at http://code.google.com/p/mendel-gpu/. Contact: gary.k.chen@usc.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22954633

  12. Haplotype Analysis Discriminates Genetic Risk for DR3-Associated Endocrine Autoimmunity and Helps Define Extreme Risk for Addison’s Disease

    PubMed Central

    Baker, Peter R.; Baschal, Erin E.; Fain, Pam R.; Triolo, Taylor M.; Nanduri, Priyaanka; Siebert, Janet C.; Armstrong, Taylor K.; Babu, Sunanda R.; Rewers, Marian J.; Gottlieb, Peter A.; Barker, Jennifer M.; Eisenbarth, George S.

    2010-01-01

    Context: Multiple autoimmune disorders (e.g. Addison’s disease, type 1 diabetes, celiac disease) are associated with HLA-DR3, but it is likely that alleles of additional genes in linkage disequilibrium with HLA-DRB1 contribute to disease. Objective: The objective of the study was to characterize major histocompatability complex (MHC) haplotypes conferring extreme risk for autoimmune Addison’s disease (AD). Design, Setting, and Participants: Eighty-six 21-hydroxylase autoantibody-positive, nonautoimmune polyendocrine syndrome type 1, Caucasian individuals collected from 1992 to 2009 with clinical AD from 68 families (12 multiplex and 56 simplex) were genotyped for HLA-DRB1, HLA-DQB1, MICA, HLA-B, and HLA-A as well as high density MHC single-nucleotide polymorphism (SNP) analysis for 34. Main Outcome Measures: AD and genotype were measured. Result: Ninety-seven percent of the multiplex individuals had both HLA-DR3 and HLA-B8 vs. 60% of simplex AD patients (P = 9.72 × 10−4) and 13% of general population controls (P = 3.00 × 10−19). The genotype DR3/DR4 with B8 was present in 85% of AD multiplex patients, 24% of simplex patients, and 1.5% of control individuals (P = 4.92 × 10−191). The DR3-B8 haplotype of AD patients had HLA-A1 less often (47%) than controls (81%, P = 7.00 × 10−5) and type 1 diabetes patients (73%, P = 1.93 × 10−3). Analysis of 1228 SNPs across the MHC for individuals with AD revealed a shorter conserved haplotype (3.8) with the loss of the extended conserved 3.8.1 haplotype approximately halfway between HLA-B and HLA-A. Conclusion: Extreme risk for AD, especially in multiplex families, is associated with haplotypic DR3 variants, in particular a portion (3.8) but not all of the conserved 3.8.1 haplotype. PMID:20631027

  13. Inference of Population Structure using Dense Haplotype Data

    PubMed Central

    Lawson, Daniel John; Hellenthal, Garrett

    2012-01-01

    The advent of genome-wide dense variation data provides an opportunity to investigate ancestry in unprecedented detail, but presents new statistical challenges. We propose a novel inference framework that aims to efficiently capture information on population structure provided by patterns of haplotype similarity. Each individual in a sample is considered in turn as a recipient, whose chromosomes are reconstructed using chunks of DNA donated by the other individuals. Results of this “chromosome painting” can be summarized as a “coancestry matrix,” which directly reveals key information about ancestral relationships among individuals. If markers are viewed as independent, we show that this matrix almost completely captures the information used by both standard Principal Components Analysis (PCA) and model-based approaches such as STRUCTURE in a unified manner. Furthermore, when markers are in linkage disequilibrium, the matrix combines information across successive markers to increase the ability to discern fine-scale population structure using PCA. In parallel, we have developed an efficient model-based approach to identify discrete populations using this matrix, which offers advantages over PCA in terms of interpretability and over existing clustering algorithms in terms of speed, number of separable populations, and sensitivity to subtle population structure. We analyse Human Genome Diversity Panel data for 938 individuals and 641,000 markers, and we identify 226 populations reflecting differences on continental, regional, local, and family scales. We present multiple lines of evidence that, while many methods capture similar information among strongly differentiated groups, more subtle population structure in human populations is consistently present at a much finer level than currently available geographic labels and is only captured by the haplotype-based approach. The software used for this article, ChromoPainter and fineSTRUCTURE, is available from

  14. Two independent apolipoprotein A5 haplotypes influence human plasma triglyceride levels.

    PubMed

    Pennacchio, Len A; Olivier, Michael; Hubacek, Jaroslav A; Krauss, Ronald M; Rubin, Edward M; Cohen, Jonathan C

    2002-11-15

    The recently identified apolipoprotein A5 gene (APOA5) has been shown to play an important role in determining plasma triglyceride concentrations in humans and mice. We previously identified an APOA5 haplotype (designated APOA5*2) that is present in approximately 16% of Caucasians and is associated with increased plasma triglyceride concentrations. In this report we describe another APOA5 haplotype (APOA5*3) containing the rare allele of the single nucleotide polymorphism c.56C>G that changes serine to tryptophan at codon 19 and is independently associated with high plasma triglyceride levels in three different populations. In a sample of 264 Caucasian men and women with plasma triglyceride concentrations above the 90th percentile or below the 10th percentile, the APOA5*3 haplotype was more than three-fold more common in the group with high plasma triglyceride levels. In a second independently ascertained sample of Caucasian men and women (n=419) who were studied while consuming their self-selected diets as well as after high-carbohydrate diets and high-fat diets, the APOA5*3 haplotype was associated with increased plasma triglyceride levels on all three dietary regimens. In a third population comprising 2660 randomly selected individuals, the APOA5*3 haplotype was found in 12% of Caucasians, 14% of African-Americans and 28% of Hispanics and was associated with increased plasma triglyceride levels in both men and women in each ethnic group. These findings establish that the APOA5 locus contributes significantly to inter-individual variation in plasma triglyceride levels in humans. Together, the APOA5*2 and APOA5*3 haplotypes are found in 25-50% of African-Americans, Hispanics and Caucasians and support the contribution of common human variation to quantitative phenotypes in the general population.

  15. Two independent apolipoprotein a5 Haplotypes influence human plasma triglyceride levels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pennacchio, Len A.; Olivier, Michael; Hubacek, Jaroslav A.

    2002-09-16

    The recently identified apolipoprotein A5 gene (APOA5) has been shown to play an important role in determining plasma triglyceride concentrations in humans and mice. We previously identified an APOA5 haplotype (designated APOA5*2) that is present in {approx}16 percent of Caucasians and is associated with increased plasma triglyceride concentrations. In this report we describe another APOA5 haplotype (APOA5*3) containing the rare allele of the single nucleotide polymorphism c.56C>G that changes serine to tryptophan at codon 19 and is independently associated with high plasma triglyceride levels in three different populations. In a sample of 264 Caucasian men and women with plasma triglyceridemore » concentrations above the 90th percentile or below the 10th percentile, the APOA5*3 haplotype was more than three-fold more common in the group with high plasma triglyceride levels. In a second independently ascertained sample of Caucasian men and women (n 1/4 419) who were studied while consuming their self-selected diets as well as after high-carbohydrate diets and high-fat diets, the APOA5*3 haplotype was associated with increased plasma triglyceride levels on all three dietary regimens. In a third population comprising 2660 randomly selected individuals, the APOA5*3 haplotype was found in 12 percent of Caucasians, 14 percent of African-Americans and 28 percent of Hispanics and was associated with increased plasma triglyceride levels in both men and women in each ethnic group. These findings establish that the APOA5 locus contributes significantly to inter-individual variation in plasma triglyceride levels in humans. Together, the APOA5*2 and APOA5*3 haplotypes are found in 25 50 percent of African-Americans, Hispanics and Caucasians and support the contribution of common human variation to quantitative phenotypes in the general population.« less

  16. Hypercontrols in genotype-phenotype analysis reveal ancestral haplotypes associated with essential hypertension.

    PubMed

    Balam-Ortiz, Eros; Esquivel-Villarreal, Adolfo; Huerta-Hernandez, David; Fernandez-Lopez, Juan Carlos; Alfaro-Ruiz, Luis; Muñoz-Monroy, Omar; Gutierrez, Ruth; Figueroa-Genis, Enrique; Carrillo, Karol; Elizalde, Adela; Hidalgo, Alfredo; Rodriguez, Mauricio; Urushihara, Maki; Kobori, Hiroyuki; Jimenez-Sanchez, Gerardo

    2012-04-01

    The angiotensinogen gene locus has been associated with essential hypertension in most populations analyzed to date. Increased plasma angiotensinogen levels have been proposed as an underlying cause of essential hypertension in whites; however, differences in the genetic regulation of plasma angiotensinogen levels have also been reported for other populations. The aim of this study was to analyze the relationship between angiotensinogen gene polymorphisms and haplotypes with plasma angiotensinogen levels and the risk of essential hypertension in the Mexican population. We genotyped 9 angiotensinogen gene polymorphisms in 706 individuals. Four polymorphisms, A-6, C4072, C6309, and G12775, were associated with increased risk, and the strongest association was found for the C6309 allele (χ(2)=23.9; P=0.0000009), which resulted in an odds ratio of 3.0 (95% CI: 1.8-4.9; P=0.000006) in the recessive model. Two polymorphisms, A-20C (P=0.003) and C3389T (P=0.0001), were associated with increased plasma angiotensinogen levels but did not show association with essential hypertension. The haplotypes H1 (χ(2)=8.1; P=0.004) and H5 (χ(2)=5.1; P=0.02) were associated with essential hypertension. Using phylogenetic analysis, we found that haplotypes 1 and 5 are the human ancestral haplotypes. Our results suggest that the positive association between angiotensinogen gene polymorphisms and haplotypes with essential hypertension is not simply explained by an increase in plasma angiotensinogen concentration. Complex interactions between risk alleles suggest that these haplotypes act as "superalleles."

  17. Hypercontrols in Genotype-Phenotype Analysis Reveal Ancestral Haplotypes Associated With Essential Hypertension

    PubMed Central

    Balam-Ortiz, Eros; Esquivel-Villarreal, Adolfo; Huerta-Hernandez, David; Fernandez-Lopez, Juan Carlos; Alfaro-Ruiz, Luis; Muñoz-Monroy, Omar; Gutierrez, Ruth; Figueroa-Genis, Enrique; Carrillo, Karol; Elizalde, Adela; Hidalgo, Alfredo; Rodriguez, Mauricio; Urushihara, Maki; Kobori, Hiroyuki; Jimenez-Sanchez, Gerardo

    2012-01-01

    The angiotensinogen gene locus has been associated with essential hypertension in most populations analyzed to date. Increased plasma angiotensinogen levels have been proposed as an underlying cause of essential hypertension in whites; however, differences in the genetic regulation of plasma angiotensinogen levels have also been reported for other populations. The aim of this study was to analyze the relationship between angiotensinogen gene polymorphisms and haplotypes with plasma angiotensinogen levels and the risk of essential hypertension in the Mexican population. We genotyped 9 angiotensinogen gene polymorphisms in 706 individuals. Four polymorphisms, A-6, C4072, C6309, and G12775, were associated with increased risk, and the strongest association was found for the C6309 allele (χ2 = 23.9; P = 0.0000009), which resulted in an odds ratio of 3.0 (95% CI: 1.8–4.9; P = 0.000006) in the recessive model. Two polymorphisms, A-20C (P = 0.003) and C3389T (P = 0.0001), were associated with increased plasma angiotensinogen levels but did not show association with essential hypertension. The haplotypes H1 (χ2 = 8.1; P = 0.004) and H5 (χ2 = 5.1; P = 0.02) were associated with essential hypertension. Using phylogenetic analysis, we found that haplotypes 1 and 5 are the human ancestral haplotypes. Our results suggest that the positive association between angiotensinogen gene polymorphisms and haplotypes with essential hypertension is not simply explained by an increase in plasma angiotensinogen concentration. Complex interactions between risk alleles suggest that these haplotypes act as “superalleles.” PMID:22371359

  18. The HLA-DRB9 gene and the origin of HLA-DR haplotypes.

    PubMed

    Gongora, R; Figueroa, F; Klein, J

    1996-11-01

    HLA-DRB9 is a gene fragment consisting of exon 2 and flanking intron sequences. It is located at the extreme end of the DRB subregion, whose other end is demarcated by the DRB1 locus. We sequenced approximately 1400 base pairs of the segment encompassing the DRB9 locus from eight human haplotypes (DR1, DR10, DR2, DR3, DR5, DR6, DR8, and DR9, the DR4 and DR7 having been sequenced by others earlier), as well as two chimpanzee, five gorillas, one orangutan and one macaque haplotype. The analysis of these sequences indicates that the DRB9 locus, which we estimate to be more than 58 million years (my) old, has been coevolving with the DRB1 locus for the last 4.2 my. As a consequence of this coevolution, the human DRB9 alleles fall into groups that correlate with the DRB1 allelic groups and with the gene organization of the human haplotypes. This observation implies that the present-day HLA-DR haplotype groups (DR1, DR51, DR52, DR8, and DR53) were founded more than 4 my ago and have remained intact (barring minor internal rearrangements that did not recombine the DRB1 and DRB9 genes) for this period of time. The haplotypes have been transmitted during speciations from ancestral to emerging species just like allelic lineages at the DRB1 locus. Thus not only allelic but also haplotype polymorphism evolves trans-specifically.

  19. β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil.

    PubMed

    Dos Santos Silva, Wellington; de Nazaré Klautau-Guimarães, Maria; Grisolia, Cesar Koppe

    2010-07-01

    Five restriction site polymorphisms in the β-globin gene cluster (HincII-5' ε, HindIII-(G) γ, HindIII-(A) γ, HincII- ψβ1 and HincII-3' ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the β(A) chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.

  20. β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil

    PubMed Central

    2010-01-01

    Five restriction site polymorphisms in the β-globin gene cluster (HincII-5‘ ε, HindIII-G γ, HindIII-A γ, HincII- ψβ1 and HincII-3‘ ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the “quilombo community”, from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the βA chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil. PMID:21637405

  1. Cluster analysis of European Y-chromosomal STR haplotypes using the discrete Laplace method.

    PubMed

    Andersen, Mikkel Meyer; Eriksen, Poul Svante; Morling, Niels

    2014-07-01

    The European Y-chromosomal short tandem repeat (STR) haplotype distribution has previously been analysed in various ways. Here, we introduce a new way of analysing population substructure using a new method based on clustering within the discrete Laplace exponential family that models the probability distribution of the Y-STR haplotypes. Creating a consistent statistical model of the haplotypes enables us to perform a wide range of analyses. Previously, haplotype frequency estimation using the discrete Laplace method has been validated. In this paper we investigate how the discrete Laplace method can be used for cluster analysis to further validate the discrete Laplace method. A very important practical fact is that the calculations can be performed on a normal computer. We identified two sub-clusters of the Eastern and Western European Y-STR haplotypes similar to results of previous studies. We also compared pairwise distances (between geographically separated samples) with those obtained using the AMOVA method and found good agreement. Further analyses that are impossible with AMOVA were made using the discrete Laplace method: analysis of the homogeneity in two different ways and calculating marginal STR distributions. We found that the Y-STR haplotypes from e.g. Finland were relatively homogeneous as opposed to the relatively heterogeneous Y-STR haplotypes from e.g. Lublin, Eastern Poland and Berlin, Germany. We demonstrated that the observed distributions of alleles at each locus were similar to the expected ones. We also compared pairwise distances between geographically separated samples from Africa with those obtained using the AMOVA method and found good agreement. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  2. Three Novel Haplotypes of Theileria bicornis in Black and White Rhinoceros in Kenya.

    PubMed

    Otiende, M Y; Kivata, M W; Jowers, M J; Makumi, J N; Runo, S; Obanda, V; Gakuya, F; Mutinda, M; Kariuki, L; Alasaad, S

    2016-02-01

    Piroplasms, especially those in the genera Babesia and Theileria, have been found to naturally infect rhinoceros. Due to natural or human-induced stress factors such as capture and translocations, animals often develop fatal clinical piroplasmosis, which causes death if not treated. This study examines the genetic diversity and occurrence of novel Theileria species infecting both black and white rhinoceros in Kenya. Samples collected opportunistically during routine translocations and clinical interventions from 15 rhinoceros were analysed by polymerase chain reaction (PCR) using a nested amplification of the small subunit ribosomal RNA (18S rRNA) gene fragments of Babesia and Theileria. Our study revealed for the first time in Kenya the presence of Theileria bicornis in white (Ceratotherium simum simum) and black (Diceros bicornis michaeli) rhinoceros and the existence of three new haplotypes: haplotypes H1 and H3 were present in white rhinoceros, while H2 was present in black rhinoceros. No specific haplotype was correlated to any specific geographical location. The Bayesian inference 50% consensus phylogram recovered the three haplotypes monophyleticly, and Theileria bicornis had very high support (BPP: 0.98). Furthermore, the genetic p-uncorrected distances and substitutions between T. bicornis and the three haplotypes were the same in all three haplotypes, indicating a very close genetic affinity. This is the first report of the occurrence of Theileria species in white and black rhinoceros from Kenya. The three new haplotypes reported here for the first time have important ecological and conservational implications, especially for population management and translocation programs and as a means of avoiding the transport of infected animals into non-affected areas. © 2014 Blackwell Verlag GmbH.

  3. Intricacies in arrangement of SNP haplotypes suggest "Great Admixture" that created modern humans.

    PubMed

    Dutta, Rajib; Mainsah, Joseph; Yatskiv, Yuriy; Chakrabortty, Sharmistha; Brennan, Patrick; Khuder, Basil; Qiu, Shuhao; Fedorova, Larisa; Fedorov, Alexei

    2017-06-05

    Inferring history from genomic sequences is challenging and problematic because chromosomes are mosaics of thousands of small Identicalby-descent (IBD) fragments, each of them having their own unique story. However, the main events in recent evolution might be deciphered from comparative analysis of numerous loci. A paradox of why humans, whose effective population size is only 10 4 , have nearly three million frequent SNPs is formulated and examined. We studied 5398 loci evenly covering all human autosomes. Common haplotypes built from frequent SNPs that are present in people from various populations have been examined. We demonstrated highly non-random arrangement of alleles in common haplotypes. Abundance of mutually exclusive pairs of common haplotypes that have different alleles at every polymorphic position (so-called Yin/Yang haplotypes) was found in 56% of loci. A novel widely spread category of common haplotypes named Mosaic has been described. Mosaic consists of numerous pieces of Yin/Yang haplotypes and represents an ancestral stage of one of them. Scenarios of possible appearance of large number of frequent human SNPs and their habitual arrangement in Yin/Yang common haplotypes have been evaluated with an advanced genomic simulation algorithm. Computer modeling demonstrated that the observed arrangement of 2.9 million frequent SNPs could not originate from a sole stand-alone population. A "Great Admixture" event has been proposed that can explain peculiarities with frequent SNP distributions. This Great Admixture presumably occurred 100-300 thousand years ago between two ancestral populations that had been separated from each other about a million years ago. Our programs and algorithms can be applied to other species to perform evolutionary and comparative genomics.

  4. Effects of apolipoprotein A5 haplotypes on the ratio of triglyceride to high-density lipoprotein cholesterol and the risk for metabolic syndrome in Koreans.

    PubMed

    Cha, Seongwon; Yu, Hyunjoo; Park, Ah Yeon; Song, Kwang Hoon

    2014-03-12

    Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C-G-A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS.

  5. FamLBL: detecting rare haplotype disease association based on common SNPs using case-parent triads.

    PubMed

    Wang, Meng; Lin, Shili

    2014-09-15

    In recent years, there has been an increasing interest in using common single-nucleotide polymorphisms (SNPs) amassed in genome-wide association studies to investigate rare haplotype effects on complex diseases. Evidence has suggested that rare haplotypes may tag rare causal single-nucleotide variants, making SNP-based rare haplotype analysis not only cost effective, but also more valuable for detecting causal variants. Although a number of methods for detecting rare haplotype association have been proposed in recent years, they are population based and thus susceptible to population stratification. We propose family-triad-based logistic Bayesian Lasso (famLBL) for estimating effects of haplotypes on complex diseases using SNP data. By choosing appropriate prior distribution, effect sizes of unassociated haplotypes can be shrunk toward zero, allowing for more precise estimation of associated haplotypes, especially those that are rare, thereby achieving greater detection power. We evaluate famLBL using simulation to gauge its type I error and power. Compared with its population counterpart, LBL, highlights famLBL's robustness property in the presence of population substructure. Further investigation by comparing famLBL with Family-Based Association Test (FBAT) reveals its advantage for detecting rare haplotype association. famLBL is implemented as an R-package available at http://www.stat.osu.edu/∼statgen/SOFTWARE/LBL/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. A comprehensive literature review of haplotyping software and methods for use with unrelated individuals.

    PubMed

    Salem, Rany M; Wessel, Jennifer; Schork, Nicholas J

    2005-03-01

    Interest in the assignment and frequency analysis of haplotypes in samples of unrelated individuals has increased immeasurably as a result of the emphasis placed on haplotype analyses by, for example, the International HapMap Project and related initiatives. Although there are many available computer programs for haplotype analysis applicable to samples of unrelated individuals, many of these programs have limitations and/or very specific uses. In this paper, the key features of available haplotype analysis software for use with unrelated individuals, as well as pooled DNA samples from unrelated individuals, are summarised. Programs for haplotype analysis were identified through keyword searches on PUBMED and various internet search engines, a review of citations from retrieved papers and personal communications, up to June 2004. Priority was given to functioning computer programs, rather than theoretical models and methods. The available software was considered in light of a number of factors: the algorithm(s) used, algorithm accuracy, assumptions, the accommodation of genotyping error, implementation of hypothesis testing, handling of missing data, software characteristics and web-based implementations. Review papers comparing specific methods and programs are also summarised. Forty-six haplotyping programs were identified and reviewed. The programs were divided into two groups: those designed for individual genotype data (a total of 43 programs) and those designed for use with pooled DNA samples (a total of three programs). The accuracy of programs using various criteria are assessed and the programs are categorised and discussed in light of: algorithm and method, accuracy, assumptions, genotyping error, hypothesis testing, missing data, software characteristics and web implementation. Many available programs have limitations (eg some cannot accommodate missing data) and/or are designed with specific tasks in mind (eg estimating haplotype frequencies rather than

  7. Association of chemokine receptor gene (CCR2-CCR5) haplotypes with acquisition and control of HIV-1 infection in Zambians

    PubMed Central

    2011-01-01

    Background Polymorphisms in chemokine (C-C motif) receptors 2 and 5 genes (CCR2 and CCR5) have been associated with HIV-1 infection and disease progression. We investigated the impact of CCR2-CCR5 haplotypes on HIV-1 viral load (VL) and heterosexual transmission in an African cohort. Between 1995 and 2006, cohabiting Zambian couples discordant for HIV-1 (index seropositive and HIV-1 exposed seronegative {HESN}) were monitored prospectively to determine the role of host genetic factors in HIV-1 control and heterosexual transmission. Genotyping for eight CCR2 and CCR5 variants resolved nine previously recognized haplotypes. By regression and survival analytic techniques, controlling for non-genetic factors, we estimated the effects of these haplotypic variants on a) index partner VL, b) seroconverter VL, c) HIV-1 transmission by index partners, d) HIV-1 acquisition by HESN partners. Results Among 567 couples, 240 virologically linked transmission events had occurred through 2006. HHF*2 homozygosity was associated with significantly lower VL in seroconverters (mean beta = -0.58, log10 P = 0.027) and the HHD/HHE diplotype was associated with significantly higher VL in the seroconverters (mean beta = 0.54, log10 P = 0.014) adjusted for age and gender in multivariable model. HHD/HHE was associated with more rapid acquisition of infection by the HESNs (HR = 2.0, 95% CI = 1.20-3.43, P = 0.008), after adjustments for index partner VL and the presence of genital ulcer or inflammation in either partner in Cox multivariable models. The HHD/HHE effect was stronger in exposed females (HR = 2.1, 95% CI = 1.14-3.95, P = 0.018). Conclusions Among Zambian discordant couples, HIV-1 coreceptor gene haplotypes and diplotypes appear to modulate HIV-1 VL in seroconverters and alter the rate of HIV-1 acquisition by HESNs. These associations replicate or resemble findings reported in other African and European populations. PMID:21429204

  8. DNA analysis of ancient dogs of the Americas: identifying possible founding haplotypes and reconstructing population histories.

    PubMed

    Witt, Kelsey E; Judd, Kathleen; Kitchen, Andrew; Grier, Colin; Kohler, Timothy A; Ortman, Scott G; Kemp, Brian M; Malhi, Ripan S

    2015-02-01

    As dogs have traveled with humans to every continent, they can potentially serve as an excellent proxy when studying human migration history. Past genetic studies into the origins of Native American dogs have used portions of the hypervariable region (HVR) of mitochondrial DNA (mtDNA) to indicate that prior to European contact the dogs of Native Americans originated in Eurasia. In this study, we summarize past DNA studies of both humans and dogs to discuss their population histories in the Americas. We then sequenced a portion of the mtDNA HVR of 42 pre-Columbian dogs from three sites located in Illinois, coastal British Columbia, and Colorado, and identify four novel dog mtDNA haplotypes. Next, we analyzed a dataset comprised of all available ancient dog sequences from the Americas to infer the pre-Columbian population history of dogs in the Americas. Interestingly, we found low levels of genetic diversity for some populations consistent with the possibility of deliberate breeding practices. Furthermore, we identified multiple putative founding haplotypes in addition to dog haplotypes that closely resemble those of wolves, suggesting admixture with North American wolves or perhaps a second domestication of canids in the Americas. Notably, initial effective population size estimates suggest at least 1000 female dogs likely existed in the Americas at the time of the first known canid burial, and that population size increased gradually over time before stabilizing roughly 1200 years before present. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Characterization of swine leukocyte antigen alleles and haplotypes on a novel miniature pig line, Microminipig.

    PubMed

    Ando, A; Imaeda, N; Ohshima, S; Miyamoto, A; Kaneko, N; Takasu, M; Shiina, T; Kulski, J K; Inoko, H; Kitagawa, H

    2014-12-01

    Microminipigs are extremely small-sized, novel miniature pigs that were recently developed for medical research. The inbred Microminipigs with defined swine leukocyte antigen (SLA) haplotypes are expected to be useful for allo- and xenotransplantation studies and also for association analyses between SLA haplotypes and immunological traits. To establish SLA-defined Microminipig lines, we characterized the polymorphic SLA alleles for three class I (SLA-1, SLA-2 and SLA-3) and two class II (SLA-DRB1 and SLA-DQB1) genes of 14 parental Microminipigs using a high-resolution nucleotide sequence-based typing method. Eleven class I and II haplotypes, including three recombinant haplotypes, were found in the offspring of the parental Microminipigs. Two class I and class II haplotypes, Hp-31.0 (SLA-1*1502-SLA-3*070102-SLA-2*1601) and Hp-0.37 (SLA-DRB1*0701-SLA-DQB1*0502), are novel and have not so far been reported in other pig breeds. Crossover regions were defined by the analysis of 22 microsatellite markers within the SLA class III region of three recombinant haplotypes. The SLA allele and haplotype information of Microminipigs in this study will be useful to establish SLA homozygous lines including three recombinants for transplantation and immunological studies. © 2014 Stichting International Foundation for Animal Genetics.

  10. SNPs and Haplotypes in Native American Populations

    PubMed Central

    Kidd, Judith R.; Friedlaender, Françoise; Pakstis, Andrew J.; Furtado, Manohar; Fang, Rixun; Wang, Xudong; Nievergelt, Caroline M.; Kidd, Kenneth K.

    2013-01-01

    Autosomal DNA polymorphisms can provide new information and understanding of both the origins of and relationships among modern Native American populations. At the same time that autosomal markers can be highly informative, they are also susceptible to ascertainment biases in the selection of the markers to use. Identifying markers that can be used for ancestry inference among Native American populations can be considered separate from identifying markers to further the quest for history. In the current study we are using data on nine Native American populations to compare the results based on a large haplotype-based dataset with relatively small independent sets of SNPs. We are interested in what types of limited datasets an individual laboratory might be able to collect are best for addressing two different questions of interest. First, how well can we differentiate the Native American populations and/or infer ancestry by assigning an individual to her population(s) of origin? Second, how well can we infer the historical/evolutionary relationships among Native American populations and their Eurasian origins. We conclude that only a large comprehensive dataset involving multiple autosomal markers on multiple populations will be able to answer both questions; different small sets of markers are able to answer only one or the other of these questions. Using our largest dataset we see a general increasing distance from Old World populations from North to South in the New World except for an unexplained close relationship between our Maya and Quechua samples. PMID:21913176

  11. Global selection on sucrose synthase haplotypes during a century of wheat breeding.

    PubMed

    Hou, Jian; Jiang, Qiyan; Hao, Chenyang; Wang, Yuquan; Zhang, Hongna; Zhang, Xueyong

    2014-04-01

    Spike number per unit area, number of grains per spike, and thousand kernel weight (TKW) are important yield components. In China, increases in wheat (Triticum aestivum) yields are mainly due to increases in grain number per spike and TKW. TKW mainly depends on starch content, as starch accounts for about 70% of the grain endosperm. Sucrose synthase catalysis is the first step in the conversion of sucrose to starch, that is, the conversion of sucrose to fructose and UDP-glucose by the wheat sucrose synthase genes (TaSus1 and TaSus2) that are located on chromosomes 7A/7B/7D and 2A/2B/2D, respectively. A total of 1,520 wheat accessions were genotyped at the six loci. Two, two, five, and two haplotypes were identified at the TaSus2-2A, TaSus2-2B, TaSus1-7A, and TaSus1-7B loci, respectively. Their main variations were detected within the introns. Significant differences between the haplotypes correlated with TKW differences among 348 modern Chinese cultivars from the core collection. Frequency changes for favored haplotypes showed gradual increases in cultivars released since beginning of the last century in China, Europe, and North America. Geographic distributions and time changes of favored haplotypes were characterized in six major wheat production regions worldwide. Strong selection bottlenecks to haplotype variations occurred at polyploidization and domestication and during breeding of wheat. Genetic-effect differences between haplotypes at the same locus influence the selection time and intensity. This work shows that the endosperm starch synthesis pathway is a major target of indirect selection in global wheat breeding for higher yield.

  12. Aldehyde dehydrogenase-2 genotypes and HLA haplotypes in Japanese patients with esophageal cancer.

    PubMed

    Watanabe, Seishiro; Sasahara, Katsuyuki; Kinekawa, Fumihiko; Uchida, Naohito; Masaki, Tsutomu; Kurokohchi, Kazutaka; Murota, Masayuki; Touge, Tetsuo; Kawauchi, Kazuyoshi; Oda, Syuji; Kuriyama, Shigeki

    2002-01-01

    The aim of this study was to examine how aldehyde dehydrogenase-2 (ALDH2) genotypes and human leukocyte antigen (HLA) haplotypes contribute to the risk for esophageal cancer. We examined ALDH2 genotypes and HLA haplotypes in 29 Japanese patients with esophageal cancer. The ratio of patients who experienced current or former intense vasodilatation upon consuming alcohol (flushing type) was much higher in individuals with the inactive form of ALDH2 encoded by the ALDH2(2)/2(2) or ALDH2(1)/2(2) genotype than in those with the active form of ALDH2 encoded by the ALDH2(1)/2(1) genotype. The ratio of inactive ALDH2 was significantly higher in patients with esophageal cancer than in control normal subjects, suggesting that alcoholics with inactive ALDH2 were susceptible to esophageal cancer. HLA haplotypes A24, A26, B54, B61 and DR9 were prevalent in patients with esophageal cancer (82.8, 24.1, 34.5, 37.9 and 44.8%, respectively). HLA haplotype of A24 and inactive ALDH2 were simultaneously found in 58.6% of patients with esophageal cancer. Furthermore, we found other primary malignancies in 6 of 29 (20.7%) patients with esophageal cancer, and 4 of these 6 patients had both the inactive form of ALDH2 and the HLA A24 haplotype. The present study showed the high prevalence of the inactive form of ALDH2 and HLA haplotypes A24, A26, B54, B61 and DR9 in Japanese patients with esophageal cancer. Therefore, the examination of genotypes of ALDH2 loci and HLA haplotypes may allow the early detection of esophageal cancer in the Japanese population.

  13. Association between β2-adrenoceptor (ADRB2) haplotypes and insulin resistance in PCOS.

    PubMed

    Tellechea, Mariana L; Muzzio, Damián O; Iglesias Molli, Andrea E; Belli, Susana H; Graffigna, Mabel N; Levalle, Oscar A; Frechtel, Gustavo D; Cerrone, Gloria E

    2013-04-01

    The aim of this study was to explore β2-adrenoceptor (ADRB2) haplotype associations with phenotypes and quantitative traits related to insulin resistance (IR) and the metabolic syndrome (MS) in a polycystic ovary syndrome (PCOS) population. A secondary purpose was to assess the association between ADRB2 haplotype and PCOS. Genetic polymorphism analysis. Cross-sectional case-control association study. Medical University Hospital and research laboratory. One hundred and sixty-five unrelated women with PCOS and 116 unrelated women without PCOS (control sample). Clinical and biochemical measurements, and ADRB2 genotyping in PCOS patients and control subjects. ADRB2 haplotypes (comprising rs1042711, rs1801704, rs1042713 and rs1042714 in that order), genotyping and statistical analysis to evaluate associations with continuous variables and traits related to IR and MS in a PCOS population. Associations between ADRB2 haplotypes and PCOS were also assessed. We observed an age-adjusted association between ADRB2 haplotype CCGG and lower insulin (P = 0·018) and HOMA (P = 0·008) in the PCOS sample. Interestingly, the expected differences in surrogate measures of IR between cases and controls were not significant in CCGG/CCGG carriers. In the case-control study, genotype CCGG/CCGG was associated with a 14% decrease in PCOS risk (P = 0·043), taking into account confounding variables. Haplotype I (CCGG) has a protective role for IR and MS in PCOS. © 2012 Blackwell Publishing Ltd.

  14. Inheritance of Hetero-Diploid Pollen S-Haplotype in Self-Compatible Tetraploid Chinese Cherry (Prunus pseudocerasus Lindl)

    PubMed Central

    Gu, Chao; Liu, Qing-Zhong; Yang, Ya-Nan; Zhang, Shu-Jun; Khan, Muhammad Awais; Wu, Jun; Zhang, Shao-Ling

    2013-01-01

    The breakdown of self-incompatibility, which could result from the accumulation of non-functional S-haplotypes or competitive interaction between two different functional S-haplotypes, has been studied extensively at the molecular level in tetraploid Rosaceae species. In this study, two tetraploid Chinese cherry (Prunus pseudocerasus) cultivars and one diploid sweet cherry (Prunus avium) cultivar were used to investigate the ploidy of pollen grains and inheritance of pollen-S alleles. Genetic analysis of the S-genotypes of two intercross-pollinated progenies showed that the pollen grains derived from Chinese cherry cultivars were hetero-diploid, and that the two S-haplotypes were made up of every combination of two of the four possible S-haplotypes. Moreover, the distributions of single S-haplotypes expressed in self- and intercross-pollinated progenies were in disequilibrium. The number of individuals of the two different S-haplotypes was unequal in two self-pollinated and two intercross-pollinated progenies. Notably, the number of individuals containing two different S-haplotypes (S1- and S5-, S5- and S8-, S1- and S4-haplotype) was larger than that of other individuals in the two self-pollinated progenies, indicating that some of these hetero-diploid pollen grains may have the capability to inactivate stylar S-RNase inside the pollen tube and grow better into the ovaries. PMID:23596519

  15. African gene flow to north Brazil as revealed by HBB*S gene haplotype analysis.

    PubMed

    Lemos Cardoso, Greice; Farias Guerreiro, João

    2006-01-01

    Haplotypes linked to the HBB*S gene were analyzed in a sample of 260 chromosomes of Brazilian sickle cell anemia patients from the population of Belém, state of Pará, to evaluate if the present-day haplotype frequencies correlate as well as expected with historical information on the geographic origin of African slaves sent directly to Northern Brazil. The HBB*S gene haplotype distribution (66% Bantu, 21.8% Benin, 10.9% Senegal, and 1.3% Cameroon) is in agreement with those observed for other Brazilian populations regarding the highest proportion of the Bantu type, followed by the Benin type, but it differs significantly concerning the Senegal type as this haplotype is rare or absent in samples from other Brazilian regions already studied. In addition, our results are in accordance with historical records that establish that about 90% of the slaves sent to Northern Brazil were from Angola, Congo, and Mozambique, where the Bantu haplotype predominates, in contrast to 10% of slaves from Senegambia, Guine-Bissau, and Cape Verde, where the Senegal haplotype is the most common. On the other hand, the observed frequency of the Benin haplotype in Belém was much higher than that expected by historical data. This fact corroborates the suggestion that the high prevalence of the Benin type in Belém is due to domestic slave trade and later internal migrations, mainly from the Northeast, since there are no historical records of direct slave trade from Central West Africa to North Brazil. Am. J. Hum. Biol. 18:93-98, 2006. (c) 2005 Wiley-Liss, Inc.

  16. Practical interpretation of CYP2D6 haplotypes: Comparison and integration of automated and expert calling.

    PubMed

    Ruaño, Gualberto; Kocherla, Mohan; Graydon, James S; Holford, Theodore R; Makowski, Gregory S; Goethe, John W

    2016-05-01

    We describe a population genetic approach to compare samples interpreted with expert calling (EC) versus automated calling (AC) for CYP2D6 haplotyping. The analysis represents 4812 haplotype calls based on signal data generated by the Luminex xMap analyzers from 2406 patients referred to a high-complexity molecular diagnostics laboratory for CYP450 testing. DNA was extracted from buccal swabs. We compared the results of expert calls (EC) and automated calls (AC) with regard to haplotype number and frequency. The ratio of EC to AC was 1:3. Haplotype frequencies from EC and AC samples were convergent across haplotypes, and their distribution was not statistically different between the groups. Most duplications required EC, as only expansions with homozygous or hemizygous haplotypes could be automatedly called. High-complexity laboratories can offer equivalent interpretation to automated calling for non-expanded CYP2D6 loci, and superior interpretation for duplications. We have validated scientific expert calling specified by scoring rules as standard operating procedure integrated with an automated calling algorithm. The integration of EC with AC is a practical strategy for CYP2D6 clinical haplotyping. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Long-range barcode labeling-sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Feng; Zhang, Tao; Singh, Kanwar K.

    Methods for sequencing single large DNA molecules by clonal multiple displacement amplification using barcoded primers. Sequences are binned based on barcode sequences and sequenced using a microdroplet-based method for sequencing large polynucleotide templates to enable assembly of haplotype-resolved complex genomes and metagenomes.

  18. BAsE-Seq: a method for obtaining long viral haplotypes from short sequence reads.

    PubMed

    Hong, Lewis Z; Hong, Shuzhen; Wong, Han Teng; Aw, Pauline P K; Cheng, Yan; Wilm, Andreas; de Sessions, Paola F; Lim, Seng Gee; Nagarajan, Niranjan; Hibberd, Martin L; Quake, Stephen R; Burkholder, William F

    2014-01-01

    We present a method for obtaining long haplotypes, of over 3 kb in length, using a short-read sequencer, Barcode-directed Assembly for Extra-long Sequences (BAsE-Seq). BAsE-Seq relies on transposing a template-specific barcode onto random segments of the template molecule and assembling the barcoded short reads into complete haplotypes. We applied BAsE-Seq on mixed clones of hepatitis B virus and accurately identified haplotypes occurring at frequencies greater than or equal to 0.4%, with >99.9% specificity. Applying BAsE-Seq to a clinical sample, we obtained over 9,000 viral haplotypes, which provided an unprecedented view of hepatitis B virus population structure during chronic infection. BAsE-Seq is readily applicable for monitoring quasispecies evolution in viral diseases.

  19. Three potato centromeres are associated with distinct haplotypes with or without megabase-sized satellite repeat arrays.

    PubMed

    Wang, Linsheng; Zeng, Zixian; Zhang, Wenli; Jiang, Jiming

    2014-02-01

    We report discoveries of different haplotypes associated with the centromeres of three potato chromosomes, including haplotypes composed of long arrays of satellite repeats and haplotypes lacking the same repeats. These results are in favor of the hypothesis that satellite repeat-based centromeres may originate from neocentromeres that lack repeats.

  20. Sex differences in TTC12/ANKK1 haplotype associations with daily tobacco smoking in Black and White Americans.

    PubMed

    David, Sean P; Mezuk, Briana; Zandi, Peter P; Strong, David; Anthony, James C; Niaura, Raymond; Uhl, George R; Eaton, William W

    2010-03-01

    The 11q23.1 genomic region has been associated with nicotine dependence in Black and White Americans. By conducting linkage disequilibrium analyses of 7 informative single nucleotide polymorphisms (SNPs) within the tetratricopeptide repeat domain 12 (TTC12)/ankyrin repeat and kinase containing 1 (ANKK1)/dopamine (D2) receptor gene cluster, we identified haplotype block structures in 270 Black and 368 White (n = 638) participants, from the Baltimore Epidemiologic Catchment Area cohort study, spanning the TTC12 and ANKK1 genes consisting of three SNPs (rs2303380-rs4938015-rs11604671). Informative haplotypes were examined for sex-specific associations with daily tobacco smoking initiation and cessation using longitudinal data from 1993-1994 and 2004-2005 interviews. There was a Haplotype x Sex interaction such that Black men possessing the GTG haplotype who were smokers in 1993-2004 were more likely to have stopped smoking by 2004-2005 (55.6% GTG vs. 22.0% other haplotypes), while Black women were less likely to have quit smoking if they possessed the GTG (20.8%) versus other haplotypes (24.0%; p = .028). In Whites, the GTG haplotype (vs. other haplotypes) was associated with lifetime history of daily smoking (smoking initiation; odds ratio = 1.6; 95% CI = 1.1-2.4; p = .013). Moreover, there was a Haplotype x Sex interaction such that there was higher prevalence of smoking initiation with GTG (77.6%) versus other haplotypes (57.0%; p = .043). In 2 different ethnic American populations, we observed man-woman variation in the influence of the rs2303380-rs4938015-rs11604671 GTG haplotype on smoking initiation and cessation. These results should be replicated in larger cohorts to establish the relationship among the rs2303380-rs4938015-rs11604671 haplotype block, sex, and smoking behavior.

  1. Occurrence of 15 Haplotypes of Linepithema micans (Hymenoptera: Formicidae) in Southern Brazil.

    PubMed

    Ramalho, Manuela Oliveira; Martins, C; Campos, T; Nondillo, A; Botton, M; Bueno, O C

    2017-08-01

    The ant genus Linepithema is widely known, thanks to the pest species Linepithema humile (Mayr), which is easily mistaken for Linepithema micans (Forel) due to their morphological similarity. Like L. humile, L. micans is associated to the main grapevine pest in Brazil, Eurhizococcus brasiliensis (Wille), also known as ground pearl. Therefore, the present study uses mtDNA fragments to expand the knowledge of haplotype diversity and distribution of L. micans in the state of Rio Grande do Sul (Brazil), to understand the genetic differences of the populations identified in this study. We identified 15 haplotypes of L. micans spread across different localities. Twelve of these haplotypes were new for the species. The high haplotype diversity uncovered in Rio Grande do Sul (Brazil) for this species was predictable, as L. micans is in its native environment. Additional studies that take gene flow into account may reveal interesting aspects of diversity in these populations. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Novel Harmful Recessive Haplotypes Identified for Fertility Traits in Nordic Holstein Cattle

    PubMed Central

    Sahana, Goutam; Nielsen, Ulrik Sander; Aamand, Gert Pedersen; Lund, Mogens Sandø; Guldbrandtsen, Bernt

    2013-01-01

    Using genomic data, lethal recessives may be discovered from haplotypes that are common in the population but never occur in the homozygote state in live animals. This approach only requires genotype data from phenotypically normal (i.e. live) individuals and not from the affected embryos that die. A total of 7,937 Nordic Holstein animals were genotyped with BovineSNP50 BeadChip and haplotypes including 25 consecutive markers were constructed and tested for absence of homozygotes states. We have identified 17 homozygote deficient haplotypes which could be loosely clustered into eight genomic regions harboring possible recessive lethal alleles. Effects of the identified haplotypes were estimated on two fertility traits: non-return rates and calving interval. Out of the eight identified genomic regions, six regions were confirmed as having an effect on fertility. The information can be used to avoid carrier-by-carrier mattings in practical animal breeding. Further, identification of causative genes/polymorphisms responsible for lethal effects will lead to accurate testing of the individuals carrying a lethal allele. PMID:24376603

  3. Integrating sequence and array data to create an improved 1000 Genomes Project haplotype reference panel.

    PubMed

    Delaneau, Olivier; Marchini, Jonathan

    2014-06-13

    A major use of the 1000 Genomes Project (1000 GP) data is genotype imputation in genome-wide association studies (GWAS). Here we develop a method to estimate haplotypes from low-coverage sequencing data that can take advantage of single-nucleotide polymorphism (SNP) microarray genotypes on the same samples. First the SNP array data are phased to build a backbone (or 'scaffold') of haplotypes across each chromosome. We then phase the sequence data 'onto' this haplotype scaffold. This approach can take advantage of relatedness between sequenced and non-sequenced samples to improve accuracy. We use this method to create a new 1000 GP haplotype reference set for use by the human genetic community. Using a set of validation genotypes at SNP and bi-allelic indels we show that these haplotypes have lower genotype discordance and improved imputation performance into downstream GWAS samples, especially at low-frequency variants.

  4. Effects of apolipoprotein A5 haplotypes on the ratio of triglyceride to high-density lipoprotein cholesterol and the risk for metabolic syndrome in Koreans

    PubMed Central

    2014-01-01

    Background Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. Methods The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). Results The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C–G–A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. Conclusions We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS. PMID:24618354

  5. Neuropsychiatric systemic lupus erythematosus is associated with imbalance in interleukin 10 promoter haplotypes

    PubMed Central

    Rood, M; Keijsers, V; van der Linden, M W; Tong, T; Borggreve, S; Verweij, C; Breedveld, F; Huizinga, T

    1999-01-01

    OBJECTIVE—To investigate the association of interleukin 10 (IL10) promoter polymorphisms and neuropsychiatric manifestations of systemic lupus erythematosus (SLE).
METHODS—IL10 haplotypes of 11 healthy volunteers were cloned to confirm that in the Dutch population, only the three common haplotypes (-1082/-819/-592) GCC, ACC and ATA exist. The IL10 promoter polymorphisms of 92 SLE patients and 162 healthy controls were determined. The medical records of the SLE patients were screened for the presence of neuropsychiatric involvement.
RESULTS—All cloned haplotypes were either GCC, ACC or ATA. Forty two SLE patients had suffered from neuropsychiatric manifestations (NP-SLE). In NP-SLE patients, the frequency of the ATA haplotype is 30% versus 18% in the controls and 17% in the non-NP-SLE group (odds ratios 1.9, p=0.02, and 2.1, p=0.04, respectively), whereas the GCC haplotype frequency is lower in the NP-SLE group compared with controls and non-NP-SLE patients (40% versus 55% and 61%, odds ratios 0.6, p=0.02 and 0.4 p=0.006). The odds ratio for the presence of NP-SLE is inversely proportional to the number of GCC haplotypes per genotype when the NP-SLE group is compared with non-NP-SLE patients.
CONCLUSIONS—The IL10 locus is associated with neuropsychiatric manifestations in SLE. This suggests that IL10 is implicated in the immunopathogenesis of neuropsychiatric manifestations in SLE.

 Keywords: systemic lupus erythematosus; neuropsychiatric manifestations; genetics; interleukin 10 promoter haplotypes PMID:10343522

  6. Investigation of extended Y chromosome STR haplotypes in Sardinia.

    PubMed

    Lacerenza, D; Aneli, S; Di Gaetano, C; Critelli, R; Piazza, A; Matullo, G; Culigioni, C; Robledo, R; Robino, C; Calò, C

    2017-03-01

    Y-chromosomal variation of selected single nucleotide polymorphisms (SNPs) and 32 short tandem repeat (STR) loci was evaluated in Sardinia in three open population groups (Northern Sardinia, n=40; Central Sardinia, n=56; Southern Sardinia, n=91) and three isolates (Desulo, n=34; Benetutti, n=45, Carloforte, n=42). The tested Y-STRs consisted of Yfiler ® Plus markers and the seven rapidly mutating (RM) loci not included in the YFiler ® Plus kit (DYF399S1, DYF403S1ab, DYF404S1, DYS526ab, DYS547, DYS612, and DYS626). As expected, inclusion of additional Y-STR loci increased haplotype diversity (h), though complete differentiation of male lineages was impossible even by means of RM Y-STRs (h=0.99997). Analysis of molecular variance indicated that the three open populations were fairly homogeneous, whereas signs of genetic heterogeneity could be detected when the three isolates were also included in the analysis. Multidimensional scaling analysis showed that, even for extended haplotypes including RM Y-STR markers, Sardinians were clearly differentiated from populations of the Italian peninsula and Sicily. The only exception was represented by the Carloforte sample that, in accordance with its peculiar population history, clustered with Northern/Central Italian populations. The introduction of extended forensic Y-STR panels, including highly variable RM Y-STR markers, is expected to reduce the impact of population structure on haplotype frequency estimations. However, our results show that the availability of geographically detailed reference databases is still important for the assessment of the evidential value of a Y-haplotype match. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. Mutation Analysis in Classical Phenylketonuria Patients Followed by Detecting Haplotypes Linked to Some PAH Mutations.

    PubMed

    Dehghanian, Fatemeh; Silawi, Mohammad; Tabei, Seyed M B

    2017-02-01

    Deficiency of phenylalanine hydroxylase (PAH) enzyme and elevation of phenylalanine in body fluids cause phenylketonuria (PKU). The gold standard for confirming PKU and PAH deficiency is detecting causal mutations by direct sequencing of the coding exons and splicing involved sequences of the PAH gene. Furthermore, haplotype analysis could be considered as an auxiliary approach for detecting PKU causative mutations before direct sequencing of the PAH gene by making comparisons between prior detected mutation linked-haplotypes and new PKU case haplotypes with undetermined mutations. In this study, 13 unrelated classical PKU patients took part in the study detecting causative mutations. Mutations were identified by polymerase chain reaction (PCR) and direct sequencing in all patients. After that, haplotype analysis was performed by studying VNTR and PAHSTR markers (linked genetic markers of the PAH gene) through application of PCR and capillary electrophoresis (CE). Mutation analysis was performed successfully and the detected mutations were as follows: c.782G>A, c.754C>T, c.842C>G, c.113-115delTCT, c.688G>A, and c.696A>G. Additionally, PAHSTR/VNTR haplotypes were detected to discover haplotypes linked to each mutation. Mutation detection is the best approach for confirming PAH enzyme deficiency in PKU patients. Due to the relatively large size of the PAH gene and high cost of the direct sequencing in developing countries, haplotype analysis could be used before DNA sequencing and mutation detection for a faster and cheaper way via identifying probable mutated exons.

  8. Divergence at the casein haplotypes in dairy and meat goat breeds.

    PubMed

    Küpper, Julia; Chessa, Stefania; Rignanese, Daniela; Caroli, Anna; Erhardt, Georg

    2010-02-01

    Casein genes have been proved to have an influence on milk properties, and are in addition appropriate for phylogeny studies. A large number of casein polymorphisms exist in goats, making their analysis quite complex. The four casein loci were analyzed by molecular techniques for genetic polymorphism detection in the two dairy goat breeds Bunte Deutsche Edelziege (BDE; n=96), Weisse Deutsche Edelziege (WDE; n=91), and the meat goat breed Buren (n=75). Of the 35 analyzed alleles, 18 were found in BDE, and 17 in Buren goats and WDE. In addition, a new allele was identified at the CSN1S1 locus in the BDE, showing a frequency of 0.05. This variant, named CSN1S1*A', is characterized by a t-->c transversion in intron 9. Linkage disequilibrium was found at the casein haplotype in all three breeds. A total of 30 haplotypes showed frequencies higher than 0.01. In the Buren breed only one haplotype showed a frequency higher than 0.1. The ancestral haplotype B-A-A-B (in the order: CSN1S1-CSN2-CSN1S2-CSN3) occurred in all three breeds, showing a very high frequency (>0.8) in the Buren.

  9. Haplotype Frequency Distribution in Northeastern European Saduria entomon (Crustacea: Isopoda) Populations. A Phylogeographic Approach

    NASA Astrophysics Data System (ADS)

    Sell, Jerzy

    2003-11-01

    The distribution pattern of mtDNA haplotypes in distinct populations of the glacial relict crustacean Saduria entomon was examined to assess phylogeographic relationships among them. Populations from the Baltic, the White Sea and the Barents Sea were screened for mtDNA variation using PCR-based RFLP analysis of a 1150 bp fragment containing part of the CO I and CO II genes. Five mtDNA haplotypes were recorded. An analysis of geographical heterogeneity in haplotype frequency distributions revealed significant differences among populations. The isolated populations of S. entomon have diverged since the retreat of the last glaciation. The geographical pattern of variation is most likely the result of stochastic (founder effect, genetic drift) mechanisms and suggests that the haplotype differentiation observed is probably older than the isolation of the Baltic and Arctic seas.

  10. Haplotype analysis indicates an association between the DOPA decarboxylase (DDC) gene and nicotine dependence.

    PubMed

    Ma, Jennie Z; Beuten, Joke; Payne, Thomas J; Dupont, Randolph T; Elston, Robert C; Li, Ming D

    2005-06-15

    DOPA decarboxylase (DDC; also known as L-amino acid decarboxylase; AADC) is involved in the synthesis of dopamine, norepinephrine and serotonin. Because the mesolimbic dopaminergic system is implicated in the reinforcing effects of many drugs, including nicotine, the DDC gene is considered a plausible candidate for involvement in the development of vulnerability to nicotine dependence (ND). Further, this gene is located within the 7p11 region that showed a 'suggestive linkage' to ND in our previous genome-wide scan in the Framingham Heart Study population. In the present study, we tested eight single nucleotide polymorphisms (SNPs) within DDC for association with ND, which was assessed by smoking quantity (SQ), the heaviness of smoking index (HSI) and the Fagerstrom test for ND (FTND) score, in a total of 2037 smokers and non-smokers from 602 nuclear families of African- or European-American (AA or EA, respectively) ancestry. Association analysis for individual SNPs using the PBAT-GEE program indicated that SNP rs921451 was significantly associated with two of the three adjusted ND measures in the EA sample (P=0.01-0.04). Haplotype-based association analysis revealed a protective T-G-T-G haplotype for rs921451-rs3735273-rs1451371-rs2060762 in the AA sample, which was significantly associated with all three adjusted ND measures after correction for multiple testing (min Z=-2.78, P=0.006 for HSI). In contrast, we found a high-risk T-G-T-G haplotype for a different SNP combination in the EA sample, rs921451-rs3735273-rs1451371-rs3757472, which showed a significant association after Bonferroni correction with the SQ and FTND score (max Z=2.73, P=0.005 for FTND). In summary, our findings provide the first evidence for the involvement of DDC in the susceptibility to ND and, further, reveal the racial specificity of its impact.

  11. Mitochondrial Haplotype Diversity in Zambian Lions: Bridging a Gap in the Biogeography of an Iconic Species

    PubMed Central

    Curry, Caitlin J.; White, Paula A.; Derr, James N.

    2015-01-01

    Analysis of DNA sequence diversity at the 12S to 16S mitochondrial genes of 165 African lions (Panthera leo) from five main areas in Zambia has uncovered haplotypes which link Southern Africa with East Africa. Phylogenetic analysis suggests Zambia may serve as a bridge connecting the lion populations in southern Africa to eastern Africa, supporting earlier hypotheses that eastern-southern Africa may represent the evolutionary cradle for the species. Overall gene diversity throughout the Zambian lion population was 0.7319 +/- 0.0174 with eight haplotypes found; three haplotypes previously described and the remaining five novel. The addition of these five novel haplotypes, so far only found within Zambia, nearly doubles the number of haplotypes previously reported for any given geographic location of wild lions. However, based on an AMOVA analysis of these haplotypes, there is little to no matrilineal gene flow (Fst = 0.47) when the eastern and western regions of Zambia are considered as two regional sub-populations. Crossover haplotypes (H9, H11, and Z1) appear in both populations as rare in one but common in the other. This pattern is a possible result of the lion mating system in which predominately males disperse, as all individuals with crossover haplotypes were male. The determination and characterization of lion sub-populations, such as done in this study for Zambia, represent a higher-resolution of knowledge regarding both the genetic health and connectivity of lion populations, which can serve to inform conservation and management of this iconic species. PMID:26674533

  12. The targetable A1 Huntington disease haplotype has distinct Amerindian and European origins in Latin America

    PubMed Central

    Kay, Chris; Tirado-Hurtado, Indira; Cornejo-Olivas, Mario; Collins, Jennifer A; Wright, Galen; Inca-Martinez, Miguel; Veliz-Otani, Diego; Ketelaar, Maria E; Slama, Ramy A; Ross, Colin J; Mazzetti, Pilar; Hayden, Michael R

    2017-01-01

    Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin (HTT) gene. HD occurs worldwide, but the causative mutation is found on different HTT haplotypes in distinct ethnic groups. In Latin America, HD is thought to have European origins, but indigenous Amerindian ancestry has not been investigated. Here, we report dense HTT haplotypes in 62 mestizo Peruvian HD families, 17 HD families from across Latin America, and 42 controls of defined Peruvian Amerindian ethnicity to determine the origin of HD in populations of admixed Amerindian and European descent. HD in Peru occurs most frequently on the A1 HTT haplotype (73%), as in Europe, but on an unexpected indigenous variant also found in Amerindian controls. This Amerindian A1 HTT haplotype predominates over the European A1 variant among geographically disparate Latin American controls and in HD families from across Latin America, supporting an indigenous origin of the HD mutation in mestizo American populations. We also show that a proportion of HD mutations in Peru occur on a C1 HTT haplotype of putative Amerindian origin (14%). The majority of HD mutations in Latin America may therefore occur on haplotypes of Amerindian ancestry rather than on haplotypes resulting from European admixture. Despite the distinct ethnic ancestry of Amerindian and European A1 HTT, alleles on the parent A1 HTT haplotype allow for development of identical antisense molecules to selectively silence the HD mutation in the greatest proportion of patients in both Latin American and European populations. PMID:28000697

  13. Mitochondrial Haplotype Diversity in Zambian Lions: Bridging a Gap in the Biogeography of an Iconic Species.

    PubMed

    Curry, Caitlin J; White, Paula A; Derr, James N

    2015-01-01

    Analysis of DNA sequence diversity at the 12S to 16S mitochondrial genes of 165 African lions (Panthera leo) from five main areas in Zambia has uncovered haplotypes which link Southern Africa with East Africa. Phylogenetic analysis suggests Zambia may serve as a bridge connecting the lion populations in southern Africa to eastern Africa, supporting earlier hypotheses that eastern-southern Africa may represent the evolutionary cradle for the species. Overall gene diversity throughout the Zambian lion population was 0.7319 +/- 0.0174 with eight haplotypes found; three haplotypes previously described and the remaining five novel. The addition of these five novel haplotypes, so far only found within Zambia, nearly doubles the number of haplotypes previously reported for any given geographic location of wild lions. However, based on an AMOVA analysis of these haplotypes, there is little to no matrilineal gene flow (Fst = 0.47) when the eastern and western regions of Zambia are considered as two regional sub-populations. Crossover haplotypes (H9, H11, and Z1) appear in both populations as rare in one but common in the other. This pattern is a possible result of the lion mating system in which predominately males disperse, as all individuals with crossover haplotypes were male. The determination and characterization of lion sub-populations, such as done in this study for Zambia, represent a higher-resolution of knowledge regarding both the genetic health and connectivity of lion populations, which can serve to inform conservation and management of this iconic species.

  14. Deletion analysis of male sterility effects of t-haplotypes in the mouse.

    PubMed

    Bennett, D; Artzt, K

    1990-01-01

    We present data on the effects of three chromosome 17 deletions on transmission ratio distortion (TRD) and sterility of several t-haplotypes. All three deletions have similar effects on male TRD: that is, Tdel/tcomplete genotypes all transmit their t-haplotype in very high proportion. However, each deletion has different effects on sterility of heterozygous males, with TOr/t being fertile, Thp/t less fertile, and TOrl/t still less fertile. These data suggest that wild-type genes on chromosomes homologous to t-haplotypes can be important regulators of both TRD and fertility in males, and that the wild-type genes concerned with TRD and fertility are at least to some extent different. The data also provide a rough map of the positions of these genes.

  15. Haplotype Sharing Provides Insights into Fine-Scale Population History and Disease in Finland.

    PubMed

    Martin, Alicia R; Karczewski, Konrad J; Kerminen, Sini; Kurki, Mitja I; Sarin, Antti-Pekka; Artomov, Mykyta; Eriksson, Johan G; Esko, Tõnu; Genovese, Giulio; Havulinna, Aki S; Kaprio, Jaakko; Konradi, Alexandra; Korányi, László; Kostareva, Anna; Männikkö, Minna; Metspalu, Andres; Perola, Markus; Prasad, Rashmi B; Raitakari, Olli; Rotar, Oxana; Salomaa, Veikko; Groop, Leif; Palotie, Aarno; Neale, Benjamin M; Ripatti, Samuli; Pirinen, Matti; Daly, Mark J

    2018-05-03

    Finland provides unique opportunities to investigate population and medical genomics because of its adoption of unified national electronic health records, detailed historical and birth records, and serial population bottlenecks. We assembled a comprehensive view of recent population history (≤100 generations), the timespan during which most rare-disease-causing alleles arose, by comparing pairwise haplotype sharing from 43,254 Finns to that of 16,060 Swedes, Estonians, Russians, and Hungarians from geographically and linguistically adjacent countries with different population histories. We find much more extensive sharing in Finns, with at least one ≥ 5 cM tract on average between pairs of unrelated individuals. By coupling haplotype sharing with fine-scale birth records from more than 25,000 individuals, we find that although haplotype sharing broadly decays with geographical distance, there are pockets of excess haplotype sharing; individuals from northeast Finland typically share several-fold more of their genome in identity-by-descent segments than individuals from southwest regions. We estimate recent effective population-size changes through time across regions of Finland, and we find that there was more continuous gene flow as Finns migrated from southwest to northeast between the early- and late-settlement regions than was dichotomously described previously. Lastly, we show that haplotype sharing is locally enriched by an order of magnitude among pairs of individuals sharing rare alleles and especially among pairs sharing rare disease-causing variants. Our work provides a general framework for using haplotype sharing to reconstruct an integrative view of recent population history and gain insight into the evolutionary origins of rare variants contributing to disease. Copyright © 2018 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  16. The effects of old and recent migration waves in the distribution of HBB*S globin gene haplotypes

    PubMed Central

    Lindenau, Juliana D.; Wagner, Sandrine C.; de Castro, Simone M.; Hutz, Mara H.

    2016-01-01

    Abstract Sickle cell hemoglobin is the result of a mutation at the sixth amino acid position of the beta (β) globin chain. The HBB*S gene is in linkage disequilibrium with five main haplotypes in the β-globin-like gene cluster named according to their ethnic and geographic origins: Bantu (CAR), Benin (BEN), Senegal (SEN), Cameroon (CAM) and Arabian-Indian (ARAB). These haplotypes demonstrated that the sickle cell mutation arose independently at least five times in human history. The distribution of βS haplotypes among Brazilian populations showed a predominance of the CAR haplotype. American populations were clustered in two groups defined by CAR or BEN haplotype frequencies. This scenario is compatible with historical records about the slave trade in the Americas. When all world populations where the sickle cell gene occurs were analyzed, three clusters were disclosed based on CAR, BEN or ARAB haplotype predominance. These patterns may change in the next decades due to recent migrations waves. Since these haplotypes show different clinical characteristics, these recent migrations events raise the necessity to develop optimized public health programs for sickle cell disease screening and management. PMID:27706371

  17. Unique haplotypes of cacao trees as revealed by trnH-psbA chloroplast DNA

    PubMed Central

    Gutiérrez-López, Nidia; Ovando-Medina, Isidro; Salvador-Figueroa, Miguel; Molina-Freaner, Francisco; Avendaño-Arrazate, Carlos H.

    2016-01-01

    Cacao trees have been cultivated in Mesoamerica for at least 4,000 years. In this study, we analyzed sequence variation in the chloroplast DNA trnH-psbA intergenic spacer from 28 cacao trees from different farms in the Soconusco region in southern Mexico. Genetic relationships were established by two analysis approaches based on geographic origin (five populations) and genetic origin (based on a previous study). We identified six polymorphic sites, including five insertion/deletion (indels) types and one transversion. The overall nucleotide diversity was low for both approaches (geographic = 0.0032 and genetic = 0.0038). Conversely, we obtained moderate to high haplotype diversity (0.66 and 0.80) with 10 and 12 haplotypes, respectively. The common haplotype (H1) for both networks included cacao trees from all geographic locations (geographic approach) and four genetic groups (genetic approach). This common haplotype (ancient) derived a set of intermediate haplotypes and singletons interconnected by one or two mutational steps, which suggested directional selection and event purification from the expansion of narrow populations. Cacao trees from Soconusco region were grouped into one cluster without any evidence of subclustering based on AMOVA (FST = 0) and SAMOVA (FST = 0.04393) results. One population (Mazatán) showed a high haplotype frequency; thus, this population could be considered an important reservoir of genetic material. The indels located in the trnH-psbA intergenic spacer of cacao trees could be useful as markers for the development of DNA barcoding. PMID:27076998

  18. Globin haplotypes of human T-cell lymphotropic virus type I-infected individuals in Salvador, Bahia, Brazil, suggest a post-Columbian African origin of this virus.

    PubMed

    Alcantara, Luiz Carlos; Van Dooren, Sonia; Gonçalves, Marilda Souza; Kashima, Simone; Costa, Maria Cristina Ramos; Santos, Fred Luciano Neves; Bittencourt, Achilea Lisboa; Dourado, Inês; Filho, Antonio Andrade; Covas, Dimas Tadeu; Vandamme, Anne-Mieke; Galvão-Castro, Bernardo

    2003-08-01

    The city of Salvador, Bahia, Brazil, has sociodemographic characteristics similar to some African cities. Up to now, it has had the highest prevalence of human T-cell lymphotropic virus type I (HTLV-I) infection (1.74%) in the country. To investigate which strains of HTLV-I are circulating in Salvador, we studied isolates from 82 patients infected with HTLV-I: 19 from the general population, 21 from pregnant women, 16 from intravenous drug users, and 26 from patients and their family attending a neurologic clinic. Phylogenetic analysis from part of the LTR fragments showed that most of these isolates belonged to the Transcontinental subgroup of the Cosmopolitan subtype (HTLV-Ia). Only one sample from a pregnant woman was closely related to the Japanese subgroup, suggesting recent introduction of a Japanese HTLV-I lineage into Salvador. betaA-Globin haplotypes were examined in 34 infected individuals and found to be atypical, confirming the racial heterogeneity of this population. A total of 20 chromosomes were characterized as Central African Republic (CAR) haplotype (29.4%), 31 (45.6%) were characterized as Benin (BEN) haplotype, and 17 (25%) were characterized as Senegal (SEN) haplotype. Five patients' genotypes (14.7%) were CAR/CAR; 10 (29,4%), BEN/BEN; 9 (26.5%), CAR/BEN; 2 (5.9%), BEN/SEN; and 7 (20.6%), SEN/SEN. One patient's genotype (2.9%) was CAR/SEN. The betaA-globin haplotype distribution in Salvador is unusual compared with other Brazilian states. Our data support the hypothesis of multiple post-Columbian introductions of African HTLV-Ia strains in Salvador, Bahia, Brazil.

  19. HLA-G, -A haplotypes in Amerindians (Ecuador): HLA-G*01:05N World distribution.

    PubMed

    Arnaiz-Villena, Antonio; Palacio-Gruber, Jose; Enriquez de Salamanca, Mercedes; Juárez, Ignacio; Campos, Cristina; Nieto, Jorge; Muñiz, Ester; Martin-Villa, Jose Manuel

    2018-02-01

    HLA-G and HLA-A frequencies have been analysed in Amerindians from Ecuador. HLA-G allele frequencies are found to be closer to those of other Amerindians (Mayas from Guatemala and Uros from Peru) and closer to European ones than to Far East Asians groups, particularly, regarding to HLA-G*01:04 allele. HLA-G/-A haplotypes have been calculated for the first time in Amerindians. It is remarkable that HLA-G*01:05N "null" allele is found in a very low frequency (like in Amerindian Mayas and Uros) and is also found in haplotypes belonging to the HLA-A19 group of alleles (HLA-A*30, -A*31, -A*33). It was previously postulated that HLA-G*01:05N appeared in HLA-A*30/-B*13 haplotypes in Middle East Mediterraneans. It may be hypothesized that in Evolution, HLA-G*01:05N existed primarily in one of the HLA extant or extinct -A19 haplotype, whether this haplotype was placed in Middle East or other World areas, including America. However, the highest present day HLA-G*01:05N frequencies are found in Middle East Mediterraneans. Copyright © 2017. Published by Elsevier Inc.

  20. [Frequency distribution of HLA antigens and haplotypes in newly arrived inhabitants of Magadan].

    PubMed

    Solovenchuk, L L; Pereverzeva, V V; Nevretdinova, Z G

    1994-09-01

    Peculiarities of the frequency distribution of antigens and haplotypes of A, B, and Cw subloci of the HLA system in 924 Slavic inhabitants of Magadan are described. Significant differences in gene and haplotype frequencies between inhabitants of Magadan and those of Moscow, Odessa, Poles'e, Latvia, and England were revealed, which could not be attributed solely to the specificity of migration processes. On the basis of an analysis of gamete associations of the A and B subloci, an attempt was made to explain the specificity of the frequency distribution of HLA system alleles and haplotypes in the investigated sample from an ecological point of view.

  1. Mineralocorticoid receptor haplotype moderates the effects of oral contraceptives and menstrual cycle on emotional information processing.

    PubMed

    Hamstra, Danielle A; de Kloet, E Ronald; Tollenaar, Marieke; Verkuil, Bart; Manai, Meriem; Putman, Peter; Van der Does, Willem

    2016-10-01

    The processing of emotional information is affected by menstrual cycle phase and by the use of oral contraceptives (OCs). The stress hormone cortisol is known to affect emotional information processing via the limbic mineralocorticoid receptor (MR). We investigated in an exploratory study whether the MR-genotype moderates the effect of both OC-use and menstrual cycle phase on emotional cognition. Healthy premenopausal volunteers (n=93) of West-European descent completed a battery of emotional cognition tests. Forty-nine participants were OC users and 44 naturally cycling, 21 of whom were tested in the early follicular (EF) and 23 in the mid-luteal (ML) phase of the menstrual cycle. In MR-haplotype 1/3 carriers, ML women gambled more than EF women when their risk to lose was relatively small. In MR-haplotype 2, ML women gambled more than EF women, regardless of their odds of winning. OC-users with MR-haplotype 1/3 recognised fewer facial expressions than ML women with MR-haplotype 1/3. MR-haplotype 1/3 carriers may be more sensitive to the influence of their female hormonal status. MR-haplotype 2 carriers showed more risky decision-making. As this may reflect optimistic expectations, this finding may support previous observations in female carriers of MR-haplotype 2 in a naturalistic cohort study. © The Author(s) 2016.

  2. Haplotype diversity of the myostatin gene among beef cattle breeds

    PubMed Central

    Dunner, Susana; Miranda, M Eugenia; Amigues, Yves; Cañón, Javier; Georges, Michel; Hanset, Roger; Williams, John; Ménissier, François

    2003-01-01

    A total of 678 individuals from 28 European bovine breeds were both phenotyped and analysed at the myostatin locus by the Single Strand Conformation Polymorphism (SSCP) method. Seven new mutations were identified which contribute to the high polymorphism (1 SNP every 100 bp) present in this small gene; twenty haplotypes were described and a genotyping method was set up using the Oligonucleotide Ligation Assay (OLA) method. Some haplotypes appeared to be exclusive to a particular breed; this was the case for 5 in the Charolaise (involving mutation Q204X) and 7 in the Maine-Anjou (involving mutation E226X). The relationships between the different haplotypes were studied, thus allowing to test the earlier hypothesis on the origin of muscular hypertrophy in Europe: muscular hypertrophy (namely nt821(del11)) was mainly spread in different waves from northern Europe milk purpose populations in most breeds; however, other mutations (mostly disruptive) arose in a single breed, were highly selected and have since scarcely evolved to other populations. PMID:12605853

  3. Salt tolerance underlies the cryptic invasion of North American salt marshes by an introduced haplotype of the common reed Phragmites australis (Poaceae)

    USGS Publications Warehouse

    Vasquez, Edward A.; Glenn, Edward P.; Brown, J. Jed; Guntenspergen, Glenn R.; Nelson, Stephen G.

    2005-01-01

    A distinct, non-native haplotype of the common reed Phragmites australis has become invasive in Atlantic coastal Spartina marshes. We compared the salt tolerance and other growth characteristics of the invasive M haplotype with 2 native haplotypes (F and AC) in greenhouse experiments. The M haplotype retained 50% of its growth potential up to 0.4 M NaCl, whereas the F and AC haplotypes did not grow above 0.1 M NaCl. The M haplotype produced more shoots per gram of rhizome tissue and had higher relative growth rates than the native haplotypes on both freshwater and saline water treatments. The M haplotype also differed from the native haplotypes in shoot water content and the biometrics of shoots and rhizomes. The results offer an explanation for how the M haplotype is able to spread in coastal salt marshes and support the conclusion of DNA analyses that the M haplotype is a distinct ecotype of P. australis.

  4. Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents.

    PubMed

    Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z

    2014-03-01

    The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P < 0.05), six significantly downregulated MGMT promoter activity (29-97% decrease; P < 0.05) and one haplotype had no effect. Mechanistic studies conducted support the conclusion that MGMT P/E haplotypes, rather than individual SNPs, differentially regulate MGMT transcription and could thus play a significant role in human sensitivity to environmental and therapeutic alkylating agents.

  5. Specific CAPN10 gene haplotypes influence the clinical profile of polycystic ovary patients.

    PubMed

    Gonzalez, Alejandro; Abril, Eduardo; Roca, Alfredo; Aragón, Maria José; Figueroa, Maria José; Velarde, Pilar; Ruiz, Rocío; Fayez, Omar; Galán, José Jorge; Herreros, José Antonio; Real, Luis Miguel; Ruiz, Agustín

    2003-11-01

    Recently, several research groups have evaluated CAPN10 gene in polycystic ovarian syndrome (PCOS) patients and other phenotypes, including hirsutism or intermediate phenotypes of PCOS. Molecular genetic analysis of CAPN10 gene indicates that different alleles may play a role in PCOS susceptibility and could be associated with idiopathic hirsutism. However, these observations are not exempt from controversy, because independent studies cannot replicate these preliminary findings. We present a haplotype-phenotype correlation study of CAPN10 haplotypes in 148 women showing ecographically detected polycystic ovaries (PCO) combined with one or more of these clinical symptoms: amenorrhea or severe oligomenorrhea, hyperandrogenism, and anovulatory infertility, as well as 93 unrelated controls. We have reconstructed and analyzed 482 CAPN10 haplotypes in patients and controls. We detected the association of UCSNP-44 allele with PCO phenotype in the Spanish population (P = 0.02). In addition, we identified several CAPN10 alleles associated to phenotypic differences observed between PCO patients, such as the presence of hypercholesterolemia (haplotype 1121, P = 0.005), presence of hyperandrogenic features (P = 0.05), and familial cancer incidence (haplotype 1111, P = 0.0005). Our results confirm the association of UCSNP-44 allele with PCO phenotype in the Spanish population. Moreover, we have identified novel candidate risk alleles and genotypes, within CAPN10 gene, that could be associated with important phenotypic and prognosis differences observed in PCOS patients.

  6. Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru

    PubMed Central

    Akinyi, Sheila; Hayden, Tonya; Gamboa, Dionicia; Torres, Katherine; Bendezu, Jorge; Abdallah, Joseph F.; Griffing, Sean M.; Quezada, Wilmer Marquiño; Arrospide, Nancy; De Oliveira, Alexandre Macedo; Lucas, Carmen; Magill, Alan J.; Bacon, David J.; Barnwell, John W.; Udhayakumar, Venkatachalam

    2013-01-01

    The majority of malaria rapid diagnostic tests (RDTs) detect Plasmodium falciparum histidine-rich protein 2 (PfHRP2), encoded by the pfhrp2 gene. Recently, P. falciparum isolates from Peru were found to lack pfhrp2 leading to false-negative RDT results. We hypothesized that pfhrp2-deleted parasites in Peru derived from a single genetic event. We evaluated the parasite population structure and pfhrp2 haplotype of samples collected between 1998 and 2005 using seven neutral and seven chromosome 8 microsatellite markers, respectively. Five distinct pfhrp2 haplotypes, corresponding to five neutral microsatellite-based clonal lineages, were detected in 1998-2001; pfhrp2 deletions occurred within four haplotypes. In 2003-2005, outcrossing among the parasite lineages resulted in eight population clusters that inherited the five pfhrp2 haplotypes seen previously and a new haplotype; pfhrp2 deletions occurred within four of these haplotypes. These findings indicate that the genetic origin of pfhrp2 deletion in Peru was not a single event, but likely occurred multiple times. PMID:24077522

  7. COMT haplotypes modulate associations of antenatal maternal anxiety and neonatal cortical morphology.

    PubMed

    Qiu, Anqi; Tuan, Ta Anh; Ong, Mei Lyn; Li, Yue; Chen, Helen; Rifkin-Graboi, Anne; Broekman, Birit F P; Kwek, Kenneth; Saw, Seang-Mei; Chong, Yap-Seng; Gluckman, Peter D; Fortier, Marielle V; Holbrook, Joanna Dawn; Meaney, Michael J

    2015-02-01

    Exposure to antenatal maternal anxiety and complex genetic variations may shape fetal brain development. In particular, the catechol-O-methyltransferase (COMT) gene, located on chromosome 22q11.2, regulates catecholamine signaling in the prefrontal cortex and is implicated in anxiety, pain, and stress responsivity. This study examined whether individual single-nucleotide polymorphisms (SNPs) of the COMT gene and their haplotypes moderate the association between antenatal maternal anxiety and in utero cortical development. A total of 146 neonates were genotyped and underwent MRI shortly after birth. Neonatal cortical morphology was characterized using cortical thickness. Antenatal maternal anxiety was assessed using the State-Trait Anxiety Inventory at week 26 of pregnancy. Individual COMT SNPs (val158met, rs737865, and rs165599) modulated the association between antenatal maternal anxiety and the prefrontal and parietal cortical thickness in neonates. Based on haplotype trend regression analysis, findings also showed that among rs737865-val158met-rs165599 haplotypes, the A-val-G (AGG) haplotype probabilities modulated positive associations of antenatal maternal anxiety with cortical thickness in the right ventrolateral prefrontal cortex and the right superior parietal cortex and precuneus. In contrast, the G-met-A (GAA) haplotype probabilities modulated negative associations of antenatal maternal anxiety with cortical thickness in bilateral precentral gyrus and the dorsolateral prefrontal cortex. These results suggest that the association between maternal anxiety and in utero neurodevelopment is modified through complex genetic variation in COMT. Such genetic moderation may explain, in part, the variation in phenotypic outcomes in offspring associated with maternal emotional well-being.

  8. Haplotype Analysis of the Melanopsin Gene in Seasonal Affective Disorder and Controls

    DTIC Science & Technology

    2007-06-19

    Cole, P. A. (2002). Serotonin n-acetyltransferase: Mechanism and inhibition. Current Medicinal Chemistry , 9(12), 1187-1199. 152 APPENDIX A STRUCTURED ...such that low light levels fall below this threshold during winter in individuals with SAD. The present study investigated the haplotype structure of...Association Studies 51 Advantages of Population-Based Case-Control Samples 52 Haplotype Structure 53 Linkage Disequilibrium: A Measure of Correlation Between

  9. Insights into HLA-G Genetics Provided by Worldwide Haplotype Diversity

    PubMed Central

    Castelli, Erick C.; Ramalho, Jaqueline; Porto, Iane O. P.; Lima, Thálitta H. A.; Felício, Leandro P.; Sabbagh, Audrey; Donadi, Eduardo A.; Mendes-Junior, Celso T.

    2014-01-01

    Human leukocyte antigen G (HLA-G) belongs to the family of non-classical HLA class I genes, located within the major histocompatibility complex (MHC). HLA-G has been the target of most recent research regarding the function of class I non-classical genes. The main features that distinguish HLA-G from classical class I genes are (a) limited protein variability, (b) alternative splicing generating several membrane bound and soluble isoforms, (c) short cytoplasmic tail, (d) modulation of immune response (immune tolerance), and (e) restricted expression to certain tissues. In the present work, we describe the HLA-G gene structure and address the HLA-G variability and haplotype diversity among several populations around the world, considering each of its major segments [promoter, coding, and 3′ untranslated region (UTR)]. For this purpose, we developed a pipeline to reevaluate the 1000Genomes data and recover miscalled or missing genotypes and haplotypes. It became clear that the overall structure of the HLA-G molecule has been maintained during the evolutionary process and that most of the variation sites found in the HLA-G coding region are either coding synonymous or intronic mutations. In addition, only a few frequent and divergent extended haplotypes are found when the promoter, coding, and 3′UTRs are evaluated together. The divergence is particularly evident for the regulatory regions. The population comparisons confirmed that most of the HLA-G variability has originated before human dispersion from Africa and that the allele and haplotype frequencies have probably been shaped by strong selective pressures. PMID:25339953

  10. A novel haplotype of spinocerebellar ataxia type 6 contributes to the highest prevalence in western Japan.

    PubMed

    Terasawa, Hideo; Oda, Masaya; Morino, Hiroyuki; Miyachi, Takafumi; Izumi, Yuishin; Maruyama, Hirofumi; Matsumoto, Masayasu; Kawakami, Hideshi

    2004-03-25

    The highest prevalence rate of spinocerebellar ataxia type 6 (SCA6) in the worldwide population is in the Chugoku and Kansai areas of Western Japan, but the reason of this geographic characteristics is unclear. We investigated the predisposing haplotypes and their geographic distribution. Genotyping of five microsatellite markers and three single nucleotide polymorphisms linked to the CACNA1A gene in 150 Japanese SCA6 patients from unrelated 118 families revealed three major haplotypes, carrying a pool of one common haplotype core. A founder chromosome was thought to have historically diverged into at least three types. One of the major haplotypes newly identified showed a strong geographical cluster around the Seto Inland Sea in the Chugoku and Kansai areas of Western Japan, whereas the others were widely distributed throughout Japan. The distribution of predisposing haplotypes contributes to the geographical differences in prevalence of SCA6.

  11. Phenotypic and genotypic expression of self-incompatibility haplotypes in Arabidopsis lyrata suggests unique origin of alleles in different dominance classes.

    PubMed

    Prigoda, Nadia L; Nassuth, Annette; Mable, Barbara K

    2005-07-01

    The highly divergent alleles of the SRK gene in outcrossing Arabidopsis lyrata have provided important insights into the evolutionary history of self-incompatibility (SI) alleles and serve as an ideal model for studies of the evolutionary and molecular interactions between alleles in cell-cell recognition systems in general. One tantalizing question is how new specificities arise in systems that require coordination between male and female components. Allelic recruitment via gene conversion has been proposed as one possibility, based on the division of DNA sequences at the SRK locus into two distinctive groups: (1) sequences whose relationships are not well resolved and display the long branch lengths expected for a gene under balancing selection (Class A); and (2) sequences falling into a well-supported group with shorter branch lengths (Class B) that are closely related to an unlinked paralogous locus. The purpose of this study was to determine if differences in phenotype (site of expression assayed using allele-specific reverse transcription-polymerase chain reaction) or function (dominance relationships assayed through controlled pollinations) accompany the sequence-based classification. Expression of Class A alleles was restricted to floral tissues, as predicted for genes involved in the SI response. In contrast, Class B alleles, despite being tightly linked to the SI phenotype, were unexpectedly expressed in both leaves and floral tissues; the same pattern found for a related unlinked paralogous sequence. Whereas Class A included haplotypes in three different dominance classes, all Class B haplotypes were found to be recessive to all except one Class A haplotype. In addition, mapping of expression and dominance patterns onto an S-domain-based genealogy suggested that allelic dominance may be determined more by evolutionary history than by frequency-dependent selection for lowered dominance as some theories suggest. The possibility that interlocus gene

  12. Submegabase Clusters of Unstable Tandem Repeats Unique to the Tla Region of Mouse T Haplotypes

    PubMed Central

    Uehara, H.; Ebersole, T.; Bennett, D.; Artzt, K.

    1990-01-01

    We describe here the identification and genomic organization of mouse t haplotype-specific elements (TSEs) 7.8 and 5.8 kb in length. The TSEs exist as submegabase-long clusters of tandem repeats localized in the Tla region of the major histocompatibility complex of all t haplotype chromosomes examined. In contrast, no such clusters were detected among 12 inbred strains of Mus musculus and other Mus species; thus, clusters of TSEs represent the first absolutely qualitative difference between t haplotypes and wild-type chromosomes. Pulsed field gel electrophoresis shows that the number of clusters, and the number of repeats in each cluster are extremely variable. Dramatic quantitative differences of TSEs uniquely distinguish every independent t haplotype from any other. The complete nucleotide sequence of one 7.8-kb TSE reveals significant homology to the ETn (a major transcript in the early embryo of the mouse), and some homologies to intracisternal A-particles and the mammary tumor virus env gene. Apart from the diagnostic relevance to t haplotypes, evolutionary and functional significances are discussed with respect to chromosome structure and genetic recombination. PMID:2076812

  13. Identification of a Fourth Haplotype of Bactericera cockerelli (Hemiptera: Triozidae) in the United States

    PubMed Central

    Swisher, Kylie D.; Henne, Donald C.; Crosslin, James M.

    2014-01-01

    Abstract The potato psyllid, Bactericera cockerelli (Sulc) (Hemiptera: Triozidae), is a pest of potato and other solanaceous crops in North and Central America and New Zealand. Previous genotyping studies have demonstrated the presence of three different haplotypes of B. cockerelli in the United States corresponding to three geographical regions: Central, Western, and Northwestern. These studies utilized psyllids collected in the western and central United States between 1998 and 2011. In an effort to further genotype potato psyllids collected in the 2012 growing season, a fourth B. cockerelli haplotype was discovered corresponding to the Southwestern United States geographical region. High-resolution melting analyses identified this new haplotype using an amplicon generated from a portion of the B. cockerelli mitochondrial cytochrome coxidase subunit I gene. Sequencing of this gene, as well as use of a restriction enzyme assay, confirmed the identification of the novel B. cockerelli haplotype in the United States. PMID:25368079

  14. Impacts of TNF-LTA SNPs/Haplotypes and Lifestyle Factors on Oral Carcinoma in an Indian Population.

    PubMed

    Bandil, Kapil; Singhal, Pallavi; Sharma, Upma; Hussain, Showket; Basu, Surojit; Parashari, Aditya; Singh, Veena; Sehgal, Ashok; Shivam, Animesh; Ahuja, Puneet; Bharadwaj, Mausumi; Banerjee, Basu Dev; Mehrotra, Ravi

    2016-10-01

    To investigate a potential association between single-nucleotide polymorphisms (SNPs) and  haplotypes at the TNFA-LTA locus and the development of oral cancer in an Indian population. In this study, 150 oral precancer/cancer samples (50 precancer and 100 cancer), along with an equal number of control samples, were genotyped. Six SNPs at the TNF-LTA locus (i.e., -238G/A, -308G/A, -857C/T, -863C/A, -1031T/C, and +252A/G) were analyzed by use of a polymerase chain reaction-restriction fragment length polymorphism method, the assay was validated by sequencing 10 % of samples. The allelic frequencies of TNFA and LTA SNPs were found to be significantly associated with the risk of oral cancer and precancerous lesions in comparison with controls (P < 0.0003). Further haplotypic analysis showed that two haplotypes (ATCTGG and ACACGG) served as risk haplotypes for oral cancer. These haplotypes were also found to be significantly and positively associated with lifestyle habits (tobacco chewing P = 0.04, odds ratio [OR] 3.4) and socioeconomic status (P = 0.01, OR 3.4). We noticed an increased percentage of risk haplotypes correlating with the aggressiveness of oral cancer. The percentages of risk haplotypes were found to be threefold higher in precancer and fourfold higher in advanced stages of oral cancer in comparison with controls. Five SNPs at the TNF-LTA locus (i.e., -308G>A, -857C>T, -863C>A, -1031T>C, and +252A>G) were found to be associated with the development of oral cancer. Two haplotypes (ATCTGG and ACACGG) emerged as major risk haplotypes for oral carcinoma progression and were also found to be associated with lifestyle factors and clinical aggressiveness. These findings make the TNF-LTA locus a suitable candidate for a future biomarker, which may be used either for early detection or for helping to improve treatment efficacy and effectiveness.

  15. Molecular and immunogenetic analysis of major histocompatibility haplotypes in Northern Bobwhite enable direct identification of corresponding haplotypes in an endangered subspecies, the Masked Bobwhite

    USGS Publications Warehouse

    Drake, B.M.; Goto, R.M.; Miller, M.M.; Gee, G.F.; Briles, W.E.

    1999-01-01

    The major histocompatibility complex (MHC) is a group of genetic loci coding for haplotypes that have been associated with fitness traits in mammals and birds. Such associations suggest that MHC diversity may be an indicator of overall genetic fitness of endangered or threatened species. The MHC haplotypes of a captive population of 12 families of northern bobwhites (Colinus virginianus) were identified using a combination of immunogenetic and molecular techniques. Alloantisera were produced within families of northern bobwhites and were then tested for differential agglutination of erythrocytes of all members of each family. The pattern of reactions determined from testing these alloantisera identified a single genetic system of alloantigens in the northern bobwhites, resulting in the assignment of a tentative genotype to each individual within the quail families. Restriction fragment patterns of the DNA of each bird were determined using the chicken MHC B-G cDNA probe bg11. The concordance between the restriction fragment patterns and the alloantisera reactions showed that the alloantisera had identified the MHC of the northern bobwhite and supported the tentative genotype assignments, identifying at least 12 northern bobwhite MHC haplotypes.

  16. A Haplotype Information Theory Method Reveals Genes of Evolutionary Interest in European vs. Asian Pigs.

    PubMed

    Hudson, Nicholas J; Naval-Sánchez, Marina; Porto-Neto, Laercio; Pérez-Enciso, Miguel; Reverter, Antonio

    2018-06-05

    Asian and European wild boars were independently domesticated ca. 10,000 years ago. Since the 17th century, Chinese breeds have been imported to Europe to improve the genetics of European animals by introgression of favourable alleles, resulting in a complex mosaic of haplotypes. To interrogate the structure of these haplotypes further, we have run a new haplotype segregation analysis based on information theory, namely compression efficiency (CE). We applied the approach to sequence data from individuals from each phylogeographic region (n = 23 from Asia and Europe) including a number of major pig breeds. Our genome-wide CE is able to discriminate the breeds in a manner reflecting phylogeography. Furthermore, 24,956 non-overlapping sliding windows (each comprising 1,000 consecutive SNP) were quantified for extent of haplotype sharing within and between Asia and Europe. The genome-wide distribution of extent of haplotype sharing was quite different between groups. Unlike European pigs, Asian pigs haplotype sharing approximates a normal distribution. In line with this, we found the European breeds possessed a number of genomic windows of dramatically higher haplotype sharing than the Asian breeds. Our CE analysis of sliding windows capture some of the genomic regions reported to contain signatures of selection in domestic pigs. Prominent among these regions, we highlight the role of a gene encoding the mitochondrial enzyme LACTB which has been associated with obesity, and the gene encoding MYOG a fundamental transcriptional regulator of myogenesis. The origin of these regions likely reflects either a population bottleneck in European animals, or selective targets on commercial phenotypes reducing allelic diversity in particular genes and/or regulatory regions.

  17. Exploring Climate Niches of Ponderosa Pine (Pinus ponderosa Douglas ex Lawson) Haplotypes in the Western United States: Implications for Evolutionary History and Conservation

    PubMed Central

    Shinneman, Douglas J.; Potter, Kevin M.; Hipkins, Valerie D.

    2016-01-01

    Ponderosa pine (Pinus ponderosa Douglas ex Lawson) occupies montane environments throughout western North America, where it is both an ecologically and economically important tree species. A recent study using mitochondrial DNA analysis demonstrated substantial genetic variation among ponderosa pine populations in the western U.S., identifying 10 haplotypes with unique evolutionary lineages that generally correspond spatially with distributions of the Pacific (P. p. var. ponderosa) and Rocky Mountain (P. p. var. scopulorum) varieties. To elucidate the role of climate in shaping the phylogeographic history of ponderosa pine, we used nonparametric multiplicative regression to develop predictive climate niche models for two varieties and 10 haplotypes and to hindcast potential distribution of the varieties during the last glacial maximum (LGM), ~22,000 yr BP. Our climate niche models performed well for the varieties, but haplotype models were constrained in some cases by small datasets and unmeasured microclimate influences. The models suggest strong relationships between genetic lineages and climate. Particularly evident was the role of seasonal precipitation balance in most models, with winter- and summer-dominated precipitation regimes strongly associated with P. p. vars. ponderosa and scopulorum, respectively. Indeed, where present-day climate niches overlap between the varieties, introgression of two haplotypes also occurs along a steep clinal divide in western Montana. Reconstructed climate niches for the LGM suggest potentially suitable climate existed for the Pacific variety in the California Floristic province, the Great Basin, and Arizona highlands, while suitable climate for the Rocky Mountain variety may have existed across the southwestern interior highlands. These findings underscore potentially unique phylogeographic origins of modern ponderosa pine evolutionary lineages, including potential adaptations to Pleistocene climates associated with discrete

  18. Exploring Climate Niches of Ponderosa Pine (Pinus ponderosa Douglas ex Lawson) Haplotypes in the Western United States: Implications for Evolutionary History and Conservation.

    PubMed

    Shinneman, Douglas J; Means, Robert E; Potter, Kevin M; Hipkins, Valerie D

    2016-01-01

    Ponderosa pine (Pinus ponderosa Douglas ex Lawson) occupies montane environments throughout western North America, where it is both an ecologically and economically important tree species. A recent study using mitochondrial DNA analysis demonstrated substantial genetic variation among ponderosa pine populations in the western U.S., identifying 10 haplotypes with unique evolutionary lineages that generally correspond spatially with distributions of the Pacific (P. p. var. ponderosa) and Rocky Mountain (P. p. var. scopulorum) varieties. To elucidate the role of climate in shaping the phylogeographic history of ponderosa pine, we used nonparametric multiplicative regression to develop predictive climate niche models for two varieties and 10 haplotypes and to hindcast potential distribution of the varieties during the last glacial maximum (LGM), ~22,000 yr BP. Our climate niche models performed well for the varieties, but haplotype models were constrained in some cases by small datasets and unmeasured microclimate influences. The models suggest strong relationships between genetic lineages and climate. Particularly evident was the role of seasonal precipitation balance in most models, with winter- and summer-dominated precipitation regimes strongly associated with P. p. vars. ponderosa and scopulorum, respectively. Indeed, where present-day climate niches overlap between the varieties, introgression of two haplotypes also occurs along a steep clinal divide in western Montana. Reconstructed climate niches for the LGM suggest potentially suitable climate existed for the Pacific variety in the California Floristic province, the Great Basin, and Arizona highlands, while suitable climate for the Rocky Mountain variety may have existed across the southwestern interior highlands. These findings underscore potentially unique phylogeographic origins of modern ponderosa pine evolutionary lineages, including potential adaptations to Pleistocene climates associated with discrete

  19. 17 Y-STR haplotype diversity in São Paulo state (southeast of Brazil).

    PubMed

    de Souza, Leandro Fonseca; da Motta, Carlos Henrique Ares Silveira; Moura-Neto, Rodrigo Soares

    2018-03-12

    A sample of 158 Brazilian males from São Paulo (SP), Brazilian southeast, was typed for 17 Y-STR loci (DYS19, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458, DYS635, YGATA_H4.1, and DYS385ab). A total of 158 haplotypes were identified, of which all were unique. The haplotype diversity and discrimination capacity were calculated in 1.0 and the genetic diversity was 67.4%. Pairwise haplotype distances showed that the São Paulo population is not significantly different from Rio de Janeiro and Portugal, but is different from African and Native American.

  20. A Candidate Trans-acting Modulator of Fetal Hemoglobin Gene Expression in the Arab-Indian Haplotype of Sickle Cell Anemia

    PubMed Central

    Vathipadiekal, Vinod; Farrell, John J.; Wang, Shuai; Edward, Heather L.; Shappell, Heather; Al-Rubaish, A.M.; Al-Muhanna, Fahad; Naserullah, Z.; Alsuliman, A.; Qutub, Hatem Othman; Simkin, Irene; Farrer, Lindsay A.; Jiang, Zhihua; Luo, Hong-Yuan; Huang, Shengwen; Mostoslavsky, Gustavo; Murphy, George J.; Patra, Pradeep.K.; Chui, David H.K.; Alsultan, Abdulrahman; Al-Ali, Amein K.; Sebastiani, Paola.; Steinberg, Martin. H.

    2016-01-01

    Fetal hemoglobin (HbF) levels are higher in the Arab-Indian (AI) β-globin gene haplotype of sickle cell anemia compared with African-origin haplotypes. To study genetic elements that effect HbF expression in the AI haplotype we completed whole genome sequencing in 14 Saudi AI haplotype sickle hemoglobin homozygotes—seven selected for low HbF (8.2±1.3%) and seven selected for high HbF (23.5±.2.6%). An intronic single nucleotide polymorphism (SNP) in ANTXR1, an anthrax toxin receptor (chromosome 2p13), was associated with HbF. These results were replicated in two independent Saudi AI haplotype cohorts of 120 and 139 patients, but not in 76 Saudi Benin haplotype, 894 African origin haplotype and 44 Arab Indian haplotype patients of Indian descent, suggesting that this association is effective only in the Saudi AI haplotype background. ANTXR1 variants explained 10% of the HbF variability compared with 8% for BCL11A. These two genes had independent, additive effects on HbF and together explained about 15% of HbF variability in Saudi AI sickle cell anemia patients. ANTXR1 was expressed at mRNA and protein levels in erythroid progenitors derived from induced pluripotent stem cells (iPSCs) and CD34+ cells. As CD34+ cells matured and their HbF decreased ANTXR1 expression increased; as iPSCs differentiated and their HbF increased, ANTXR1 expression decreased. Along with elements in cis to the HbF genes, ANTXR1 contributes to the variation in HbF in Saudi AI haplotype sickle cell anemia and is the first gene in trans to HBB that is associated with HbF only in carriers of the Saudi AI haplotype. PMID:27501013

  1. Mitochondrial DNA haplotype distribution patterns in Pinus ponderosa (Pinaceae): range-wide evolutionary history and implications for conservation.

    PubMed

    Potter, Kevin M; Hipkins, Valerie D; Mahalovich, Mary F; Means, Robert E

    2013-08-01

    Ponderosa pine (Pinus ponderosa Douglas ex P. Lawson & C. Lawson) exhibits complicated patterns of morphological and genetic variation across its range in western North America. This study aims to clarify P. ponderosa evolutionary history and phylogeography using a highly polymorphic mitochondrial DNA marker, with results offering insights into how geographical and climatological processes drove the modern evolutionary structure of tree species in the region. We amplified the mtDNA nad1 second intron minisatellite region for 3,100 trees representing 104 populations, and sequenced all length variants. We estimated population-level haplotypic diversity and determined diversity partitioning among varieties, races and populations. After aligning sequences of minisatellite repeat motifs, we evaluated evolutionary relationships among haplotypes. The geographical structuring of the 10 haplotypes corresponded with division between Pacific and Rocky Mountain varieties. Pacific haplotypes clustered with high bootstrap support, and appear to have descended from Rocky Mountain haplotypes. A greater proportion of diversity was partitioned between Rocky Mountain races than between Pacific races. Areas of highest haplotypic diversity were the southern Sierra Nevada mountain range in California, northwestern California, and southern Nevada. Pinus ponderosa haplotype distribution patterns suggest a complex phylogeographic history not revealed by other genetic and morphological data, or by the sparse paleoecological record. The results appear consistent with long-term divergence between the Pacific and Rocky Mountain varieties, along with more recent divergences not well-associated with race. Pleistocene refugia may have existed in areas of high haplotypic diversity, as well as the Great Basin, Southwestern United States/northern Mexico, and the High Plains.

  2. ABO, Rhesus, and Kell Antigens, Alleles, and Haplotypes in West Bengal, India

    PubMed Central

    Basu, Debapriya; Datta, Suvro Sankha; Montemayor, Celina; Bhattacharya, Prasun; Mukherjee, Krishnendu; Flegel, Willy A.

    2018-01-01

    Background Few studies have documented the blood group antigens in the population of eastern India. Frequencies of some common alleles and haplotypes were unknown. We describe phenotype, allele, and haplotype frequencies in the state of West Bengal, India. Methods We tested 1,528 blood donors at the Medical College Hospital, Kolkata. The common antigens of the ABO, Rhesus, and Kell blood group systems were determined by standard serologic methods in tubes. Allele and haplotype frequencies were calculated with an iterative method that yielded maximum-likelihood estimates under the assumption of a Hardy-Weinberg equilibrium. Results The prevalence of ABO antigens were B (34%), O (32%), A (25%), and AB (9%) with ABO allele frequencies for O = 0.567, A = 0.189, and B = 0.244. The D antigen (RH1) was observed in 96.6% of the blood donors with RH haplotype frequencies, such as for CDe = 0.688809, cde = 0.16983 and CdE = 0.000654. The K antigen (K1) was observed in 12 donors (0.79%) with KEL allele frequencies for K = 0.004 and k = 0.996. Conclusions: For the Bengali population living in the south of West Bengal, we established the frequencies of the major clinically relevant antigens in the ABO, Rhesus, and Kell blood group systems and derived estimates for the underlying ABO and KEL alleles and RH haplotypes. Such blood donor screening will improve the availability of compatible red cell units for transfusion. Our approach using widely available routine methods can readily be applied in other regions, where the sufficient supply of blood typed for the Rh and K antigens is lacking. PMID:29593462

  3. Haplotype structure in Ashkenazi Jewish BRCA1 and BRCA2 mutation carriers

    PubMed Central

    Im, Kate M.; Kirchhoff, Tomas; Wang, Xianshu; Green, Todd; Chow, Clement Y.; Vijai, Joseph; Korn, Joshua; Gaudet, Mia M.; Fredericksen, Zachary; Pankratz, V. Shane; Guiducci, Candace; Crenshaw, Andrew; McGuffog, Lesley; Kartsonaki, Christiana; Morrison, Jonathan; Healey, Sue; Sinilnikova, Olga M.; Mai, Phuong L.; Greene, Mark H.; Piedmonte, Marion; Rubinstein, Wendy S.; Hogervorst, Frans B.; Rookus, Matti A.; Collée, J. Margriet; Hoogerbrugge, Nicoline; van Asperen, Christi J.; Meijers-Heijboer, Hanne E. J.; Van Roozendaal, Cees E.; Caldes, Trinidad; Perez-Segura, Pedro; Jakubowska, Anna; Lubinski, Jan; Huzarski, Tomasz; Blecharz, Paweł; Nevanlinna, Heli; Aittomäki, Kristiina; Lazaro, Conxi; Blanco, Ignacio; Barkardottir, Rosa B.; Montagna, Marco; D'Andrea, Emma; Devilee, Peter; Olopade, Olufunmilayo I.; Neuhausen, Susan L.; Peissel, Bernard; Bonanni, Bernardo; Peterlongo, Paolo; Singer, Christian F.; Rennert, Gad; Lejbkowicz, Flavio; Andrulis, Irene L.; Glendon, Gord; Ozcelik, Hilmi; Toland, Amanda Ewart; Caligo, Maria Adelaide; Beattie, Mary S.; Chan, Salina; Domchek, Susan M.; Nathanson, Katherine L.; Rebbeck, Timothy R.; Phelan, Catherine; Narod, Steven; John, Esther M.; Hopper, John L.; Buys, Saundra S.; Daly, Mary B.; Southey, Melissa C.; Terry, Mary-Beth; Tung, Nadine; Hansen, Thomas v. O.; Osorio, Ana; Benitez, Javier; Durán, Mercedes; Weitzel, Jeffrey N.; Garber, Judy; Hamann, Ute; Peock, Susan; Cook, Margaret; Oliver, Clare T.; Frost, Debra; Platte, Radka; Evans, D. Gareth; Eeles, Ros; Izatt, Louise; Paterson, Joan; Brewer, Carole; Hodgson, Shirley; Morrison, Patrick J.; Porteous, Mary; Walker, Lisa; Rogers, Mark T.; Side, Lucy E.; Godwin, Andrew K.; Schmutzler, Rita K.; Wappenschmidt, Barbara; Laitman, Yael; Meindl, Alfons; Deissler, Helmut; Varon-Mateeva, Raymonda; Preisler-Adams, Sabine; Kast, Karin; Venat-Bouvet, Laurence; Stoppa-Lyonnet, Dominique; Chenevix-Trench, Georgia; Easton, Douglas F.; Klein, Robert J.; Daly, Mark J.; Friedman, Eitan; Dean, Michael; Clark, Andrew G.; Altshuler, David M.; Antoniou, Antonis C.; Couch, Fergus J.; Offit, Kenneth; Gold, Bert

    2011-01-01

    Abstract Three founder mutations in BRCA1 and BRCA2 contribute to the risk of hereditary breast and ovarian cancer in Ashkenazi Jews (AJ). They are observed at increased frequency in the AJ compared to other BRCA mutations in Caucasian non-Jews (CNJ). Several authors have proposed that elevated allele frequencies in the surrounding genomic regions reflect adaptive or balancing selection. Such proposals predict long-range linkage dis-equilibrium (LD) resulting from a selective sweep, although genetic drift in a founder population may also act to create long-distance LD. To date, few studies have used the tools of statistical genomics to examine the likelihood of long-range LD at a deleterious locus in a population that faced a genetic bottleneck. We studied the genotypes of hundreds of women from a large international consortium of BRCA1 and BRCA2 mutation carriers and found that AJ women exhibited long-range haplotypes compared to CNJ women. More than 50% of the AJ chromosomes with the BRCA1 185delAG mutation share an identical 2.1 Mb haplotype and nearly 16% of AJ chromosomes carrying the BRCA2 6174delT mutation share a 1.4 Mb haplotype. Simulations based on the best inference of Ashkenazi population demography indicate that long-range haplotypes are expected in the context of a genome-wide survey. Our results are consistent with the hypothesis that a local bottleneck effect from population size constriction events could by chance have resulted in the large haplotype blocks observed at high frequency in the BRCA1 and BRCA2 regions of Ashkenazi Jews. PMID:21597964

  4. Global variation in CYP2C8–CYP2C9 functional haplotypes

    PubMed Central

    Speed, William C; Kang, Soonmo Peter; Tuck, David P; Harris, Lyndsay N; Kidd, Kenneth K

    2009-01-01

    We have studied the global frequency distributions of 10 single nucleotide polymorphisms (SNPs) across 132 kb of CYP2C8 and CYP2C9 in ∼2500 individuals representing 45 populations. Five of the SNPs were in noncoding sequences; the other five involved the more common missense variants (four in CYP2C8, one in CYP2C9) that change amino acids in the gene products. One haplotype containing two CYP2C8 coding variants and one CYP2C9 coding variant reaches an average frequency of 10% in Europe; a set of haplotypes with a different CYP2C8 coding variant reaches 17% in Africa. In both cases these haplotypes are found in other regions of the world at <1%. This considerable geographic variation in haplotype frequencies impacts the interpretation of CYP2C8/CYP2C9 association studies, and has pharmacogenomic implications for drug interactions. PMID:19381162

  5. Mitochondrial DNA and trade data support multiple origins of Helicoverpa armigera (Lepidoptera, Noctuidae) in Brazil

    PubMed Central

    Tay, Wee Tek; Walsh, Thomas K.; Downes, Sharon; Anderson, Craig; Jermiin, Lars S.; Wong, Thomas K. F.; Piper, Melissa C.; Chang, Ester Silva; Macedo, Isabella Barony; Czepak, Cecilia; Behere, Gajanan T.; Silvie, Pierre; Soria, Miguel F.; Frayssinet, Marie; Gordon, Karl H. J.

    2017-01-01

    The Old World bollworm Helicoverpa armigera is now established in Brazil but efforts to identify incursion origin(s) and pathway(s) have met with limited success due to the patchiness of available data. Using international agricultural/horticultural commodity trade data and mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and cytochrome b (Cyt b) gene markers, we inferred the origins and incursion pathways into Brazil. We detected 20 mtDNA haplotypes from six Brazilian states, eight of which were new to our 97 global COI-Cyt b haplotype database. Direct sequence matches indicated five Brazilian haplotypes had Asian, African, and European origins. We identified 45 parsimoniously informative sites and multiple substitutions per site within the concatenated (945 bp) nucleotide dataset, implying that probabilistic phylogenetic analysis methods are needed. High diversity and signatures of uniquely shared haplotypes with diverse localities combined with the trade data suggested multiple incursions and introduction origins in Brazil. Increasing agricultural/horticultural trade activities between the Old and New Worlds represents a significant biosecurity risk factor. Identifying pest origins will enable resistance profiling that reflects countries of origin to be included when developing a resistance management strategy, while identifying incursion pathways will improve biosecurity protocols and risk analysis at biosecurity hotspots including national ports. PMID:28350004

  6. Mitochondrial DNA and trade data support multiple origins of Helicoverpa armigera (Lepidoptera, Noctuidae) in Brazil.

    PubMed

    Tay, Wee Tek; Walsh, Thomas K; Downes, Sharon; Anderson, Craig; Jermiin, Lars S; Wong, Thomas K F; Piper, Melissa C; Chang, Ester Silva; Macedo, Isabella Barony; Czepak, Cecilia; Behere, Gajanan T; Silvie, Pierre; Soria, Miguel F; Frayssinet, Marie; Gordon, Karl H J

    2017-03-28

    The Old World bollworm Helicoverpa armigera is now established in Brazil but efforts to identify incursion origin(s) and pathway(s) have met with limited success due to the patchiness of available data. Using international agricultural/horticultural commodity trade data and mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and cytochrome b (Cyt b) gene markers, we inferred the origins and incursion pathways into Brazil. We detected 20 mtDNA haplotypes from six Brazilian states, eight of which were new to our 97 global COI-Cyt b haplotype database. Direct sequence matches indicated five Brazilian haplotypes had Asian, African, and European origins. We identified 45 parsimoniously informative sites and multiple substitutions per site within the concatenated (945 bp) nucleotide dataset, implying that probabilistic phylogenetic analysis methods are needed. High diversity and signatures of uniquely shared haplotypes with diverse localities combined with the trade data suggested multiple incursions and introduction origins in Brazil. Increasing agricultural/horticultural trade activities between the Old and New Worlds represents a significant biosecurity risk factor. Identifying pest origins will enable resistance profiling that reflects countries of origin to be included when developing a resistance management strategy, while identifying incursion pathways will improve biosecurity protocols and risk analysis at biosecurity hotspots including national ports.

  7. Mitochondrial DNA and trade data support multiple origins of Helicoverpa armigera (Lepidoptera, Noctuidae) in Brazil

    NASA Astrophysics Data System (ADS)

    Tay, Wee Tek; Walsh, Thomas K.; Downes, Sharon; Anderson, Craig; Jermiin, Lars S.; Wong, Thomas K. F.; Piper, Melissa C.; Chang, Ester Silva; Macedo, Isabella Barony; Czepak, Cecilia; Behere, Gajanan T.; Silvie, Pierre; Soria, Miguel F.; Frayssinet, Marie; Gordon, Karl H. J.

    2017-03-01

    The Old World bollworm Helicoverpa armigera is now established in Brazil but efforts to identify incursion origin(s) and pathway(s) have met with limited success due to the patchiness of available data. Using international agricultural/horticultural commodity trade data and mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and cytochrome b (Cyt b) gene markers, we inferred the origins and incursion pathways into Brazil. We detected 20 mtDNA haplotypes from six Brazilian states, eight of which were new to our 97 global COI-Cyt b haplotype database. Direct sequence matches indicated five Brazilian haplotypes had Asian, African, and European origins. We identified 45 parsimoniously informative sites and multiple substitutions per site within the concatenated (945 bp) nucleotide dataset, implying that probabilistic phylogenetic analysis methods are needed. High diversity and signatures of uniquely shared haplotypes with diverse localities combined with the trade data suggested multiple incursions and introduction origins in Brazil. Increasing agricultural/horticultural trade activities between the Old and New Worlds represents a significant biosecurity risk factor. Identifying pest origins will enable resistance profiling that reflects countries of origin to be included when developing a resistance management strategy, while identifying incursion pathways will improve biosecurity protocols and risk analysis at biosecurity hotspots including national ports.

  8. Genetic differences in the two main groups of the Japanese population based on autosomal SNPs and haplotypes.

    PubMed

    Yamaguchi-Kabata, Yumi; Tsunoda, Tatsuhiko; Kumasaka, Natsuhiko; Takahashi, Atsushi; Hosono, Naoya; Kubo, Michiaki; Nakamura, Yusuke; Kamatani, Naoyuki

    2012-05-01

    Although the Japanese population has a rather low genetic diversity, we recently confirmed the presence of two main clusters (the Hondo and Ryukyu clusters) through principal component analysis of genome-wide single-nucleotide polymorphism (SNP) genotypes. Understanding the genetic differences between the two main clusters requires further genome-wide analyses based on a dense SNP set and comparison of haplotype frequencies. In the present study, we determined haplotypes for the Hondo cluster of the Japanese population by detecting SNP homozygotes with 388,591 autosomal SNPs from 18,379 individuals and estimated the haplotype frequencies. Haplotypes for the Ryukyu cluster were inferred by a statistical approach using the genotype data from 504 individuals. We then compared the haplotype frequencies between the Hondo and Ryukyu clusters. In most genomic regions, the haplotype frequencies in the Hondo and Ryukyu clusters were very similar. However, in addition to the human leukocyte antigen region on chromosome 6, other genomic regions (chromosomes 3, 4, 5, 7, 10 and 12) showed dissimilarities in haplotype frequency. These regions were enriched for genes involved in the immune system, cell-cell adhesion and the intracellular signaling cascade. These differentiated genomic regions between the Hondo and Ryukyu clusters are of interest because they (1) should be examined carefully in association studies and (2) likely contain genes responsible for morphological or physiological differences between the two groups.

  9. Meta-analysis of haplotype-association studies: comparison of methods and empirical evaluation of the literature

    PubMed Central

    2011-01-01

    Background Meta-analysis is a popular methodology in several fields of medical research, including genetic association studies. However, the methods used for meta-analysis of association studies that report haplotypes have not been studied in detail. In this work, methods for performing meta-analysis of haplotype association studies are summarized, compared and presented in a unified framework along with an empirical evaluation of the literature. Results We present multivariate methods that use summary-based data as well as methods that use binary and count data in a generalized linear mixed model framework (logistic regression, multinomial regression and Poisson regression). The methods presented here avoid the inflation of the type I error rate that could be the result of the traditional approach of comparing a haplotype against the remaining ones, whereas, they can be fitted using standard software. Moreover, formal global tests are presented for assessing the statistical significance of the overall association. Although the methods presented here assume that the haplotypes are directly observed, they can be easily extended to allow for such an uncertainty by weighting the haplotypes by their probability. Conclusions An empirical evaluation of the published literature and a comparison against the meta-analyses that use single nucleotide polymorphisms, suggests that the studies reporting meta-analysis of haplotypes contain approximately half of the included studies and produce significant results twice more often. We show that this excess of statistically significant results, stems from the sub-optimal method of analysis used and, in approximately half of the cases, the statistical significance is refuted if the data are properly re-analyzed. Illustrative examples of code are given in Stata and it is anticipated that the methods developed in this work will be widely applied in the meta-analysis of haplotype association studies. PMID:21247440

  10. Construction and forensic genetic characterization of 11 autosomal haplotypes consisting of 22 tri-allelic indels.

    PubMed

    Zhao, Xiaohong; Chen, Xiaogang; Zhao, Yuancun; Zhang, Shu; Gao, Zehua; Yang, Yiwen; Wang, Yufang; Zhang, Ji

    2018-05-01

    Insertion/deletion polymorphisms (indels), which combine the advantages of both short tandem repeats and single-nucleotide polymorphisms, are suitable for parentage testing. To overcome the limitations of the low polymorphism of di-allelic indels, we constructed a set of haplotypes with physically linked, multi-allelic indels. Candidate haplotypes were selected from the 1000 Genomes Project database, and were subject to the following criteria for inclusion: (i) each marker must have a minimum allele frequency (MAF) of ≥0.1 in the Han population of China; (ii) markers must exist in a non-coding region; (iii) the physical distance between a pair of candidate indels must be <500 bp; (iv) the allele length variation of each indel from 1 to 20 bp; (v) different haplotypes must be located on different chromosomes or chromosomal arms, or be more than 10 Mb apart if on the same chromosomal arm; and (vi) they must not be located across a recombination hotspot. A multiplex system with 11 haplotype markers, comprising 22 tri-allelic indel loci distributed over 10 chromosomes was developed. To validate the multiplex panel, we investigated the haplotype distribution in sets of two and three-generation pedigrees. The results demonstrated that the haplotypes consisting of multi-allelic indel markers exhibited higher polymorphism than a single indel locus, and thus provide Supplementary information for forensic kinship identification. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Dominant Sequences of Human Major Histocompatibility Complex Conserved Extended Haplotypes from HLA-DQA2 to DAXX

    PubMed Central

    Larsen, Charles E.; Alford, Dennis R.; Trautwein, Michael R.; Jalloh, Yanoh K.; Tarnacki, Jennifer L.; Kunnenkeri, Sushruta K.; Fici, Dolores A.; Yunis, Edmond J.; Awdeh, Zuheir L.; Alper, Chester A.

    2014-01-01

    We resequenced and phased 27 kb of DNA within 580 kb of the MHC class II region in 158 population chromosomes, most of which were conserved extended haplotypes (CEHs) of European descent or contained their centromeric fragments. We determined the single nucleotide polymorphism and deletion-insertion polymorphism alleles of the dominant sequences from HLA-DQA2 to DAXX for these CEHs. Nine of 13 CEHs remained sufficiently intact to possess a dominant sequence extending at least to DAXX, 230 kb centromeric to HLA-DPB1. We identified the regions centromeric to HLA-DQB1 within which single instances of eight “common” European MHC haplotypes previously sequenced by the MHC Haplotype Project (MHP) were representative of those dominant CEH sequences. Only two MHP haplotypes had a dominant CEH sequence throughout the centromeric and extended class II region and one MHP haplotype did not represent a known European CEH anywhere in the region. We identified the centromeric recombination transition points of other MHP sequences from CEH representation to non-representation. Several CEH pairs or groups shared sequence identity in small blocks but had significantly different (although still conserved for each separate CEH) sequences in surrounding regions. These patterns partly explain strong calculated linkage disequilibrium over only short (tens to hundreds of kilobases) distances in the context of a finite number of observed megabase-length CEHs comprising half a population's haplotypes. Our results provide a clearer picture of European CEH class II allelic structure and population haplotype architecture, improved regional CEH markers, and raise questions concerning regional recombination hotspots. PMID:25299700

  12. F8 haplotype and inhibitor risk: results from the Hemophilia Inhibitor Genetics Study (HIGS) Combined Cohort

    PubMed Central

    Schwarz, John; Astermark, Jan; Menius, Erika D.; Carrington, Mary; Donfield, Sharyne M.; Gomperts, Edward D.; Nelson, George W.; Oldenburg, Johannes; Pavlova, Anna; Shapiro, Amy D.; Winkler, Cheryl A.; Berntorp, Erik

    2012-01-01

    Background Ancestral background, specifically African descent, confers higher risk for development of inhibitory antibodies to factor VIII (FVIII) in hemophilia A. It has been suggested that differences in the distribution of factor VIII gene (F8) haplotypes, and mismatch between endogenous F8 haplotypes and those comprising products used for treatment could contribute to risk. Design and Methods Data from the HIGS Combined Cohort were used to determine the association between F8 haplotype 3 (H3) vs. haplotypes 1 and 2 (H1+H2) and inhibitor risk among individuals of genetically-determined African descent. Other variables known to affect inhibitor risk including type of F8 mutation and HLA were included in the analysis. A second research question regarding risk related to mismatch in endogenous F8 haplotype and recombinant FVIII products used for treatment was addressed. Results H3 was associated with higher inhibitor risk among those genetically-identified (N=49) as of African ancestry, but the association did not remain significant after adjustment for F8 mutation type and the HLA variables. Among subjects of all racial ancestries enrolled in HIGS who reported early use of recombinant products (N=223), mismatch in endogenous haplotype and the FVIII proteins constituting the products used did not confer greater risk for inhibitor development. Conclusion H3 was not an independent predictor of inhibitor risk. Further, our findings did not support a higher risk of inhibitors in the presence of a haplotype mismatch between the FVIII molecule infused and that of the individual. PMID:22958194

  13. HLA-DR2-associated DRB1 and DRB5 alleles and haplotypes in Koreans.

    PubMed

    Song, E Y; Kang, S J; Lee, Y J; Park, M H

    2000-09-01

    There are considerable racial differences in the distribution of HLA-DR2-associated DRB1 and DRB5 alleles and the characteristics of linkage disequilibrium between these alleles. In this study, the frequencies of DR2-associated DRB1 and DRB5 alleles and related haplotypes were analyzed in 186 DR2-positive individuals out of 800 normal Koreans registered for unrelated bone marrow donors. HLA class I antigen typing was performed by the serological method and DRB1 and DRB5 genotyping by the PCR-single strand conformational polymorphism method. Only 3 alleles were detected for DR2-associated DRB1 and DRB5 genes, respectively: DRB1(*)1501 (gene frequency 8.0%), (*)1502 (3.2%), (*)1602 (0.9%); DRB5(*)0101 (8.0%), (*)0102 (3.2%), and (*)0202 (0.9%). DRB1-DRB5 haplotype analysis showed an exclusive association between these alleles: DRB1*1501-DRB5*0101 (haplotype frequency 8.0%), DRB1(*)1502-DRB5(*)0102 (3.2%), and DRB1(*)1602-DRB5(*)0202 (0.9%). The 5 most common DR2-associated A-B-DRB1 haplotypes occurring at frequencies of > or = 0.5% were A24-B52-DRB1(*)1502 (1.8%), A2-B62-DRB1(*)1501, A2-B54-DRB1(*)1501, A26-B61-DRB1(*)1501, and A24-B51-DRB1(*)1501. The remarkable homogeneity in the haplotypic associations between DR2-associated DRB1 and DRB5 alleles in Koreans would be advantageous for organ transplantation compared with other ethnic groups showing considerable heterogeneity in the distribution of DRB1-DRB5 haplotypes.

  14. µ-Calpain, calpastatin, and growth hormone receptor genetic effects on preweaning performance, carcass quality traits, and residual variance of tenderness in Angus cattle selected to increase minor haplotype ... frequencies

    USDA-ARS?s Scientific Manuscript database

    Genetic marker effects and interactions are estimated with poor precision when minor marker allele frequencies are low. An Angus population was subjected to marker assisted selection for multiple years to increase divergent haplotype and minor marker allele frequencies to 1) estimate effect size an...

  15. On the use of haplotype phylogeny to detect disease susceptibility loci

    PubMed Central

    Bardel, Claire; Danjean, Vincent; Hugot, Jean-Pierre; Darlu, Pierre; Génin, Emmanuelle

    2005-01-01

    Background The cladistic approach proposed by Templeton has been presented as promising for the study of the genetic factors involved in common diseases. This approach allows the joint study of multiple markers within a gene by considering haplotypes and grouping them in nested clades. The idea is to search for clades with an excess of cases as compared to the whole sample and to identify the mutations defining these clades as potential candidate disease susceptibility sites. However, the performance of this approach for the study of the genetic factors involved in complex diseases has never been studied. Results In this paper, we propose a new method to perform such a cladistic analysis and we estimate its power through simulations. We show that under models where the susceptibility to the disease is caused by a single genetic variant, the cladistic test is neither really more powerful to detect an association nor really more efficient to localize the susceptibility site than an individual SNP testing. However, when two interacting sites are responsible for the disease, the cladistic analysis greatly improves the probability to find the two susceptibility sites. The impact of the linkage disequilibrium and of the tree characteristics on the efficiency of the cladistic analysis are also discussed. An application on a real data set concerning the CARD15 gene and Crohn disease shows that the method can successfully identify the three variant sites that are involved in the disease susceptibility. Conclusion The use of phylogenies to group haplotypes is especially interesting to pinpoint the sites that are likely to be involved in disease susceptibility among the different markers identified within a gene. PMID:15904492

  16. Estimating haplotype frequencies by combining data from large DNA pools with database information.

    PubMed

    Gasbarra, Dario; Kulathinal, Sangita; Pirinen, Matti; Sillanpää, Mikko J

    2011-01-01

    We assume that allele frequency data have been extracted from several large DNA pools, each containing genetic material of up to hundreds of sampled individuals. Our goal is to estimate the haplotype frequencies among the sampled individuals by combining the pooled allele frequency data with prior knowledge about the set of possible haplotypes. Such prior information can be obtained, for example, from a database such as HapMap. We present a Bayesian haplotyping method for pooled DNA based on a continuous approximation of the multinomial distribution. The proposed method is applicable when the sizes of the DNA pools and/or the number of considered loci exceed the limits of several earlier methods. In the example analyses, the proposed model clearly outperforms a deterministic greedy algorithm on real data from the HapMap database. With a small number of loci, the performance of the proposed method is similar to that of an EM-algorithm, which uses a multinormal approximation for the pooled allele frequencies, but which does not utilize prior information about the haplotypes. The method has been implemented using Matlab and the code is available upon request from the authors.

  17. Functional and genetic analysis of haplotypic sequence variation at the nicastrin genomic locus

    PubMed Central

    Hamilton, Gillian; Killick, Richard; Lambert, Jean-Charles; Amouyel, Philippe; Carrasquillo, Minerva M.; Pankratz, V. Shane; Graff-Radford, Neill R.; Dickson, Dennis W.; Petersen, Ronald C.; Younkin, Steven G.; Powell, John F.; Wade-Martins, Richard

    2013-01-01

    Nicastrin (NCSTN) is a component of the γ-secretase complex and therefore potentially a candidate risk gene for Alzheimer's disease. Here, we have developed a novel functional genomics methodology to express common locus haplotypes to assess functional differences. DNA recombination was used to engineer 5 bacterial artificial chromosomes (BACs) to each express a different haplotype of the NCSTN locus. Each NCSTN-BAC was delivered to knockout nicastrin (Ncstn−/−) cells and clonal NCSTN-BAC+/Ncstn−/− cell lines were created for functional analyses. We showed that all NCSTN-BAC haplotypes expressed nicastrin protein and rescued γ-secretase activity and amyloid beta (Aβ) production in NCSTN-BAC+/Ncstn−/− lines. We then showed that genetic variation at the NCSTN locus affected alternative splicing in human postmortem brain tissue. However, there was no robust functional difference between clonal cell lines rescued by each of the 5 different haplotypes. Finally, there was no statistically significant association of NCSTN with disease risk in the 4 cohorts. We therefore conclude that it is unlikely that common variation at the NCSTN locus is a risk factor for Alzheimer's disease. PMID:22405046

  18. Mitochondrial control region haplotypes of the South American sea lion Otaria flavescens (Shaw, 1800).

    PubMed

    Artico, L O; Bianchini, A; Grubel, K S; Monteiro, D S; Estima, S C; Oliveira, L R de; Bonatto, S L; Marins, L F

    2010-09-01

    The South American sea lion, Otaria flavescens, is widely distributed along the Pacific and Atlantic coasts of South America. However, along the Brazilian coast, there are only two nonbreeding sites for the species (Refúgio de Vida Silvestre da Ilha dos Lobos and Refúgio de Vida Silvestre do Molhe Leste da Barra do Rio Grande), both in Southern Brazil. In this region, the species is continuously under the effect of anthropic activities, mainly those related to environmental contamination with organic and inorganic chemicals and fishery interactions. This paper reports, for the first time, the genetic diversity of O. flavescens found along the Southern Brazilian coast. A 287-bp fragment of the mitochondrial DNA control region (D-loop) was analyzed. Seven novel haplotypes were found in 56 individuals (OFA1-OFA7), with OFA1 being the most frequent (47.54%). Nucleotide diversity was moderate (π = 0.62%) and haplotype diversity was relatively low (67%). Furthermore, the median joining network analysis indicated that Brazilian haplotypes formed a reciprocal monophyletic clade when compared to the haplotypes from the Peruvian population on the Pacific coast. These two populations do not share haplotypes and may have become isolated some time back. Further genetic studies covering the entire species distribution are necessary to better understand the biological implications of the results reported here for the management and conservation of South American sea lions.

  19. Catechol-O-methyltransferase gene haplotypes in Mexican and Spanish patients with fibromyalgia

    PubMed Central

    Vargas-Alarcón, Gilberto; Fragoso, José-Manuel; Cruz-Robles, David; Vargas, Angélica; Vargas, Alfonso; Lao-Villadóniga, José-Ignacio; García-Fructuoso, Ferrán; Ramos-Kuri, Manuel; Hernández, Fernando; Springall, Rashidi; Bojalil, Rafael; Vallejo, Maite; Martínez-Lavín, Manuel

    2007-01-01

    Autonomic dysfunction is frequent in patients with fibromyalgia (FM). Heart rate variability analyses have demonstrated signs of ongoing sympathetic hyperactivity. Catecholamines are sympathetic neurotransmitters. Catechol-O-methyltransferase (COMT), an enzyme, is the major catecholamine-clearing pathway. There are several single-nucleotide polymorphisms (SNPs) in the COMT gene associated with the different catecholamine-clearing abilities of the COMT enzyme. These SNPs are in linkage disequilibrium and segregate as 'haplotypes'. Healthy females with a particular COMT gene haplotype (ACCG) producing a defective enzyme are more sensitive to painful stimuli. The objective of our study was to define whether women with FM, from two different countries (Mexico and Spain), have the COMT gene haplotypes that have been previously associated with greater sensitivity to pain. All the individuals in the study were female. Fifty-seven Mexican patients and 78 Spanish patients were compared with their respective healthy control groups. All participants filled out the Fibromyalgia Impact Questionnaire (FIQ). Six COMT SNPs (rs2097903, rs6269, rs4633, rs4818, rs4680, and rs165599) were genotyped from peripheral blood DNA. In Spanish patients, there was a significant association between three SNPs (rs6269, rs4818, and rs4680) and the presence of FM when compared with healthy controls. Moreover, in Spanish patients with the 'high pain sensitivity' haplotype (ACCG), the disease, as assessed by the FIQ, was more severe. By contrast, Mexican patients displayed only a weak association between rs6269 and rs165599, and some FIQ subscales. In our group of Spanish patients, there was an association between FM and the COMT haplotype previously associated with high pain sensitivity. This association was not observed in Mexican patients. Studies with a larger sample size are needed in order to verify or amend these preliminary results. PMID:17961261

  20. Haplotype analysis of the polymorphic 40 Y-STR markers in Chinese populations.

    PubMed

    Ou, Xueling; Wang, Ying; Liu, Chao; Yang, Donggui; Zhang, Chuchu; Deng, Shujiao; Sun, Hongyu

    2015-11-01

    Forty Y-STR loci were analyzed in 1128 males from the following six Chinese ethnic populations: Han (n=300), Hui (n=244), Korean (n=100), Mongolian (n=100), Uighur (n=284) and Tibetan (n=100), utilizing two new generation multiplex Y-STR systems, AGCU Y24 STR and GFS Y24 STR genotyping kits, which allow for the genotyping of 24 loci from a single amplification reaction in each system. The lowest estimates of genetic diversity (below 0.5) correspond to markers DYS391 (0.441658) and DYS437 (0.496977), and the greatest diversity corresponds to markers DYS385a/b (0.969919) and DYS527a/b (0.94676). A considerable number of duplicate and off-ladder alleles were also revealed. Additionally, there were 1111 different haplotypes identified from the total 1128 samples, of which 1095 were unique. Notably, no shared haplotypes between populations were observed. The estimated overall haplotype diversity (HD) was 0.999085, and its discrimination capacity (DC) was 0.970745. An MDS plot based on the genetic distances between populations showed the genetic similarity of the southern Han population to the Northern populations of Hui, Korean, Mongolian and Uighur and a clear genetic departure of the Tibetan population from other populations. For the Y STR markers, population substructure correction was considered when calculating the rarity of the Y STR profile. However, because the haplotype based Fst values are extremely small within the present data (0.000153 with 40 Y-STRs), no substructure correction is required to estimate the rarity of a haplotype comprising 40 markers. In summary, the results of our study indicate that the 40 Y-STRs have a high level of polymorphism in Chinese ethnic groups and could therefore be a powerful tool for forensic applications and population genetic studies. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  1. Phylogeography of Japanese horse chestnut (Aesculus turbinata) in the Japanese Archipelago based on chloroplast DNA haplotypes.

    PubMed

    Sugahara, Kanako; Kaneko, Yuko; Ito, Satoshi; Yamanaka, Keisuke; Sakio, Hitoshi; Hoshizaki, Kazuhiko; Suzuki, Wajiro; Yamanaka, Norikazu; Setoguchi, Hiroaki

    2011-01-01

    Japanese horse chestnut (Aesculus turbinata: Hippocastanaceae) is one of the typical woody plants that grow in temperate riparian forests in the Japanese Archipelago. To analyze the phylogeography of this plant in the Japanese Archipelago, we determined cpDNA haplotypes for 337 samples from 55 populations covering the entire distribution range. Based on 1,313 bp of two spacers, we determined ten haplotypes that are distinguished from adjacent haplotypes by one or two steps. Most of the populations had a single haplotype, suggesting low diversity. Spatial analysis of molecular variance suggested three obvious phylogeographic structures in western Japan, where Japanese horse chestnut is scattered and isolated in mountainous areas. Conversely, no clear phylogeographic structure was observed from the northern to the southern limit of this species, including eastern Japan, where this plant is more common. Rare and private haplotypes were also found in southwestern Japan, where Japanese horse chestnuts are distributed sparsely. These findings imply that western Japan might have maintained a relatively large habitat for A. turbinata during the Quaternary climatic oscillations, while northerly regions could not.

  2. SLC22A1-ABCB1 haplotype profiles predict imatinib pharmacokinetics in Asian patients with chronic myeloid leukemia.

    PubMed

    Singh, Onkar; Chan, Jason Yongsheng; Lin, Keegan; Heng, Charles Chuah Thuan; Chowbay, Balram

    2012-01-01

    This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM) pharmacokinetics in Asian patients with chronic myeloid leukemia (CML). Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each) and CML patients (n = 38) were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h)) and clearance (CL) were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM) to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T), to be significantly associated with IM clearance (p = 0.013). Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2) L/hr/mg): CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h) than patients carrying 0 or 1 copy [CL (10(-2) L/hr/mg): 2.19 vs 3.29, p = 0.026; C(0h) (10(-6) 1/ml): 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h) (p = 0.002 and 0.009, respectively). This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.

  3. Autosomal dominant retinitis pigmentosa with macular involvement associated with a disease haplotype that included a novel PRPH2 variant (p.Cys250Gly).

    PubMed

    Katagiri, Satoshi; Hayashi, Takaaki; Mizobuchi, Kei; Yoshitake, Kazutoshi; Iwata, Takeshi; Nakano, Tadashi

    2018-06-01

    It is known that PRPH2 variants appear to be rare causes of retinitis pigmentosa (RP) in the Japanese population. The purpose of this study was to describe clinical and genetic features in autosomal dominant RP (adRP) patients with a novel disease-causing variant in the PRHP2 gene. A total of 57 unrelated Japanese probands with adRP were investigated in this study. Comprehensive ophthalmic examinations include fundus photography, fundus autofluorescence imaging, spectral-domain optical coherence tomography, and electroretinography. Whole exome sequencing or Sanger sequencing for 25 targeted exons of multiple genes causing adRP was performed to identify disease-causing variants. Co-segregation and haplotype analyses were performed to determine a disease-causing gene variant and its haplotype. Genetic analysis identified a novel heterozygous PRPH2 variant (c.748T>G, p.Cys250Gly) as disease causing in four probands from four families. The variant co-segregated with the RP phenotype in the eight affected patients in all families. At least three of the four families shared the same haplotype for the variant allele. Clinically, seven of the eight affected patients exhibited typical RP presentation, as well as variable macular involvement including cystoid macular change, vitelliform-like appearance, choroidal neovascularization, and macular atrophy. The same disease haplotype that included a novel PRPH2 variant (p.Cys250Gly) was identified in three of the four Japanese families with adRP, suggesting a founder effect. Our clinical findings indicate that adRP caused by the p.Cys250Gly variant may accompany macular involvement with high frequency.

  4. Association between platelet P2Y12 haplotype and risk of cardiovascular events in chronic coronary disease.

    PubMed

    Schettert, Isolmar T; Pereira, Alexandre C; Lopes, Neuza H; Hueb, Whady A; Krieger, Jose E

    2006-01-01

    A positive association was recently described between P2Y12 platelet receptor H1 and H2 haplotypes and peripheral artery disease. We tested the described P2Y12 receptor haplotypes in a group of patients with coronary artery disease. The P2Y12 platelet receptor H1 and H2 haplotypes was tested in a group of 540 patients enrolled in the Medical, Angioplasty, or Surgery Study II (MASS II), a randomized trial comparing treatments for patients with coronary artery disease (CAD) and preserved left ventricular function. After a 3-year follow-up period, the incidence of the composite end point of cardiac death, myocardial infarction, and refractory angina requiring revascularization was determined in the H1/H1, H1/H2 and H2/H2 haplotype groups. We used Student's t-test and the chi-square test to analyze the differences among groups and Kaplan-Meier method to calculate survival curves. Risk was assessed with the use of a Cox proportional-hazards model. The frequency of haplotypes among studied patients were 410 (75.9%) H1/H1, 119 (22.0%) H1/H2 and 11 (2.1%) H2/H2. The baseline clinical characteristics, mean clinical follow-up time and received treatment of each genotype group were similar. We did not disclose any association between haplotype groups regarding the incidence of any of the studied cardiovascular end-points. This is the first report studying the association of P2Y12 platelet receptor H1 and H2 haplotype and cardiovascular events. Our findings do not provide evidence for a strong association between H1/H1 and H1/H2 haplotypes and a increased risk of cardiovascular events in a population with CAD. Future works should address the role of the H2/H2 haplotype as a genetic marker for cardiovascular events.

  5. Construction of the third-generation Zea mays haplotype map.

    PubMed

    Bukowski, Robert; Guo, Xiaosen; Lu, Yanli; Zou, Cheng; He, Bing; Rong, Zhengqin; Wang, Bo; Xu, Dawen; Yang, Bicheng; Xie, Chuanxiao; Fan, Longjiang; Gao, Shibin; Xu, Xun; Zhang, Gengyun; Li, Yingrui; Jiao, Yinping; Doebley, John F; Ross-Ibarra, Jeffrey; Lorant, Anne; Buffalo, Vince; Romay, M Cinta; Buckler, Edward S; Ware, Doreen; Lai, Jinsheng; Sun, Qi; Xu, Yunbi

    2018-04-01

    Characterization of genetic variations in maize has been challenging, mainly due to deterioration of collinearity between individual genomes in the species. An international consortium of maize research groups combined resources to develop the maize haplotype version 3 (HapMap 3), built from whole-genome sequencing data from 1218 maize lines, covering predomestication and domesticated Zea mays varieties across the world. A new computational pipeline was set up to process more than 12 trillion bp of sequencing data, and a set of population genetics filters was applied to identify more than 83 million variant sites. We identified polymorphisms in regions where collinearity is largely preserved in the maize species. However, the fact that the B73 genome used as the reference only represents a fraction of all haplotypes is still an important limiting factor.

  6. Association of KIR genotypes and haplotypes with susceptibility to chronic hepatitis B virus infection in Chinese Han population.

    PubMed

    Lu, Zhiming; Zhang, Bingchang; Chen, Shijun; Gai, Zhongtao; Feng, Zhaolei; Liu, Xiangdong; Liu, Yiqing; Wen, Xin; Li, Li; Jiao, Yulian; Ma, Chunyan; Shao, Song; Cui, Xiangfa; Chen, Guojian; Li, Jianfeng; Zhao, Yueran

    2008-12-01

    Killer immunoglobulin-like receptor (KIR) genes can regulate the activation of NK and T cells upon interaction with HLA class I molecules. Hepatitis B virus (HBV) infection has been regarded as a multi-factorial disorder disease. Previous studies revealed that KIRs were involved in HCV and HIV infection or clearance. The aim of this study was to explore the possibility of the inheritance of KIR genotypes and haplotypes as a candidate for susceptibility to persistent HBV infection or HBV clearance. The sequence specific primer polymerase chain reaction (SSP-PCR) was employed to identify the KIR genes and pseudogenes in 150 chronic hepatitis B (CHB) patients, 251 spontaneously recovered (SR) controls, and 412 healthy controls. The frequencies of genotype G, M, FZ1 increased in CHB patients compared with healthy control subjects. The frequency of genotype AH was higher in SR controls than that in both CHB patients and healthy controls. The carriage frequencies of genotype G and AH were higher; while, the frequencies of AF and AJ were lower in SR controls than those in healthy control subjects. The frequency of A haplotype was lower, whereas, the frequency of B haplotype was higher in CHB patients and SR controls than those in healthy controls. In healthy controls, haplotype 4 was found lower compared with that in CHB patients and SR controls and the frequency of haplotype 5 was higher in SR controls than that in other two groups. Based on these findings, it seems that the genotypes M and FZ1 are HBV susceptive genotypes; AH, on the other hand, may be protective genotypes that facilitate the clearance of HBV. It appears that the haplotype 4 is HBV susceptive haplotype, whereas, haplotype 5 may be the protective haplotype that facilitates the clearance of HBV.

  7. Cis-acting mutation and duplication: History of molecular evolution in a P450 haplotype responsible for insecticide resistance in Culex quinquefasciatus.

    PubMed

    Itokawa, Kentaro; Komagata, Osamu; Kasai, Shinji; Masada, Masahiro; Tomita, Takashi

    2011-07-01

    A cytochrome P450 gene, Cyp9m10, is more than 200-fold overexpressed in a pyrethroid resistant strain of Culex quinquefasciatus, JPal-per. The haplotype of this strain contains two copies of Cyp9m10 resulted from recent tandem duplication. In this study, we discovered and isolated a Cyp9m10 haplotype closely related to this duplicated Cyp9m10 haplotype from JHB, a strain used for the recent genome project for this mosquito species. The isolated haplotype (JHB-NIID-B haplotype) shared the same insertion of a transposable element upstream of the coding region with JPal-per strain but not duplicated. The JHB-NIID-B haplotype was considered to have diverged from the JPal-per lineage just before the duplication event. Cyp9m10 was moderately overexpressed in larvae with the JHB-NIID-B haplotype. The overexpressions in JHB-NIID-B and JPal-per haplotypes were developmentally regulated in similar pattern indicating both haplotypes share a common cis-acting mutation responsible for the overexpressions. The isolated moderately overexpressed haplotype conferred resistance, however, its efficacy was relatively small. We hypothesized that the first cis-acting mutation modified the consequence of the subsequent duplication in JPal-per lineage to confer stronger phenotypic effect than that if it occurred before the first cis-acting mutation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Patterns of haplotypes for 92 cystic fibrosis mutations: Variability, association and recurrence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morral, N.; Llevadot, R.; Estivill, X.

    1994-09-01

    Most CFTR mutations are very uncommon among the cystic fibrosis population, with frequencies of less than 1%, and many are found only in specific areas. We have analyzed 92 CF mutations for several markers (4 microsatellites and 3 other polymorphisms) scattered in the CFTR gene. Haplotypes associated with these mutations can be used as a framework in the screening of chromosomes carrying unknown mutations. The association between mutation and haplotype reduces the number of mutations it is necessary to search for to a maximum of 16 for the same haplotype. Only mutations {triangle}F508, G542X and N1303K are associated with moremore » than one haplotype as a result of slippage at more than one microsatellite loci, suggesting that these three are the most ancient CF mutations. Recurrence has been found for at least 7 mutations: H199Y, R347P, L558S, R553X, 2184insA, 3272-26A{r_arrow}G, 3849+10kbC{r_arrow}T and R1162X. Also microsatellite analysis of chromosomes of several ethnic origins (Czech, Italian, Russian, Slovac and Spanish) suggested that possibility of three or more independent origins for mutations R334W, R347P, R1162X, and 3849+10kbC{r_arrow}T, which was confirmed by analysis of markers flanking these mutations.« less

  9. Vitamin K epoxide reductase complex subunit 1 (Vkorc1) haplotype diversity in mouse priority strains

    PubMed Central

    Song, Ying; Vera, Nicole; Kohn, Michael H

    2008-01-01

    Background Polymorphisms in the vitamin K-epoxide reductase complex subunit 1 gene, Vkorc1, could affect blood coagulation and other vitamin K-dependent proteins, such as osteocalcin (bone Gla protein, BGP). Here we sequenced the Vkorc1 gene in 40 mouse priority strains. We analyzed Vkorc1 haplotypes with respect to prothrombin time (PT) and bone mineral density and composition (BMD and BMC); phenotypes expected to be vitamin K-dependent and represented by data in the Mouse Phenome Database (MPD). Findings In the commonly used laboratory strains of Mus musculus domesticus we identified only four haplotypes differing in the intron or 5' region sequence of the Vkorc1. Six haplotypes differing by coding and non-coding polymorphisms were identified in the other subspecies of Mus. We detected no significant association of Vkorc1 haplotypes with PT, BMD and BMC within each subspecies of Mus. Vkorc1 haplotype sequences divergence between subspecies was associated with PT, BMD and BMC. Conclusion Phenotypic variation in PT, BMD and BMC within subspecies of Mus, while substantial, appears to be dominated by genetic variation in genes other than the Vkorc1. This was particularly evident for M. m. domesticus, where a single haplotype was observed in conjunction with virtually the entire range of PT, BMD and BMC values of all 5 subspecies of Mus included in this study. Differences in these phenotypes between subspecies also should not be attributed to Vkorc1 variants, but should be viewed as a result of genome wide genetic divergence. PMID:19046458

  10. Huntington disease in the South African population occurs on diverse and ethnically distinct genetic haplotypes

    PubMed Central

    Baine, Fiona K; Kay, Chris; Ketelaar, Maria E; Collins, Jennifer A; Semaka, Alicia; Doty, Crystal N; Krause, Amanda; Jacquie Greenberg, L; Hayden, Michael R

    2013-01-01

    Huntington disease (HD) is a neurodegenerative disorder resulting from the expansion of a CAG trinucleotide repeat in the huntingtin (HTT) gene. Worldwide prevalence varies geographically with the highest figures reported in populations of European ancestry. HD in South Africa has been reported in Caucasian, black and mixed subpopulations, with similar estimated prevalence in the Caucasian and mixed groups and a lower estimate in the black subpopulation. Recent studies have associated specific HTT haplotypes with HD in distinct populations. Expanded HD alleles in Europe occur predominantly on haplogroup A (specifically high-risk variants A1/A2), whereas in East Asian populations, HD alleles are associated with haplogroup C. Whether specific HTT haplotypes associate with HD in black Africans and how these compare with haplotypes found in European and East Asian populations remains unknown. The current study genotyped the HTT region in unaffected individuals and HD patients from each of the South African subpopulations, and haplotypes were constructed. CAG repeat sizes were determined and phased to haplotype. Results indicate that HD alleles from Caucasian and mixed patients are predominantly associated with haplogroup A, signifying a similar European origin for HD. However, in black patients, HD occurs predominantly on haplogroup B, suggesting several distinct origins of the mutation in South Africa. The absence of high-risk variants (A1/A2) in the black subpopulation may also explain the reported low prevalence of HD. Identification of haplotypes associated with HD-expanded alleles is particularly relevant to the development of population-specific therapeutic targets for selective suppression of the expanded HTT transcript. PMID:23463025

  11. Haploidentical and Matched Sibling Donor Hematopoietic Cell Transplantation for Patients with HLA-Homozygous Haplotypes.

    PubMed

    Kanda, Junya; Ikegame, Kazuhiro; Fuji, Shigeo; Kurokawa, Mineo; Kanamori, Heiwa; Fukuda, Takahiro; Ohashi, Kazuteru; Ishikawa, Jun; Ogawa, Hiroyasu; Inoue, Masami; Ichinohe, Tatsuo; Atsuta, Yoshiko; Kanda, Yoshinobu

    2016-11-01

    More than 1% of the Japanese population has HLA-homozygous haplotypes. For patients with such haplotypes, HLA-haploidentical family members who have no HLA mismatch in the graft-versus-host direction are readily available donor candidates for hematopoietic cell transplantation (HCT). In this study, the outcomes of patients with homozygous HLA-A, -B, and -DRB1 antigens who received HCT without T cell depletion from a haploidentical related donor with mismatches in the host-versus-graft direction only (hetero-to-homo, n = 78) or from an HLA-matched sibling donor (MSD) (MSD-homo, n = 153) were compared with those in patients with heterozygous haplotypes who received HCT from an MSD (MSD-hetero, n = 7242). Transplant outcomes in the hetero-to-homo group were similar to those in the MSD-hetero group regarding neutrophil engraftment, grades III to IV acute graft-versus-host disease (aGVHD), nonrelapse mortality (NRM), relapse, and overall survival. On the other hand, the incidences of severe aGVHD and NRM in the MSD-homo group were significantly lower than those in the MSD-hetero group (grades III to IV aGVHD: aHR .50, P = .034; NRM: aHR .48, P = .004). In conclusion, patients with HLA-homozygous haplotypes achieved lower GVHD and NRM rates for MSD transplantation than those with HLA-heterozygous haplotypes. When an MSD or an appropriate alternative donor is not available for patients with HLA-homozygous haplotypes who need immediate transplantation, transplantation from a haploidentical donor without T cell depletion is a viable option, given the comparable transplant outcomes for hetero-to-homo HCT and MSD-hetero HCT. Copyright © 2016 The American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.

  12. HIGH-THROUGHPUT IDENTIFICATION OF THE PREDOMINANT MALARIA PARASITE CLONE IN COMPLEX BLOOD STAGE INFECTIONS USING A MULTI-SNP MOLECULAR HAPLOTYPING ASSAY

    PubMed Central

    COLE-TOBIAN, JENNIFER L.; ZIMMERMAN, PETER A.; KING, CHRISTOPHER L.

    2013-01-01

    Individuals living in malaria endemic areas are often infected with multiple parasite clones. Currently used single nucleotide polymorphism (SNP) genotyping methods for malaria parasites are cumbersome; furthermore, few methods currently exist that can rapidly determine the most abundant clone in these complex infections. Here we describe an oligonucleotide ligation assay (OLA) to distinguish SNPs in the Plasmodium vivax Duffy binding protein gene (Pvdbp) at 14 polymorphic residues simultaneously. Allele abundance is determined by the highest mean fluorescent intensity of each allele. Using mixtures of plasmids encoding known haplotypes of the Pvdbp, single clones of P. vivax parasites from infected Aotus monkeys, and well-defined mixed infections from field samples, we were able to identify the predominant Pvdbp genotype with > 93% accuracy when the dominant clone is twice as abundant as a lesser genotype and > 97% of the time if the ratio was 5:1 or greater. Thus, the OLA can accurately, reproducibly, and rapidly determine the predominant parasite haplotype in complex blood stage infections. PMID:17255222

  13. Nomenclature of mitochondrial DNA haplotypes for Oncorhynchus mykiss

    USGS Publications Warehouse

    Graziano, Sara L.; Brown, K.H.; Nielsen, Jennifer L.

    2005-01-01

    Congruence of genetic data is critical for comparative and collaborative studies on natural fish populations. A comprehensive list of reported mitochrondrial DNA haplotypes for Oncorhynchus mykiss generated using the S-Phe/P2 primer set is presented as a resource for future investigations of this species.

  14. A founder haplotype of APOE-Sendai mutation associated with lipoprotein glomerulopathy.

    PubMed

    Toyota, Kentaro; Hashimoto, Taeko; Ogino, Daisuke; Matsunaga, Akira; Ito, Minoru; Masakane, Ikuto; Degawa, Noriyuki; Sato, Hiroshi; Shirai, Sayuri; Umetsu, Kazuo; Tamiya, Gen; Saito, Takao; Hayasaka, Kiyoshi

    2013-05-01

    Lipoprotein glomerulopathy (LPG) is a hereditary disease characterized by lipoprotein thrombi in the glomerulus, hyperlipoproteinemia, and a marked increase in serum apolipoprotein E (APOE). More than 12 APOE mutations have been identified as causes of LPG, and APOE-Sendai (Arg145Pro) mutation was frequently detected in patients from the eastern part of Japan including Yamagata prefecture. Recently, effective therapy with intensive lipid-lowering agents was established, and epidemiologic data are required for early diagnosis. We determined the haplotype structure of APOE-Sendai in 13 patients from 9 unrelated families with LPG, and found that the haplotype of all APOE-Sendai mutations was identical, suggesting that APOE-Sendai mutation is common in Japanese patients probably through a founder effect. We also studied the gene frequency of APOE-Sendai in 2023 control subjects and 418 patients receiving hemodialysis in Yamagata prefecture using the TaqMan method, but did not identify any subjects carrying the mutation, indicating that it is very rare in the general population even in the eastern part of Japan. In addition to APOE mutation, other genetic and/or epigenetic factors are considered to be involved in the pathogenesis of LPG because of its low penetrance. The patients did not have a common haplotype of the counterpart APOE allele, and some patients had the same haplotype of the counterpart APOE allele as the asymptomatic carriers. These results suggest that the counterpart APOE allele is not likely associated with the onset of LPG. Further study is required to clarify the pathogenesis of LPG.

  15. Genetic structure of Phytophthora infestans populations in China indicates multiple migration events.

    PubMed

    Guo, Liyun; Zhu, Xiao-Qiong; Hu, Chia-Hui; Ristaino, Jean Beagle

    2010-10-01

    One hundred isolates of Phytophthora infestans collected from 10 provinces in China between 1998 and 2004 were analyzed for mating type, metalaxyl resistance, mitochondrial DNA (mtDNA) haplotype, allozyme genotype, and restriction fragment length polymorphism (RFLP) with the RG-57 probe. In addition, herbarium samples collected in China, Russia, Australia, and other Asian countries were also typed for mtDNA haplotype. The Ia haplotype was found during the first outbreaks of the disease in China (1938 and 1940), Japan (1901, 1930, and 1931), India (1913), Peninsular Malaysia (1950), Nepal (1954), The Philippines (1910), Australia (1917), Russia (1917), and Latvia (1935). In contrast, the Ib haplotype was found after 1950 in China on both potato and tomato (1952, 1954, 1956, and 1982) and in India (1968 and 1974). Another migration of a genotype found in Siberia called SIB-1 (Glucose-6-phosphate isomerase [Gpi] 100/100, Peptidase [Pep] 100/100, IIa mtDNA haplotype) was identified using RFLP fingerprints among 72% of the isolates and was widely distributed in the north and south of China and has also been reported in Japan. A new genotype named CN-11 (Gpi 100/111, Pep 100/100, IIb mtDNA haplotype), found only in the south of China, and two additional genotypes (Gpi 100/100, Pep 100/100, Ia mtDNA haplotype) named CN-9 and CN-10 were identified. There were more diverse genotypes among isolates from Yunnan province than elsewhere. The SIB-1 (IIa) genotype is identical to those from Siberia, suggesting later migration of this genotype from either Russia or Japan into China. The widespread predominance of SIB-1 suggests that this genotype has enhanced fitness compared with other genotypes found. Movement of the pathogen into China via infected seed from several sources most likely accounts for the distribution of pathogen genotypes observed. MtDNA haplotype evidence and RFLP data suggest multiple migrations of the pathogen into China after the initial introduction of the

  16. Huntingtin Haplotypes Provide Prioritized Target Panels for Allele-specific Silencing in Huntington Disease Patients of European Ancestry

    PubMed Central

    Kay, Chris; Collins, Jennifer A; Skotte, Niels H; Southwell, Amber L; Warby, Simon C; Caron, Nicholas S; Doty, Crystal N; Nguyen, Betty; Griguoli, Annamaria; Ross, Colin J; Squitieri, Ferdinando; Hayden, Michael R

    2015-01-01

    Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin gene (HTT). Heterozygous polymorphisms in cis with the mutation allow for allele-specific suppression of the pathogenic HTT transcript as a therapeutic strategy. To prioritize target selection, precise heterozygosity estimates are needed across diverse HD patient populations. Here we present the first comprehensive investigation of all common target alleles across the HTT gene, using 738 reference haplotypes from the 1000 Genomes Project and 2364 haplotypes from HD patients and relatives in Canada, Sweden, France, and Italy. The most common HD haplotypes (A1, A2, and A3a) define mutually exclusive sets of polymorphisms for allele-specific therapy in the greatest number of patients. Across all four populations, a maximum of 80% are treatable using these three target haplotypes. We identify a novel deletion found exclusively on the A1 haplotype, enabling potent and selective silencing of mutant HTT in approximately 40% of the patients. Antisense oligonucleotides complementary to the deletion reduce mutant A1 HTT mRNA by 78% in patient cells while sparing wild-type HTT expression. By suppressing specific haplotypes on which expanded CAG occurs, we demonstrate a rational approach to the development of allele-specific therapy for a monogenic disorder. PMID:26201449

  17. Probability distribution of haplotype frequencies under the two-locus Wright-Fisher model by diffusion approximation.

    PubMed

    Boitard, Simon; Loisel, Patrice

    2007-05-01

    The probability distribution of haplotype frequencies in a population, and the way it is influenced by genetical forces such as recombination, selection, random drift ...is a question of fundamental interest in population genetics. For large populations, the distribution of haplotype frequencies for two linked loci under the classical Wright-Fisher model is almost impossible to compute because of numerical reasons. However the Wright-Fisher process can in such cases be approximated by a diffusion process and the transition density can then be deduced from the Kolmogorov equations. As no exact solution has been found for these equations, we developed a numerical method based on finite differences to solve them. It applies to transient states and models including selection or mutations. We show by several tests that this method is accurate for computing the conditional joint density of haplotype frequencies given that no haplotype has been lost. We also prove that it is far less time consuming than other methods such as Monte Carlo simulations.

  18. Nanophotothermolysis of multiple scattered cancer cells with carbon nanotubes guided by time-resolved infrared thermal imaging

    PubMed Central

    Biris, Alexandru S.; Boldor, Dorin; Palmer, Jason; Monroe, William T.; Mahmood, Meena; Dervishi, Enkeleda; Xu, Yang; Li, Zhongrui; Galanzha, Ekaterina I.; Zharov, Vladimir P.

    2016-01-01

    Nanophotothermolysis with long laser pulses for treatment of scattered cancer cells and their clusters is introduced with the main focus on real-time monitoring of temperature dynamics inside and around individual cancer cells labeled with carbon nanotubes. This technique utilizes advanced time- and spatially-resolved thermal radiometry imaging for the visualization of laser-induced temperature distribution in multiple-point absorbing targets. The capability of this approach was demonstrated for monitoring of thermal effects under long laser exposure (from millisecond to seconds, wavelength 1064 nm, maximum power 1 W) of cervical cancer HeLa cells labeled with carbon nanotubes in vitro. The applications are discussed with a focus on the nanophotothermolysis of small tumors, tumor margins, or micrometastases under the guidance of near-IR and microwave radiometry. PMID:19405720

  19. Haplotypic Analysis of Wellcome Trust Case Control Consortium Data

    PubMed Central

    Browning, Brian L.; Browning, Sharon R.

    2008-01-01

    We applied a recently developed multilocus association testing method (localized haplotype clustering) to Wellcome Trust Case Control Consortium data (14,000 cases of seven common diseases and 3,000 shared controls genotyped on the Affymetrix 500K array). After rigorous data quality filtering, we identified three disease-associated loci with strong statistical support from localized haplotype cluster tests but with only marginal significance in single marker tests. These loci are chromosomes 10p15.1 with type 1 diabetes (p = 5.1 × 10-9), 12q15 with type 2 diabetes (p = 1.9 × 10-7) and 15q26.2 with hypertension (p = 2.8 × 10-8). We also detected the association of chromosome 9p21.3 with type 2 diabetes (p = 2.8 × 10-8), although this locus did not pass our stringent genotype quality filters. The association of 10p15.1 with type 1 diabetes and 9p21.3 with type 2 diabetes have both been replicated in other studies using independent data sets. Overall, localized haplotype cluster analysis had better success detecting disease associated variants than a previous single-marker analysis of imputed HapMap SNPs. We found that stringent application of quality score thresholds to genotype data substantially reduced false-positive results arising from genotype error. In addition, we demonstrate that it is possible to simultaneously phase 16,000 individuals genotyped on genome-wide data (450K markers) using the Beagle software package. PMID:18224336

  20. Molecular definition of red cell Rh haplotypes by tightly linked SphI RFLPs.

    PubMed

    Huang, C H; Reid, M E; Chen, Y; Coghlan, G; Okubo, Y

    1996-01-01

    The Rh blood group system of human red cells contains five major antigens D, C/c, and E/e (the latter four designated "non-D") that are specified by eight gene complexes known as Rh haplotypes. In this paper, we report on the mapping of RH locus and identification of a set of SphI RFLPs that are tightly linked with the Rh structural genes. Using exon-specific probes, we have localized the SphI cleavage sites resulting in these DNA markers and derived a comprehensive map for the RH locus. It was found that the SphI fragments encompassing exons 4-7 of the Rh genes occur in four banding patterns or frameworks that correspond to the distribution and segregation of the common Rh haplotypes. This linkage disequilibrium allowed a genotype-phenotype correlation and direct determination of Rh zygosity related to the Rh-positive or Rh-negative status (D/D, D/d, and d/d). Studies on the occurrence of SphI RFLPs in a number of rare Rh variants indicated that Rh phenotypic diversity has taken place on different haplotype backgrounds and has arisen by diverse genetic mechanisms. The molecular definition of Rh haplotypes by SphI RFLP frameworks should provide a useful procedure for genetic counseling and prenatal assessment of Rh alloimmunization.

  1. Estimating the age of Hb G-Coushatta [β22(B4)Glu→Ala] mutation by haplotypes of β-globin gene cluster in Denizli, Turkey.

    PubMed

    Ozturk, Onur; Arikan, Sanem; Atalay, Ayfer; Atalay, Erol O

    2018-05-01

    Hb G-Coushatta variant was reported from various populations' parts of the world such as Thai, Korea, Algeria, Thailand, China, Japan and Turkey. In our study, we aimed to discuss the possible historical relationships of the Hb G-Coushatta mutation with the possible migration routes of the world. For this purpose, associated haplotypes were determined using polymorphic loci in the beta globin gene cluster of hemoglobin G-Coushatta and normal populations in Denizli, Turkey. We performed statistical analysis such as haplotype analysis, Hardy-Weinberg equilibrium, measurement of genetic diversity and population differentiation parameters, analysis of molecular variance using F-statistics, historical-demographic analyses, mismatch distribution analysis of both populations and applied the test statistics in Arlequin ver. 3.5 software program. The diversity of haplotypes has been shown to indicate different genetic origins for two populations. However, AMOVA results, molecular diversity parameters and population demographic expansion times showed that the Hb G-Coushatta mutation develops on the normal population gene pool. Our estimated τ values showed the average time since the demographic expansion for normal and Hb G-Coushatta populations ranged from approximately 42,000 to 38,000 ybp, respectively. Our data suggest that Hb G-Coushatta population originate in normal population in Denizli, Turkey. These results support the hypothesis that the multiple origin of Hb G-Coushatta and indicate that mutation may have been triggered the formation of new variants on beta globin haplotypes. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  2. High variation and strong phylogeographic pattern among cpDNA haplotypes in Taxus wallichiana (Taxaceae) in China and North Vietnam.

    PubMed

    Gao, L M; Möller, M; Zhang, X-M; Hollingsworth, M L; Liu, J; Mill, R R; Gibby, M; Li, D-Z

    2007-11-01

    We studied the phylogeography of Chinese yew (Taxus wallichiana), a tree species distributed over most of southern China and adjacent regions. A total of 1235 individuals from 50 populations from China and North Vietnam were analysed for chloroplast DNA variation using polymerase chain reaction-restriction fragment length polymorphism of the trnL-F intron-spacer region. A total of 19 different haplotypes were distinguished. We found a very high level of population differentiation and a strong phylogeographic pattern, suggesting low levels of recurrent gene flow among populations. Haplotype differentiation was most marked along the boundary between the Sino-Himalayan and Sino-Japanese Forest floristic subkingdoms, with only one haplotype being shared among these two subkingdoms. The Malesian and Sino-Himalayan Forest subkingdoms had five and 10 haplotypes, respectively, while the relatively large Sino-Japanese Forest subkingdom had only eight. The strong geography-haplotype correlation persisted at the regional floristic level, with most regions possessing a unique set of haplotypes, except for the central China region. Strong landscape effects were observed in the Hengduan and Dabashan mountains, where steep mountains and valleys might have been natural dispersal barriers. The molecular phylogenetic data, together with the geographic distribution of the haplotypes, suggest the existence of several localized refugia during the last glaciation from which the present-day distribution may be derived. The pattern of haplotype distribution across China and North Vietnam corresponded well with the current taxonomic delineation of the three intraspecific varieties of T. wallichiana.

  3. Construction of the third-generation Zea mays haplotype map

    PubMed Central

    Bukowski, Robert; Guo, Xiaosen; Lu, Yanli; Zou, Cheng; He, Bing; Rong, Zhengqin; Wang, Bo; Xu, Dawen; Yang, Bicheng; Xie, Chuanxiao; Fan, Longjiang; Gao, Shibin; Xu, Xun; Zhang, Gengyun; Li, Yingrui; Jiao, Yinping; Doebley, John F; Ross-Ibarra, Jeffrey; Lorant, Anne; Buffalo, Vince; Romay, M Cinta; Buckler, Edward S; Ware, Doreen; Lai, Jinsheng; Sun, Qi

    2017-01-01

    Abstract Background Characterization of genetic variations in maize has been challenging, mainly due to deterioration of collinearity between individual genomes in the species. An international consortium of maize research groups combined resources to develop the maize haplotype version 3 (HapMap 3), built from whole-genome sequencing data from 1218 maize lines, covering predomestication and domesticated Zea mays varieties across the world. Results A new computational pipeline was set up to process more than 12 trillion bp of sequencing data, and a set of population genetics filters was applied to identify more than 83 million variant sites. Conclusions We identified polymorphisms in regions where collinearity is largely preserved in the maize species. However, the fact that the B73 genome used as the reference only represents a fraction of all haplotypes is still an important limiting factor. PMID:29300887

  4. Novel pfdhps Haplotypes among Imported Cases of Plasmodium falciparum Malaria in the United Kingdom ▿

    PubMed Central

    Sutherland, Colin J.; Fifer, Helen; Pearce, Richard J.; bin Reza, Faisal; Nicholas, Meredydd; Haustein, Thomas; Njimgye-Tekumafor, Njah E.; Doherty, Justin F.; Gothard, Philip; Polley, Spencer D.; Chiodini, Peter L.

    2009-01-01

    Treatment of acute malaria caused by Plasmodium falciparum may include long-half-life drugs, such as the antifolate combination sulfadoxine-pyrimethamine (SP), to provide posttreatment chemoprophylaxis against parasite recrudescence or delayed emergence from the liver. An unusual case of P. falciparum recrudescence in a returned British traveler who received such a regimen, as well as a series of 44 parasite isolates from the same hospital, was analyzed by PCR and direct DNA sequencing for the presence of markers of parasite resistance to chloroquine and antifolates. The index patient harbored a mixture of wild-type and resistant pfdhfr and pfdhps alleles upon initial presentation. During his second malaria episode, he harbored only resistant parasites, with the haplotypes IRNI (codons 51, 59, 108, and 164) and SGEAA (codons 436, 437, 540, 581, and 613) at these two loci, respectively. Analysis of isolates from 44 other patients showed that the pfdhfr haplotype IRNI was common (found in 81% of cases). The SGEAA haplotype of pfdhps was uncommon (found only in eight cases of East African origin [17%]). A previously undescribed mutation, I431V, was observed for seven cases of Nigerian origin, occurring as one of two haplotypes, VAGKGS or VAGKAA. The presence of this mutation was also confirmed in isolates of Nigerian origin from the United Kingdom Malaria Reference Laboratory. The presence of the pfdhps haplotype SGEAA in P. falciparum parasites of East African origin appears to compromise the efficacy of treatment regimens that include SP as a means to prevent recrudescence. Parasites with novel pfdhps haplotypes are circulating in West Africa. The response of these parasites to chemotherapy needs to be evaluated. PMID:19433569

  5. HLA-DRB*1501 associations with magnetic resonance imaging measures of grey matter pathology in multiple sclerosis.

    PubMed

    Yaldizli, Özgür; Sethi, Varun; Pardini, Matteo; Tur, Carmen; Mok, Kin Y; Muhlert, Nils; Liu, Zheng; Samson, Rebecca S; Wheeler-Kingshott, Claudia A M; Yousry, Tarek A; Houlden, Henry; Hardy, John; Miller, David H; Chard, Declan T

    2016-05-01

    The HLA-DRB*1501 haplotype influences the risk of developing multiple sclerosis (MS), but it is not known how it affects grey matter pathology. To assess HLA-DRB(*)1501 effects on magnetic resonance imaging (MRI) cortical grey matter pathology. Whole and lesional cortical grey matter volumes, lesional and normal-appearing grey matter magnetization transfer ratio were measured in 85 people with MS and 36 healthy control subjects. HLA-DRB(*)1501 haplotype was determined by genotyping (rs3135388). No significant differences were observed in MRI measures between the HLA-DRB(*)1501 subgroups. The HLA-DRB(*)1501 haplotype is not strongly associated with MRI-visible grey matter pathology. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. HLA-DRB1*15:01-DQA1*01:02-DQB1*06:02 Haplotype Protects Autoantibody-Positive Relatives From Type 1 Diabetes Throughout the Stages of Disease Progression

    PubMed Central

    Boulware, David; Yu, Liping; Babu, Sunanda; Steck, Andrea K.; Becker, Dorothy; Rodriguez, Henry; DiMeglio, Linda; Evans-Molina, Carmella; Harrison, Leonard C.; Schatz, Desmond; Palmer, Jerry P.; Greenbaum, Carla; Eisenbarth, George S.; Sosenko, Jay M.

    2016-01-01

    The HLA-DRB1*15:01-DQA1*01:02-DQB1*06:02 haplotype is linked to protection from the development of type 1 diabetes (T1D). However, it is not known at which stages in the natural history of T1D development this haplotype affords protection. We examined a cohort of 3,358 autoantibody-positive relatives of T1D patients in the Pathway to Prevention (PTP) Study of the Type 1 Diabetes TrialNet. The PTP study examines risk factors for T1D and disease progression in relatives. HLA typing revealed that 155 relatives carried this protective haplotype. A comparison with 60 autoantibody-negative relatives suggested protection from autoantibody development. Moreover, the relatives with DRB1*15:01-DQA1*01:02-DQB1*06:02 less frequently expressed autoantibodies associated with higher T1D risk, were less likely to have multiple autoantibodies at baseline, and rarely converted from single to multiple autoantibody positivity on follow-up. These relatives also had lower frequencies of metabolic abnormalities at baseline and exhibited no overall metabolic worsening on follow-up. Ultimately, they had a very low 5-year cumulative incidence of T1D. In conclusion, the protective influence of DRB1*15:01-DQA1*01:02-DQB1*06:02 spans from autoantibody development through all stages of progression, and relatives with this allele only rarely develop T1D. PMID:26822082

  7. An omnibus test for family-based association studies with multiple SNPs and multiple phenotypes.

    PubMed

    Lasky-Su, Jessica; Murphy, Amy; McQueen, Matthew B; Weiss, Scott; Lange, Christoph

    2010-06-01

    We propose an omnibus family-based association test (MFBAT) that can be applied to multiple markers and multiple phenotypes and that has only one degree of freedom. The proposed test statistic extends current FBAT methodology to incorporate multiple markers as well as multiple phenotypes. Using simulation studies, power estimates for the proposed methodology are compared with the standard methodologies. On the basis of these simulations, we find that MFBAT substantially outperforms other methods, including haplotypic approaches and doing multiple tests with single single-nucleotide polymorphisms (SNPs) and single phenotypes. The practical relevance of the approach is illustrated by an application to asthma in which SNP/phenotype combinations are identified and reach overall significance that would not have been identified using other approaches. This methodology is directly applicable to cases in which there are multiple SNPs, such as candidate gene studies, cases in which there are multiple phenotypes, such as expression data, and cases in which there are multiple phenotypes and genotypes, such as genome-wide association studies that incorporate expression profiles as phenotypes. This program is available in the PBAT analysis package.

  8. Genetic diversity and geographical structure of the pitcher plant Nepenthes vieillardii in New Caledonia: A chloroplast DNA haplotype analysis.

    PubMed

    Kurata, Kaoruko; Jaffré, Tanguy; Setoguchi, Hiroaki

    2008-12-01

    Among the many species that grow in New Caledonia, the pitcher plant Nepenthes vieillardii (Nepenthaceae) has a high degree of morphological variation. In this study, we present the patterns of genetic differentiation of pitcher plant populations based on chloroplast DNA haplotype analysis using the sequences of five spacers. We analyzed 294 samples from 16 populations covering the entire range of the species, using 4660 bp of sequence. Our analysis identified 17 haplotypes, including one that is widely distributed across the islands, as well as regional and private haplotypes. The greatest haplotype diversity was detected on the eastern coast of the largest island and included several private haplotypes, while haplotype diversity was low in the southern plains region. The parsimony network analysis of the 17 haplotypes suggested that the genetic divergence is the result of long-term isolation of individual populations. Results from a spatial analysis of molecular variance and a cluster analysis suggest that the plants once covered the entire serpentine area of New Caledonia and that subsequent regional fragmentation resulted in the isolation of each population and significantly restricted seed flow. This isolation may have been an important factor in the development of the morphological and genetic variation among pitcher plants in New Caledonia.

  9. Measuring and partitioning the high-order linkage disequilibrium by multiple order Markov chains.

    PubMed

    Kim, Yunjung; Feng, Sheng; Zeng, Zhao-Bang

    2008-05-01

    A map of the background levels of disequilibrium between nearby markers can be useful for association mapping studies. In order to assess the background levels of linkage disequilibrium (LD), multilocus LD measures are more advantageous than pairwise LD measures because the combined analysis of pairwise LD measures is not adequate to detect simultaneous allele associations among multiple markers. Various multilocus LD measures based on haplotypes have been proposed. However, most of these measures provide a single index of association among multiple markers and does not reveal the complex patterns and different levels of LD structure. In this paper, we employ non-homogeneous, multiple order Markov Chain models as a statistical framework to measure and partition the LD among multiple markers into components due to different orders of marker associations. Using a sliding window of multiple markers on phased haplotype data, we compute corresponding likelihoods for different Markov Chain (MC) orders in each window. The log-likelihood difference between the lowest MC order model (MC0) and the highest MC order model in each window is used as a measure of the total LD or the overall deviation from the gametic equilibrium for the window. Then, we partition the total LD into lower order disequilibria and estimate the effects from two-, three-, and higher order disequilibria. The relationship between different orders of LD and the log-likelihood difference involving two different orders of MC models are explored. By applying our method to the phased haplotype data in the ENCODE regions of the HapMap project, we are able to identify high/low multilocus LD regions. Our results reveal that the most LD in the HapMap data is attributed to the LD between adjacent pairs of markers across the whole region. LD between adjacent pairs of markers appears to be more significant in high multilocus LD regions than in low multilocus LD regions. We also find that as the multilocus total LD

  10. Exploring climate niches of ponderosa pine (Pinus ponderosa Douglas ex Lawson) haplotypes in the western United States: Implications for evolutionary history and conservation

    USGS Publications Warehouse

    Shinneman, Douglas; Means, Robert E.; Potter, Kevin M.; Hipkins, Valerie D.

    2016-01-01

    Ponderosa pine (Pinus ponderosa Douglas ex Lawson) occupies montane environments throughout western North America, where it is both an ecologically and economically important tree species. A recent study using mitochondrial DNA analysis demonstrated substantial genetic variation among ponderosa pine populations in the western U.S., identifying 10 haplotypes with unique evolutionary lineages that generally correspond spatially with distributions of the Pacific (P. p. var. ponderosa) and Rocky Mountain (P. p. var. scopulorum) varieties. To elucidate the role of climate in shaping the phylogeographic history of ponderosa pine, we used nonparametric multiplicative regression to develop predictive climate niche models for two varieties and 10 haplotypes and to hindcast potential distribution of the varieties during the last glacial maximum (LGM), ~22,000 yr BP. Our climate niche models performed well for the varieties, but haplotype models were constrained in some cases by small datasets and unmeasured microclimate influences. The models suggest strong relationships between genetic lineages and climate. Particularly evident was the role of seasonal precipitation balance in most models, with winter- and summer-dominated precipitation regimes strongly associated with P. p. vars. ponderosa and scopulorum, respectively. Indeed, where present-day climate niches overlap between the varieties, introgression of two haplotypes also occurs along a steep clinal divide in western Montana. Reconstructed climate niches for the LGM suggest potentially suitable climate existed for the Pacific variety in the California Floristic province, the Great Basin, and Arizona highlands, while suitable climate for the Rocky Mountain variety may have existed across the southwestern interior highlands. These findings underscore potentially unique phylogeographic origins of modern ponderosa pine evolutionary lineages, including potential adaptations to Pleistocene climates associated with

  11. Canis mtDNA HV1 database: a web-based tool for collecting and surveying Canis mtDNA HV1 haplotype in public database.

    PubMed

    Thai, Quan Ke; Chung, Dung Anh; Tran, Hoang-Dung

    2017-06-26

    Canine and wolf mitochondrial DNA haplotypes, which can be used for forensic or phylogenetic analyses, have been defined in various schemes depending on the region analyzed. In recent studies, the 582 bp fragment of the HV1 region is most commonly used. 317 different canine HV1 haplotypes have been reported in the rapidly growing public database GenBank. These reported haplotypes contain several inconsistencies in their haplotype information. To overcome this issue, we have developed a Canis mtDNA HV1 database. This database collects data on the HV1 582 bp region in dog mitochondrial DNA from the GenBank to screen and correct the inconsistencies. It also supports users in detection of new novel mutation profiles and assignment of new haplotypes. The Canis mtDNA HV1 database (CHD) contains 5567 nucleotide entries originating from 15 subspecies in the species Canis lupus. Of these entries, 3646 were haplotypes and grouped into 804 distinct sequences. 319 sequences were recognized as previously assigned haplotypes, while the remaining 485 sequences had new mutation profiles and were marked as new haplotype candidates awaiting further analysis for haplotype assignment. Of the 3646 nucleotide entries, only 414 were annotated with correct haplotype information, while 3232 had insufficient or lacked haplotype information and were corrected or modified before storing in the CHD. The CHD can be accessed at http://chd.vnbiology.com . It provides sequences, haplotype information, and a web-based tool for mtDNA HV1 haplotyping. The CHD is updated monthly and supplies all data for download. The Canis mtDNA HV1 database contains information about canine mitochondrial DNA HV1 sequences with reconciled annotation. It serves as a tool for detection of inconsistencies in GenBank and helps identifying new HV1 haplotypes. Thus, it supports the scientific community in naming new HV1 haplotypes and to reconcile existing annotation of HV1 582 bp sequences.

  12. Multi-allelic haplotype model based on genetic partition for genomic prediction and variance component estimation using SNP markers.

    PubMed

    Da, Yang

    2015-12-18

    The amount of functional genomic information has been growing rapidly but remains largely unused in genomic selection. Genomic prediction and estimation using haplotypes in genome regions with functional elements such as all genes of the genome can be an approach to integrate functional and structural genomic information for genomic selection. Towards this goal, this article develops a new haplotype approach for genomic prediction and estimation. A multi-allelic haplotype model treating each haplotype as an 'allele' was developed for genomic prediction and estimation based on the partition of a multi-allelic genotypic value into additive and dominance values. Each additive value is expressed as a function of h - 1 additive effects, where h = number of alleles or haplotypes, and each dominance value is expressed as a function of h(h - 1)/2 dominance effects. For a sample of q individuals, the limit number of effects is 2q - 1 for additive effects and is the number of heterozygous genotypes for dominance effects. Additive values are factorized as a product between the additive model matrix and the h - 1 additive effects, and dominance values are factorized as a product between the dominance model matrix and the h(h - 1)/2 dominance effects. Genomic additive relationship matrix is defined as a function of the haplotype model matrix for additive effects, and genomic dominance relationship matrix is defined as a function of the haplotype model matrix for dominance effects. Based on these results, a mixed model implementation for genomic prediction and variance component estimation that jointly use haplotypes and single markers is established, including two computing strategies for genomic prediction and variance component estimation with identical results. The multi-allelic genetic partition fills a theoretical gap in genetic partition by providing general formulations for partitioning multi-allelic genotypic values and provides a haplotype

  13. A DRD1 haplotype is associated with risk for autism spectrum disorders in male-only affected sib-pair families.

    PubMed

    Hettinger, Joe A; Liu, Xudong; Schwartz, Charles E; Michaelis, Ron C; Holden, Jeanette J A

    2008-07-05

    Individuals with autism spectrum disorders (ASDs) have impairments in executive function and social cognition, with males generally being more severely affected in these areas than females. Because the dopamine D1 receptor (encoded by DRD1) is integral to the neural circuitry mediating these processes, we examined the DRD1 gene for its role in susceptibility to ASDs by performing single marker and haplotype case-control comparisons, family-based association tests, and genotype-phenotype assessments (quantitative transmission disequilibrium tests: QTDT) using three DRD1 polymorphisms, rs265981C/T, rs4532A/G, and rs686T/C. Our previous findings suggested that the dopaminergic system may be more integrally involved in families with affected males only than in other families. We therefore restricted our study to families with two or more affected males (N = 112). There was over-transmission of rs265981-C and rs4532-A in these families (P = 0.040, P = 0.038), with haplotype TDT analysis showing over-transmission of the C-A-T haplotype (P = 0.022) from mothers to affected sons (P = 0.013). In addition, haplotype case-control comparisons revealed an increase of this putative risk haplotype in affected individuals relative to a comparison group (P = 0.004). QTDT analyses showed associations of the rs265981-C, rs4532-A, rs686-T alleles, and the C-A-T haplotype with more severe problems in social interaction, greater difficulties with nonverbal communication and increased stereotypies compared to individuals with other haplotypes. Preferential haplotype transmission of markers at the DRD1 locus and an increased frequency of a specific haplotype support the DRD1 gene as a risk gene for core symptoms of ASD in families having only affected males. Copyright 2008 Wiley-Liss, Inc.

  14. Different DRB1*03:01-DQB1*02:01 haplotypes confer different risk for celiac disease.

    PubMed

    Alshiekh, S; Zhao, L P; Lernmark, Å; Geraghty, D E; Naluai, Å T; Agardh, D

    2017-08-01

    Celiac disease is associated with the HLA-DR3-DQA1*05:01-DQB1*02:01 and DR4-DQA1*03:01-DQB1*03:02 haplotypes. In addition, there are currently over 40 non-HLA loci associated with celiac disease. This study extends previous analyses on different HLA haplotypes in celiac disease using next generation targeted sequencing. Included were 143 patients with celiac disease and 135 non-celiac disease controls investigated at median 9.8 years (1.4-18.3 years). PCR-based amplification of HLA and sequencing with Illumina MiSeq technology were used for extended sequencing of the HLA class II haplotypes HLA-DRB1, DRB3, DRB4, DRB5, DQA1 and DQB1, respectively. Odds ratios were computed marginally for every allele and haplotype as the ratio of allelic frequency in patients and controls as ratio of exposure rates (RR), when comparing a null reference with equal exposure rates in cases and controls. Among the extended HLA haplotypes, the strongest risk haplotype for celiac disease was shown for DRB3*01:01:02 in linkage with DQA1*05:01-DQB1*02:01 (RR = 6.34; P-value < .0001). In a subpopulation analysis, DRB3*01:01:02-DQA1*05:01-DQB1*02:01 remained the most significant in patients with Scandinavian ethnicity (RR = 4.63; P < .0001) whereas DRB1*07:01:01-DRB4*01:03:01-DQA1*02:01-DQB1*02:02:01 presented the highest risk of celiac disease among non-Scandinavians (RR = 7.94; P = .011). The data also revealed 2 distinct celiac disease risk DR3-DQA1*05:01-DQB*02:01 haplotypes distinguished by either the DRB3*01:01:02 or DRB3*02:02:01 alleles, indicating that different DRB1*03:01-DQB1*02:01 haplotypes confer different risk for celiac disease. The associated risk of celiac disease for DR3-DRB3*01:01:02-DQA1*05:01-DQB1*02:01 is predominant among patients of Scandinavian ethnicity. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Rapid growth of a Eurasian haplotype of Phragmites australis in a restored brackish marsh in Louisiana, USA

    USGS Publications Warehouse

    Howard, R.J.; Travis, S.E.; Sikes, B.A.

    2008-01-01

    While numerous studies have documented patterns of invasion by non-indigenous plant species, few have considered the invasive properties of non-native genotypes of native species. Characteristics associated with specific genotypes, such as tolerance to disturbance, may mistakenly be applied to an entire species in the absence of genetic information, which consequently may affect management decisions. We report here on the incidence and growth of an introduced lineage of Phragmites australis in the Gulf of Mexico coastal zone of Louisiana. P. australis was collected from nine separate locations for inclusion in a series of growth experiments. Chloroplast DNA analysis indicated that specimens collected from four locations in the Mississippi River Delta represented the introduced Eurasian haplotype; the remainder represented the gulf coast haplotype. Three distinct genotypes, or clones, were identified within each haplotype via analysis using amplified fragment length polymorphisms, which also revealed reduced genetic diversity of the gulf coast clones compared to the Eurasian clones. Clones of each haplotype were planted along with three other native macrophytes at similar densities in a restored brackish marsh and monitored for growth. After 14 months, the Eurasian haplotype had spread vegetatively to cover about 82% of the experimental plots, more than four times the coverage (18%) of the gulf coast haplotype. Thus, the use of P. australis plantings for wetland restoration should consider the genetic lineage of plants used since our results indicate the potential of the Eurasian haplotype to grow rapidly at newly restored sites. This rapid growth may limit the establishment of more slowly growing native species. ?? 2007 Springer Science+Business Media B.V.

  16. Inferring mechanisms of copy number change from haplotype structures at the human DEFA1A3 locus.

    PubMed

    Black, Holly A; Khan, Fayeza F; Tyson, Jess; Al Armour, John

    2014-07-21

    The determination of structural haplotypes at copy number variable regions can indicate the mechanisms responsible for changes in copy number, as well as explain the relationship between gene copy number and expression. However, obtaining spatial information at regions displaying extensive copy number variation, such as the DEFA1A3 locus, is complex, because of the difficulty in the phasing and assembly of these regions. The DEFA1A3 locus is intriguing in that it falls within a region of high linkage disequilibrium, despite its high variability in copy number (n = 3-16); hence, the mechanisms responsible for changes in copy number at this locus are unclear. In this study, a region flanking the DEFA1A3 locus was sequenced across 120 independent haplotypes with European ancestry, identifying five common classes of DEFA1A3 haplotype. Assigning DEFA1A3 class to haplotypes within the 1000 Genomes project highlights a significant difference in DEFA1A3 class frequencies between populations with different ancestry. The features of each DEFA1A3 class, for example, the associated DEFA1A3 copy numbers, were initially assessed in a European cohort (n = 599) and replicated in the 1000 Genomes samples, showing within-class similarity, but between-class and between-population differences in the features of the DEFA1A3 locus. Emulsion haplotype fusion-PCR was used to generate 61 structural haplotypes at the DEFA1A3 locus, showing a high within-class similarity in structure. Structural haplotypes across the DEFA1A3 locus indicate that intra-allelic rearrangement is the predominant mechanism responsible for changes in DEFA1A3 copy number, explaining the conservation of linkage disequilibrium across the locus. The identification of common structural haplotypes at the DEFA1A3 locus could aid studies into how DEFA1A3 copy number influences expression, which is currently unclear.

  17. Interactions Between Serotonin Transporter Gene Haplotypes and Quality of Mothers’ Parenting Predict the Development of Children’s Noncompliance

    PubMed Central

    Sulik, Michael J.; Eisenberg, Nancy; Lemery-Chalfant, Kathryn; Spinrad, Tracy L.; Silva, Kassondra M.; Eggum, Natalie D.; Betkowski, Jennifer A.; Kupfer, Anne; Smith, Cynthia L.; Gaertner, Bridget; Stover, Daryn A.; Verrelli, Brian C.

    2012-01-01

    The LPR and STin2 polymorphisms of the serotonin transporter gene (SLC6A4) were combined into haplotypes that, together with quality of maternal parenting, were used to predict initial levels and linear change in children’s (N = 138) noncompliance and aggression from age 18 –54 months. Quality of mothers’ parenting behavior was observed when children were 18 months old, and nonparental caregivers’ reports of noncompliance and aggression were collected annually from 18 to 54 months of age. Quality of early parenting was negatively related to the slope of noncompliance only for children with the LPR-S/STin2-10 haplotype and to 18-month noncompliance only for children with haplotypes that did not include LPR-S. The findings support the notion that SLC6A4 haplotypes index differential susceptibility to variability in parenting quality, with certain haplotypes showing greater reactivity to both supportive and unsupportive environments. These different genetic backgrounds likely reflect an evolutionary response to variation in the parenting environment. PMID:22059451

  18. HLA class I antigen and HLA-A, -B, and -C haplotype frequencies in Uruguayans.

    PubMed

    Alvarez, Ines; Bengochea, Milka; Toledo, Roberto; Carretto, Elena; Hidalgo, Pedro C

    2006-08-01

    HLA class I antigens were determined for 959 unrelated Uruguayans. The predominant HLA alleles were A2, Cw4, and B35, and the most frequently observed two-loci haplotypes were A2-B44 and B35-Cw4. The most frequent three-loci HLA haplotype was A2-Cw5-B44. We compared the Uruguayan sample with similar data from other populations.

  19. Quantitative, spectrally-resolved intraoperative fluorescence imaging

    PubMed Central

    Valdés, Pablo A.; Leblond, Frederic; Jacobs, Valerie L.; Wilson, Brian C.; Paulsen, Keith D.; Roberts, David W.

    2012-01-01

    Intraoperative visual fluorescence imaging (vFI) has emerged as a promising aid to surgical guidance, but does not fully exploit the potential of the fluorescent agents that are currently available. Here, we introduce a quantitative fluorescence imaging (qFI) approach that converts spectrally-resolved data into images of absolute fluorophore concentration pixel-by-pixel across the surgical field of view (FOV). The resulting estimates are linear, accurate, and precise relative to true values, and spectral decomposition of multiple fluorophores is also achieved. Experiments with protoporphyrin IX in a glioma rodent model demonstrate in vivo quantitative and spectrally-resolved fluorescence imaging of infiltrating tumor margins for the first time. Moreover, we present images from human surgery which detect residual tumor not evident with state-of-the-art vFI. The wide-field qFI technique has broad implications for intraoperative surgical guidance because it provides near real-time quantitative assessment of multiple fluorescent biomarkers across the operative field. PMID:23152935

  20. The IGF1 small dog haplotype is derived from Middle Eastern grey wolves.

    PubMed

    Gray, Melissa M; Sutter, Nathan B; Ostrander, Elaine A; Wayne, Robert K

    2010-02-24

    A selective sweep containing the insulin-like growth factor 1 (IGF1) gene is associated with size variation in domestic dogs. Intron 2 of IGF1 contains a SINE element and single nucleotide polymorphism (SNP) found in all small dog breeds that is almost entirely absent from large breeds. In this study, we surveyed a large sample of grey wolf populations to better understand the ancestral pattern of variation at IGF1 with a particular focus on the distribution of the small dog haplotype and its relationship to the origin of the dog. We present DNA sequence data that confirms the absence of the derived small SNP allele in the intron 2 region of IGF1 in a large sample of grey wolves and further establishes the absence of a small dog associated SINE element in all wild canids and most large dog breeds. Grey wolf haplotypes from the Middle East have higher nucleotide diversity suggesting an origin there. Additionally, PCA and phylogenetic analyses suggests a closer kinship of the small domestic dog IGF1 haplotype with those from Middle Eastern grey wolves. The absence of both the SINE element and SNP allele in grey wolves suggests that the mutation for small body size post-dates the domestication of dogs. However, because all small dogs possess these diagnostic mutations, the mutations likely arose early in the history of domestic dogs. Our results show that the small dog haplotype is closely related to those in Middle Eastern wolves and is consistent with an ancient origin of the small dog haplotype there. Thus, in concordance with past archeological studies, our molecular analysis is consistent with the early evolution of small size in dogs from the Middle East.See associated opinion by Driscoll and Macdonald: http://jbiol.com/content/9/2/10.

  1. Genome-wide association studies for multiple diseases of the German Shepherd Dog

    PubMed Central

    Tsai, Kate L.; Noorai, Rooksana E.; Starr-Moss, Alison N.; Quignon, Pascale; Rinz, Caitlin J.; Ostrander, Elaine A.; Steiner, Jörg M.; Murphy, Keith E.

    2012-01-01

    The German Shepherd Dog (GSD) is a popular working and companion breed for which over 50 hereditary diseases have been documented. Herein, SNP profiles for 197 GSDs were generated using the Affymetrix v2 canine SNP array for a genome-wide association study to identify loci associated with four diseases: pituitary dwarfism, degenerative myelopathy (DM), congenital megaesophagus (ME), and pancreatic acinar atrophy (PAA). A locus on Chr 9 is strongly associated with pituitary dwarfism and is proximal to a plausible candidate gene, LHX3. Results for DM confirm a major locus encompassing SOD1, in which an associated point mutation was previously identified, but do not suggest modifier loci. Several SNPs on Chr 12 are associated with ME and a 4.7 Mb haplotype block is present in affected dogs. Analysis of additional ME cases for a SNP within the haplotype provides further support for this association. Results for PAA indicate more complex genetic underpinnings. Several regions on multiple chromosomes reach genome-wide significance. However, no major locus is apparent and only two associated haplotype blocks, on Chrs 7 and 12 are observed. These data suggest that PAA may be governed by multiple loci with small effects, or it may be a heterogeneous disorder. PMID:22105877

  2. Using Multiple Representations to Resolve Conflict in Student Conceptual Understanding of Chemistry

    NASA Astrophysics Data System (ADS)

    Daubenmire, Paul L.

    which students develop conceptual understanding and resolve conflicts between different representations of the same phenomena is by verbalizing their ideas as a conjecture (as a verbal explanation to advance towards a hypothesis). Thus, it is proposed that symbolic representations are most effective viewed not as an end goal but as a bridge for connecting macroscopic, visible phenomena with what is occurring at the molecular, invisible level. When the focus on merely memorizing chemical equations and symbols is removed, students can gain a coherent understanding of the meaning available when multiple representations are viewed together.

  3. Variants and Haplotypes in Angiotensinogen Gene Are Associated With Plasmatic Angiotensinogen Level in Mexican Population

    PubMed Central

    Balam-Ortiz, Eros; Esquivel-Villarreal, Adolfo; Alfaro-Ruiz, Luis; Carrillo, Karol; Elizalde, Adela; Gil, Trinidad; Urushihara, Maki; Kobori, Hiroyuki; Jimenez-Sanchez, Gerardo

    2011-01-01

    Introduction The plasmatic angiotensinogen (AGT) level has been associated with essential hypertension. Linkage analysis has found a relationship between the AGT gene locus and hypertension in the Mexican-American population, but studies have failed to identify genetic variants associated with hypertension or plasma AGT levels. This study analyzes the relationship between polymorphisms in the AGT gene and plasmatic AGT levels in Mexican population. Methods Nine polymorphisms in AGT gene were genotyped, and plasma AGT level was determined by enzyme-linked immunosorbent assay. Results Differences in AGT plasma levels were associated with 2 polymorphisms: T-20G, TT = 25.3 ± 8.3 versus TG + GG = 21.6 ± 8.8 μg/mL; P = 0.008 and C3389T (T174M), CC = 25.8 ± 9.9 versus TC + TT = 20.5 ± 5.4 μg/mL; P = 0.0002. Haplotype 2 was associated with low plasma AGT (−5.1 μg/mL [95% confidence interval: −8.6 to −1.6], P = 0.004) and Haplotype 8 was associated with high plasma AGT (6.5 μg/mL [95% confidence interval: 2.5 to 10.6], P = 0.001). This association remained after adjustment for covariates. A Likelihood Ratio Test for haplotype-phenotype association adjusted for covariates resulted in χ2 = 38.9, P = 0.0005. The total effect of the haplotypes on plasma AGT level variance was 19.5%. No association was identified between haplotypes and quantitative traits of blood pressure. Conclusions Two polymorphisms (T-20G and C3389T) and 2 haplotypes (H2 and H8) showed an association with plasma AGT levels in Mexican population. PMID:21629041

  4. Molecular definition of red cell Rh haplotypes by tightly linked SphI RFLPs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, C.H.; Reid, M.E.; Chen, Y.

    The Rh blood group system of human red cells contains five major antigens D, C/c, and E/e (the latter four designated {open_quotes}non-D{close_quotes}) that are specified by eight gene complexes known as Rh haplotypes. In this paper, we report on the mapping of the RH locus and identification of a set of SphI RFLPs that are tightly linked with the Rh structural genes. Using exon-specific probes, we have localized the SphI cleavage sites resulting in these DNA markers and derived a comprehensive map for the RH locus. It was found that the SphI fragments encompassing exons 4-7 of the Rh genesmore » occur in four banding patterns or frameworks that correspond to the distribution and segregation of the common Rh haplotypes. This linkage disequilibrium allowed a genotype-phenotype correlation and direct determination of Rh zygosity related to the Rh-positive or Rh-negative status (D/D, D/d, and d/d). Studies on the occurrence of SphI RFLPs in a number of rare Rh variants indicated that Rh phenotypic diversity has taken place on different haplotype backgrounds and has arisen by diverse genetic mechanisms. The molecular definition of Rh haplotypes by SphI RFLP frameworks should provide a useful procedure for genetic counseling and prenatal assessment of Rh alloimmunization. 32 refs., 7 figs., 3 tabs.« less

  5. Differential distribution of Y-chromosome haplotypes in Swiss and Southern European goat breeds.

    PubMed

    Vidal, Oriol; Drögemüller, Cord; Obexer-Ruff, Gabriela; Reber, Irene; Jordana, Jordi; Martínez, Amparo; Bâlteanu, Valentin Adrian; Delgado, Juan Vicente; Eghbalsaied, Shahin; Landi, Vincenzo; Goyache, Felix; Traoré, Amadou; Pazzola, Michele; Vacca, Giuseppe Massimo; Badaoui, Bouabid; Pilla, Fabio; D'Andrea, Mariasilvia; Álvarez, Isabel; Capote, Juan; Sharaf, Abdoallah; Pons, Àgueda; Amills, Marcel

    2017-11-23

    The analysis of Y-chromosome variation has provided valuable clues about the paternal history of domestic animal populations. The main goal of the current work was to characterize Y-chromosome diversity in 31 goat populations from Central Eastern (Switzerland and Romania) and Southern Europe (Spain and Italy) as well as in reference populations from Africa and the Near East. Towards this end, we have genotyped seven single nucleotide polymorphisms (SNPs), mapping to the SRY, ZFY, AMELY and DDX3Y Y-linked loci, in 275 bucks from 31 populations. We have observed a low level of variability in the goat Y-chromosome, with just five haplotypes segregating in the whole set of populations. We have also found that Swiss bucks carry exclusively Y1 haplotypes (Y1A: 24%, Y1B1: 15%, Y1B2: 43% and Y1C: 18%), while in Italian and Spanish bucks Y2A is the most abundant haplotype (77%). Interestingly, in Carpathian goats from Romania the Y2A haplotype is also frequent (42%). The high Y-chromosome differentiation between Swiss and Italian/Spanish breeds might be due to the post-domestication spread of two different Near Eastern genetic stocks through the Danubian and Mediterranean corridors. Historical gene flow between Southern European and Northern African goats might have also contributed to generate such pattern of genetic differentiation.

  6. Association between mitochondrial DNA haplotype compatibility and increased efficiency of bovine intersubspecies cloning.

    PubMed

    Yan, Hao; Yan, Zhonghai; Ma, Qingwen; Jiao, Fei; Huang, Shuzhen; Zeng, Fanyi; Zeng, Yitao

    2011-01-01

    Reconstructed embryos derived from intersubspecies somatic cell nuclear transfer (SCNT) have poorer developmental potential than those from intrasubspecies SCNT. Based on our previous study that Holstein dairy bovine (HD) mitochondrial DNA (mtDNA) haplotype compatibility between donor karyoplast and recipient cytoplast is crucial for SCNT embryo development, we performed intersubspecies SCNT using HD as donor karyoplast and Luxi yellow heifer (LY) as recipient cytoplast according to mtDNA haplotypes determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. The results demonstrated that intersubspecies mtDNA homotype SCNT embryos had higher pre- and post-implantation developmental competence than intrasubspecies mtDNA heterotype embryos as well as improved blastocyst reprogramming status, including normal H3K9 dimethylation pattern and promoter hypomethylation of pluripotent genes such as Oct4 and Sox2, suggesting that intersubspecies SCNT using LY oocytes maintains HD cloning efficiency and may reprogram HD nuclei to develop into a normal cloned animal ultimately. Our results indicated that karyoplast-cytoplast interactions and mtDNA haplotype compatibility may affect bovine intersubspecies SCNT efficiency. This study on bovine intersubspecies SCNT is valuable for understanding the mechanisms of mtDNA haplotype compatibility between karyoplast and cytoplast impacting the bovine SCNT efficiency, and provides an alternative and economic resource for HD cloning. Copyright © 2011. Published by Elsevier Ltd.

  7. D-loop haplotype diversity in Brazilian horse breeds

    PubMed Central

    Ianella, Patrícia; Albuquerque, Maria do Socorro Maués; Paiva, Samuel Rezende; do Egito, Andréa Alves; Almeida, Leonardo Daniel; Sereno, Fabiana T. P. S.; Carvalho, Luiz Felipe Ramos; Mariante, Arthur da Silva; McManus, Concepta Margaret

    2017-01-01

    Abstract The first horses were brought to Brazil by the colonizers after 1534. Over the centuries, these animals evolved and adapted to local environmental conditions usually unsuitable for exotic breeds, thereby originating locally adapted Brazilian breeds. The present work represents the first description of maternal genetic diversity in these horse breeds based on D-loop sequences. A D-Loop HSV-I fragment of 252 bp, from 141 horses belonging to ten Brazilian breeds / genetic groups (locally adapted and specialized breeds) were analysed. Thirty-five different haplotypes belonging to 18 haplogroups were identified with 33 polymorphic sites. Haplotype diversity (varying from 0.20 to 0.96) and nucleotide diversity (varying from 0.0039 to 0.0239) was lower for locally adapted than for specialized breeds, with the same pattern observed for FST values. Haplogroups identified in Brazilian breeds are in agreement with previous findings in South American samples. The low variability observed mainly in locally adapted breeds, indicates that, to ensure conservation of these breeds, careful reproductive management is needed. Additional genetic characterization studies are required to support accurate decision-making. PMID:28863209

  8. Multiple Origins of a Mitochondrial Mutation Conferring Deafness

    PubMed Central

    Hutchin, T. P.; Cortopassi, G. A.

    1997-01-01

    A point mutation (1555G) in the smaller ribosomal subunit of the mitochondrial DNA (mtDNA) has been associated with maternally inherited traits of hypersensitivity to streptomycin and sensorineural deafness in a number of families from China, Japan, Israel, and Africa. To determine whether this distribution was the result of a single or multiple mutational events, we carried out genetic distance analysis and phylogenetic analysis of 10 independent mtDNA D-loop sequences from Africa and Asia. The mtDNA sequence diversity was high (2.21%). Phylogenetic analysis assigned 1555G-bearing haplotypes at very divergent points in the human mtDNA evolutionary tree, and the 1555G mutations occur in many cases on race-specific mtDNA haplotypes, both facts are inconsistent with a recent introgression of the mutation into these races. The simplest interpretation of the available data is that there have been multiple origins of the 1555G mutation. The genetic distance among mtDNAs bearing the pathogenic 1555G mutation is much larger than among mtDNAs bearing either evolutionarily neutral or weakly deleterious nucleotide substitutions (such as the 4336G mutation). These results are consistent with the view that pathogenic mtDNA haplotypes such as 1555G arise on disparate mtDNA lineages which because of negative natural selection leave relatively few related descendants. The co-existence of the same mutation with deafness in individuals with very different nuclear and mitochondrial genetic backgrounds confirms the pathogenicity of the 1555G mutation. PMID:9055086

  9. Distribution of HLA class I alleles and haplotypes in Korean.

    PubMed Central

    Kim, T. G.; Han, H.; Lim, B. U.; Kim, W.; Kim, S. M.

    1993-01-01

    The antigen (phenotype), gene (allele) and haplotype frequencies of HLA class I were analysed in 4,622 Koreans. With allele frequencies of over 0.05, the most frequent HLA-A,-B and -C antigens were A2, A24, A33, A11, A26, A31; B62, B51, B44, B54, B61, B35, B58, B60; Cw3, Cw1, Cw4, Cw7. Of these A2, A24, Cw1 and Cw3 were present in very high frequencies, respectively (0.3211, 0.2200, 0.2204, and 0.3737). The most common haplotypes with frequencies larger than 0.02 were A2-Blank, A33-B44, A33-B58, A11-B62, A24-B51, A24-B54, A2-B27, B54-Cw1, B58-Cw3, B51-Blank, B61-Cw3, B62-Cw4, B35-Cw3, B44-Blank, B60-Cw3, B27-Cw1, A2-Cw3, A2-Cw1, A24-Cw1, A33-Cw3, A26-Cw3, and A11-Cw4. A significant negative linkage disequilibrium was found for the haplotypes of A2-B7, A2-B44, A2-B58, A24-B13, A24-B27, A33-B54 and A33-B62, of which frequencies were larger than 0.003. The B-C and A-C haplotypes which showed the significant negative linkage disequilibrium were B44-Cw1, B51-Cw1, B44-Cw3,B62-Blank, A2-Cw4, A2-Blank, A11-Cw3, A11-Blank and A33-Cw1 and had frequencies higher than 0.01. The findings presented here could be used per se to estimate the populational relationships or as the control data for HLA-disease investigation. Furthermore they could provide the scope for the definition of new antigens. PMID:8240747

  10. Morphometric characteristics and COI haplotype diversity of Arctodiaptomus spinosus (Copedoda) populations in soda pans in Hungary.

    PubMed

    Forró, László; Nédli, Judit; Csata, Enikő; Krízsik, Virág; Balogh, Csilla; G-Tóth, László

    2017-09-01

    Arctodiaptomus spinosus (Daday, 1891) is a characteristic species of the soda pan zooplankton in the Great Hungarian Plain. The biogeographical distribution of the species is interesting, since its range expands from the Pannonian Biogeographic region to the other side of the Carpathians, occurring in saline lakes in Eastern Anatolia, Armenia, Iran and in temporary waters in Ukraine. Our investigations focused on the morphometric characteristics and the COI haplotype diversity of four Hungarian populations in the Kiskunság area. We detected substantial morphological differences between the Böddi-szék population and the rest of the sampling sites, however considerable differences were not observable in the COI haplotypes in the populations. The 20 animals investigated for COI haplotypes belonged to the same haplotype network. Tajima's D indicated departures from the neutral Wright - Fisher population model and suggested population expansion. The genetic composition of Arctodiaptomus spinosus populations in the Kiskunság area is rather uniform.

  11. The JAK2 46/1 haplotype predisposes to MPL-mutated myeloproliferative neoplasms

    PubMed Central

    Jones, Amy V.; Campbell, Peter J.; Beer, Philip A.; Schnittger, Susanne; Vannucchi, Alessandro M.; Zoi, Katerina; Percy, Melanie J.; McMullin, Mary Frances; Scott, Linda M.; Tapper, William; Silver, Richard T.; Oscier, David; Harrison, Claire N.; Grallert, Harald; Kisialiou, Aliaksei; Strike, Paul; Chase, Andrew J.; Green, Anthony R.

    2010-01-01

    The 46/1 JAK2 haplotype predisposes to V617F-positive myeloproliferative neoplasms, but the underlying mechanism is obscure. We analyzed essential thrombocythemia patients entered into the PT-1 studies and, as expected, found that 46/1 was overrepresented in V617F-positive cases (n = 404) versus controls (n = 1492, P = 3.9 × 10−11). The 46/1 haplotype was also overrepresented in cases without V617F (n = 347, P = .009), with an excess seen for both MPL exon 10 mutated and V617F, MPL exon 10 nonmutated cases. Analysis of further MPL-positive, V617F-negative cases confirmed an excess of 46/1 (n = 176, P = .002), but no association between MPL mutations and MPL haplotype was seen. An excess of 46/1 was also seen in JAK2 exon 12 mutated cases (n = 69, P = .002), and these mutations preferentially arose on the 46/1 chromosome (P = .029). No association between 46/1 and clinical or laboratory features was seen in the PT-1 cohort either with or without V617F. The excess of 46/1 in JAK2 exon 12 cases is compatible with both the “hypermutability” and “fertile ground” hypotheses, but the excess in MPL-mutated cases argues against the former. No difference in sequence, splicing, or expression of JAK2 was found on 46/1 compared with other haplotypes, suggesting that any functional difference of JAK2 on 46/1, if it exists, must be relatively subtle. PMID:20304805

  12. KCNQ1 Haplotypes Associate with Type 2 Diabetes in Malaysian Chinese Subjects

    PubMed Central

    Saif-Ali, Riyadh; Ismail, Ikram S.; Al-Hamodi, Zaid; Al-Mekhlafi, Hesham M.; Siang, Lee C.; Alabsi, Aied M.; Muniandy, Sekaran

    2011-01-01

    The aim of this study was to investigate the association of single nucleotide polymorphisms (SNPs) and haplotypes of potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1) with type 2 diabetes (T2D) in Malaysian Chinese subjects. The KCNQ1 SNPs rs2237892, rs2283228 and rs2237895 were genotyped in 300 T2D patients and 230 control subjects without diabetes and metabolic syndrome. Two logistic regression models of analysis were applied, the first adjusted for age and gender while the second adjusted for age, gender and body mass index. The additive genetic analysis showed that adjusting for body mass index (BMI) even strengthened association of rs2237892, rs2283228 and rs2237895 with T2D (OR = 2.0, P = 5.1 × 10−5; OR = 1.9, P = 5.2 × 10−5; OR = 1.9, P = 7.8 × 10−5, respectively). The haplotype TCA containing the allele of rs2237892 (T), rs2283228 (C) and rs2237895 (A) was highly protective against T2D (Second model; OR = 0.17, P = 3.7 × 10−11). The KCNQ1 rs2237892 (TT), and the protective haplotype (TCA) were associated with higher beta-cell function (HOMA-B) in normal subjects (P = 0.0002; 0.014, respectively). This study found that KCNQ1 SNPs was associated with T2D susceptibility in Malaysian Chinese subjects. In addition, certain KCNQ1 haplotypes were strongly associated with T2D. PMID:22016621

  13. Exact algorithms for haplotype assembly from whole-genome sequence data.

    PubMed

    Chen, Zhi-Zhong; Deng, Fei; Wang, Lusheng

    2013-08-15

    Haplotypes play a crucial role in genetic analysis and have many applications such as gene disease diagnoses, association studies, ancestry inference and so forth. The development of DNA sequencing technologies makes it possible to obtain haplotypes from a set of aligned reads originated from both copies of a chromosome of a single individual. This approach is often known as haplotype assembly. Exact algorithms that can give optimal solutions to the haplotype assembly problem are highly demanded. Unfortunately, previous algorithms for this problem either fail to output optimal solutions or take too long time even executed on a PC cluster. We develop an approach to finding optimal solutions for the haplotype assembly problem under the minimum-error-correction (MEC) model. Most of the previous approaches assume that the columns in the input matrix correspond to (putative) heterozygous sites. This all-heterozygous assumption is correct for most columns, but it may be incorrect for a small number of columns. In this article, we consider the MEC model with or without the all-heterozygous assumption. In our approach, we first use new methods to decompose the input read matrix into small independent blocks and then model the problem for each block as an integer linear programming problem, which is then solved by an integer linear programming solver. We have tested our program on a single PC [a Linux (x64) desktop PC with i7-3960X CPU], using the filtered HuRef and the NA 12878 datasets (after applying some variant calling methods). With the all-heterozygous assumption, our approach can optimally solve the whole HuRef data set within a total time of 31 h (26 h for the most difficult block of the 15th chromosome and only 5 h for the other blocks). To our knowledge, this is the first time that MEC optimal solutions are completely obtained for the filtered HuRef dataset. Moreover, in the general case (without the all-heterozygous assumption), for the HuRef dataset our

  14. Molecular characterization of a long range haplotype affecting protein yield and mastitis susceptibility in Norwegian Red cattle.

    PubMed

    Sodeland, Marte; Grove, Harald; Kent, Matthew; Taylor, Simon; Svendsen, Morten; Hayes, Ben J; Lien, Sigbjørn

    2011-08-11

    Previous fine mapping studies in Norwegian Red cattle (NRC) in the region 86-90.4 Mb on Bos taurus chromosome 6 (BTA6) has revealed a quantitative trait locus (QTL) for protein yield (PY) around 88 Mb and a QTL for clinical mastitis (CM) around 90 Mb. The close proximity of these QTLs may partly explain the unfavorable genetic correlation between these two traits in NRC. A long range haplotype covering this region was introduced into the NRC population through the importation of a Holstein-Friesian bull (1606 Frasse) from Sweden in the 1970s. It has been suggested that this haplotype has a favorable effect on milk protein content but an unfavorable effect on mastitis susceptibility. Selective breeding for milk production traits is likely to have increased the frequency of this haplotype in the NRC population. Association mapping for PY and CM in NRC was performed using genotypes from 556 SNPs throughout the region 86-97 Mb on BTA6 and daughter-yield-deviations (DYDs) from 2601 bulls made available from the Norwegian dairy herd recording system. Highest test scores for PY were found for single-nucleotide polymorphisms (SNPs) within and surrounding the genes CSN2 and CSN1S2, coding for the β-casein and α(S2)-casein proteins. High coverage re-sequencing by high throughput sequencing technology enabled molecular characterization of a long range haplotype from 1606 Frasse encompassing these two genes. Haplotype analysis of a large number of descendants from this bull indicated that the haplotype was not markedly disrupted by recombination in this region. The haplotype was associated with both increased milk protein content and increased susceptibility to mastitis, which might explain parts of the observed genetic correlation between PY and CM in NRC. Plausible causal polymorphisms affecting PY were detected in the promoter region and in the 5'-flanking UTR of CSN1S2. These polymorphisms could affect transcription or translation of CSN1S2 and thereby affect the amount

  15. The Association of a Novel Haplotype in the Dopamine Transporter with Preschool Age Posttraumatic Stress Disorder

    PubMed Central

    Brett, Zoë H.; Henry, Caitlin; Scheeringa, Michael

    2013-01-01

    Abstract Objective Significant evidence supports a genetic contribution to the development of posttraumatic stress disorder (PTSD). Three previous studies have demonstrated an association between PTSD and the nine repeat allele of the 3′ untranslated region (3′UTR) variable number tandem repeat (VNTR) in the dopamine transporter (DAT, rs28363170). Recently a novel, functionally significant C/T single-nucleotide polymorphism (SNP) in the 3′UTR (rs27072) with putative interactions with the 3′VNTR, has been identified. To provide enhanced support for the role of DAT and striatal dopamine regulation in the development of PTSD, this study examined the impact of a haplotype defined by the C allele of rs27072 and the nine repeat allele of the 3′VNTR on PTSD diagnosis in young trauma-exposed children. Methods DAT haplotypes were determined in 150 trauma-exposed 3–6 year-old children. PTSD was assessed with a semistructured interview. After excluding double heterozygotes, analysis was performed on 143 total subjects. Haplotype was examined in relation to categorical and continuous measures of PTSD, controlling for trauma type and race. Additional analysis within the two largest race categories was performed, as other means of controlling for ethnic stratification were not available. Results The number of haplotypes (0, 1, or 2) defined by the presence of the nine repeat allele of rs28363170 (VNTR in the 3′UTR) and the C allele of rs27072 (SNP in the 3′UTR) was significantly associated with both the diagnosis of PTSD and total PTSD symptoms. Specifically, children with one or two copies of the haplotype had significantly more PTSD symptoms and were more likely to be diagnosed with PTSD than were children without this haplotype. Conclusions These findings extend previous findings associating genetic variation in the DAT with PTSD. The association of a haplotype in DAT with PTSD provides incremental traction for a model of genetic vulnerability to PTSD, a

  16. Inheritance of the 8.1 ancestral haplotype in recurrent pregnancy loss

    PubMed Central

    Kolte, Astrid M.; Nielsen, Henriette S.; Steffensen, Rudi; Crespi, Bernard; Christiansen, Ole B.

    2015-01-01

    Background and objectives: The 8.1 ancestral haplotype (AH) (HLA-A1, C7, B8, C4AQ0, C4B1, DR3, DQ2) is a remarkably long and conserved haplotype in the human major histocompatibility complex. It has been associated with both beneficial and detrimental effects, consistent with antagonistic pleiotropy. It has also been proposed that the survival of long, conserved haplotypes may be due to gestational drive, i.e. selective miscarriage of fetuses who have not inherited the haplotype from a heterozygous mother. Recurrent pregnancy loss (RPL) is defined as three or more consecutive pregnancy losses. The objective was to test the gestational drive theory for the 8.1AH in women with RPL and their live born children. Methodology: We investigated the inheritance of the 8.1AH from 82 heterozygous RPL women to 110 live born children. All participants were genotyped for HLA-A, -B and -DRB1 in DNA from EDTA-treated blood or buccal swaps. Inheritance was compared with a Mendelian inheritance of 50% using a two-sided exact binomial test. Results: We found that 55% of the live born children had inherited the 8.1AH, which was not significantly higher than the expected 50% (P = 0.29). Interestingly, we found a non-significant trend toward a higher inheritance of the 8.1AH in girls, 63%, P = 0.11 as opposed to boys, 50%, P = 1.00. Conclusions and implications: We did not find that the 8.1AH was significantly more often inherited by live born children of 8.1AH heterozygous RPL women. However our data suggest that there may be a sex-specific effect which would be interesting to explore further, both in RPL and in a background population. PMID:26675299

  17. A functional haplotype of UBE2L3 confers risk for Systemic Lupus Erythematosus

    PubMed Central

    Wang, Shaofeng; Adrianto, Indra; Wiley, Graham B.; Lessard, Christopher J.; Kelly, Jennifer A.; Adler, Adam J.; Glenn, Stuart B.; Williams, Adrienne H.; Ziegler, Julie T.; Comeau, Mary E.; Marion, Miranda C.; Wakeland, Benjamin E.; Liang, Chaoying; Kaufman, Kenneth M.; Guthridge, Joel M.; Alarcón-Riquelme, Marta E.; Alarcón, Graciela S.; Anaya, Juan-Manuel; Bae, Sang-Cheol; Kim, Jae-Hoon; Joo, Young Bin; Boackle, Susan A.; Brown, Elizabeth E.; Petri, Michelle A.; Ramsey-Goldman, Rosalind; Reveille, John D.; Vilá, Luis M.; Criswell, Lindsey A.; Edberg, Jeffrey C.; Freedman, Barry I.; Gilkeson, Gary S.; Jacob, Chaim O.; James, Judith A.; Kamen, Diane L.; Kimberly, Robert P.; Martin, Javier; Merrill, Joan T.; Niewold, Timothy B.; Pons-Estel, Bernardo A.; Scofield, R. Hal; Stevens, Anne M.; Tsao, Betty P.; Vyse, Timothy J.; Langefeld, Carl D.; Harley, John B.; Wakeland, Edward K.; Moser, Kathy L.; Montgomery, Courtney G.; Gaffney, Patrick M.

    2012-01-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical manifestations characterized by the development of pathogenic autoantibodies manifesting in inflammation of target organs such as the kidneys, skin and joints. Genome-wide association studies have identified genetic variants in the UBE2L3 region that are associated with SLE in subjects of European and Asian ancestry. UBE2L3 encodes an ubiquitin-conjugating enzyme, UBCH7, involved in cell proliferation and immune function. In this study, we sought to further characterize the genetic association in the region of UBE2L3 and use molecular methods to determine the functional effect of the risk haplotype. We identified significant associations between variants in the region of UBE2L3 and SLE in individuals of European and Asian ancestry that exceeded a Bonferroni corrected threshold (P < 1 × 10−4). A single risk haplotype was observed in all associated populations. Individuals harboring the risk haplotype display a significant increase in both UBE2L3 mRNA expression (P = 0.0004) and UBCH7 protein expression (P = 0.0068). The results suggest that variants carried on the SLE associated UBE2L3 risk haplotype influence autoimmunity by modulating UBCH7 expression. PMID:22476155

  18. Mapping the genetic diversity of HLA haplotypes in the Japanese populations

    PubMed Central

    Saw, Woei-Yuh; Liu, Xuanyao; Khor, Chiea-Chuen; Takeuchi, Fumihiko; Katsuya, Tomohiro; Kimura, Ryosuke; Nabika, Toru; Ohkubo, Takayoshi; Tabara, Yasuharu; Yamamoto, Ken; Yokota, Mitsuhiro; Akiyama, Koichi; Asano, Hiroyuki; Asayama, Kei; Haga, Toshikazu; Hara, Azusa; Hirose, Takuo; Hosaka, Miki; Ichihara, Sahoko; Imai, Yutaka; Inoue, Ryusuke; Ishiguro, Aya; Isomura, Minoru; Isono, Masato; Kamide, Kei; Kato, Norihiro; Katsuya, Tomohiro; Kikuya, Masahiro; Kohara, Katsuhiko; Matsubara, Tatsuaki; Matsuda, Ayako; Metoki, Hirohito; Miki, Tetsuro; Murakami, Keiko; Nabika, Toru; Nakatochi, Masahiro; Ogihara, Toshio; Ohnaka, Keizo; Ohkubo, Takayoshi; Rakugi, Hiromi; Satoh, Michihiro; Shiwaku, Kunihiro; Sugimoto, Ken; Tabara, Yasuharu; Takami, Yoichi; Takayanagi, Ryoichi; Takeuchi, Fumihiko; Tsubota-Utsugi, Megumi; Yamamoto, Ken; Yamamoto, Koichi; Yamasaki, Masayuki; Yasui, Daisaku; Yokota, Mitsuhiro; Teo, Yik-Ying; Kato, Norihiro

    2015-01-01

    Japan has often been viewed as an Asian country that possesses a genetically homogenous community. The basis for partitioning the country into prefectures has largely been geographical, although cultural and linguistic differences still exist between some of the districts/prefectures, especially between Okinawa and the mainland prefectures. The Major Histocompatibility Complex (MHC) region has consistently emerged as the most polymorphic region in the human genome, harbouring numerous biologically important variants; nevertheless the presence of population-specific long haplotypes hinders the imputation of SNPs and classical HLA alleles. Here, we examined the extent of genetic variation at the MHC between eight Japanese populations sampled from Okinawa, and six other prefectures located in or close to the mainland of Japan, specifically focusing at the haplotypes observed within each population, and what the impact of any variation has on imputation. Our results indicated that Okinawa was genetically farther to the mainland Japanese than were Gujarati Indians from Tamil Indians, while the mainland Japanese from six prefectures were more homogeneous than between northern and southern Han Chinese. The distribution of haplotypes across Japan was similar, although imputation was most accurate for Okinawa and several mainland prefectures when population-specific panels were used as reference. PMID:26648100

  19. Reference-based phasing using the Haplotype Reference Consortium panel.

    PubMed

    Loh, Po-Ru; Danecek, Petr; Palamara, Pier Francesco; Fuchsberger, Christian; A Reshef, Yakir; K Finucane, Hilary; Schoenherr, Sebastian; Forer, Lukas; McCarthy, Shane; Abecasis, Goncalo R; Durbin, Richard; L Price, Alkes

    2016-11-01

    Haplotype phasing is a fundamental problem in medical and population genetics. Phasing is generally performed via statistical phasing in a genotyped cohort, an approach that can yield high accuracy in very large cohorts but attains lower accuracy in smaller cohorts. Here we instead explore the paradigm of reference-based phasing. We introduce a new phasing algorithm, Eagle2, that attains high accuracy across a broad range of cohort sizes by efficiently leveraging information from large external reference panels (such as the Haplotype Reference Consortium; HRC) using a new data structure based on the positional Burrows-Wheeler transform. We demonstrate that Eagle2 attains a ∼20× speedup and ∼10% increase in accuracy compared to reference-based phasing using SHAPEIT2. On European-ancestry samples, Eagle2 with the HRC panel achieves >2× the accuracy of 1000 Genomes-based phasing. Eagle2 is open source and freely available for HRC-based phasing via the Sanger Imputation Service and the Michigan Imputation Server.

  20. Velocity landscape correlation resolves multiple flowing protein populations from fluorescence image time series.

    PubMed

    Pandžić, Elvis; Abu-Arish, Asmahan; Whan, Renee M; Hanrahan, John W; Wiseman, Paul W

    2018-02-16

    Molecular, vesicular and organellar flows are of fundamental importance for the delivery of nutrients and essential components used in cellular functions such as motility and division. With recent advances in fluorescence/super-resolution microscopy modalities we can resolve the movements of these objects at higher spatio-temporal resolutions and with better sensitivity. Previously, spatio-temporal image correlation spectroscopy has been applied to map molecular flows by correlation analysis of fluorescence fluctuations in image series. However, an underlying assumption of this approach is that the sampled time windows contain one dominant flowing component. Although this was true for most of the cases analyzed earlier, in some situations two or more different flowing populations can be present in the same spatio-temporal window. We introduce an approach, termed velocity landscape correlation (VLC), which detects and extracts multiple flow components present in a sampled image region via an extension of the correlation analysis of fluorescence intensity fluctuations. First we demonstrate theoretically how this approach works, test the performance of the method with a range of computer simulated image series with varying flow dynamics. Finally we apply VLC to study variable fluxing of STIM1 proteins on microtubules connected to the plasma membrane of Cystic Fibrosis Bronchial Epithelial (CFBE) cells. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. Human Leukocyte Antigen-A, B, C, DRB1, and DQB1 Allele and Haplotype Frequencies in a Subset of 237 Donors in the South African Bone Marrow Registry

    PubMed Central

    Ingram, Charlotte; Schlaphoff, Terry; Borrill, Veronica; Christoffels, Alan

    2018-01-01

    Human leukocyte antigen- (HLA-) A, HLA-B, HLA-C, HLA-DRB1, and HLA-DQB1 allele and haplotype frequencies were studied in a subset of 237 volunteer bone marrow donors registered at the South African Bone Marrow Registry (SABMR). Hapl-o-Mat software was used to compute allele and haplotype frequencies from individuals typed at various resolutions, with some alleles in multiple allele code (MAC) format. Four hundred and thirty-eight HLA-A, 235 HLA-B, 234 HLA-DRB1, 41 HLA-DQB1, and 29 HLA-C alleles are reported. The most frequent alleles were A∗02:02g (0.096), B∗07:02g (0.082), C∗07:02g (0.180), DQB1∗06:02 (0.157), and DRB1∗15:01 (0.072). The most common haplotype was A∗03:01g~B∗07:02g~C∗07:02g~DQB1∗06:02~DRB1∗15:01 (0.067), which has also been reported in other populations. Deviations from Hardy-Weinberg equilibrium were observed in A, B, and DRB1 loci, with C~DQB1 being the only locus pair in linkage disequilibrium. This study describes allele and haplotype frequencies from a subset of donors registered at SABMR, the only active bone marrow donor registry in Africa. Although the sample size was small, our results form a key resource for future population studies, disease association studies, and donor recruitment strategies. PMID:29850621

  2. Spatial and temporal distribution of the neutral polymorphisms in the last ZFX intron: analysis of the haplotype structure and genealogy.

    PubMed Central

    Jaruzelska, J; Zietkiewicz, E; Batzer, M; Cole, D E; Moisan, J P; Scozzari, R; Tavaré, S; Labuda, D

    1999-01-01

    With 10 segregating sites (simple nucleotide polymorphisms) in the last intron (1089 bp) of the ZFX gene we have observed 11 haplotypes in 336 chromosomes representing a worldwide array of 15 human populations. Two haplotypes representing 77% of all chromosomes were distributed almost evenly among four continents. Five of the remaining haplotypes were detected in Africa and 4 others were restricted to Eurasia and the Americas. Using the information about the ancestral state of the segregating positions (inferred from human-great ape comparisons), we applied coalescent analysis to estimate the age of the polymorphisms and the resulting haplotypes. The oldest haplotype, with the ancestral alleles at all the sites, was observed at low frequency only in two groups of African origin. Its estimated age of 740 to 1100 kyr corresponded to the time to the most recent common ancestor. The two most frequent worldwide distributed haplotypes were estimated at 550 to 840 and 260 to 400 kyr, respectively, while the age of the continentally restricted polymorphisms was 120 to 180 kyr and smaller. Comparison of spatial and temporal distribution of the ZFX haplotypes suggests that modern humans diverged from the common ancestral stock in the Middle Paleolithic era. Subsequent range expansion prevented substantial gene flow among continents, separating African groups from populations that colonized Eurasia and the New World. PMID:10388827

  3. Spatial and temporal distribution of the neutral polymorphisms in the last ZFX intron: analysis of the haplotype structure and genealogy.

    PubMed

    Jaruzelska, J; Zietkiewicz, E; Batzer, M; Cole, D E; Moisan, J P; Scozzari, R; Tavaré, S; Labuda, D

    1999-07-01

    With 10 segregating sites (simple nucleotide polymorphisms) in the last intron (1089 bp) of the ZFX gene we have observed 11 haplotypes in 336 chromosomes representing a worldwide array of 15 human populations. Two haplotypes representing 77% of all chromosomes were distributed almost evenly among four continents. Five of the remaining haplotypes were detected in Africa and 4 others were restricted to Eurasia and the Americas. Using the information about the ancestral state of the segregating positions (inferred from human-great ape comparisons), we applied coalescent analysis to estimate the age of the polymorphisms and the resulting haplotypes. The oldest haplotype, with the ancestral alleles at all the sites, was observed at low frequency only in two groups of African origin. Its estimated age of 740 to 1100 kyr corresponded to the time to the most recent common ancestor. The two most frequent worldwide distributed haplotypes were estimated at 550 to 840 and 260 to 400 kyr, respectively, while the age of the continentally restricted polymorphisms was 120 to 180 kyr and smaller. Comparison of spatial and temporal distribution of the ZFX haplotypes suggests that modern humans diverged from the common ancestral stock in the Middle Paleolithic era. Subsequent range expansion prevented substantial gene flow among continents, separating African groups from populations that colonized Eurasia and the New World.

  4. Single nucleotide polymorphisms and haplotypes associated with feed efficiency in beef cattle

    PubMed Central

    2013-01-01

    Background General, breed- and diet-dependent associations between feed efficiency in beef cattle and single nucleotide polymorphisms (SNPs) or haplotypes were identified on a population of 1321 steers using a 50 K SNP panel. Genomic associations with traditional two-step indicators of feed efficiency – residual feed intake (RFI), residual average daily gain (RADG), and residual intake gain (RIG) – were compared to associations with two complementary one-step indicators of feed efficiency: efficiency of intake (EI) and efficiency of gain (EG). Associations uncovered in a training data set were evaluated on independent validation data set. A multi-SNP model was developed to predict feed efficiency. Functional analysis of genes harboring SNPs significantly associated with feed efficiency and network visualization aided in the interpretation of the results. Results For the five feed efficiency indicators, the numbers of general, breed-dependent, and diet-dependent associations with SNPs (P-value < 0.0001) were 31, 40, and 25, and with haplotypes were six, ten, and nine, respectively. Of these, 20 SNP and six haplotype associations overlapped between RFI and EI, and five SNP and one haplotype associations overlapped between RADG and EG. This result confirms the complementary value of the one and two-step indicators. The multi-SNP models included 89 SNPs and offered a precise prediction of the five feed efficiency indicators. The associations of 17 SNPs and 7 haplotypes with feed efficiency were confirmed on the validation data set. Nine clusters of Gene Ontology and KEGG pathway categories (mean P-value < 0.001) including, 9nucleotide binding; ion transport, phosphorous metabolic process, and the MAPK signaling pathway were overrepresented among the genes harboring the SNPs associated with feed efficiency. Conclusions The general SNP associations suggest that a single panel of genomic variants can be used regardless of breed and diet. The breed- and diet

  5. Population-Specific Haplotype Association of the Postsynaptic Density Gene DLG4 with Schizophrenia, in Family-Based Association Studies

    PubMed Central

    Balan, Shabeesh; Yamada, Kazuo; Hattori, Eiji; Iwayama, Yoshimi; Toyota, Tomoko; Ohnishi, Tetsuo; Maekawa, Motoko; Toyoshima, Manabu; Iwata, Yasuhide; Suzuki, Katsuaki; Kikuchi, Mitsuru; Yoshikawa, Takeo

    2013-01-01

    The post-synaptic density (PSD) of glutamatergic synapses harbors a multitude of proteins critical for maintaining synaptic dynamics. Alteration of protein expression levels in this matrix is a marked phenomenon of neuropsychiatric disorders including schizophrenia, where cognitive functions are impaired. To investigate the genetic relationship of genes expressed in the PSD with schizophrenia, a family-based association analysis of genetic variants in PSD genes such as DLG4, DLG1, PICK1 and MDM2, was performed, using Japanese samples (124 pedigrees, n = 376 subjects). Results showed a significant association of the rs17203281 variant from the DLG4 gene, with preferential transmission of the C allele (p = 0.02), although significance disappeared after correction for multiple testing. Replication analysis of this variant, found no association in a Chinese schizophrenia cohort (293 pedigrees, n = 1163 subjects) or in a Japanese case-control sample (n = 4182 subjects). The DLG4 expression levels between postmortem brain samples from schizophrenia patients showed no significant changes from controls. Interestingly, a five marker haplotype in DLG4, involving rs2242449, rs17203281, rs390200, rs222853 and rs222837, was enriched in a population specific manner, where the sequences A-C-C-C-A and G-C-C-C-A accumulated in Japanese (p = 0.0009) and Chinese (p = 0.0007) schizophrenia pedigree samples, respectively. However, this could not be replicated in case-control samples. None of the variants in other examined candidate genes showed any significant association in these samples. The current study highlights a putative role for DLG4 in schizophrenia pathogenesis, evidenced by haplotype association, and warrants further dense screening for variants within these haplotypes. PMID:23936182

  6. A new JAVA interface implementation of THESIAS: testing haplotype effects in association studies.

    PubMed

    Tregouet, D A; Garelle, V

    2007-04-15

    THESIAS (Testing Haplotype EffectS In Association Studies) is a popular software for carrying haplotype association analysis in unrelated individuals. In addition to the command line interface, a graphical JAVA interface is now proposed allowing one to run THESIAS in a user-friendly manner. Besides, new functionalities have been added to THESIAS including the possibility to analyze polychotomous phenotype and X-linked polymorphisms. The software package including documentation and example data files is freely available at http://genecanvas.ecgene.net. The source codes are also available upon request.

  7. Cystic fibrosis transmembrane regulator haplotypes in households of patients with cystic fibrosis.

    PubMed

    Furgeri, Daniela Tenório; Marson, Fernando Augusto Lima; Correia, Cyntia Arivabeni Araújo; Ribeiro, José Dirceu; Bertuzzo, Carmen Sílvia

    2018-01-30

    Nearly 2000 mutations in the cystic fibrosis transmembrane regulator (CFTR) gene have been reported. The F508del mutation occurs in approximately 50-65% of patients with cystic fibrosis (CF). However, molecular diagnosis is not always possible. Therefore, silent polymorphisms can be used to label the mutant allele in households of patients with CF. To verify the haplotypes of four polymorphisms at the CFTR locus in households of patients with CF for pre-fertilization, pre-implantation, and prenatal indirect mutation diagnosis to provide better genetic counseling for families and patients with CF and to associate the genotypes/haplotypes with the F508del mutation screening. GATT polymorphism analysis was performed using direct polymerase chain reaction amplification, and the MP6-D9, TUB09 and TUB18 polymorphism analyses were performed using restriction fragment length polymorphism. Nine haplotypes were found in 37 CFTR alleles, and of those, 24 were linked with the F508del mutation and 13 with other CFTR mutations. The 6 (GATT), C (MP6-D9), G (TUB09), and C (TUB18) haplotypes showed the highest prevalence (48%) of the mutant CFTR allele and were linked to the F508del mutation (64%). In 43% of households analyzed, at least one informative polymorphism can be used for the indirect diagnostic test. CFTR polymorphisms are genetic markers that are useful for identifying the mutant CFTR alleles in households of patients with CF when it is not possible to establish the complete CFTR genotype. Moreover, the polymorphisms can be used for indirect CFTR mutation identification in cases of pre-fertilization, pre-implantation and prenatal analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Effects of ploidy level and haplotype on variation of photosynthetic traits: Novel evidence from two Fragaria species

    PubMed Central

    Gao, Song; Yan, Qiaodi; Chen, Luxi; Song, Yaobin; Fu, Chengxin; Dong, Ming

    2017-01-01

    To reveal the effects of ploidy level and haplotype on photosynthetic traits, we chose 175 genotypes of wild strawberries belonging to two haplotypes at two types of ploidy levels (diploidy and tetraploidy) and measured photosynthetic traits. Our results revealed that ploidy significantly affected the characteristics of light-response curves, CO2-response curves, and leaf gas exchange parameters, except intercellular CO2 concentration (Ci). Tetraploid species had a lower light saturation point (LSP) and CO2 saturation point (CSP), higher light compensation point (LCP), dark respiration (Rd), and CO2 compensation point (CCP) than diploid species. Furthermore, tetraploid species have lower photosynthetic capacity than diploid species, including net photosynthetic rate (Pn), stomatal conductivity (Gs), and transpiration rate (Tr). In addition, haplotype had a significant effect on LSP, CSP, Tr, and Ci as well as a significant interactive effect between ploidy and haplotype on the maximal photosynethic rate of the light-response curve and Rd. Most of the variance existed within haplotypes among individuals. These results suggest that polyploidization was the main driver for the evolution of photosynthesis with increasing ploidy level (i.e. from diploidy to tetraploidy in Fragaria species), while the origin of a chromosome could also affect the photosynthetic traits and the polyploidization effect on photosynthetic traits. PMID:28644876

  9. Effects of ploidy level and haplotype on variation of photosynthetic traits: Novel evidence from two Fragaria species.

    PubMed

    Gao, Song; Yan, Qiaodi; Chen, Luxi; Song, Yaobin; Li, Junmin; Fu, Chengxin; Dong, Ming

    2017-01-01

    To reveal the effects of ploidy level and haplotype on photosynthetic traits, we chose 175 genotypes of wild strawberries belonging to two haplotypes at two types of ploidy levels (diploidy and tetraploidy) and measured photosynthetic traits. Our results revealed that ploidy significantly affected the characteristics of light-response curves, CO2-response curves, and leaf gas exchange parameters, except intercellular CO2 concentration (Ci). Tetraploid species had a lower light saturation point (LSP) and CO2 saturation point (CSP), higher light compensation point (LCP), dark respiration (Rd), and CO2 compensation point (CCP) than diploid species. Furthermore, tetraploid species have lower photosynthetic capacity than diploid species, including net photosynthetic rate (Pn), stomatal conductivity (Gs), and transpiration rate (Tr). In addition, haplotype had a significant effect on LSP, CSP, Tr, and Ci as well as a significant interactive effect between ploidy and haplotype on the maximal photosynethic rate of the light-response curve and Rd. Most of the variance existed within haplotypes among individuals. These results suggest that polyploidization was the main driver for the evolution of photosynthesis with increasing ploidy level (i.e. from diploidy to tetraploidy in Fragaria species), while the origin of a chromosome could also affect the photosynthetic traits and the polyploidization effect on photosynthetic traits.

  10. Computational intelligence in bioinformatics: SNP/haplotype data in genetic association study for common diseases.

    PubMed

    Kelemen, Arpad; Vasilakos, Athanasios V; Liang, Yulan

    2009-09-01

    Comprehensive evaluation of common genetic variations through association of single-nucleotide polymorphism (SNP) structure with common complex disease in the genome-wide scale is currently a hot area in human genome research due to the recent development of the Human Genome Project and HapMap Project. Computational science, which includes computational intelligence (CI), has recently become the third method of scientific enquiry besides theory and experimentation. There have been fast growing interests in developing and applying CI in disease mapping using SNP and haplotype data. Some of the recent studies have demonstrated the promise and importance of CI for common complex diseases in genomic association study using SNP/haplotype data, especially for tackling challenges, such as gene-gene and gene-environment interactions, and the notorious "curse of dimensionality" problem. This review provides coverage of recent developments of CI approaches for complex diseases in genetic association study with SNP/haplotype data.

  11. Population Structure of Pseudocercospora fijiensis in Costa Rica Reveals Shared Haplotype Diversity with Southeast Asian Populations.

    PubMed

    Saville, Amanda; Charles, Melodi; Chavan, Suchitra; Muñoz, Miguel; Gómez-Alpizar, Luis; Ristaino, Jean Beagle

    2017-12-01

    Pseudocercospora fijiensis is the causal pathogen of black Sigatoka, a devastating disease of banana that can cause 20 to 80% yield loss in the absence of fungicides in banana crops. The genetic structure of populations of P. fijiensis in Costa Rica was examined and compared with Honduran and global populations to better understand migration patterns and inform management strategies. In total, 118 isolates of P. fijiensis collected from Costa Rica and Honduras from 2010 to 2014 were analyzed using multilocus genotyping of six loci and compared with a previously published global dataset of populations of P. fijiensis. The Costa Rican and Honduran populations shared haplotype diversity with haplotypes from Southeast Asia, Oceania, and the Americas but not Africa for all but one of the six loci studied. Gene flow and shared haplotype diversity was found in Honduran and Costa Rican populations of the pathogen. The data indicate that the haplotypic diversity observed in Costa Rican populations of P. fijiensis is derived from dispersal from initial outbreak sources in Honduras and admixtures between genetically differentiated sources from Southeast Asia, Oceania, and the Americas.

  12. Discovery of a haplotype affecting fertility in Ayrshire dairy dattle and identification of a putative causal variant

    USDA-ARS?s Scientific Manuscript database

    Initial genomic test results for US Ayrshire dairy cattle became available in January of 2013. Several haplotypes that showed a deficiency of homozygotes were investigated to determine if they had an effect on fertility. A haplotype on chromosome 17 was determined to affect fertility, indicating tha...

  13. Addiction Genetics and Pleiotropic Effects of Common Haplotypes that Make Polygenic Contributions to Vulnerability to Substance Dependence

    PubMed Central

    Uhl, George R.; Drgon, Tomas; Johnson, Catherine; Liu, Qing-Rong

    2016-01-01

    Abundant evidence from family, adoption, and twin studies point to large genetic contributions to individual differences in vulnerability to develop dependence on one or more addictive substances. Twin data suggest that most of this genetic vulnerability is shared by individuals who are dependent on a variety of addictive substances. Molecular genetic studies, especially genomewide and candidate gene association studies, have elucidated common haplotypes in dozens of genes that appear to make polygenic contributions to vulnerability to developing dependence. Most genes that harbor currently identified addiction-associated haplotypes are expressed in the brain. Haplotypes in many of the same genes are identified in genomewide association studies that compare allele frequencies in substance dependent vs. control individuals from European, African, and Asian racial/ethnic backgrounds. Many of these addiction-associated haplotypes display pleiotropic influences on a variety of related brain-based phenotypes that display 1) substantial heritability and 2) clinical cooccurence with substance dependence. PMID:19152208

  14. Assessment of pfcrt 72-76 haplotypes eight years after chloroquine withdrawal in Kinshasa, Democratic Republic of Congo.

    PubMed

    Mvumbi, Dieudonné Makaba; Boreux, Raphael; Sacheli, Rosalie; Lelo, Mvumbi; Lengu, Bobanga; Nani-Tuma, Situakibanza; Melin, Pierrette; Ntumba, Kayembe; Lunganza, Kalala; DeMol, Patrick; Hayette, Marie-Pierre

    2013-12-20

    In 2001, the World Health Organization (WHO) has recommended the use of artemisinin-based combination therapy (ACT) as the first-line treatment of uncomplicated malaria cases, as monotherapies had become ineffective in many parts of the world. As a result, the Democratic Republic of Congo (DRC) withdrew chloroquine (CQ) from its malaria treatment policy in 2002 and an artesunate (AS)-amodiaquine (AQ) combination became the ACT of choice in DRC in 2005. AQ-resistance (AQR) has been reported in several parts of the world and mutations in codons 72-76 of the Plasmodium falciparum chloroquine-resistance transporter (pfcrt) gene have been strongly correlated with resistance, especially mutations encoding the SVMNT haplotype. This haplotype was first identified in Southeast Asia and South America but was recently reported in two African countries neighbouring DRC. These facts raised two questions: the first about the evolution of CQ resistance (CQR) in DRC and the second about the presence of the SVMNT haplotype, which would compromise the use of AQ as a partner drug for ACT. A total of 213 thick blood films were randomly collected in 2010 from a paediatric clinic in Kinshasa, DRC. Microscopy controls and real-time polymerase chain reaction (RT-PCR) were performed for Plasmodium species identification. Haplotypes of the pfcrt gene were determined by sequencing. The K76T mutation was detected in 145 out of 198 P. falciparum-positive samples (73.2%). In these 145 resistant strains, only the CVIET haplotype was detected. This study is the first to assess the molecular markers of resistance to CQ and AQ after the introduction of ACT in DRC. The results suggest first that CQR is decreasing, as wild-type pfcrt haplotypes were found in only 26.8% of the samples and secondly that the SVMNT haplotype is not yet present in Kinshasa, suggesting that AQ remains valid as a partner drug for ACT in this region.

  15. Haplotypes identified by 10 DNA restriction fragment length polymorphisms at the human low density lipoprotein receptor gene locus.

    PubMed Central

    Kotze, M J; Langenhoven, E; Retief, A E; Seftel, H C; Henderson, H E; Weich, H F

    1989-01-01

    Ten useful two allele restriction fragment length polymorphisms of the low density lipoprotein receptor gene were used for haplotype analysis in 45 unrelated familial hypercholesterolaemic (FH) patients, 60 normal controls, and 32 FH homozygotes, all of whom were white Afrikaners. Pedigree analysis in 27 informative heterozygous FH and 23 normal families has shown the segregation of at least 17 haplotypes in the normal population (111 chromosomes) compared to a predominant association of two of these haplotypes with the disease in the FH subjects. This association was further confirmed in 32 FH homozygotes, indicating at least two 'founder' members for the disease in the Afrikaner population. Recombination events were not detected in any of the families studied and we thus conclude that the haplotypes associated with FH function as specific markers for the disease and will allow presymptomatic diagnosis in affected families. PMID:2565980

  16. The effect of missing data on linkage disequilibrium mapping and haplotype association analysis in the GAW14 simulated datasets

    PubMed Central

    McCaskie, Pamela A; Carter, Kim W; McCaskie, Simon R; Palmer, Lyle J

    2005-01-01

    We used our newly developed linkage disequilibrium (LD) plotting software, JLIN, to plot linkage disequilibrium between pairs of single-nucleotide polymorphisms (SNPs) for three chromosomes of the Genetic Analysis Workshop 14 Aipotu simulated population to assess the effect of missing data on LD calculations. Our haplotype analysis program, SIMHAP, was used to assess the effect of missing data on haplotype-phenotype association. Genotype data was removed at random, at levels of 1%, 5%, and 10%, and the LD calculations and haplotype association results for these levels of missingness were compared to those for the complete dataset. It was concluded that ignoring individuals with missing data substantially affects the number of regions of LD detected which, in turn, could affect tagging SNPs chosen to generate haplotypes. PMID:16451612

  17. Biological impact of α genes, β haplotypes, and G6PD activity in sickle cell anemia at baseline and with hydroxyurea

    PubMed Central

    Arnaud, Cécile; Kamdem, Annie; Hau, Isabelle; Lelong, Françoise; Epaud, Ralph; Pondarré, Corinne; Pissard, Serge

    2018-01-01

    Sickle cell anemia (SCA), albeit monogenic, has heterogeneous phenotypic expression, mainly related to the level of hemoglobin F (HbF). No large cohort studies have ever compared biological parameters in patients with major β-globin haplotypes; ie, Senegal (SEN), Benin (BEN), and Bantu/Central African Republic (CAR). The aim of this study was to evaluate the biological impact of α genes, β haplotypes, and glucose-6-phosphate dehydrogenase (G6PD) activity at baseline and with hydroxyurea (HU). Homozygous HbS patients from the Créteil pediatric cohort with available α-gene and β-haplotype data were included (n = 580; 301 females and 279 males) in this retrospective study. Homozygous β-haplotype patients represented 74% of cases (37.4% CAR/CAR, 24.3% BEN/BEN, and 12.1% SEN/SEN). HU was given to 168 cohort SCA children. Hematological parameters were recorded when HbF was maximal, and changes (ΔHU-T0) were calculated. At baseline, CAR-haplotype and α-gene numbers were independently and negatively correlated with Hb and positively correlated with lactate dehydrogenase. HbF was negatively correlated with CAR-haplotype numbers and positively with BEN- and SEN-haplotype numbers. The BCL11A/rs1427407 “T” allele, which is favorable for HbF expression, was positively correlated with BEN- and negatively correlated with CAR-haplotype numbers. With HU treatment, Δ and HbF values were positively correlated with the BEN-haplotype number. BEN/BEN patients had higher HbF and Hb levels than CAR/CAR and SEN/SEN patients. In conclusion, we show that BEN/BEN patients have the best response on HU and suggest that this could be related to the higher prevalence of the favorable BCL11A/rs1427407/T/allele for HbF expression in these patients. PMID:29555644

  18. HLA haplotype map of river valley populations with hemochromatosis traced through five centuries in Central Sweden.

    PubMed

    Olsson, K Sigvard; Ritter, Bernd; Hansson, Norbeth; Chowdhury, Ruma R

    2008-07-01

    The hemochromatosis mutation, C282Y of the HFE gene, seems to have originated from a single event which once occurred in a person living in the north west of Europe carrying human leukocyte antigen (HLA)-A3-B7. In descendants of this ancestor also other haplotypes appear probably caused by local recombinations and founder effects. The background of these associations is unknown. Isolated river valley populations may be fruitful for the mapping of genetic disorders such as hemochromatosis. In this study, we try to test this hypothesis in a study from central Sweden where the haplotyope A1-B8 was common. HLA haplotypes and HFE mutations were studied in hemochromatosis patients with present or past parental origin in a sparsely populated (1/km(2)) rural district (n = 8366 in the year of 2005), in central Sweden. Pedigrees were constructed from the Swedish church book registry. Extended haplotypes were studied to evaluate origin of recombinations. There were 87 original probands, 36 females and 51 males identified during 30 yr, of whom 86% carried C282Y/C282Y and 14% C282Y/H63D. Of 32 different HLA haplotypes A1-B8 was the most common (34%), followed by A3-B7 (16%), both in strong linkage disequilibrium with controls, (P < 0.001). Twenty-nine different families with A1-B8 had a common founder origin 15 generations ago in small bottleneck populations of the late 16th century. A second A1-B8 founder born 1655 was of Norwegian origin. Most of the A3 carriers (n = 26) had a common founder origin 16 generations ago in an even smaller nearby river valley. A fourth founder family carrying HLA-A2 seems to have originated from a recombination along the descendant lines from the A3 ancestor supported by extended haplotype studies. A1-haplotypes with alleles at the B locus different from B8 had a similar recombination origin as HLA-A2 alleles and a common founder origin 11 generations ago. The intergenerational time interval averaged 35.5 +/- 7.9 yr in men and 31.9 +/- 5.9 in

  19. Y chromosomal haplotype characteristics of domestic sheep (Ovis aries) in China.

    PubMed

    Wang, Yutao; Xu, Lei; Yan, Wei; Li, Shaobin; Wang, Jiqing; Liu, Xiu; Hu, Jiang; Luo, Yuzhu

    2015-07-10

    Investigations on the variation present at the male-specific Y chromosome region provide strong information to understand the origin and evolution of domestic sheep. One SNP OY1 (g.88A>G) in the upstream region of SRY gene, and the microsatellite SRYM18 locus within ovine Y chromosome were analyzed in one hundred and forty five samples collected from eleven breeds in China. SNP OY1 was analyzed using PCR-SSCP method and sequencing. Two different PCR-SSCP patterns represented two specific sequences with sequence analysis revealing SNP-OY1 (g.88A>G) were observed, while SNP A-OY1 showed the most common frequency (82.8%). Sequencing of the SRYM18 region revealed one novel size fragment (A2) with different repetitive units. Seven haplotypes (H4, H5, H6, H7, H8, H9 and H12) and two novel haplotypes (Ha and Hb) were established using combined genotype analysis. H6 showed the highest frequency (43.4%) across all breeds, and H8 showed the second frequency (24.1%). Ha was only found in one breed (Tan), while Hb was present in three breeds (Gansu alpine, White Suffolk and Duolang). Our findings reveal one novel allele in SRYM18 region and two novel male haplotypes of domestic sheep in China. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Linkage Disequilibrium and Haplotype Diversity in the Genes of the Renin–Angiotensin System: Findings From the Family Blood Pressure Program

    PubMed Central

    Zhu, Xiaofeng; Yan, Denise; Cooper, Richard S.; Luke, Amy; Ikeda, Morna A.; Chang, Yen-Pei C.; Weder, Alan; Chakravarti, Aravinda

    2003-01-01

    Association studies of candidate genes with complex traits have generally used one or a few single nucleotide polymorphisms (SNPs), although variation in the extent of linkage disequilibrium (LD) within genes markedly influences the sensitivity and precision of association studies. The extent of LD and the underlying haplotype structure for most candidate genes are still unavailable. We sampled 193 blacks (African-Americans) and 160 whites (European-Americans) and estimated the intragenic LD and the haplotype structure in four genes of the renin–angiotensin system. We genotyped 25 SNPs, with all but one of the pairs spaced between 1 and 20 kb, thus providing resolution at small scale. The pattern of LD within a gene was very heterogeneous. Using a robust method to define haplotype blocks, blocks of limited haplotype diversity were identified at each locus; between these blocks, LD was lost owing to the history of recombination events. As anticipated, there was less LD among blacks, the number of haplotypes was substantially larger, and shorter haplotype segments were found, compared with whites. These findings have implications for candidate-gene association studies and indicate that variation between populations of European and African origin in haplotype diversity is characteristic of most genes. [The sequence data described in this paper are available in GenBank under the following accession nos: AGT, MIM 106150; Renin, MIM 179820; ACE, MIM 106180; Angiotensin receptor I, MIM 106165. Supplementary material is available online at http://www.genome.org.] PMID:12566395

  1. Association of galanin haplotypes with alcoholism and anxiety in two ethnically distinct populations

    PubMed Central

    Belfer, I; Hipp, H; McKnight, C; Evans, C; Buzas, B; Bollettino, A; Albaugh, B; Virkkunen, M; Yuan, Q; Max, MB; Goldman, D; Enoch, MA

    2009-01-01

    The neuropeptide galanin (GAL) is widely expressed in the central nervous system. Animal studies have implicated GAL in alcohol abuse and anxiety: chronic ethanol intake increases hypothalamic GAL mRNA; high levels of stress increase GAL release in the central amygdala. The coding sequence of the galanin gene, GAL, is highly conserved and a functional polymorphism has not yet been found. The aim of our study was, for the first time, to identify GAL haplotypes and investigate associations with alcoholism and anxiety. Seven single-nucleotide polymorphisms (SNPs) spanning GAL were genotyped in 65 controls from five populations: US and Finnish Caucasians, African Americans, Plains and Southwestern Indians. A single haplotype block with little evidence of historical recombination was observed for each population. Four tag SNPs were then genotyped in DSM-III-R lifetime alcoholics and nonalcoholics from two population isolates: 514 Finnish Caucasian men and 331 Plains Indian men and women. Tridimensional Personality Questionnaire harm avoidance (HA) scores, a dimensional measure of anxiety, were obtained. There was a haplotype association with alcoholism in both the Finnish (P=0.001) and Plains Indian (P=0.004) men. The SNPs were also significantly associated. Alcoholics were divided into high and low HA groups (≥ and < mean HA of population). In the Finns, haplotype (P < 0.0001) and diplotype (P < 0.0001) distributions differed between high HA alcoholics, low HA alcoholics and nonalcoholics. Our results from two independent populations suggest that GAL may contribute to vulnerability to alcoholism, perhaps mediated by dimensional anxiety. PMID:16314872

  2. Effect of genetic type and casein haplotype on antioxidant activity of yogurts during storage.

    PubMed

    Perna, A; Intaglietta, I; Simonetti, A; Gambacorta, E

    2013-06-01

    The aim of this work was to investigate the antioxidant activity of yogurt made from the milk of 2 breeds-Italian Brown and Italian Holstein-characterized by different casein haplotypes (αS1-, β-, and κ-caseins) during storage up to 15 d. The casein haplotype was determined by isoelectric focusing; antioxidant activity of yogurt was measured using 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid). The statistical analysis showed a significant effect of the studied factors. Antioxidant activity increased during storage of both yogurt types, but yogurt produced with Italian Brown milk showed higher antioxidant activity than those produced with Italian Holstein milk. A high scavenging activity was present in yogurts with the allelic combination of BB-A(2)A(2)-BB. The results of this study suggest that the genetic type and the haplotype make a significant contribution in the production of yogurts with high nutraceutical value. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. Overtone Mobility Spectrometry (Part 2): Theoretical Considerations of Resolving Power

    PubMed Central

    Valentine, Stephen J.; Stokes, Sarah T.; Kurulugama, Ruwan T.; Nachtigall, Fabiane M.; Clemmer, David E.

    2009-01-01

    The transport of ions through multiple drift regions is modeled in order to develop an equation that is useful for an understanding of the resolving power of an overtone mobility spectrometry (OMS) technique. It is found that resolving power is influenced by a number of experimental variables, including those that define ion mobility spectrometry (IMS) resolving power: drift field (E), drift region length (L), and buffer gas temperature (T). However, unlike IMS, the resolving power of OMS is also influenced by the number of drift regions (n), harmonic frequency value (m), and the phase number (ϕ) of the applied drift field. The OMS resolving power dependence upon the new OMS variables (n, m, and ϕ) scales differently than the square root dependence of the E, L, and T variables in IMS. The results provide insight about optimal instrumental design and operation. PMID:19230705

  4. Y chromosome haplotype diversity of domestic sheep (Ovis aries) in northern Eurasia.

    PubMed

    Zhang, Min; Peng, Wei-Feng; Yang, Guang-Li; Lv, Feng-Hua; Liu, Ming-Jun; Li, Wen-Rong; Liu, Yong-Gang; Li, Jin-Quan; Wang, Feng; Shen, Zhi-Qiang; Zhao, Sheng-Guo; Hehua, Eer; Marzanov, Nurbiy; Murawski, Maziek; Kantanen, Juha; Li, Meng-Hua

    2014-12-01

    Variation in two SNPs and one microsatellite on the Y chromosome was analyzed in a total of 663 rams representing 59 breeds from a large geographic range in northern Eurasia. SNPA-oY1 showed the highest allele frequency (91.55%) across the breeds, whereas SNPG-oY1 was present in only 56 samples. Combined genotypes established seven haplotypes (H4, H5, H6, H7, H8, H12 and H19). H6 dominated in northern Eurasia, and H8 showed the second-highest frequency. H4, which had been earlier reported to be absent in European breeds, was detected in one European breed (Swiniarka), whereas H7, which had been previously identified to be unique to European breeds, was present in two Chinese breeds (Ninglang Black and Large-tailed Han), one Buryatian (Transbaikal Finewool) and two Russian breeds (North Caucasus Mutton-Wool and Kuibyshev). H12, which had been detected only in Turkish breeds, was also found in Chinese breeds in this work. An overall low level of haplotype diversity (median h = 0.1288) was observed across the breeds with relatively higher median values in breeds from the regions neighboring the Near Eastern domestication center of sheep. H6 is the dominant haplotype in northwestern and eastern China, in which the haplotype distribution could be explained by the historical translocations of the H4 and H8 Y chromosomes to China via the Mongol invasions followed by expansions to northwestern and eastern China. Our findings extend previous results of sheep Y chromosomal genetic variability and indicate probably recent paternal gene flows between sheep breeds from distinct major geographic regions. © 2014 Stichting International Foundation for Animal Genetics.

  5. [Analysis of HLA haplotype frequency and linkage disequilibrium in patients with acute lymphoblastic leukemia from Northern Chinese Han].

    PubMed

    Gao, Su-qing; Cheng, Liang-hong; Lu, Liang; Jing, Shi-zheng; Cheng, Xi; Zhang, Yin-ze; Zou, Hong-yan; Deng, Zhi-hui

    2009-02-01

    To analyze the difference between the frequencies of HLA-A-B, B-DRB1 and A-B-DRB1 haplotype, as well as their linkage disequilibrium pattern in patients with acute lymphoblastic leukemia(ALL) and healthy controls from Northern Chinese Han. The frequencies of HLA-A-B, B-DRB1, A-B-DR haplotypes and linkage disequilibrium were estimated by Expectation Maximization method based on the genotypes of 643 patients with ALL and 2 0359 unrelated healthy donors, and the statistical significance between the two groups were estimated by chi-square test. Linkage disequilibrium was analyzed with population genetic methods. The most common HLA-A-B, B-DRB1, and A-B-DR haplotypes were A30-B13, A2-B46, A33-B58, B13-DR7, B46-DR9, B52-DR15, B58-DR17, A30-B13-DR7, A33-B58-DR17 and A1-B37-DR10 in both groups. The frequencies of A30-B13, A2-B46, A33-B44, B13-DR7, A30-B13-DR7 and A2-B46-DR9 haplotypes and linkage disequilibrium value were significantly decreased (P<0.05) in the patient group than that in the control group. On the other hand, the frequencies of A2-B52, A31-B61, A24- B8, B60-DR9, B27-DR4, B52-DR14, B44-DR17, B27-DR12 and A11-B27-DR12 haplotypes and linkage disequilibrium value were significantly increased (P<0.05) in the patient group than that in the control group. There are some common and positive linkage disequilibrium haplotypes in both the ALL patients and the healthy donors in Northern Chinese Han. Interestingly, some haplotypes and their linkage disequilibrium patterns had significantly different distributions between the two groups. The study provided basic data for the relationship of ALL and HLA haplotype and for finding the HLA-A, B, DR matching donors.

  6. The prognostic impact of germline 46/1 haplotype of Janus kinase 2 in cytogenetically normal acute myeloid leukemia

    PubMed Central

    Nahajevszky, Sarolta; Andrikovics, Hajnalka; Batai, Arpad; Adam, Emma; Bors, Andras; Csomor, Judit; Gopcsa, Laszlo; Koszarska, Magdalena; Kozma, Andras; Lovas, Nora; Lueff, Sandor; Matrai, Zoltan; Meggyesi, Nora; Sinko, Janos; Sipos, Andrea; Varkonyi, Andrea; Fekete, Sandor; Tordai, Attila; Masszi, Tamas

    2011-01-01

    Background Prognostic risk stratification according to acquired or inherited genetic alterations has received increasing attention in acute myeloid leukemia in recent years. A germline Janus kinase 2 haplotype designated as the 46/1 haplotype has been reported to be associated with an inherited predisposition to myeloproliferative neoplasms, and also to acute myeloid leukemia with normal karyotype. The aim of this study was to assess the prognostic impact of the 46/1 haplotype on disease characteristics and treatment outcome in acute myeloid leukemia. Design and Methods Janus kinase 2 rs12343867 single nucleotide polymorphism tagging the 46/1 haplotype was genotyped by LightCycler technology applying melting curve analysis with the hybridization probe detection format in 176 patients with acute myeloid leukemia under 60 years diagnosed consecutively and treated with curative intent. Results The morphological subtype of acute myeloid leukemia with maturation was less frequent among 46/1 carriers than among non-carriers (5.6% versus 17.2%, P=0.018, cytogenetically normal subgroup: 4.3% versus 20.6%, P=0.031), while the morphological distribution shifted towards the myelomonocytoid form in 46/1 haplotype carriers (28.1% versus 14.9%, P=0.044, cytogenetically normal subgroup: 34.0% versus 11.8%, P=0.035). In cytogenetically normal cases of acute myeloid leukemia, the 46/1 carriers had a considerably lower remission rate (78.7% versus 94.1%, P=0.064) and more deaths in remission or in aplasia caused by infections (46.8% versus 23.5%, P=0.038), resulting in the 46/1 carriers having shorter disease-free survival and overall survival compared to the 46/1 non-carriers. In multivariate analysis, the 46/1 haplotype was an independent adverse prognostic factor for disease-free survival (P=0.024) and overall survival (P=0.024) in patients with a normal karyotype. Janus kinase 2 46/1 haplotype had no impact on prognosis in the subgroup with abnormal karyotype. Conclusions Janus

  7. Near East mtDNA haplotype variants in Roman cattle from Augusta Raurica, Switzerland, and in the Swiss Evolène breed.

    PubMed

    Schlumbaum, A; Turgay, M; Schibler, J

    2006-08-01

    Typical Near East mitochondrial haplotypes of the T2 lineage were found in one cattle metacarpus sample from the Roman period and in two present-day Evolène cattle in Switzerland. Sequences from eight additional Evolène and four Raetian Grey aligned to the European haplotype T3. Analysis of nucleotide diversity within the mitochondrial D-loop of both studied Swiss cattle breeds revealed high haplotype diversity and similar diversity to a European cattle reference group. Mitochondrial T3 haplotypes radiated star-like from two similarly frequent haplotypes, possibly indicating two different expansion routes. The breed structure of Evolène cattle can be explained either by an introduction of diverse female lineages from the domestication centre or by later admixture. The introduction of the Near East lineage to Switzerland must have happened during the Roman time or earlier.

  8. Haplotag: Software for Haplotype-Based Genotyping-by-Sequencing Analysis

    PubMed Central

    Tinker, Nicholas A.; Bekele, Wubishet A.; Hattori, Jiro

    2016-01-01

    Genotyping-by-sequencing (GBS), and related methods, are based on high-throughput short-read sequencing of genomic complexity reductions followed by discovery of single nucleotide polymorphisms (SNPs) within sequence tags. This provides a powerful and economical approach to whole-genome genotyping, facilitating applications in genomics, diversity analysis, and molecular breeding. However, due to the complexity of analyzing large data sets, applications of GBS may require substantial time, expertise, and computational resources. Haplotag, the novel GBS software described here, is freely available, and operates with minimal user-investment on widely available computer platforms. Haplotag is unique in fulfilling the following set of criteria: (1) operates without a reference genome; (2) can be used in a polyploid species; (3) provides a discovery mode, and a production mode; (4) discovers polymorphisms based on a model of tag-level haplotypes within sequenced tags; (5) reports SNPs as well as haplotype-based genotypes; and (6) provides an intuitive visual “passport” for each inferred locus. Haplotag is optimized for use in a self-pollinating plant species. PMID:26818073

  9. IL1B-CGTC haplotype is associated with colorectal cancer in admixed individuals with increased African ancestry

    PubMed Central

    Sanabria-Salas, María Carolina; Hernández-Suárez, Gustavo; Umaña-Pérez, Adriana; Rawlik, Konrad; Tenesa, Albert; Serrano-López, Martha Lucía; Sánchez de Gómez, Myriam; Rojas, Martha Patricia; Bravo, Luis Eduardo; Albis, Rosario; Plata, José Luis; Green, Heather; Borgovan, Theodor; Li, Li; Majumdar, Sumana; Garai, Jone; Lee, Edward; Ashktorab, Hassan; Brim, Hassan; Li, Li; Margolin, David; Fejerman, Laura; Zabaleta, Jovanny

    2017-01-01

    Single-nucleotide polymorphisms (SNPs) in cytokine genes can affect gene expression and thereby modulate inflammation and carcinogenesis. However, the data on the association between SNPs in the interleukin 1 beta gene (IL1B) and colorectal cancer (CRC) are conflicting. We found an association between a 4-SNP haplotype block of the IL1B (-3737C/-1464G/-511T/-31C) and CRC risk, and this association was exclusively observed in individuals with a higher proportion of African ancestry, such as individuals from the Coastal Colombian region (odds ratio, OR 2.06; 95% CI 1.31–3.25; p < 0.01). Moreover, a significant interaction between this CRC risk haplotype and local African ancestry dosage was identified in locus 2q14 (p = 0.03). We conclude that Colombian individuals with high African ancestry proportions at locus 2q14 harbour more IL1B-CGTC copies and are consequently at an increased risk of CRC. This haplotype has been previously found to increase the IL1B promoter activity and is the most frequent haplotype in African Americans. Despite of limitations in the number of samples and the lack of functional analysis to examine the effect of these haplotypes on CRC cell lines, our results suggest that inflammation and ethnicity play a major role in the modulation of CRC risk. PMID:28157220

  10. HLA-DRB1*15:01-DQA1*01:02-DQB1*06:02 Haplotype Protects Autoantibody-Positive Relatives From Type 1 Diabetes Throughout the Stages of Disease Progression.

    PubMed

    Pugliese, Alberto; Boulware, David; Yu, Liping; Babu, Sunanda; Steck, Andrea K; Becker, Dorothy; Rodriguez, Henry; DiMeglio, Linda; Evans-Molina, Carmella; Harrison, Leonard C; Schatz, Desmond; Palmer, Jerry P; Greenbaum, Carla; Eisenbarth, George S; Sosenko, Jay M

    2016-04-01

    The HLA-DRB1*15:01-DQA1*01:02-DQB1*06:02 haplotype is linked to protection from the development of type 1 diabetes (T1D). However, it is not known at which stages in the natural history of T1D development this haplotype affords protection. We examined a cohort of 3,358 autoantibody-positive relatives of T1D patients in the Pathway to Prevention (PTP) Study of the Type 1 Diabetes TrialNet. The PTP study examines risk factors for T1D and disease progression in relatives. HLA typing revealed that 155 relatives carried this protective haplotype. A comparison with 60 autoantibody-negative relatives suggested protection from autoantibody development. Moreover, the relatives with DRB1*15:01-DQA1*01:02-DQB1*06:02 less frequently expressed autoantibodies associated with higher T1D risk, were less likely to have multiple autoantibodies at baseline, and rarely converted from single to multiple autoantibody positivity on follow-up. These relatives also had lower frequencies of metabolic abnormalities at baseline and exhibited no overall metabolic worsening on follow-up. Ultimately, they had a very low 5-year cumulative incidence of T1D. In conclusion, the protective influence of DRB1*15:01-DQA1*01:02-DQB1*06:02 spans from autoantibody development through all stages of progression, and relatives with this allele only rarely develop T1D. © 2016 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  11. HLA-E regulatory and coding region variability and haplotypes in a Brazilian population sample.

    PubMed

    Ramalho, Jaqueline; Veiga-Castelli, Luciana C; Donadi, Eduardo A; Mendes-Junior, Celso T; Castelli, Erick C

    2017-11-01

    The HLA-E gene is characterized by low but wide expression on different tissues. HLA-E is considered a conserved gene, being one of the least polymorphic class I HLA genes. The HLA-E molecule interacts with Natural Killer cell receptors and T lymphocytes receptors, and might activate or inhibit immune responses depending on the peptide associated with HLA-E and with which receptors HLA-E interacts to. Variable sites within the HLA-E regulatory and coding segments may influence the gene function by modifying its expression pattern or encoded molecule, thus, influencing its interaction with receptors and the peptide. Here we propose an approach to evaluate the gene structure, haplotype pattern and the complete HLA-E variability, including regulatory (promoter and 3'UTR) and coding segments (with introns), by using massively parallel sequencing. We investigated the variability of 420 samples from a very admixed population such as Brazilians by using this approach. Considering a segment of about 7kb, 63 variable sites were detected, arranged into 75 extended haplotypes. We detected 37 different promoter sequences (but few frequent ones), 27 different coding sequences (15 representing new HLA-E alleles) and 12 haplotypes at the 3'UTR segment, two of them presenting a summed frequency of 90%. Despite the number of coding alleles, they encode mainly two different full-length molecules, known as E*01:01 and E*01:03, which corresponds to about 90% of all. In addition, differently from what has been previously observed for other non classical HLA genes, the relationship among the HLA-E promoter, coding and 3'UTR haplotypes is not straightforward because the same promoter and 3'UTR haplotypes were many times associated with different HLA-E coding haplotypes. This data reinforces the presence of only two main full-length HLA-E molecules encoded by the many HLA-E alleles detected in our population sample. In addition, this data does indicate that the distal HLA-E promoter is by

  12. Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

    PubMed Central

    2013-01-01

    Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different

  13. [Association between the methylenetetrahydrofolate reductase gene polymorphisms and haplotype with toxicity response of high dose methotrexate chemotherapy].

    PubMed

    Liao, Qing-Chuan; Li, Xiao-Lei; Liu, Si-Ting; Zhang, Yong; Li, Tian-Yuan; Qiu, Jin-Chun

    2012-07-01

    To investigate the association between single nucleotide polymorphisms (SNP) and its haplotypes of methylenetetrahydrofolate reductase (MTHFR) gene with high dose methotrexate (HDMTX)-induced toxicity in children with acute lymphoblastic leukemia (ALL). HDMTX-treated children with ALL (1.2 to 14-years old) were selected from inpatient and followed for a retrospective study. The toxicity response of HDMTX chemotherapy was evaluated using WHO common toxicity criteria. Sixty-one patients with therapy-related toxicity and 36 patients without therapy-related toxicity were genotyped for 2 SNP (677C > T and 1298A > C) of the MTHFR gene by polymerase chain reaction-restriction fragment length polymorphism. Frequency of haplotypes and linkage disequilibrium of MTHFR gene were analyzed by SHEsis program. The distribution of MTHFR gene 677C > T polymorphism did not appeare different between groups with or without toxicity response (χ(2) = 4.609, P = 0.100), but the 1298A > C polymorphism was significantly different (χ(2) = 10.192, P = 0.006). Individuals who carried C allele (AC + CC genotype) had a decreased risk of toxicity response compared to AA genotype (OR = 0.245, 95%CI: 0.099 - 0.607, P = 0.002). 677C > T and 1298A > C polymorphisms showed strong linkage disequilibrium (D' = 0.895). The CC haplotype was significantly associated with decreased risk of toxicity response (OR = 0.338, 95%CI: 0.155 - 0.738, P = 0.005), while the TA haplotype was significantly associated with the increased risk of toxicity response (OR = 1.907, 95%CI: 1.045 - 3.482, P = 0.035). MTHFR gene 1298C allele and CC haplotype might serve as protective factors while TA haplotype as a risk factor for the susceptibility to toxicity response of HDMTX chemotherapy in children with ALL.

  14. Imputation of microsatellite alleles from dense SNP genotypes for parentage verification across multiple Bos taurus and Bos indicus breeds

    PubMed Central

    McClure, Matthew C.; Sonstegard, Tad S.; Wiggans, George R.; Van Eenennaam, Alison L.; Weber, Kristina L.; Penedo, Cecilia T.; Berry, Donagh P.; Flynn, John; Garcia, Jose F.; Carmo, Adriana S.; Regitano, Luciana C. A.; Albuquerque, Milla; Silva, Marcos V. G. B.; Machado, Marco A.; Coffey, Mike; Moore, Kirsty; Boscher, Marie-Yvonne; Genestout, Lucie; Mazza, Raffaele; Taylor, Jeremy F.; Schnabel, Robert D.; Simpson, Barry; Marques, Elisa; McEwan, John C.; Cromie, Andrew; Coutinho, Luiz L.; Kuehn, Larry A.; Keele, John W.; Piper, Emily K.; Cook, Jim; Williams, Robert; Van Tassell, Curtis P.

    2013-01-01

    To assist cattle producers transition from microsatellite (MS) to single nucleotide polymorphism (SNP) genotyping for parental verification we previously devised an effective and inexpensive method to impute MS alleles from SNP haplotypes. While the reported method was verified with only a limited data set (N = 479) from Brown Swiss, Guernsey, Holstein, and Jersey cattle, some of the MS-SNP haplotype associations were concordant across these phylogenetically diverse breeds. This implied that some haplotypes predate modern breed formation and remain in strong linkage disequilibrium. To expand the utility of MS allele imputation across breeds, MS and SNP data from more than 8000 animals representing 39 breeds (Bos taurus and B. indicus) were used to predict 9410 SNP haplotypes, incorporating an average of 73 SNPs per haplotype, for which alleles from 12 MS markers could be accurately be imputed. Approximately 25% of the MS-SNP haplotypes were present in multiple breeds (N = 2 to 36 breeds). These shared haplotypes allowed for MS imputation in breeds that were not represented in the reference population with only a small increase in Mendelian inheritance inconsistancies. Our reported reference haplotypes can be used for any cattle breed and the reported methods can be applied to any species to aid the transition from MS to SNP genetic markers. While ~91% of the animals with imputed alleles for 12 MS markers had ≤1 Mendelian inheritance conflicts with their parents' reported MS genotypes, this figure was 96% for our reference animals, indicating potential errors in the reported MS genotypes. The workflow we suggest autocorrects for genotyping errors and rare haplotypes, by MS genotyping animals whose imputed MS alleles fail parentage verification, and then incorporating those animals into the reference dataset. PMID:24065982

  15. Contribution of HLA-A/B/C/DRB1/DQB1 common haplotypes to donor search outcome in unrelated hematopoietic stem cell transplantation.

    PubMed

    Pédron, Béatrice; Guérin-El Khourouj, Valérie; Dalle, Jean-Hugues; Ouachée-Chardin, Marie; Yakouben, Karima; Corroyez, France; Auvrignon, Anne; Petit, Arnaud; Landman-Parker, Judith; Leverger, Guy; Baruchel, André; Sterkers, Ghislaine

    2011-11-01

    In unrelated hematopoietic stem cell transplantation (HSCT), the prediction of donor search outcome at the time of search initiation is of great value for the physicians to delineate the strategy of patient care. The probability of finding an unrelated donor is high for patients who carry at least 1 of the 10 most common HLA haplotypes in Caucasians. As only 10% to 20% patients respond to this criterion, here we aimed at finding additional common haplotypes to improve the prediction of a successful search. HLA broad HLA-A/B/DRB1 haplotypes that were observed with frequencies ≥0.19% in patient families of European origin and that split into ≤2 predominant 4-digit HLA-A/B/C/DRB1/DQB1 haplotypes were considered as common. Carriage of at least 1 of those in 168 patients of various geographic areas with no family donor was confronted to the chance of finding ≥9/10 HLA-matched unrelated donors. Fifty common 4-digit haplotypes were identified. A higher (P < 5 × 10(-6)) chance of finding a suitable donor was found for 55 of 170 (32%) recipients that carried at least 1 of these common haplotypes. Up to now, estimates classified patients into ≥3 groups of probability with ≥1 intermediate group of poor utility for the clinicians. Considering carriage of these common haplotypes together with the frequencies of alleles and of B/C and DRB1/DQB1 associations, which are carried by patient HLA haplotypes, we could classify the patients into 2 groups of probability with a 98% and 26% chance of finding a donor, respectively. Prediction of search outcome could be improved by including the 50 most common HLA haplotypes in the current approaches. Copyright © 2011 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.

  16. ABCB1 haplotype and OPRM1 118A > G genotype interaction in methadone maintenance treatment pharmacogenetics

    PubMed Central

    Barratt, Daniel T; Coller, Janet K; Hallinan, Richard; Byrne, Andrew; White, Jason M; Foster, David JR; Somogyi, Andrew A

    2012-01-01

    Background: Genetic variability in ABCB1, encoding the P-glycoprotein efflux transporter, has been linked to altered methadone maintenance treatment dose requirements. However, subsequent studies have indicated that additional environmental or genetic factors may confound ABCB1 pharmacogenetics in different methadone maintenance treatment settings. There is evidence that genetic variability in OPRM1, encoding the mu opioid receptor, and ABCB1 may interact to affect morphine response in opposite ways. This study aimed to examine whether a similar gene-gene interaction occurs for methadone in methadone maintenance treatment. Methods: Opioid-dependent subjects (n = 119) maintained on methadone (15–300 mg/day) were genotyped for five single nucleotide polymorphisms of ABCB1 (61A > G; 1199G > A; 1236C > T; 2677G > T; 3435C > T), as well as for the OPRM1 118A > G single nucleotide polymorphism. Subjects’ methadone doses and trough plasma (R)-methadone concentrations (Ctrough) were compared between ABCB1 haplotypes (with and without controlling for OPRM1 genotype), and between OPRM1 genotypes (with and without controlling for ABCB1 haplotype). Results: Among wild-type OPRM1 subjects, an ABCB1 variant haplotype group (subjects with a wild-type and 61A:1199G:1236C:2677T:3435T haplotype combination, or homozygous for the 61A:1199G:1236C:2677T:3435T haplotype) had significantly lower doses (median ± standard deviation 35 ± 5 versus 180 ± 65 mg/day, P < 0.01) and Ctrough (78 ± 22 versus 177 ± 97 ng/mL, P < 0.05) than ABCB1 wild-type subjects. Among subjects with the most common ABCB1 haplotype combination (wild-type with 61A:1199G:1236T:2677T:3435T), the OPRM1 118 A/G genotype was associated with a significantly higher Ctrough than 118 A/A (250 ± 126 versus 108 ± 36 ng/mL, P = 0.016). No ABCB1 haplotype group or OPRM1 genotype was associated with dose or Ctrough without taking into account confounding genetic variability at the other locus. Therefore, two

  17. Identification of specific angiotensin-converting enzyme variants and haplotypes that confer risk and protection against type 2 diabetic nephropathy.

    PubMed

    Ezzidi, Intissar; Mtiraoui, Nabil; Kacem, Maha; Chaieb, Molka; Mahjoub, Touhami; Almawi, Wassim Y

    2009-11-01

    Cross-sectional and family studies identified angiotensin-converting enzyme (ACE) gene as a risk factor for diabetic nephropathy (DN). The contribution of ACE gene variants to DN development and progression is controversial and varies among different ethnic/racial groups. We investigated the association of three ACE gene variants with DN, rs1799752 insertion/deletion (I/D), rs1800764T/C and rs12449782A/G in 917 Tunisian type 2 diabetic (T2DM) patients: 515 with (DN) and 402 without (DWN) nephropathy. ACE genotyping was done by PCR-based assays; haplotype estimation was performed using H-Plus software (chi(2)-test based). Genotype frequency distributions of the three studied variants were in Hardy-Weinberg equilibrium. Minor allele frequency of rs1800764 was higher in DN patients than DWN patients or healthy controls, and minor allele frequency of rs1799752 was higher in DN than DWN patients. Higher frequency of rs1799752 and rs1800764 homozygous mutant genotypes was seen in DN compared to DWN patients. Of the three variants, only rs1799752 deletion/deletion (D/D) genotype was associated with a significant increase in albumin to creatinine ratios levels, and D/D carriers had elevated low-density lipoprotein, total cholesterol and urea. Three locus haplotype [rs1799752(I/D)/rs1800764(T/C)/rs12449782(A/G)] analysis revealed that the frequency of DCG haplotype was higher, while that of ITG and ICA haplotypes were lower among unselected type 2 diabetic patients. Taking ITA haplotype as reference, multivariate regression analysis confirmed the negative (ITG), and positive (DCG, DTG, DCA and DTA) association of specific ACE haplotypes with DN, after adjusting for potential nephropathy-linked covariates. Our results support the involvement of specific ACE variants in DN pathogenesis and demonstrate the presence of DN-specific haplotypes at the ACE locus.

  18. Relative extended haplotype homozygosity signals across breeds reveal dairy and beef specific signatures of selection.

    PubMed

    Bomba, Lorenzo; Nicolazzi, Ezequiel L; Milanesi, Marco; Negrini, Riccardo; Mancini, Giordano; Biscarini, Filippo; Stella, Alessandra; Valentini, Alessio; Ajmone-Marsan, Paolo

    2015-04-02

    A number of methods are available to scan a genome for selection signatures by evaluating patterns of diversity within and between breeds. Among these, "extended haplotype homozygosity" (EHH) is a reliable approach to detect genome regions under recent selective pressure. The objective of this study was to use this approach to identify regions that are under recent positive selection and shared by the most representative Italian dairy and beef cattle breeds. A total of 3220 animals from Italian Holstein (2179), Italian Brown (775), Simmental (493), Marchigiana (485) and Piedmontese (379) breeds were genotyped with the Illumina BovineSNP50 BeadChip v.1. After standard quality control procedures, genotypes were phased and core haplotypes were identified. The decay of linkage disequilibrium (LD) for each core haplotype was assessed by measuring the EHH. Since accurate estimates of local recombination rates were not available, relative EHH (rEHH) was calculated for each core haplotype. Genomic regions that carry frequent core haplotypes and with significant rEHH values were considered as candidates for recent positive selection. Candidate regions were aligned across to identify signals shared by dairy or beef cattle breeds. Overall, 82 and 87 common regions were detected among dairy and beef cattle breeds, respectively. Bioinformatic analysis identified 244 and 232 genes in these common genomic regions. Gene annotation and pathway analysis showed that these genes are involved in molecular functions that are biologically related to milk or meat production. Our results suggest that a multi-breed approach can lead to the identification of genomic signatures in breeds of cattle that are selected for the same production goal and thus to the localisation of genomic regions of interest in dairy and beef production.

  19. Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms

    PubMed Central

    Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

    2016-01-01

    Abstract Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited. We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms. In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D’ and r2 values were 0.883 and 0.143, respectively. In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs. PMID:27902594

  20. Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana).

    PubMed

    Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila

    2010-07-16

    Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A

  1. Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana)

    PubMed Central

    2010-01-01

    Background Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Results Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M

  2. More powerful haplotype sharing by accounting for the mode of inheritance.

    PubMed

    Ziegler, Andreas; Ewhida, Adel; Brendel, Michael; Kleensang, André

    2009-04-01

    The concept of haplotype sharing (HS) has received considerable attention recently, and several haplotype association methods have been proposed. Here, we extend the work of Beckmann and colleagues [2005 Hum. Hered. 59:67-78] who derived an HS statistic (BHS) as special case of Mantel's space-time clustering approach. The Mantel-type HS statistic correlates genetic similarity with phenotypic similarity across pairs of individuals. While phenotypic similarity is measured as the mean-corrected cross product of phenotypes, we propose to incorporate information of the underlying genetic model in the measurement of the genetic similarity. Specifically, for the recessive and dominant modes of inheritance we suggest the use of the minimum and maximum of shared length of haplotypes around a marker locus for pairs of individuals. If the underlying genetic model is unknown, we propose a model-free HS Mantel statistic using the max-test approach. We compare our novel HS statistics to BHS using simulated case-control data and illustrate its use by re-analyzing data from a candidate region of chromosome 18q from the Rheumatoid Arthritis (RA) Consortium. We demonstrate that our approach is point-wise valid and superior to BHS. In the re-analysis of the RA data, we identified three regions with point-wise P-values<0.005 containing six known genes (PMIP1, MC4R, PIGN, KIAA1468, TNFRSF11A and ZCCHC2) which might be worth follow-up.

  3. Specific haplotypes of the CALPAIN-5 gene are associated with polycystic ovary syndrome.

    PubMed

    González, A; Sáez, M E; Aragón, M J; Galán, J J; Vettori, P; Molina, L; Rubio, C; Real, L M; Ruiz, Agustín; Ramírez-Lorca, R

    2006-04-01

    Polycystic ovary syndrome (PCOS) is a common endocrine disorder in women of reproductive age. The aim of the present study was to investigate the role of CALPAIN-5 (CAPN5) gene in PCOS susceptibility. We analysed four intronic polymorphisms of the CAPN5 gene in 148 well-characterized women with PCOS and 606 unrelated controls. We performed a case-control study and an intracohort analysis of clinical characteristics associated with PCOS. Analysis of haplotypes distribution between PCOS population compared to controls showed a strong deviation (P = 0.00029). The haplotypes GGCA and GGTG were overrepresented in PCOS patients (P = 0.009 and P = 0.001, respectively). In addition, we identified several CAPN5 haplotypes associated with phenotypic differences observed between PCOS patients, such as the presence of obesity (P = 0.02), cardiovascular complications (P = 0.02), familial antecedents of obesity (P = 0.003) and of hypertension (P = 0.007) and type 2 diabetes mellitus aggregation (P = 0.04). These results suggest a role of CAPN5 gene in PCOS susceptibility in humans. Moreover, novel candidate risk alleles have been identified, within CAPN5 gene, which could be associated with important phenotypic and prognosis differences observed in PCOS patients.

  4. Haplotype data for 23 Y-chromosome markers in a reference sample from Bosnia and Herzegovina

    PubMed Central

    Kovačević, Lejla; Fatur-Cerić, Vera; Hadžić, Negra; Čakar, Jasmina; Primorac, Dragan; Marjanović, Damir

    2013-01-01

    Aim To detect polymorphisms of 23 Y-chromosomal short tandem repeat (STR) loci, including 6 new loci, in a reference database of male population of Bosnia and Herzegovina, as well as to assess the importance of increasing the number of Y-STR loci utilized in forensic DNA analysis. Methods The reference sample consisted of 100 healthy, unrelated men originating from Bosnia and Herzegovina. Sample collection using buccal swabs was performed in all geographical regions of Bosnia and Herzegovina in the period from 2010 to 2011. DNA samples were typed for 23 Y STR loci, including 6 new loci: DYS576, DYS481, DYS549, DYS533, DYS570, and DYS643, which are included in the new PowerPlex® Y 23 amplification kit. Results The absolute frequency of generated haplotypes was calculated and results showed that 98 samples had unique Y 23 haplotypes, and that only two samples shared the same haplotype. The most polymorphic locus was DYS418, with 14 detected alleles and the least polymorphic loci were DYS389I, DYS391, DYS437, and DYS393. Conclusion This study showed that by increasing the number of highly polymorphic Y STR markers, to include those tested in our analysis, leads to a reduction of repeating haplotypes, which is very important in the application of forensic DNA analysis. PMID:23771760

  5. Haplotype data for 23 Y-chromosome markers in a reference sample from Bosnia and Herzegovina.

    PubMed

    Kovačević, Lejla; Fatur-Cerić, Vera; Hadzic, Negra; Čakar, Jasmina; Primorac, Dragan; Marjanović, Damir

    2013-06-01

    To detect polymorphisms of 23 Y-chromosomal short tandem repeat (STR) loci, including 6 new loci, in a reference database of male population of Bosnia and Herzegovina, as well as to assess the importance of increasing the number of Y-STR loci utilized in forensic DNA analysis. The reference sample consisted of 100 healthy, unrelated men originating from Bosnia and Herzegovina. Sample collection using buccal swabs was performed in all geographical regions of Bosnia and Herzegovina in the period from 2010 to 2011. DNA samples were typed for 23 Y STR loci, including 6 new loci: DYS576, DYS481, DYS549, DYS533, DYS570, and DYS643, which are included in the new PowerPlex® Y 23 amplification kit. The absolute frequency of generated haplotypes was calculated and results showed that 98 samples had unique Y 23 haplotypes, and that only two samples shared the same haplotype. The most polymorphic locus was DYS418, with 14 detected alleles and the least polymorphic loci were DYS389I, DYS391, DYS437, and DYS393. This study showed that by increasing the number of highly polymorphic Y STR markers, to include those tested in our analysis, leads to a reduction of repeating haplotypes, which is very important in the application of forensic DNA analysis.

  6. Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population.

    PubMed

    Saeki, Mayumi; Saito, Yoshiro; Nakamura, Takahiro; Murayama, Norie; Kim, Su-Ryang; Ozawa, Shogo; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Nakajima, Toshiharu; Saito, Hirohisa; Kitamura, Yutaka; Kamatani, Naoyuki; Sawada, Jun-ichi

    2003-06-01

    In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese. Copyright 2003 Wiley-Liss, Inc.

  7. Globally dispersed Y chromosomal haplotypes in wild and domestic sheep.

    PubMed

    Meadows, J R S; Hanotte, O; Drögemüller, C; Calvo, J; Godfrey, R; Coltman, D; Maddox, J F; Marzanov, N; Kantanen, J; Kijas, J W

    2006-10-01

    To date, investigations of genetic diversity and the origins of domestication in sheep have utilised autosomal microsatellites and variation in the mitochondrial genome. We present the first analysis of both domestic and wild sheep using genetic markers residing on the ovine Y chromosome. Analysis of a single nucleotide polymorphism (oY1) in the SRY promoter region revealed that allele A-oY1 was present in all wild bighorn sheep (Ovis canadensis), two subspecies of thinhorn sheep (Ovis dalli), European Mouflon (Ovis musimon) and the Barbary (Ammontragis lervia). A-oY1 also had the highest frequency (71.4%) within 458 domestic sheep drawn from 65 breeds sampled from Africa, Asia, Australia, the Caribbean, Europe, the Middle East and Central Asia. Sequence analysis of a second locus, microsatellite SRYM18, revealed a compound repeat array displaying fixed differences, which identified bighorn and thinhorn sheep as distinct from the European Mouflon and domestic animals. Combined genotypic data identified 11 male-specific haplotypes that represented at least two separate lineages. Investigation of the geographical distribution of each haplotype revealed that one (H6) was both very common and widespread in the global sample of domestic breeds. The remaining haplotypes each displayed more restricted and informative distributions. For example, H5 was likely founded following the domestication of European breeds and was used to trace the recent transportation of animals to both the Caribbean and Australia. A high rate of Y chromosomal dispersal appears to have taken place during the development of domestic sheep as only 12.9% of the total observed variation was partitioned between major geographical regions.

  8. [The haplomatch program for comparing Y-chromosome STR-haplotypes and its application to the analysis of the origin of Don Cossacks].

    PubMed

    Chukhryaeva, M I; Ivanov, I O; Frolova, S A; Koshel, S M; Utevska, O M; Skhalyakho, R A; Agdzhoyan, A T; Bogunov, Yu V; Balanovska, E V; Balanovsky, O P

    2016-05-01

    STR haplotypes of the Y chromosome are widely used as effective genetic markers in studies of human populations and in forensic DNA analysis. The task often arises to compare the spectrum of haplotypes in individuals or entire populations. Performing this task manually is too laborious and thus unrealistic. We propose an algorithm for counting similarity between STR haplotypes. This algorithm is suitable for massive analyses of samples. It is implemented in the computer program Haplomatch, which makes it possible to find haplotypes that differ from the target haplotype by 0, 1, 2, 3, or more mutational steps. The program may operate in two modes: comparison of individuals and comparison of populations. Flexibility of the program (the possibility of using any external database), its usability (MS Excel spreadsheets are used), and the capability of being applied to other chromosomes and other species could make this software a new useful tool in population genetics and forensic and genealogical studies. The Haplomatch software is freely available on our website www.genofond.ru. The program is applied to studying the gene pool of Cossacks. Experimental analysis of Y-chromosomal diversity in a representative set (N = 131) of Upper Don Cossacks is performed. Analysis of the STR haplotypes detects genetic proximity of Cossacks to East Slavic populations (in particular, to Southern and Central Russians, as well as to Ukrainians), which confirms the hypothesis of the origin of the Cossacks mainly due to immigration from Russia and Ukraine. Also, a small genetic influence of Turkicspeaking Nogais is found, probably caused by their occurrence in the Don Voisko as part of the Tatar layer. No similarities between haplotype spectra of Cossacks and Caucasus populations are found. This case study demonstrates the effectiveness of the Haplomatch software in analyzing large sets of STR haplotypes.

  9. Genetic variants in a haplotype block spanning IDE are significantly associated with plasma Abeta42 levels and risk for Alzheimer disease.

    PubMed

    Ertekin-Taner, Nilüfer; Allen, Mariet; Fadale, Daniel; Scanlin, Leah; Younkin, Linda; Petersen, Ronald C; Graff-Radford, Neill; Younkin, Steven G

    2004-04-01

    Risk for late onset Alzheimer disease (LOAD) and plasma amyloid beta levels (Abeta42; encoded by APP), an intermediate phenotype for LOAD, show linkage to chromosome 10q. Several strong candidate genes (VR22, PLAU, IDE) lie within the 1-lod support interval for linkage. Others have independently identified haplotypes in the chromosome 10q region harboring IDE that show highly significant association with intermediate AD phenotypes and with risk for AD. To pursue these associations, we analyzed the same haplotypes for association with plasma Abeta42 in 24 extended LOAD families and for association with LOAD in two independent case-control series. One series (MCR, 188 age-matched case-control pairs) did not show association (p=0.64) with the six haplotypes in the 276-kb region spanning three genes (IDE, KNSL1, and HHEX) previously shown to associate with LOAD. The other series (MCJ, 109 age-matched case-control pairs) showed significant (p=0.003) association with these haplotypes. In the MCJ series, the H4 (odds ratio [OR]=5.1, p=0.003) and H2(H7) haplotypes (OR=0.60, p=0.04) had the same effects previously reported. In this series, the H8 haplotype (OR=2.7, p=0.098) also had an effect similar as in one previous case control series but not in others. In the extended families, the H8 haplotype was associated with significantly elevated plasma Abeta42 (p=0.02). In addition, the H5(H10) haplotype, which is associated with reduced risk for AD in the other study is associated with reduced plasma Abeta42 (p=0.007) in our family series. These results provide strong evidence for pathogenic variant(s) in the 276-kb region harboring IDE that influence intermediate AD phenotypes and risk for AD. Copyright 2004 Wiley-Liss, Inc.

  10. Time-Resolved Measurements in Optoelectronic Microbioanalysis

    NASA Technical Reports Server (NTRS)

    Bearman, Gregory; Kossakovski, Dmitri

    2003-01-01

    A report presents discussion of time-resolved measurements in optoelectronic microbioanalysis. Proposed microbioanalytical laboratory-on-a-chip devices for detection of microbes and toxic chemicals would include optoelectronic sensors and associated electronic circuits that would look for fluorescence or phosphorescence signatures of multiple hazardous biomolecules in order to detect which ones were present in a given situation. The emphasis in the instant report is on gating an active-pixel sensor in the time domain, instead of filtering light in the wavelength domain, to prevent the sensor from responding to a laser pulse used to excite fluorescence or phosphorescence while enabling the sensor to respond to the decaying fluorescence or phosphorescence signal that follows the laser pulse. The active-pixel sensor would be turned on after the laser pulse and would be used to either integrate the fluorescence or phosphorescence signal over several lifetimes and many excitation pulses or else take time-resolved measurements of the fluorescence or phosphorescence. The report also discusses issues of multiplexing and of using time-resolved measurements of fluorophores with known different fluorescence lifetimes to distinguish among them.

  11. [Genetic ecological monitoring in human populations: heterozygosity, mtDNA haplotype variation, and genetic load].

    PubMed

    Balanovskiĭ, O P; Koshel', S M; Zaporozhchenko, V V; Pshenichnov, A S; Frolova, S A; Kuznetsova, M A; Baranova, E E; Teuchezh, I E; Kuznetsova, A A; Romashkina, M V; Utevskaia, O M; Churnosov, M I; Villems, R; Balanovskaia, E V

    2011-11-01

    Yu. P. Altukhov suggested that heterozygosity is an indicator of the state of the gene pool. The idea and a linked concept of genetic ecological monitoring were applied to a new dataset on mtDNA variation in East European ethnic groups. Haplotype diversity (an analog of the average heterozygosity) was shown to gradually decrease northwards. Since a similar trend is known for population density, interlinked changes were assumed for a set of parameters, which were ordered to form a causative chain: latitude increases, land productivity decreases, population density decreases, effective population size decreases, isolation of subpopulations increases, genetic drift increases, and mtDNA haplotype diversity decreases. An increase in genetic drift increases the random inbreeding rate and, consequently, the genetic load. This was confirmed by a significant correlation observed between the incidence of autosomal recessive hereditary diseases and mtDNA haplotype diversity. Based on the findings, mtDNA was assumed to provide an informative genetic system for genetic ecological monitoring; e.g., analyzing the ecology-driven changes in the gene pool.

  12. Tryptophan Hydroxylase 2 haplotype association with borderline personality disorder and aggression in a sample of patients with personality disorders and healthy controls

    PubMed Central

    Perez-Rodriguez, M. Mercedes; Weinstein, Shauna; New, Antonia S.; Bevilacqua, Laura; Yuan, Qiaoping; Zhou, Zhifeng; Hodgkinson, Colin; Goodman, Marianne; Koenigsberg, Harold W.; Goldman, David; Siever, Larry J.

    2010-01-01

    Background There is decreased serotonergic function in impulsive aggression and borderline personality disorder (BPD), and genetic association studies suggest a role of serotonergic genes in impulsive aggression and BPD. Only one study has analyzed the association between the tryptophan-hydroxylase 2 (TPH2) gene and BPD. A TPH2 “risk” haplotype has been described that is associated with anxiety, depression and suicidal behavior. Methods We assessed the relationship between the previously identified “risk” haplotype at the TPH2 locus and BPD diagnosis, impulsive aggression, affective lability, and suicidal/parasuicidal behaviors, in a well-characterized clinical sample of 103 healthy controls (HCs) and 251 patients with personality disorders (109 with BPD). A logistic regression including measures of depression, affective lability and aggression scores in predicting “risk” haplotype was conducted. Results The prevalence of the “risk” haplotype was significantly higher in patients with BPD compared to HCs. Those with the “risk” haplotype have higher aggression and affect lability scores and more suicidal/parasuicidal behaviors than those without it. In the logistic regression model, affect lability was the only significant predictor and it correctly classified 83.1% of the subjects as “risk” or “non-risk” haplotype carriers. Conclusions We found an association between the previously described TPH2 “risk” haplotype and BPD diagnosis, affective lability, suicidal/parasuicidal behavior, and aggression scores. PMID:20451217

  13. Association of interleukin-10 promoter haplotypes with disease susceptibility and IL-10 levels in Mexican patients with systemic lupus erythematosus.

    PubMed

    Palafox-Sánchez, Claudia Azucena; Oregon-Romero, Edith; Salazar-Camarena, Diana Celeste; Valle, Yeminia Maribel; Machado-Contreras, Jesús René; Cruz, Alvaro; Orozco-López, Mariana; Orozco-Barocio, Gerardo; Vázquez-Del Mercado, Mónica; Muñoz-Valle, José Francisco

    2015-11-01

    Systemic lupus erythematosus (SLE) is the prototype autoimmune rheumatic disease. The etiology of this disease is incompletely understood; however, environmental factors and genetic predisposition are involved. Cytokine-mediated immunity plays a crucial role in the pathogenesis of SLE. We investigate the association of interleukin-10 (IL-10) promoter polymorphisms and their haplotypes in SLE patients from the western Mexico. One hundred and twenty-five SLE patients fulfilling the 1997 ACR criteria and 260 unrelated healthy subjects (HS), both Mexican mestizos, were genotyped for IL-10 -1082A>G, -819C>T, and -592C>A polymorphisms. Haplotypes were inferred using the expectation-maximization algorithm, then allele and haplotype distributions were compared between patients and HS, as well as patients with different clinical variables. We identified at -1082, -819, and -592 four predominant haplotypes ACC (43.70 % in patients vs 46.55 % in HS), ATA (21.45 vs 22.97 %), GCC (16.28 vs 14.21 %), and GTA (14.12 vs 14.12 %). The ATC haplotype was more frequent in SLE respect to HS, suggesting a risk effect (3.23 vs 1.05 %; OR 3.55, CI 1.14-11.11; p = 0.0293). SLE patient carriers of -592 CC genotype as well as the dominant model of inheritance showed higher sIL-10 respect to AA genotype, suggesting that -592 C allele is associated with increased production of the cytokine (p < 0.05). The ACC haplotype had higher IL-10 serum levels and higher values of Mexican version of the Systemic Lupus Erythematosus Disease Activity Index compared with the other haplotype carriers; however, no association was found regarding autoantibodies. Our data suggest that the IL-10 promoter haplotypes play an important role in the risk of developing SLE and influence the production of IL-10 in Mexican population. Nevertheless, further studies are required to analyze the expression of mRNA as well as to investigate the interacting epigenetic factors that could help to define the true contribution of

  14. X-chromosome as a marker for population history: linkage disequilibrium and haplotype study in Eurasian populations

    PubMed Central

    Laan, Maris; Wiebe, Victor; Khusnutdinova, Elza; Remm, Maido; Pääbo, Svante

    2005-01-01

    Linkage disequilibrium structure is still unpredictable because the interplay of regional recombination rate and demographic history is poorly understood. We have compared the distribution of LD across two genomic regions differing in crossing-over activity – Xq13 (0.166 cM/Mb) and Xp22 (1.3 cM/Mb) – in 15 Eurasian populations. Demographic events predicted to increase the LD level – genetic drift, bottleneck and admixture – had a very strong impact on extent and patterns of regional LD across Xq13 compared to Xp22. The haplotype distribution of the DXS1225-DXS8082 microsatellites from Xq13 exhibiting strong association in all populations was remarkably influenced by population history. European populations shared one common haplotype with a frequency of 25-40%. The Volga-Ural populations studied, living at the geographic borderline of Europe, showed elevated LD as well as harboring a significant fraction of haplotypes originating from East Asia, thus reflecting their past migrations and admixture. In the young Kuusamo isolate from Finland, a bottleneck has led to allelic associations between loci and shifted the haplotype distribution, but has much less affected single microsatellite allele frequencies compared to the main Finnish population. The data show that the footprint of a demographic event is longer preserved in haplotype distribution within a region of low crossing-over rate, than in the information content of a single marker, or between actively recombining markers. As the knowledge of LD patterns is often chosen to assist association mapping of common disease, our conclusions emphasise the importance of understanding the history, structure and variation of a study population. PMID:15657606

  15. Batrachochytrium dendrobatidis Shows High Genetic Diversity and Ecological Niche Specificity among Haplotypes in the Maya Mountains of Belize

    PubMed Central

    Kaiser, Kristine; Pollinger, John

    2012-01-01

    The amphibian pathogen Batrachochytrium dendrobatidis (Bd) has been implicated in amphibian declines around the globe. Although it has been found in most countries in Central America, its presence has never been assessed in Belize. We set out to determine the range, prevalence, and diversity of Bd using quantitative PCR (qPCR) and sequencing of a portion of the 5.8 s and ITS1-2 regions. Swabs were collected from 524 amphibians of at least 26 species in the protected areas of the Maya Mountains of Belize. We sequenced a subset of 72 samples that had tested positive for Bd by qPCR at least once; 30 samples were verified as Bd. Eight unique Bd haplotypes were identified in the Maya Mountains, five of which were previously undescribed. We identified unique ecological niches for the two most broadly distributed haplotypes. Combined with data showing differing virulence shown in different strains in other studies, the 5.8 s - ITS1-2 region diversity found in this study suggests that there may be substantial differences among populations or haplotypes. Future work should focus on whether specific haplotypes for other genomic regions and possibly pathogenicity can be associated with haplotypes at this locus, as well as the integration of molecular tools with other ecological tools to elucidate the ecology and pathogenicity of Bd. PMID:22389681

  16. Eurasian otters, Lutra lutra, have a dominant mtDNA haplotype from the Iberian Peninsula to Scandinavia.

    PubMed

    Ferrando, Ainhoa; Ponsà, Montserrat; Marmi, Josep; Domingo-Roura, Xavier

    2004-01-01

    The Eurasian otter, Lutra lutra, has a Palaearctic distribution and has suffered a severe decline throughout Europe during the last century. Previous studies in this and other mustelids have shown reduced levels of variability in mitochondrial DNA, although otter phylogeographic studies were restricted to central-western Europe. In this work we have sequenced 361 bp of the mtDNA control region in 73 individuals from eight countries and added our results to eight sequences available from GenBank and the literature. The range of distribution has been expanded in relation to previous works north towards Scandinavia, east to Russia and Belarus, and south to the Iberian Peninsula. We found a single dominant haplotype in 91.78% of the samples, and six more haplotypes deviating a maximum of two mutations from the dominant haplotype restricted to a single country. Variability was extremely low in western Europe but higher in eastern countries. This, together with the lack of phylogeographical structuring, supports the postglacial recolonization of Europe from a single refugium. The Eurasian otter mtDNA control region has a 220-bp variable minisatellite in Domain III that we sequenced in 29 otters. We found a total of 19 minisatellite haplotypes, but they showed no phylogenetic information.

  17. DLA-DRB1, DQA1, and DQB1 alleles and haplotypes in North American Gray Wolves.

    PubMed

    Kennedy, Lorna J; Angles, John M; Barnes, Annette; Carmichael, Lindsey E; Radford, Alan D; Ollier, William E R; Happ, George M

    2007-01-01

    The canine major histocompatibility complex contains highly polymorphic genes, many of which are critical in regulating immune response. Since domestic dogs evolved from Gray Wolves (Canis lupus), common DLA class II alleles should exist. Sequencing was used to characterize 175 Gray Wolves for DLA class II alleles, and data from 1856 dogs, covering 85 different breeds of mostly European origin, were available for comparison. Within wolves, 28 new alleles were identified, all occurring in at least 2 individuals. Three DLA-DRB1, 8 DLA-DQA1, and 6 DLA-DQB1 alleles also identified in dogs were present. Twenty-eight haplotypes were identified, of which 2 three-locus haplotypes, and many DLA-DQA1/DQB1 haplotypes, are also found in dogs. The wolves studied had relatively few dog DLA alleles and may therefore represent a remnant population descended from Asian wolves. The single European wolf included carried a haplotype found in both these North American wolves and in many dog breeds. Furthermore, one wolf DQB1 allele has been found in Shih Tzu, a breed of Asian origin. These data suggest that the wolf ancestors of Asian and European dogs may have had different gene pools, currently reflected in the DLA alleles present in dog breeds.

  18. Mitochondrial haplotypes are not associated with mice selectively bred for high voluntary wheel running.

    PubMed

    Wone, Bernard W M; Yim, Won C; Schutz, Heidi; Meek, Thomas H; Garland, Theodore

    2018-04-04

    Mitochondrial haplotypes have been associated with human and rodent phenotypes, including nonshivering thermogenesis capacity, learning capability, and disease risk. Although the mammalian mitochondrial D-loop is highly polymorphic, D-loops in laboratory mice are identical, and variation occurs elsewhere mainly between nucleotides 9820 and 9830. Part of this region codes for the tRNA Arg gene and is associated with mitochondrial densities and number of mtDNA copies. We hypothesized that the capacity for high levels of voluntary wheel-running behavior would be associated with mitochondrial haplotype. Here, we analyzed the mtDNA polymorphic region in mice from each of four replicate lines selectively bred for 54 generations for high voluntary wheel running (HR) and from four control lines (Control) randomly bred for 54 generations. Sequencing the polymorphic region revealed a variable number of adenine repeats. Single nucleotide polymorphisms (SNPs) varied from 2 to 3 adenine insertions, resulting in three haplotypes. We found significant genetic differentiations between the HR and Control groups (F st  = 0.779, p ≤ 0.0001), as well as among the replicate lines of mice within groups (F sc  = 0.757, p ≤ 0.0001). Haplotypes, however, were not strongly associated with voluntary wheel running (revolutions run per day), nor with either body mass or litter size. This system provides a useful experimental model to dissect the physiological processes linking mitochondrial, genomic SNPs, epigenetics, or nuclear-mitochondrial cross-talk to exercise activity. Copyright © 2018. Published by Elsevier B.V.

  19. Hereditary tyrosinemia type I: strong association with haplotype 6 in French Canadians permits simple carrier detection and prenatal diagnosis.

    PubMed Central

    Demers, S. I.; Phaneuf, D.; Tanguay, R. M.

    1994-01-01

    Hereditary tyrosinemia type 1 (HT1), a severe inborn error of tyrosine catabolism, is caused by deficiency of the terminal enzyme, fumarylacetoacetate hydrolase (FAH). The highest reported frequency of HT1 is in the French Canadian population, especially in the Saguenay-Lac-St-Jean region. Using human FAH cDNA probes, we have identified 10 haplotypes with TaqI, KpnI, RsaI, BglII, and MspI RFLPs in 118 normal chromosomes from the French Canadian population. Interestingly, in 29 HT1 children, a prevalent haplotype, haplotype 6, was found to be strongly associated with the disease, at a frequency of 90% of alleles, as compared with approximately 18% in 35 control individuals. This increased to 96% in the 24 patients originating from Saguenay-Lac-St-Jean. These results suggest that one or only a few prevailing mutations are responsible for most of the HT1 cases in Saguenay-Lac-St-Jean. Since most patients were found to be homozygous for a specific haplotype in this population, FAH RFLPs have permitted simple carrier detection in nine different informative HT1 families, with a confidence level of 99.9%. Heterozygosity rate values obtained from 52 carriers indicated that approximately 88% of families at risk from Saguenay-Lac-St-Jean are fully or partially informative. Prenatal diagnosis was also achieved in an American family. Analysis of 24 HT1 patients from nine countries gave a frequency of approximately 52% for haplotype 6, suggesting a relatively high association, worldwide, of HT1 with this haplotype. Images Figure 1 PMID:7913582

  20. Common PCSK1 haplotypes are associated with obesity in the Chinese population.

    PubMed

    Chang, Yi-Cheng; Chiu, Yen-Feng; Shih, Kuang-Chung; Lin, Ming-Wei; Sheu, Wayne Huey-Herng; Donlon, Timothy; Curb, Jess David; Jou, Yuh-Shan; Chang, Tien-Jyun; Li, Hung-Yuan; Chuang, Lee-Ming

    2010-07-01

    Prohormone convertase subtilisin/kexin type 1 (PCSK1) genetic polymorphisms have recently been associated with obesity in European populations. This study aimed to examine whether common PCSK1 genetic variation is associated with obesity and related metabolic phenotypes in the Chinese population. We genotyped nine common tag single-nucleotide polymorphisms (tagSNP) of the PCSK1 gene in 1,094 subjects of Chinese origin from the Stanford Asia-Pacific Program for Hypertension and Insulin Resistance (SAPPHIRe) family study. One SNP in the PCSK1 gene (rs155971) were nominally associated with risk of obesity in the SAPPHIRe cohort (P = 0.01). A common protective haplotype was associated with reduced risk of obesity (23.79% vs. 32.89%, P = 0.01) and smaller waist circumference (81.71 +/- 10.22 vs. 84.75 +/- 10.48 cm, P = 0.02). Another common haplotype was significantly associated with increased risk of obesity (37.07% vs. 23.84%, P = 0.005). The global P value for haplotype association with obesity was 0.02. We also identified a suggestive association of another PCSK1 SNP (rs3811951) with fasting glucose, fasting insulin, homeostasis model assessment of insulin resistance (HOMA(IR)), triglycerides, and high-density lipoprotein cholesterol (P = 0.05, 0.003, 0.001, 0.04, and 0.04, respectively). These data indicate common PCSK1 genetic variants are associated with obesity in the Chinese population.

  1. Risk of pediatric celiac disease according to HLA haplotype and country.

    PubMed

    Liu, Edwin; Lee, Hye-Seung; Aronsson, Carin A; Hagopian, William A; Koletzko, Sibylle; Rewers, Marian J; Eisenbarth, George S; Bingley, Polly J; Bonifacio, Ezio; Simell, Ville; Agardh, Daniel

    2014-07-03

    The presence of HLA haplotype DR3-DQ2 or DR4-DQ8 is associated with an increased risk of celiac disease. In addition, nearly all children with celiac disease have serum antibodies against tissue transglutaminase (tTG). We studied 6403 children with HLA haplotype DR3-DQ2 or DR4-DQ8 prospectively from birth in the United States, Finland, Germany, and Sweden. The primary end point was the development of celiac disease autoimmunity, which was defined as the presence of tTG antibodies on two consecutive tests at least 3 months apart. The secondary end point was the development of celiac disease, which was defined for the purpose of this study as either a diagnosis on biopsy or persistently high levels of tTG antibodies. The median follow-up was 60 months (interquartile range, 46 to 77). Celiac disease autoimmunity developed in 786 children (12%). Of the 350 children who underwent biopsy, 291 had confirmed celiac disease; an additional 21 children who did not undergo biopsy had persistently high levels of tTG antibodies. The risks of celiac disease autoimmunity and celiac disease by the age of 5 years were 11% and 3%, respectively, among children with a single DR3-DQ2 haplotype, and 26% and 11%, respectively, among those with two copies (DR3-DQ2 homozygosity). In the adjusted model, the hazard ratios for celiac disease autoimmunity were 2.09 (95% confidence interval [CI], 1.70 to 2.56) among heterozygotes and 5.70 (95% CI, 4.66 to 6.97) among homozygotes, as compared with children who had the lowest-risk genotypes (DR4-DQ8 heterozygotes or homozygotes). Residence in Sweden was also independently associated with an increased risk of celiac disease autoimmunity (hazard ratio, 1.90; 95% CI, 1.61 to 2.25). Children with the HLA haplotype DR3-DQ2, especially homozygotes, were found to be at high risk for celiac disease autoimmunity and celiac disease early in childhood. The higher risk in Sweden than in other countries highlights the importance of studying environmental

  2. RTEL1 tagging SNPs and haplotypes were associated with glioma development.

    PubMed

    Li, Gang; Jin, Tianbo; Liang, Hongjuan; Zhang, Zhiguo; He, Shiming; Tu, Yanyang; Yang, Haixia; Geng, Tingting; Cui, Guangbin; Chen, Chao; Gao, Guodong

    2013-05-17

    As glioma ranks as the first most prevalent solid tumors in primary central nervous system, certain single-nucleotide polymorphisms (SNPs) may be related to increased glioma risk, and have implications in carcinogenesis. The present case-control study was carried out to elucidate how common variants contribute to glioma susceptibility. Ten candidate tagging SNPs (tSNPs) were selected from seven genes whose polymorphisms have been proven by classical literatures and reliable databases to be tended to relate with gliomas, and with the minor allele frequency (MAF)>5% in the HapMap Asian population. The selected tSNPs were genotyped in 629 glioma patients and 645 controls from a Han Chinese population using the multiplexed SNP MassEXTEND assay calibrated. Two significant tSNPs in RTEL1 gene were observed to be associated with glioma risk (rs6010620, P=0.0016, OR: 1.32, 95% CI: 1.11-1.56; rs2297440, P=0.001, OR: 1.33, 95% CI: 1.12-1.58) by χ2 test. It was identified the genotype "GG" of rs6010620 acted as the protective genotype for glioma (OR, 0.46; 95% CI, 0.31-0.7; P=0.0002), while the genotype "CC" of rs2297440 as the protective genotype in glioma (OR, 0.47; 95% CI, 0.31-0.71; P=0.0003). Furthermore, haplotype "GCT" in RTEL1 gene was found to be associated with risk of glioma (OR, 0.7; 95% CI, 0.57-0.86; Fisher's P=0.0005; Pearson's P=0.0005), and haplotype "ATT" was detected to be associated with risk of glioma (OR, 1.32; 95% CI, 1.12-1.57; Fisher's P=0.0013; Pearson's P=0.0013). Two single variants, the genotypes of "GG" of rs6010620 and "CC" of rs2297440 (rs6010620 and rs2297440) in the RTEL1 gene, together with two haplotypes of GCT and ATT, were identified to be associated with glioma development. And it might be used to evaluate the glioma development risks to screen the above RTEL1 tagging SNPs and haplotypes. The virtual slides for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1993021136961998.

  3. Resolving the multiple sequence alignment problem using biogeography-based optimization with multiple populations.

    PubMed

    Zemali, El-Amine; Boukra, Abdelmadjid

    2015-08-01

    The multiple sequence alignment (MSA) is one of the most challenging problems in bioinformatics, it involves discovering similarity between a set of protein or DNA sequences. This paper introduces a new method for the MSA problem called biogeography-based optimization with multiple populations (BBOMP). It is based on a recent metaheuristic inspired from the mathematics of biogeography named biogeography-based optimization (BBO). To improve the exploration ability of BBO, we have introduced a new concept allowing better exploration of the search space. It consists of manipulating multiple populations having each one its own parameters. These parameters are used to build up progressive alignments allowing more diversity. At each iteration, the best found solution is injected in each population. Moreover, to improve solution quality, six operators are defined. These operators are selected with a dynamic probability which changes according to the operators efficiency. In order to test proposed approach performance, we have considered a set of datasets from Balibase 2.0 and compared it with many recent algorithms such as GAPAM, MSA-GA, QEAMSA and RBT-GA. The results show that the proposed approach achieves better average score than the previously cited methods.

  4. New and Common Haplotypes Shape Genetic Diversity in Asian Tiger Mosquito Populations from Costa Rica and Panamá.

    PubMed

    Futami, K; Valderrama, A; Baldi, M; Minakawa, N; Marín Rodríguez, R; Chaves, L F

    2015-04-01

    The Asian tiger mosquito, Aedes albopictus (Skuse) (Diptera: Culicidae), is a vector of several human pathogens. Ae. albopictus is also an invasive species that, over recent years, has expanded its range out of its native Asia. Ae. albopictus was suspected to be present in Central America since the 1990s, and its presence was confirmed by most Central American nations by 2010. Recently, this species has been regularly found, yet in low numbers, in limited areas of Panamá and Costa Rica (CR). Here, we report that short sequences (∼558 bp) of the mitochondrial cytochrome oxidase subunit 1 (COI) and NADH dehydrogenase subunit 5 genes of Ae. albopictus, had no haplotype diversity. Instead, there was a common haplotype for each gene in both CR and Panamá. In contrast, a long COI sequence (∼1,390 bp) revealed that haplotype diversity (±SD) was relatively high in CR (0.72±0.04) when compared with Panamá (0.33±0.13), below the global estimate for reported samples (0.89±0.01). The long COI sequence allowed us to identify seven (five new) haplotypes in CR and two (one new) in Panamá. A haplotype network for the long COI gene sequence showed that samples from CR and Panamá belong to a single large group. The long COI gene sequences suggest that haplotypes in Panamá and CR, although similar to each other, had a significant geographic differentiation (Kst=1.33; P<0.001). Thus, most of our results suggest a recent range expansion in CR and Panamá. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Two extended haplotype blocks are associated with adaptation to high altitude habitats in East African honey bees

    PubMed Central

    Schöning, Caspar

    2017-01-01

    Understanding the genetic basis of adaption is a central task in biology. Populations of the honey bee Apis mellifera that inhabit the mountain forests of East Africa differ in behavior and morphology from those inhabiting the surrounding lowland savannahs, which likely reflects adaptation to these habitats. We performed whole genome sequencing on 39 samples of highland and lowland bees from two pairs of populations to determine their evolutionary affinities and identify the genetic basis of these putative adaptations. We find that in general, levels of genetic differentiation between highland and lowland populations are very low, consistent with them being a single panmictic population. However, we identify two loci on chromosomes 7 and 9, each several hundred kilobases in length, which exhibit near fixation for different haplotypes between highland and lowland populations. The highland haplotypes at these loci are extremely rare in samples from the rest of the world. Patterns of segregation of genetic variants suggest that recombination between haplotypes at each locus is suppressed, indicating that they comprise independent structural variants. The haplotype on chromosome 7 harbors nearly all octopamine receptor genes in the honey bee genome. These have a role in learning and foraging behavior in honey bees and are strong candidates for adaptation to highland habitats. Molecular analysis of a putative breakpoint indicates that it may disrupt the coding sequence of one of these genes. Divergence between the highland and lowland haplotypes at both loci is extremely high suggesting that they are ancient balanced polymorphisms that greatly predate divergence between the extant honey bee subspecies. PMID:28542163

  6. Musical aptitude is associated with AVPR1A-haplotypes.

    PubMed

    Ukkola, Liisa T; Onkamo, Päivi; Raijas, Pirre; Karma, Kai; Järvelä, Irma

    2009-05-20

    Artistic creativity forms the basis of music culture and music industry. Composing, improvising and arranging music are complex creative functions of the human brain, which biological value remains unknown. We hypothesized that practicing music is social communication that needs musical aptitude and even creativity in music. In order to understand the neurobiological basis of music in human evolution and communication we analyzed polymorphisms of the arginine vasopressin receptor 1A (AVPR1A), serotonin transporter (SLC6A4), catecol-O-methyltranferase (COMT), dopamin receptor D2 (DRD2) and tyrosine hydroxylase 1 (TPH1), genes associated with social bonding and cognitive functions in 19 Finnish families (n = 343 members) with professional musicians and/or active amateurs. All family members were tested for musical aptitude using the auditory structuring ability test (Karma Music test; KMT) and Carl Seashores tests for pitch (SP) and for time (ST). Data on creativity in music (composing, improvising and/or arranging music) was surveyed using a web-based questionnaire. Here we show for the first time that creative functions in music have a strong genetic component (h(2) = .84; composing h(2) = .40; arranging h(2) = .46; improvising h(2) = .62) in Finnish multigenerational families. We also show that high music test scores are significantly associated with creative functions in music (p<.0001). We discovered an overall haplotype association with AVPR1A gene (markers RS1 and RS3) and KMT (p = 0.0008; corrected p = 0.00002), SP (p = 0.0261; corrected p = 0.0072) and combined music test scores (COMB) (p = 0.0056; corrected p = 0.0006). AVPR1A haplotype AVR+RS1 further suggested a positive association with ST (p = 0.0038; corrected p = 0.00184) and COMB (p = 0.0083; corrected p = 0.0040) using haplotype-based association test HBAT. The results suggest that the neurobiology of music perception and production is likely to be related to the pathways affecting intrinsic

  7. Review: can diet influence the selective advantage of mitochondrial DNA haplotypes?

    PubMed

    Ballard, J William O; Youngson, Neil A

    2015-11-05

    This review explores the potential for changes in dietary macronutrients to differentially influence mitochondrial bioenergetics and thereby the frequency of mtDNA haplotypes in natural populations. Such dietary modification may be seasonal or result from biogeographic or demographic shifts. Mechanistically, mtDNA haplotypes may influence the activity of the electron transport system (ETS), retrograde signalling to the nuclear genome and affect epigenetic modifications. Thus, differential provisioning by macronutrients may lead to selection through changes in the levels of ATP production, modulation of metabolites (including AMP, reactive oxygen species (ROS) and the NAD(+)/NADH ratio) and potentially complex epigenetic effects. The exquisite complexity of dietary influence on haplotype frequency is further illustrated by the fact that macronutrients may differentially influence the selective advantage of specific mutations in different life-history stages. In Drosophila, complex I mutations may affect larval growth because dietary nutrients are fed through this complex in immaturity. In contrast, the majority of electrons are provided to complex III in adult flies. We conclude the review with a case study that considers specific interactions between diet and complex I of the ETS. Complex I is the first enzyme of the mitochondrial ETS and co-ordinates in the oxidation of NADH and transfer of electrons to ubiquinone. Although the supposition that mtDNA variants may be selected upon by dietary macronutrients could be intuitively consistent to some and counter intuitive to others, it must face a multitude of scientific hurdles before it can be recognized. © 2015 Authors.

  8. Bootstrap study of genome-enabled prediction reliabilities using haplotype blocks across Nordic Red cattle breeds.

    PubMed

    Cuyabano, B C D; Su, G; Rosa, G J M; Lund, M S; Gianola, D

    2015-10-01

    This study compared the accuracy of genome-enabled prediction models using individual single nucleotide polymorphisms (SNP) or haplotype blocks as covariates when using either a single breed or a combined population of Nordic Red cattle. The main objective was to compare predictions of breeding values of complex traits using a combined training population with haplotype blocks, with predictions using a single breed as training population and individual SNP as predictors. To compare the prediction reliabilities, bootstrap samples were taken from the test data set. With the bootstrapped samples of prediction reliabilities, we built and graphed confidence ellipses to allow comparisons. Finally, measures of statistical distances were used to calculate the gain in predictive ability. Our analyses are innovative in the context of assessment of predictive models, allowing a better understanding of prediction reliabilities and providing a statistical basis to effectively calibrate whether one prediction scenario is indeed more accurate than another. An ANOVA indicated that use of haplotype blocks produced significant gains mainly when Bayesian mixture models were used but not when Bayesian BLUP was fitted to the data. Furthermore, when haplotype blocks were used to train prediction models in a combined Nordic Red cattle population, we obtained up to a statistically significant 5.5% average gain in prediction accuracy, over predictions using individual SNP and training the model with a single breed. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  9. Estimating trace-suspect match probabilities for singleton Y-STR haplotypes using coalescent theory.

    PubMed

    Andersen, Mikkel Meyer; Caliebe, Amke; Jochens, Arne; Willuweit, Sascha; Krawczak, Michael

    2013-02-01

    Estimation of match probabilities for singleton haplotypes of lineage markers, i.e. for haplotypes observed only once in a reference database augmented by a suspect profile, is an important problem in forensic genetics. We compared the performance of four estimators of singleton match probabilities for Y-STRs, namely the count estimate, both with and without Brenner's so-called 'kappa correction', the surveying estimate, and a previously proposed, but rarely used, coalescent-based approach implemented in the BATWING software. Extensive simulation with BATWING of the underlying population history, haplotype evolution and subsequent database sampling revealed that the coalescent-based approach is characterized by lower bias and lower mean squared error than the uncorrected count estimator and the surveying estimator. Moreover, in contrast to the two count estimators, both the surveying and the coalescent-based approach exhibited a good correlation between the estimated and true match probabilities. However, although its overall performance is thus better than that of any other recognized method, the coalescent-based estimator is still computation-intense on the verge of general impracticability. Its application in forensic practice therefore will have to be limited to small reference databases, or to isolated cases of particular interest, until more powerful algorithms for coalescent simulation have become available. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  10. The effects of NAMPT haplotypes and metabolic risk factors on circulating visfatin/NAMPT levels in childhood obesity.

    PubMed

    Belo, V A; Luizon, M R; Lacchini, R; Miranda, J A; Lanna, C M M; Souza-Costa, D C; Tanus-Santos, J E

    2015-01-01

    Polymorphisms in the NAMPT gene, which encodes the adipocytokine visfatin/nicotinamide phosphorybosil transferase (NAMPT), affect the circulating visfatin/NAMPT levels and are associated with obesity and cardiovascular diseases. However, no study has tested the hypothesis that NAMPT haplotypes could affect visfatin/NAMPT levels in case of childhood obesity. We investigated the effects of traditional metabolic risk factors (MRFs) and NAMPT polymorphisms T/C (rs1319501) and A/G (rs3801266) or haplotypes on visfatin/NAMPT levels in obese children and adolescents, and whether NAMPT polymorphisms and/or haplotypes are associated with susceptibility to childhood obesity. We studied 175 control, 99 obese and 82 obese with ⩾ 3 MRFs children and adolescents. Genotypes were determined by a Taqman allele discrimination assay and real-time PCR. The plasma visfatin/NAMPT level was measured using an enzyme immunoassay. Obese children and adolescents with ⩾ 3 MRFs had higher plasma visfatin/NAMPT levels in comparison with control children and adolescents (P<0.05). Although positive associations were observed between visfatin/NAMPT and body mass index (rs = 0.157; P = 0.034) as well as visfatin/NAMPT and waist circumference (rs = 0.192; P = 0.011), visfatin/NAMPT and high-density lipoprotein cholesterol were inversely associated (rs = -0.162; P = 0.031). No significant differences in genotype, allele or haplotype frequency distributions for the studied polymorphisms were found when the three groups were compared. However, higher plasma visfatin/NAMPT levels were found in control and obese subjects carrying the GG genotype for the A/G (rs3801266) polymorphism (P<0.05) but not in obese children with ⩾ 3 MRFs. Moreover, control subjects carrying the 'T-G' haplotype showed higher plasma visfatin/NAMPT levels. NAMPT genotypes or haplotypes were not associated with childhood obesity. Obesity in children with ⩾ 3 MRFs increases plasma visfatin/NAMPT levels, and this marker was

  11. Sequence-Based Genotyping of Expressed Swine Leukocyte Antigen Class I Alleles by Next-Generation Sequencing Reveal Novel Swine Leukocyte Antigen Class I Haplotypes and Alleles in Belgian, Danish, and Kenyan Fattening Pigs and Göttingen Minipigs.

    PubMed

    Sørensen, Maria Rathmann; Ilsøe, Mette; Strube, Mikael Lenz; Bishop, Richard; Erbs, Gitte; Hartmann, Sofie Bruun; Jungersen, Gregers

    2017-01-01

    The need for typing of the swine leukocyte antigen (SLA) is increasing with the expanded use of pigs as models for human diseases and organ-transplantation experiments, their use in infection studies, and for design of veterinary vaccines. Knowledge of SLA sequences is furthermore a prerequisite for the prediction of epitope binding in pigs. The low number of known SLA class I alleles and the limited knowledge of their prevalence in different pig breeds emphasizes the need for efficient SLA typing methods. This study utilizes an SLA class I-typing method based on next-generation sequencing of barcoded PCR amplicons. The amplicons were generated with universal primers and predicted to resolve 68-88% of all known SLA class I alleles dependent on amplicon size. We analyzed the SLA profiles of 72 pigs from four different pig populations; Göttingen minipigs and Belgian, Kenyan, and Danish fattening pigs. We identified 67 alleles, nine previously described haplotypes and 15 novel haplotypes. The highest variation in SLA class I profiles was observed in the Danish pigs and the lowest among the Göttingen minipig population, which also have the highest percentage of homozygote individuals. Highlighting the fact that there are still numerous unknown SLA class I alleles to be discovered, a total of 12 novel SLA class I alleles were identified. Overall, we present new information about known and novel alleles and haplotypes and their prevalence in the tested pig populations.

  12. Cassava haplotype map highlights fixation of deleterious mutations during clonal propagation

    USDA-ARS?s Scientific Manuscript database

    Cassava (Manihot esculenta Crantz) is an important staple food crop in Africa and South America whose fitness may be severely reduced by ubiquitous deleterious variation. To evaluate these deleterious mutations in cassava genome, we constructed a cassava haplotype map by deep sequencing of 241 diver...

  13. The α‐synuclein gene in multiple system atrophy

    PubMed Central

    Ozawa, T; Healy, D G; Abou‐Sleiman, P M; Ahmadi, K R; Quinn, N; Lees, A J; Shaw, K; Wullner, U; Berciano, J; Moller, J C; Kamm, C; Burk, K; Josephs, K A; Barone, P; Tolosa, E; Goldstein, D B; Wenning, G; Geser, F; Holton, J L; Gasser, T; Revesz, T; Wood, N W

    2006-01-01

    Background The formation of α‐synuclein aggregates may be a critical event in the pathogenesis of multiple system atrophy (MSA). However, the role of this gene in the aetiology of MSA is unknown and untested. Method The linkage disequilibrium (LD) structure of the α‐synuclein gene was established and LD patterns were used to identify a set of tagging single nucleotide polymorphisms (SNPs) that represent 95% of the haplotype diversity across the entire gene. The effect of polymorphisms on the pathological expression of MSA in pathologically confirmed cases was also evaluated. Results and conclusion In 253 Gilman probable or definite MSA patients, 457 possible, probable, and definite MSA cases and 1472 controls, a frequency difference for the individual tagging SNPs or tag‐defined haplotypes was not detected. No effect was observed of polymorphisms on the pathological expression of MSA in pathologically confirmed cases. PMID:16543523

  14. Large variation in mitochondrial DNA of sexual and parthenogenetic Dahlica triquetrella (Lepidoptera: Psychidae) shows multiple origins of parthenogenesis.

    PubMed

    Elzinga, Jelmer A; Jokela, Jukka; Shama, Lisa N S

    2013-04-26

    Obligate parthenogenesis is relatively rare in animals. Still, in some groups it is quite common and has evolved and persisted multiple times. These groups may provide important clues to help solve the 'paradox of sex'. Several species in the Psychidae (Lepidoptera) have obligate parthenogenesis. Dahlica triquetrella is one of those species where multiple transitions to parthenogenesis are postulated based on intensive cytological and behavioural studies. This has led to the hypothesis that multiple transitions from sexuals to diploid parthenogens occurred during and after the last glacial period, followed by transitions from parthenogenetic diploids to parthenogenetic tetraploids. Our study is the first to test these hypotheses using a molecular phylogeny based on mtDNA from multiple sexual and parthenogenetic populations from a wide geographic range. Parthenogenetic (and sexual) D. triquetrella are not monophyletic, and considerable sequence variation is present suggesting multiple transitions to parthenogenesis. However, we could not establish ancestral sexual haplotypes from our dataset. Our data suggest that some parthenogenetic clades have evolved, indicating origins of parthenogenesis before the last glacial period. Multiple transitions to parthenogenesis have taken place in Dahlica triquetrella, confirming previous hypotheses. The number of different parthenogenetic clades, haplotypes and their apparent evolutionary age, clearly show that parthenogenesis has been a very successful reproductive strategy in this species over a long period.

  15. eNOS gene haplotype is indirectly associated with the recovery of cardiovascular autonomic modulation from exercise.

    PubMed

    Silva, Bruno M; Barbosa, Thales C; Neves, Fabricia J; Sales, Allan K; Rocha, Natalia G; Medeiros, Renata F; Pereira, Felipe S; Garcia, Vinicius P; Cardoso, Fabiane T; Nobrega, Antonio C L

    2014-12-01

    Polymorphisms in the endothelial nitric oxide synthase (eNOS) gene decrease expression and activation of eNOS in vitro, which is associated with lower post-exercise increase in vasodilator reactivity in vivo. However, it is unknown whether such polymorphisms are associated with other eNOS-related phenotypes during recovery from exercise. Therefore, we investigated the impact of an eNOS haplotype containing polymorphic alleles at loci -786 and 894 on the recovery of cardiovascular autonomic function from exercise. Sedentary, non-obese, healthy subjects were enrolled [n = 107, age 32 ± 1 years (mean ± SEM)]. Resting autonomic modulation (heart rate variability, systolic blood pressure variability, and spontaneous baroreflex sensitivity) and vascular reactivity (forearm hyperemic response post-ischemia) were assessed at baseline, 10, 60, and 120 min after a maximal cardiopulmonary exercise test. Besides, autonomic function was assessed by heart rate recovery (HRR) immediately after peak exercise. Haplotype analysis showed that vagal modulation (i.e., HF n.u.) was significantly higher, combined sympathetic and vagal modulation (i.e., LF/HF) was significantly lower and total blood pressure variability was significantly lower post-exercise in a haplotype containing polymorphic alleles (H2) compared to a haplotype with wild type alleles (H1). HRR was similar between groups. Corroborating previous evidence, H2 had significantly lower post-exercise increase in vasodilator reactivity than H1. In conclusion, a haplotype containing polymorphic alleles at loci -786 and 894 had enhanced recovery of autonomic modulation from exercise, along with unchanged HRR, and attenuated vasodilator reactivity. Then, these results suggest an autonomic compensatory response of a direct deleterious effect of eNOS polymorphisms on the vascular function. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Association of two independent functional risk haplotypes in TNIP1 with systemic lupus erythematosus.

    PubMed

    Adrianto, Indra; Wang, Shaofeng; Wiley, Graham B; Lessard, Christopher J; Kelly, Jennifer A; Adler, Adam J; Glenn, Stuart B; Williams, Adrienne H; Ziegler, Julie T; Comeau, Mary E; Marion, Miranda C; Wakeland, Benjamin E; Liang, Chaoying; Kaufman, Kenneth M; Guthridge, Joel M; Alarcón-Riquelme, Marta E; Alarcón, Graciela S; Anaya, Juan-Manuel; Bae, Sang-Cheol; Kim, Jae-Hoon; Joo, Young Bin; Boackle, Susan A; Brown, Elizabeth E; Petri, Michelle A; Ramsey-Goldman, Rosalind; Reveille, John D; Vilá, Luis M; Criswell, Lindsey A; Edberg, Jeffrey C; Freedman, Barry I; Gilkeson, Gary S; Jacob, Chaim O; James, Judith A; Kamen, Diane L; Kimberly, Robert P; Martín, Javier; Merrill, Joan T; Niewold, Timothy B; Pons-Estel, Bernardo A; Scofield, R Hal; Stevens, Anne M; Tsao, Betty P; Vyse, Timothy J; Langefeld, Carl D; Harley, John B; Wakeland, Edward K; Moser, Kathy L; Montgomery, Courtney G; Gaffney, Patrick M

    2012-11-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by autoantibody production and altered type I interferon expression. Genetic surveys and genome-wide association studies have identified >30 SLE susceptibility genes. One of these genes, TNIP1, encodes the ABIN1 protein. ABIN1 functions in the immune system by restricting NF-κB signaling. The present study was undertaken to investigate the genetic factors that influence association with SLE in genes that regulate the NF-κB pathway. We analyzed a dense set of genetic markers spanning TNIP1 and TAX1BP1, as well as the TNIP1 homolog TNIP2, in case-control populations of diverse ethnic origins. TNIP1, TNIP2, and TAX1BP1 were fine-mapped in a total of 8,372 SLE cases and 7,492 healthy controls from European-ancestry, African American, Hispanic, East Asian, and African American Gullah populations. Levels of TNIP1 messenger RNA (mRNA) and ABIN1 protein in Epstein-Barr virus-transformed human B cell lines were analyzed by quantitative reverse transcription-polymerase chain reaction and Western blotting, respectively. We found significant associations between SLE and genetic variants within TNIP1, but not in TNIP2 or TAX1BP1. After resequencing and imputation, we identified 2 independent risk haplotypes within TNIP1 in individuals of European ancestry that were also present in African American and Hispanic populations. Levels of TNIP1 mRNA and ABIN1 protein were reduced among subjects with these haplotypes, suggesting that they harbor hypomorphic functional variants that influence susceptibility to SLE by restricting ABIN1 expression. Our results confirm the association signals between SLE and TNIP1 variants in multiple populations and provide new insight into the mechanism by which TNIP1 variants may contribute to SLE pathogenesis. Copyright © 2012 by the American College of Rheumatology.

  17. Two Independent Functional Risk Haplotypes in TNIP1 are Associated with Systemic Lupus Erythematosus

    PubMed Central

    Adrianto, Indra; Wang, Shaofeng; Wiley, Graham B.; Lessard, Christopher J.; Kelly, Jennifer A.; Adler, Adam J.; Glenn, Stuart B.; Williams, Adrienne H.; Ziegler, Julie T.; Comeau, Mary E.; Marion, Miranda C.; Wakeland, Benjamin E.; Liang, Chaoying; Kaufman, Kenneth M.; Guthridge, Joel M.; Alarcón-Riquelme, Marta E.; Alarcón, Graciela S.; Anaya, Juan-Manuel; Bae, Sang-Cheol; Kim, Jae-Hoon; Joo, Young Bin; Boackle, Susan A.; Brown, Elizabeth E.; Petri, Michelle A.; Ramsey-Goldman, Rosalind; Reveille, John D.; Vilá, Luis M.; Criswell, Lindsey A.; Edberg, Jeffrey C.; Freedman, Barry I.; Gilkeson, Gary S.; Jacob, Chaim O.; James, Judith A.; Kamen, Diane L.; Kimberly, Robert P.; Martin, Javier; Merrill, Joan T.; Niewold, Timothy B.; Pons-Estel, Bernardo A.; Scofield, R. Hal; Stevens, Anne M.; Tsao, Betty P.; Vyse, Timothy J.; Langefeld, Carl D.; Harley, John B.; Wakeland, Edward K.; Moser, Kathy L.; Montgomery, Courtney G.; Gaffney, Patrick M.

    2012-01-01

    Objective Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by autoantibody production and altered type I interferon expression. Genetic surveys and genome-wide association studies have identified more than 30 SLE susceptibility genes. One of these genes, TNIP1, encodes the ABIN1 protein. ABIN1 functions in the immune system by restricting the NF-κB signaling. In order to better understand the genetic factors that influence association with SLE in genes that regulate the NF-κB pathway, we analyzed a dense set of genetic markers spanning TNIP1 and TAX1BP1, as well as the TNIP1 homolog, TNIP2, in case-control sets of diverse ethnic origins. Methods We fine-mapped TNIP1, TNIP2, and TAX1BP1 in a total of 8372 SLE cases and 7492 healthy controls from European-ancestry, African-American, Hispanic, East Asian, and African-American Gullah populations. Levels of TNIP1 mRNA and ABIN1 protein were analyzed using quantitative RT-PCR and Western blotting, respectively, in EBV-transformed human B cell lines. Results We found significant associations between genetic variants within TNIP1 and SLE but not in TNIP2 or TAX1BP1. After resequencing and imputation, we identified two independent risk haplotypes within TNIP1 in individuals of European-ancestry that were also present in African-American and Hispanic populations. These risk haplotypes produced lower levels of TNIP1 mRNA and ABIN1 protein suggesting they harbor hypomorphic functional variants that influence susceptibility to SLE by restricting ABIN1 expression. Conclusion Our results confirmed the association signals between SLE and TNIP1 variants in multiple populations and provide new insight into the mechanism by which TNIP1 variants may contribute to SLE pathogenesis. PMID:22833143

  18. BMP4 and FGF3 haplotypes increase the risk of tendinopathy in volleyball athletes.

    PubMed

    Salles, José Inácio; Amaral, Marcus Vinícius; Aguiar, Diego Pinheiro; Lira, Daisy Anne; Quinelato, Valquiria; Bonato, Letícia Ladeira; Duarte, Maria Eugenia Leite; Vieira, Alexandre Rezende; Casado, Priscila Ladeira

    2015-03-01

    To investigate whether genetic variants can be correlated with tendinopathy in elite male volleyball athletes. Case-control study. Fifteen single nucleotide polymorphisms within BMP4, FGF3, FGF10, FGFR1 genes were investigated in 138 elite volleyball athletes, aged between 18 and 35 years, who undergo 4-5h of training per day: 52 with tendinopathy and 86 with no history of pain suggestive of tendinopathy in patellar, Achilles, shoulder, and hip abductors tendons. The clinical diagnostic criterion was progressive pain during training, confirmed by magnetic resonance image. Genomic DNA was obtained from saliva samples. Genetic markers were genotyped using TaqMan real-time PCR. Chi-square test compared genotypes and haplotype differences between groups. Multivariate logistic regression analyzed the significance of covariates and incidence of tendinopathy. Statistical analysis revealed participant age (p=0.005) and years of practice (p=0.004) were risk factors for tendinopathy. A significant association between BMP4 rs2761884 (p=0.03) and tendinopathy was observed. Athletes with a polymorphic genotype have 2.4 times more susceptibility to tendinopathy (OR=2.39; 95%CI=1.10-5.19). Also, association between disease and haplotype TTGGA in BMP4 (p=0.01) was observed. The FGF3 TGGTA haplotype showed a tendency of association with tendinopathy (p=0.05), and so did FGF10 rs900379. FGFR1 showed no association with disease. These findings indicate that haplotypes in BMP4 and FGF3 genes may contribute to the tendon disease process in elite volleyball athletes. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  19. Genome-wide Association Study Identifies HLA 8.1 Ancestral Haplotype Alleles as Major Genetic Risk Factors for Myositis Phenotypes

    PubMed Central

    Miller, Frederick W.; Chen, Wei; O’Hanlon, Terrance P.; Cooper, Robert G.; Vencovsky, Jiri; Rider, Lisa G.; Danko, Katalin; Wedderburn, Lucy R.; Lundberg, Ingrid E.; Pachman, Lauren M.; Reed, Ann M.; Ytterberg, Steven R.; Padyukov, Leonid; Selva-O’Callaghan, Albert; Radstake, Timothy R.; Isenberg, David A.; Chinoy, Hector; Ollier, William E.R.; Scheet, Paul; Peng, Bo; Lee, Annette; Byun, Jinyoung; Lamb, Janine A.; Gregersen, Peter K.; Amos, Christopher I.

    2016-01-01

    Autoimmune muscle diseases (myositis) comprise a group of complex phenotypes influenced by genetic and environmental factors. To identify genetic risk factors in patients of European ancestry, we conducted a genome-wide association study (GWAS) of the major myositis phenotypes in a total of 1710 cases, which included 705 adult dermatomyositis; 473 juvenile dermatomyositis; 532 polymyositis; and 202 adult dermatomyositis, juvenile dermatomyositis or polymyositis patients with anti-histidyl tRNA synthetase (anti-Jo-1) autoantibodies, and compared them with 4724 controls. Single-nucleotide polymorphisms showing strong associations (P < 5 × 10−8) in GWAS were identified in the major histocompatibility complex (MHC) region for all myositis phenotypes together, as well as for the four clinical and autoantibody phenotypes studied separately. Imputation and regression analyses found that alleles comprising the human leukocyte antigen (HLA) 8.1 ancestral haplotype (AH8.1) defined essentially all the genetic risk in the phenotypes studied. Although the HLA DRB1*03:01 allele showed slightly stronger associations with adult and juvenile dermatomyositis, and HLA B*08:01 with polymyositis and anti-Jo-1 autoantibody-positive myositis, multiple alleles of AH8.1 were required for the full risk effects. Our findings establish that alleles of the AH8.1haplotype comprise the primary genetic risk factors associated with the major myositis phenotypes in geographically diverse Caucasian populations. PMID:26291516

  20. Echinococcus equinus and Echinococcus granulosus sensu stricto from the United Kingdom: genetic diversity and haplotypic variation.

    PubMed

    Boufana, Belgees; Lett, Wai San; Lahmar, Samia; Buishi, Imad; Bodell, Anthony J; Varcasia, Antonio; Casulli, Adriano; Beeching, Nicholas J; Campbell, Fiona; Terlizzo, Monica; McManus, Donald P; Craig, Philip S

    2015-02-01

    Cystic echinococcosis is endemic in Europe including the United Kingdom. However, information on the molecular epidemiology of Echinococcus spp. from the United Kingdom is limited. Echinococcus isolates from intermediate and definitive animal hosts as well as from human cystic echinococcosis cases were analysed to determine species and genotypes within these hosts. Echinococcus equinus was identified from horse hydatid isolates, cysts retrieved from captive UK mammals and copro-DNA of foxhounds and farm dogs. Echinococcus granulosus sensu stricto (s.s.) was identified from hydatid cysts of sheep and cattle as well as in DNA extracted from farm dog and foxhound faecal samples, and from four human cystic echinococcosis isolates, including the first known molecular confirmation of E. granulosus s.s. infection in a Welsh sheep farmer. Low genetic variability for E. equinus from various hosts and from different geographical locations was detected using the mitochondrial cytochrome c oxidase subunit 1 gene (cox1), indicating the presence of a dominant haplotype (EQUK01). In contrast, greater haplotypic variation was observed for E. granulosus s.s. cox1 sequences. The haplotype network showed a star-shaped network with a centrally placed main haplotype (EgUK01) that had been reported from other world regions. Copyright © 2014 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  1. Evidence of a Native Northwest Atlantic COI Haplotype Clade in the Cryptogenic Colonial Ascidian Botryllus schlosseri.

    PubMed

    Yund, Philip O; Collins, Catherine; Johnson, Sheri L

    2015-06-01

    The colonial ascidian Botryllus schlosseri should be considered cryptogenic (i.e., not definitively classified as either native or introduced) in the Northwest Atlantic. Although all the evidence is quite circumstantial, over the last 15 years most research groups have accepted the scenario of human-mediated dispersal and classified B. schlosseri as introduced; others have continued to consider it native or cryptogenic. We address the invasion status of this species by adding 174 sequences to the growing worldwide database for the mitochondrial gene cytochrome c oxidase subunit I (COI) and analyzing 1077 sequences to compare genetic diversity of one clade of haplotypes in the Northwest Atlantic with two hypothesized source regions (the Northeast Atlantic and Mediterranean). Our results lead us to reject the prevailing view of the directionality of transport across the Atlantic. We argue that the genetic diversity patterns at COI are far more consistent with the existence of at least one haplotype clade in the Northwest Atlantic (and possibly a second) that substantially pre-dates human colonization from Europe, with this native North American clade subsequently introduced to three sites in Northeast Atlantic and Mediterranean waters. However, we agree with past researchers that some sites in the Northwest Atlantic have more recently been invaded by alien haplotypes, so that some populations are currently composed of a mixture of native and invader haplotypes. © 2015 Marine Biological Laboratory.

  2. Geophysical Factor Resolving of Rainfall Mechanism for Super Typhoons by Using Multiple Spatiotemporal Components Analysis

    NASA Astrophysics Data System (ADS)

    Huang, Chien-Lin; Hsu, Nien-Sheng

    2016-04-01

    This study develops a novel methodology to resolve the geophysical cause of typhoon-induced rainfall considering diverse dynamic co-evolution at multiple spatiotemporal components. The multi-order hidden patterns of complex hydrological process in chaos are detected to understand the fundamental laws of rainfall mechanism. The discovered spatiotemporal features are utilized to develop a state-of-the-art descriptive statistical model for mechanism validation, modeling and further prediction during typhoons. The time series of hourly typhoon precipitation from different types of moving track, atmospheric field and landforms are respectively precede the signal analytical process to qualify each type of rainfall cause and to quantify the corresponding affected degree based on the measured geophysical atmospheric-hydrological variables. This study applies the developed methodology in Taiwan Island which is constituted by complex diverse landform formation. The identified driving-causes include: (1) cloud height to ground surface; (2) co-movement effect induced by typhoon wind field with monsoon; (3) stem capacity; (4) interaction between typhoon rain band and terrain; (5) structural intensity variance of typhoon; and (6) integrated cloudy density of rain band. Results show that: (1) for the central maximum wind speed exceeding 51 m/sec, Causes (1) and (3) are the primary ones to generate rainfall; (2) for the typhoon moving toward the direction of 155° to 175°, Cause (2) is the primary one; (3) for the direction of 90° to 155°, Cause (4) is the primary one; (4) for the typhoon passing through mountain chain which above 3500 m, Cause (5) is the primary one; and (5) for the moving speed lower than 18 km/hr, Cause (6) is the primary one. Besides, the multiple geophysical component-based precipitation modeling can achieve 81% of average accuracy and 0.732 of average correlation coefficient (CC) within average 46 hours of duration, that improve their predictability.

  3. Genomic dissection of a ‘Fuji’ apple cultivar: re-sequencing, SNP marker development, definition of haplotypes, and QTL detection

    PubMed Central

    Kunihisa, Miyuki; Moriya, Shigeki; Abe, Kazuyuki; Okada, Kazuma; Haji, Takashi; Hayashi, Takeshi; Kawahara, Yoshihiro; Itoh, Ryutaro; Itoh, Takeshi; Katayose, Yuichi; Kanamori, Hiroyuki; Matsumoto, Toshimi; Mori, Satomi; Sasaki, Harumi; Matsumoto, Takashi; Nishitani, Chikako; Terakami, Shingo; Yamamoto, Toshiya

    2016-01-01

    ‘Fuji’ is one of the most popular and highly-produced apple cultivars worldwide, and has been frequently used in breeding programs. The development of genotypic markers for the preferable phenotypes of ‘Fuji’ is required. Here, we aimed to define the haplotypes of ‘Fuji’ and find associations between haplotypes and phenotypes of five traits (harvest day, fruit weight, acidity, degree of watercore, and flesh mealiness) by using 115 accessions related to ‘Fuji’. Through the re-sequencing of ‘Fuji’ genome, total of 2,820,759 variants, including single nucleotide polymorphisms (SNPs) and insertions or deletions (indels) were detected between ‘Fuji’ and ‘Golden Delicious’ reference genome. We selected mapping-validated 1,014 SNPs, most of which were heterozygous in ‘Fuji’ and capable of distinguishing alleles inherited from the parents of ‘Fuji’ (i.e., ‘Ralls Janet’ and ‘Delicious’). We used these SNPs to define the haplotypes of ‘Fuji’ and trace their inheritance in relatives, which were shown to have an average of 27% of ‘Fuji’ genome. Analysis of variance (ANOVA) based on ‘Fuji’ haplotypes identified one quantitative trait loci (QTL) each for harvest time, acidity, degree of watercore, and mealiness. A haplotype from ‘Delicious’ chr14 was considered to dominantly cause watercore, and one from ‘Ralls Janet’ chr1 was related to low-mealiness. PMID:27795675

  4. Molecular identification and first report of mitochondrial COI gene haplotypes in the hawksbill turtle Eretmochelys imbricata (Testudines: Cheloniidae) in the Colombian Caribbean nesting colonies.

    PubMed

    Daza-Criado, L; Hernández-Fernández, J

    2014-02-21

    Hawksbill sea turtles Eretmochelys imbricata are found extensively around the world, including the Atlantic, Pacific, and Indian Oceans; the Persian Gulf, and the Red and Mediterranean Seas. Populations of this species are affected by international trafficking of their shields, meat, and eggs, making it a critically endangered animal. We determined the haplotypes of 17 hawksbill foraging turtles of Islas del Rosario (Bolivar) and of the nesting beach Don Diego (Magdalena) in the Colombian Caribbean based on amplification and sequencing of the mitochondrial gene cytochrome oxidase c subunit I (COI). We identified 5 haplotypes, including EI-A1 previously reported in Puerto Rico, which was similar to 10 of the study samples. To our knowledge, the remaining 4 haplotypes have not been described. Samples EICOI11 and EICOI3 showed 0.2% divergence from EI-A1, by a single nucleotide change, and were classified as the EI-A2 haplotype. EICOI6, EICOI14, and EICOI12 samples showed 0.2% divergence from EI-A1 and 0.3% divergence from EI-A2 and were classified as EI-A3 haplotype. Samples EICOI16 and EICOI15 presented 5 nucleotide changes each and were classified as 2 different haplotypes, EI-A4 and EI-A5, respectively. The last 2 haplotypes had higher nucleotide diversity (K2P=1.7%) than that by the first 3 haplotypes. EI-A1 and EI-A2 occurred in nesting individuals, and EI-A2, EI-A3, EI-A4, and EI-A5 occurred in foraging individuals. The description of the haplotypes may be associated with reproductive migrations or foraging and could support the hypothesis of natal homing. Furthermore, they can be used in phylogeographic studies.

  5. Lack of haplotype structuring for two candidate genes for trypanotolerance in cattle.

    PubMed

    Álvarez, I; Pérez-Pardal, L; Traoré, A; Fernández, I; Goyache, F

    2016-04-01

    Bovine trypanotolerance is a heritable trait associated to the ability of the individuals to control parasitaemia and anaemia. The INHBA (BTA4) and TICAM1 (BTA7) genes are strong candidates for trypanotolerance-related traits. The coding sequence of both genes (3951 bp in total) were analysed in a panel including 79 Asian, African and European cattle (Bos taurus and B. indicus) to identify naturally occurring polymorphisms on both genes. In general, the genetic diversity was low. Nineteen of the 33 mutations identified were found just one time. Seventeen different haplotypes were defined for the TICAM1 gene, and 9 and 12 were defined for the exon 1 and the exon 2 of the INHBA gene, respectively. There was no clear separation between cattle groups. The most frequent haplotypes identified in West African taurine samples were also identified in other cattle groups including Asian zebu and European cattle. Phylogenetic trees and principal component analysis confirmed that divergence among the cattle groups analysed was poor, particularly for the INHBA sequences. The European cattle subset had the lowest values of haplotype diversity for both the exon1 (monomorphic) and the exon2 (0.077 ± 0.066) of the INHBA gene. Neutrality tests, in general, did not suggest that the analysed genes were under positive selection. The assessed scenario would be consistent with the identification of recent mutations in evolutionary terms. © 2015 Blackwell Verlag GmbH.

  6. Mutations in the von Hippel-Lindau (VHL) tumor suppressor gene and VHL-haplotype analysis in patients with presumable congenital erythrocytosis.

    PubMed

    Cario, Holger; Schwarz, Klaus; Jorch, Norbert; Kyank, Ulrike; Petrides, Petro E; Schneider, Dominik T; Uhle, Renate; Debatin, Klaus-Michael; Kohne, Elisabeth

    2005-01-01

    Congenital erythrocytoses or polycythemias are rare and heterogeneous. A homozygous mutation (C598T->Arg200Trp) in the von Hippel-Lindau (VHL) gene was originally identified as the cause of the endemic Chuvash polycythemia. Subsequently this and other mutations in the VHL gene were also detected in several patients of different ethnic origin. Haplotype analyses of the VHL gene suggested a common origin for the Chuvash-type mutation. Thirty-four patients with presumable congenital erythrocytosis due to an unknown underlying disorder were examined for VHL gene mutations and VHL region haplotypes. Four patients were homozygous and one patient heterozygous for the Chuvash-type mutation. One additional patient presented a previously not described heterozygous mutation G311->T VHL in exon 1. The haplotype analyses were in agreement with recently published data for three of the four patients with homozygous mutations as well as for the patient with a heterozygous Chuvash-type mutation. One patient of Turkish origin with homozygous Chuvash-type mutation had a haplotype not previously found in individuals with Chuvash-type mutation. These results confirm that mutations in the VHL gene are responsible for a substantial proportion of patients with congenital erythrocytoses. Erythrocytoses due to a C598->T mutation of the VHL gene are not geographically restricted. The majority of patients with Chuvash polycythemia share a common VHL gene haplotype. The different haplotype in one of the patients with Chuvash-type mutation indicates that this mutation was not spread only from a single founder but developed independently in other individuals.

  7. Haplotype analysis of sucrose synthase gene family in three Saccharum species

    PubMed Central

    2013-01-01

    Background Sugarcane is an economically important crop contributing about 80% and 40% to the world sugar and ethanol production, respectively. The complicated genetics consequential to its complex polyploid genome, however, have impeded efforts to improve sugar yield and related important agronomic traits. Modern sugarcane cultivars are complex hybrids derived mainly from crosses among its progenitor species, S. officinarum and S. spontanuem, and to a lesser degree, S. robustom. Atypical of higher plants, sugarcane stores its photoassimilates as sucrose rather than as starch in its parenchymous stalk cells. In the sugar biosynthesis pathway, sucrose synthase (SuSy, UDP-glucose: D-fructose 2-a-D-glucosyltransferase, EC 2.4.1.13) is a key enzyme in the regulation of sucrose accumulation and partitioning by catalyzing the reversible conversion of sucrose and UDP into UDP-glucose and fructose. However, little is known about the sugarcane SuSy gene family members and hence no definitive studies have been reported regarding allelic diversity of SuSy gene families in Saccharum species. Results We identified and characterized a total of five sucrose synthase genes in the three sugarcane progenitor species through gene annotation and PCR haplotype analysis by analyzing 70 to 119 PCR fragments amplified from intron-containing target regions. We detected all but one (i.e. ScSuSy5) of ScSuSy transcripts in five tissue types of three Saccharum species. The average SNP frequency was one SNP per 108 bp, 81 bp, and 72 bp in S. officinarum, S. robustom, and S. spontanuem respectively. The average shared SNP is 15 between S. officinarum and S. robustom, 7 between S. officinarum and S. spontanuem , and 11 between S. robustom and S. spontanuem. We identified 27, 35, and 32 haplotypes from the five ScSuSy genes in S. officinarum, S. robustom, and S. spontanuem respectively. Also, 12, 11, and 9 protein sequences were translated from the haplotypes in S. officinarum, S. robustom, S

  8. Haplotype analysis of sucrose synthase gene family in three Saccharum species.

    PubMed

    Zhang, Jisen; Arro, Jie; Chen, Youqiang; Ming, Ray

    2013-05-10

    Sugarcane is an economically important crop contributing about 80% and 40% to the world sugar and ethanol production, respectively. The complicated genetics consequential to its complex polyploid genome, however, have impeded efforts to improve sugar yield and related important agronomic traits. Modern sugarcane cultivars are complex hybrids derived mainly from crosses among its progenitor species, S. officinarum and S. spontanuem, and to a lesser degree, S. robustom. Atypical of higher plants, sugarcane stores its photoassimilates as sucrose rather than as starch in its parenchymous stalk cells. In the sugar biosynthesis pathway, sucrose synthase (SuSy, UDP-glucose: D-fructose 2-a-D-glucosyltransferase, EC 2.4.1.13) is a key enzyme in the regulation of sucrose accumulation and partitioning by catalyzing the reversible conversion of sucrose and UDP into UDP-glucose and fructose. However, little is known about the sugarcane SuSy gene family members and hence no definitive studies have been reported regarding allelic diversity of SuSy gene families in Saccharum species. We identified and characterized a total of five sucrose synthase genes in the three sugarcane progenitor species through gene annotation and PCR haplotype analysis by analyzing 70 to 119 PCR fragments amplified from intron-containing target regions. We detected all but one (i.e. ScSuSy5) of ScSuSy transcripts in five tissue types of three Saccharum species. The average SNP frequency was one SNP per 108 bp, 81 bp, and 72 bp in S. officinarum, S. robustom, and S. spontanuem respectively. The average shared SNP is 15 between S. officinarum and S. robustom, 7 between S. officinarum and S. spontanuem , and 11 between S. robustom and S. spontanuem. We identified 27, 35, and 32 haplotypes from the five ScSuSy genes in S. officinarum, S. robustom, and S. spontanuem respectively. Also, 12, 11, and 9 protein sequences were translated from the haplotypes in S. officinarum, S. robustom, S. spontanuem

  9. Serum Klotho (but not haplotypes) associate with the post-myocardial infarction status of older adults

    PubMed Central

    Paula, Roberta S; Souza, Vinícius C; Machado-Silva, Wilcelly; Almeida, Bruno Ratier S; Daros, Andersen C; Gomes, Lucy; Ferreira, Aparecido P; Brito, Ciro J; Córdova, Cláudio; Moraes, Clayton F; Nóbrega, Otávio T

    2016-01-01

    OBJECTIVES: The number of deaths from vascular diseases is incredibly high worldwide, and reliable markers for major events are still needed. The current cross-sectional study investigated the association of Klotho haplotypes and Klotho serum levels with classic risk factors and a clinical history of vascular events. METHODS: Clinical, anthropometric, biochemical and nutritional assessments were conducted with 168 older adults, complemented by genotyping (rs9536314 and rs9527025) and the detection of serum Klotho (ELISA). RESULTS: Klotho levels and haplotypes did not associate with most classic risk factors for vascular events, including markers such as C-reactive protein and homocysteine. A positive association was only found between Klotho levels and the previous occurrence of a myocardial infarction by both correlational (p=0.006) and variance analyses (p<0.001), and these associations were independent of the context. CONCLUSION: Our results suggest that serum Klotho is higher in individuals with a clinical history of myocardial infarction but not with a history of coronary artery disease or stroke. None of the Klotho haplotypes were associated with the variables investigated herein. PMID:28076518

  10. Restricted dog leucocyte antigen (DLA) class II haplotypes and genotypes in Beagles.

    PubMed

    Soutter, Francesca; Kennedy, Lorna J; Ollier, William E R; Solano-Gallego, Laia; Catchpole, Brian

    2015-03-01

    Beagles are commonly used in vaccine trials as part of the regulatory approval process. Genetic restriction within this breed and the impact this might have on vaccine responses are rarely considered. This study was designed to characterise diversity of dog leucocyte antigen (DLA) class II genes in a breeding colony of laboratory Beagles, whose offspring are used in vaccine studies. DLA haplotypes were determined by PCR and sequence-based typing from genomic DNA extracted from blood. Breeding colony Beagles had significantly different DLA haplotype frequencies in comparison with pet Beagles and both groups showed limited DLA diversity. Restricted DLA class II genetic variability within Beagles might result in selective antigen presentation and vaccine responses that are not necessarily representative of those seen in other dog breeds. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Association of HLA-DRB1 Haplotypes With Rheumatoid Arthritis Severity, Mortality, and Treatment Response

    PubMed Central

    Viatte, Sebastien; Plant, Darren; Han, Buhm; Fu, Bo; Yarwood, Annie; Thomson, Wendy; Symmons, Deborah P. M.; Worthington, Jane; Young, Adam; Hyrich, Kimme L.; Morgan, Ann W.; Wilson, Anthony G.; Isaacs, John D.; Raychaudhuri, Soumya; Barton, Anne

    2016-01-01

    IMPORTANCE Advances have been made in identifying genetic susceptibility loci for autoimmune diseases, but evidence is needed regarding their association with prognosis and treatment response. OBJECTIVE To assess whether specific HLA-DRB1 haplotypes associated with rheumatoid arthritis (RA) susceptibility are also associated with radiological severity, mortality, and response to tumor necrosis factor (TNF) inhibitor drugs. DESIGN, SETTING, AND PARTICIPANTS The Norfolk Arthritis Register (NOAR; 1691 patients and 2811 radiographs; recruitment: 1989–2008; 2008 as final follow-up) was used as a discovery cohort and the Early Rheumatoid Arthritis Study (421 patients and 3758 radiographs; recruitment: 1986–1999; 2005 as final follow-up) as an independent replication cohort for studies of radiographic outcome. Mortality studies were performed in the NOAR cohort (2432 patients; recruitment: 1990–2007; 2011 as final follow-up) and studies of treatment response in the Biologics in Rheumatoid Arthritis Genetics and Genomics Study Syndicate cohort (1846 patients enrolled at initiation of TNF inhibitor; recruitment: 2006–2010; 2011 as final follow-up). Longitudinal statistical modeling was performed to integrate multiple radiograph records per patient over time. All patients were from the United Kingdom and had self-reported white ancestry. EXPOSURES Sixteen HLA-DRB1 haplotypes defined by amino acids at positions 11, 71, and 74. MAIN OUTCOMES AND MEASURES Radiological outcome using the Larsen score (range: 0 [none] to 200 [severe joint damage]) and erosions of the hands and feet on radiographs, all-cause mortality, and treatment response measured by change in Disease Activity Score based on 28 joint counts and European League Against Rheumatism (EULAR) response. RESULTS Patients with RA and valine at position 11 of HLA-DRB1 had the strongest association with radiological damage (OR, 1.75 [95% CI, 1.51–2.05], P = 4.6E-13). By year 5, the percentages of patients with

  12. Haplotypes composed of minor frequency single nucleotide polymorphisms of the TNF gene protect from progression into sepsis: A study using the new sepsis classification.

    PubMed

    Retsas, Theodoros; Huse, Klaus; Lazaridis, Lazaros-Dimitrios; Karampela, Niki; Bauer, Michael; Platzer, Matthias; Kolonia, Virginia; Papageorgiou, Eirini; Giamarellos-Bourboulis, Evangelos J; Dimopoulos, George

    2018-02-01

    Several articles have provided conflicting results regarding the role of single nucleotide polymorphisms (SNPs) in the promoter region of the TNF gene in susceptibility to sepsis. Former articles have been based on previous definitions of sepsis. This study investigated the influence of TNF haplotypes on the development of sepsis using the new Sepsis-3 definitions. DNA was isolated from patients suffering from infection and systemic inflammatory response syndrome. Haplotyping was performed for six SNPs of TNF. The serum levels of tumour necrosis factor alpha (TNF-α) of these patients were measured using an enzyme immunosorbent assay. Patients were classified into infection and sepsis categories using the Sepsis-3 definitions. Associations between the TNF haplotypes and the clinical characteristics and serum TNF-α levels of the patients were examined. The most common TNF haplotype h1 was composed of major alleles of the studied SNPs. Carriage of haplotypes composed of minor frequency alleles was associated with a lower risk of developing sepsis (odds ratio 0.41, 95% confidence interval 0.19-0.88, p=0.022), but this did not affect the 28-day outcome. Serum TNF-α levels were significantly higher among patients homozygous for h1 haplotypes who developed sepsis compared to infection (p=0.032); a similar result was not observed for patients carrying other haplotypes. Haplotypes containing minor frequency SNP alleles of TNF protect against the development of sepsis without affecting the outcome. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  13. HLA-A, -B, -C, -DRB1 and -DQB1 allele and haplotype frequencies in the Serbian population.

    PubMed

    Andric, Zorana; Popadic, Dusan; Jovanovic, Barbara; Jaglicic, Ivana; Bojic, Svetlana; Simonovic, Ruzica

    2014-03-01

    This study provides the first published detailed analysis of five loci polymorphisms as well as reports of two, three and five loci haplotype frequencies in the Serbian population in a sample of 1992 volunteer bone marrow donors recruited from different part of the country. Typing was performed by PCR SSO method combined with PCR SSP techniques to resolve ambiguities. In total, 16 HLA-A, 28 HLA-B, 14 HLA-C, 13 HLA-DRB1 and 5 HLA-DQB1 allelic groups were identified. The most frequent in allele groups are HLA-A(∗)02 (29.5%), HLA-A(∗)01 (14.2%), HLA-B(∗)35 (13.1%), HLA-B(∗)51 (12.8%), HLA-C(∗)07 (24.8%), HLA-DRB1(∗)11 (16.9%), HLA-DRB1(∗)13 (13.2%), HLA-DQB1(∗)03 (33.3%) and DQB1(∗)05 (33.0%). The most frequent three- and five-loci haplotypes were A(∗)01-B(∗)08-DRB1(∗)03 (5.9%) and A(∗)02-B(∗)18-DRB1(∗)11 (1.9%), A(∗)01-B(∗)08-C(∗)07-DRB1(∗)03-DQB1(∗)02 (6.6%) followed by A(∗)02-B(∗)18-C(∗)07-DRB1(∗)11-DQB1(∗)03 (2.5%), then A(∗)33-B(∗)14-C(∗)08-DRB1(∗)01-DQB1(∗)05 and A(∗)02-B(∗)35-C(∗)04-DRB1(∗)16-DQB1(∗)05 (2.2% both), respectively. The results of cluster analysis showed that the Serbian population is closely related to the populations living in central Balkan and neighboring European regions. The level of allelic diversity found in this study are relevant to facilitate searching for unrelated matched donor and provide a healthy control population from our region that should be useful in the future disease association study. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  14. Spectrally resolved digital holography using a white light LED

    NASA Astrophysics Data System (ADS)

    Claus, D.; Pedrini, G.; Buchta, D.; Osten, W.

    2017-06-01

    This paper introduces the concept of spectrally resolved digital holography. The measurement principle and the analysis of the data will be discussed in detail. The usefulness of spectrally resolved digital holography is demonstrated for colour imaging and optical metrology with regards to the recovery of modulus information and phase information, respectively. The phase information will be used to measure the shape of an object via the application of the dual wavelength method. Based on the large degree of data available, multiple speckle de-correlated dual wavelength phase maps can be obtained, which when averaged result in a signal to noise ratio improvement.

  15. Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.

    PubMed

    Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E

    2009-11-20

    In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply

  16. MDR1 haplotypes derived from exons 21 and 26 do not affect the steady-state pharmacokinetics of tacrolimus in renal transplant patients.

    PubMed

    Mai, Ingrid; Perloff, Elke S; Bauer, Steffen; Goldammer, Mark; Johne, Andreas; Filler, Guido; Budde, Klemens; Roots, Ivar

    2004-11-01

    This retrospective study investigated the influence of MDR1 haplotypes derived from the polymorphisms 2677G > T (exon 21) and 3435C > T (exon 26) on the pharmacokinetics of the immunosuppressant drug tacrolimus in 73 renal transplant patients. Based on both variants of SNPs 2677 and 3435, four different haplotypes and eight different genotypes were identified in the study sample. Tacrolimus trough concentrations (C(0)) were compared between different SNP variants and genotypes, as well as between carriers and noncarriers of each haplotype. Additionally, CYP3A5 genotype (6956G > A) was determined. No significant differences were observed between groups. Differences in mean tacrolimus C(0) values between carriers and noncarriers of each haplotype ranged from -0.04 microg/litre (95% confidence interval: -0.53 to 0.60) to -23 microg/litre (-1.07 to 1.53). No association was found between CYP3A5*1/*3 genotype and tacrolimus Co concentractions. MDR1 haplotypes derived from the SNPs 2677G > T (exon 21) and 3435C > T (exon 26) do not influence the pharmacokinetics of tacrolimus in renal transplant patients.

  17. Risk of Pediatric Celiac Disease According to HLA Haplotype and Country

    PubMed Central

    Liu, Edwin; Lee, Hye-Seung; Aronsson, Carin A.; Hagopian, William A.; Koletzko, Sibylle; Rewers, Marian J.; Eisenbarth, George S.; Bingley, Polly J.; Bonifacio, Ezio; Simell, Ville; Agardh, Daniel

    2014-01-01

    BACKGROUND The presence of HLA haplotype DR3–DQ2 or DR4–DQ8 is associated with an increased risk of celiac disease. In addition, nearly all children with celiac disease have serum antibodies against tissue transglutaminase (tTG). METHODS We studied 6403 children with HLA haplotype DR3–DQ2 or DR4–DQ8 prospectively from birth in the United States, Finland, Germany, and Sweden. The primary end point was the development of celiac disease autoimmunity, which was defined as the presence of tTG antibodies on two consecutive tests at least 3 months apart. The secondary end point was the development of celiac disease, which was defined for the purpose of this study as either a diagnosis on biopsy or persistently high levels of tTG antibodies. RESULTS The median follow-up was 60 months (interquartile range, 46 to 77). Celiac disease autoimmunity developed in 786 children (12%). Of the 350 children who underwent biopsy, 291 had confirmed celiac disease; an additional 21 children who did not undergo biopsy had persistently high levels of tTG antibodies. The risks of celiac disease autoimmunity and celiac disease by the age of 5 years were 11% and 3%, respectively, among children with a single DR3–DQ2 haplotype, and 26% and 11%, respectively, among those with two copies (DR3–DQ2 homozygosity). In the adjusted model, the hazard ratios for celiac disease autoimmunity were 2.09 (95% confidence interval [CI], 1.70 to 2.56) among heterozygotes and 5.70 (95% CI, 4.66 to 6.97) among homozygotes, as compared with children who had the lowest-risk genotypes (DR4–DQ8 heterozygotes or homozygotes). Residence in Sweden was also independently associated with an increased risk of celiac disease autoimmunity (hazard ratio, 1.90; 95% CI, 1.61 to 2.25). CONCLUSIONS Children with the HLA haplotype DR3–DQ2, especially homozygotes, were found to be at high risk for celiac disease autoimmunity and celiac disease early in childhood. The higher risk in Sweden than in other countries

  18. RTEL1 tagging SNPs and haplotypes were associated with glioma development

    PubMed Central

    2013-01-01

    Abstract As glioma ranks as the first most prevalent solid tumors in primary central nervous system, certain single-nucleotide polymorphisms (SNPs) may be related to increased glioma risk, and have implications in carcinogenesis. The present case–control study was carried out to elucidate how common variants contribute to glioma susceptibility. Ten candidate tagging SNPs (tSNPs) were selected from seven genes whose polymorphisms have been proven by classical literatures and reliable databases to be tended to relate with gliomas, and with the minor allele frequency (MAF) > 5% in the HapMap Asian population. The selected tSNPs were genotyped in 629 glioma patients and 645 controls from a Han Chinese population using the multiplexed SNP MassEXTEND assay calibrated. Two significant tSNPs in RTEL1 gene were observed to be associated with glioma risk (rs6010620, P = 0.0016, OR: 1.32, 95% CI: 1.11-1.56; rs2297440, P = 0.001, OR: 1.33, 95% CI: 1.12-1.58) by χ2 test. It was identified the genotype “GG” of rs6010620 acted as the protective genotype for glioma (OR, 0.46; 95% CI, 0.31-0.7; P = 0.0002), while the genotype “CC” of rs2297440 as the protective genotype in glioma (OR, 0.47; 95% CI, 0.31-0.71; P = 0.0003). Furthermore, haplotype “GCT” in RTEL1 gene was found to be associated with risk of glioma (OR, 0.7; 95% CI, 0.57-0.86; Fisher’s P = 0.0005; Pearson’s P = 0.0005), and haplotype “ATT” was detected to be associated with risk of glioma (OR, 1.32; 95% CI, 1.12-1.57; Fisher’s P = 0.0013; Pearson’s P = 0.0013). Two single variants, the genotypes of “GG” of rs6010620 and “CC” of rs2297440 (rs6010620 and rs2297440) in the RTEL1 gene, together with two haplotypes of GCT and ATT, were identified to be associated with glioma development. And it might be used to evaluate the glioma development risks to screen the above RTEL1 tagging SNPs and haplotypes. Virtual slides The virtual slides for this article

  19. Human leukocyte antigen alleles, genotypes and haplotypes frequencies in renal transplant donors and recipients from West Central India.

    PubMed

    Patel, Jaina S; Patel, Manisha M; Koringa, Prakash G; Shah, Tejas M; Patel, Amrutlal K; Tripathi, Ajai K; Mathew, Anila; Rajapurkar, Mohan M; Joshi, Chaitanya G

    2013-04-01

    Human leukocyte antigen (HLA) is comprised of a highly polymorphic set of genes which determines the histocompatibility of organ transplantation. The present study was undertaken to identify HLA class I and class II allele, genotype and haplotype frequencies in renal transplant recipients and donors from West Central India. HLA typing was carried out using Polymerase Chain Reaction-Sequence Specific Primer in 552 live related and unrelated renal transplant recipients and donors. The most frequent HLA class I and class II alleles and their frequencies in recipients were HLA-AFNx0101 (0.1685) and AFNx0102 (0.1649), HLA-BFNx0135 (0.1322), and HLA-DR beta 1 (DRB 1)FNx0115 (0.2192), whereas in donors, these were HLA-AFNx0102 (0.1848) and AFNx0101 (0.1667), HLA-BFNx0135 (0.1359), and HLA-DRB1FNx0115 (0.2409). The two-locus haplotype statistical analysis revealed HLA-AFNx0102-B61 as the most common haplotype with the frequency of 0.0487 and 0.0510 in recipients and donors, respectively. Further, among the three locus haplotypes HLA-AFNx0133-BFNx0144-DRB1FNx0107 and HLA-AFNx0102-BFNx0161-DRB1FNx0115 were the most common haplotypes with frequencies 0.0362 and 0.0326, respectively in recipients and 0.0236 and 0.0323, respectively in donors. Genotype frequency revealed a high prevalence of genotype HLA-AFNx0102/AFNx0124 in recipients (0.058) compared to donors (0.0109) whereas low prevalence of HLA-AFNx0101/AFNx0102 in recipients (0.0435) than in donors (0.0797). The phylogenetic and principal component analysis of HLA allele and haplotype frequency distribution revealed genetic similarities of various ethnic groups. Further, case control analysis provides preliminary evidence of association of HLA-A genotype (P < 0.05) with renal failure. This study will be helpful in suitable donor search besides providing valuable information for population genetics and HLA disease association analysis.

  20. Analysis of extended human leukocyte antigen haplotype association with Addison's disease in three populations.

    PubMed

    Gombos, Z; Hermann, R; Kiviniemi, M; Nejentsev, S; Reimand, K; Fadeyev, V; Peterson, P; Uibo, R; Ilonen, J

    2007-12-01

    Addison's disease is an organ-specific autoimmune disorder with a polygenic background. The aim of the study was to identify non-class II human leukocyte antigen (HLA) susceptibility genes for Addison's disease. Addison's disease patients from three European populations were analysed for selected HLA-DR-DQ alleles and for 11 microsatellite markers covering approximately 4 Mb over the HLA region. Subjects were 69 patients with Addison's disease from Estonia (24), Finland (14) and Russia (31). Consecutively recruited healthy newborns from the same geographical regions were used as controls (269 Estonian, 1000 Finnish and 413 Russian). Association measures for HLA-DRB1, DQB1, DQA1 and 11 microsatellites between D6S273 and D6S2223 were taken. A low-resolution full-house typing was used for HLA class II genes, while microsatellite markers were studied using fluorescence-based DNA fragment sizing technology. We confirmed that the HLA-DR3-DQ2 and the DQB1*0302-DRB1*0404 haplotypes confer disease susceptibility. In Russian patients, we also found an increase of DRB1*0403 allele, combined with DQB1*0305 allele in three out of six cases (P<0.0001). Analysis of 11 microsatellite markers including STR MICA confirmed the strong linkage in DR3-DQ2 haplotypes but DRB1*0404-DQB1*0302 haplotypes were diverse. MICA5.1 allele was found in 22 out of 24 Estonian patients, but results from Finnish and Russian patients did not support its independent role in disease susceptibility. HLA-DRB1*0403 was identified as a novel susceptibility allele for Addison's disease. Additionally, we found no evidence of a non-class II HLA disease susceptibility locus; however, the HLA-DR3-DQ2 haplotype appeared more conserved in patient groups with high DR-DQ2 frequencies.

  1. [Association between CETP polymorphisms and haplotypes with dyslipidemia in Xinjiang Uygur and Kazak residents].

    PubMed

    Hu, Y H; Liu, J M; Zhang, M; He, J; Yan, Y Z; Ma, J L; Ma, R L; Guo, H; Rui, D S; Sun, F; Mu, L L; Niu, Q; Ding, Y S; Zhang, J Y; Li, S G; Guo, S X

    2016-08-24

    To explore the relationship between the polymorphisms and haplotypes in the CETP gene and dyslipidemia among Xinjiang Kazak and Uygur residents. A population status survey was performed from 2010 to 2011 in Kashgar Xinjiang Uygur and Kazak residents, stratified cluster sampling method was used to select Uygur, Kazak residents with abnormal blood lipid values (n=367 and 345, respectively) as the dyslipidemia groups, and to select residents with normal lipid values as control group from the same area (n=374 and 390, respectively). SNaPshot technology was applied to detect the DNA of CETP gene rs3764261, rs1800775, rs708272 and rs5882 loci in all selected residents, and linkage disequilibrium analysis and haplotype construction were performed. (1) In Uygur residents, the dyslipidemia risk of rs708272 CT (OR=0.64, 95%CI 0.46-0.91, P=0.01) and TT genotype (OR=0.60, 95%CI 0.40-0.91, P=0.02) was significantly lower than CC genotype. Dyslipidemia risk of rs3764261 GT (OR=0.55, 95%CI 0.40-0.74, P=0.00) and TT genotype (OR=0.47, 95%CI 0.28-0.78, P<0.01) was significantly lower than GG genetype. Dyslipidemia risk of the rs1800775 CC genotype was higher than AA genotype (OR=1.79, 95%CI 1.17-2.74, P=0.01). There was no statistical significance in CETP gene of the 4 genotype and allele frequency between the dyslipidemia and normal lipid groups in Kazak residents (all P>0.05). (2) In Uighur residents with dyslipidemia, HDL-C level was significantly higher in rs708272 TT genotype carriers than in CC and CT genotypes (all P<0.05) and in rs3764261 TT genotype carriers than in GG genotype carriers (P=0.008), while was significantly lower in rs1800775 CC genotype carriers with AA genotype carriers (P=0.008). (3) Linkage disequilibrium analysis showed that there was strong linkage disequilibrium between rs3764261 and rs708272 (D'=0.869, r(2)=0.869), rs1800775 and rs708272 (D'=0.845, r(2)=0.446) in Uighur residents, and there was strong linkage disequilibrium between rs3764261 and rs

  2. Toll-like receptor 4 polymorphisms and their haplotypes modulate the risk of developing diabetic retinopathy in type 2 diabetes patients

    PubMed Central

    Singh, Kanhaiya; Kant, Shri; Singh, Vivek Kumar; Agrawal, Neeraj K.; Gupta, Sanjeev K.

    2014-01-01

    Purpose Persistent inflammation and impaired neovascularization in type 2 diabetes mellitus (T2DM) patients may lead to development of macro- and microvascular complications. Diabetic retinopathy (DR) is one of the secondary microvascular complications of T2DM. Improper activation of the innate immune system may be an important contributor in the pathophysiology of DR. Toll-like receptor 4 (TLR4) is an important mediator of innate immunity, and genetic alterations in TLR4 support inflammation in the hyperglycemic condition. The present work was designed to investigate whether the TLR4 single nucleotide polymorphisms (SNPs) rs4986790, rs4986791, rs10759931, rs1927911, and rs1927914 are associated with DR in a north Indian population. Methods The study group of 698 individuals (128 DR, 250 T2DM, 320 controls) was genotyped by PCR-RFLP. Haplotype and linkage disequilibrium between SNPs were determined using Haploview software. Results Combined risk genotypes of TLR4 SNPs rs10759931 (odds ratio [OR] 1.50, p = 0.05) and rs1927914 (OR 1.48, p = 0.05) were found to be significantly associated with pathogenesis of DR. A total of 14 haplotypes with frequency >1% were obtained using Haploview software. Haplotypes ACATC (37.5%) and ACATT (14.8%) were the two most common haplotypes obtained. Conclusions Results of the present case-control study that included 698 north Indian subjects suggested that TLR4 SNPs rs10759931 and rs1927914 modulate the risk of DR in T2DM cases. Association analysis using haplotypes showed none of the haplotypes were associated with either susceptibility or resistance to DR in a north Indian population. PMID:24883015

  3. Brain white matter development is associated with a human-specific haplotype increasing the synthesis of long chain fatty acids.

    PubMed

    Peters, Bart D; Voineskos, Aristotle N; Szeszko, Philip R; Lett, Tristram A; DeRosse, Pamela; Guha, Saurav; Karlsgodt, Katherine H; Ikuta, Toshikazu; Felsky, Daniel; John, Majnu; Rotenberg, David J; Kennedy, James L; Lencz, Todd; Malhotra, Anil K

    2014-04-30

    The genetic and molecular pathways driving human brain white matter (WM) development are only beginning to be discovered. Long chain polyunsaturated fatty acids (LC-PUFAs) have been implicated in myelination in animal models and humans. The biosynthesis of LC-PUFAs is regulated by the fatty acid desaturase (FADS) genes, of which a human-specific haplotype is strongly associated with ω-3 and ω-6 LC-PUFA concentrations in blood. To investigate the relationship between LC-PUFA synthesis and human brain WM development, we examined whether this FADS haplotype is associated with age-related WM differences across the life span in healthy individuals 9-86 years of age (n = 207). Diffusion tensor imaging was performed to measure fractional anisotropy (FA), a putative measure of myelination, of the cerebral WM tracts. FADS haplotype status was determined with a single nucleotide polymorphism (rs174583) that tags this haplotype. Overall, normal age-related WM differences were observed, including higher FA values in early adulthood compared with childhood, followed by lower FA values across older age ranges. However, individuals homozygous for the minor allele (associated with lower LC-PUFA concentrations) did not display these normal age-related WM differences (significant age × genotype interactions, p(corrected) < 0.05). These findings suggest that LC-PUFAs are involved in human brain WM development from childhood into adulthood. This haplotype and LC-PUFAs may play a role in myelin-related disorders of neurodevelopmental origin.

  4. Genome Patterns of Selection and Introgression of Haplotypes in Natural Populations of the House Mouse (Mus musculus)

    PubMed Central

    Staubach, Fabian; Lorenc, Anna; Messer, Philipp W.; Tang, Kun; Petrov, Dmitri A.; Tautz, Diethard

    2012-01-01

    General parameters of selection, such as the frequency and strength of positive selection in natural populations or the role of introgression, are still insufficiently understood. The house mouse (Mus musculus) is a particularly well-suited model system to approach such questions, since it has a defined history of splits into subspecies and populations and since extensive genome information is available. We have used high-density single-nucleotide polymorphism (SNP) typing arrays to assess genomic patterns of positive selection and introgression of alleles in two natural populations of each of the subspecies M. m. domesticus and M. m. musculus. Applying different statistical procedures, we find a large number of regions subject to apparent selective sweeps, indicating frequent positive selection on rare alleles or novel mutations. Genes in the regions include well-studied imprinted loci (e.g. Plagl1/Zac1), homologues of human genes involved in adaptations (e.g. alpha-amylase genes) or in genetic diseases (e.g. Huntingtin and Parkin). Haplotype matching between the two subspecies reveals a large number of haplotypes that show patterns of introgression from specific populations of the respective other subspecies, with at least 10% of the genome being affected by partial or full introgression. Using neutral simulations for comparison, we find that the size and the fraction of introgressed haplotypes are not compatible with a pure migration or incomplete lineage sorting model. Hence, it appears that introgressed haplotypes can rise in frequency due to positive selection and thus can contribute to the adaptive genomic landscape of natural populations. Our data support the notion that natural genomes are subject to complex adaptive processes, including the introgression of haplotypes from other differentiated populations or species at a larger scale than previously assumed for animals. This implies that some of the admixture found in inbred strains of mice may also have

  5. IRF5 haplotypes demonstrate diverse serological associations which predict serum interferon alpha activity and explain the majority of the genetic association with systemic lupus erythematosus

    PubMed Central

    Niewold, Timothy B; Kelly, Jennifer A; Kariuki, Silvia N; Franek, Beverly S; Kumar, Akaash A; Kaufman, Kenneth M; Thomas, Kenaz; Walker, Daniel; Kamp, Stan; Frost, Jacqueline M; Wong, Andrew K; Merrill, Joan T; Alarcón-Riquelme, Marta E; Tikly, Mohammed; Ramsey-Goldman, Rosalind; Reveille, John D; Petri, Michelle A; Edberg, Jeffrey C; Kimberly, Robert P; Alarcón, Graciela S; Kamen, Diane L; Gilkeson, Gary S; Vyse, Timothy J; James, Judith A; Gaffney, Patrick M; Moser, Kathy L; Crow, Mary K; Harley, John B

    2012-01-01

    Objective High serum interferon α (IFNα) activity is a heritable risk factor for systemic lupus erythematosus (SLE). Auto-antibodies found in SLE form immune complexes which can stimulate IFNα production by activating endosomal Toll-like receptors and interferon regulatory factors (IRFs), including IRF5. Genetic variation in IRF5 is associated with SLE susceptibility; however, it is unclear how IRF5 functional genetic elements contribute to human disease. Methods 1034 patients with SLE and 989 controls of European ancestry, 555 patients with SLE and 679 controls of African–American ancestry, and 73 patients with SLE of South African ancestry were genotyped at IRF5 polymorphisms, which define major haplotypes. Serum IFNα activity was measured using a functional assay. Results In European ancestry subjects, anti-double-stranded DNA (dsDNA) and anti-Ro antibodies were each associated with different haplotypes characterised by a different combination of functional genetic elements (OR > 2.56, p >003C; 1.9×10−14 for both). These IRF5 haplotype-auto-antibody associations strongly predicted higher serum IFNα in patients with SLE and explained > 70% of the genetic risk of SLE due to IRF5. In African–American patients with SLE a similar relationship between serology and IFNα was observed, although the previously described European ancestry-risk haplotype was present at admixture proportions in African–American subjects and absent in African patients with SLE. Conclusions The authors define a novel risk haplotype of IRF5 that is associated with anti-dsDNA antibodies and show that risk of SLE due to IRF5 genotype is largely dependent upon particular auto-antibodies. This suggests that auto-antibodies are directly pathogenic in human SLE, resulting in increased IFNα in cooperation with particular combinations of IRF5 functional genetic elements. SLE is a systemic autoimmune disorder affecting multiple organ systems including the skin, musculoskeletal, renal and

  6. Musical Aptitude Is Associated with AVPR1A-Haplotypes

    PubMed Central

    Ukkola, Liisa T.; Onkamo, Päivi; Raijas, Pirre; Karma, Kai; Järvelä, Irma

    2009-01-01

    Artistic creativity forms the basis of music culture and music industry. Composing, improvising and arranging music are complex creative functions of the human brain, which biological value remains unknown. We hypothesized that practicing music is social communication that needs musical aptitude and even creativity in music. In order to understand the neurobiological basis of music in human evolution and communication we analyzed polymorphisms of the arginine vasopressin receptor 1A (AVPR1A), serotonin transporter (SLC6A4), catecol-O-methyltranferase (COMT), dopamin receptor D2 (DRD2) and tyrosine hydroxylase 1 (TPH1), genes associated with social bonding and cognitive functions in 19 Finnish families (n = 343 members) with professional musicians and/or active amateurs. All family members were tested for musical aptitude using the auditory structuring ability test (Karma Music test; KMT) and Carl Seashores tests for pitch (SP) and for time (ST). Data on creativity in music (composing, improvising and/or arranging music) was surveyed using a web-based questionnaire. Here we show for the first time that creative functions in music have a strong genetic component (h2 = .84; composing h2 = .40; arranging h2 = .46; improvising h2 = .62) in Finnish multigenerational families. We also show that high music test scores are significantly associated with creative functions in music (p<.0001). We discovered an overall haplotype association with AVPR1A gene (markers RS1 and RS3) and KMT (p = 0.0008; corrected p = 0.00002), SP (p = 0.0261; corrected p = 0.0072) and combined music test scores (COMB) (p = 0.0056; corrected p = 0.0006). AVPR1A haplotype AVR+RS1 further suggested a positive association with ST (p = 0.0038; corrected p = 0.00184) and COMB (p = 0.0083; corrected p = 0.0040) using haplotype-based association test HBAT. The results suggest that the neurobiology of music perception and production is likely to be

  7. The discrete Laplace exponential family and estimation of Y-STR haplotype frequencies.

    PubMed

    Andersen, Mikkel Meyer; Eriksen, Poul Svante; Morling, Niels

    2013-07-21

    Estimating haplotype frequencies is important in e.g. forensic genetics, where the frequencies are needed to calculate the likelihood ratio for the evidential weight of a DNA profile found at a crime scene. Estimation is naturally based on a population model, motivating the investigation of the Fisher-Wright model of evolution for haploid lineage DNA markers. An exponential family (a class of probability distributions that is well understood in probability theory such that inference is easily made by using existing software) called the 'discrete Laplace distribution' is described. We illustrate how well the discrete Laplace distribution approximates a more complicated distribution that arises by investigating the well-known population genetic Fisher-Wright model of evolution by a single-step mutation process. It was shown how the discrete Laplace distribution can be used to estimate haplotype frequencies for haploid lineage DNA markers (such as Y-chromosomal short tandem repeats), which in turn can be used to assess the evidential weight of a DNA profile found at a crime scene. This was done by making inference in a mixture of multivariate, marginally independent, discrete Laplace distributions using the EM algorithm to estimate the probabilities of membership of a set of unobserved subpopulations. The discrete Laplace distribution can be used to estimate haplotype frequencies with lower prediction error than other existing estimators. Furthermore, the calculations could be performed on a normal computer. This method was implemented in the freely available open source software R that is supported on Linux, MacOS and MS Windows. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Acute chest syndrome is associated with single nucleotide polymorphism-defined beta globin cluster haplotype in children with sickle cell anaemia

    PubMed Central

    Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.

    2013-01-01

    Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145

  9. Myopia and Late-Onset Progressive Cone Dystrophy Associate to LVAVA/MVAVA Exon 3 Interchange Haplotypes of Opsin Genes on Chromosome X.

    PubMed

    Orosz, Orsolya; Rajta, István; Vajas, Attila; Takács, Lili; Csutak, Adrienne; Fodor, Mariann; Kolozsvári, Bence; Resch, Miklós; Sényi, Katalin; Lesch, Balázs; Szabó, Viktória; Berta, András; Balogh, István; Losonczy, Gergely

    2017-03-01

    Rare interchange haplotypes in exon 3 of the OPN1LW and OPN1MW opsin genes cause X-linked myopia, color vision defect, and cone dysfunction. The severity of the disease varies on a broad scale from nonsyndromic high myopia to blue cone monochromatism. Here, we describe a new genotype-phenotype correlation attributed to rare exon 3 interchange haplotypes simultaneously present in the long- and middle-wavelength sensitive opsin genes (L- and M-opsin genes). A multigenerational family with X-linked high myopia and cone dystrophy was investigated. Affected male patients had infantile onset myopia with normal visual acuity and color vision until their forties. Visual acuity decreased thereafter, along with the development of severe protan and deutan color vision defects. A mild decrease in electroretinography response of cone photoreceptors was detected in childhood, which further deteriorated in middle-aged patients. Rods were also affected, however, to a lesser extent than cones. Clinical exome sequencing identified the LVAVA and MVAVA toxic haplotypes in the OPN1LW and OPN1MW opsin genes, respectively. Here, we show that LVAVA haplotype of the OPN1LW gene and MVAVA haplotype of the OPN1MW gene cause apparently nonsyndromic high myopia in young patients but lead to progressive cone-rod dystrophy with deuteranopia and protanopia in middle-aged patients corresponding to a previously unknown disease course. To the best of our knowledge, this is the first report on the joint effect of these toxic haplotypes in the two opsin genes on chromosome X.

  10. Genomic association for sexual precocity in beef heifers using pre-selection of genes and haplotype reconstruction

    PubMed Central

    Barbero, Marina M. D.; Oliveira, Henrique N.; de Camargo, Gregório M. F.; Fernandes Júnior, Gerardo A.; Aspilcueta-Borquis, Rusbel R.; Souza, Fabio R. P.; Boligon, Arione A.; Melo, Thaise P.; Regatieri, Inaê C.; Feitosa, Fabieli L. B.; Fonseca, Larissa F. S.; Magalhães, Ana F. B.; Costa, Raphael B.; Albuquerque, Lucia G.

    2018-01-01

    Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs. PMID:29293544

  11. Genomic association for sexual precocity in beef heifers using pre-selection of genes and haplotype reconstruction.

    PubMed

    Takada, Luciana; Barbero, Marina M D; Oliveira, Henrique N; de Camargo, Gregório M F; Fernandes Júnior, Gerardo A; Aspilcueta-Borquis, Rusbel R; Souza, Fabio R P; Boligon, Arione A; Melo, Thaise P; Regatieri, Inaê C; Feitosa, Fabieli L B; Fonseca, Larissa F S; Magalhães, Ana F B; Costa, Raphael B; Albuquerque, Lucia G

    2018-01-01

    Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs.

  12. Compound Heterozygosity for Null Mutations and a Common Hypomorphic Risk Haplotype in TBX6 Causes Congenital Scoliosis.

    PubMed

    Takeda, Kazuki; Kou, Ikuyo; Kawakami, Noriaki; Iida, Aritoshi; Nakajima, Masahiro; Ogura, Yoji; Imagawa, Eri; Miyake, Noriko; Matsumoto, Naomichi; Yasuhiko, Yukuto; Sudo, Hideki; Kotani, Toshiaki; Nakamura, Masaya; Matsumoto, Morio; Watanabe, Kota; Ikegawa, Shiro

    2017-03-01

    Congenital scoliosis (CS) occurs as a result of vertebral malformations and has an incidence of 0.5-1/1,000 births. Recently, TBX6 on chromosome 16p11.2 was reported as a disease gene for CS; about 10% of Chinese CS patients were compound heterozygotes for rare null mutations and a common haplotype defined by three SNPs in TBX6. All patients had hemivertebrae. We recruited 94 Japanese CS patients, investigated the TBX6 locus for both mutations and the risk haplotype, examined transcriptional activities of mutant TBX6 in vitro, and evaluated clinical and radiographic features. We identified TBX6 null mutations in nine patients, including a missense mutation that had a loss of function in vitro. All had the risk haplotype in the opposite allele. One of the mutations showed dominant negative effect. Although all Chinese patients had one or more hemivertebrae, two Japanese patients did not have hemivertebra. The compound heterozygosity of null mutations and the common risk haplotype in TBX6 also causes CS in Japanese patients with similar incidence. Hemivertebra was not a specific type of spinal malformation in TBX6-associated CS (TACS). A heterozygous TBX6 loss-of-function mutation has been reported in a family with autosomal-dominant spondylocostal dysostosis, but it may represent a spectrum of the same disease with TACS. © 2017 WILEY PERIODICALS, INC.

  13. Nonhomologous Pairing in Mice Heterozygous for a t Haplotype Can Produce Recombinant Chromosomes with Duplications and Deletions

    PubMed Central

    Sarvetnick, Nora; Fox, Howard S.; Mann, Elizabeth; Mains, Paul E.; Elliott, Rosemary W.; Silver, Lee M.

    1986-01-01

    We have investigated the structure and properties of a chromosomal product recovered from a rare recombination event between a t haplotype and a wild-type form of mouse chromosome 17. Our embryological and molecular studies indicate that this chromosome (twLub2 ) is characterized by both a deletion and duplication of adjacent genetic material. The deletion appears to be responsible for a dominant lethal maternal effect and a recessive embryonic lethality. The duplication provides an explanation for the twLub2 suppression of the dominant T locus phenotype. A reanalysis of previously described results with another chromosome 17 variant called TtOrl indicates a structure for this chromosome that is reciprocal to that observed for twLub2. We have postulated the existence of an inversion over the proximal portion of all complete t haplotypes in order to explain the generation of the partial t haplotypes t wLub2 and TtOrl. This proximal inversion and the previously described distal inversion are sufficient to account for all of the recombination properties that are characteristic of complete t haplotypes. The structures determined for twLub2 and TtOrl indicate that rare recombination can occur between nonequivalent genomic sequences within the inverted proximal t region when wild-type and t chromosomes are paired in a linear, nonhomologous configuration. PMID:3732789

  14. No evidence for MHC class II-based non-random mating at the gametic haplotype in Atlantic salmon.

    PubMed

    Promerová, M; Alavioon, G; Tusso, S; Burri, R; Immler, S

    2017-06-01

    Genes of the major histocompatibility complex (MHC) are a likely target of mate choice because of their role in inbreeding avoidance and potential benefits for offspring immunocompetence. Evidence for female choice for complementary MHC alleles among competing males exists both for the pre- and the postmating stages. However, it remains unclear whether the latter may involve non-random fusion of gametes depending on gametic haplotypes resulting in transmission ratio distortion or non-random sequence divergence among fused gametes. We tested whether non-random gametic fusion of MHC-II haplotypes occurs in Atlantic salmon Salmo salar. We performed in vitro fertilizations that excluded interindividual sperm competition using a split family design with large clutch sample sizes to test for a possible role of the gametic haplotype in mate choice. We sequenced two MHC-II loci in 50 embryos per clutch to assess allelic frequencies and sequence divergence. We found no evidence for transmission ratio distortion at two linked MHC-II loci, nor for non-random gamete fusion with respect to MHC-II alleles. Our findings suggest that the gametic MHC-II haplotypes play no role in gamete association in Atlantic salmon and that earlier findings of MHC-based mate choice most likely reflect choice among diploid genotypes. We discuss possible explanations for these findings and how they differ from findings in mammals.

  15. Large variation in mitochondrial DNA of sexual and parthenogenetic Dahlica triquetrella (Lepidoptera: Psychidae) shows multiple origins of parthenogenesis

    PubMed Central

    2013-01-01

    Background Obligate parthenogenesis is relatively rare in animals. Still, in some groups it is quite common and has evolved and persisted multiple times. These groups may provide important clues to help solve the ‘paradox of sex’. Several species in the Psychidae (Lepidoptera) have obligate parthenogenesis. Dahlica triquetrella is one of those species where multiple transitions to parthenogenesis are postulated based on intensive cytological and behavioural studies. This has led to the hypothesis that multiple transitions from sexuals to diploid parthenogens occurred during and after the last glacial period, followed by transitions from parthenogenetic diploids to parthenogenetic tetraploids. Our study is the first to test these hypotheses using a molecular phylogeny based on mtDNA from multiple sexual and parthenogenetic populations from a wide geographic range. Results Parthenogenetic (and sexual) D. triquetrella are not monophyletic, and considerable sequence variation is present suggesting multiple transitions to parthenogenesis. However, we could not establish ancestral sexual haplotypes from our dataset. Our data suggest that some parthenogenetic clades have evolved, indicating origins of parthenogenesis before the last glacial period. Conclusions Multiple transitions to parthenogenesis have taken place in Dahlica triquetrella, confirming previous hypotheses. The number of different parthenogenetic clades, haplotypes and their apparent evolutionary age, clearly show that parthenogenesis has been a very successful reproductive strategy in this species over a long period. PMID:23622052

  16. Discovery of novel MHC-class I alleles and haplotypes in Filipino cynomolgus macaques (Macaca fascicularis) by pyrosequencing and Sanger sequencing: Mafa-class I polymorphism.

    PubMed

    Shiina, Takashi; Yamada, Yukiho; Aarnink, Alice; Suzuki, Shingo; Masuya, Anri; Ito, Sayaka; Ido, Daisuke; Yamanaka, Hisashi; Iwatani, Chizuru; Tsuchiya, Hideaki; Ishigaki, Hirohito; Itoh, Yasushi; Ogasawara, Kazumasa; Kulski, Jerzy K; Blancher, Antoine

    2015-10-01

    Although the low polymorphism of the major histocompatibility complex (MHC) transplantation genes in the Filipino cynomolgus macaque (Macaca fascicularis) is expected to have important implications in the selection and breeding of animals for medical research, detailed polymorphism information is still lacking for many of the duplicated class I genes. To better elucidate the degree and types of MHC polymorphisms and haplotypes in the Filipino macaque population, we genotyped 127 unrelated animals by the Sanger sequencing method and high-resolution pyrosequencing and identified 112 different alleles, 28 at cynomolgus macaque MHC (Mafa)-A, 54 at Mafa-B, 12 at Mafa-I, 11 at Mafa-E, and seven at Mafa-F alleles, of which 56 were newly described. Of them, the newly discovered Mafa-A8*01:01 lineage allele had low nucleotide similarities (<86%) with primate MHC class I genes, and it was also conserved in the Vietnamese and Indonesian populations. In addition, haplotype estimations revealed 17 Mafa-A, 23 Mafa-B, and 12 Mafa-E haplotypes integrated with 84 Mafa-class I haplotypes and Mafa-F alleles. Of these, the two Mafa-class I haplotypes, F/A/E/B-Hp1 and F/A/E/B-Hp2, had the highest haplotype frequencies at 10.6 and 10.2%, respectively. This suggests that large scale genetic screening of the Filipino macaque population would identify these and other high-frequency Mafa-class I haplotypes that could be used as MHC control animals for the benefit of biomedical research.

  17. Reducing animal sequencing redundancy by preferentially selecting animals with low-frequency haplotypes

    USDA-ARS?s Scientific Manuscript database

    Many studies leverage targeted whole genome sequencing (WGS) experiments in order to identify rare and causal variants within populations. As a natural consequence of experimental design, many of these surveys tend to sequence redundant haplotype segments due to high frequency in the base population...

  18. High-resolution HLA-A, HLA-B, and HLA-DRB1 haplotype frequencies from the French Bone Marrow Donor Registry.

    PubMed

    Gourraud, Pierre-Antoine; Pappas, Derek James; Baouz, Amar; Balère, Marie-Lorraine; Garnier, Federico; Marry, Evelyne

    2015-05-01

    We have estimated human leukocyte antigen (HLA) haplotype frequencies using the maximum likelihood mode, which accommodates typing ambiguities. The results of the frequency distribution of the 7015 haplotypes obtained are presented here. These include a total of 114 HLA-A, 185 HLA-B, and 76 HLA-DRB1 unique alleles at each locus. Across all populations, although the most common individual HLA alleles were HLA-A(∗)02:01 (29.0%), HLA-B(∗)07:02 (11.4%), and HLA-DRB1(∗)07:01 (15.9%), the most frequent haplotype was found to be HLA-A(∗)01:01∼B(∗)08:01∼DRB1(∗)03:01. Copyright © 2015 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  19. Understanding healthcare professionals' self-efficacy to resolve interprofessional conflict.

    PubMed

    Sexton, Martha; Orchard, Carole

    2016-05-01

    Conflict within interprofessional healthcare teams, when not effectively resolved, has been linked to detrimental consequences; however, effective conflict resolution has been shown to enhance team performance, increase patient safety, and improve patient outcomes. Alarmingly, knowledge of healthcare professionals' ability to resolve conflict has been limited, largely due to the challenges that arise when researchers attempt to observe a conflict occurring in real time. Research literature has identified three central components that seem to influence healthcare professional's perceived ability to resolve conflict: communication competence, problem-solving ability, and conflict resolution education and training. The purpose of this study was to investigate the impact of communication competence, problem-solving ability, and conflict resolution education and training on healthcare professionals' perceived ability to resolve conflicts. This study employed a cross-sectional survey design. Multiple regression analyses demonstrated that two of the three central components-conflict resolution education and training and communication competence-were found to be statistically significant predictors of healthcare professionals' perceived ability to resolve conflict. Implications include a call to action for clinicians and academicians to recognize the importance of communication competence and conflict resolution education and training as a vital area in interprofessional pre- and post-licensure education and collaborative practice.

  20. Haplotypes in the APOA1-C3-A4-A5 gene cluster affect plasma lipids in both humans and baboons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Qian-fei; Liu, Xin; O'Connell, Jeff

    2003-09-15

    Genetic studies in non-human primates serve as a potential strategy for identifying genomic intervals where polymorphisms impact upon human disease-related phenotypes. It remains unclear, however, whether independently arising polymorphisms in orthologous regions of non-human primates leads to similar variation in a quantitative trait found in both species. To explore this paradigm, we studied a baboon apolipoprotein gene cluster (APOA1/C3/A4/A5) for which the human gene orthologs have well established roles in influencing plasma HDL-cholesterol and triglyceride concentrations. Our extensive polymorphism analysis of this 68 kb gene cluster in 96 pedigreed baboons identified several haplotype blocks each with limited diversity, consistent withmore » haplotype findings in humans. To determine whether baboons, like humans, also have particular haplotypes associated with lipid phenotypes, we genotyped 634 well characterized baboons using 16 haplotype tagging SNPs. Genetic analysis of single SNPs, as well as haplotypes, revealed an association of APOA5 and APOC3 variants with HDL cholesterol and triglyceride concentrations, respectively. Thus, independent variation in orthologous genomic intervals does associate with similar quantitative lipid traits in both species, supporting the possibility of uncovering human QTL genes in a highly controlled non-human primate model.« less

  1. The influence of casein haplotype on morphometric characteristics of fat globules and fatty acid composition of milk in Italian Holstein cows.

    PubMed

    Perna, Annamaria; Intaglietta, Immacolata; Simonetti, Amalia; Gambacorta, Emilio

    2016-04-01

    The aim of this work was to investigate the effect of casein haplotypes (αS1-, β-, and κ-caseins) on morphometric characteristics of fat globules and fatty acid composition of Italian Holstein milk. Casein haplotypes were determined by isoelectric focusing; milk fat globule size was measured by using a fluorescence microscope; and fatty acid profile was determined by gas chromatography. Casein haplotype significantly affected the fat globule size, the percentage incidence of each globule size class on total measured milk fat globules, and fatty acid composition. A higher incidence of smaller milk fat globules was associated with the BB-A(2)A(2)-BB genotype (αS1-, β-, and κ-casein haplotypes, respectively), whereas small globules were not detected in BB-A(2)A(1)-AA milk, but that milk had the highest percentage of large globules. A higher content of monounsaturated fatty acids was associated with the BB-A(2)A(2)-AB genotype, whereas higher contents of conjugated linoleic acid and docosahexaenoic acid were detected in BB-A(1)A(1)-AA milk. Our results indicate that casein haplotype could affect fat characteristics and, therefore, the nutritional and technological quality of milk. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. The advantages of haplotype analysis of the promoter region of the human apolipoprotein E gene.

    PubMed

    McLaughlin, D P; Sharma, A; McGinley, A; Samra, G S

    2001-12-15

    Polymorphisms in the regulatory region of the human apolipoprotein E gene (gene, APOE; protein, apoE) have been implicated in Alzheimer's disease. Here we describe in detail the advantages of a simple method for haplotype analysis of this region (at -491 and -427 bases relative to the transcription start site of the gene). The promoter region of the APOE gene was amplified by polymerase chain reaction (PCR) and this fragment was then used as a template for PCR with "nested" primers to generate a 228-bp product incorporating both the -491 and the -427 loci. PCR products were then digested with DraI and AluI together and subjected to polyacrylamide gel electrophoresis. The distinct pattern of bands appearing on the gel was then used to ascribe [-491,-427] haplotypes to each subject, from which -491 and -427 genotypes were inferred. -491 and -427 genotypes were also confirmed by digestion with DraI alone or AluI alone. Haplotype analysis was successful in all 20 samples analyzed and was 100% consistent with genotyping. We suggest that this is a reliable, time-saving method that the will be useful in large-scale APOE promoter genotyping studies. (c)2001 Elsevier Science.

  3. Exploring and Harnessing Haplotype Diversity to Improve Yield Stability in Crops.

    PubMed

    Qian, Lunwen; Hickey, Lee T; Stahl, Andreas; Werner, Christian R; Hayes, Ben; Snowdon, Rod J; Voss-Fels, Kai P

    2017-01-01

    In order to meet future food, feed, fiber, and bioenergy demands, global yields of all major crops need to be increased significantly. At the same time, the increasing frequency of extreme weather events such as heat and drought necessitates improvements in the environmental resilience of modern crop cultivars. Achieving sustainably increase yields implies rapid improvement of quantitative traits with a very complex genetic architecture and strong environmental interaction. Latest advances in genome analysis technologies today provide molecular information at an ultrahigh resolution, revolutionizing crop genomic research, and paving the way for advanced quantitative genetic approaches. These include highly detailed assessment of population structure and genotypic diversity, facilitating the identification of selective sweeps and signatures of directional selection, dissection of genetic variants that underlie important agronomic traits, and genomic selection (GS) strategies that not only consider major-effect genes. Single-nucleotide polymorphism (SNP) markers today represent the genotyping system of choice for crop genetic studies because they occur abundantly in plant genomes and are easy to detect. SNPs are typically biallelic, however, hence their information content compared to multiallelic markers is low, limiting the resolution at which SNP-trait relationships can be delineated. An efficient way to overcome this limitation is to construct haplotypes based on linkage disequilibrium, one of the most important features influencing genetic analyses of crop genomes. Here, we give an overview of the latest advances in genomics-based haplotype analyses in crops, highlighting their importance in the context of polyploidy and genome evolution, linkage drag, and co-selection. We provide examples of how haplotype analyses can complement well-established quantitative genetics frameworks, such as quantitative trait analysis and GS, ultimately providing an effective tool

  4. Mice, humans and haplotypes--the hunt for disease genes in SLE.

    PubMed

    Rigby, R J; Fernando, M M A; Vyse, T J

    2006-09-01

    Defining the polymorphisms that contribute to the development of complex genetic disease traits is a challenging, although increasingly tractable problem. Historically, the technical difficulties in conducting association studies across the entire human genome are such that murine models have been used to generate candidate genes for analysis in human complex diseases, such as SLE. In this article we discuss the advantages and disadvantages of this approach and specifically address some assumptions made in the transition from studying one species to another, using lupus as an example. These issues include differences in genetic structure and genetic organisation which are a reflection on the population history. Clearly there are major differences in the histories of the human population and inbred laboratory strains of mice. Both human and murine genomes do exhibit structure at the genetic level. That is to say, they comprise haplotypes which are genomic regions that carry runs of polymorphisms that are not independently inherited. Haplotypes therefore reduce the number of combinations of the polymorphisms in the DNA in that region and facilitate the identification of disease susceptibility genes in both mice and humans. There are now novel means of generating candidate genes in SLE using mutagenesis (with ENU) in mice and identifying mice that generate antinuclear autoimmunity. In addition, murine models still provide a valuable means of exploring the functional consequences of genetic variation. However, advances in technology are such that human geneticists can now screen large fractions of the human genome for disease associations using microchip technologies that provide information on upwards of 100,000 different polymorphisms. These approaches are aimed at identifying haplotypes that carry disease susceptibility mutations and rely less on the generation of candidate genes.

  5. Haplotype combination of the bovine CFL2 gene sequence variants and association with growth traits in Qinchuan cattle.

    PubMed

    Sun, Yujia; Lan, Xianyong; Lei, Chuzhao; Zhang, Chunlei; Chen, Hong

    2015-06-01

    The aim of this study was to examine the association of cofilin2 (CFL2) gene polymorphisms with growth traits in Chinese Qinchuan cattle. Three single nucleotide polymorphisms (SNPs) were identified in the bovine CFL2 gene using DNA sequencing and (forced) PCR-RFLP methods. These polymorphisms included a missense mutation (NC_007319.5: g. C 2213 G) in exon 4, one synonymous mutation (NC_007319.5: g. T 1694 A) in exon 4, and a mutation (NC_007319.5: g. G 1500 A) in intron 2, respectively. In addition, we evaluated the haplotype frequency and linkage disequilibrium coefficient of three sequence variants in 488 individuals in QC cattle. All the three SNPs in QC cattle belonged to an intermediate level of genetic diversity (0.25Haplotype analysis of three SNPs showed that 8 different haplotypes were identified in all, but only 5 haplotypes were listed except for those with a frequency of <0.03. Hap4 (-GTC-) had the highest haplotype frequencies (34.70%). However in the three SNPs there were no significant associations between the 13 combined genotypes of the CFL2 gene and growth traits. LD analysis showed that the SNP T 1694 A and C 2213 G loci had a strong linkage (r(2)>0.33). Association analysis indicated that SNP G 1500 A, T 1694 A and C 2213 G were significantly associated with growth traits in the QC population. The results of our study suggest that the CFL2 gene may be a strong candidate gene that affects growth traits in the QC cattle breeding program. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Overview of worldwide diversity of Diaphorina citri Kuwayama mitochondrial cytochrome oxidase 1 haplotypes: two Old World lineages and a New World invasion

    PubMed Central

    Boykin, L.M.; De Barro, P.; Hall, D.G.; Hunter, W.B.; McKenzie, C.L.; Powell, C.A.; Shatters, R.G.

    2012-01-01

    Relationships among worldwide collections of Diaphorina citri (Asian citrus psyllid) were analyzed using mitochondrial cytochrome oxidase I (mtCOI) haplotypes from novel primers. Sequences were produced from PCR amplicons of an 821bp portion of the mtCOI gene using D. citri specific primers, derived from an existing EST library. An alignment was constructed using 612bps of this fragment and consisted of 212 individuals from 52 collections representing 15 countries. There were a total of eight polymorphic sites that separated the sequences into eight different haplotypes (Dcit-1 through Dcit-8). Phylogenetic network analysis using the statistical parsimony software, TCS, suggests two major haplotype groups with preliminary geographic bias between southwestern Asia (SWA) and southeastern Asia (SEA). The recent (within the last 15 to 25 years) invasion into the New World originated from only the SWA group in the northern hemisphere (USA and Mexico) and from both the SEA and SWA groups in the southern hemisphere (Brazil). In only one case, Reunion Island, did haplotypes from both the SEA and SWA group appear in the same location. In Brazil, both groups were present, but in separate locations. The Dcit-1 SWA haplotype was the most frequently encountered, including ~50% of the countries sampled and 87% of the total sequences obtained from India, Pakistan and Saudi Arabia. The second most frequently encountered haplotype, Dcit-2, the basis of the SEA group, represented ~50% of the countries and contained most of the sequences from Southeast Asia and China. Interestingly, only the Caribbean collections (Puerto Rico and Guadeloupe) represented a unique haplotype not found in other countries, indicating no relationship between the USA (Florida) and Caribbean introductions. There is no evidence for cryptic speciation for D. citri based on the COI region included in this study. PMID:22717059

  7. Predictive value of interleukin-10 promoter genotypes and haplotypes in determining the susceptibility to nephropathy in type 2 diabetes patients.

    PubMed

    Mtiraoui, Nabil; Ezzidi, Intissar; Kacem, Maha; Ben Hadj Mohamed, Manel; Chaieb, Molka; Haj Jilani, Aoutef Bel; Mahjoub, Touhami; Almawi, Wassim Y

    2009-01-01

    The IL-10 promoter polymorphisms -1082G/A, -819C/T, and -592C/A have been consistently associated with type 2 diabetes (T2DM). We examined whether these polymorphisms variants are also associated with progression of diabetic nephropathy (DN). These promoter variants were genotyped in 917 T2DM patients comprising 515 DN patients and 402 control patients without nephropathy (DWN), together with 748 non-diabetic control subjects. Haplotype analysis and multivariate regression analysis were employed in assessing the contribution of IL-10 haplotypes to DN risk, using genotype, clinical and biochemical profile, and their interactions as predictors of DN. Carriers of mutant -592A and -819T alleles, and -819T/T, -592A/A, and -819C/T genotypes were more frequent in T2DM. However, the -819C/T genotype appeared to be protective of DN, since lower frequency -819T allele and -819C/T genotype were seen in DN patients. Regression analysis identified -1082G/-819T/-592A (GTA) and -1082G/-819T/-592C (GTC) haplotypes as DN-protective haplotypes. Relative to the -1082G/-819C/-592C haplotype, GTA [P = 0.044; odds ratio (OR) = 0.54, 95% confidence interval (CI): 0.30-0.98] and GTC (P = 0.045; OR = 0.56, 95% CI: 0.31-0.99) haplotypes were associated with decreased odds ratio (OR) for DN, after controlling for a number of covariates (age, sex, body mass index (BMI), hypertension, glucose, HbA(1c), DN duration, total cholesterol). Our results indicate that genetic variations at the IL-10 promoter influence the risk of nephropathy in T2DM patients and thus represent a potential DN genetic-susceptibility locus worthy of replication. Copyright 2009 John Wiley & Sons, Ltd.

  8. Genetic variation in heat shock protein 70 is associated with septic shock: narrowing the association to a specific haplotype.

    PubMed

    Kee, C; Cheong, K Y; Pham, K; Waterer, G W; Temple, S E L

    2008-12-01

    Heat shock protein 70 (HSP70) plays a major role in immune responses. Polymorphisms within the gene have been associated with development of septic shock. This study refines the region of the HSP70 gene associated with development of septic shock and confirms its functionality. Subjects (n = 31) were grouped into one of three haplotypes based on their HSPA1B-179C>T and HSPA1B1267A>G genotypes. Mononuclear cells from these subjects were stimulated with heat-killed bacteria (10(7 )colony-forming units/mL Escherichia coli or Streptococcus pneumoniae) for 8 and 21 h. HSP70 and tumour necrosis factor (TNF) mRNA and protein levels were measured by reverse transcriptase-polymerase chain reaction and ELISA, respectively. The HSPA1B-179*C:1267*A haplotype was associated with significantly lower levels of HSPA1B mRNA and protein and higher production of TNF mRNA and protein compared to the other haplotypes. Induction of HSP70 was TNF independent. These results suggest that the HSPA1B-179C>T:1267A>G haplotype is functional and may explain the association of the HSP70 gene with development of septic shock.

  9. WFIRST: Resolving the Milky Way Galaxy

    NASA Astrophysics Data System (ADS)

    Kalirai, Jason; Conroy, Charlie; Dressler, Alan; Geha, Marla; Levesque, Emily; Lu, Jessica; Tumlinson, Jason

    2018-01-01

    WFIRST will yield a transformative impact in measuring and characterizing resolved stellar populations in the Milky Way. The proximity and level of detail that such populations need to be studied at directly map to all three pillars of WFIRST capabilities - sensitivity from a 2.4 meter space based telescope, resolution from 0.1" pixels, and large 0.3 degree field of view from multiple detectors. In this poster, we describe the activities of the WFIRST Science Investigation Team (SIT), "Resolving the Milky Way with WFIRST". Notional programs guiding our analysis include targeting sightlines to establish the first well-resolved large scale maps of the Galactic bulge aand central region, pockets of star formation in the disk, benchmark star clusters, and halo substructure and ultra faint dwarf satellites. As an output of this study, our team is building optimized strategies and tools to maximize stellar population science with WFIRST. This will include: new grids of IR-optimized stellar evolution and synthetic spectroscopic models; pipelines and algorithms for optimal data reduction at the WFIRST sensitivity and pixel scale; wide field simulations of Milky Way environments including new astrometric studies; and strategies and automated algorithms to find substructure and dwarf galaxies in the Milky Way through the WFIRST High Latitude Survey.

  10. [Gene and haplotype frequencies for the loci HLA-A, B and DRB1 in 11755 north Chinese Han bone marrow registry donors].

    PubMed

    Wu, Qiang-Ju; Liu, Meng-Li; Qi, Jun; Liu, Sheng; Zhang, Yan; Wei, Xiao-Qian

    2007-04-01

    The study was aimed to investigate the human leukocyte antigen (HLA)-A, B, DRB1 alleles and haplotype frequencies and the characteristics of linkage disequilibrium in north Chinese Han bone marrow donors. HLA phenotype data of 11 755 north Chinese Han bone marrow donors were identified by PCR-SSP and PCR-SSO. HLA-A, B, DRB1 allele and haplotype frequencies were calculated by computer software named Arleguin which was based on Expectation-Maximization (EM) algorithms. The results showed that the population of 11755 unrelated-donors was tested by Hardy-Weinberg equilibrium, and 18,42 and 15 specificities of HLA alleles were identified on the HLA-A, B, DRB1 locus respectively, including HLA-A25, B42, B53, B73 and DR3 which were rarely reported in Han population. HLA-A36, A43, A80, B78, B82 and DR18 were not detected in this study. The most frequent alleles with a frequency of over 0.05 were HLA-A*02, A*11, A*24, A*33, A*30, A*01, A*03, A*13, B62, B*51, B*46, B60, B61, B*35, B*44, DRB1*15, DRB1*09, DRB1*04, DRB1*07, DRB1*12, DRB1*11, DRB1*14, DRB1*08, DRB1*13. There were a total of 2 026 kinds of HLA-A-B-DR haplotypes (with a frequency of over 10(-6)) to be obtained. The each frequency of 26 kinds of three-locus haplotypes including HLA-A30-B13-DR7, A2-B46-DR9, A33-B58-DR17 etc was higher than 0.005. A30-B13-DR7 was the most frequent haplotype in north Chinese Han population. There were a total of 538 kinds of haplotypes for HLA-A-B, 227 kinds for A-DR and 522 kinds for B-DR to be obtained, and there were 409, 195, 423 kinds of haplotypes respectively with a frequency higher than 10 - 6. There were 28 kinds of HLA-A-B haplotypes including A30-B13, A2-B46, A33-B58 etc, 26 kinds of HLA-A-DR haplotypes including A2-DR9, A2-DR15, A30-DR7 etc, and 24 kinds of HLA-B-DR haplotypes including B13-DR7, B46-DR9, B13-DR12 etc with a frequency higher than 0.01. 296 (72%) kinds of HLA-A-B, 130 (67%) kinds of A-DR and 308 (73%) kinds of B-DR haplotypes were statistical linkage

  11. HLA-A, -B, -DRB1 allele and haplotype frequencies of 920 cord blood units from Central Chile.

    PubMed

    Schäfer, Christian; Sauter, Jürgen; Riethmüller, Tobias; Kashi, Zahra Mehdizadeh; Schmidt, Alexander H; Barriga, Francisco J

    2016-08-01

    We present human leukocyte antigen (HLA) haplotype and allele/antigenic group frequencies derived from a data set of 920 umbilical cord blood units collected in Central Chile. HLA-A and -B genotypes were typed using sequence specific oligonucleotide probe methods while HLA-DRB1 genotypes were obtained from sequencing-based typing. The most frequent haplotype is A*29~B*44~DRB1*07:01 with an estimated frequency of 2.1%. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  12. Genotypes and Haplotypes of the Estrogen Receptor α Gene (ESR1) Are Associated With Female-to-Male Gender Dysphoria.

    PubMed

    Cortés-Cortés, Joselyn; Fernández, Rosa; Teijeiro, Nerea; Gómez-Gil, Esther; Esteva, Isabel; Almaraz, Mari Cruz; Guillamón, Antonio; Pásaro, Eduardo

    2017-03-01

    Gender dysphoria, a marked incongruence between one's experienced gender and biological sex, is commonly believed to arise from discrepant cerebral and genital sexual differentiation. With the discovery that estrogen receptor β is associated with female-to-male (FtM) but not with male-to-female (MtF) gender dysphoria, and given estrogen receptor α involvement in central nervous system masculinization, it was hypothesized that estrogen receptor α, encoded by the ESR1 gene, also might be implicated. To investigate whether ESR1 polymorphisms (TA)n-rs3138774, PvuII-rs2234693, and XbaI-rs9340799 and their haplotypes are associated with gender dysphoria in adults. Molecular analysis was performed in peripheral blood samples from 183 FtM subjects, 184 MtF subjects, and 394 sex- and ethnically-matched controls. Genotype and haplotype analyses of the (TA)n-rs3138774, PvuII-rs2234693, and XbaI-rs9340799 polymorphisms. Allele and genotype frequencies for the polymorphism XbaI were statistically significant only in FtM vs control XX subjects (P = .021 and P = .020). In XX individuals, the A/G genotype was associated with a low risk of gender dysphoria (odds ratio [OR] = 0.34; 95% CI = 0.16-0.74; P = .011); in XY individuals, the A/A genotype implied a low risk of gender dysphoria (OR = 0.39; 95% CI = 0.17-0.89; P = .008). Binary logistic regression showed partial effects for all three polymorphisms in FtM but not in MtF subjects. The three polymorphisms were in linkage disequilibrium: a small number of TA repeats was linked to the presence of PvuII and XbaI restriction sites (haplotype S-T-A), and a large number of TA repeats was linked to the absence of these restriction sites (haplotype L-C-G). In XX individuals, the presence of haplotype L-C-G carried a low risk of gender dysphoria (OR = 0.66; 95% CI = 0.44-0.99; P = .046), whereas the presence of haplotype L-C-A carried a high susceptibility to gender dysphoria (OR = 3.96; 95% CI = 1.04-15.02; P = .044

  13. Genome-wide association study for Crohn's disease in the Quebec Founder Population identifies multiple validated disease loci.

    PubMed

    Raelson, John V; Little, Randall D; Ruether, Andreas; Fournier, Hélène; Paquin, Bruno; Van Eerdewegh, Paul; Bradley, W E C; Croteau, Pascal; Nguyen-Huu, Quynh; Segal, Jonathan; Debrus, Sophie; Allard, René; Rosenstiel, Philip; Franke, Andre; Jacobs, Gunnar; Nikolaus, Susanna; Vidal, Jean-Michel; Szego, Peter; Laplante, Nathalie; Clark, Hilary F; Paulussen, René J; Hooper, John W; Keith, Tim P; Belouchi, Abdelmajid; Schreiber, Stefan

    2007-09-11

    Genome-wide association (GWA) studies offer a powerful unbiased method for the identification of multiple susceptibility genes for complex diseases. Here we report the results of a GWA study for Crohn's disease (CD) using family trios from the Quebec Founder Population (QFP). Haplotype-based association analyses identified multiple regions associated with the disease that met the criteria for genome-wide significance, with many containing a gene whose function appears relevant to CD. A proportion of these were replicated in two independent German Caucasian samples, including the established CD loci NOD2 and IBD5. The recently described IL23R locus was also identified and replicated. For this region, multiple individuals with all major haplotypes in the QFP were sequenced and extensive fine mapping performed to identify risk and protective alleles. Several additional loci, including a region on 3p21 containing several plausible candidate genes, a region near JAKMIP1 on 4p16.1, and two larger regions on chromosome 17 were replicated. Together with previously published loci, the spectrum of CD genes identified to date involves biochemical networks that affect epithelial defense mechanisms, innate and adaptive immune response, and the repair or remodeling of tissue.

  14. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    PubMed

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (<5 kb) DNA fragments. In the current study, a novel modification was applied to overcome these problems. A limited amount of cellular DNA was carefully released from intact cells into a mildly heated alkaline agarose solution and mixed thoroughly. The solution was then gently aliquoted and allowed to solidify while maintaining the integrity of the diluted DNA. Exogenously provided Phi29 DNA polymerase was used to perform consistent genomic amplification with random hexameric oligonucleotides within the agarose gels. Simple heat melting of the gel allowed recovery of the amplified materials in a solution of the polymerase chain reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  15. Relationship of polymorphisms and haplotype in interleukin-16 and adiponectin gene with late-onset Alzheimer’s disease risk

    PubMed Central

    Yin, Honglei; Zhang, Yuzhen; Hua, Linlin; Li, Jinfeng; Zeng, Zhilei; Yang, Xiaopeng; Gong, Bin; Geng, Shuang; Liu, Yajun; Zhang, Hui; Liu, Yanqiu; Zhao, Jing; Wang, Yunliang

    2017-01-01

    Aims To investigate the impact of Interleukin-16 (IL- 16) and Adiponectin (ANP) gene single nucleotide polymorphisms (SNPs), gene- gene interactions and haplotype on late-onset Alzheimer’s disease (LOAD) risk. Methods Hardy-Weinberg equilibrium (HWE), haplotype and pairwise linkage disequilibrium (LD) analysis were investigated by using SNPstats (available online at http://bioinfo.iconcologia.net/SNPstats). Generalized multifactor dimensionality reduction (GMDR) was used to examine interaction among 4 SNPs, odds ratio (OR) and 95% confident interval (95%CI) were calculated by logistic regression model. Results LOAD risk was significantly higher in carriers of rs266729- G allele than those with CC genotype (CG+ GG versus CC), OR (95%CI) =1.61 (1.26-1.96), and higher in carriers of rs1501299- T allele, OR (95%CI) = 1.62 (1.32-2.12), lower in carriers of rs4072111- T allele, adjusted OR (95%CI) =0.65 (0.44-0.93). We also found a significant gene- gene interaction between rs266729 and rs4072111. Participants with CG or GG of rs266729 and CC of rs4072111 genotype have the highest LOAD risk, OR (95%CI) = 2.62 (1.64 -3.58). Haplotype containing the rs266729- G and rs1501299- T alleles were associated with increased LOAD risk, OR (95%CI)= 1.83 (1.32- 2.43), and haplotype containing the rs1131445- C and rs4072111- T alleles were associated with decreased LOAD risk, OR (95%CI)= 0.53 (0.18- 0.95). Conclusions We concluded that rs266729 and rs1501299 minor alleles were associated with increased LOAD risk, but rs4072111 minor allele was associated with decreased LOAD risk. We also found that interaction involving rs266729 and rs4072111, and haplotype combinations were associated with LOAD risk. PMID:29108295

  16. No association between polymorphisms/haplotypes of the vascular endothelial growth factor gene and preeclampsia

    PubMed Central

    2011-01-01

    Background Preeclampsia (PE) is the first worldwide cause of death in pregnant women, intra-uterine growth retardation, and fetal prematurity. Some vascular endothelial grown factor gene (VEGF) polymorphisms have been associated to PE and other pregnancy disturbances. We evaluated the associations between VEGF genotypes/haplotypes and PE in Mexican women. Methods 164 pregnant women were enrolled in a case-control study (78 cases and 86 normotensive pregnant controls). The rs699947 (-2578C/A), rs1570360 (-1154G/A), rs2010963 (+405G/C), and rs25648 (-7C/T), VEGF variants were discriminated using Polymerase Chain Reaction - Restriction Fragment Length Polymorphism (PCR-RFLP) methods or Taqman single nucleotide polymorphism (SNP) assays. Results The proportions of the minor allele for rs699947, rs1570360, rs2010963, and rs25648 VEGF SNPs were 0.33, 0.2, 0.39, and 0.17 in controls, and 0.39, 0.23, 0.41, and 0.15 in cases, respectively (P values > 0.05). The most frequent haplotypes of rs699947, rs1570360, rs2010963, and rs25648 VEGF SNPs, were C-G-C-C and C-G-G-C with frequencies of 0.39, 0.21 in cases and 0.37, 0.25 in controls, respectively (P values > 0.05) Conclusion There was no evidence of an association between VEGF alleles, genotypes, or haplotypes frequencies and PE in our study. PMID:21575227

  17. ASSOCIATION BETWEEN GAB2 HAPLOTYPE AND HIGHER GLUCOSE METABOLISM IN ALZHEIMER'S DISEASE-AFFECTED BRAIN REGIONS IN COGNITIVELY NORMAL APOEε4 CARRIERS

    PubMed Central

    Liang, Winnie S.; Chen, Kewei; Lee, Wendy; Sidhar, Kunal; Corneveaux, Jason J.; Allen, April N.; Myers, Amanda; Villa, Stephen; Meechoovet, Bessie; Pruzin, Jeremy; Bandy, Daniel; Fleisher, Adam S.; Langbaum, Jessica B.S.; Huentelman, Matthew J.; Jensen, Kendall; Dunckley, Travis; Caselli, Richard J.; Kaib, Susan; Reiman, Eric M.

    2010-01-01

    In a genome-wide association study (GWAS) of late-onset Alzheimer's disease (AD), we found an association between common haplotypes of the GAB2 gene and AD risk in carriers of the apolipoprotein E (APOE) ε4 allele, the major late-onset AD susceptibility gene. We previously proposed the use of fluorodeoxyglucose positron emission tomography (FDG-PET) measurements as a quantitative presymptomatic endophenotype, more closely related to disease risk than the clinical syndrome itself, to help evaluate putative genetic and non-genetic modifiers of AD risk. In this study, we examined the relationship between the presence or absence of the relatively protective GAB2 haplotype and PET measurements of regional-to-whole brain FDG uptake in several AD-affected brain regions in 158 cognitively normal late-middle-aged APOEε4 homozygotes, heterozygotes, and non-carriers. GAB2 haplotypes were characterized using Affymetrix Genome-Wide Human SNP 6.0 Array data from each of these subjects. As predicted, the possibly protective GAB2 haplotype was associated with higher regional-to-whole brain FDG uptake in AD-affected brain regions in APOEε4 carriers. While additional studies are needed, this study supports the association between the possibly protective GAB2 haplotype and the risk of late-onset AD in APOEε4 carriers. It also supports the use of brain-imaging endophenotypes to help assess possible modifiers of AD risk. PMID:20888920

  18. Periodicity in Age-Resolved Populations

    NASA Astrophysics Data System (ADS)

    Esipov, Sergei

    We discuss the interplay between the non-linear diffusion and age-resolved population dynamics. Depending on the age properties of collective migration the system may exhibit continuous joint expansion of all ages or continuous expansion with age segregation. Between these two obvious limiting regimes there is an interesting window of periodic expansion, which has been previously used by us in modeling bacterial colonies of Proteus mirabilis. In order to test whether the age-dependent collective migration leads to periodicity in other systems we performed a Fourier analysis of historical data on ethnic expansions and found multiple co-existing periods of activity.

  19. Phenotypic and genetic effects of recessive haplotypes on yield, longevity, and fertility

    USDA-ARS?s Scientific Manuscript database

    Phenotypes from the August 2015 US national genetic evaluation were used to compute phenotypic effects of cholesterol deficiency (CD) and 17 other recessive haplotypes in Ayrshire (AY; n=1), Brown Swiss (BS; n = 5), Holstein (HO; n = 10), and Jersey (JE; n = 2) cattle on milk, fat, and protein yield...

  20. Frequency and origin of haplotypes associated with the beta-globin gene cluster in individuals with trait and sickle cell anemia in the Atlantic and Pacific coastal regions of Colombia

    PubMed Central

    Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo

    2013-01-01

    Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events. PMID:24385850

  1. Compressive hyperspectral time-resolved wide-field fluorescence lifetime imaging

    NASA Astrophysics Data System (ADS)

    Pian, Qi; Yao, Ruoyang; Sinsuebphon, Nattawut; Intes, Xavier

    2017-07-01

    Spectrally resolved fluorescence lifetime imaging and spatial multiplexing have offered information content and collection-efficiency boosts in microscopy, but efficient implementations for macroscopic applications are still lacking. An imaging platform based on time-resolved structured light and hyperspectral single-pixel detection has been developed to perform quantitative macroscopic fluorescence lifetime imaging (MFLI) over a large field of view (FOV) and multiple spectral bands simultaneously. The system makes use of three digital micromirror device (DMD)-based spatial light modulators (SLMs) to generate spatial optical bases and reconstruct N by N images over 16 spectral channels with a time-resolved capability (∼40 ps temporal resolution) using fewer than N2 optical measurements. We demonstrate the potential of this new imaging platform by quantitatively imaging near-infrared (NIR) Förster resonance energy transfer (FRET) both in vitro and in vivo. The technique is well suited for quantitative hyperspectral lifetime imaging with a high sensitivity and paves the way for many important biomedical applications.

  2. Chloroformate derivatization for tracing the fate of Amino acids in cells and tissues by multiple stable isotope resolved metabolomics (mSIRM).

    PubMed

    Yang, Ye; Fan, Teresa W-M; Lane, Andrew N; Higashi, Richard M

    2017-07-11

    Amino acids have crucial roles in central metabolism, both anabolic and catabolic. To elucidate these roles, steady-state concentrations of amino acids alone are insufficient, as each amino acid participates in multiple pathways and functions in a complex network, which can also be compartmentalized. Stable Isotope-Resolved Metabolomics (SIRM) is an approach that uses atom-resolved tracking of metabolites through biochemical transformations in cells, tissues, or whole organisms. Using different elemental stable isotopes to label multiple metabolite precursors makes it possible to resolve simultaneously the utilization of these precursors in a single experiment. Conversely, a single precursor labeled with two (or more) different elemental isotopes can trace the allocation of e.g. C and N atoms through the network. Such dual-label experiments however challenge the resolution of conventional mass spectrometers, which must distinguish the neutron mass differences among different elemental isotopes. This requires ultrahigh resolution Fourier transform mass spectrometry (UHR-FTMS). When combined with direct infusion nano-electrospray ion source (nano-ESI), UHR-FTMS can provide rapid, global, and quantitative analysis of all possible mass isotopologues of metabolites. Unfortunately, very low mass polar metabolites such as amino acids can be difficult to analyze by current models of UHR-FTMS, plus the high salt content present in typical cell or tissue polar extracts may cause unacceptable ion suppression for sources such as nano-ESI. Here we describe a modified method of ethyl chloroformate (ECF) derivatization of amino acids to enable rapid quantitative analysis of stable isotope labeled amino acids using nano-ESI UHR-FTMS. This method showed excellent linearity with quantifiable limits in the low nanomolar range represented in microgram quantities of biological specimens, which results in extracts with total analyte abundances in the low to sub-femtomole range. We have

  3. Maternal smoking during pregnancy and offspring type 1 diabetes mellitus risk: accounting for HLA haplotype.

    PubMed

    Mattsson, Kristina; Jönsson, Ida; Malmqvist, Ebba; Larsson, Helena Elding; Rylander, Lars

    2015-03-01

    The main objective of this study was to investigate the risk of type 1 diabetes mellitus (T1D) in children exposed to tobacco smoking in utero, also taking genetic predisposition as expressed by HLA haplotype into account. In Skåne, the southernmost county of Sweden, all children born 1999-2005 who developed T1D were registered, resulting in 344 cases. For each child with T1D, three control children, matched for HLA haplotype and birthyear, were selected. Information on prenatal smoking exposure was retrieved from a regional birth register. Conditional logistic regressions were used to evaluate T1D risk following prenatal smoking exposure. In these data, maternal smoking in early pregnancy was associated with a higher risk of her child developing T1D [odds ratio (OR) 2.83; 95% confidence interval (CI) 1.67-4.80 for 1-9 cigarettes/day, and OR 3.91; 95% CI 1.22-12.51 for >9 cigarettes/day]. Results remained through all adjustments and sensitivity analyses. When genetic predisposition in terms of HLA haplotype was taken into account, we found that children exposed to smoking during fetal life were at higher risk of developing T1D in childhood.

  4. Hb S [β6(A3)Glu→Val, GAG>GTG] in Mexican Mestizos: frequency and analysis of the 5' β-globin haplotype.

    PubMed

    Guzmán, Luis F; Perea, Francisco J; Magaña, María T; Morales-González, Karina R; Chávez-Velazco, M Luz; Ibarra, Bertha

    2010-01-01

    Between 1978 and 2009, we studied 1,863 Mexican Mestizo patients with clinical data compatible with a hemoglobinopathy. Of these patients, 382 had some hemoglobin (Hb) abnormality (20.5%), 128 had a sickle cell hemoglobinopathy, representing a general frequency of 6.9%, which is similar to the percentage observed in previous studies on Mexican Mestizos. We analyzed the 5' β-globin haplotype (5'Hp) in 79 unrelated β(S) chromosomes (26 β(S)/β(S), 14 β(S)/β(Thal), nine β(S)/β(A) and four β(S)/β(D)), and four haplotypes were observed: 72.2% CAR 24.1% Benin, 2.5% Senegal and 1.2% Cameroon; the last two are reported for first time in Mexico. In some Latin American populations such as Brazil, the Bantu haplotype predominates, while in others such as Jamaica, the Benin haplotype is the most frequent, showing heterogeneity of African genes as a consequence of different regions involved in the slave trade.

  5. Novel Tenascin-C Haplotype Modifies the Risk for a Failure to Heal After Rotator Cuff Repair.

    PubMed

    Kluger, Rainer; Huber, Klaus R; Seely, Philipp G; Berger, Christian E; Frommlet, Florian

    2017-11-01

    Several single-nucleotide polymorphisms (SNPs) in the TNC gene have recently been found to be associated with degenerative rotator cuff tears. Exonic SNPs in the TNC gene are related to the risk for a failure to heal after rotator cuff repair. Case-control study; Level of evidence, 3. A total of 302 patients from the Vienna area and European Caucasian ancestry underwent mini-open rotator cuff repair for a full-thickness superior or posterosuperior tear and were assessed for the integrity of the repair 1 year postoperatively with a real-time 7.5- to 10-MHz ultrasound linear array transducer. Outcomes were classified as intact (complete footprint coverage), small (<200 mm 2 ), or large (≥200 mm 2 ) recurrent defect. Patients were genotyped for 15 previously identified risk SNPs within a 49-kbp segment of the TNC gene with the KASP genotyping technology or the Ion-Torrent Personal Genome Machine System. All recurrent defects were atraumatic failures, and the overall failure rate was 39.7%. Of the traditional risk factors, only the initial tear size was significantly associated with a failure to heal. In a multinomial logistic regression model, the T allele at rs1138545 [C>T] was protective for a large recurrent defect (odds ratio = 0.16; 95% CI, 0.09-0.31). The role of rs1138545 was further backed by haplotype analysis, which showed that the combination of the C allele at rs1138545 [C>T], the A allele at rs2104772 [A>T], and the G allele at rs10759752 [A>G] formed the risk-related haplotype [CAG]. The CAG haplotype was associated with large recurrent defects ( P < .0001; haplotype frequency, 0.394; haplotype score, 4.518). Exonic marker rs1138545 transcribed into all isoforms of the TNC protein, whereas exonic marker rs2104772, which has been associated with Achilles tendinopathy before, transcribed only into large isoforms of the TNC protein. Recurrent defects after rotator cuff repairs are clinically relevant, and a heritable component of the disorder is plausible

  6. Haplotype frequency distribution for 7 microsatellites in chromosome 8 and 11 in relation to the metabolic syndrome in four ethnic groups: Tehran Lipid and Glucose Study.

    PubMed

    Daneshpour, Maryam Sadat; Hosseinzadeh, Nima; Zarkesh, Maryam; Azizi, Fereidoun

    2012-03-01

    Different variants of haplotype frequencies may lead to various frequencies of the same variants in individuals with drug resistance and disease susceptibility at the population level. In this study, the haplotype frequencies of 4 STR loci including the D8S1132, D8S1779, D8S514 and D8S1743, and 3 STR loci including D11S1304, D11S1998 and D11S934 were investigated in 563 individuals of four Iranian ethnic groups in the capital city of Iran, Tehran. One hundred thirty subjects had the metabolic syndrome. Haplotype frequencies of all markers were calculated. There were significant differences in the haplotype frequencies in short and long alleles between the metabolic affected subjects and controls. In addition, haplotype frequencies were significant in the four ethnic groups in both chromosomes 8 and 11. Our findings show a relation between the short allele of D8S1743 in all related haplotype frequencies of subjects with metabolic syndrome. These findings may require more studies of some candidate genes, including the lipoprotein lipase gene, in this chromosomal region. Copyright © 2011. Published by Elsevier B.V.

  7. Genetic structure of Plasmodium vivax using the merozoite surface protein 1 icb5-6 fragment reveals new hybrid haplotypes in southern Mexico

    PubMed Central

    2014-01-01

    Background Plasmodium vivax is a protozoan parasite with an extensive worldwide distribution, being highly prevalent in Asia as well as in Mesoamerica and South America. In southern Mexico, P. vivax transmission has been endemic and recent studies suggest that these parasites have unique biological and genetic features. The msp1 gene has shown high rate of nucleotide substitutions, deletions, insertions, and its mosaic structure reveals frequent events of recombination, maybe between highly divergent parasite isolates. Methods The nucleotide sequence variation in the polymorphic icb5-6 fragment of the msp1 gene of Mexican and worldwide isolates was analysed. To understand how genotype diversity arises, disperses and persists in Mexico, the genetic structure and genealogical relationships of local isolates were examined. To identify new sequence hybrids and their evolutionary relationships with other P. vivax isolates circulating worldwide two haplotype networks were constructed questioning that two portions of the icb5-6 have different evolutionary history. Results Twelve new msp1 icb5-6 haplotypes of P. vivax from Mexico were identified. These nucleotide sequences show mosaic structure comprising three partially conserved and two variable subfragments and resulted into five different sequence types. The variable subfragment sV1 has undergone recombination events and resulted in hybrid sequences and the haplotype network allocated the Mexican haplotypes to three lineages, corresponding to the Sal I and Belem types, and other more divergent group. In contrast, the network from icb5-6 fragment but not sV1 revealed that the Mexican haplotypes belong to two separate lineages, none of which are closely related to Sal I or Belem sequences. Conclusions These results suggest that the new hybrid haplotypes from southern Mexico were the result of at least three different recombination events. These rearrangements likely resulted from the recombination between haplotypes of

  8. Pregnancy after azathioprine therapy for ulcerative colitis in a woman with autoimmune premature ovarian failure and Addison's disease: HLA haplotype characterization.

    PubMed

    Ferraù, Francesco; Gangemi, Sebastiano; Vita, Giuseppe; Trimarchi, Francesco; Cannavò, Salvatore

    2011-06-01

    To present a case of fertility restored by azathioprine treatment in a woman with autoimmune premature ovarian failure, Addison's disease, and ulcerative colitis, and to study the genetic background of the three autoimmune diseases. Case report. Endocrinology and Immunology Units of an university hospital. A 30-year-old woman with autoimmune premature ovarian failure, Addison's disease, and ulcerative colitis. Azathioprine has been administered as immunosuppressive treatment. We performed analysis of human leukocyte antigens expression on lymphocytes and genomic haplotype of the patient. The human leukocyte antigen haplotype of the patient was consistent with the haplotypes predisposing for the three autoimmune diseases, as reported in the literature. The administration of azathioprine restored regular menses and allowed uneventful pregnancy. This is the first clinical evidence of association of immunosuppressive azathioprine treatment and restored ovarian function and fertility in a woman with autoimmune premature ovarian failure. In this patient, the haplotype was associated with susceptibility to autoimmune premature ovarian failure, Addison's disease, and ulcerative colitis. Copyright © 2011 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  9. High-Resolution Analyses of Human Leukocyte Antigens Allele and Haplotype Frequencies Based on 169,995 Volunteers from the China Bone Marrow Donor Registry Program

    PubMed Central

    Zhou, Xiao-Yang; Zhu, Fa-Ming; Li, Jian-Ping; Mao, Wei; Zhang, De-Mei; Liu, Meng-Li; Hei, Ai-Lian; Dai, Da-Peng; Jiang, Ping; Shan, Xiao-Yan; Zhang, Bo-Wei; Zhu, Chuan-Fu; Shen, Jie; Deng, Zhi-Hui; Wang, Zheng-Lei; Yu, Wei-Jian; Chen, Qiang; Qiao, Yan-Hui; Zhu, Xiang-Ming; Lv, Rong; Li, Guo-Ying; Li, Guo-Liang; Li, Heng-Cong; Zhang, Xu; Pei, Bin; Jiao, Li-Xin; Shen, Gang; Liu, Ying; Feng, Zhi-Hui; Su, Yu-Ping; Xu, Zhao-Xia; Di, Wen-Ying; Jiang, Yao-Qin; Fu, Hong-Lei; Liu, Xiang-Jun; Liu, Xiang; Zhou, Mei-Zhen; Du, Dan; Liu, Qi; Han, Ying; Zhang, Zhi-Xin; Cai, Jian-Ping

    2015-01-01

    Allogeneic hematopoietic stem cell transplantation is a widely used and effective therapy for hematopoietic malignant diseases and numerous other disorders. High-resolution human leukocyte antigen (HLA) haplotype frequency distributions not only facilitate individual donor searches but also determine the probability with which a particular patient can find HLA-matched donors in a registry. The frequencies of the HLA-A, -B, -C, -DRB1, and -DQB1 alleles and haplotypes were estimated among 169,995 Chinese volunteers using the sequencing-based typing (SBT) method. Totals of 191 HLA-A, 244 HLA-B, 146 HLA-C, 143 HLA-DRB1 and 47 HLA-DQB1 alleles were observed, which accounted for 6.98%, 7.06%, 6.46%, 9.11% and 7.91%, respectively, of the alleles in each locus in the world (IMGT 3.16 Release, Apr. 2014). Among the 100 most common haplotypes from the 169,995 individuals, nine distinct haplotypes displayed significant regionally specific distributions. Among these, three were predominant in the South China region (i.e., the 20th, 31st, and 81sthaplotypes), another three were predominant in the Southwest China region (i.e., the 68th, 79th, and 95th haplotypes), one was predominant in the South and Southwest China regions (the 18th haplotype), one was relatively common in the Northeast and North China regions (the 94th haplotype), and one was common in the Northeast, North and Northwest China (the 40th haplotype). In conclusion, this is the first to analyze high-resolution HLA diversities across the entire country of China, based on a detailed and complete data set that covered 31 provinces, autonomous regions, and municipalities. Specifically, we also evaluated the HLA matching probabilities within and between geographic regions and analyzed the regional differences in the HLA diversities in China. We believe that the data presented in this study might be useful for unrelated HLA-matched donor searches, donor registry planning, population genetic studies, and anthropogenesis

  10. Haplotypes and effects on growth traits of bovine Wnt7a gene in Chinese Qinchuan cattle.

    PubMed

    Xue, Jing; Sun, Yujia; Guo, Wenjiao; Yang, Ziqi; Tian, Huibin; Zhang, Chunlei; Lei, Chuzhao; Lan, Xianyong; Chen, Hong

    2013-07-25

    Wnt7a is a member of the WNT gene family, which encodes secreted signaling proteins and responds to many biological processes. Specifically Wnt7a influences satellite stem cells and regulates the regenerative potential of the muscle. However, similar researches about the bovine Wnt7a gene are lacking. Therefore, in this study, polymorphisms of the bovine Wnt7a gene were detected in 488 individuals from Chinese Qinchuan cattle by DNA pooling, forced PCR-RFLP, and DNA sequencing methods. 3 novel SNPs were identified, two SNPs (g.T4926C and g.A21943G) were in the intron and the last one (g.C63777T) was in the exon. Five haplotypes involved in these three variant sites in the Wnt7a gene were identified and their effects on growth traits were analyzed. The results revealed that haplotype 1 had the highest haplotype frequencies and was highly significantly associated with body height (P<0.01), body weight (P<0.05), chest width (P<0.05) and height at hip cross (P<0.01) respectively. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. A Gene-Oriented Haplotype Comparison Reveals Recently Selected Genomic Regions in Temperate and Tropical Maize Germplasm

    PubMed Central

    Zhang, Jie; Li, Yongxiang; Zheng, Jun; Zhang, Hongwei; Yang, Xiaohong; Wang, Jianhua; Wang, Guoying

    2017-01-01

    The extensive genetic variation present in maize (Zea mays) germplasm makes it possible to detect signatures of positive artificial selection that occurred during temperate and tropical maize improvement. Here we report an analysis of 532,815 polymorphisms from a maize association panel consisting of 368 diverse temperate and tropical inbred lines. We developed a gene-oriented approach adapting exonic polymorphisms to identify recently selected alleles by comparing haplotypes across the maize genome. This analysis revealed evidence of selection for more than 1100 genomic regions during recent improvement, and included regulatory genes and key genes with visible mutant phenotypes. We find that selected candidate target genes in temperate maize are enriched in biosynthetic processes, and further examination of these candidates highlights two cases, sucrose flux and oil storage, in which multiple genes in a common pathway can be cooperatively selected. Finally, based on available parallel gene expression data, we hypothesize that some genes were selected for regulatory variations, resulting in altered gene expression. PMID:28099470

  12. Serpin peptidase inhibitor (SERPINB5) haplotypes are associated with susceptibility to hepatocellular carcinoma

    NASA Astrophysics Data System (ADS)

    Yang, Shun-Fa; Yeh, Chao-Bin; Chou, Ying-Erh; Lee, Hsiang-Lin; Liu, Yu-Fan

    2016-05-01

    Hepatocellular carcinoma (HCC) represents the second leading cause of cancer-related death worldwide. The serpin peptidase inhibitor SERPINB5 is a tumour-suppressor gene that promotes the development of various cancers in humans. However, whether SERPINB5 gene variants play a role in HCC susceptibility remains unknown. In this study, we genotyped 6 SNPs of the SERPINB5 gene in an independent cohort from a replicate population comprising 302 cases and 590 controls. Additionally, patients who had at least one rs2289520 C allele in SERPINB5 tended to exhibit better liver function than patients with genotype GG (Child-Pugh grade A vs. B or C; P = 0.047). Next, haplotype blocks were reconstructed according to the linkage disequilibrium structure of the SERPINB5 gene. A haplotype “C-C-C” (rs17071138 + rs3744941 + rs8089204) in SERPINB5-correlated promoter showed a significant association with an increased HCC risk (AOR = 1.450 P = 0.031). Haplotypes “T-C-A” and “C-C-C” (rs2289519 + rs2289520 + rs1455555) located in the SERPINB5 coding region had a decreased (AOR = 0.744 P = 0.031) and increased (AOR = 1.981 P = 0.001) HCC risk, respectively. Finally, an additional integrated in silico analysis confirmed that these SNPs affected SERPINB5 expression and protein stability, which significantly correlated with tumour expression and subsequently with tumour development and aggressiveness. Taken together, our findings regarding these biomarkers provide a prediction model for risk assessment.

  13. Methylenetetrahydrofolate reductase gene haplotypes affect toxicity during maintenance therapy for childhood acute lymphoblastic leukemia in Japanese patients.

    PubMed

    Tanaka, Yoichi; Manabe, Atsushi; Nakadate, Hisaya; Kondoh, Kensuke; Nakamura, Kozue; Koh, Katsuyoshi; Kikuchi, Akira; Komiyama, Takako

    2014-05-01

    Abstract The aim of this study was to investigate the influence of daily 6-mercaptopurine (6-MP) and low-dose weekly methotrexate (MTX) combination treatment and methylenetetrahydrofolate reductase (MTHFR) haplotypes on toxicity during maintenance therapy in Japanese childhood acute lymphoblastic leukemia (ALL). We retrospectively analyzed the MTHFR C677T and A1298C polymorphisms and influence of haplotypes on toxicity in 73 patients. Patients with the MTHFR 677TT and 677CT + 1298AC were associated with severe liver toxicity (p = 0.014, odds ratio [OR] = 3.82, 95% confidence interval [CI] = 1.27-11.46) and more rapid onset of liver toxicity (p = 0.010). Patients with MTHFR 677TT and 677CT + 1298AC were associated with lower frequency of 6-MP and MTX dose reduction due to leukopenia (p < 0.05). No difference was observed in average drug doses in the MTHFR genotypes. In conclusion, the MTHFR C677T and A1298C haplotypes might be useful for monitoring adverse effects in childhood ALL maintenance therapy in Japanese patients.

  14. PCR/oligonucleotide probe typing of HLA class II alleles in a Filipino population reveals an unusual distribution of HLA haplotypes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bugawan, T.L.; Chang, J.D.; Erlich, H.A.

    1994-02-01

    The authors have analyzed the distribution of HLA class II alleles and haplotypes in a Filipino population by PCR amplification of the DRB1, DQB1, and DPB1 second-exon sequences from buccal swabs obtained from 124 family members and 53 unrelated individuals. The amplified DNA was typed by using nonradioactive sequence-specific oligonucleotide probes. Twenty-two different DRB1 alleles, including the novel Filipino *1105, and 46 different DRB1/DQB1 haplotypes, including the unusual DRB1*0405-DQB1*0503, were identified. An unusually high frequency (f = .383) of DPB1*0101, a rare allele in other Asian populations, was also observed. In addition, an unusual distribution of DRB1 alleles and haplotypesmore » was seen in this population, with DR2 (f = .415) and DRB1*1502-DQB1*0502 (f = .233) present at high frequencies. This distribution of DRB1 alleles differs from the typical HLA population distribution, in which the allele frequencies are more evenly balanced. The distribution of HLA class II alleles and haplotypes in this Filipino population is different from that of other Asian and Pacific groups: of those populations studied to date, the Indonesian population is the most similar. DRB1*1502-DQB1*0502 was in strong linkage disequilibrium (D[prime] = .41) with DPB 1*0101 (f = .126, for the extended haplotype), which is consistent with selection for this DR, DQ, DP haplotype being responsible for the high frequency of these three class II alleles in this populations. 30 refs., 2 figs., 6 tabs.« less

  15. Association of HLA alleles and haplotypes with CYP21A2 gene p. V282L mutation in the Croatian population.

    PubMed

    Grubic, Z; Maskalan, M; Stingl Jankovic, K; Zvecic, S; Dumic Kubat, K; Krnic, N; Zunec, R; Ille, J; Kusec, V; Dumic, M

    2016-11-01

    The CYP21A2 mutations that are in linkage disequilibrium with particular HLA-A, -B, -DRB1 alleles/haplotypes, cause deficiency of the 21-hydroxylase enzyme (21-OHD) and account for the majority of congenital adrenal hyperplasia (CAH) cases. The aim of this study was to investigate those associations with the p.V282L mutation linked to the non-classical (NC) form of CAH among Croatians. The study included parents of patients with the NC form of CAH, positive for the p.V282L mutation (N = 55) and cadaveric donor samples (N = 231). All subjects were HLA-A, -B, and -DRB1 typed and tested for the presence of the p.V282L mutation. Among parents of patients, 92.73% of subjects were positive for the B*14:02 allele and almost half of them carried the HLA-A*33:01-B*14:02-DRB1*01:02 haplotype. Among cadaveric samples 77 out of 96 subjects positive for the B*14:02 allele had the p.V282L mutation. Among them, 37 were positive for the HLA-A*33:01-B*14:02-DRB1*01:02 haplotype, 23 had the HLA-A*33:01-B*14:02-DRB1*03:01 haplotype, 8 had the B*14:02-DRB1*01:02 combination and 5 were carrying the HLA-A*68:02-B*14:02-DRB1*13:03 haplotype. Only 4 of these subjects were positive for the B*14:02 allele. HLA-B*14:02 was the only single allele with association that reached statistically significant P value (RR = 12.00; P = 0.0024). Haplotypes B*14:02-DRB1*01:02 (P < 0.001) and HLA-A*68:02-B*14:02-DRB1*13:03 (P < 0.001) as well as HLA-A*33:01-B*14:02-DRB1*01:02 and HLA-A*33:01-B*14:02-DRB1*03:01 showed high relative risks (RR = 45.00, RR = 41.63 and RR = 36.96, respectively). Our data support the previously documented association of the HLA-A*33:01-B*14:02-DRB1*01:02 haplotype with the p.V282L mutation, but also point out a high frequency of the p.V282L mutation among Croatians with HLA-A*33:01-B*14:02-DRB1*03:01 and HLA-A*68:02-B*14:02-DRB1*13:03 haplotypes. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. A haplotype spanning PLAG1 contributed to stature recovery in modern cattle

    USDA-ARS?s Scientific Manuscript database

    The recent evolution of cattle is marked by fluctuations in body size. Height in the Bos taurus lineage was reduced by a factor of ~1.5 from the Neolithic to the Middle Ages, and increased again only during the Early Modern Ages. Here, we provide evidence that the bovine PLAG1 haplotype (Q) with maj...

  17. High-resolution HLA allele and haplotype frequencies in majority and minority populations of Costa Rica and Nicaragua: Differential admixture proportions in neighboring countries.

    PubMed

    Arrieta-Bolaños, E; Madrigal-Sánchez, J J; Stein, J E; Órlich-Pérez, P; Moreira-Espinoza, M J; Paredes-Carias, E; Vanegas-Padilla, Y; Salazar-Sánchez, L; Madrigal, J A; Marsh, S G E; Shaw, B E

    2018-06-01

    The HLA system shows the most extensive polymorphism in the human genome. Allelic and haplotypic frequencies of HLA genes vary dramatically across human populations. Due to a complex history of migration, populations in Latin America show a broad variety of admixture proportions, usually varying not only between countries, but also within countries. Knowledge of HLA allele and haplotype frequencies is essential for medical fields such as transplantation, but also serves as a means to assess genetic diversity and ancestry in human populations. Here, we have determined high-resolution HLA-A, -B, -C, and -DRB1 allele and haplotype frequencies in a sample of 713 healthy subjects from three Mestizo populations, one population of African descent, and Amerindians of five different groups from Costa Rica and Nicaragua and compared their profiles to a large set of indigenous populations from Iberia, Sub-Saharan Africa, and the Americas. Our results show a great degree of allelic and haplotypic diversity within and across these populations, with most extended haplotypes being private. Mestizo populations show alleles and haplotypes of putative European, Amerindian, and Sub-Saharan African origin, albeit with differential proportions. Despite some degree of gene flow, Amerindians and Afro-descendants show great similarity to other Amerindian and West African populations, respectively. This is the first comprehensive study reporting high-resolution HLA diversity in Central America, and its results will shed light into the genetic history of this region while also supporting the development of medical programs for organ and stem cell transplantation. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Final Report: Resolving and Discriminating Overlapping Anomalies from Multiple Objects in Cluttered Environments

    DTIC Science & Technology

    2015-12-15

    UXO community . NAME Total Number: PERCENT_SUPPORTEDNAME FTE Equivalent: Total Number: Irma Shamatava 0.50 0.50 1 Resolving and Discriminating...Distinguishing an object of interest from innocuous items is the main problem that the UXO community is facing currently. This inverse problem...innocuous items is the main problem that the UXO community is facing currently. This inverse problem demands fast and accurate representation of

  19. PTCH1 gene haplotype association with basal cell carcinoma after transplantation.

    PubMed

    Begnini, A; Tessari, G; Turco, A; Malerba, G; Naldi, L; Gotti, E; Boschiero, L; Forni, A; Rugiu, C; Piaserico, S; Fortina, A B; Brunello, A; Cascone, C; Girolomoni, G; Gomez Lira, M

    2010-08-01

    Basal cell carcinoma (BCC) is 10 times more frequent in organ transplant recipients (OTRs) than in the general population. Factors in OTRs conferring increased susceptibility to BCC include ultraviolet radiation exposure, immunosuppression, viral infections such as human papillomavirus, phototype and genetic predisposition. The PTCH1 gene is a negative regulator of the hedgehog pathway, that provides mitogenic signals to basal cells in skin. PTCH1 gene mutations cause naevoid BCC syndrome, and contribute to the development of sporadic BCC and other types of cancers. Associations have been reported between PTCH1 polymorphisms and BCC susceptibility in nontransplanted individuals. To search for novel common polymorphisms in the proximal 5' regulatory region upstream of PTCH1 gene exon 1B, and to investigate the possible association of PTCH1 polymorphisms and haplotypes with BCC risk after organ transplantation. Three PTCH1 single nucleotide polymorphisms (rs2297086, rs2066836 and rs357564) were analysed by restriction fragment length polymorphism analysis in 161 northern Italian OTRs (56 BCC cases and 105 controls). Two regions of the PTCH1 gene promoter were screened by heteroduplex analysis in 30 cases and 30 controls. Single locus analysis showed no significant association. Haplotype T(1686)-T(3944) appeared to confer a significantly higher risk for BCC development (odds ratio 2.98, 95% confidence interval 2.55-3.48; P = 0.001). Two novel rare polymorphisms were identified at positions 176 and 179 of the 5'UTR. Two novel alleles of the -4 (CGG)(n) microsatellite were identified. No association of this microsatellite with BCC was observed. Haplotypes containing T(1686)-T(3944) alleles were shown to be associated with an increased BCC risk in our study population. These data appear to be of great interest for further investigations in a larger group of transplant individuals. Our results do not support the hypothesis that common polymorphisms in the proximal 5

  20. Ancestral haplotype-based association mapping with generalized linear mixed models accounting for stratification.

    PubMed

    Zhang, Z; Guillaume, F; Sartelet, A; Charlier, C; Georges, M; Farnir, F; Druet, T

    2012-10-01

    In many situations, genome-wide association studies are performed in populations presenting stratification. Mixed models including a kinship matrix accounting for genetic relatedness among individuals have been shown to correct for population and/or family structure. Here we extend this methodology to generalized linear mixed models which properly model data under various distributions. In addition we perform association with ancestral haplotypes inferred using a hidden Markov model. The method was shown to properly account for stratification under various simulated scenari presenting population and/or family structure. Use of ancestral haplotypes resulted in higher power than SNPs on simulated datasets. Application to real data demonstrates the usefulness of the developed model. Full analysis of a dataset with 4600 individuals and 500 000 SNPs was performed in 2 h 36 min and required 2.28 Gb of RAM. The software GLASCOW can be freely downloaded from www.giga.ulg.ac.be/jcms/prod_381171/software. francois.guillaume@jouy.inra.fr Supplementary data are available at Bioinformatics online.