Yoshimura, Yasushi; Kurasawa, Mitsue; Yorozu, Keigo; Puig, Oscar; Bordogna, Walter; Harada, Naoki
2016-03-01
Alectinib is a highly selective next-generation anaplastic lymphoma kinase (ALK) inhibitor. Although alectinib shows inhibitory activity against various crizotinib-resistant ALK mutations in studies using cell-free kinase assays and Ba/F3 cell-based assays, it has not been tested for efficacy against non-small cell lung cancer (NSCLC) with the ALK mutations. We conducted in vitro and in vivo investigations into the antitumor activity of alectinib against an ALK-positive NSCLC cell line, SNU-2535, which harbors an ALK G1269A mutation. The clinical efficacy of alectinib against a NSCLC patient harboring ALK G1269A mutation was evaluated in the phase I part of the North American study. Alectinib exhibited antiproliferative activity against SNU-2535 cells in vitro with IC50 of 33.1 nM. Alectinib strongly inhibited phosphorylation of ALK and its downstream signaling molecules ERK1/2, AKT, and STAT3. In a mouse xenograft model, once-daily oral administration of alectinib for 21 days resulted in strong tumor regression. In addition, administration of alectinib for 100 days achieved continuous tumor regression without tumor regrowth in all mice. Notably, eradication of tumor cells was observed in half of the mice. In the clinical study, a patient with ALK G1269A mutation showed partial response to alectinib with a duration of response of 84 days. These results indicated that alectinib has potent antitumor activity against NSCLC cells harboring the crizotinib-resistant mutation ALK G1269A. It is expected that alectinib would provide a valuable therapeutic option for patients with NSCLC having not only native ALK but also crizotinib-resistant ALK mutations.
Yamaoka, Toshimitsu; Ohmori, Tohru; Ohba, Motoi; Arata, Satoru; Kishino, Yasunari; Murata, Yasunori; Kusumoto, Sojiro; Ishida, Hiroo; Shirai, Takao; Hirose, Takashi; Ohnishi, Tsukasa; Sasaki, Yasutsuna
2016-12-01
Met-amplified EGFR-tyrosine kinase inhibitor (TKI)-resistant non-small cell lung cancer (NSCLC) harboring an activating EGFR mutation is responsive to concurrent EGFR-TKI and Met-TKI treatment in a preclinical model. Here, we determined that Met-amplified gefitinib-resistant cells acquire dual resistance to inhibition of EGFR and Met tyrosine kinase activities. PC-9 lung adenocarcinoma cells harboring 15-bp deletions (Del E746_A750) in EGFR exon 19 were treated with increasing concentrations of the Met-TKI PHA665752 and 1 μmol/L gefitinib for 1 year; three resistant clones were established via Met amplification. The three dual-resistance cell lines (PC-9DR2, PC-9DR4, and PC-9DR6, designated as DR2, DR4, and DR6, respectively) exhibited different mechanisms for evading both EGFR and Met inhibition. None of the clones harbored a secondary mutation of EGFR T790M or a Met mutation. Insulin-like growth factor (IGF)/IGF1 receptor activation in DR2 and DR4 cells acted as a bypass signaling pathway. Met expression was attenuated to a greater extent in DR2 than in PC-9 cells, but was maintained in DR4 cells by overexpression of IGF-binding protein 3. In DR6 cells, Met was further amplified by association with HSP90, which protected Met from degradation and induced SET and MYND domain-containing 3 (SMYD3)-mediated Met transcription. This is the first report describing the acquisition of dual resistance mechanisms in NSCLC harboring an activating EGFR mutation to Met-TKI and EGFR-TKI following previous EGFR-TKI treatment. These results might inform the development of more effective therapeutic strategies for NSCLC treatment. Mol Cancer Ther; 15(12); 3040-54. ©2016 AACR. ©2016 American Association for Cancer Research.
Kim, Do-Hee; Kwak, Yeonui; Kim, Nam Doo; Sim, Taebo
2016-01-01
ABSTRACT Aberrant mutational activation of FGFR2 is associated with endometrial cancers (ECs). AP24534 (ponatinib) currently undergoing clinical trials has been known to be an orally available multi-targeted tyrosine kinase inhibitor. Our biochemical kinase assay showed that AP24534 is potent against wild-type FGFR1-4 and 5 mutant FGFRs (V561M-FGFR1, N549H-FGFR2, K650E-FGFR3, G697C-FGFR3, N535K-FGFR4) and possesses the strongest kinase-inhibitory activity on N549H-FGFR2 (IC50 of 0.5 nM) among all FGFRs tested. We therefore investigated the effects of AP24534 on endometrial cancer cells harboring activating FGFR2 mutations and explored the underlying molecular mechanisms. AP24534 significantly inhibited the proliferation of endometrial cancer cells bearing activating FGFR2 mutations (N549K, K310R/N549K, S252W) and mainly induced G1/S cell cycle arrest leading to apoptosis. AP24534 also diminished the kinase activity of immunoprecipitated FGFR2 derived from MFE-296 and MFE-280 cells and reduced the phosphorylation of FGFR2 and FRS2 on MFE-296 and AN3CA cells. AP24534 caused substantial reductions in ERK phosphorylation, PLCγ signaling and STAT5 signal transduction on ECs bearing FGFR2 activating mutations. Akt signaling pathway was also deactivated by AP24534. AP24534 causes the chemotherapeutic effect through mainly the blockade of ERK, PLCγ and STAT5 signal transduction on ECs. Moreover, AP24534 inhibited migration and invasion of endometrial cancer cells with FGFR2 mutations. In addition, AP24534 significantly blocked anchorage-independent growth of endometrial cancer cells. We, for the first time, report the molecular mechanisms by which AP24534 exerts antitumor effects on ECs with FGFR2 activating mutations, which would provide mechanistic insight into ongoing clinical investigations of AP24534 for ECs. PMID:26574622
Activating cysteinyl leukotriene receptor 2 (CYSLTR2) mutations in blue nevi
Möller, Inga; Murali, Rajmohan; Müller, Hansgeorg; Wiesner, Thomas; Jackett, Louise A; Scholz, Simone L; Cosgarea, Ioana; van de Nes, Johannes AP; Sucker, Antje; Hillen, Uwe; Schilling, Bastian; Paschen, Annette; Kutzner, Heinz; Rütten, Arno; Böckers, Martin; Scolyer, Richard A; Schadendorf, Dirk; Griewank, Klaus G
2017-01-01
Blue nevi are common melanocytic tumors arising in the dermal layer of the skin. Similar to uveal melanomas, blue nevi frequently harbor GNAQ and GNA11 mutations. Recently, recurrent CYSLTR2 and PLCB4 mutations were identified in uveal melanomas not harboring GNAQ or GNA11 mutations. All four genes (GNAQ, GNA11, CYSLTR2, and PLCB4) code for proteins involved in the same signaling pathway, which is activated by mutations in these genes. Given the related functional consequences of these mutations and the known genetic similarities between uveal melanoma and blue nevi, we analyzed a cohort of blue nevi to investigate whether CYSLTR2 and PLCB4 mutations occur in tumors lacking GNAQ or GNA11 mutations (as in uveal melanoma). A targeted next-generation sequencing assay covering known activating mutations in GNAQ, GNA11, CYSLTR2, PLCB4, KIT, NRAS, and BRAF was applied to 103 blue nevi. As previously reported, most blue nevi were found to harbor activating mutations in GNAQ (59%, n = 61), followed by less frequent mutations in GNA11 (16%, n = 17). Additionally, one BRAF (1%) and three NRAS (3%) mutations were detected. In three tumors (3%) harboring none of the aforementioned gene alterations, CYSLTR2 mutations were identified. All three CYSLTR2 mutations were the same c.386T > A, L129Q mutation previously identified in uveal melanoma that has been shown to lead to increased receptor activation and signaling. In summary, our study identifies CYSLTR2 L129Q alterations as a previously unrecognized activating mutation in blue nevi, occuring in a mutually exclusive fashion with known GNAQ and GNA11 mutations. Similar to GNAQ and GNA11 mutations, CYSLTR2 mutations, when present, are likely defining pathogenetic events in blue nevi. PMID:27934878
Activating cysteinyl leukotriene receptor 2 (CYSLTR2) mutations in blue nevi.
Möller, Inga; Murali, Rajmohan; Müller, Hansgeorg; Wiesner, Thomas; Jackett, Louise A; Scholz, Simone L; Cosgarea, Ioana; van de Nes, Johannes Ap; Sucker, Antje; Hillen, Uwe; Schilling, Bastian; Paschen, Annette; Kutzner, Heinz; Rütten, Arno; Böckers, Martin; Scolyer, Richard A; Schadendorf, Dirk; Griewank, Klaus G
2017-03-01
Blue nevi are common melanocytic tumors arising in the dermal layer of the skin. Similar to uveal melanomas, blue nevi frequently harbor GNAQ and GNA11 mutations. Recently, recurrent CYSLTR2 and PLCB4 mutations were identified in uveal melanomas not harboring GNAQ or GNA11 mutations. All four genes (GNAQ, GNA11, CYSLTR2, and PLCB4) code for proteins involved in the same signaling pathway, which is activated by mutations in these genes. Given the related functional consequences of these mutations and the known genetic similarities between uveal melanoma and blue nevi, we analyzed a cohort of blue nevi to investigate whether CYSLTR2 and PLCB4 mutations occur in tumors lacking GNAQ or GNA11 mutations (as in uveal melanoma). A targeted next-generation sequencing assay covering known activating mutations in GNAQ, GNA11, CYSLTR2, PLCB4, KIT, NRAS, and BRAF was applied to 103 blue nevi. As previously reported, most blue nevi were found to harbor activating mutations in GNAQ (59%, n=61), followed by less frequent mutations in GNA11 (16%, n=17). Additionally, one BRAF (1%) and three NRAS (3%) mutations were detected. In three tumors (3%) harboring none of the aforementioned gene alterations, CYSLTR2 mutations were identified. All three CYSLTR2 mutations were the same c.386T>A, L129Q mutation previously identified in uveal melanoma that has been shown to lead to increased receptor activation and signaling. In summary, our study identifies CYSLTR2 L129Q alterations as a previously unrecognized activating mutation in blue nevi, occuring in a mutually exclusive fashion with known GNAQ and GNA11 mutations. Similar to GNAQ and GNA11 mutations, CYSLTR2 mutations, when present, are likely defining pathogenetic events in blue nevi.
Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle
2011-07-01
Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.
Hodi, F Stephen; Corless, Christopher L; Giobbie-Hurder, Anita; Fletcher, Jonathan A; Zhu, Meijun; Marino-Enriquez, Adrian; Friedlander, Philip; Gonzalez, Rene; Weber, Jeffrey S; Gajewski, Thomas F; O'Day, Steven J; Kim, Kevin B; Lawrence, Donald; Flaherty, Keith T; Luke, Jason J; Collichio, Frances A; Ernstoff, Marc S; Heinrich, Michael C; Beadling, Carol; Zukotynski, Katherine A; Yap, Jeffrey T; Van den Abbeele, Annick D; Demetri, George D; Fisher, David E
2013-09-10
Amplifications and mutations in the KIT proto-oncogene in subsets of melanomas provide therapeutic opportunities. We conducted a multicenter phase II trial of imatinib in metastatic mucosal, acral, or chronically sun-damaged (CSD) melanoma with KIT amplifications and/or mutations. Patients received imatinib 400 mg once per day or 400 mg twice per day if there was no initial response. Dose reductions were permitted for treatment-related toxicities. Additional oncogene mutation screening was performed by mass spectroscopy. Twenty-five patients were enrolled (24 evaluable). Eight patients (33%) had tumors with KIT mutations, 11 (46%) with KIT amplifications, and five (21%) with both. Median follow-up was 10.6 months (range, 3.7 to 27.1 months). Best overall response rate (BORR) was 29% (21% excluding nonconfirmed responses) with a two-stage 95% CI of 13% to 51%. BORR was significantly greater than the hypothesized null of 5% and statistically significantly different by mutation status (7 of 13 or 54% KIT mutated v 0% KIT amplified only). There were no statistical differences in rates of progression or survival by mutation status or by melanoma site. The overall disease control rate was 50% but varied significantly by KIT mutation status (77% mutated v 18% amplified). Four patients harbored pretreatment NRAS mutations, and one patient acquired increased KIT amplification after treatment. Melanomas that arise on mucosal, acral, or CSD skin should be assessed for KIT mutations. Imatinib can be effective when tumors harbor KIT mutations, but not if KIT is amplified only. NRAS mutations and KIT copy number gain may be mechanisms of therapeutic resistance to imatinib.
Hussein, Yaser R; Weigelt, Britta; Levine, Douglas A; Schoolmeester, J Kenneth; Dao, Linda N; Balzer, Bonnie L; Liles, Georgia; Karlan, Beth; Köbel, Martin; Lee, Cheng-Han; Soslow, Robert A
2015-04-01
The Cancer Genome Atlas described four major genomic groups of endometrial carcinomas, including a POLE ultramutated subtype comprising ∼10% of endometrioid adenocarcinoma, characterized by POLE exonuclease domain mutations, ultrahigh somatic mutation rates, and favorable outcome. Our aim was to examine the morphological and clinicopathological features of ultramutated endometrial carcinomas harboring somatic POLE exonuclease domain mutations. Hematoxylin and eosin slides and pathology reports for 8/17 POLE-mutated endometrial carcinomas described in the Cancer Genome Atlas study were studied; for the remaining cases, virtual whole slide images publicly available at cBioPortal (www.cbioportal.org) were examined. A second cohort of eight POLE mutated endometrial carcinomas from University of Calgary was also studied. Median age was 55 years (range 33-87 years). Nineteen patients presented as stage I, 1 stage II, and 5 stage III. The majority of cases (24 of the 25) demonstrated defining morphological features of endometrioid differentiation. The studied cases were frequently high grade (60%) and rich in tumor-infiltrating lymphocytes and/or peri-tumoral lymphocytes (84%); many tumors showed morphological heterogeneity (52%) and ambiguity (16%). Foci demonstrating severe nuclear atypia led to concern for serous carcinoma in 28% of cases. At the molecular level, the majority of the Cancer Genome Atlas POLE-mutated tumors were microsatellite stable (65%), and TP53 mutations were present in 35% of cases. They also harbored mutations in PTEN (94%), FBXW7 (82%), ARID1A (76%), and PIK3CA (71%). All patients from both cohorts were alive without disease, and none of the patients developed recurrence at the time of follow-up (median 33 months; range 2-102 months). In conclusion, the recognition of ultramutated endometrial carcinomas with POLE exonuclease domain mutation is important given their favorable outcome. Our histopathological review revealed that these tumors are
A MELAS syndrome family harboring two mutations in mitochondrial genome.
Choi, Byung-Ok; Hwang, Jung Hee; Kim, Joonki; Cho, Eun Min; Cho, Sun Young; Hwang, Su Jin; Lee, Hyang Woon; Kim, Song Ja; Chung, Ki Wha
2008-06-30
Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a genetically heterogeneous mitochondrial disorder with variable clinical symptoms. Here, from the sequencing of the entire mitochondrial genome, we report a Korean MELAS family harboring two homoplasmic missense mutations, which were reported 9957T>C (Phe251Leu) transition mutation in the cytochrome c oxidase subunit 3 (COX3) gene and a novel 13849A>C (Asn505His) transversion mutation in the NADH dehydrogenase subunit 5 (ND5) gene. Neither of these mutations was found in 205 normal controls. Both mutations were identified from the proband and his mother, but not his father. The patients showed cataract symptom in addition to MELAS phenotype. We believe that the 9957T>C mutation is pathogenic, however, the 13849A>C mutation is of unclear significance. It is likely that the 13849A>C mutation might function as the secondary mutation which increase the expressivity of overlapping phenotypes of MELAS and cataract. This study also demonstrates the importance of full sequencing of mtDNA for the molecular genetic understanding of mitochondrial disorders.
A MELAS syndrome family harboring two mutations in mitochondrial genome
Choi, Byung-Ok; Hwang, Jung Hee; Kim, Joonki; Cho, Eun Min; Cho, Sun Young; Hwang, Su Jin; Lee, Hyang Woon; Kim, Song Ja
2008-01-01
Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a genetically heterogeneous mitochondrial disorder with variable clinical symptoms. Here, from the sequencing of the entire mitochondrial genome, we report a Korean MELAS family harboring two homoplasmic missense mutations, which were reported 9957T > C (Phe251Leu) transition mutation in the cytochrome c oxidase subunit 3 (COX3) gene and a novel 13849A > C (Asn505His) transversion mutation in the NADH dehydrogenase subunit 5 (ND5) gene. Neither of these mutations was found in 205 normal controls. Both mutations were identified from the proband and his mother, but not his father. The patients showed cataract symptom in addition to MELAS phenotype. We believe that the 9957T > C mutation is pathogenic, however, the 13849A > C mutation is of unclear significance. It is likely that the 13849A > C mutation might function as the secondary mutation which increase the expressivity of overlapping phenotypes of MELAS and cataract. This study also demonstrates the importance of full sequencing of mtDNA for the molecular genetic understanding of mitochondrial disorders. PMID:18587274
Chumsri, Saranya; Weidler, Jodi; Ali, Siraj; Balasubramanian, Sohail; Wallweber, Gerald; DeFazio-Eli, Lisa; Chenna, Ahmed; Huang, Weidong; DeRidder, Angela; Goicocheal, Lindsay; Perez, Edith A
2015-09-01
In the current genomic era, increasing evidence demonstrates that approximately 2% of HER2-negative breast cancers, by current standard testings, harbor activating mutations of ERBB2. However, whether patients with HER2-negative breast cancer with activating mutations of ERBB2 also experience response to anti-HER2 therapies remains unclear. This case report describes a patient with HER2-nonamplified heavily pretreated breast cancer who experienced prolonged response to trastuzumab in combination with pertuzumab and fulvestrant. Further molecular analysis demonstrated that her tumors had an elevated HER2 dimerization that corresponded to ERBB2 S310F mutation. Located in the extracellular domain of the HER2 protein, this mutation was reported to promote noncovalent dimerization that results in the activation of the downstream signaling pathways. This case highlights the fact that HER2-targeted therapy may be valuable in patients harboring an ERBB2 S310F mutation. Copyright © 2015 by the National Comprehensive Cancer Network.
Zeng, Yunxin; Zhang, Jingwen; Li, Xiaoqing; Zhang, Ling; Liu, Jiajun
2018-06-01
T315I mutation is the most common BCR-ABL mutation and confers resistance to all the first and second generation BCR-ABL tyrosine kinases, including nilotinib and dasatinib. We report a high risk chronic myelogenous leukemia (CML) patient harboring the T315I mutation treated by Interferon-α (INF-α) solo and subsequently combined with dasatinib. Hematological investigation, bone marrow cytology inspection, chromosomal analysis (G-banding), and real-time quantitative polymerase chain reaction (RQ-PCR) were performed on a 47-year-old male patient. After 8 months IFN-α monotherapy, the patient lost the T315I mutation but acquired a new F359V mutation. After 2 months on dasatinib and INF-α treatment, the patient achieved complete hematologic response (CHR). IFN-α based combination therapy could be a viable treatment option for CML patients harboring T315I BCR-ABL mutation.
Nishinarita, Noriko; Igawa, Satoshi; Kasajima, Masashi; Kusuhara, Seiichiro; Harada, Shinya; Okuma, Yuriko; Sugita, Keisuke; Ozawa, Takahiro; Fukui, Tomoya; Mitsufuji, Hisashi; Yokoba, Masanori; Katagiri, Masato; Kubota, Masaru; Sasaki, Jiichiro; Naoki, Katsuhiko
2018-04-26
Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKIs) therapy has been recognized as the standard treatment for patients with non-small cell lung cancer (NSCLC) harboring EGFR mutations. However, resistance to EGFR-TKIs has been observed in certain subpopulations of these patients. We aimed to evaluate the impact of smoking history on the efficacy of EGFR-TKIs. The records of patients (n = 248) with NSCLC harboring activating EGFR mutations who were treated with gefitinib or erlotinib at our institution between March 2010 and June 2016 were retrospectively reviewed, and the treatment outcomes were evaluated. The overall response rate and median progression-free survival (PFS) were 59.7% and 10.7 months, respectively. The overall response rate was significantly higher in the ex- and nonsmokers than in the current smokers (64.6 vs. 51.1%, p = 0.038). PFS also differed significantly between the current smokers and the ex- and nonsmokers (12.4 vs. 7.4 months, p = 0.016). Multivariate analysis identified smoking history as an independent predictor of PFS and overall survival. The clinical data obtained in this study provide a valuable rationale for considering smoking history as a predictor of the efficacy of EGFR-TKI in NSCLC patients harboring activating EGFR mutations. © 2018 S. Karger AG, Basel.
Wang, Yuehong; Shen, Yi Hong; Ma, Shanni; Zhou, Jianying
2015-09-01
The present study reports the case of an 84-year-old male with primary pulmonary large cell neuroendocrine carcinoma (LCNEC) harboring an epidermal growth factor receptor (EGFR) gene mutation that exhibited a long-lasting response to the EGFR-tyrosine kinase inhibitor (EGFR-TKI) icotinib. The patient had an extensive smoking history, a poor performance status, and presented with an irregular mass in the middle lobe of the right lung on computed tomography (CT) and an enlarged left supraclavicular lymph node on physical examination. Right middle lobe bronchial brushing during fiberoptic bronchoscopy identified poorly-differentiated cancer cells. The left supraclavicular lymph node was biopsied and a diagnosis of metastatic LCNEC was determined. Furthermore, an EGFR exon 19 deletion was identified by DNA sequencing. Following diagnosis, icotinib was administered at a dose of 125 mg three times a day. Chest CT scans were performed after 1 month of treatment, which indicated that the tumor was in partial remission. This marked response to icotinib lasted for 8 months. Thus, the present case illustrates the possibility of identifying EGFR mutations in LCNEC and indicates that EGFR-tyrosine kinase inhibitors may be an alternative treatment strategy for patients with LCNEC harboring activating EGFR mutations.
Floc'h, Nicolas; Martin, Matthew J; Riess, Jonathan W; Orme, Jonathan P; Staniszewska, Anna D; Ménard, Ludovic; Cuomo, Maria Emanuela; O'Neill, Daniel J; Ward, Richard A; Finlay, M Raymond V; McKerrecher, Darren; Cheng, Mingshan; Vang, Daniel P; Burich, Rebekah A; Keck, James G; Gandara, David R; Mack, Philip C; Cross, Darren A E
2018-05-01
EGFR exon 20 insertions (Ex20Ins) account for 4% to 10% of EGFR activating mutations in non-small cell lung cancer (NSCLC). EGFR Ex20Ins tumors are generally unresponsive to first- and second-generation EGFR inhibitors, and current standard of care for NSCLC patients with EGFR Ex20Ins is conventional cytotoxic chemotherapy. Therefore, the development of an EGFR TKI that can more effectively target NSCLC with EGFR Ex20Ins mutations represents a major advance for this patient subset. Osimertinib is a third-generation EGFR TKI approved for the treatment of advanced NSCLC harboring EGFR T790M; however, the activity of osimertinib in EGFR Ex20Ins NSCLC has yet to be fully assessed. Using CRISPR-Cas 9 engineered cell lines carrying the most prevalent Ex20Ins mutations, namely Ex20Ins D770_N771InsSVD (22%) or Ex20Ins V769_D770InsASV (17%), and a series of patient-derived xenografts, we have characterized osimertinib and AZ5104 (a circulating metabolite of osimertinib) activities against NSCLC harboring Ex20Ins. We report that osimertinib and AZ5104 inhibit signaling pathways and cellular growth in Ex20Ins mutant cell lines in vitro and demonstrate sustained tumor growth inhibition of EGFR-mutant tumor xenograft harboring the most prevalent Ex20Ins in vivo The antitumor activity of osimertinib and AZ5104 in NSCLC harboring EGFR Ex20Ins is further described herein using a series of patient-derived xenograft models. Together these data support clinical testing of osimertinib in patients with EGFR Ex20Ins NSCLC. Mol Cancer Ther; 17(5); 885-96. ©2018 AACR . ©2018 American Association for Cancer Research.
Takeda, Masayuki; Sakai, Kazuko; Hayashi, Hidetoshi; Tanaka, Kaoru; Tanizaki, Junko; Takahama, Takayuki; Haratani, Koji; Nishio, Kazuto; Nakagawa, Kazuhiko
2018-04-20
Unlike common epidermal growth factor receptor gene ( EGFR ) mutations that confer sensitivity to tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer (NSCLC), mutations in exon 20 of either EGFR or the human EGFR2 gene ( HER2 ) are associated with insensitivity to EGFR-TKIs, with treatment options for patients with such mutations being limited. Clinical characteristics, outcome of EGFR-TKI or nivolumab treatment, and the presence of coexisting mutations were reviewed for NSCLC patients with exon-20 mutations of EGFR or HER2 as detected by routine application of an amplicon-based next-generation sequencing panel. Between July 2013 and June 2017, 206 patients with pathologically confirmed lung cancer were screened for genetic alterations including HER2 and EGFR mutations. Ten patients harbored HER2 exon-20 insertions (one of whom also carried an exon-19 deletion of EGFR ), and 12 patients harbored EGFR exon-20 mutations. Five of the 13 patients with EGFR mutations were treated with EGFR-TKIs, two of whom manifested a partial response, two stable disease, and one progressive disease. Among the seven patients treated with nivolumab, one patient manifested a partial response, three stable disease, and three progressive disease, with most (86%) of these patients discontinuing treatment as a result of disease progression within 4 months. The H1047R mutation of PIK3CA detected in one patient was the only actionable mutation coexisting with the exon-20 mutations of EGFR or HER2 . Potentially actionable mutations thus rarely coexist with exon-20 mutations of EGFR or HER2 , and EGFR-TKIs and nivolumab show limited efficacy in patients with such exon-20 mutations.
Imai, Hisao; Minemura, Hiroyuki; Sugiyama, Tomohide; Yamada, Yutaka; Kaira, Kyoichi; Kanazawa, Kenya; Kasai, Takashi; Kaburagi, Takayuki; Minato, Koichi
2018-05-08
Epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) is effective as first-line chemotherapy for patients with advanced non-small-cell lung cancer (NSCLC) harboring sensitive EGFR mutations. However, whether the efficacy of second-line cytotoxic drug chemotherapy after first-line EGFR-TKI treatment is similar to that of first-line cytotoxic drug chemotherapy in elderly patients aged ≥ 75 years harboring sensitive EGFR mutations is unclear. Therefore, we aimed to investigate the efficacy and safety of cytotoxic drug chemotherapy after first-line EGFR-TKI treatment in elderly patients with NSCLC harboring sensitive EGFR mutations. We retrospectively evaluated the clinical effects and safety profiles of second-line cytotoxic drug chemotherapy after first-line EGFR-TKI treatment in elderly patients with NSCLC harboring sensitive EGFR mutations (exon 19 deletion/exon 21 L858R mutation). Between April 2008 and December 2015, 78 elderly patients with advanced NSCLC harboring sensitive EGFR mutations received first-line EGFR-TKI at four Japanese institutions. Baseline characteristics, regimens, responses to first- and second-line treatments, whether or not patients received subsequent treatment, and if not, the reasons for non-administration were recorded. Overall, 20 patients with a median age of 79.5 years (range 75-85 years) were included in our analysis. The overall response, disease control, median progression-free survival, and overall survival rates were 15.0, 60.0%, 2.4, and 13.2 months, respectively. Common adverse events included leukopenia, neutropenia, anemia, thrombocytopenia, malaise, and anorexia. Major grade 3 or 4 toxicities included leukopenia (25.0%) and neutropenia (45.0%). No treatment-related deaths were noted. Second-line cytotoxic drug chemotherapy after first-line EGFR-TKI treatment among elderly patients with NSCLC harboring sensitive EGFR mutations was effective and safe and showed equivalent outcomes to first
Radiological Features of Brain Metastases from Non-small Cell Lung Cancer Harboring EGFR Mutation.
Takamori, Shinkichi; Toyokawa, Gouji; Shimokawa, Mototsugu; Kinoshita, Fumihiko; Kozuma, Yuka; Matsubara, Taichi; Haratake, Naoki; Akamine, Takaki; Mukae, Nobutaka; Hirai, Fumihiko; Tagawa, Tetsuzo; Oda, Yoshinao; Iwaki, Toru; Iihara, Koji; Honda, Hiroshi; Maehara, Yoshihiko
2018-06-01
To investigate the radiological features on computed tomography (CT) of brain metastasis (BM) from epidermal growth factor receptor (EGFR)-mutated non-small cell lung cancer (NSCLC). Thirty-four patients with NSCLC with BMs who underwent surgical resection of the BMs at the Department of Neurosurgery, Kyushu University from 2005 to 2016 were enrolled in the study. The EGFR statuses of the 34 BMs were investigated. Radiological features, including the number, size, and location of the tumor, were delineated by CT. Patients with EGFR-mutated BMs had significantly higher frequencies of multiple metastases than those with the non-EGFR-mutated type (p=0.042). BMs harboring mutations in EGFR were more frequently observed in the central area of the brain compared to those without mutations in EGFR (p=0.037). Careful follow-up of patients with EGFR-mutated NSCLC may be necessary given the high frequencies of multiple BMs and their location in the central area of the brain. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Zhou, Xiaoyang; Wang, Lulu; Du, Yinan; Xie, Fei; Li, Liang; Liu, Yu; Liu, Chuanhong; Wang, Shiqiang; Zhang, Shibing; Huang, Xingxu; Wang, Yong; Wei, Hong
2016-01-01
Precise genetic mutation of model animals is highly valuable for functional investigation of human mutations. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced homology-directed repair (HDR) is usually used for precise genetic mutation, being limited by the relatively low efficiency compared with that of non-homologous end joining (NHEJ). Although inhibition of NHEJ was shown to enhance HDR-derived mutation, in this work, without inhibition of NHEJ, we first generated gene-modified pigs harboring precise orthologous human mutation (Sox10 c.A325>T) via CRISPR/Cas9-induced HDR in zygotes using single-strand oligo DNA (ssODN) as template with an efficiency as high as 80%, indicating that pig zygotes exhibited high activities of HDR relative to NHEJ and were highly amendable to genetic mutation via CIRSPR/Cas9-induced HDR. Besides, we found a higher concentration of ssODN remarkably reduced HDR-derived mutation in pig zygotes, suggesting a possible balance for optimal HDR-derived mutation in zygotes between the excessive accessibility to HDR templates and the activities of HDR relative to NHEJ which appeared to be negatively correlated to ssODN concentration. In addition, the HDR-derived mutation, as well as those from NHEJ, extensively integrated into various tissues including gonad of founder pig without detected off-targeting, suggesting CRISPR/Cas9-induced HDR in zygotes is a reliable approach for precise genetic mutation in pigs. © 2015 WILEY PERIODICALS, INC.
Koba, Taro; Kijima, Takashi; Takimoto, Takayuki; Hirata, Haruhiko; Naito, Yujiro; Hamaguchi, Masanari; Otsuka, Tomoyuki; Kuroyama, Muneyoshi; Nagatomo, Izumi; Takeda, Yoshito; Kida, Hiroshi; Kumanogoh, Atsushi
2017-01-01
Abstract Rationale: Most of nonsmall cell lung cancer (NSCLC) patients harboring epidermal growth factor receptor (EGFR) activating mutations eventually acquire resistance to the first EGFR-tyrosine kinase inhibitors (TKIs) therapy after varying periods of treatment. Of note, approximately one-third of those patients develop brain metastases, which deteriorate their quality of life and survival. The effect of systemic chemotherapy on brain metastases after acquisition of EGFR-TKI resistance is limited, and thus far, whole-brain radiation therapy, which may cause the harmful effect on neurocognitive functions, has been the only established therapeutic option for especially symptomatic brain metastases. Osimertinib is a third-generation oral, potent, and irreversible EGFR-TKI. It can bind to EGFRs with high affinity even when the EGFR T790M mutation exists in addition to the sensitizing mutations. Its clinical efficacy for NSCLC patients harboring the T790M mutation has already been shown; however, the evidence of osimertinib on brain metastases has not been documented well, especially in terms of the appropriate timing for treatment and its response evaluation. Patient concerns, Diagnoses, and Interventions: We experienced 2 NSCLC patients with the EGFR T790M mutation; a 67-year-old woman with symptomatic multiple brain metastases administered osimertinib as seventh-line chemotherapy, and a 76-year old man with an asymptomatic single brain metastasis administered osimertinib as fifth-line chemotherapy. Outcomes: These patients showed great response to osimertinib within 2 weeks without radiation therapy. Lessons: These are the first reports to reveal the rapid response of the brain metastases to osimertinib within 2 weeks. These cases suggest the possibility that preemptive administration of osimertinib may help patients to postpone or avoid radiation exposures. In addition, rapid reassessment of the effect of osimertinib on brain metastases could prevent patients
Sergerie, Yan; Boivin, Guy
2008-01-01
Drug-resistant herpes simplex virus type 1 (HSV-1) recombinant strains harboring mutations in the thymidine kinase and/or the DNA polymerase genes were evaluated for their susceptibility to various antivirals in the presence of 25 microg/ml of hydroxyurea (HyU). The latter compound decreased the 50% inhibitory concentrations of acyclovir by 1.5-3.8-fold and that of cidofovir by 2.7-14.4-fold. However, HyU did not affect the susceptibilities of the various recombinant mutants to foscarnet. Hydroxyurea, a ribonucleotide reductase inhibitor, can increase the activity of nucleoside/nucleotide analogues against drug-resistant viruses.
Yang, Minglei; Tong, Xiaoling; Xu, Xiang; Zheng, Enkuo; Ni, Junjun; Li, Junfang; Yan, Junrong; Shao, Yang W; Zhao, Guofang
2018-07-01
Missense mutations in EGFR exon 20 are rare in non-small-cell lung cancer (NSCLC), and mostly insensitive to the first generation tyrosine kinase inhibitors (TKIs) of EGFR. However, their responses to the third generation TKI are unclear. Here, we reported a patient with advanced NSCLC harboring a rare EGFR H773L/V774M mutation complex. Although he was irresponsive to the first generation TKI gefitinib, he demonstrated sustained disease control to osimertinib, suggesting that this complex is an activating mutation of EGFR and can be suppressed by osimertinib. The follow-up genetic profiling revealed multiple acquired new mutations that might be related to his resistance to osimertinib. This finding would provide valuable experience for future treatment of the same mutations. Copyright © 2018 Elsevier B.V. All rights reserved.
Khan, Arif O; Aldahmesh, Mohammed A; Meyer, Brian
2008-04-01
To correlate ophthalmic findings with carrier status for a severe Norrie disease (ND) gene mutation (C95F). Prospective interventional case series. Six potential carriers and 1 obligate carrier from a family harboring the mutation. An ophthalmologist blind to the pedigree performed a full ophthalmic examination for the 7 asymptomatic family members. A peripheral blood sample was collected from each for ND gene sequencing. Ophthalmic examination findings (with attention to the presence or absence of retinal findings) and results of ND gene sequencing. Three carriers were identified by molecular genetics, and all 3 of them had peripheral retinal abnormality. However, 3 of the 4 genetically identified noncarriers also exhibited peripheral retinal abnormality. Two of these noncarriers with retinal findings were the offspring of a confirmed noncarrier. The genetically identified noncarrier with a normal peripheral retinal examination was the daughter of an obligate carrier. The presence of peripheral retinal changes was not useful for carrier prediction in a family harboring ND. There are likely additional loci responsible for phenotypic expression.
Mutation-Independent Activation of the Anaplastic Lymphoma Kinase in Neuroblastoma.
Regairaz, Marie; Munier, Fabienne; Sartelet, Hervé; Castaing, Marine; Marty, Virginie; Renauleaud, Céline; Doux, Camille; Delbé, Jean; Courty, José; Fabre, Monique; Ohta, Shigeru; Vielh, Philippe; Michiels, Stefan; Valteau-Couanet, Dominique; Vassal, Gilles
2016-02-01
Activating mutations of anaplastic lymphoma kinase (ALK) have been identified as important players in neuroblastoma development. Our goal was to evaluate the significance of overall ALK activation in neuroblastoma. Expression of phosphorylated ALK, ALK, and its putative ligands, pleiotrophin and midkine, was screened in 289 neuroblastomas and 56 paired normal tissues. ALK was expressed in 99% of tumors and phosphorylated in 48% of cases. Pleiotrophin and midkine were expressed in 58% and 79% of tumors, respectively. ALK activation was significantly higher in tumors than in paired normal tissues, together with ALK and midkine expression. ALK activation was largely independent of mutations and correlated with midkine expression in tumors. ALK activation in tumors was associated with favorable features, including a younger age at diagnosis, hyperdiploidy, and detection by mass screening. Antitumor activity of the ALK inhibitor TAE684 was evaluated in wild-type or mutated ALK neuroblastoma cell lines and xenografts. TAE684 was cytotoxic in vitro in all cell lines, especially those harboring an ALK mutation. TAE684 efficiently inhibited ALK phosphorylation in vivo in both F1174I and R1275Q xenografts but demonstrated antitumor activity only against the R1275Q xenograft. In conclusion, ALK activation occurs frequently during neuroblastoma oncogenesis, mainly through mutation-independent mechanisms. However, ALK activation is not associated with a poor outcome and is not always a driver of cell proliferation and/or survival in neuroblastoma. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Yeh, Chun-Nan; Chen, Ming-Huang; Chen, Yen-Yang; Yang, Ching-Yao; Yen, Chueh-Chuan; Tzen, Chin-Yuan; Chen, Li-Tzong; Chen, Jen-Shi
2017-07-04
Gastrointestinal stromal tumors (GISTs) are caused by the constitutive activation of KIT or platelet-derived growth factor receptor alpha (PDGFRA) mutations. Imatinib selectively inhibits KIT and PDGFR, leading to disease control for 80%-90% of patients with metastatic GIST. Imatinib resistance can occur within a median of 2-3 years due to secondary mutations in KIT. According to preclinical studies, both imatinib and sunitinib are ineffective against exon 17 mutations. However, the treatment efficacy of regorafenib for patients with GIST with exon 17 mutations is still unknown. Documented patients with GIST with exon 17 mutations were enrolled in this study. Patients received 160 mg of oral regorafenib daily on days 1-21 of a 28-day cycle. The primary end point of this trial was the clinical benefit rate (CBR; i.e., complete or partial response [PR], as well as stable disease [SD]) at 16 weeks. The secondary end points of this study included progression free survival (PFS), overall survival, and safety. Between June 2014 to May 2016, 18 patients were enrolled (15 of which were eligible for response evaluation). The CBR at 16 weeks was 93.3% (14 of 15; 6 PR and 8 SD). The median PFS was 22.1 months. The most common grade 3 toxicities were hand-and-foot skin reactions (10 of 18; 55.6%), followed by hypertension (5 of 18; 27.8%). Regorafenib significantly prolonged PFS in patients with advanced GIST harboring secondary mutations of exon 17. A phase III trial of regorafenib versus placebo is warranted. This trial is registered at ClinicalTrials.gov in November 2015, number NCT02606097.Key message: This phase II trial was conducted to assess the efficacy and safety of regorafenib in patients with GIST with exon 17 mutations. The results provide strong evidence that regorafenib significantly prolonged PFS in patients with advanced GIST harboring secondary mutations of exon 17.
Gow, Chien-Hung; Hsieh, Min-Shu; Wu, Shang-Gin; Shih, Jin-Yuan
2017-01-01
Recurrent somatic splice-site alterations at MET exon 14 (MET Δ14 ), which result in exon skipping and MET proto-oncogene, receptor tyrosine kinase (MET) activation, have been characterised. However, their demographic features and clinical outcomes in East Asian lung cancer patients have yet to be determined. A one-step reverse transcription-polymerase chain reaction (RT-PCR), using RNA samples from 850 East Asian lung cancer patients, was performed in order to detect MET Δ14 and five other major driver mutations, including those in the EGFR, KRAS, ALK, HER2, and ROS1 genes. Immunohistochemistry (IHC) was used to confirm the overexpression of MET in patients harbouring the MET Δ14 mutation. We analysed the demographic data and clinical outcomes of MET Δ14 mutation positive lung cancer patients and compared them to those of MET Δ14 mutation negative lung cancer patients. In total, 27 lung adenocarcinoma (ADC) patients and 1 squamous cell carcinoma patient with the MET Δ14 mutation were identified. The overall incidence was 3.3% for lung cancer and 4.0% for lung ADC. IHC demonstrated that the majority of lung cancer patients harboring a MET Δ14 mutation exhibited a strong cytoplasmic expression of MET. MET Δ14 mutation positive patients were generally quite elderly individuals. Stage IV MET Δ14 mutation positive lung cancer patients receiving no specific anti-MET therapy were observed to have a similar overall survival (OS) compared to patients in the all negative group (P>0.05). In the multivariate analysis, mutation status was found not to be a major risk factor for OS in lung cancer patients without appropriate tyrosine kinase inhibitors treatment. The OS of MET Δ14 mutation positive lung cancer patients is comparable to that of the major driver gene mutation negative lung cancer patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Activating MAPK1 (ERK2) mutation in an aggressive case of disseminated juvenile xanthogranuloma
Chakraborty, Rikhia; Hampton, Oliver A.; Abhyankar, Harshal; Zinn, Daniel J.; Grimes, Amanda; Skull, Brooks; Eckstein, Olive; Mahmood, Nadia; Wheeler, David A.; Lopez-Terrada, Dolores; Peters, Tricia L.; Hicks, John M.; Elghetany, Tarek; Krance, Robert; Poulikakos, Poulikos I.; Merad, Miriam; McClain, Kenneth L.; Allen, Carl E.; Parsons, Donald W.
2017-01-01
Juvenile xanthogranuloma (JXG) is a rare histiocytic disorder that is usually benign and self-limiting. We present a case of atypical, aggressive JXG harboring a novel mitogen-activated protein kinase (MAPK) pathway mutation in the MAPK1 gene, which encodes mitogen-activated protein kinase 1 or extracellular signal-regulated 2 (ERK2). Our analysis revealed that the mutation results in constitutive ERK activation that is resistant to BRAF or MEK inhibitors but susceptible to an ERK inhibitor. These data highlight the importance of identifying specific MAPK pathway alterations as part of the diagnostic workup for patients with histiocytic disorders rather than initiating empiric treatment with MEK inhibitors. PMID:28512266
Spectrum of mutations in RARS-T patients includes TET2 and ASXL1 mutations.
Szpurka, Hadrian; Jankowska, Anna M; Makishima, Hideki; Bodo, Juraj; Bejanyan, Nelli; Hsi, Eric D; Sekeres, Mikkael A; Maciejewski, Jaroslaw P
2010-08-01
While a majority of patients with refractory anemia with ring sideroblasts and thrombocytosis harbor JAK2V617F and rarely MPLW515L, JAK2/MPL-negative cases constitute a diagnostic problem. 23 RARS-T cases were investigated applying immunohistochemical phospho-STAT5, sequencing and SNP-A-based karyotyping. Based on the association of TET2/ASXL1 mutations with MDS/MPN we studied molecular pattern of these genes. Two patients harbored ASXL1 and another 2 TET2 mutations. Phospho-STAT5 activation was present in one mutated TET2 and ASXL1 case. JAK2V617F/MPLW515L mutations were absent in TET2/ASXL1 mutants, indicating that similar clinical phenotype can be produced by various MPN-associated mutations and that additional unifying lesions may be present in RARS-T. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
Fan, Xiangshan; Liu, Biao; Xu, Haodong; Yu, Bo; Shi, Shanshan; Zhang, Jin; Wang, Xuan; Wang, Jiandong; Lu, Zhenfeng; Ma, Henghui; Zhou, Xiaojun
2013-08-01
Mutation analysis of epidermal growth factor receptor (EGFR) is essential in determining the therapeutic strategy for lung adenocarcinoma. Immunohistochemical (IHC) staining with EGFR mutation-specific antibodies of del E746-A750 in exon 19 and L858R in exon 21 has been evaluated in resection specimens in a few studies but rarely in biopsy samples. A total of 169 cases (78 biopsies and 91 resected specimens) of lung adenocarcinoma with EGFR mutation status predefined by direct DNA sequencing were histologically examined, and IHC was performed using EGFR mutation-specific antibodies of del E746-A750 and L858R. The cases with positive results by IHC but negative results by direct DNA sequencing were examined by amplified refractory mutation system. Our results showed that the frequency of EGFR mutations for both E746-A750 deletion and L858R mutation was 38.5% (65/169) by DNA sequencing or amplified refractory mutation system and 34.3% (58/169) by IHC in lung adenocarcinomas. Based on molecular test results, the overall sensitivity, specificity, positive predictive value, and negative predictive value of IHC using these 2 antibodies in all (biopsy/resection) cases were 87.7% (80%/94.3%), 99.0% (97.9%/100%), 98.3% (96%/100%), and 92.8% (88.7%/96.6%), respectively. Lung adenocarcinomas with a predominant acinar, papillary, lepidic, or solid growth pattern more often harbor EGFR mutation of del E746-A750 or L858R. In conclusion, the immunostaining with EGFR del E746-A750 and L858R mutation antibodies is a reliable screening method with high specificity and sensitivity for identifying the EGFR mutation in both resected and biopsied lung adenocarcinomas. Copyright © 2013 Elsevier Inc. All rights reserved.
Koba, Taro; Kijima, Takashi; Takimoto, Takayuki; Hirata, Haruhiko; Naito, Yujiro; Hamaguchi, Masanari; Otsuka, Tomoyuki; Kuroyama, Muneyoshi; Nagatomo, Izumi; Takeda, Yoshito; Kida, Hiroshi; Kumanogoh, Atsushi
2017-02-01
Most of nonsmall cell lung cancer (NSCLC) patients harboring epidermal growth factor receptor (EGFR) activating mutations eventually acquire resistance to the first EGFR-tyrosine kinase inhibitors (TKIs) therapy after varying periods of treatment. Of note, approximately one-third of those patients develop brain metastases, which deteriorate their quality of life and survival. The effect of systemic chemotherapy on brain metastases after acquisition of EGFR-TKI resistance is limited, and thus far, whole-brain radiation therapy, which may cause the harmful effect on neurocognitive functions, has been the only established therapeutic option for especially symptomatic brain metastases. Osimertinib is a third-generation oral, potent, and irreversible EGFR-TKI. It can bind to EGFRs with high affinity even when the EGFR T790M mutation exists in addition to the sensitizing mutations. Its clinical efficacy for NSCLC patients harboring the T790M mutation has already been shown; however, the evidence of osimertinib on brain metastases has not been documented well, especially in terms of the appropriate timing for treatment and its response evaluation. We experienced 2 NSCLC patients with the EGFR T790M mutation; a 67-year-old woman with symptomatic multiple brain metastases administered osimertinib as seventh-line chemotherapy, and a 76-year old man with an asymptomatic single brain metastasis administered osimertinib as fifth-line chemotherapy. These patients showed great response to osimertinib within 2 weeks without radiation therapy. These are the first reports to reveal the rapid response of the brain metastases to osimertinib within 2 weeks. These cases suggest the possibility that preemptive administration of osimertinib may help patients to postpone or avoid radiation exposures. In addition, rapid reassessment of the effect of osimertinib on brain metastases could prevent patients from being too late to receive essential radiotherapy.
Yamada, Seiji; Kipp, Benjamin R; Voss, Jesse S; Giannini, Caterina; Raghunathan, Aditya
2016-02-01
Pleomorphic xanthoastrocytoma (PXA) has rarely been reported in combination with infiltrating glioma, historically interpreted as a "collision tumor." Isocitrate dehydrogenase 1 (IDH1) and BRAF V600E mutations are usually not concurrent. The former is typical of adult infiltrating gliomas, and the latter is identified in a variety of primary central nervous system neoplasms, including PXA, ganglioglioma, pilocytic astrocytoma, and rarely infiltrating gliomas. We report the case of a 56-year-old man presenting with seizures and headaches. Magnetic resonance imaging revealed a large right temporal lobe mass with low T1 and high T2/FLAIR signal and a discrete contrast-enhancing focus. Histologically, the tumor showed 2 distinct components: an infiltrating astrocytoma harboring 5 mitoses/10 high-power fields and a relatively circumscribed focus, resembling PXA with, at most, 2 mitoses/10 high-power fields. No microvascular proliferation or necrosis was present in either component. The infiltrating astrocytoma component contained numerous axons, whereas the PXA-like component had sparse axons, as demonstrated by the neurofilament immunostain. Both components were positive for the mutant IDH1 R132H and showed loss of ATRX expression, whereas BRAF V600E was restricted to the PXA-like component. On sequencing of the 2 components separately after microdissection, both showed identical IDH1 R132H and TP53 R273C point mutations, whereas the BRAF V600E mutation was limited to the PXA-like component. These findings are consistent with clonal expansion of a morphologically distinct focus, harboring a private BRAF V600E mutation within an IDH1-mutant glioma. Intratumoral heterogeneity and clonal evolution, as seems to have occurred here, suggest reevaluation of "collision tumors" as a concept.
Liao, Chengshui; Wang, Xiaoli; Tian, Wenjing; Zhang, Mengke; Zhang, Chunjie; Li, Yinju; Wu, Tingcai; Cheng, Xiangchao
2017-08-25
Although there are 125 predicted DNase Ⅱ-like family genes in the Trichinella spiralis genome, plancitoxin-1-like (Ts-Pt) contains the HKD motif, a typical conserved region of DNase Ⅱ, in N- and C-terminal. It is generally believed that histidine is the active site in DNase Ⅱ. To study the nuclease activity of recombinant Ts-Pt with mutations in the active site from T. spiralis, different fragments of the mutated Ts-Pt genes were cloned using overlap PCR technique and inserted into the expressing vector pET-28a(+), and transformed into Escherichia coli Rosseta (DE3). The fusion proteins were purified by Ni-NTA affinity chromatography and SDS-PAGE. Nuclease activity of the recombinant proteins was detected by agarose gel electrophoresis and nuclease-zymography. The recombinant plasmids harboring the mutated Ts-Pt genes were constructed and expressed as inclusive body in a prokaryotic expression system. After renaturation in vitro, the recombinant proteins had no nuclease activity according to agarose gel electrophoresis. However, the expressed proteins as inclusive body displayed the ability to degrade DNA after renaturation in gel. And the nuclease activity was not affected after subjected to mutation of active site in N- and C-termini of Ts-Pt. These results provide the basis to study the relationship between DNase Ⅱ-like protein family and infection of T. spiralis.
Wang, Lulu; Li, Yan; Li, Luchun; Wu, Zhijuan; Yang, Dan; Ma, Huiwen; Wang, Donglin
2018-01-01
This study was conducted to compare the efficacy of a combination of icotinib and chemotherapy with icotinib or chemotherapy alone in untreated non-small cell lung cancer (NSCLC) patients harboring epidermal growth factor receptor (EGFR)-sensitive mutations and to analyze the curative effect of different treatments on different genetic mutations (EGFR 19 exon deletion and L858R mutation) in a real-life setting. One hundred ninety-one patients were studied in this retrospective analysis from January 2013 to December 2015. The baseline characteristics, curative effects and adverse events of patients were analyzed. The primary endpoint was progression free survival (PFS). Longer PFS and overall survival (OS), and better objective response rate (ORR) were observed in the combination group compared to icotinib or chemotherapy along. For patients with an EGFR 19 exon deletion, the PFS, OS, and ORR in the combination group were superior to those in the icotinib or chemotherapy group. For the patients with the EGFR L858R mutation, better PFS and ORR were observed in the combination group, but OS was not obviously prolonged. Grade 3 or 4 adverse events were most commonly reported with combination therapy or chemotherapy alone. No possible drug-related interstitial lung disease or of drug related deaths occurred. The combination of icotinib and chemotherapy in patients with untreated NSCLC harboring sensitive EGFR mutations resulted in improved PFS and OS, especially in those who harbored the EGFR exon 19 deletion.
Wang, Lulu; Li, Yan; Li, Luchun; Wu, Zhijuan; Yang, Dan; Ma, Huiwen; Wang, Donglin
2018-01-01
Purpose This study was conducted to compare the efficacy of a combination of icotinib and chemotherapy with icotinib or chemotherapy alone in untreated non-small cell lung cancer (NSCLC) patients harboring epidermal growth factor receptor (EGFR)-sensitive mutations and to analyze the curative effect of different treatments on different genetic mutations (EGFR 19 exon deletion and L858R mutation) in a real-life setting. Patients and methods One hundred ninety-one patients were studied in this retrospective analysis from January 2013 to December 2015. The baseline characteristics, curative effects and adverse events of patients were analyzed. The primary endpoint was progression free survival (PFS). Results Longer PFS and overall survival (OS), and better objective response rate (ORR) were observed in the combination group compared to icotinib or chemotherapy along. For patients with an EGFR 19 exon deletion, the PFS, OS, and ORR in the combination group were superior to those in the icotinib or chemotherapy group. For the patients with the EGFR L858R mutation, better PFS and ORR were observed in the combination group, but OS was not obviously prolonged. Grade 3 or 4 adverse events were most commonly reported with combination therapy or chemotherapy alone. No possible drug-related interstitial lung disease or of drug related deaths occurred. Conclusion The combination of icotinib and chemotherapy in patients with untreated NSCLC harboring sensitive EGFR mutations resulted in improved PFS and OS, especially in those who harbored the EGFR exon 19 deletion. PMID:29731642
The prevalence of CTNNB1 mutations in primary aldosteronism and consequences for clinical outcomes.
Wu, Vin-Cent; Wang, Shuo-Meng; Chueh, Shih-Chieh Jeff; Yang, Shao-Yu; Huang, Kuo-How; Lin, Yen-Hung; Wang, Jian-Jhong; Connolly, Rory; Hu, Ya-Hui; Gomez-Sanchez, Celso E; Peng, Kang-Yung; Wu, Kwan-Dun
2017-01-19
Constitutive activation of the Wnt pathway/β-catenin signaling may be important in aldosterone-producing adenoma (APA). However, significant gaps remain in our understanding of the prevalence and clinical outcomes after adrenalectomy in APA patients harboring CTNNB1 mutations. The molecular expression of CYP11B2 and gonadal receptors in adenomas were also explored. Adenomas from 219 APA patients (95 men; 44.2%; aged 50.5 ± 11.9 years) showed a high rate of somatic mutations (n = 128, 58.4%). The majority of them harbored KCNJ5 mutations (n = 116, 52.9%); 8 patients (3.7%, 6 women) had CTNNB1 mutations. Patients with APAs harboring CTNNB1 mutations were older and had shorter duration of hypertension. After adrenalectomy, CTNNB1 mutation carriers had a higher possibility (87.5%) of residual hypertension than other APA patients. APAs harboring CTNNB1 mutations have heterogeneous staining of β-catenin and variable expression of gonadal receptors and both CYP11B1 and CYP11B2. This suggests that CTNNB1 mutations may be more related to tumorigenesis rather than excessive aldosterone production.
76 FR 50489 - Agency Information Collection Activities: Harbor Maintenance Fee
Federal Register 2010, 2011, 2012, 2013, 2014
2011-08-15
... Activities: Harbor Maintenance Fee AGENCY: U.S. Customs and Border Protection, Department of Homeland... Security will be submitting the following information collection request to the Office of Management and Budget (OMB) for review and approval in accordance with the Paperwork Reduction Act: Harbor Maintenance...
Tonacchera, M; Chiovato, L; Pinchera, A; Agretti, P; Fiore, E; Cetani, F; Rocchi, R; Viacava, P; Miccoli, P; Vitti, P
1998-02-01
Toxic multinodular goiter is a cause of nonautoimmune hyperthyroidism and is believed to differ in its nature and pathogenesis from toxic adenoma. Gain-of-function mutations of the TSH receptor gene have been identified as a cause of toxic adenoma. The pathogenesis at the molecular level of hyperfunctioning nodules in toxic multinodular goiter has yet not been reported. Six patients with a single hot nodule within a multinodular goiter and 11 patients with toxic thyroid adenoma were enrolled in our study. At histology five hyperfunctioning nodules in multinodular goiters showed the features of adenomas, and one was identified as a hyperplastic nodule. The entire exon 10 of the TSH receptor gene was directly sequenced after PCR amplification from genomic DNA obtained from surgical specimens. Functional studies of mutated receptors were performed in COS-7 cells. Five out of 6 (83%) hyperfunctioning nodules within toxic multinodular goiters harbored a TSH receptor mutation. A TSH receptor mutation was also evident in the hyperfunctioning nodule that at histology had the features of noncapsulated hyperplastic nodule. Among toxic adenomas, 8 out of 11 (72%) nodules harbored a TSH receptor mutation. All the mutations were heterozygotic and somatic. Nonfunctioning nodules, whether adenomas or hyperplastic nodules present in association with hyperfunctioning nodules in the same multinodular goiters, had no TSH receptor mutation. All the mutations identified had constitutive activity as assessed by cAMP production after expression in COS-7 cells. Hyperfunctioning thyroid nodules in multinodular goiters recognize the same pathogenetic event (TSH receptor mutation) as toxic adenoma. Other mechanisms are implicated in the growth of nonfunctioning thyroid nodules coexistent in the same gland.
Differential Reprogramming of Isogenic Colorectal Cancer Cells by Distinct Activating KRAS Mutations
2015-01-01
Oncogenic mutations of Ras at codons 12, 13, or 61, that render the protein constitutively active, are found in ∼16% of all cancer cases. Among the three major Ras isoforms, KRAS is the most frequently mutated isoform in cancer. Each Ras isoform and tumor type displays a distinct pattern of codon-specific mutations. In colon cancer, KRAS is typically mutated at codon 12, but a significant fraction of patients have mutations at codon 13. Clinical data suggest different outcomes and responsiveness to treatment between these two groups. To investigate the differential effects upon cell status associated with KRAS mutations we performed a quantitative analysis of the proteome and phosphoproteome of isogenic SW48 colon cancer cell lines in which one allele of the endogenous gene has been edited to harbor specific KRAS mutations (G12V, G12D, or G13D). Each mutation generates a distinct signature, with the most variability seen between G13D and the codon 12 KRAS mutants. One notable example of specific up-regulation in KRAS codon 12 mutant SW48 cells is provided by the short form of the colon cancer stem cell marker doublecortin-like Kinase 1 (DCLK1) that can be reversed by suppression of KRAS. PMID:25599653
Sequeira, Vasco; Wijnker, Paul J M; Nijenkamp, Louise L A M; Kuster, Diederik W D; Najafi, Aref; Witjas-Paalberends, E Rosalie; Regan, Jessica A; Boontje, Nicky; Ten Cate, Folkert J; Germans, Tjeerd; Carrier, Lucie; Sadayappan, Sakthivel; van Slegtenhorst, Marjon A; Zaremba, Ruud; Foster, D Brian; Murphy, Anne M; Poggesi, Corrado; Dos Remedios, Cris; Stienen, Ger J M; Ho, Carolyn Y; Michels, Michelle; van der Velden, Jolanda
2013-05-24
High-myofilament Ca(2+) sensitivity has been proposed as a trigger of disease pathogenesis in familial hypertrophic cardiomyopathy (HCM) on the basis of in vitro and transgenic mice studies. However, myofilament Ca(2+) sensitivity depends on protein phosphorylation and muscle length, and at present, data in humans are scarce. To investigate whether high myofilament Ca(2+) sensitivity and perturbed length-dependent activation are characteristics for human HCM with mutations in thick and thin filament proteins. Cardiac samples from patients with HCM harboring mutations in genes encoding thick (MYH7, MYBPC3) and thin (TNNT2, TNNI3, TPM1) filament proteins were compared with sarcomere mutation-negative HCM and nonfailing donors. Cardiomyocyte force measurements showed higher myofilament Ca(2+) sensitivity in all HCM samples and low phosphorylation of protein kinase A (PKA) targets compared with donors. After exogenous PKA treatment, myofilament Ca(2+) sensitivity was similar (MYBPC3mut, TPM1mut, sarcomere mutation-negative HCM), higher (MYH7mut, TNNT2mut), or even significantly lower (TNNI3mut) compared with donors. Length-dependent activation was significantly smaller in all HCM than in donor samples. PKA treatment increased phosphorylation of PKA-targets in HCM myocardium and normalized length-dependent activation to donor values in sarcomere mutation-negative HCM and HCM with truncating MYBPC3 mutations but not in HCM with missense mutations. Replacement of mutant by wild-type troponin in TNNT2mut and TNNI3mut corrected length-dependent activation to donor values. High-myofilament Ca(2+) sensitivity is a common characteristic of human HCM and partly reflects hypophosphorylation of PKA targets compared with donors. Length-dependent sarcomere activation is perturbed by missense mutations, possibly via posttranslational modifications other than PKA hypophosphorylation or altered protein-protein interactions, and represents a common pathomechanism in HCM.
Oostdijk, Wilma; Idkowiak, Jan; Mueller, Jonathan W.; House, Philip J.; Taylor, Angela E.; O'Reilly, Michael W.; Hughes, Beverly A.; de Vries, Martine C.; Kant, Sarina G.; Santen, Gijs W. E.; Verkerk, Annemieke J. M. H.; Uitterlinden, André G.; Wit, Jan M.; Losekoot, Monique
2015-01-01
Context: PAPSS2 (PAPS synthase 2) provides the universal sulfate donor PAPS (3′-phospho-adenosine-5′-phosphosulfate) to all human sulfotransferases, including SULT2A1, responsible for sulfation of the crucial androgen precursor dehydroepiandrosterone (DHEA). Impaired DHEA sulfation is thought to increase the conversion of DHEA toward active androgens, a proposition supported by the previous report of a girl with inactivating PAPSS2 mutations who presented with low serum DHEA sulfate and androgen excess, clinically manifesting with premature pubarche and early-onset polycystic ovary syndrome. Patients and Methods: We investigated a family harboring two novel PAPSS2 mutations, including two compound heterozygous brothers presenting with disproportionate short stature, low serum DHEA sulfate, but normal serum androgens. Patients and parents underwent a DHEA challenge test comprising frequent blood sampling and urine collection before and after 100 mg DHEA orally, with subsequent analysis of DHEA sulfation and androgen metabolism by mass spectrometry. The functional impact of the mutations was investigated in silico and in vitro. Results: We identified a novel PAPSS2 frameshift mutation, c.1371del, p.W462Cfs*3, resulting in complete disruption, and a novel missense mutation, c.809G>A, p.G270D, causing partial disruption of DHEA sulfation. Both patients and their mother, who was heterozygous for p.W462Cfs*3, showed increased 5α-reductase activity at baseline and significantly increased production of active androgens after DHEA intake. The mother had a history of oligomenorrhea and chronic anovulation that required clomiphene for ovulation induction. Conclusions: We provide direct in vivo evidence for the significant functional impact of mutant PAPSS2 on DHEA sulfation and androgen activation. Heterozygosity for PAPSS2 mutations can be associated with a phenotype resembling polycystic ovary syndrome. PMID:25594860
Hafner, Christian; López-Knowles, Elena; Luis, Nuno M.; Toll, Agustí; Baselga, Eulàlia; Fernández-Casado, Alex; Hernández, Silvia; Ribé, Adriana; Mentzel, Thomas; Stoehr, Robert; Hofstaedter, Ferdinand; Landthaler, Michael; Vogt, Thomas; Pujol, Ramòn M.; Hartmann, Arndt; Real, Francisco X.
2007-01-01
Activating mutations of the p110 α subunit of PI3K (PIK3CA) oncogene have been identified in a broad spectrum of malignant tumors. However, their role in benign or preneoplastic conditions is unknown. Activating FGF receptor 3 (FGFR3) mutations are common in benign skin lesions, either as embryonic mutations in epidermal nevi (EN) or as somatic mutations in seborrheic keratoses (SK). FGFR3 mutations are also common in low-grade malignant bladder tumors, where they often occur in association with PIK3CA mutations. Therefore, we examined exons 9 and 20 of PIK3CA and FGFR3 hotspot mutations in EN (n = 33) and SK (n = 62), two proliferative skin lesions lacking malignant potential. Nine of 33 (27%) EN harbored PIK3CA mutations; all cases showed the E545G substitution, which is uncommon in cancers. In EN, R248C was the only FGFR3 mutation identified. By contrast, 10 of 62 (16%) SK revealed the typical cancer-associated PIK3CA mutations E542K, E545K, and H1047R. The same lesions displayed a wide range of FGFR3 mutations. Corresponding unaffected tissue was available for four EN and two mutant SK: all control samples displayed a WT sequence, confirming the somatic nature of the mutations found in lesional tissue. Forty of 95 (42%) lesions showed at least one mutation in either gene. PIK3CA and FGFR3 mutations displayed an independent distribution; 5/95 lesions harbored mutations in both genes. Our findings suggest that, in addition to their role in cancer, oncogenic PIK3CA mutations contribute to the pathogenesis of skin tumors lacking malignant potential. The remarkable genotype–phenotype correlation as observed in this study points to a distinct etiopathogenesis of the mutations in keratinocytes occuring either during fetal development or in adult life. PMID:17673550
Wang, Yiqiang; Hedblom, Andreas; Koerner, Steffi K; Li, Mailin; Jernigan, Finith E; Wegiel, Barbara; Sun, Lijun
2016-12-01
A series of novel chalcones were synthesized by the Claisen-Schmidt condensation reaction of tetralones and 5-/6-indolecarboxaldehydes. Treatment of human lung cancer cell line harboring KRAS mutation (A549) with the chalcones induced dose-dependent apoptosis. Cell cycle analyses and Western blotting suggested the critical role of the chalcones in interrupting G2/M transition of cell cycle. SAR study demonstrated that substituent on the indole N atom significantly affects the anticancer activity of the chalcones, with methyl and ethyl providing the more active compounds (EC 50 : 110-200nM), Compound 1g was found to be >4-fold more active in the A549 cells (EC 50 : 110nM) than in prostate (PC3) or pancreatic cancer (CLR2119, PAN02) cells. Furthermore, compound 1l selectively induced apoptosis of lung cancer cells A549 (EC 50 : 0.55μM) but did not show measurable toxicity in the normal lung bronchial epithelial cells (hBEC) at doses as high as 10μM, indicating specificity towards cancer cells. Copyright © 2016 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Manoli, E.; Chelioti-Chatzidimitriou, A.; Karageorgou, K.; Kouras, A.; Voutsa, D.; Samara, C.; Kampanos, I.
2017-10-01
Harbors are often characterized by high levels of air pollutants that are emitted from ship traffic and other harbor activities. In the present study, the concentrations of Polycyclic Aromatic Hydrocarbons (PAHs) and trace elements (As, Cd, Ni, Pb, Cr, Mn, Zn, and Fe) bounded to the inhalable particulate matter PM10 were studied in the harbor of Volos, central Greece, during a 2-year period (2014-2015). Seasonal and daily variations were investigated. Moreover, total carcinogenic and mutagenic activities of PAHs were calculated. The effect of major wind sectors (sea, city, industrial, harbor) was estimated to assess the potential contribution of ship traffic and harbor activities, such as scrap metal handling operations. Results showed that the harbor sector (calm winds ≤ 0.5 m s-1) was associated with the highest concentrations of PM10. The harbor sector was also associated with relatively increased levels of trace elements (As, Fe, Cr, Mn, Ni), however the effect of this sector was lower than the corresponding effect of the industrial wind sector. The sea sector showed only a slight increase in B[a]Py and Σ12PAHs, whereas the highest increasing effect for PAHs and traffic-related elements, such as Pb and Zn, was evidenced for the city sector.
Cancer-Associated Mutations in Endometriosis without Cancer
Anglesio, M.S.; Papadopoulos, N.; Ayhan, A.; Nazeran, T.M.; Noë, M.; Horlings, H.M.; Lum, A.; Jones, S.; Senz, J.; Seckin, T.; Ho, J.; Wu, R.-C.; Lac, V.; Ogawa, H.; Tessier-Cloutier, B.; Alhassan, R.; Wang, A.; Wang, Y.; Cohen, J.D.; Wong, F.; Hasanovic, A.; Orr, N.; Zhang, M.; Popoli, M.; McMahon, W.; Wood, L.D.; Mattox, A.; Allaire, C.; Segars, J.; Williams, C.; Tomasetti, C.; Boyd, N.; Kinzler, K.W.; Gilks, C.B.; Diaz, L.; Wang, T.-L.; Vogelstein, B.; Yong, P.J.; Huntsman, D.G.; Shih, I.-M.
2017-01-01
BACKGROUND Endometriosis, defined as the presence of ectopic endometrial stroma and epithelium, affects approximately 10% of reproductive-age women and can cause pelvic pain and infertility. Endometriotic lesions are considered to be benign inflammatory lesions but have cancerlike features such as local invasion and resistance to apoptosis. METHODS We analyzed deeply infiltrating endometriotic lesions from 27 patients by means of exomewide sequencing (24 patients) or cancer-driver targeted sequencing (3 patients). Mutations were validated with the use of digital genomic methods in micro-dissected epithelium and stroma. Epithelial and stromal components of lesions from an additional 12 patients were analyzed by means of a droplet digital polymerase-chain-reaction (PCR) assay for recurrent activating KRAS mutations. RESULTS Exome sequencing revealed somatic mutations in 19 of 24 patients (79%). Five patients harbored known cancer driver mutations in ARID1A, PIK3CA, KRAS, or PPP2R1A, which were validated by Safe-Sequencing System or immunohistochemical analysis. The likelihood of driver genes being affected at this rate in the absence of selection was estimated at P = 0.001 (binomial test). Targeted sequencing and a droplet digital PCR assay identified KRAS mutations in 2 of 3 patients and 3 of 12 patients, respectively, with mutations in the epithelium but not the stroma. One patient harbored two different KRAS mutations, c.35G→T and c.35G→C, and another carried identical KRAS c.35G→A mutations in three distinct lesions. CONCLUSIONS We found that lesions in deep infiltrating endometriosis, which are associated with virtually no risk of malignant transformation, harbor somatic cancer driver mutations. Ten of 39 deep infiltrating lesions (26%) carried driver mutations; all the tested somatic mutations appeared to be confined to the epithelial compartment of endometriotic lesions. PMID:28489996
Recurrent PTPRB and PLCG1 mutations in angiosarcoma.
Behjati, Sam; Tarpey, Patrick S; Sheldon, Helen; Martincorena, Inigo; Van Loo, Peter; Gundem, Gunes; Wedge, David C; Ramakrishna, Manasa; Cooke, Susanna L; Pillay, Nischalan; Vollan, Hans Kristian M; Papaemmanuil, Elli; Koss, Hans; Bunney, Tom D; Hardy, Claire; Joseph, Olivia R; Martin, Sancha; Mudie, Laura; Butler, Adam; Teague, Jon W; Patil, Meena; Steers, Graham; Cao, Yu; Gumbs, Curtis; Ingram, Davis; Lazar, Alexander J; Little, Latasha; Mahadeshwar, Harshad; Protopopov, Alexei; Al Sannaa, Ghadah A; Seth, Sahil; Song, Xingzhi; Tang, Jiabin; Zhang, Jianhua; Ravi, Vinod; Torres, Keila E; Khatri, Bhavisha; Halai, Dina; Roxanis, Ioannis; Baumhoer, Daniel; Tirabosco, Roberto; Amary, M Fernanda; Boshoff, Chris; McDermott, Ultan; Katan, Matilda; Stratton, Michael R; Futreal, P Andrew; Flanagan, Adrienne M; Harris, Adrian; Campbell, Peter J
2014-04-01
Angiosarcoma is an aggressive malignancy that arises spontaneously or secondarily to ionizing radiation or chronic lymphoedema. Previous work has identified aberrant angiogenesis, including occasional somatic mutations in angiogenesis signaling genes, as a key driver of angiosarcoma. Here we employed whole-genome, whole-exome and targeted sequencing to study the somatic changes underpinning primary and secondary angiosarcoma. We identified recurrent mutations in two genes, PTPRB and PLCG1, which are intimately linked to angiogenesis. The endothelial phosphatase PTPRB, a negative regulator of vascular growth factor tyrosine kinases, harbored predominantly truncating mutations in 10 of 39 tumors (26%). PLCG1, a signal transducer of tyrosine kinases, encoded a recurrent, likely activating p.Arg707Gln missense variant in 3 of 34 cases (9%). Overall, 15 of 39 tumors (38%) harbored at least one driver mutation in angiogenesis signaling genes. Our findings inform and reinforce current therapeutic efforts to target angiogenesis signaling in angiosarcoma.
Malikova, Jana; Camats, Núria; Fernández-Cancio, Mónica; Heath, Karen; González, Isabel; Caimarí, María; del Campo, Miguel; Albisu, Marian; Kolouskova, Stanislava; Audí, Laura; Flück, Christa E.
2014-01-01
Context Human NR5A1/SF-1 mutations cause 46,XY disorder of sex development (DSD) with broad phenotypic variability, and rarely cause adrenal insufficiency although SF-1 is an important transcription factor for many genes involved in steroidogenesis. In addition, the Sf-1 knockout mouse develops obesity with age. Obesity might be mediated through Sf-1 regulating activity of brain-derived neurotrophic factor (BDNF), an important regulator of energy balance in the ventromedial hypothalamus. Objective To characterize novel SF-1 gene variants in 4 families, clinical, genetic and functional studies were performed with respect to steroidogenesis and energy balance. Patients 5 patients with 46,XY DSD were found to harbor NR5A1/SF-1 mutations including 2 novel variations. One patient harboring a novel mutation also suffered from adrenal insufficiency. Methods SF-1 mutations were studied in cell systems (HEK293, JEG3) for impact on transcription of genes involved in steroidogenesis (CYP11A1, CYP17A1, HSD3B2) and in energy balance (BDNF). BDNF regulation by SF-1 was studied by promoter assays (JEG3). Results Two novel NR5A1/SF-1 mutations (Glu7Stop, His408Profs*159) were confirmed. Glu7Stop is the 4th reported SF-1 mutation causing DSD and adrenal insufficiency. In vitro studies revealed that transcription of the BDNF gene is regulated by SF-1, and that mutant SF-1 decreased BDNF promoter activation (similar to steroid enzyme promoters). However, clinical data from 16 subjects carrying SF-1 mutations showed normal birth weight and BMI. Conclusions Glu7Stop and His408Profs*159 are novel SF-1 mutations identified in patients with 46,XY DSD and adrenal insufficiency (Glu7Stop). In vitro, SF-1 mutations affect not only steroidogenesis but also transcription of BDNF which is involved in energy balance. However, in contrast to mice, consequences on weight were not found in humans with SF-1 mutations. PMID:25122490
Malikova, Jana; Camats, Núria; Fernández-Cancio, Mónica; Heath, Karen; González, Isabel; Caimarí, María; del Campo, Miguel; Albisu, Marian; Kolouskova, Stanislava; Audí, Laura; Flück, Christa E
2014-01-01
Human NR5A1/SF-1 mutations cause 46,XY disorder of sex development (DSD) with broad phenotypic variability, and rarely cause adrenal insufficiency although SF-1 is an important transcription factor for many genes involved in steroidogenesis. In addition, the Sf-1 knockout mouse develops obesity with age. Obesity might be mediated through Sf-1 regulating activity of brain-derived neurotrophic factor (BDNF), an important regulator of energy balance in the ventromedial hypothalamus. To characterize novel SF-1 gene variants in 4 families, clinical, genetic and functional studies were performed with respect to steroidogenesis and energy balance. 5 patients with 46,XY DSD were found to harbor NR5A1/SF-1 mutations including 2 novel variations. One patient harboring a novel mutation also suffered from adrenal insufficiency. SF-1 mutations were studied in cell systems (HEK293, JEG3) for impact on transcription of genes involved in steroidogenesis (CYP11A1, CYP17A1, HSD3B2) and in energy balance (BDNF). BDNF regulation by SF-1 was studied by promoter assays (JEG3). Two novel NR5A1/SF-1 mutations (Glu7Stop, His408Profs*159) were confirmed. Glu7Stop is the 4th reported SF-1 mutation causing DSD and adrenal insufficiency. In vitro studies revealed that transcription of the BDNF gene is regulated by SF-1, and that mutant SF-1 decreased BDNF promoter activation (similar to steroid enzyme promoters). However, clinical data from 16 subjects carrying SF-1 mutations showed normal birth weight and BMI. Glu7Stop and His408Profs*159 are novel SF-1 mutations identified in patients with 46,XY DSD and adrenal insufficiency (Glu7Stop). In vitro, SF-1 mutations affect not only steroidogenesis but also transcription of BDNF which is involved in energy balance. However, in contrast to mice, consequences on weight were not found in humans with SF-1 mutations.
Janjigian, Yelena Y.; Park, Bernard J.; Zakowski, Maureen F.; Ladanyi, Marc; Pao, William; D’Angelo, Sandra P.; Kris, Mark G.; Shen, Ronglai; Zheng, Junting; Azzoli, Christopher G.
2013-01-01
Background Patients with stage IV lung adenocarcinoma and EGFR mutation derive clinical benefit from treatment with EGFR tyrosine kinase inhibitors (TKI). Whether treatment with TKI improves outcomes in patients with resected lung adenocarcinoma and EGFR mutation is unknown. Methods Data were analyzed from a surgical database of patients with resected lung adenocarcinoma harboring EGFR exon 19 or 21 mutations. In a multivariate analysis, we evaluated the impact of treatment with adjuvant TKI. Results The cohort consists of 167 patients with completely resected stage I–III lung adenocarcinoma. 93 patients (56%) had exon 19 del, 74 patients (44%) had exon 21 mutations, 56 patients (33%) received perioperative TKI. In a multivariate analysis controlling for sex, stage, type of surgery and adjuvant platinum chemotherapy, the 2-year DFS was 89% for patients treated with adjuvant TKI compared with 72% in control group (hazard ratio [HR] = 0.53; 95% confidence interval [CI] 0.28 to 1.03; p = 0.06). The 2-year OS was 96% with adjuvant EGFR TKI and 90% in the group that did not receive TKI (HR 0.62; 95% CI 0.26 to 1.51; p = 0.296). Conclusions Compared to patients who did not receive adjuvant TKI, we observed a trend toward improvement in disease free survival among individuals with resected stages I–III lung adenocarcinomas harboring mutations in EGFR exons 19 or 21 who received these agents as adjuvant therapy. Based on these data, 320 patients are needed for a randomized trial to prospectively validate this DFS benefit. PMID:21150674
Yao, Shuyang; Zhi, Xiuyi; Wang, Ruotian; Qian, Kun; Hu, Mu
2016-01-01
Background Epidermal growth factor receptor (EGFR) mutations occur in about 50% of Asian patients with non‐small cell lung cancer (NSCLC). Patients with advanced NSCLC and EGFR mutations derive clinical benefit from treatment with EGFR‐tyrosine kinase inhibitors (TKIs). This study assessed the efficacy and safety of adjuvant icotinib without chemotherapy in EGFR‐mutated NSCLC patients undergoing resection of stage IB–IIIA. Methods Our retrospective study enrolled 20 patients treated with icotinib as adjuvant therapy. Survival factors were evaluated by univariate and Cox regression analysis. Results The median follow‐up time was 30 months (range 24–41). At the data cut‐off, five patients (25%) had recurrence or metastasis and one patient had died of the disease. The two‐year disease‐free survival (DFS) rate was 85%. No recurrence occurred in the high‐risk stage IB subgroup during the follow‐up period. In univariate analysis, the micropapillary pattern had a statistically significant effect on DFS (P = 0.040). Multivariate logistic regression analysis showed that there was no independent predictor. Drug related adverse events (AEs) occurred in nine patients (45.0%). The most common AEs were skin‐related events and diarrhea, but were relatively mild. No grade 3 AEs or occurrences of intolerable toxicity were observed. Conclusions Icotinib as adjuvant therapy is effective in patients harboring EGFR mutations after complete resection, with an acceptable AE profile. Further trials with larger sample sizes might confirm the efficiency of adjuvant TKI in selected patients. PMID:27766784
Roher, Alex E; Maarouf, Chera L; Malek-Ahmadi, Michael; Wilson, Jeffrey; Kokjohn, Tyler A; Daugs, Ian D; Whiteside, Charisse M; Kalback, Walter M; Macias, MiMi P; Jacobson, Sandra A; Sabbagh, Marwan N; Ghetti, Bernardino; Beach, Thomas G
2013-01-01
Alzheimer’s disease (AD) dementia impacts all facets of higher order cognitive function and is characterized by the presence of distinctive pathological lesions in the gray matter (GM). The profound alterations in GM structure and function have fostered the view that AD impacts are primarily a consequence of GM damage. However, the white matter (WM) represents about 50% of the cerebrum and this area of the brain is substantially atrophied and profoundly abnormal in both sporadic AD (SAD) and familial AD (FAD). We examined the WM biochemistry by ELISA and Western blot analyses of key proteins in 10 FAD cases harboring mutations in the presenilin genes PSEN1 and PSEN2 as well as in 4 non-demented control (NDC) individuals and 4 subjects with SAD. The molecules examined were direct substrates of PSEN1 such as Notch-1 and amyloid precursor protein (APP). In addition, apolipoproteins, axonal transport molecules, cytoskeletal and structural proteins, neurotrophic factors and synaptic proteins were examined. PSEN-FAD subjects had, on average, higher amounts of WM amyloid-beta (Aβ) peptides compared to SAD, which may play a role in the devastating dysfunction of the brain. However, the PSEN-FAD mutations we examined did not produce uniform increases in the relative proportions of Aβ42 and exhibited substantial variability in total Aβ levels. These observations suggest that neurodegeneration and dementia do not depend solely on enhanced Aβ42 levels. Our data revealed additional complexities in PSEN-FAD individuals. Some direct substrates of γ-secretase, such as Notch, N-cadherin, Erb-B4 and APP, deviated substantially from the NDC group baseline for some, but not all, mutation types. Proteins that were not direct γ-secretase substrates, but play key structural and functional roles in the WM, likewise exhibited varied concentrations in the distinct PSEN mutation backgrounds. Detailing the diverse biochemical pathology spectrum of PSEN mutations may offer valuable
Suda, Kenichi; Mizuuchi, Hiroshi; Maehara, Yoshihiko; Mitsudomi, Tetsuya
2012-12-01
Lung cancers that harbor somatic activating mutations in the gene for the epidermal growth factor receptor (EGFR) depend on mutant EGFR for their proliferation and survival; therefore, lung cancer patients with EGFR mutations often dramatically respond to orally available EGFR tyrosine kinase inhibitors (TKIs). However, emergence of acquired resistance is virtually inevitable, thus limiting improvement in patient outcomes. To elucidate and overcome this acquired resistance, multidisciplinary basic and clinical investigational approaches have been applied, using in vitro cell line models or samples obtained from lung cancer patients treated with EGFR-TKIs. These efforts have revealed several acquired resistance mechanisms and candidates, including EGFR secondary mutations (T790M and other rare mutations), MET amplification, PTEN downregulation, CRKL amplification, high-level HGF expression, FAS-NFκB pathway activation, epithelial-mesenchymal transition, and conversion to small cell lung cancer. Interestingly, cancer cells harbor potential destiny and ductility together in acquiring resistance to EGFR-TKIs, as shown in in vitro acquired resistance models. Molecular mechanisms of "reversible EGFR-TKI tolerance" that occur in early phase EGFR-TKI exposure have been identified in cell line models. Furthermore, others have reported molecular markers that can predict response to EGFR-TKIs in clinical settings. Deeper understanding of acquired resistance mechanisms to EGFR-TKIs, followed by the development of molecular target drugs that can overcome the resistance, might turn this fatal disease into a chronic disorder.
A targeted mutational landscape of angioimmunoblastic T-cell lymphoma
Odejide, Oreofe; Weigert, Oliver; Lane, Andrew A.; Toscano, Dan; Lunning, Matthew A.; Kopp, Nadja; Kim, Sunhee; van Bodegom, Diederik; Bolla, Sudha; Schatz, Jonathan H.; Teruya-Feldstein, Julie; Hochberg, Ephraim; Louissaint, Abner; Dorfman, David; Stevenson, Kristen; Rodig, Scott J.; Piccaluga, Pier Paolo; Jacobsen, Eric; Pileri, Stefano A.; Harris, Nancy L.; Ferrero, Simone; Inghirami, Giorgio; Horwitz, Steven M.
2014-01-01
The genetics of angioimmunoblastic T-cell lymphoma (AITL) are very poorly understood. We defined the mutational landscape of AITL across 219 genes in 85 cases from the United States and Europe. We identified ≥2 mutations in 34 genes, nearly all of which were not previously implicated in AITL. These included loss-of-function mutations in TP53 (n = 4), ETV6 (n = 3), CCND3 (n = 2), and EP300 (n = 5), as well as gain-of-function mutations in JAK2 (n = 2) and STAT3 (n = 4). TET2 was mutated in 65 (76%) AITLs, including 43 that harbored 2 or 3 TET2 mutations. DNMT3A mutations occurred in 28 (33%) AITLs; 100% of these also harbored TET2 mutations (P < .0001). Seventeen AITLs harbored IDH2 R172 substitutions, including 15 with TET2 mutations. In summary, AITL is characterized by high frequencies of overlapping mutations in epigenetic modifiers and targetable mutations in a subset of cases. PMID:24345752
Fu, Qiang; Li, Shiyu; Wang, Zhaofei; Shan, Wenya; Ma, Jingjiao; Cheng, Yuqiang; Wang, Hengan; Yan, Yaxian; Sun, Jianhe
2017-01-01
Shiga toxin-converting bacteriophages (Stx phages) carry the stx gene and convert nonpathogenic bacterial strains into Shiga toxin-producing bacteria. There is limited understanding of the effect that an Escherichia coli ( E. coli ) clustered regularly interspaced short palindromic repeats (CRISPR)-Cas adaptive immune system has on Stx phage lysogen. We investigated heat-stable nucleoid-structuring (H-NS) mutation-mediated CRISPR-Cas activation and its effect on E. coli Stx2 phage lysogen. The Δ hns mutant (MG1655Δ hns ) of the E. coli K-12 strain MG1655 was obtained. The Δ hns mutant lysogen that was generated after Stx phage lysogenic infection had a repressed growth status and showed subdued group behavior, including biofilm formation and swarming motility, in comparison to the wild-type strain. The de-repression effect of the H-NS mutation on CRISPR-Cas activity was then verified. The results showed that cas gene expression was upregulated and the transformation efficiency of the wild-type CRISPR plasmids was decreased, which may indicate activation of the CRISPR-Cas system. Furthermore, the function of CRISPR-Cas on Stx2 phage lysogen was investigated by activating the CRISPR-Cas system, which contains an insertion of the protospacer regions of the Stx2 phage Min27. The phage release and toxin production of four lysogens harboring the engineered CRISPRs were investigated. Notably, in the supernatant of the Δ hns mutant lysogen harboring the Min27 spacer, both the progeny phage release and the toxin production were inhibited after mitomycin C induction. These observations demonstrate that the H-NS mutation-activated CRISPR-Cas system plays a role in modifying the effects of the Stx2 phage lysogen. Our findings indicated that H-NS mutation-mediated CRISPR-Cas activation in E. coli protects bacteria against Stx2 phage lysogeny by inhibiting the phage release and toxin production of the lysogen.
Minoia, Francesca; Bertamino, Marta; Picco, Paolo; Severino, Mariasavina; Rossi, Andrea; Fiorillo, Chiara; Minetti, Carlo; Nesti, Claudia; Santorelli, Filippo Maria; Di Rocco, Maja
2017-01-01
Leigh syndrome (LS) is an early-onset progressive neurodegenerative disorder, characterized by a wide clinical and genetic heterogeneity, and is the most frequent disorder of mitochondrial energy production in children. Beside its great variability in clinical, biochemical, and genetic features, LS is pathologically uniformly characterized by multifocal bilateral and symmetric spongiform degeneration of the basal ganglia, brainstem, thalamus, cerebellum, spinal cord, and optic nerves. Isolated complex I deficiency is the most common defect identified in Leigh syndrome. In 2011, the first child with a mutation of NDUFA10 gene, coding for an accessory subunits of complex I, was described. Here, we present an additional description of a child with Leigh syndrome harboring a homozygous mutation in NDUFA10, providing insights in clinical, biochemical, and neuroradiologic features for future earlier recognition.
Wang, Jun; Wang, Baocheng; Chu, Huili; Yao, Yunfeng
2016-01-01
Identifying activating EGFR mutations is a useful predictive strategy that helps select a population of advanced non-small-cell lung cancer (NSCLC) patients for treatment with EGFR tyrosine kinase inhibitors (TKIs). Patients with sensitizing EGFR mutations (predominantly an in-frame deletion in exon 19 and an L858R substitution) are highly responsive to first-generation EGFR TKIs, such as gefitinib and erlotinib, and show improved progression-free survival without serious side effects. However, all patients with activating EGFR mutations who are initially responsive to EGFR TKIs eventually develop acquired resistance after a median progression-free survival of 10–16 months, followed by disease progression. Moreover, ~20%–30% of NSCLC patients have no objective tumor regression on initial EGFR TKI treatment, although they harbor an activating EGFR mutation. These patients represent an NSCLC subgroup that is defined as having intrinsic or primary resistance to EGFR TKIs. Different mechanisms of acquired EGFR TKI resistance have been identified, and several novel compounds have been developed to reverse acquired resistance, but little is known about EGFR TKI intrinsic resistance. In this review, we summarize the latest findings involving mechanisms of intrinsic resistance to EGFR TKIs in advanced NSCLC with activating EGFR mutations and present possible therapeutic strategies to overcome this resistance. PMID:27382309
Lau, Calvin Ho-Fung; Fraud, Sebastien; Jones, Marcus; Peterson, Scott N.; Poole, Keith
2013-01-01
The amgRS operon encodes a presumed membrane stress-responsive two-component system linked to intrinsic aminoglycoside resistance in Pseudomonas aeruginosa. Genome sequencing of a lab isolate showing modest pan-aminoglycoside resistance, strain K2979, revealed a number of mutations, including a substitution in amgS that produced an R182C change in the AmgS sensor kinase product of this gene. Introduction of this mutation into an otherwise wild-type strain recapitulated the resistance phenotype, while correcting the mutation in the resistant mutant abrogated the resistant phenotype, confirming that the amgS mutation is responsible for the aminoglycoside resistance of strain K2979. The amgSR182 mutation promoted an AmgR-dependent, 2- to 3-fold increase in expression of the AmgRS target genes htpX and PA5528, mirroring the impact of aminoglycoside exposure of wild-type cells on htpX and PA5528 expression. This suggests that amgSR182 is a gain-of-function mutation that activates AmgS and the AmgRS two-component system in promoting modest resistance to aminoglycosides. Screening of several pan-aminoglycoside-resistant clinical isolates of P. aeruginosa revealed three that showed elevated htpX and PA5528 expression and harbored single amino acid-altering mutations in amgS (V121G or D106N) and no mutations in amgR. Introduction of the amgSV121G mutation into wild-type P. aeruginosa generated a resistance phenotype reminiscent of the amgSR182 mutant and produced a 2- to 3-fold increase in htpX and PA5528 expression, confirming that it, too, is a gain-of-function aminoglycoside resistance-promoting mutation. These results highlight the contribution of amgS mutations and activation of the AmgRS two-component system to acquired aminoglycoside resistance in lab and clinical isolates of P. aeruginosa. PMID:23459488
Yao, Shuyang; Zhi, Xiuyi; Wang, Ruotian; Qian, Kun; Hu, Mu; Zhang, Yi
2016-09-01
Epidermal growth factor receptor (EGFR) mutations occur in about 50% of Asian patients with non-small cell lung cancer (NSCLC). Patients with advanced NSCLC and EGFR mutations derive clinical benefit from treatment with EGFR-tyrosine kinase inhibitors (TKIs). This study assessed the efficacy and safety of adjuvant icotinib without chemotherapy in EGFR-mutated NSCLC patients undergoing resection of stage IB-IIIA. Our retrospective study enrolled 20 patients treated with icotinib as adjuvant therapy. Survival factors were evaluated by univariate and Cox regression analysis. The median follow-up time was 30 months (range 24-41). At the data cut-off, five patients (25%) had recurrence or metastasis and one patient had died of the disease. The two-year disease-free survival (DFS) rate was 85%. No recurrence occurred in the high-risk stage IB subgroup during the follow-up period. In univariate analysis, the micropapillary pattern had a statistically significant effect on DFS ( P = 0.040). Multivariate logistic regression analysis showed that there was no independent predictor. Drug related adverse events (AEs) occurred in nine patients (45.0%). The most common AEs were skin-related events and diarrhea, but were relatively mild. No grade 3 AEs or occurrences of intolerable toxicity were observed. Icotinib as adjuvant therapy is effective in patients harboring EGFR mutations after complete resection, with an acceptable AE profile. Further trials with larger sample sizes might confirm the efficiency of adjuvant TKI in selected patients. © 2016 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.
Erdogan, Bulent; Kodaz, Hilmi; Karabulut, Senem; Cinkaya, Ahmet; Tozkir, Hilmi; Tanriverdi, Ozgur; Cabuk, Devrim; Hacioglu, Muhammed Bekir; Turkmen, Esma; Hacibekiroglu, Ilhan; Uzunoglu, Sernaz; Cicin, Irfan
2016-11-10
Lung cancer in smokers and non-smokers demonstrates distinct genetic profiles, and cigarette smoking affects epidermal growth factor receptor (EGFR) function and causes secondary EGFR tyrosine kinase resistance. We evaluated the effect of active smoking in patients with metastatic lung adenocarcinoma. A total of 132 metastatic lung adenocarcinoma patients, diagnosed between 2008 and 2013, with known EGFR mutation status, were evaluated retrospectively. Among these patients, 40 had an activating EGFR mutation. Patients who continued smoking during the treatment were defined as active smokers. Former smokers and never smokers were together defined as non-smokers. The outcomes of the treatment in relation to the EGFR mutation and smoking status were evaluated. The median follow-up time was 10.5 months. The overall response rate for the first-line therapy was significantly higher among the EGFR-mutant patients (p = 0.01), however, smoking status had no impact on the response rate (p = 0.1). The EGFR-mutant active smokers progressed earlier than the non-smokers (p < 0.01). The overall survival (OS) of the non-smokers and patients treated with erlotinib was significantly longer (p = 0.02 and p = 0.01, respectively). Smoking status did not affect the OS in EGFR wild type tumors (p = 0.49) but EGFR-mutant non-smokers had a longer OS than the active smokers (p = 0.01).The active smokers treated with erlotinib had poorer survival than the non-smokers (p = 0.03). Multivariate analysis of EGFR-mutant patients showed that erlotinib treatment at any line and non-smoking were independent prognostic factors for the OS (p = 0.04 and p = 0.01, respectively). Smoking during treatment is a negative prognostic factor in metastatic lung adenocarcinoma with an EGFR mutation.
Dick, Emily; Kalra, Spandan; Anderson, David; George, Vinoj; Ritso, Morten; Laval, Steven H; Barresi, Rita; Aartsma-Rus, Annemieke; Lochmüller, Hanns; Denning, Chris
2013-10-15
With an incidence of ∼1:3,500 to 5,000 in male children, Duchenne muscular dystrophy (DMD) is an X-linked disorder in which progressive muscle degeneration occurs and affected boys usually die in their twenties or thirties. Cardiac involvement occurs in 90% of patients and heart failure accounts for up to 40% of deaths. To enable new therapeutics such as gene therapy and exon skipping to be tested in human cardiomyocytes, we produced human induced pluripotent stem cells (hiPSC) from seven patients harboring mutations across the DMD gene. Mutations were retained during differentiation and analysis indicated the cardiomyocytes showed a dystrophic gene expression profile. Antisense oligonucleotide-mediated skipping of exon 51 restored dystrophin expression to ∼30% of normal levels in hiPSC-cardiomyocytes carrying exon 47-50 or 48-50 deletions. Alternatively, delivery of a dystrophin minigene to cardiomyocytes with a deletion in exon 35 or a point mutation in exon 70 allowed expression levels similar to those seen in healthy cells. This demonstrates that DMD hiPSC-cardiomyocytes provide a novel tool to evaluate whether new therapeutics can restore dystrophin expression in the heart.
Dick, Emily; Kalra, Spandan; Anderson, David; George, Vinoj; Ritso, Morten; Laval, Steven H.; Barresi, Rita; Aartsma-Rus, Annemieke; Lochmüller, Hanns
2013-01-01
With an incidence of ∼1:3,500 to 5,000 in male children, Duchenne muscular dystrophy (DMD) is an X-linked disorder in which progressive muscle degeneration occurs and affected boys usually die in their twenties or thirties. Cardiac involvement occurs in 90% of patients and heart failure accounts for up to 40% of deaths. To enable new therapeutics such as gene therapy and exon skipping to be tested in human cardiomyocytes, we produced human induced pluripotent stem cells (hiPSC) from seven patients harboring mutations across the DMD gene. Mutations were retained during differentiation and analysis indicated the cardiomyocytes showed a dystrophic gene expression profile. Antisense oligonucleotide-mediated skipping of exon 51 restored dystrophin expression to ∼30% of normal levels in hiPSC-cardiomyocytes carrying exon 47–50 or 48–50 deletions. Alternatively, delivery of a dystrophin minigene to cardiomyocytes with a deletion in exon 35 or a point mutation in exon 70 allowed expression levels similar to those seen in healthy cells. This demonstrates that DMD hiPSC-cardiomyocytes provide a novel tool to evaluate whether new therapeutics can restore dystrophin expression in the heart. PMID:23829870
Perthes disease: A new finding in Floating-Harbor syndrome.
Milani, Donatella; Scuvera, Giulietta; Gatti, Marta; Tolva, Gianluca; Bonarrigo, Francesca; Esposito, Susanna; Gervasini, Cristina
2018-03-01
Floating-Harbor Syndrome (FHS; OMIM #136140) is an ultra-rare autosomal dominant genetic condition characterized by expressive language delay, short stature with delayed bone mineralization, a triangular face with a prominent nose, and deep-set eyes, and hand anomalies. First reported in 1973, FHS is associated with mutations in the SRCAP gene, which encodes SNF2-related CREBBP activator protein. Mutations in the CREBBP gene cause Rubinstein-Taybi Syndrome (RSTS; OMIM #180849, #613684), another rare disease characterized by broad thumbs and halluces, facial dysmorphisms, short stature, and intellectual disability, which has a phenotypic overlap with FHS. We describe a case of FHS associated with a novel SRCAP mutation and characterized by Perthes disease, a skeletal anomaly described in approximately 3% of patients with RSTS. Thus Perthes disease can be added to the list of clinical features that overlap between FHS and RSTS. © 2018 Wiley Periodicals, Inc.
Katayama, Ryohei; Khan, Tahsin M.; Benes, Cyril; Lifshits, Eugene; Ebi, Hiromichi; Rivera, Victor M.; Shakespeare, William C.; Iafrate, A. John; Engelman, Jeffrey A.; Shaw, Alice T.
2011-01-01
The echinoderm microtubule-associated protein-like 4 (EML4)-anaplastic lymphoma kinase (ALK) fusion oncogene represents a molecular target in a small subset of non-small cell lung cancers (NSCLCs). This fusion leads to constitutive ALK activation with potent transforming activity. In a pivotal phase 1 clinical trial, the ALK tyrosine kinase inhibitor (TKI) crizotinib (PF-02341066) demonstrated impressive antitumor activity in the majority of patients with NSCLC harboring ALK fusions. However, despite these remarkable initial responses, cancers eventually develop resistance to crizotinib, usually within 1 y, thereby limiting the potential clinical benefit. To determine how cancers acquire resistance to ALK inhibitors, we established a model of acquired resistance to crizotinib by exposing a highly sensitive EML4-ALK–positive NSCLC cell line to increasing doses of crizotinib until resistance emerged. We found that cells resistant to intermediate doses of crizotinib developed amplification of the EML4-ALK gene. Cells resistant to higher doses (1 μM) also developed a gatekeeper mutation, L1196M, within the kinase domain, rendering EML4-ALK insensitive to crizotinib. This gatekeeper mutation was readily detected using a unique and highly sensitive allele-specific PCR assay. Although crizotinib was ineffectual against EML4-ALK harboring the gatekeeper mutation, we observed that two structurally different ALK inhibitors, NVP-TAE684 and AP26113, were highly active against the resistant cancer cells in vitro and in vivo. Furthermore, these resistant cells remained highly sensitive to the Hsp90 inhibitor 17-AAG. Thus, we have developed a model of acquired resistance to ALK inhibitors and have shown that second-generation ALK TKIs or Hsp90 inhibitors are effective in treating crizotinib-resistant tumors harboring secondary gatekeeper mutations. PMID:21502504
Azuma, Koichi; Nishio, Makoto; Hayashi, Hidetoshi; Kiura, Katsuyuki; Satouchi, Miyako; Sugawara, Shunichi; Hida, Toyoaki; Iwamoto, Yasuo; Inoue, Akira; Takeda, Koji; Ikeda, Satoshi; Nakagawa, Tomoki; Takeda, Kentaro; Asahina, Seitaro; Komatsu, Kanji; Morita, Satoshi; Fukuoka, Masahiro; Nakagawa, Kazuhiko
2018-05-28
Epidermal growth factor receptor (EGFR) activating mutations occur in approximately 50% of East Asian patients with non-small cell lung cancer (NSCLC) and confer sensitivity to tyrosine kinase inhibitors (TKI). ASP8273 is an orally administered, irreversible EGFR-TKI that inhibits EGFR activating mutations and has demonstrated clinical activity in patients with EGFR mutation-positive NSCLC. EGFR-TKI-naïve Japanese adult patients (≥20 years) with NSCLC harboring EGFR mutations were enrolled in this open-label, single-arm, Phase 2 study (NCT02500927). Patients received ASP8273 300mg once daily until discontinuation criteria were met. The primary endpoint was to determine the safety of ASP8273 300mg; secondary endpoint was antitumor activity defined by RECIST v1.1. Thirty-one patients (12M/19F; median age 64 years [range: 31-82]) with EGFR mutation-positive NSCLC were enrolled; as of 23 February 2016, 25 patients (81%) were still on study. Of the 31 patients, 27 (87%) had an ex19del (n=13, 42%) or a L858R (n=14, 45%) EGFR activating mutation; 2 (7%) had L861Q mutation and 5 (16%) had other EGFR activating mutations, two had an activating mutation and the T790M resistance mutation. The most commonly reported treatment-emergent adverse event was diarrhea [n=24, 77%]. All patients had at least 1 post-baseline scan; 1 patient (3%) achieved a confirmed complete response, 13 (42%) had a confirmed partial response, and 15 (48%) had confirmed stable disease (disease control rate: 94% [n=29/31]) per investigator assessment. Once-daily ASP8273 300 mg was generally well tolerated and demonstrated antitumor activity in TKI-naïve Japanese patients with EGFR mutation-positive NSCLC. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Partouche, Nicolas; Conejero, Carole; Barathon, Quentin; Moroch, Julien; Tulliez, Michel; Cordonnier, Catherine; Giraudier, Stephane
2018-02-01
Myeloproliferative neoplasms are characterized by transduction pathway recognized as mutually exclusive molecular abnormalities such as BCR-ABL translocation, JAK2V617F or JAK2 exon 12 mutations, MPL w515, and CALR mutations. However, in some rare cases, associations of such mutations are found in 1 patient. This can be related to 2 pathologies (at least 2 different clones harboring 2 mutations) or associated mutations in 1 clone. We describe here such an association of CALR and MPL mutations in a patient harboring the second mutation in a subclone during the phenotypic evolution of the myeloproliferative neoplasms. Copyright © 2017 John Wiley & Sons, Ltd.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-04-02
...-AA08 Special Local Regulations; St. Thomas Carnival Watersport Activities, Charlotte Amalie Harbor; St... proposes to establish a special local regulation on the waters of Charlotte Amalie Harbor in St Thomas, USVI during the St. Thomas Carnival Watersport Activities, a high speed boat race. The event is...
HIV-1 replication in cell lines harboring INI1/hSNF5 mutations.
Sorin, Masha; Yung, Eric; Wu, Xuhong; Kalpana, Ganjam V
2006-08-31
INI1/hSNF5 is a cellular protein that directly interacts with HIV-1 integrase (IN). It is specifically incorporated into HIV-1 virions. A dominant negative mutant derived from INI1 inhibits HIV-1 replication. Recent studies indicate that INI1 is associated with pre-integration and reverse transcription complexes that are formed upon viral entry into the target cells. INI1 also is a tumor suppressor, biallelically deleted/mutated in malignant rhabdoid tumors. We have utilized cell lines derived from the rhabdoid tumors, MON and STA-WT1, that harbor either null or truncating mutations of INI1 respectively, to assess the effect of INI1 on HIV-1 replication. We found that while HIV-1 virions produced in 293T cells efficiently transduced MON and STA-WT1 cells, HIV-1 particle production was severely reduced in both of these cells. Reintroduction of INI1 into MON and STA-WT1 significantly enhanced the particle production in both cell lines. HIV-1 particles produced in MON cells were reduced for infectivity, while those produced in STA-WT1 were not. Further analysis indicated the presence of INI1 in those virions produced from STA-WT1 but not from those produced from MON cells. HIV-1 produced in MON cells were defective for synthesis of early and late reverse transcription products in the target cells. Furthermore, virions produced in MON cells were defective for exogenous reverse transcriptase activity carried out using exogenous template, primer and substrate. Our results suggest that INI1-deficient cells exhibit reduced particle production that can be partly enhanced by re-introduction of INI1. Infectivity of HIV-1 produced in some but not all INI1 defective cells, is affected and this defect may correlate to the lack of INI1 and/or some other proteins in these virions. The block in early events of virion produced from MON cells appears to be at the stage of reverse transcription. These studies suggest that presence of INI1 or some other host factor in virions and
Lopes, Gabriel Lima; Vattimo, Edoardo Filippo de Queiroz; de Castro, Gilberto
2015-01-01
Abstract Lung cancer is the leading cause of cancer-related deaths worldwide. Promising new therapies have recently emerged from the development of molecular targeted drugs; particularly promising are those blocking the signal transduction machinery of cancer cells. One of the most widely studied cell signaling pathways is that of EGFR, which leads to uncontrolled cell proliferation, increased cell angiogenesis, and greater cell invasiveness. Activating mutations in the EGFR gene (deletions in exon 19 and mutation L858R in exon 21), first described in 2004, have been detected in approximately 10% of all non-squamous non-small cell lung cancer (NSCLC) patients in Western countries and are the most important predictors of a response to EGFR tyrosine-kinase inhibitors (EGFR-TKIs). Studies of the EGFR-TKIs gefitinib, erlotinib, and afatinib, in comparison with platinum-based regimens, as first-line treatments in chemotherapy-naïve patients have shown that the EGFR-TKIs produce gains in progression-free survival and overall response rates, although only in patients whose tumors harbor activating mutations in the EGFR gene. Clinical trials have also shown EGFR-TKIs to be effective as second- and third-line therapies in advanced NSCLC. Here, we review the main aspects of EGFR pathway activation in NSCLC, underscore the importance of correctly identifying activating mutations in the EGFR gene, and discuss the main outcomes of EGFR-TKI treatment in NSCLC. PMID:26398757
Lopes, Gabriel Lima; Vattimo, Edoardo Filippo de Queiroz; Castro Junior, Gilberto de
2015-01-01
Lung cancer is the leading cause of cancer-related deaths worldwide. Promising new therapies have recently emerged from the development of molecular targeted drugs; particularly promising are those blocking the signal transduction machinery of cancer cells. One of the most widely studied cell signaling pathways is that of EGFR, which leads to uncontrolled cell proliferation, increased cell angiogenesis, and greater cell invasiveness. Activating mutations in the EGFR gene (deletions in exon 19 and mutation L858R in exon 21), first described in 2004, have been detected in approximately 10% of all non-squamous non-small cell lung cancer (NSCLC) patients in Western countries and are the most important predictors of a response to EGFR tyrosine-kinase inhibitors (EGFR-TKIs). Studies of the EGFR-TKIs gefitinib, erlotinib, and afatinib, in comparison with platinum-based regimens, as first-line treatments in chemotherapy-naïve patients have shown that the EGFR-TKIs produce gains in progression-free survival and overall response rates, although only in patients whose tumors harbor activating mutations in the EGFR gene. Clinical trials have also shown EGFR-TKIs to be effective as second- and third-line therapies in advanced NSCLC. Here, we review the main aspects of EGFR pathway activation in NSCLC, underscore the importance of correctly identifying activating mutations in the EGFR gene, and discuss the main outcomes of EGFR-TKI treatment in NSCLC.
Uchibori, Ken; Inase, Naohiko; Nishio, Makoto; Fujita, Naoya; Katayama, Ryohei
2018-04-24
The survival of patients with EGFR mutation-positive lung cancer has dramatically improved since the introduction of EGFR tyrosine kinase inhibitors (EGFR-TKIs). Recently, osimertinib showed significantly prolonged progression-free survival than first-generation EGFR-TKI in first-line treatment, suggesting that a paradigm change that would move osimetinib to first-line treatment is indicated. We performed N-ethyl-N-nitrosourea (ENU) mutagenesis screening to uncover the resistant mechanism in first- and second-line osimertinib treatment. Ba/F3 cells harboring EGFR activating-mutation with or without secondary resistant mutation were exposed to ENU for 24 hours to introduce random mutations and selected with gefitinib, afatinib, or osimertinib. Mutations of emerging resistant cells were assessed. The resistance of T790M and C797S to gefitinib and osimertinib, respectively, was prevalent in the mutagenesis screening with the Ba/F3 cells harboring activating-mutation alone. From C797S/activating-mutation expressing Ba/F3, the additional T790M was a major resistant mechanism in gefitinib and afatinib selection and the additional T854A and L792H were minor resistance mechanisms only in afatinib selection. However, the additional T854A or L792H mediated resistance to all classes of EGFR-TKI. Surprisingly, no resistant clone due to secondary mutation emerged from activating-mutation alone in the gefitinib + osimertinib selection. We showed the resistance mechanism to EGFR-TKI focusing on first- and second-line osimertinib using ENU mutagenesis screening. Additional T854A and L792H on C797S/activating-mutation were found as afatinib resistance and not as gefitinib resistance. Thus, compared to afatinib, the first-generation EGFR-TKI might be preferable as second-line treatment to C797S/activating-mutation emerging after first-line osimertinib treatment. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights
Inhibition of FLT3 Expression by Green Tea Catechins in FLT3 Mutated-AML Cells
Ly, Bui Thi Kim; Chi, Hoang Thanh; Yamagishi, Makoto; Kano, Yasuhiko; Hara, Yukihiko; Nakano, Kazumi; Sato, Yuko; Watanabe, Toshiki
2013-01-01
Acute myeloid leukemia (AML) is a heterogeneous disease characterized by a block in differentiation and uncontrolled proliferation. FLT3 is a commonly mutated gene found in AML patients. In clinical trials, the presence of a FLT3-ITD mutation significantly correlates with an increased risk of relapse and dismal overall survival. Therefore, activated FLT3 is a promising molecular target for AML therapies. In this study, we have shown that green tea polyphenols including (−)-epigallocatechin-3-gallate (EGCG), (−)-epigallocatechin (EGC), and (−)-epicatechin-3-gallate (ECG) suppress the proliferation of AML cells. Interestingly, EGCG, EGC and ECG showed the inhibition of FLT3 expression in cell lines harboring FLT3 mutations. In the THP-1 cells harboring FLT3 wild-type, EGCG showed the suppression of cell proliferation but did not suppress the expression of FLT3 even at the concentration that suppress 100% cell proliferation. Moreover, EGCG-, EGC-and ECG-treated cells showed the suppression of MAPK, AKT and STAT5 phosphorylation. Altogether, we suggest that green tea polyphenols could serve as reagents for treatment or prevention of leukemia harboring FLT3 mutations. PMID:23840454
Griewank, Klaus G; Wiesner, Thomas; Murali, Rajmohan; Pischler, Carina; Müller, Hansgeorg; Koelsche, Christian; Möller, Inga; Franklin, Cindy; Cosgarea, Ioana; Sucker, Antje; Schadendorf, Dirk; Schaller, Jörg; Horn, Susanne; Brenn, Thomas; Mentzel, Thomas
2018-03-01
Atypical fibroxanthomas and pleomorphic dermal sarcomas are tumors arising in sun-damaged skin of elderly patients. They have differing prognoses and are currently distinguished using histological criteria, such as invasion of deeper tissue structures, necrosis and lymphovascular or perineural invasion. To investigate the as-yet poorly understood genetics of these tumors, 41 atypical fibroxanthomas and 40 pleomorphic dermal sarcomas were subjected to targeted next-generation sequencing approaches as well as DNA copy number analysis by comparative genomic hybridization. In an analysis of the entire coding region of 341 oncogenes and tumor suppressor genes in 13 atypical fibroxanthomas using an established hybridization-based next-generation sequencing approach, we found that these tumors harbor a large number of mutations. Gene alterations were identified in more than half of the analyzed samples in FAT1, NOTCH1/2, CDKN2A, TP53, and the TERT promoter. The presence of these alterations was verified in 26 atypical fibroxanthoma and 35 pleomorphic dermal sarcoma samples by targeted amplicon-based next-generation sequencing. Similar mutation profiles in FAT1, NOTCH1/2, CDKN2A, TP53, and the TERT promoter were identified in both atypical fibroxanthoma and pleomorphic dermal sarcoma. Activating RAS mutations (G12 and G13) identified in 3 pleomorphic dermal sarcoma were not found in atypical fibroxanthoma. Comprehensive DNA copy number analysis demonstrated a wide array of different copy number gains and losses, with similar profiles in atypical fibroxanthoma and pleomorphic dermal sarcoma. In summary, atypical fibroxanthoma and pleomorphic dermal sarcoma are highly mutated tumors with recurrent mutations in FAT1, NOTCH1/2, CDKN2A, TP53, and the TERT promoter, and a range of DNA copy number alterations. These findings suggest that atypical fibroxanthomas and pleomorphic dermal sarcomas are genetically related, potentially representing two ends of a common tumor spectrum
Structure-functional prediction and analysis of cancer mutation effects in protein kinases.
Dixit, Anshuman; Verkhivker, Gennady M
2014-01-01
A central goal of cancer research is to discover and characterize the functional effects of mutated genes that contribute to tumorigenesis. In this study, we provide a detailed structural classification and analysis of functional dynamics for members of protein kinase families that are known to harbor cancer mutations. We also present a systematic computational analysis that combines sequence and structure-based prediction models to characterize the effect of cancer mutations in protein kinases. We focus on the differential effects of activating point mutations that increase protein kinase activity and kinase-inactivating mutations that decrease activity. Mapping of cancer mutations onto the conformational mobility profiles of known crystal structures demonstrated that activating mutations could reduce a steric barrier for the movement from the basal "low" activity state to the "active" state. According to our analysis, the mechanism of activating mutations reflects a combined effect of partial destabilization of the kinase in its inactive state and a concomitant stabilization of its active-like form, which is likely to drive tumorigenesis at some level. Ultimately, the analysis of the evolutionary and structural features of the major cancer-causing mutational hotspot in kinases can also aid in the correlation of kinase mutation effects with clinical outcomes.
Allele-Specific Chromatin Recruitment and Therapeutic Vulnerabilities of ESR1 Activating Mutations.
Jeselsohn, Rinath; Bergholz, Johann S; Pun, Matthew; Cornwell, MacIntosh; Liu, Weihan; Nardone, Agostina; Xiao, Tengfei; Li, Wei; Qiu, Xintao; Buchwalter, Gilles; Feiglin, Ariel; Abell-Hart, Kayley; Fei, Teng; Rao, Prakash; Long, Henry; Kwiatkowski, Nicholas; Zhang, Tinghu; Gray, Nathanael; Melchers, Diane; Houtman, Rene; Liu, X Shirley; Cohen, Ofir; Wagle, Nikhil; Winer, Eric P; Zhao, Jean; Brown, Myles
2018-02-12
Estrogen receptor α (ER) ligand-binding domain (LBD) mutations are found in a substantial number of endocrine treatment-resistant metastatic ER-positive (ER + ) breast cancers. We investigated the chromatin recruitment, transcriptional network, and genetic vulnerabilities in breast cancer models harboring the clinically relevant ER mutations. These mutants exhibit both ligand-independent functions that mimic estradiol-bound wild-type ER as well as allele-specific neomorphic properties that promote a pro-metastatic phenotype. Analysis of the genome-wide ER binding sites identified mutant ER unique recruitment mediating the allele-specific transcriptional program. Genetic screens identified genes that are essential for the ligand-independent growth driven by the mutants. These studies provide insights into the mechanism of endocrine therapy resistance engendered by ER mutations and potential therapeutic targets. Copyright © 2018 Elsevier Inc. All rights reserved.
Structure-Functional Prediction and Analysis of Cancer Mutation Effects in Protein Kinases
Dixit, Anshuman; Verkhivker, Gennady M.
2014-01-01
A central goal of cancer research is to discover and characterize the functional effects of mutated genes that contribute to tumorigenesis. In this study, we provide a detailed structural classification and analysis of functional dynamics for members of protein kinase families that are known to harbor cancer mutations. We also present a systematic computational analysis that combines sequence and structure-based prediction models to characterize the effect of cancer mutations in protein kinases. We focus on the differential effects of activating point mutations that increase protein kinase activity and kinase-inactivating mutations that decrease activity. Mapping of cancer mutations onto the conformational mobility profiles of known crystal structures demonstrated that activating mutations could reduce a steric barrier for the movement from the basal “low” activity state to the “active” state. According to our analysis, the mechanism of activating mutations reflects a combined effect of partial destabilization of the kinase in its inactive state and a concomitant stabilization of its active-like form, which is likely to drive tumorigenesis at some level. Ultimately, the analysis of the evolutionary and structural features of the major cancer-causing mutational hotspot in kinases can also aid in the correlation of kinase mutation effects with clinical outcomes. PMID:24817905
Ihara, Yukiko; Tomonoh, Yuko; Deshimaru, Masanobu; Zhang, Bo; Uchida, Taku; Ishii, Atsushi; Hirose, Shinichi
2016-01-01
The hetero-tetrameric voltage-gated potassium channel Kv7.2/Kv7.3, which is encoded by KCNQ2 and KCNQ3, plays an important role in limiting network excitability in the neonatal brain. Kv7.2/Kv7.3 dysfunction resulting from KCNQ2 mutations predominantly causes self-limited or benign epilepsy in neonates, but also causes early onset epileptic encephalopathy. Retigabine (RTG), a Kv7.2/ Kv7.3-channel opener, seems to be a rational antiepileptic drug for epilepsies caused by KCNQ2 mutations. We therefore evaluated the effects of RTG on seizures in two strains of knock-in mice harboring different Kcnq2 mutations, in comparison to the effects of phenobarbital (PB), which is the first-line antiepileptic drug for seizures in neonates. The subjects were heterozygous knock-in mice (Kcnq2Y284C/+ and Kcnq2A306T/+) bearing the Y284C or A306T Kcnq2 mutation, respectively, and their wild-type (WT) littermates, at 63-100 days of age. Seizures induced by intraperitoneal injection of kainic acid (KA, 12mg/kg) were recorded using a video-electroencephalography (EEG) monitoring system. Effects of RTG on KA-induced seizures of both strains of knock-in mice were assessed using seizure scores from a modified Racine's scale and compared with those of PB. The number and total duration of spike bursts on EEG and behaviors monitored by video recording were also used to evaluate the effects of RTG and PB. Both Kcnq2Y284C/+ and Kcnq2A306T/+ mice showed significantly more KA-induced seizures than WT mice. RTG significantly attenuated KA-induced seizure activities in both Kcnq2Y284C/+ and Kcnq2A306T/+ mice, and more markedly than PB. This is the first reported evidence of RTG ameliorating KA-induced seizures in knock-in mice bearing mutations of Kcnq2, with more marked effects than those observed with PB. RTG or other Kv7.2-channel openers may be considered as first-line antiepileptic treatments for epilepsies resulting from KCNQ2 mutations.
Zimmermannova, O; Doktorova, E; Stuchly, J; Kanderova, V; Kuzilkova, D; Strnad, H; Starkova, J; Alberich-Jorda, M; Falkenburg, J H F; Trka, J; Petrak, J; Zuna, J; Zaliova, M
2017-01-01
Leukemias harboring the ETV6-ABL1 fusion represent a rare subset of hematological malignancies with unfavorable outcomes. The constitutively active chimeric Etv6-Abl1 tyrosine kinase can be specifically inhibited by tyrosine kinase inhibitors (TKIs). Although TKIs represent an important therapeutic tool, so far, the mechanism underlying the potential TKI resistance in ETV6-ABL1-positive malignancies has not been studied in detail. To address this issue, we established a TKI-resistant ETV6-ABL1-positive leukemic cell line through long-term exposure to imatinib. ETV6-ABL1-dependent mechanisms (including fusion gene/protein mutation, amplification, enhanced expression or phosphorylation) and increased TKI efflux were excluded as potential causes of resistance. We showed that TKI effectively inhibited the Etv6-Abl1 kinase activity in resistant cells, and using short hairpin RNA (shRNA)-mediated silencing, we confirmed that the resistant cells became independent from the ETV6-ABL1 oncogene. Through analysis of the genomic and proteomic profiles of resistant cells, we identified an acquired mutation in the GNB1 gene, K89M, as the most likely cause of the resistance. We showed that cells harboring mutated GNB1 were capable of restoring signaling through the phosphoinositide-3-kinase (PI3K)/Akt/mTOR and mitogen-activated protein kinase (MAPK) pathways, whose activation is inhibited by TKI. This alternative GNB1K89M-mediated pro-survival signaling rendered ETV6-ABL1-positive leukemic cells resistant to TKI therapy. The mechanism of TKI resistance is independent of the targeted chimeric kinase and thus is potentially relevant not only to ETV6-ABL1-positive leukemias but also to a wider spectrum of malignancies treated by kinase inhibitors. PMID:28650474
Yoda, Satoshi; Lin, Jessica J; Lawrence, Michael S; Burke, Benjamin J; Friboulet, Luc; Langenbucher, Adam; Dardaei, Leila; Prutisto-Chang, Kylie; Dagogo-Jack, Ibiayi; Timofeevski, Sergei; Hubbeling, Harper; Gainor, Justin F; Ferris, Lorin A; Riley, Amanda K; Kattermann, Krystina E; Timonina, Daria; Heist, Rebecca S; Iafrate, A John; Benes, Cyril H; Lennerz, Jochen K; Mino-Kenudson, Mari; Engelman, Jeffrey A; Johnson, Ted W; Hata, Aaron N; Shaw, Alice T
2018-06-01
The cornerstone of treatment for advanced ALK-positive lung cancer is sequential therapy with increasingly potent and selective ALK inhibitors. The third-generation ALK inhibitor lorlatinib has demonstrated clinical activity in patients who failed previous ALK inhibitors. To define the spectrum of ALK mutations that confer lorlatinib resistance, we performed accelerated mutagenesis screening of Ba/F3 cells expressing EML4-ALK. Under comparable conditions, N -ethyl- N -nitrosourea (ENU) mutagenesis generated numerous crizotinib-resistant but no lorlatinib-resistant clones harboring single ALK mutations. In similar screens with EML4-ALK containing single ALK resistance mutations, numerous lorlatinib-resistant clones emerged harboring compound ALK mutations. To determine the clinical relevance of these mutations, we analyzed repeat biopsies from lorlatinib-resistant patients. Seven of 20 samples (35%) harbored compound ALK mutations, including two identified in the ENU screen. Whole-exome sequencing in three cases confirmed the stepwise accumulation of ALK mutations during sequential treatment. These results suggest that sequential ALK inhibitors can foster the emergence of compound ALK mutations, identification of which is critical to informing drug design and developing effective therapeutic strategies. Significance: Treatment with sequential first-, second-, and third-generation ALK inhibitors can select for compound ALK mutations that confer high-level resistance to ALK-targeted therapies. A more efficacious long-term strategy may be up-front treatment with a third-generation ALK inhibitor to prevent the emergence of on-target resistance. Cancer Discov; 8(6); 714-29. ©2018 AACR. This article is highlighted in the In This Issue feature, p. 663 . ©2018 American Association for Cancer Research.
SF3B1 and BAP1 mutations in blue nevus-like melanoma.
Griewank, Klaus G; Müller, Hansgeorg; Jackett, Louise A; Emberger, Michael; Möller, Inga; van de Nes, Johannes Ap; Zimmer, Lisa; Livingstone, Elisabeth; Wiesner, Thomas; Scholz, Simone L; Cosgarea, Ioana; Sucker, Antje; Schimming, Tobias; Hillen, Uwe; Schilling, Bastian; Paschen, Annette; Reis, Henning; Mentzel, Thomas; Kutzner, Heinz; Rütten, Arno; Murali, Rajmohan; Scolyer, Richard A; Schadendorf, Dirk
2017-07-01
Blue nevi are melanocytic tumors originating in the cutaneous dermis. Malignant tumors may arise in association with or resembling blue nevi, so called 'blue nevus-like melanoma', which can metastasize and result in patient death. Identifying which tumors will behave in a clinically aggressive manner can be challenging. Identifying genetic alterations in such tumors may assist in their diagnosis and prognostication. Blue nevi are known to be genetically related to uveal melanomas (eg, both harboring GNAQ and GNA11 mutations). In this study, we analyzed a large cohort (n=301) of various morphologic variants of blue nevi and related tumors including tumors diagnosed as atypical blue nevi (n=21), and blue nevus-like melanoma (n=12), screening for all gene mutations known to occur in uveal melanoma. Similar to published reports, we found the majority of blue nevi harbored activating mutations in GNAQ (53%) or GNA11 (15%). In addition, rare CYSLTR2 (1%) and PLCB4 (1%) mutations were identified. EIF1AX, SF3B1, and BAP1 mutations were also detected, with BAP1 and SF3B1 R625 mutations being present only in clearly malignant tumors (17% (n=2) and 25% (n=3) of blue nevus-like melanoma, respectively). In sequencing data from a larger cohort of cutaneous melanomas, this genetic profile was also identified in tumors not originally diagnosed as blue nevus-like melanoma. Our findings suggest that the genetic profile of coexistent GNAQ or GNA11 mutations with BAP1 or SF3B1 mutations can aid the histopathological diagnosis of blue nevus-like melanoma and distinguish blue nevus-like melanoma from conventional epidermal-derived melanomas. Future studies will need to further elucidate the prognostic implications and appropriate clinical management for patients with tumors harboring these mutation profiles.
Song, Dae Hyun; Lee, Boram; Shin, Yooju; Choi, In Ho; Ha, Sang Yun; Lee, Jae Jun; Hong, Min Eui; Choi, Yoon-La; Han, Joungho; Um, Sang-Won
2015-07-01
Kirsten rat sarcoma 2 viral oncogene homolog (KRAS) mutation in pulmonary adenocarcinoma is clinically important due to its association with resistance to EGFR inhibitors and poor prognosis. To our knowledge, there has not been a comparative study focusing on cytological nuclear features of pulmonary adenocarcinoma harboring KRAS mutation (KRAS-AD). Hence, we compared the cytomorphology of metastatic KRAS-AD and EGFR-positive adenocarcinoma (EGFR-AD) in aspiration specimens from lymph nodes. Forty lymph node aspiration specimens from forty KRAS-AD patients were collected at Samsung Medical Center (Seoul, Korea) from 2009 to 2013. As a control group, 40 EBUS-FNA lymph node specimens from 20 EGFR-AD patients were collected. EGFR-AD specimens were evaluated at Samsung Medical Center (Seoul, Korea) from 2012 to 2013. All 80 specimens were histologically confirmed to metastatic adenocarcinoma. Two pathologists performed a blinded review of all specimens. Compared with EGFR-AD, KRAS-AD exhibited more severe nuclear pleomorphism (P < 0.001), coarse chromatin (P = 0.001), cherry-red nucleoli (P < 0.001) and naked tumor cells (P = 0.002) with necrotic (P < 0.001) and neutrophilic (P = 0.008) background. Our study provides the first demonstration of cytomorphologic differentiation between metastatic KRAS-AD and metastatic EGFR-AD in lymph node aspiration specimens. © 2014 Wiley Periodicals, Inc.
Bernasconi-Elias, Paula; Hu, Tiancen; Jenkins, David; Firestone, Brant; Gans, Sara; Kurth, Esther; Capodieci, Paola; Deplazes-Lauber, Joelle; Petropoulos, Konstantin; Thiel, Phillip; Ponsel, Dirk; Choi, Sung Hee; LeMotte, Peter; London, Anne; Goetcshkes, Margaret; Nolin, Erin; Jones, Michael D.; Slocum, Kelly; Kluk, Michael J.; Weinstock, David M.; Christodoulou, Alexandra; Weinberg, Olga; Jaehrling, Jan; Ettenberg, Seth A.; Buckler, Alan; Blacklow, Stephen C.; Aster, Jon C.; Fryer, Christy J.
2016-01-01
Notch receptors have been implicated as oncogenic drivers in several cancers, the most notable example being NOTCH1 in T-cell acute lymphoblastic leukemia (T-ALL). To characterize the role of activated NOTCH3 in cancer, we generated an antibody that detects the neo-epitope created upon gamma-secretase cleavage of NOTCH3 to release its intracellular domain (ICD3), and sequenced the negative regulatory region (NRR) and PEST domain coding regions of NOTCH3 in a panel of cell lines. We also characterize NOTCH3 tumor-associated mutations that result in activation of signaling and report new inhibitory antibodies. We determined the structural basis for receptor inhibition by obtaining the first co-crystal structure of a NOTCH3 antibody with the NRR protein and defined two distinct epitopes for NRR antibodies. The antibodies exhibit potent anti-leukemic activity in cell lines and tumor xenografts harboring NOTCH3 activating mutations. Screening of primary T-ALL samples reveals that two of 40 tumors examined show active NOTCH3 signaling. We also identified evidence of NOTCH3 activation in 12 of 24 patient-derived orthotopic xenograft models, two of which exhibit activation of NOTCH3 without activation of NOTCH1. Our studies provide additional insights into NOTCH3 activation and offer a path forward for identification of cancers that are likely to respond to therapy with NOTCH3 selective inhibitory antibodies. PMID:27157619
Uemura, Takehiro; Oguri, Tetsuya; Okayama, Minami; Furuta, Hiromi; Kanemitsu, Yoshihiro; Takakuwa, Osamu; Ohkubo, Hirotsugu; Takemura, Masaya; Maeno, Ken; Ito, Yutaka; Niimi, Akio
2017-04-01
We herein report a case of dramatic intracranial response to osimertinib in a poor performance status patient with lung adenocarcinoma harboring the epidermal growth factor receptor ( EGFR ) T790M mutation encoded in exon 20. The patient was a 59-year-old woman with EGFR exon 19 deletion-positive lung adenocarcinoma, who relapsed with multiple brain metastases. Computed tomography-guided biopsy of the left pleural tumor revealed adenocarcinoma harboring an EGFR exon 19 deletion and an EGFR T790M mutation encoded in exon 20. The patient was treated with osimertinib, a third-generation EGFR tyrosine kinase inhibitor. Two days after treatment initiation, the patient displayed profound disturbance of consciousness, possibly due to carcinomatous meningitis, and treatment had to be discontinued due to difficulty in taking osimertinib. However, the patient gradually started to recover consciousness and, after 3 days, she was again able to take osimertinib. One month after the initiation of osimertinib treatment, magnetic resonance imaging revealed an apparent reduction in brain metastases. The patient is currently under continued treatment with osimertinib. At the last follow-up (February, 2017) she exhibited partial response to the treatment.
Uemura, Takehiro; Oguri, Tetsuya; Okayama, Minami; Furuta, Hiromi; Kanemitsu, Yoshihiro; Takakuwa, Osamu; Ohkubo, Hirotsugu; Takemura, Masaya; Maeno, Ken; Ito, Yutaka; Niimi, Akio
2017-01-01
We herein report a case of dramatic intracranial response to osimertinib in a poor performance status patient with lung adenocarcinoma harboring the epidermal growth factor receptor (EGFR) T790M mutation encoded in exon 20. The patient was a 59-year-old woman with EGFR exon 19 deletion-positive lung adenocarcinoma, who relapsed with multiple brain metastases. Computed tomography-guided biopsy of the left pleural tumor revealed adenocarcinoma harboring an EGFR exon 19 deletion and an EGFR T790M mutation encoded in exon 20. The patient was treated with osimertinib, a third-generation EGFR tyrosine kinase inhibitor. Two days after treatment initiation, the patient displayed profound disturbance of consciousness, possibly due to carcinomatous meningitis, and treatment had to be discontinued due to difficulty in taking osimertinib. However, the patient gradually started to recover consciousness and, after 3 days, she was again able to take osimertinib. One month after the initiation of osimertinib treatment, magnetic resonance imaging revealed an apparent reduction in brain metastases. The patient is currently under continued treatment with osimertinib. At the last follow-up (February, 2017) she exhibited partial response to the treatment. PMID:28413660
1975-08-01
Paul, Minnesota 55101 August 1975 ,.’U * - S • S S S S S • S U U FIN"L ENVIRONMENTAL IMPACT STATEMENT OPERATION AND MAINTENANCE ACTIVITIES ONTONAGON...HARBOR, MICHIGAN LAKE SUPERIOR Responsible Office: St. Paul District, Corps of Engineers, 1135 U.S. Post Office and Custom House, St. Paul, Minnesota ... mining is present at White Pine, 12 air miles southwest of Ontonagon Harbor. 6 2.130 Topography. - The area’s topography is directly related to the
Isaksen, Toke Jost; Vedovato, Natascia; Vitenzon, Ariel; Gadsby, David C.; Khodakhah, Kamran
2017-01-01
Mutations in the neuron-specific α3 isoform of the Na+/K+-ATPase are found in patients suffering from Rapid onset Dystonia Parkinsonism and Alternating Hemiplegia of Childhood, two closely related movement disorders. We show that mice harboring a heterozygous hot spot disease mutation, D801Y (α3+/D801Y), suffer abrupt hypothermia-induced dystonia identified by electromyographic recordings. Single-neuron in vivo recordings in awake α3+/D801Y mice revealed irregular firing of Purkinje cells and their synaptic targets, the deep cerebellar nuclei neurons, which was further exacerbated during dystonia and evolved into abnormal high-frequency burst-like firing. Biophysically, we show that the D-to-Y mutation abolished pump-mediated Na+/K+ exchange, but allowed the pumps to bind Na+ and become phosphorylated. These findings implicate aberrant cerebellar activity in α3 isoform-related dystonia and add to the functional understanding of the scarce and severe mutations in the α3 isoform Na+/K+-ATPase. PMID:28472154
Galán-Díez, Marta; Isa, Adiba; Ponzetti, Marco; Nielsen, Morten Frost; Kassem, Moustapha; Kousteni, Stavroula
2016-03-01
Osteoblasts are emerging regulators of myeloid malignancies since genetic alterations in them, such as constitutive activation of β-catenin, instigate their appearance. The LDL receptor-related protein 5 (LRP5), initially proposed to be a co-receptor for Wnt proteins, in fact favors bone formation by suppressing gut-serotonin synthesis. This function of Lrp5 occurring in the gut is independent of β-catenin activation in osteoblasts. However, it is unknown whether Lrp5 can act directly in osteoblast to influence other functions that require β-catenin signaling, particularly, the deregulation of hematopoiesis and leukemogenic properties of β-catenin activation in osteoblasts, that lead to development of acute myeloid leukemia (AML). Using mice with gain-of-function (GOF) Lrp5 alleles (Lrp5(A214V)) that recapitulate the human high bone mass (HBM) phenotype, as well as patients with the T253I HBM Lrp5 mutation, we show here that Lrp5 GOF mutations in both humans and mice do not activate β-catenin signaling in osteoblasts. Consistent with a lack of β-catenin activation in their osteoblasts, Lrp5(A214V) mice have normal trilinear hematopoiesis. In contrast to leukemic mice with constitutive activation of β-catenin in osteoblasts (Ctnnb1(CAosb)), accumulation of early myeloid progenitors, a characteristic of AML, myeloid-blasts in blood, and segmented neutrophils or dysplastic megakaryocytes in the bone marrow, are not observed in Lrp5(A214V) mice. Likewise, peripheral blood count analysis in HBM patients showed normal hematopoiesis, normal percentage of myeloid cells, and lack of anemia. We conclude that Lrp5 GOF mutations do not activate β-catenin signaling in osteoblasts. As a result, myeloid lineage differentiation is normal in HBM patients and mice. This article is part of a Special Issue entitled: Tumor Microenvironment Regulation of Cancer Cell Survival, Metastasis, Inflammation, and Immune Surveillance edited by Peter Ruvolo and Gregg L. Semenza. Published
Phenotypic diversity in patients with lipodystrophy associated with LMNA mutations.
Mory, Patricia B; Crispim, Felipe; Freire, Maria Beatriz S; Salles, João Eduardo N; Valério, Cynthia M; Godoy-Matos, Amelio F; Dib, Sérgio A; Moisés, Regina S
2012-09-01
Mutations in LMNA have been linked to diverse disorders called laminopathies, which display heterogeneous phenotypes and include diseases affecting muscles, axonal neurons, progeroid syndromes, and lipodystrophies. Among the lipodystrophies, LMNA mutations have been reported most frequently in patients with familial partial lipodystrophy (FPLD) of the Dunnigan variety; however, phenotypic heterogeneity in the pattern of body fat loss has been observed. In this study, we searched for LMNA mutations in patients with various forms of lipodystrophy. We studied 21 unrelated individuals with lipodystrophy. Subjects underwent a complete clinical evaluation and were classified as typical FPLD (n=12), atypical partial lipodystrophy (n=7), or generalized lipodystrophy (n=2). Molecular analysis of LMNA gene, analysis of body fat by dual-energy X-ray absorptiometry, and biochemical measurements were performed. ALL PATIENTS WITH TYPICAL FPLD WERE FOUND TO CARRY LMNA MUTATIONS: seven patients harbored the heterozygous p.R482W (c.1444C>T), two patients harbored the p.R482Q (c.1445G>A), and two individuals harbored the novel heterozygous variant p.N466D (c.1396A>G), all in exon 8. Also, a homozygous p.R584H (c.1751 G>A) mutation in exon 11 was found. Among patients with atypical partial lipodystrophy, two of them were found to have LMNA mutations: a novel heterozygous p.R582C variation (c.1744 C>T) in exon 11 and a heterozygous substitution p.R349W (c.1045C>T) in exon 6. Among patients with generalized lipodystrophy, only one harbored LMNA mutation, a heterozygous p.T10I (c.29C>T) in exon 1. We have identified LMNA mutations in phenotypically diverse lipodystrophies. Also, our study broadens the spectrum of LMNA mutations in lipodystrophy.
Fischer, Marcus M; Yeung, V Pete; Cattaruzza, Fiore; Hussein, Rajaa; Yen, Wan-Ching; Murriel, Christopher; Evans, James W; O'Young, Gilbert; Brunner, Alayne L; Wang, Min; Cain, Jennifer; Cancilla, Belinda; Kapoun, Ann; Hoey, Timothy
2017-11-10
Activating mutations in the Wnt pathway are a characteristic feature of colorectal cancer (CRC). The R-spondin (RSPO) family is a group of secreted proteins that enhance Wnt signaling and RSPO2 and RSPO3 gene fusions have been reported in CRC. We have previously shown that Wnt pathway blockers exhibit potent combinatorial activity with taxanes to inhibit tumor growth. Here we show that RSPO3 antagonism synergizes with paclitaxel based chemotherapies in patient-derived xenograft models (PDX) with RSPO3 fusions and in tumors with common CRC mutations such as APC, β-catenin, or RNF43. In these latter types of tumors that represent over 90% of CRC, RSPO3 is produced by stromal cells in the tumor microenvironment and the activating mutations appear to sensitize the tumors to Wnt-Rspo synergy. The combination of RSPO3 inhibition and taxane treatment provides an approach to effectively target oncogenic WNT signaling in a significant number of patients with colorectal and other intestinal cancers.
Targeting RAF kinases for cancer therapy: BRAF mutated melanoma and beyond
Holderfield, Matthew; Deuker, Marian M.; McCormick, Frank; McMahon, Martin
2014-01-01
The identification of mutationally activated BRAF in many cancers altered our conception of the role played by the RAF family of protein kinases in oncogenesis. In this review we describe the development of BRAF inhibitors and the results that have emerged from their analysis in both the laboratory and the clinic. We discuss the spectrum of RAF mutations in human cancer and the complex interplay between tissue of origin and response to RAF inhibition. Finally, we enumerate mechanisms of resistance to BRAF inhibition that have been characterized and postulate how strategies of RAF pathway inhibition may be extended in scope to benefit, not only the thousands of patients diagnosed annually with BRAF-mutated metastatic melanoma, but also the larger patient population with malignancies harboring mutationally activated RAF genes that is ineffectively treated with the current generation of BRAF kinase inhibitors. PMID:24957944
Bernasconi-Elias, P; Hu, T; Jenkins, D; Firestone, B; Gans, S; Kurth, E; Capodieci, P; Deplazes-Lauber, J; Petropoulos, K; Thiel, P; Ponsel, D; Hee Choi, S; LeMotte, P; London, A; Goetcshkes, M; Nolin, E; Jones, M D; Slocum, K; Kluk, M J; Weinstock, D M; Christodoulou, A; Weinberg, O; Jaehrling, J; Ettenberg, S A; Buckler, A; Blacklow, S C; Aster, J C; Fryer, C J
2016-11-24
Notch receptors have been implicated as oncogenic drivers in several cancers, the most notable example being NOTCH1 in T-cell acute lymphoblastic leukemia (T-ALL). To characterize the role of activated NOTCH3 in cancer, we generated an antibody that detects the neo-epitope created upon gamma-secretase cleavage of NOTCH3 to release its intracellular domain (ICD3), and sequenced the negative regulatory region (NRR) and PEST (proline, glutamate, serine, threonine) domain coding regions of NOTCH3 in a panel of cell lines. We also characterize NOTCH3 tumor-associated mutations that result in activation of signaling and report new inhibitory antibodies. We determined the structural basis for receptor inhibition by obtaining the first co-crystal structure of a NOTCH3 antibody with the NRR protein and defined two distinct epitopes for NRR antibodies. The antibodies exhibit potent anti-leukemic activity in cell lines and tumor xenografts harboring NOTCH3 activating mutations. Screening of primary T-ALL samples reveals that 2 of 40 tumors examined show active NOTCH3 signaling. We also identified evidence of NOTCH3 activation in 12 of 24 patient-derived orthotopic xenograft models, 2 of which exhibit activation of NOTCH3 without activation of NOTCH1. Our studies provide additional insights into NOTCH3 activation and offer a path forward for identification of cancers that are likely to respond to therapy with NOTCH3 selective inhibitory antibodies.
Emergence of fatal avian influenza in New England harbor seals
Anthony, S.J.; St. Leger, J. A.; Pugliares, K.; Ip, Hon S.; Chan, J.M.; Carpenter, Z.W.; Navarrete-Macias, I.; Sanchez-Leon, M.; Saliki, J.T.; Pedersen, J.; Karesh, W.; Daszak, P.; Rabadan, R.; Rowles, T.; Lipkin, W.I.
2012-01-01
From September to December 2011, 162 New England harbor seals died in an outbreak of pneumonia. Sequence analysis of postmortem samples revealed the presence of an avian H3N8 influenza A virus, similar to a virus circulating in North American waterfowl since at least 2002 but with mutations that indicate recent adaption to mammalian hosts. These include a D701N mutation in the viral PB2 protein, previously reported in highly pathogenic H5N1 avian influenza viruses infecting people. Lectin staining and agglutination assays indicated the presence of the avian-preferred SAα-2,3 and mammalian SAα-2,6 receptors in seal respiratory tract, and the ability of the virus to agglutinate erythrocytes bearing either the SAα-2,3 or the SAα-2,6 receptor. The emergence of this A/harbor seal/Massachusetts/1/2011 virus may herald the appearance of an H3N8 influenza clade with potential for persistence and cross-species transmission.
Beeman, R. W.; Thomson, M. S.; Clark, J. M.; DeCamillis, M. A.; Brown, S. J.; Denell, R. E.
1996-01-01
A recently isolated, lethal mutation of the homeotic Abdominal gene of the red flour beetle Tribolium castaneum is associated with an insertion of a novel retrotransposon into an intron. Sequence analysis indicates that this retrotransposon, named Woot, is a member of the gypsy family of mobile elements. Most strains of T. castaneum appear to harbor ~25-35 copies of Woot per genome. Woot is composed of long terminal repeats of unprecedented length (3.6 kb each), flanking an internal coding region 5.0 kb in length. For most copies of Woot, the internal region includes two open reading frames (ORFs) that correspond to the gag and pol genes of previously described retrotransposons and retroviruses. The copy of Woot inserted into Abdominal bears an apparent single frameshift mutation that separates the normal second ORF into two. Woot does not appear to generate infectious virions by the criterion that no envelop gene is discernible. The association of Woot with a recent mutation suggests that this retroelement is currently transpositionally active in at least some strains. PMID:8722793
Farchoukh, Lama; Kuan, Shih-Fan; Dudley, Beth; Brand, Randall; Nikiforova, Marina; Pai, Reetesh K
2016-10-01
can harbor KRAS mutations and arise from precursor polyps resembling conventional tubular/tubulovillous adenomas.
Mutation scanning of BRAF, NRAS, KIT, and GNAQ/GNA11 in oral mucosal melanoma: a study of 57 cases.
Lyu, Jiong; Wu, Yunteng; Li, Chaojun; Wang, Runxiang; Song, Hao; Ren, Guoxin; Guo, Wei
2016-04-01
Recent advances in novel targeted therapies have created the need for molecular characterization of cancer to allow accurate personalized treatments. In this study, our aim was to investigate the incidence of activating mutations of oncogenes BRAF, NRAS, KIT, and GNAQ/GNA11 in oral mucosal melanoma. We analyzed a cohort of 57 oral mucosal melanoma samples, including 27 frozen samples and 30 formalin-fixed paraffin-embedded samples. The tumors were screened for hotspot mutations of BRAF (exon 15), NRAS (exons 2 and 3), KIT (exons 9, 11, 13, and 17), and GNAQ/GNA11 (exon 5) by high-resolution melting and direct sequencing. In oral mucosal melanoma, 7.0% of tumors harbored KIT mutations and 3.5% harbored BRAF mutations, while classic BRAF V600E mutation was not detected. We found no mutations of NRAS or GNAQ/GNA11 in oral mucosal melanoma. We demonstrated that driver mutations are rare in mutational hotspots of BRAF, NRAS, KIT, and GNAQ/GNA11 in oral mucosal melanoma. The majority of patients will not benefit from KIT and BRAF inhibitors. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Analysis of EGFR, EML4-ALK, KRAS, and c-MET mutations in Chinese lung adenocarcinoma patients.
Xia, Ning; An, Jian; Jiang, Qing-qing; Li, Min; Tan, Jun; Hu, Cheng-ping
2013-10-01
Mutation analysis of cancer driver genes is helpful for determining an optimal treatment strategy. We evaluated mutations in four driver genes, namely epidermal growth factor receptor (EGFR), Kirsten ras oncogene (KRAS), c-MET, and echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK), in Chinese lung adenocarcinoma patients from Hunan Province. We enrolled 110 lung adenocarcinoma patients in a single institution. EGFR and KRAS mutations were examined by direct sequencing, the EML4-ALK fusion gene was analyzed by fluorescence in situ hybridization, and c-MET amplification and c-Met protein expression were detected by quantitative PCR and immunohistochemistry, respectively. EGFR and KRAS mutations were observed in 52.7% (58/110) and 3.6% (4/106) of patients, respectively. c-MET amplification was detected in 5.5% (6/110) of patients. In addition, 30% (33/110) of the cases expressed c-Met protein, including all of the patients harboring c-MET amplification. Ten percent (11/110) of patients harbored the EML4-ALK fusion gene, and the frequency of ALK rearrangement was higher than that of other cohort analyses involving patients from other regions in China. Almost all of these gene mutations were exclusive except that in two female non-smoking patients, who harbored an EGFR mutation and EML4-ALK rearrangement simultaneously. In total, 70% of patients in the study harbored one of the four gene mutations. Most Chinese lung adenocarcinoma patients harbor driver gene mutations, among which ALK rearrangements were more common in Hunan patients than in previously reported populations. Future clinical trials should be conducted to determine the safety and efficacy of drug combination targeting different driver mutations.
NASA Astrophysics Data System (ADS)
Yang, Linlin; Li, Lei
2017-03-01
UV radiation triggers the formation of 5-thyminyl-5,6-dihydrothymine, i.e. the spore photoproduct (SP), in the genomic DNA of bacterial endospores. These SPs, if not repaired in time, may lead to genome instability and cell death. SP is mainly repaired by spore photoproduct lyase (SPL) during spore outgrowth via an unprecedented protein-harbored radical transfer pathway that is composed of at least a cysteine and two tyrosine residues. This mechanism is consistent with the recently solved SPL structure that shows all three residues are located in proximity and thus able to participate in the radical transfer process during the enzyme catalysis. In contrast, an earlier in vivo mutational study identified a glycine to arginine mutation at the position 168 on the B. subtilis SPL that was later found to be > 15 Å away from the enzyme active site. This mutation appears to abolish the enzyme activity because endospores carrying this mutant were sensitive to UV light. To understand the molecular basis for this rendered enzyme activity, we constructed two SPL mutations G168A and G168R, examined their repair of dinucleotide SP TpT, and found that both mutants exhibit reduced enzyme activity. Comparing with the wildtype (WT) SPL enzyme, the G168A mutant slows down the SP TpT repair by 3 4 fold while the G168R mutant by 80 fold. Both mutants exhibit a smaller apparent (DV) kinetic isotope effect (KIE) but a bigger competitive (DV/K) KIE than that by the WT SPL. Moreover, the G168R mutant also produces a large portion of the abortive repair product TpT-SO2-; the formation of which indicates that cysteine 141 is no longer well positioned as the H-donor to the thymine allylic radical intermediate. All these data imply that the mutation at the remote glycine 168 residue alters the enzyme 3D structure, subsequently reducing the SPL activity by changing the positions of the essential amino acids involved in the radical transfer process.
Mroske, Cameron; Rasmussen, Kristen; Shinde, Deepali N; Huether, Robert; Powis, Zoe; Lu, Hsiao-Mei; Baxter, Ruth M; McPherson, Elizabeth; Tang, Sha
2015-11-05
In humans, Mammalian Target of Rapamycin (MTOR) encodes a 300 kDa serine/ threonine protein kinase that is ubiquitously expressed, particularly at high levels in brain. MTOR functions as an integrator of multiple cellular processes, and in so doing either directly or indirectly regulates the phosphorylation of at least 800 proteins. While somatic MTOR mutations have been recognized in tumors for many years, and more recently in hemimegalencephaly, germline MTOR mutations have rarely been described. We report the successful application of family-trio Diagnostic Exome Sequencing (DES) to identify the underlying molecular etiology in two brothers with multiple neurological and developmental lesions, and for whom previous testing was non-diagnostic. The affected brothers, who were 6 and 23 years of age at the time of DES, presented symptoms including but not limited to mild Autism Spectrum Disorder (ASD), megalencephaly, gross motor skill delay, cryptorchidism and bilateral iris coloboma. Importantly, we determined that each affected brother harbored the MTOR missense alteration p.E1799K (c.5395G>A). This exact variant has been previously identified in multiple independent human somatic cancer samples and has been shown to result in increased MTOR activation. Further, recent independent reports describe two unrelated families in whom p.E1799K co-segregated with megalencephaly and intellectual disability (ID); in both cases, p.E1799K was shown to have originated due to germline mosaicism. In the case of the family reported herein, the absence of p.E1799K in genomic DNA extracted from the blood of either parent suggests that this alteration most likely arose due to gonadal mosaicism. Further, the p.E1799K variant exerts its effect by a gain-of-function (GOF), autosomal dominant mechanism. Herein, we describe the use of DES to uncover an activating MTOR missense alteration of gonadal mosaic origin that is likely to be the causative mutation in two brothers who present
Chen, Ding; Xu, Tao; Tu, Mengjun; Xu, Jinlin; Zhou, Chenchen; Cheng, Lulu; Yang, Ruqing; Yang, Tanchu; Zheng, Weiwei; He, Xiubin; Deng, Ruzhi; Ge, Xianglian; Li, Jin; Song, Zongming; Zhao, Junzhao; Gu, Feng
2017-01-01
X-linked juvenile retinoschisis (XLRS) is a retinal disease caused by mutations in the gene encoding retinoschisin (RS1), which leads to a significant proportion of visual impairment and blindness. To develop personalized genome editing based gene therapy, knock-in animal disease models that have the exact mutation identified in the patients is extremely crucial, and that the way which genome editing in knock-in animals could be easily transferred to the patients. Here we recruited a family diagnosed with XLRS and identified the causative mutation ( RS1 , p.Y65X), then a knock-in mouse model harboring this disease-causative mutation was generated via TALEN (transcription activator-like effector nucleases). We found that the b-wave amplitude of the ERG of the RS1 -KI mice was significantly decreased. Moreover, we observed that the structure of retina in RS1 -KI mice has become disordered, including the disarray of inner nuclear layer and outer nuclear layer, chaos of outer plexiform layer, decreased inner segments of photoreceptor and the loss of outer segments. The novel knock-in mice ( RS1 -KI) harboring patient-specific mutation will be valuable for development of treatment via genome editing mediated gene correction.
Spectrum of oncogenic driver mutations in lung adenocarcinomas from East Asian never smokers.
Li, Chenguang; Fang, Rong; Sun, Yihua; Han, Xiangkun; Li, Fei; Gao, Bin; Iafrate, A John; Liu, Xin-Yuan; Pao, William; Chen, Haiquan; Ji, Hongbin
2011-01-01
We previously showed that 90% (47 of 52; 95% CI, 0.79 to 0.96) of lung adenocarcinomas from East Asian never-smokers harbored well-known oncogenic mutations in just four genes: EGFR, HER2, ALK, and KRAS. Here, we sought to extend these findings to more samples and identify driver alterations in tumors negative for these mutations. We have collected and analyzed 202 resected lung adenocarcinomas from never smokers seen at Fudan University Shanghai Cancer Center. Since mutations were mutually exclusive in the first 52 examined, we determined the status of EGFR, KRAS, HER2, ALK, and BRAF in stepwise fashion as previously described. Samples negative for mutations in these 5 genes were subsequently examined for known ROS1 fusions by RT-PCR and direct sequencing. 152 tumors (75.3%) harbored EGFR mutations, 12 (6%) had HER2 mutations, 10 (5%) had ALK fusions all involving EML4 as the 5' partner, 4 (2%) had KRAS mutations, and 2 (1%) harbored ROS1 fusions. No BRAF mutation were detected. The vast majority (176 of 202; 87.1%, 95% CI: 0.82 to 0.91) of lung adenocarcinomas from never smokers harbor mutant kinases sensitive to available TKIs. Interestingly, patients with EGFR mutant patients tend to be older than those without EGFR mutations (58.3 Vs 54.3, P = 0.016) and patient without any known oncogenic driver tend to be diagnosed at a younger age (52.3 Vs 57.9, P = 0.013). Collectively, these data indicate that the majority of never smokers with lung adenocarcinoma could benefit from treatment with a specific tyrosine kinase inhibitor.
Spectrum of Oncogenic Driver Mutations in Lung Adenocarcinomas from East Asian Never Smokers
Han, Xiangkun; Li, Fei; Gao, Bin; Iafrate, A. John; Liu, Xin-Yuan; Pao, William; Chen, Haiquan; Ji, Hongbin
2011-01-01
Purpose We previously showed that 90% (47 of 52; 95% CI, 0.79 to 0.96) of lung adenocarcinomas from East Asian never-smokers harbored well-known oncogenic mutations in just four genes: EGFR, HER2, ALK, and KRAS. Here, we sought to extend these findings to more samples and identify driver alterations in tumors negative for these mutations. Experimental Design We have collected and analyzed 202 resected lung adenocarcinomas from never smokers seen at Fudan University Shanghai Cancer Center. Since mutations were mutually exclusive in the first 52 examined, we determined the status of EGFR, KRAS, HER2, ALK, and BRAF in stepwise fashion as previously described. Samples negative for mutations in these 5 genes were subsequently examined for known ROS1 fusions by RT-PCR and direct sequencing. Results 152 tumors (75.3%) harbored EGFR mutations, 12 (6%) had HER2 mutations, 10 (5%) had ALK fusions all involving EML4 as the 5′ partner, 4 (2%) had KRAS mutations, and 2 (1%) harbored ROS1 fusions. No BRAF mutation were detected. Conclusion The vast majority (176 of 202; 87.1%, 95% CI: 0.82 to 0.91) of lung adenocarcinomas from never smokers harbor mutant kinases sensitive to available TKIs. Interestingly, patients with EGFR mutant patients tend to be older than those without EGFR mutations (58.3 Vs 54.3, P = 0.016) and patient without any known oncogenic driver tend to be diagnosed at a younger age (52.3 Vs 57.9, P = 0.013). Collectively, these data indicate that the majority of never smokers with lung adenocarcinoma could benefit from treatment with a specific tyrosine kinase inhibitor. PMID:22140546
p53 mutations promote proteasomal activity.
Oren, Moshe; Kotler, Eran
2016-07-27
p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.
Tonacchera, M; Vitti, P; Agretti, P; Giulianetti, B; Mazzi, B; Cavaliere, R; Ceccarini, G; Fiore, E; Viacava, P; Naccarato, A; Pinchera, A; Chiovato, L
1998-07-01
Activating thyrotropin (TSH) receptor mutations have been found in toxic adenomas and in hot nodules contained in toxic multinodular goiter. The typical feature of multinodular goiter is the heterogeneity in morphology and function of different follicles within the same enlarged gland. In this report we describe a patient with a huge multinodular goiter, normal free triiodothyronine (FT3) and free thyroxine (FT4) serum values, and subnormal TSH serum concentration. Thyroid scintiscan showed two hot areas corresponding to the basal and apical nodules of the left lobe. The right lobe was poorly visualized by the radioisotope. The patient underwent thyroidectomy, and histological examination of the tissue was performed. Genomic DNA was extracted from the tissue specimen and direct sequencing of the TSH receptor and Gs alpha genes was done. At histology, one hyperfunctioning nodule had the typical microscopic structure of thyroid adenomas, and the other contained multiple macrofollicular areas not confined by a capsule. In spite of this histological difference, both hyperfunctioning nodules harbored a mutation of the thyrotropin receptor (TSHr) gene: an isoleucine instead of a threonine in position 632 (T632I) in the first nodule and a methionine instead of an isoleucine in position 486 (I486M) in the second nodule. In conclusion, our findings show for the first time that gain-of-function TSHr mutations are not only present in hyperfunctioning thyroid nodules with the histological features of the true thyroid adenomas, but also in hyperfunctioning hyperplastic nodules contained in the same multinodular goiter.
Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krauthammer, Michael; Kong, Yong; Ha, Byung Hak
We characterized the mutational landscape of melanoma, the form of skin cancer with the highest mortality rate, by sequencing the exomes of 147 melanomas. Sun-exposed melanomas had markedly more ultraviolet (UV)-like C>T somatic mutations compared to sun-shielded acral, mucosal and uveal melanomas. Among the newly identified cancer genes was PPP6C, encoding a serine/threonine phosphatase, which harbored mutations that clustered in the active site in 12% of sun-exposed melanomas, exclusively in tumors with mutations in BRAF or NRAS. Notably, we identified a recurrent UV-signature, an activating mutation in RAC1 in 9.2% of sun-exposed melanomas. This activating mutation, the third most frequentmore » in our cohort of sun-exposed melanoma after those of BRAF and NRAS, changes Pro29 to serine (RAC1{sup P29S}) in the highly conserved switch I domain. Crystal structures, and biochemical and functional studies of RAC1{sup P29S} showed that the alteration releases the conformational restraint conferred by the conserved proline, causes an increased binding of the protein to downstream effectors, and promotes melanocyte proliferation and migration. These findings raise the possibility that pharmacological inhibition of downstream effectors of RAC1 signaling could be of therapeutic benefit.« less
Wang, Qiang; Li, Miaoxin; Yang, Zhenxing; Hu, Xun; Wu, Hei-Man; Ni, Peiyan; Ren, Hongyan; Deng, Wei; Li, Mingli; Ma, Xiaohong; Guo, Wanjun; Zhao, Liansheng; Wang, Yingcheng; Xiang, Bo; Lei, Wei; Sham, Pak C; Li, Tao
2015-12-15
Schizophrenia is a heritable, heterogeneous common psychiatric disorder. In this study, we evaluated the hypothesis that de novo variants (DNVs) contribute to the pathogenesis of schizophrenia. We performed exome sequencing in Chinese patients (N = 45) with schizophrenia and their unaffected parents (N = 90). Forty genes were found to contain DNVs. These genes had enriched transcriptional co-expression profile in prenatal frontal cortex (Bonferroni corrected p < 9.1 × 10(-3)), and in prenatal temporal and parietal regions (Bonferroni corrected p < 0.03). Also, four prenatal anatomical subregions (VCF, MFC, OFC and ITC) have shown significant enrichment of connectedness in co-expression networks. Moreover, four genes (LRP1, MACF1, DICER1 and ABCA2) harboring the damaging de novo mutations are strongly prioritized as susceptibility genes by multiple evidences. Our findings in Chinese schizophrenic patients indicate the pathogenic role of DNVs, supporting the hypothesis that schizophrenia is a neurodevelopmental disease.
Wang, Qiang; Li, Miaoxin; Yang, Zhenxing; Hu, Xun; Wu, Hei-Man; Ni, Peiyan; Ren, Hongyan; Deng, Wei; Li, Mingli; Ma, Xiaohong; Guo, Wanjun; Zhao, Liansheng; Wang, Yingcheng; Xiang, Bo; Lei, Wei; Sham, Pak C; Li, Tao
2015-01-01
Schizophrenia is a heritable, heterogeneous common psychiatric disorder. In this study, we evaluated the hypothesis that de novo variants (DNVs) contribute to the pathogenesis of schizophrenia. We performed exome sequencing in Chinese patients (N = 45) with schizophrenia and their unaffected parents (N = 90). Forty genes were found to contain DNVs. These genes had enriched transcriptional co-expression profile in prenatal frontal cortex (Bonferroni corrected p < 9.1 × 10−3), and in prenatal temporal and parietal regions (Bonferroni corrected p < 0.03). Also, four prenatal anatomical subregions (VCF, MFC, OFC and ITC) have shown significant enrichment of connectedness in co-expression networks. Moreover, four genes (LRP1, MACF1, DICER1 and ABCA2) harboring the damaging de novo mutations are strongly prioritized as susceptibility genes by multiple evidences. Our findings in Chinese schizophrenic patients indicate the pathogenic role of DNVs, supporting the hypothesis that schizophrenia is a neurodevelopmental disease. PMID:26666178
Okabe, Masahiro; Yamaguchi, Hiroki; Usuki, Kensuke; Kobayashi, Yutaka; Kawata, Eri; Kuroda, Junya; Kimura, Shinya; Tajika, Kenji; Gomi, Seiji; Arima, Nobuyoshi; Mori, Sinichiro; Ito, Shigeki; Koizumi, Masayuki; Ito, Yoshikazu; Wakita, Satoshi; Arai, Kunihito; Kitano, Tomoaki; Kosaka, Fumiko; Dan, Kazuo; Inokuchi, Koiti
2016-01-01
The risk of complication of polycythemia vera (PV) and essential thrombocythemia (ET) by thrombosis in Japanese patients is clearly lower than in western populations, suggesting that genetic background such as race may influence the clinical features. This study aimed to clarify the relationship between genetic mutations and haplotypes and clinical features in Japanese patients with PV and ET. Clinical features were assessed prospectively among 74 PV and 303 ET patients. There were no clinical differences, including JAK2V617F allele burden, between PV patients harboring the various genetic mutations. However, CALR mutation-positive ET patients had a significantly lower WBC count, Hb value, Ht value, and neutrophil alkaline phosphatase score (NAP), and significantly more platelets, relative to JAK2V617F-positive ET patients and ET patients with no mutations. Compared to normal controls, the frequency of the JAK246/1 haplotype was significantly higher among patients with JAK2V617F, JAK2Ex12del, or MPL mutations, whereas no significant difference was found among CALR mutation-positive patients. CALR mutation-positive patients had a lower incidence of thrombosis relative to JAK2V617F-positive patients. Our findings suggest that JAK2V617F-positive ET patients and CALR mutation-positive patients have different mechanisms of occurrence and clinical features of ET, suggesting the potential need for therapy stratification in the future. Copyright © 2015 Elsevier Ltd. All rights reserved.
Szabo, R; Samson, A L; Lawrence, D A; Medcalf, R L; Bugge, T H
2016-08-01
Essentials C57BL/6J-tissue plasminogen activator (tPA)-deficient mice are widely used to study tPA function. Congenic C57BL/6J-tPA-deficient mice harbor large 129-derived chromosomal segments. The 129-derived chromosomal segments contain gene mutations that may confound data interpretation. Passenger mutation-free isogenic tPA-deficient mice were generated for study of tPA function. Background The ability to generate defined null mutations in mice revolutionized the analysis of gene function in mammals. However, gene-deficient mice generated by using 129-derived embryonic stem cells may carry large segments of 129 DNA, even when extensively backcrossed to reference strains, such as C57BL/6J, and this may confound interpretation of experiments performed in these mice. Tissue plasminogen activator (tPA), encoded by the PLAT gene, is a fibrinolytic serine protease that is widely expressed in the brain. A number of neurological abnormalities have been reported in tPA-deficient mice. Objectives To study genetic contamination of tPA-deficient mice. Materials and methods Whole genome expression array analysis, RNAseq expression profiling, low- and high-density single nucleotide polymorphism (SNP) analysis, bioinformatics and genome editing were used to analyze gene expression in tPA-deficient mouse brains. Results and conclusions Genes differentially expressed in the brain of Plat(-/-) mice from two independent colonies highly backcrossed onto the C57BL/6J strain clustered near Plat on chromosome 8. SNP analysis attributed this anomaly to about 20 Mbp of DNA flanking Plat being of 129 origin in both strains. Bioinformatic analysis of these 129-derived chromosomal segments identified a significant number of mutations in genes co-segregating with the targeted Plat allele, including several potential null mutations. Using zinc finger nuclease technology, we generated novel 'passenger mutation'-free isogenic C57BL/6J-Plat(-/-) and FVB/NJ-Plat(-/-) mouse strains by introducing
Cohen, Stacey A.; Turner, Emily H.; Beightol, Mallory B.; Jacobson, Angela; Gooley, Ted A.; Salipante, Stephen J.; Haraldsdottir, Sigurdis; Smith, Christina; Scroggins, Sheena; Tait, Jonathan F.; Grady, William M.; Lin, Edward H.; Cohn, David E.; Goodfellow, Paul J.; Arnold, Mark W.; de la Chapelle, Albert; Pearlman, Rachel; Hampel, Heather; Pritchard, Colin C.
2016-01-01
Background & Aims Double somatic mutations in mismatch repair (MMR) genes have recently been described in colorectal and endometrial cancers with microsatellite instability (MSI) not attributable to MLH1 hypermethylation or germline mutation. We sought to define the molecular phenotype of this newly recognized tumor subtype. Methods From two prospective Lynch syndrome screening studies, we identified patients with colorectal and endometrial tumors harboring ≥2 somatic MMR mutations, but normal germline MMR testing (“double somatic”). We determined the frequencies of tumor PIK3CA, BRAF, KRAS, NRAS, and PTEN mutations by targeted next-generation sequencing and used logistic-regression models to compare them to: Lynch syndrome, MLH1 hypermethylated, and microsatellite stable (MSS) tumors. We validated our findings using independent datasets from The Cancer Genome Atlas (TCGA). Results Among colorectal cancer cases, we found that 14/21 (67%) of double somatic cases had PIK3CA mutations vs. 4/18 (22%) Lynch syndrome, 2/10 (20%) MLH1 hypermethylated, and 12/78 (15%) MSS tumors; p<0.0001. PIK3CA mutations were detected in 100% of 13 double somatic endometrial cancers (p=0.04). BRAF mutations were absent in double somatic and Lynch syndrome colorectal tumors. We found highly similar results in a validation cohort from TCGA (113 colorectal, 178 endometrial cancer), with 100% of double somatic cases harboring a PIK3CA mutation (p<0.0001). Conclusions PIK3CA mutations are present in double somatic mutated colorectal and endometrial cancers at substantially higher frequencies than other MSI subgroups. PIK3CA mutation status may better define an emerging molecular entity in colorectal and endometrial cancers, with the potential to inform screening and therapeutic decision making. PMID:27302833
Cancer-associated IDH1 mutations produce 2-hydroxyglutarate
Dang, Lenny; White, David W.; Gross, Stefan; Bennett, Bryson D.; Bittinger, Mark A.; Driggers, Edward M.; Fantin, Valeria R.; Jang, Hyun Gyung; Jin, Shengfang; Keenan, Marie C.; Marks, Kevin M.; Prins, Robert M.; Ward, Patrick S.; Yen, Katharine E.; Liau, Linda M.; Rabinowitz, Joshua D.; Cantley, Lewis C.; Thompson, Craig B.; Vander Heiden, Matthew G.; Su, Shinsan M.
2009-01-01
Summary Mutations in the enzyme cytosolic isocitrate dehydrogenase 1 (IDH1) are a common feature of a major subset of primary human brain cancers. These mutations occur at a single amino acid residue of the IDH1 active site resulting in loss of the enzyme’s ability to catalyze conversion of isocitrate to α-ketoglutarate. However, only a single copy of the gene is mutated in tumors, raising the possibility that the mutations do not result in a simple loss of function. Here we show that cancer-associated IDH1 mutations result in a new ability of the enzyme to catalyze the NADPH-dependent reduction of α-ketoglutarate to R(−)-2-hydroxyglutarate (2HG). Structural studies demonstrate that when R132 is mutated to histidine, residues in the active site are shifted to produce structural changes consistent with reduced oxidative decarboxylation of isocitrate and acquisition of the ability to convert α-ketoglutarate to 2HG. Excess accumulation of 2HG has been shown to lead to an elevated risk of malignant brain tumors in patients with inborn errors of 2HG metabolism. Similarly, in human malignant gliomas harboring IDH1 mutations, we find dramatically elevated levels of 2HG. These data demonstrate that the IDH1 mutations result in production of the onco-metabolite 2HG, and suggest that the excess 2HG which accumulates in vivo contributes to the formation and malignant progression of gliomas. PMID:19935646
Contribution of JAK2 mutations to T-cell lymphoblastic lymphoma development.
Roncero, A M; López-Nieva, P; Cobos-Fernández, M A; Villa-Morales, M; González-Sánchez, L; López-Lorenzo, J L; Llamas, P; Ayuso, C; Rodríguez-Pinilla, S M; Arriba, M C; Piris, M A; Fernández-Navarro, P; Fernández, A F; Fraga, M F; Santos, J; Fernández-Piqueras, J
2016-01-01
The JAK-STAT pathway has a substantial role in lymphoid precursor cell proliferation, survival and differentiation. Nonetheless, the contribution of JAK2 to T-cell lymphoblastic lymphoma (T-LBL) development remains poorly understood. We have identified one activating TEL-JAK2 translocation and four missense mutations accumulated in 2 out of 16 T-LBL samples. Two of them are novel JAK2 mutations and the other two are reported for the first time in T-LBL. Notably, R683G and I682T might have arisen owing to RNA editing. Mutated samples showed different mutated transcripts suggesting sub-clonal heterogeneity. Functional approaches revealed that two JAK2 mutations (H574R and R683G) constitutively activate JAK-STAT signaling in γ2A cells and can drive the proliferation of BaF3-EpoR cytokine-dependent cell line. In addition, aberrant hypermethylation of SOCS3 might contribute to enhance the activation of JAK-STAT signaling. Of utmost interest is that primary T-LBL samples harboring JAK2 mutations exhibited increased expression of LMO2, suggesting a mechanistic link between JAK2 mutations and the expression of LMO2, which was confirmed for the four missense mutations in transfected γ2A cells. We therefore propose that active JAK2 contribute to T-LBL development by two different mechanisms, and that the use of pan-JAK inhibitors in combination with epigenetic drugs should be considered in future treatments.
Contribution of JAK2 mutations to T-cell lymphoblastic lymphoma development
Roncero, A M; López-Nieva, P; Cobos-Fernández, M A; Villa-Morales, M; González-Sánchez, L; López-Lorenzo, J L; Llamas, P; Ayuso, C; Rodríguez-Pinilla, S M; Arriba, M C; Piris, M A; Fernández-Navarro, P; Fernández, A F; Fraga, M F; Santos, J; Fernández-Piqueras, J
2016-01-01
The JAK-STAT pathway has a substantial role in lymphoid precursor cell proliferation, survival and differentiation. Nonetheless, the contribution of JAK2 to T-cell lymphoblastic lymphoma (T-LBL) development remains poorly understood. We have identified one activating TEL-JAK2 translocation and four missense mutations accumulated in 2 out of 16 T-LBL samples. Two of them are novel JAK2 mutations and the other two are reported for the first time in T-LBL. Notably, R683G and I682T might have arisen owing to RNA editing. Mutated samples showed different mutated transcripts suggesting sub-clonal heterogeneity. Functional approaches revealed that two JAK2 mutations (H574R and R683G) constitutively activate JAK-STAT signaling in γ2A cells and can drive the proliferation of BaF3-EpoR cytokine-dependent cell line. In addition, aberrant hypermethylation of SOCS3 might contribute to enhance the activation of JAK-STAT signaling. Of utmost interest is that primary T-LBL samples harboring JAK2 mutations exhibited increased expression of LMO2, suggesting a mechanistic link between JAK2 mutations and the expression of LMO2, which was confirmed for the four missense mutations in transfected γ2A cells. We therefore propose that active JAK2 contribute to T-LBL development by two different mechanisms, and that the use of pan-JAK inhibitors in combination with epigenetic drugs should be considered in future treatments. PMID:26216197
Clustered Mutation Signatures Reveal that Error-Prone DNA Repair Targets Mutations to Active Genes.
Supek, Fran; Lehner, Ben
2017-07-27
Many processes can cause the same nucleotide change in a genome, making the identification of the mechanisms causing mutations a difficult challenge. Here, we show that clustered mutations provide a more precise fingerprint of mutagenic processes. Of nine clustered mutation signatures identified from >1,000 tumor genomes, three relate to variable APOBEC activity and three are associated with tobacco smoking. An additional signature matches the spectrum of translesion DNA polymerase eta (POLH). In lymphoid cells, these mutations target promoters, consistent with AID-initiated somatic hypermutation. In solid tumors, however, they are associated with UV exposure and alcohol consumption and target the H3K36me3 chromatin of active genes in a mismatch repair (MMR)-dependent manner. These regions normally have a low mutation rate because error-free MMR also targets H3K36me3 chromatin. Carcinogens and error-prone repair therefore redistribute mutations to the more important regions of the genome, contributing a substantial mutation load in many tumors, including driver mutations. Copyright © 2017 Elsevier Inc. All rights reserved.
POLE somatic mutations in advanced colorectal cancer.
Guerra, Joana; Pinto, Carla; Pinto, Diana; Pinheiro, Manuela; Silva, Romina; Peixoto, Ana; Rocha, Patrícia; Veiga, Isabel; Santos, Catarina; Santos, Rui; Cabreira, Verónica; Lopes, Paula; Henrique, Rui; Teixeira, Manuel R
2017-12-01
Despite all the knowledge already gathered, the picture of somatic genetic changes in colorectal tumorigenesis is far from complete. Recently, germline and somatic mutations in the exonuclease domain of polymerase epsilon, catalytic subunit (POLE) gene have been reported in a small subset of microsatellite-stable and hypermutated colorectal carcinomas (CRCs), affecting the proofreading activity of the enzyme and leading to misincorporation of bases during DNA replication. To evaluate the role of POLE mutations in colorectal carcinogenesis, namely in advanced CRC, we searched for somatic mutations by Sanger sequencing in tumor DNA samples from 307 cases. Microsatellite instability and mutation analyses of a panel of oncogenes were performed in the tumors harboring POLE mutations. Three heterozygous mutations were found in two tumors, the c.857C>G, p.Pro286Arg, the c.901G>A, p.Asp301Asn, and the c.1376C>T, p.Ser459Phe. Of the POLE-mutated CRCs, one tumor was microsatellite-stable and the other had low microsatellite instability, whereas KRAS and PIK3CA mutations were found in one tumor each. We conclude that POLE somatic mutations exist but are rare in advanced CRC, with further larger studies being necessary to evaluate its biological and clinical implications. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Goh, Gerald; Walradt, Trent; Markarov, Vladimir; Blom, Astrid; Riaz, Nadeem; Doumani, Ryan; Stafstrom, Krista; Moshiri, Ata; Yelistratova, Lola; Levinsohn, Jonathan; Chan, Timothy A; Nghiem, Paul; Lifton, Richard P; Choi, Jaehyuk
2016-01-19
Merkel cell carcinoma (MCC) is a rare but highly aggressive cutaneous neuroendocrine carcinoma, associated with the Merkel cell polyomavirus (MCPyV) in 80% of cases. To define the genetic basis of MCCs, we performed exome sequencing of 49 MCCs. We show that MCPyV-negative MCCs have a high mutation burden (median of 1121 somatic single nucleotide variants (SSNVs) per-exome with frequent mutations in RB1 and TP53 and additional damaging mutations in genes in the chromatin modification (ASXL1, MLL2, and MLL3), JNK (MAP3K1 and TRAF7), and DNA-damage pathways (ATM, MSH2, and BRCA1). In contrast, MCPyV-positive MCCs harbor few SSNVs (median of 12.5 SSNVs/tumor) with none in the genes listed above. In both subgroups, there are rare cancer-promoting mutations predicted to activate the PI3K pathway (HRAS, KRAS, PIK3CA, PTEN, and TSC1) and to inactivate the Notch pathway (Notch1 and Notch2). TP53 mutations appear to be clinically relevant in virus-negative MCCs as 37% of these tumors harbor potentially targetable gain-of-function mutations in TP53 at p.R248 and p.P278. Moreover, TP53 mutational status predicts death in early stage MCC (5-year survival in TP53 mutant vs wild-type stage I and II MCCs is 20% vs. 92%, respectively; P = 0.0036). Lastly, we identified the tumor neoantigens in MCPyV-negative and MCPyV-positive MCCs. We found that virus-negative MCCs harbor more tumor neoantigens than melanomas or non-small cell lung cancers (median of 173, 65, and 111 neoantigens/sample, respectively), two cancers for which immune checkpoint blockade can produce durable clinical responses. Collectively, these data support the use of immunotherapies for virus-negative MCCs.
Wang, Shuyun; Gao, Aiqin; Liu, Jie; Sun, Yuping
2018-03-01
As the standard first-line treatment for advanced non-small cell lung cancer (NSCLC) with activating epidermal growth factor receptor (EGFR) mutation, EGFR-tyrosine kinase inhibitors (EGFR-TKIs) have significantly improved the median progression-free survival (PFS) up to 18.9 months. However, almost all patients eventually develop acquired resistance to EGFR-TKIs, which limits the first-line PFS. To overcome the resistance and improve overall survival, researchers have tried to identify the resistance mechanisms and develop new treatment strategies, among which a combination of EGFR-TKIs and cytotoxic chemotherapy is one of the hotspots. The data from preclinical and clinical studies on combined EGFR-TKIs and chemotherapy have shown very interesting results. Here, we reviewed the available preclinical and clinical studies on first-line EGFR-TKIs-chemotherapy combination in patients with advanced NSCLC harboring activating EGFR mutation, aiming to provide evidences for more potential choices and shed light on clinical treatment.
Activating PIK3CA mutations coexist with BRAF or NRAS mutations in a limited fraction of melanomas.
Manca, Antonella; Lissia, Amelia; Capone, Mariaelena; Ascierto, Paolo A; Botti, Gerardo; Caracò, Corrado; Stanganelli, Ignazio; Colombino, Maria; Sini, MariaCristina; Cossu, Antonio; Palmieri, Giuseppe
2015-01-28
Activated PI3K-AKT pathway may contribute to decrease sensitivity to inhibitors of key pathogenetic effectors (mutated BRAF, active NRAS or MEK) in melanoma. Functional alterations are deeply involved in PI3K-AKT activation, with a minimal role reported for mutations in PIK3CA, the catalytic subunit of the PI3K gene. We here assessed the prevalence of the coexistence of BRAF/NRAS and PIK3CA mutations in a series of melanoma samples. A total of 245 tumor specimens (212 primary melanomas and 33 melanoma cell lines) was screened for mutations in BRAF, NRAS, and PIK3CA genes by automated direct sequencing. Overall, 110 (44.9%) samples carried mutations in BRAF, 26 (10.6%) in NRAS, and 24 (9.8%) in PIK3CA. All identified PIK3CA mutations have been reported to induce PI3K activation; those detected in cultured melanomas were investigated for their interference with the antiproliferative activity of the BRAF-mutant inhibitor vemurafenib. A reduced suppression in cell growth was observed in treated cells carrying both BRAF and PIK3CA mutations as compared with those presenting a mutated BRAF only. Among the analysed melanomas, 12/245 (4.9%) samples presented the coexistence of PIK3CA and BRAF/NRAS mutations. Our study further suggests that PIK3CA mutations account for a small fraction of PI3K pathway activation and have a limited impact in interfering with the BRAF/NRAS-driven growth in melanoma.
Comprehensive Conservation and Management Plan for Charlotte Harbor
This 2013 CCMP Update for Charlotte Harbor provides insight on the main priorities that the harbor is facing as well as research needed, restoration activities, legislative changes, and public outreach needs.
Mohanram, Rajamani; Jagtap, Chandrakant; Kumar, Pradeep
2016-04-15
Diverse marine bacterial species predominantly found in oil-polluted seawater produce diverse surface-active agents. Surface-active agents produced by bacteria are classified into two groups based on their molecular weights, namely biosurfactants and bioemulsifiers. In this study, surface-active agent-producing, oil-degrading marine bacteria were isolated using a modified Bushnell-Haas medium with high-speed diesel as a carbon source from three oil-polluted sites of Mumbai Harbor. Surface-active agent-producing bacterial strains were screened using nine widely used methods. The nineteen bacterial strains showed positive results for more than four surface-active agent screening methods; further, these strains were characterized using biochemical and nucleic acid sequencing methods. Based on the results, the organisms belonged to the genera Acinetobacter, Alcanivorax, Bacillus, Comamonas, Chryseomicrobium, Halomonas, Marinobacter, Nesterenkonia, Pseudomonas, and Serratia. The present study confirmed the prevalence of surface-active agent-producing bacteria in the oil-polluted waters of Mumbai Harbor. Copyright © 2016 Elsevier Ltd. All rights reserved.
Fu, Jen-Fen; Liang, Sung-Tzu; Huang, Ying-Jung; Liang, Kung-Hao; Yen, Tzung-Hai; Liang, Der-Cherng; Shih, Lee-Yung
2017-03-01
PTPN11 mutation, a RAS signaling pathway mutation, is associated with MLL translocations in acute leukemia. A girl with MLL/AF10 AML was found to carry PTPN11 G503A . To study the impact of PTPN11 G503A cooperating with MLL/AF10 on leukemogenesis, we established a retroviral transduction/transplantation mouse model. Compared to the MLL/AF10(OM-LZ) leukemia cells harboring PTPN11 wt , the cells harboring PTPN11 G503A were hypersensitive to GM-CSF and IL3, and more resistant to death upon treatment with daunorubicin but sensitive to cytarabine. The cells harboring PTPN11 G503A autonomously differentiated into macrophages (1.8%) in the medium containing IL3. Further studies showed that the cells had an elevated (∼2.9-fold) Csf1 transcription level and secreted more (∼4.5-fold) M-CSF to the medium which can stimulate monocyte/macrophage differentiation of BM cells. Mice transplanted with the cells harboring PTPN11 G503A had a higher concentration of M-CSF in plasma. When mixed with the MLL/AF10(OM-LZ) leukemia cells harboring PTPN11 wt , the cells harboring PTPN11 G503A had an increased competitive engraftment and clonal expansion in the BM and spleen of recipient mice, although no competitive growth advantage was observed in the in vitro co-culturing assays. The mice transplanted with the MLL/AF10(OM-LZ) cells harboring PTPN11 wt developed myelomonocytic leukemia, while those transplanted with the cells harboring PTPN11 G503A -induced monocytic leukemia in a shorter latency. Our results demonstrated that addition of PTPN11 G503A to MLL/AF10 affected cell proliferation, chemo-resistance, differentiation, in vivo BM recruitment/clonal expansion and accelerated disease progression. © 2016 UICC.
Azorsa, David O; Lee, David W; Wai, Daniel H; Bista, Ranjan; Patel, Apurvi R; Aleem, Eiman; Henry, Michael M; Arceci, Robert J
2018-05-16
Patients with Langerhans cell histiocytosis (LCH) harbor BRAF V600E and activating mutations of MAP2K1/MEK1 in 50% and 25% of cases, respectively. We evaluated a patient with treatment-refractory LCH for mutations in the RAS-RAF-MEK-ERK pathway and identified a novel mutation in the MAP2K1 gene resulting in a p.L98_K104 > Q deletion and predicted to be auto-activating. During treatment with the MEK inhibitor trametinib, the patient's disease showed significant progression. In vitro characterization of the MAP2K1 p.L98_K104 > Q deletion confirmed its effect on cellular activation of the ERK pathway and drug resistance. © 2018 Wiley Periodicals, Inc.
An MRPS12 mutation modifies aminoglycoside sensitivity caused by 12S rRNA mutations
Emperador, Sonia; Pacheu-Grau, David; Bayona-Bafaluy, M. Pilar; Garrido-Pérez, Nuria; Martín-Navarro, Antonio; López-Pérez, Manuel J.; Montoya, Julio; Ruiz-Pesini, Eduardo
2015-01-01
Several homoplasmic pathologic mutations in mitochondrial DNA, such as those causing Leber hereditary optic neuropathy or non-syndromic hearing loss, show incomplete penetrance. Therefore, other elements must modify their pathogenicity. Discovery of these modifying factors is not an easy task because in multifactorial diseases conventional genetic approaches may not always be informative. Here, we have taken an evolutionary approach to unmask putative modifying factors for a particular homoplasmic pathologic mutation causing aminoglycoside-induced and non-syndromic hearing loss, the m.1494C>T transition in the mitochondrial DNA. The mutation is located in the decoding site of the mitochondrial ribosomal RNA. We first looked at mammalian species that had fixed the human pathologic mutation. These mutations are called compensated pathogenic deviations because an organism carrying one must also have another that suppresses the deleterious effect of the first. We found that species from the primate family Cercopithecidae (old world monkeys) harbor the m.1494T allele even if their auditory function is normal. In humans the m.1494T allele increases the susceptibility to aminoglycosides. However, in primary fibroblasts from a Cercopithecidae species, aminoglycosides do not impair cell growth, respiratory complex IV activity and quantity or the mitochondrial protein synthesis. Interestingly, this species also carries a fixed mutation in the mitochondrial ribosomal protein S12. We show that the expression of this variant in a human m.1494T cell line reduces its susceptibility to aminoglycosides. Because several mutations in this human protein have been described, they may possibly explain the absence of pathologic phenotype in some pedigree members with the most frequent pathologic mutations in mitochondrial ribosomal RNA. PMID:25642242
Röver, Lea Kristin; Gevensleben, Heidrun; Dietrich, Jörn; Bootz, Friedrich; Landsberg, Jennifer; Goltz, Diane; Dietrich, Dimo
2018-02-01
Immune checkpoints are important targets for immunotherapies. However, knowledge on the epigenetic modification of immune checkpoint genes is sparse. In the present study, we investigated promoter methylation of CTLA4, PD-L1, PD-L2, and PD-1 in diffuse lower-grade gliomas (LGG) harboring isocitrate dehydrogenase (IDH) mutations with regard to mRNA expression levels, clinicopathological parameters, previously established methylation subtypes, immune cell infiltrates, and survival in a cohort of 419 patients with IDH-mutated LGG provided by The Cancer Genome Atlas. PD-L1, PD-L2, and CTLA-4 mRNA expression levels showed a significant inverse correlation with promoter methylation (PD-L1: p=0.005; PD-L2: p<0.001; CTLA-4: p<0.001). Furthermore, immune checkpoint methylation was significantly associated with age (PD-L2: p=0.003; PD-1: p=0.015), molecular alterations, i.e. MGMT methylation (PD-L1: p<0.001; PD-L2: p<0.001), ATRX mutations (PD-L2: p<0.001, PD-1: p=0.001), and TERT mutations (PD-L1: p=0.035, PD-L2: p<0.001, PD-1: p<0.001, CTLA4: p<0.001) as well as methylation subgroups and immune cell infiltrates. In multivariate Cox proportional hazard analysis, PD-1 methylation qualified as strong prognostic factor (HR=0.51 [0.34-0.76], p=0.001). Our findings suggest an epigenetic regulation of immune checkpoint genes via DNA methylation in LGG. PD-1 methylation may assist the identification of patients that might benefit from an alternative treatment, particularly in the context of emerging immunotherapies. Copyright © 2018 The Author(s). Published by Elsevier B.V. All rights reserved.
Rapisuwon, Suthee; Parks, Kellie; Al-Refaie, Waddah; Atkins, Michael B
2014-10-01
Primary mucosal melanomas represent ∼1.3% of all cases of melanoma diagnosed in the USA. The sinonasal location is the most common primary site. Mutations in the KIT gene occur in 10-22% of mucosal melanomas. Tumor response to imatinib mesylate has been reported in about half of the patients with tumors harboring KIT mutations. Responses are almost exclusively restricted to tumors with mutations in KIT exon 9 or 11. We report a case of a patient with a sinonasal mucosal melanoma with a novel exon 8 mutation (C443S) who had marked initial response to imatinib. Somatic exon 8 KIT mutations have not been previously reported in mucosal melanoma or in other human solid tumors; however, such mutations have been reported in canine and feline mast cell tumors. Protein transcripts from exon 8 play an important role in the structural and functional integrity of the extracellular domain of KIT. In preclinical studies, a mutation in exon 8 led to autophosphorylation, independent of KIT ligand, and constitutive activation of the tyrosine kinase. This biology may explain the successful application of imatinib in animals with tumors harboring exon 8 KIT mutations and in our patient with mucosal melanoma. This report expands the population of patients with melanoma who might benefit from imatinib to those with somatic exon 8 KIT mutations. Such mutations should be looked for in patients with mucosal melanoma.
Nie, Keke; Jiang, Haiping; Zhang, Chunling; Geng, Chuanxin; Xu, Xiajuan; Zhang, Ling; Zhang, Hao; Zhang, Zhongfa; Lan, Ketao; Ji, Youxin
2018-01-01
To identify the somatic mutated genes for optimal targets of non-small-cell lung cancer after resistance to osimertinib treatment. Study patients all had advanced lung adenocarcinoma and acquired resistance to osimertinib as a second- or third-line treatment. These patients had harboring EGFR T790M mutation before osimertinib treatment, which was confirmed by Amplification Refractory Mutation System (ARMS) PCR or Next-Generation Sequencing (NGS). After resistance to osimertinib treatment, tumor tissue was collected by core needle biopsy. DNA was extracted from 15 × 5 um sliced section of formalin-fixed paraffin-embedded (FFPE) material and NGS was done. The genetic changes were analyzed. A total of 9 Chinese patients were studied, 5 females and 4 males, age 51-89 years. After progression with osimertinib treatment, core needle biopsy was performed and next-generation sequencing was performed. Nine patients had harboring 62 point mutations, 2 altered gene copies, 2 amplifications, and 1 EML4-ALK gene fusion. No MET or HER2 amplification was found in this cohort study. Nine patients still maintained initial EGFR 19 del or L858R activating mutations, while 7 of them kept EGFR T790M mutations. Among the 7 patients, 5 had secondary EGFR C797S and/or C797G mutations, which all happened in the same allele with T790M mutation. All patients were treated with targets therapies, chemotherapy, or best supportive care (BSC) in accordance with NGS genetic results and patients' performance status; 7 of them are still alive and 2 of them died of disease progression at last follow-up. EGFR C797S/G mutation and the same one presented on the same allele with EGFR T790M mutation were the most common mutation feature and played a key role in resistance to osimertinib in Chinese patients with NSCLC. Tumor cells losing T790M mutation and maintaining EGFR activating mutation might benefit from first-generation EGFR-TKI treatment.
Aldosterone-stimulating somatic gene mutations are common in normal adrenal glands
Nishimoto, Koshiro; Tomlins, Scott A.; Kuick, Rork; Cani, Andi K.; Giordano, Thomas J.; Hovelson, Daniel H.; Liu, Chia-Jen; Sanjanwala, Aalok R.; Edwards, Michael A.; Gomez-Sanchez, Celso E.; Nanba, Kazutaka; Rainey, William E.
2015-01-01
Primary aldosteronism (PA) represents the most common cause of secondary hypertension, but little is known regarding its adrenal cellular origins. Recently, aldosterone-producing cell clusters (APCCs) with high expression of aldosterone synthase (CYP11B2) were found in both normal and PA adrenal tissue. PA-causing aldosterone-producing adenomas (APAs) harbor mutations in genes encoding ion channels/pumps that alter intracellular calcium homeostasis and cause renin-independent aldosterone production through increased CYP11B2 expression. Herein, we hypothesized that APCCs have APA-related aldosterone-stimulating somatic gene mutations. APCCs were studied in 42 normal adrenals from kidney donors. To clarify APCC molecular characteristics, we used microarrays to compare the APCC transcriptome with conventional adrenocortical zones [zona glomerulosa (ZG), zona fasciculata, and zona reticularis]. The APCC transcriptome was most similar to ZG but with an enhanced capacity to produce aldosterone. To determine if APCCs harbored APA-related mutations, we performed targeted next generation sequencing of DNA from 23 APCCs and adjacent normal adrenal tissue isolated from both formalin-fixed, paraffin-embedded, and frozen tissues. Known aldosterone driver mutations were identified in 8 of 23 (35%) APCCs, including mutations in calcium channel, voltage-dependent, L-type, α1D-subunit (CACNA1D; 6 of 23 APCCs) and ATPase, Na+/K+ transporting, α1-polypeptide (ATP1A1; 2 of 23 APCCs), which were not observed in the adjacent normal adrenal tissue. Overall, we show three major findings: (i) APCCs are common in normal adrenals, (ii) APCCs harbor somatic mutations known to cause excess aldosterone production, and (iii) the mutation spectrum of aldosterone-driving mutations is different in APCCs from that seen in APA. These results provide molecular support for APCC as a precursor of PA. PMID:26240369
Novel Insight into Mutational Landscape of Head and Neck Squamous Cell Carcinoma
Gaykalova, Daria A.; Mambo, Elizabeth; Choudhary, Ashish; Houghton, Jeffery; Buddavarapu, Kalyan; Sanford, Tiffany; Darden, Will; Adai, Alex; Hadd, Andrew; Latham, Gary; Danilova, Ludmila V.; Bishop, Justin; Li, Ryan J.; Westra, William H.; Hennessey, Patrick; Koch, Wayne M.; Ochs, Michael F.; Califano, Joseph A.; Sun, Wenyue
2014-01-01
Development of head and neck squamous cell carcinoma (HNSCC) is characterized by accumulation of mutations in several oncogenes and tumor suppressor genes. We have formerly described the mutation pattern of HNSCC and described NOTCH signaling pathway alterations. Given the complexity of the HNSCC, here we extend the previous study to understand the overall HNSCC mutation context and to discover additional genetic alterations. We performed high depth targeted exon sequencing of 51 highly actionable cancer-related genes with a high frequency of mutation across many cancer types, including head and neck. DNA from primary tumor tissues and matched normal tissues was analyzed for 37 HNSCC patients. We identified 26 non-synonymous or stop-gained mutations targeting 11 of 51 selected genes. These genes were mutated in 17 out of 37 (46%) studied HNSCC patients. Smokers harbored 3.2-fold more mutations than non-smokers. Importantly, TP53 was mutated in 30%, NOTCH1 in 8% and FGFR3 in 5% of HNSCC. HPV negative patients harbored 4-fold more TP53 mutations than HPV positive patients. These data confirm prior reports of the HNSCC mutational profile. Additionally, we detected mutations in two new genes, CEBPA and FES, which have not been previously reported in HNSCC. These data extend the spectrum of HNSCC mutations and define novel mutation targets in HNSCC carcinogenesis, especially for smokers and HNSCC without HPV infection. PMID:24667986
2010-01-01
Background Chronic myelogenous leukemia (CML) is characterized by the chimeric tyrosine kinase Bcr-Abl. Bcr-Abl-T315I is the notorious point mutation that causes resistance to imatinib and the second generation tyrosine kinase inhibitors, leading to poor prognosis. CML blasts have constitutive p65 (RelA NF-κB) transcriptional activity, and NF-κB may be a potential target for molecular therapies in CML that may also be effective against CML cells with Bcr-Abl-T315I. Results In this report, we discovered that pristimerin, a quinonemethide triterpenoid isolated from Celastraceae and Hippocrateaceae, inhibited growth and induced apoptosis in CML cells, including the cells harboring Bcr-Abl-T315I mutation. Additionally, pristimerin inhibited the growth of imatinib-resistant Bcr-Abl-T315I xenografts in nude mice. Pristimerin blocked the TNFα-induced IκBα phosphorylation, translocation of p65, and expression of NF-κB-regulated genes. Pristimerin inhibited two steps in NF-κB signaling: TAK1→IKK and IKK→IκBα. Pristimerin potently inhibited two pairs of CML cell lines (KBM5 versus KBM5-T315I, 32D-Bcr-Abl versus 32D-Bcr-Abl-T315I) and primary cells from a CML patient with acquired resistance to imatinib. The mRNA and protein levels of Bcr-Abl in imatinib-sensitive (KBM5) or imatinib-resistant (KBM5-T315I) CML cells were reduced after pristimerin treatment. Further, inactivation of Bcr-Abl by imatinib pretreatment did not abrogate the TNFα-induced NF-κB activation while silencing p65 by siRNA did not affect the levels of Bcr-Abl, both results together indicating that NF-κB inactivation and Bcr-Abl inhibition may be parallel independent pathways. Conclusion To our knowledge, this is the first report to show that pristimerin is effective in vitro and in vivo against CML cells, including those with the T315I mutation. The mechanisms may involve inhibition of NF-κB and Bcr-Abl. We concluded that pristimerin could be a lead compound for further drug development to
Gps mutations in Chilean patients harboring growth hormone-secreting pituitary tumors.
Johnson, M C; Codner, E; Eggers, M; Mosso, L; Rodriguez, J A; Cassorla, F
1999-01-01
Hypersecretion of GH is usually caused by a pituitary adenoma and about 40% of these tumors exhibit missense gsp mutations in Arg201 or Gln227 of the Gs, gene. We studied 20 pituitary tumors obtained from patients with GH hypersecretion. One tumor was resected from an 11 year-old boy with a 3 year history of accelerated growth, associated with increased concentrations of serum GH and IGF-I, which were not suppressed by glucose administration. The remaining 19 tumors were obtained from adult acromegalic patients, who had elevated baseline serum GH levels that did not show evidence of suppression after administration of glucose. The gsp mutations were studied by enzymatic digestion of the amplified PCR fragment of exon 8 (Arg201) and exon 9 (Gln227) with the enzymes NlaIII and NgoAIV, respectively. The tumors obtained from the boy and from nine of the 19 patients with acromegaly exhibited the gsp mutation R201H. None of the tumors had the Gln227 mutation. The gsp positive patients tended to be older, had smaller tumors, and had preoperative basal serum GH levels which were significantly lower (21 +/- 6 vs 56 +/- 16 microg/l, p<0.05) than the gsp negative patients. In this study, we documented the presence of a gsp mutation in Arg201 in a boy with gigantism and in approximately half of 19 Chilean adult patients with acromegaly, similar to other populations.
Shen, Yinchen; Wang, Jianfei; Han, Xiaohong; Yang, Hongying; Wang, Shuai; Lin, Dongmei; Shi, Yuankai
2013-01-01
Mutations in KRAS oncogene are recognized biomarkers that predict lack of response to anti- epidermal growth factor receptor (EGFR) antibody therapies. However, some patients with KRAS wild-type tumors still do not respond, so other downstream mutations in BRAF, PIK3CA and NRAS should be investigated. Herein we used direct sequencing to analyze mutation status for 676 patients in KRAS (codons 12, 13 and 61), BRAF (exon 11 and exon 15), PIK3CA (exon 9 and exon 20) and NRAS (codons12, 13 and 61). Clinicopathological characteristics associations were analyzed together with overall survival (OS) of metastatic colorectal cancer patients (mCRC). We found 35.9% (242/674) tumors harbored a KRAS mutation, 6.96% (47/675) harbored a BRAF mutation, 9.9% (62/625) harbored a PIK3CA mutation and 4.19% (26/621) harbored a NRAS mutation. KRAS mutation coexisted with BRAF, PIK3CA and NRAS mutation, PIK3CA exon9 mutation appeared more frequently in KRAS mutant tumors (P = 0.027) while NRAS mutation almost existed in KRAS wild-types (P<0.001). Female patients and older group harbored a higher KRAS mutation (P = 0.018 and P = 0.031, respectively); BRAF (V600E) mutation showed a higher frequency in colon cancer and poor differentiation tumors (P = 0.020 and P = 0.030, respectively); proximal tumors appeared a higher PIK3CA mutation (P<0.001) and distant metastatic tumors shared a higher NRAS mutation (P = 0.010). However, in this study no significant result was found between OS and gene mutation in mCRC group. To our knowledge, the first large-scale retrospective study on comprehensive genetic profile which associated with anti-EGFR MoAbs treatment selection in East Asian CRC population, appeared a specific genotype distribution picture, and the results provided a better understanding between clinicopathological characteristics and gene mutations in CRC patients.
Zhao, Yuanyuan; Yang, Yunpeng; Hu, Zhihuang; Xue, Cong; Zhang, Jing; Zhang, Jianwei; Ma, Yuxiang; Zhou, Ting; Yan, Yue; Hou, Xue; Qin, Tao; Dinglin, Xiaoxiao; Tian, Ying; Huang, Peiyu; Huang, Yan; Zhao, Hongyun; Zhang, Li
2014-01-01
Background Several EGFR-tyrosine kinase inhibitors (EGFR-TKIs) including erlotinib, gefitinib, afatinib and icotinib are currently available as treatment for patients with advanced non-small-cell lung cancer (NSCLC) who harbor EGFR mutations. However, no head to head trials between these TKIs in mutated populations have been reported, which provides room for indirect and integrated comparisons. Methods We searched electronic databases for eligible literatures. Pooled data on objective response rate (ORR), progression free survival (PFS), overall survival (OS) were calculated. Appropriate networks for different outcomes were established to incorporate all evidences. Multiple-treatments comparisons (MTCs) based on Bayesian network integrated the efficacy and specific toxicities of all included treatments. Results Twelve phase III RCTs that investigated EGFR-TKIs involving 1821 participants with EGFR mutation were included. For mutant patients, the weighted pooled ORR and 1-year PFS of EGFR-TKIs were significant superior to that of standard chemotherapy (ORR: 66.6% vs. 30.9%, OR 5.46, 95%CI 3.59 to 8.30, P<0.00001; 1-year PFS: 42.9% vs. 9.7%, OR 7.83, 95%CI 4.50 to 13.61; P<0.00001) through direct meta-analysis. In the network meta-analyses, no statistically significant differences in efficacy were found between these four TKIs with respect to all outcome measures. Trend analyses of rank probabilities revealed that the cumulative probabilities of being the most efficacious treatments were (ORR, 1-year PFS, 1-year OS, 2-year OS): erlotinib (51%, 38%, 14%, 19%), gefitinib (1%, 6%, 5%, 16%), afatinib (29%, 27%, 30%, 27%) and icotinib (19%, 29%, NA, NA), respectively. However, afatinib and erlotinib showed significant severer rash and diarrhea compared with gefitinib and icotinib. Conclusions The current study indicated that erlotinib, gefitinib, afatinib and icotinib shared equivalent efficacy but presented different efficacy-toxicity pattern for EGFR-mutated patients
Liang, Wenhua; Wu, Xuan; Fang, Wenfeng; Zhao, Yuanyuan; Yang, Yunpeng; Hu, Zhihuang; Xue, Cong; Zhang, Jing; Zhang, Jianwei; Ma, Yuxiang; Zhou, Ting; Yan, Yue; Hou, Xue; Qin, Tao; Dinglin, Xiaoxiao; Tian, Ying; Huang, Peiyu; Huang, Yan; Zhao, Hongyun; Zhang, Li
2014-01-01
Several EGFR-tyrosine kinase inhibitors (EGFR-TKIs) including erlotinib, gefitinib, afatinib and icotinib are currently available as treatment for patients with advanced non-small-cell lung cancer (NSCLC) who harbor EGFR mutations. However, no head to head trials between these TKIs in mutated populations have been reported, which provides room for indirect and integrated comparisons. We searched electronic databases for eligible literatures. Pooled data on objective response rate (ORR), progression free survival (PFS), overall survival (OS) were calculated. Appropriate networks for different outcomes were established to incorporate all evidences. Multiple-treatments comparisons (MTCs) based on Bayesian network integrated the efficacy and specific toxicities of all included treatments. Twelve phase III RCTs that investigated EGFR-TKIs involving 1821 participants with EGFR mutation were included. For mutant patients, the weighted pooled ORR and 1-year PFS of EGFR-TKIs were significant superior to that of standard chemotherapy (ORR: 66.6% vs. 30.9%, OR 5.46, 95%CI 3.59 to 8.30, P<0.00001; 1-year PFS: 42.9% vs. 9.7%, OR 7.83, 95%CI 4.50 to 13.61; P<0.00001) through direct meta-analysis. In the network meta-analyses, no statistically significant differences in efficacy were found between these four TKIs with respect to all outcome measures. Trend analyses of rank probabilities revealed that the cumulative probabilities of being the most efficacious treatments were (ORR, 1-year PFS, 1-year OS, 2-year OS): erlotinib (51%, 38%, 14%, 19%), gefitinib (1%, 6%, 5%, 16%), afatinib (29%, 27%, 30%, 27%) and icotinib (19%, 29%, NA, NA), respectively. However, afatinib and erlotinib showed significant severer rash and diarrhea compared with gefitinib and icotinib. The current study indicated that erlotinib, gefitinib, afatinib and icotinib shared equivalent efficacy but presented different efficacy-toxicity pattern for EGFR-mutated patients. Erlotinib and afatinib revealed
Trbusek, Martin; Smardova, Jana; Malcikova, Jitka; Sebejova, Ludmila; Dobes, Petr; Svitakova, Miluse; Vranova, Vladimira; Mraz, Marek; Francova, Hana Skuhrova; Doubek, Michael; Brychtova, Yvona; Kuglik, Petr; Pospisilova, Sarka; Mayer, Jiri
2011-07-01
There is a distinct connection between TP53 defects and poor prognosis in chronic lymphocytic leukemia (CLL). It remains unclear whether patients harboring TP53 mutations represent a homogenous prognostic group. We evaluated the survival of patients with CLL and p53 defects identified at our institution by p53 yeast functional assay and complementary interphase fluorescence in situ hybridization analysis detecting del(17p) from 2003 to 2010. A defect of the TP53 gene was identified in 100 of 550 patients. p53 mutations were strongly associated with the deletion of 17p and the unmutated IgVH locus (both P < .001). Survival assessed from the time of abnormality detection was significantly reduced in patients with both missense (P < .001) and nonmissense p53 mutations (P = .004). In addition, patients harboring missense mutation located in p53 DNA-binding motifs (DBMs), structurally well-defined parts of the DNA-binding domain, manifested a clearly shorter median survival (12 months) compared with patients having missense mutations outside DBMs (41 months; P = .002) or nonmissense alterations (36 months; P = .005). The difference in survival was similar in the analysis limited to patients harboring mutation accompanied by del(17p) and was also confirmed in a subgroup harboring TP53 defect at diagnosis. The patients with p53 DBMs mutation (at diagnosis) also manifested a short median time to first therapy (TTFT; 1 month). The substantially worse survival and the short TTFT suggest a strong mutated p53 gain-of-function phenotype in patients with CLL with DBMs mutations. The impact of p53 DBMs mutations on prognosis and response to therapy should be analyzed in investigative clinical trials.
Is MPP a good prognostic factor in stage III lung adenocarcinoma with EGFR exon 19 mutation?
Zhang, Tian; Wang, Jing; Su, Yanjun; Chen, Xi; Yan, Qingna; Li, Qi; Sun, Leina; Wang, Yuwen; Er, Puchun; Pang, Qingsong; Wang, Ping
2017-06-20
Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein encoded by a gene located in the short arm of chromosome 7. This study aimed to investigate the clinicopathologic characteristics of classic EGFR exon mutation in Chinese patients with TMN stage III lung adenocarcinoma who received radical surgery. A total of 1,801 lung adenocarcinomas were analyzed for mutations in EGFR; 35% exhibited mutation of classic EGFR exons. Clinical and pathologic characteristics of patients with EGFR exon 19 mutation were compared with those who harbored EGFR exon 21 mutation. Patients with EGFR exon 19 mutation had a higher overall survival (OS, p=0.023) than those harboring EGFR exon 21 mutation. Our results demonstrated that patients with a micropapillary pattern (MPP) pathologic type in EGFR exon 19 mutation had a higher OS (p=0.022), and patients with exon 19 mutation were more sensitive to EGFR-tyrosine kinase inhibitors (p=0.032). The results of the current study can be used in decision-making regarding the treatment of patients with classic EGFR exon mutations.
Fujihashi, Masahiro; Nishitani, Yuichi; Kiriyama, Tomohiro; Aono, Riku; Sato, Takaaki; Takai, Tomoyuki; Tagashira, Kenta; Fukuda, Wakao; Atomi, Haruyuki; Imanaka, Tadayuki; Miki, Kunio
2016-10-01
Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) plays a central role in carbon dioxide fixation on our planet. Rubisco from a hyperthermophilic archaeon Thermococcus kodakarensis (Tk-Rubisco) shows approximately twenty times the activity of spinach Rubisco at high temperature, but only one-eighth the activity at ambient temperature. We have tried to improve the activity of Tk-Rubisco at ambient temperature, and have successfully constructed several mutants which showed higher activities than the wild-type enzyme both in vitro and in vivo. Here, we designed new Tk-Rubisco mutants based on its three-dimensional structure and a sequence comparison of thermophilic and mesophilic plant Rubiscos. Four mutations were introduced to generate new mutants based on this strategy, and one of the four mutants, T289D, showed significantly improved activity compared to that of the wild-type enzyme. The crystal structure of the Tk-Rubisco T289D mutant suggested that the increase in activity was due to mechanisms distinct from those involved in the improvement in activity of Tk-Rubisco SP8, a mutant protein previously reported to show the highest activity at ambient temperature. Combining the mutations of T289D and SP8 successfully generated a mutant protein (SP8-T289D) with the highest activity to date both in vitro and in vivo. The improvement was particularly pronounced for the in vivo activity of SP8-T289D when introduced into the mesophilic, photosynthetic bacterium Rhodopseudomonas palustris, which resulted in a strain with nearly two-fold higher specific growth rates compared to that of a strain harboring the wild-type enzyme at ambient temperature. Proteins 2016; 84:1339-1346. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Odogwu, Lauretta; Mathieu, Luckson; Goldberg, Kirsten B; Blumenthal, Gideon M; Larkins, Erin; Fiero, Mallorie H; Rodriguez, Lisa; Bijwaard, Karen; Lee, Eunice Y; Philip, Reena; Fan, Ingrid; Donoghue, Martha; Keegan, Patricia; McKee, Amy; Pazdur, Richard
2018-03-01
On March 30, 2017, the U.S. Food and Drug Administration (FDA) approved osimertinib for the treatment of patients with metastatic, epidermal growth factor receptor (EGFR) T790M mutation-positive, non-small cell lung cancer (NSCLC), as detected by an FDA-approved test, whose disease has progressed following EGFR tyrosine kinase inhibitor (TKI) therapy. Approval was based on demonstration of a statistically significant difference in the primary endpoint of progression-free survival (PFS) when comparing osimertinib with chemotherapy in an international, multicenter, open-label, randomized trial (AURA3). In this confirmatory trial, which enrolled 419 patients, the PFS hazard ratio for osimertinib compared with chemotherapy per investigator assessment was 0.30 (95% confidence interval 0.23-0.41), p < .001, with median PFS of 10.1 months in the osimertinib arm and 4.4 months in the chemotherapy arm. Supportive efficacy data included PFS per blinded independent review committee demonstrating similar PFS results and an improved confirmed objective response rate per investigator assessment of 65% and 29%, with estimated median durations of response of 11.0 months and 4.2 months, in the osimertinib and chemotherapy arms, respectively. Patients received osimertinib 80 mg once daily and had a median duration of exposure of 8 months. The toxicity profile of osimertinib compared favorably with the profile of other approved EGFR TKIs and chemotherapy. The most common adverse drug reactions (>20%) in patients treated with osimertinib were diarrhea, rash, dry skin, nail toxicity, and fatigue. Herein, we review the benefit-risk assessment of osimertinib that led to regular approval, for patients with metastatic NSCLC harboring EGFR TKI whose disease has progressed on or after EGFR TKI therapy. Osimertinib administered to metastatic non-small cell lung cancer (NSCLC) patients harboring an EGFR T790M mutation, who have progressed on or following EGFR TKI therapy, demonstrated a
Erson-Omay, E. Zeynep; Çağlayan, Ahmet Okay; Schultz, Nikolaus; Weinhold, Nils; Omay, S. Bülent; Özduman, Koray; Köksal, Yavuz; Li, Jie; Serin Harmancı, Akdes; Clark, Victoria; Carrión-Grant, Geneive; Baranoski, Jacob; Çağlar, Caner; Barak, Tanyeri; Coşkun, Süleyman; Baran, Burçin; Köse, Doğan; Sun, Jia; Bakırcıoğlu, Mehmet; Moliterno Günel, Jennifer; Pamir, M. Necmettin; Mishra-Gorur, Ketu; Bilguvar, Kaya; Yasuno, Katsuhito; Vortmeyer, Alexander; Huttner, Anita J.; Sander, Chris; Günel, Murat
2015-01-01
Background Malignant high-grade gliomas (HGGs), including the most aggressive form, glioblastoma multiforme, show significant clinical and genomic heterogeneity. Despite recent advances, the overall survival of HGGs and their response to treatment remain poor. In order to gain further insight into disease pathophysiology by correlating genomic landscape with clinical behavior, thereby identifying distinct HGG molecular subgroups associated with improved prognosis, we performed a comprehensive genomic analysis. Methods We analyzed and compared 720 exome-sequenced gliomas (136 from Yale, 584 from The Cancer Genome Atlas) based on their genomic, histological, and clinical features. Results We identified a subgroup of HGGs (6 total, 4 adults and 2 children) that harbored a statistically significantly increased number of somatic mutations (mean = 9257.3 vs 76.2, P = .002). All of these “ultramutated” tumors harbored somatic mutations in the exonuclease domain of the polymerase epsilon gene (POLE), displaying a distinctive genetic profile, characterized by genomic stability and increased C-to-A transversions. Histologically, they all harbored multinucleated giant or bizarre cells, some with predominant infiltrating immune cells. One adult and both pediatric patients carried homozygous germline mutations in the mutS homolog 6 (MSH6) gene. In adults, POLE mutations were observed in patients younger than 40 years and were associated with a longer progression-free survival. Conclusions We identified a genomically, histologically, and clinically distinct subgroup of HGGs that harbored somatic POLE mutations and carried an improved prognosis. Identification of distinctive molecular and pathological HGG phenotypes has implications not only for improved classification but also for potential targeted treatments. PMID:25740784
β-catenin contributes to lung tumor development induced by EGFR mutations
Nakayama, Sohei; Sng, Natasha; Carretero, Julian; Welner, Robert; Hayashi, Yuichiro; Yamamoto, Mihoko; Tan, Alistair J.; Yamaguchi, Norihiro; Yasuda, Hiroyuki; Li, Danan; Soejima, Kenzo; Soo, Ross A.; Costa, Daniel B.; Wong, Kwok-Kin; Kobayashi, Susumu S.
2014-01-01
The discovery of somatic mutations in epidermal growth factor receptor (EGFR) and development of EGFR tyrosine kinase inhibitors (TKIs) have revolutionized treatment for lung cancer. However, resistance to TKIs emerges in almost all patients and currently no effective treatment is available. Here we show that β-catenin is essential for development of EGFR mutated lung cancers. β-catenin was upregulated and activated in EGFR mutated cells. Mutant EGFR preferentially bound to and tyrosine-phosphorylated β-catenin, leading to increase in β-catenin-mediated transactivation, particularly in cells harboring the gefitinib/erlotinib-resistant gatekeeper EGFR-T790M mutation. Pharmacological inhibition of β-catenin suppressed EGFR-L858R-T790M mutated lung tumor growth and genetic deletion of the β-catenin gene dramatically reduced lung tumor formation in EGFR-L858R-T790M transgenic mice. These data suggest that β-catenin plays an essential role in lung tumorigenesis and that targeting the β-catenin pathway may provide novel strategies to prevent lung cancer development or overcome resistance to EGFR TKIs. PMID:25164010
HER2 activating mutations are targets for colorectal cancer treatment.
Kavuri, Shyam M; Jain, Naveen; Galimi, Francesco; Cottino, Francesca; Leto, Simonetta M; Migliardi, Giorgia; Searleman, Adam C; Shen, Wei; Monsey, John; Trusolino, Livio; Jacobs, Samuel A; Bertotti, Andrea; Bose, Ron
2015-08-01
The Cancer Genome Atlas project identified HER2 somatic mutations and gene amplification in 7% of patients with colorectal cancer. Introduction of the HER2 mutations S310F, L755S, V777L, V842I, and L866M into colon epithelial cells increased signaling pathways and anchorage-independent cell growth, indicating that they are activating mutations. Introduction of these HER2 activating mutations into colorectal cancer cell lines produced resistance to cetuximab and panitumumab by sustaining MAPK phosphorylation. HER2 mutants are potently inhibited by low nanomolar doses of the irreversible tyrosine kinase inhibitors neratinib and afatinib. HER2 gene sequencing of 48 cetuximab-resistant, quadruple (KRAS, NRAS, BRAF, and PIK3CA) wild-type (WT) colorectal cancer patient-derived xenografts (PDX) identified 4 PDXs with HER2 mutations. HER2-targeted therapies were tested on two PDXs. Treatment with a single HER2-targeted drug (trastuzumab, neratinib, or lapatinib) delayed tumor growth, but dual HER2-targeted therapy with trastuzumab plus tyrosine kinase inhibitors produced regression of these HER2-mutated PDXs. HER2 activating mutations cause EGFR antibody resistance in colorectal cell lines, and PDXs with HER2 mutations show durable tumor regression when treated with dual HER2-targeted therapy. These data provide a strong preclinical rationale for clinical trials targeting HER2 activating mutations in metastatic colorectal cancer. ©2015 American Association for Cancer Research.
Pardanani, Animesh; Lasho, Terra L; Finke, Christy; Mesa, Ruben A; Hogan, William J; Ketterling, Rhett P; Gilliland, Dwight Gary; Tefferi, Ayalew
2007-09-01
JAK2V617F and MPLW515L/K are myeloproliferative disorder (MPD)-associated mutations. We genotyped 552 individual hematopoietic colonies obtained by CD34+ cell culture from 16 affected patients (13 JAK2V617F and 3 MPLW515L/K) to determine (a) the proportion of colonies harboring a particular mutation in the presence or absence of cytokines, (b) the lineage distribution of endogenous colonies for each mutation, and (c) the differences (if any) in the pattern of mutation among the various MPDs, as established by genotyping of individual colonies. Genotyping analysis revealed cohabitation of mutation-negative and mutation-positive endogenous colonies in polycythemia vera as well as other MPDs. Culture of progenitor cells harboring MPLW515L/K yielded virtually no endogenous erythroid colonies in contrast to JAK2V617F-harboring progenitor cells. The mutation pattern (i.e., relative distribution of homozygous, heterozygous, or wild-type colonies) was not a distinguishing feature among the MPDs, and MPLW515 mutations were detected in B and/or T lymphocytes in all three patients tested. These observations suggest that clonal myelopoiesis antedates acquisition of JAK2V617F or MPLW515L/K mutations and that the latter is acquired in a lympho-myeloid progenitor cell.
Toledo, Rodrigo A; Wagner, Simona M; Coutinho, Flavia L; Lourenço, Delmar M; Azevedo, Juliana A; Longuini, Viviane C; Reis, Mariana T A; Siqueira, Sheila A C; Lucon, Antonio M; Tavares, Marcos R; Fragoso, Maria C B V; Pereira, Adelaide A; Dahia, Patricia L M; Mulligan, Lois M; Toledo, Sergio P A
2010-03-01
Previous studies have shown that double RET mutations may be associated with unusual multiple endocrine neoplasia type 2 (MEN 2) phenotypes. Our objective was to report the clinical features of patients harboring a previously unreported double mutation of the RET gene and to characterize this mutation in vitro. Sixteen patients from four unrelated families and harboring the C634Y/Y791F double RET germline mutation were included in the study. Large pheochromocytomas measuring 6.0-14 cm and weighing up to 640 g were identified in the four index cases. Three of the four tumors were bilateral. High penetrance of pheochromocytoma was also seen in the C634Y/Y791F-mutation-positive relatives (seven of nine, 77.7%). Of these, two cases had bilateral tumors, one presented with multifocal tumors, two cases had large tumors (>5 cm), and one case, which was diagnosed with a large (5.5 x 4.5 x 4.0 cm) pheochromocytoma, reported early onset of symptoms of the disease (14 yr old). The overall penetrance of pheochromocytoma was 84.6% (11 of 13). Development of medullary thyroid carcinoma in our patients seemed similar to that observed in patients with codon 634 mutations. Haplotype analysis demonstrated that the mutation did not arise from a common ancestor. In vitro studies showed the double C634Y/Y791F RET receptor was significantly more phosphorylated than either activated wild-type receptor or single C634Y and Y791F RET mutants. Our data suggest that the natural history of the novel C634Y/Y791F double mutation carries a codon 634-like pattern of medullary thyroid carcinoma development, is associated with increased susceptibility to unusually large bilateral pheochromocytomas, and is likely more biologically active than each individual mutation.
Eto, Tsugio; Miyake, Keisuke; Nosho, Katsuhiko; Ohmuraya, Masaki; Imamura, Yu; Arima, Kota; Kanno, Shinichi; Fu, Lingfeng; Kiyozumi, Yuki; Izumi, Daisuke; Sugihara, Hidetaka; Hiyoshi, Yukiharu; Miyamoto, Yuji; Sawayama, Hiroshi; Iwatsuki, Masaaki; Baba, Yoshifumi; Yoshida, Naoya; Furukawa, Toru; Araki, Kimi; Baba, Hideo; Ishimoto, Takatsugu
2018-05-13
RNF43 mutations are frequently detected in colorectal cancer cells and lead to a loss of function of the ubiquitin E3 ligase. Here, we investigated the clinical significance of RNF43 mutations in a large Japanese cohort and the role of RNF43 at various stages of colorectal cancer development and progression. Mutation analysis of the RNF43 gene locus using pyrosequencing technology detected RNF43 hotspot mutations in 1 (0.88%) of 113 colorectal polyp cases and 30 (6.45%) of 465 colorectal cancer cases. Moreover, patients with colorectal cancer harboring mutated RNF43 experienced a higher recurrence rate than those harboring non-mutated RNF43. In addition, the growth of RNF43 wild-type colorectal cancer cell lines was significantly increased by RNF43 silencing. We generated Rnf43 knock-out mice in a C57BL/6N background using the CRISPR-Cas9 system. Although intestinal organoids from the Rnf43 knock-out mice did not show continuous growth compared with those from the wild-type mice in the absence of R-spondin, an azoxymethane (AOM)/dextran sodium sulfate (DSS) mouse model demonstrated that the tumors were markedly larger in the Rnf43 knock-out mice than in the wild-type mice. These findings provide evidence that Wnt signaling activation by RNF43 mutations during the tumorigenic stage enhances tumor growth and promotes a high recurrence rate in colorectal cancer patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
FabH Mutations Confer Resistance to FabF-Directed Antibiotics in Staphylococcus aureus
Parsons, Joshua B.; Yao, Jiangwei; Frank, Matthew W.
2014-01-01
Delineating the mechanisms for genetically acquired antibiotic resistance is a robust approach to target validation and anticipates the evolution of clinical drug resistance. This study defines a spectrum of mutations in fabH that render Staphylococcus aureus resistant to multiple natural products known to inhibit the elongation condensing enzyme (FabF) of bacterial type II fatty acid synthesis. Twenty independently isolated clones resistant to platensimycin, platencin, or thiolactomycin were isolated. All mutants selected against one antibiotic were cross-resistant to the other two antibiotics. Mutations were not detected in fabF, but the resistant strains harbored missense mutations in fabH. The altered amino acids clustered in and around the FabH active-site tunnel. The mutant FabH proteins were catalytically compromised based on the low activities of the purified enzymes, a fatty acid-dependent growth phenotype, and elevated expression of the fabHF operon in the mutant strains. Independent manipulation of fabF and fabH expression levels showed that the FabH/FabF activity ratio was a major determinant of antibiotic sensitivity. Missense mutations that reduce FabH activity are sufficient to confer resistance to multiple antibiotics that bind to the FabF acyl-enzyme intermediate in S. aureus. PMID:25403676
IDH2 Mutations Define a Unique Subtype of Breast Cancer with Altered Nuclear Polarity
Chiang, Sarah; Weigelt, Britta; Wen, Huei-Chi; Pareja, Fresia; Raghavendra, Ashwini; Martelotto, Luciano G.; Burke, Kathleen A.; Basili, Thais; Li, Anqi; Geyer, Felipe C.; Piscuoglio, Salvatore; Ng, Charlotte K.Y.; Jungbluth, Achim A.; Balss, Jörg; Pusch, Stefan; Baker, Gabrielle M.; Cole, Kimberly S.; von Deimling, Andreas; Batten, Julie M.; Marotti, Jonathan D.; Soh, Hwei-Choo; McCalip, Benjamin L.; Serrano, Jonathan; Lim, Raymond S.; Siziopikou, Kalliopi P.; Lu, Song; Liu, Xiaolong; Hammour, Tarek; Brogi, Edi; Snuderl, Matija; Iafrate, A. John; Reis-Filho, Jorge S.; Schnitt, Stuart J.
2017-01-01
Solid papillary carcinoma with reverse polarity (SPCRP) is a rare breast cancer subtype with an obscure etiology. In this study, we sought to describe its unique histopathologic features and to identify the genetic alterations that underpin SPCRP using massively parallel whole-exome and targeted sequencing. The morphologic and immunohistochemical features of SPCRP support the invasive nature of this subtype. Ten of 13 (77%) SPCRPs harbored hotspot mutations at R172 of the isocitrate dehydrogenase IDH2, of which 8 of 10 displayed concurrent pathogenic mutations affecting PIK3CA or PIK3R1. One of the IDH2 wild-type SPCRPs harbored a TET2 Q548* truncating mutation coupled with a PIK3CA H1047R mutation. Functional studies demonstrated that IDH2 and PIK3CA hotspot mutations are likely drivers of SPCRP, resulting in its reversed nuclear polarization phenotype. Our results offer a molecular definition of SPCRP as a distinct breast cancer subtype. Concurrent IDH2 and PIK3CA mutations may help diagnose SPCRP and possibly direct effective treatment. PMID:27913435
Taron, Miguel; Ichinose, Yukito; Rosell, Rafael; Mok, Tony; Massuti, Bartomeu; Zamora, Lurdes; Mate, Jose Luis; Manegold, Christian; Ono, Mayumi; Queralt, Cristina; Jahan, Thierry; Sanchez, Jose Javier; Sanchez-Ronco, Maria; Hsue, Victor; Jablons, David; Sanchez, Jose Miguel; Moran, Teresa
2005-08-15
Activating mutations in the tyrosine kinase domain of the epidermal growth factor receptor (EGFR) confer a strong sensitivity to gefitinib, a selective tyrosine kinase inhibitor of EGFR. We examined EGFR mutations at exons 18, 19, and 21 in tumor tissue from 68 gefitinib-treated, chemorefractory, advanced non-small cell lung cancer patients from the United States, Europe, and Asia and in a highly gefitinib-sensitive non-small cell lung cancer cell line and correlated their presence with response and survival. In addition, in a subgroup of 28 patients for whom the remaining tumor tissue was available, we examined the relationship among EGFR mutations, CA repeats in intron 1 of EGFR, EGFR and caveolin-1 mRNA levels, and increased EGFR gene copy numbers. Seventeen patients had EGFR mutations, all of which were in lung adenocarcinomas. Radiographic response was observed in 16 of 17 (94.1%) patients harboring EGFR mutations, in contrast with 6 of 51 (12.6%) with wild-type EGFR (P < 0.0001). Probability of response increased significantly in never smokers, patients receiving a greater number of prior chemotherapy regimens, Asians, and younger patients. Median survival was not reached for patients with EGFR mutations and was 9.9 months for those with wild-type EGFR (P = 0.001). EGFR mutations tended to be associated with increased numbers of CA repeats and increased EGFR gene copy numbers but not with EGFR and caveolin-1 mRNA overexpression (P = not significant). The presence of EGFR mutations is a major determinant of gefitinib response, and targeting EGFR should be considered in preference to chemotherapy as first-line treatment in lung adenocarcinomas that have demonstrable EGFR mutations.
Novel monoamine oxidase A knock out mice with human-like spontaneous mutation.
Scott, Anna L; Bortolato, Marco; Chen, Kevin; Shih, Jean C
2008-05-07
A novel line of mutant mice [monoamine oxidase A knockout (MAOA KO)] harboring a spontaneous point nonsense mutation in exon 8 of the MAO A gene was serendipitously identified in a 129/SvEvTac colony. This mutation is analogous to the cause of a rare human disorder, Brunner syndrome, characterized by complete MAO A deficiency and impulsive aggressiveness. Concurrent with previous studies of MAO A KO mice generated by insertional mutagenesis ('Tg8'), MAOA(A863T) KO lack MAO A enzyme activity and display enhanced aggression toward intruder mice. MAOA(A863T) KO, however, exhibited lower locomotor activity in a novel, inescapable open field and similar immobility during tail suspension compared with wild type, observations which differ from reports of Tg8. These findings consolidate evidence linking MAO A to aggression and highlight subtle yet distinctive phenotypical characteristics.
Odogwu, Lauretta; Mathieu, Luckson; Goldberg, Kirsten B.; Blumenthal, Gideon M.; Larkins, Erin; Fiero, Mallorie H.; Rodriguez, Lisa; Bijwaard, Karen; Lee, Eunice Y.; Philip, Reena; Fan, Ingrid; Donoghue, Martha; Keegan, Patricia; McKee, Amy; Pazdur, Richard
2017-01-01
Abstract On March 30, 2017, the U.S. Food and Drug Administration (FDA) approved osimertinib for the treatment of patients with metastatic, epidermal growth factor receptor (EGFR) T790M mutation‐positive, non‐small cell lung cancer (NSCLC), as detected by an FDA‐approved test, whose disease has progressed following EGFR tyrosine kinase inhibitor (TKI) therapy. Approval was based on demonstration of a statistically significant difference in the primary endpoint of progression‐free survival (PFS) when comparing osimertinib with chemotherapy in an international, multicenter, open‐label, randomized trial (AURA3). In this confirmatory trial, which enrolled 419 patients, the PFS hazard ratio for osimertinib compared with chemotherapy per investigator assessment was 0.30 (95% confidence interval 0.23–0.41), p < .001, with median PFS of 10.1 months in the osimertinib arm and 4.4 months in the chemotherapy arm. Supportive efficacy data included PFS per blinded independent review committee demonstrating similar PFS results and an improved confirmed objective response rate per investigator assessment of 65% and 29%, with estimated median durations of response of 11.0 months and 4.2 months, in the osimertinib and chemotherapy arms, respectively. Patients received osimertinib 80 mg once daily and had a median duration of exposure of 8 months. The toxicity profile of osimertinib compared favorably with the profile of other approved EGFR TKIs and chemotherapy. The most common adverse drug reactions (>20%) in patients treated with osimertinib were diarrhea, rash, dry skin, nail toxicity, and fatigue. Herein, we review the benefit‐risk assessment of osimertinib that led to regular approval, for patients with metastatic NSCLC harboring EGFR TKI whose disease has progressed on or after EGFR TKI therapy. Implications for Practice. Osimertinib administered to metastatic non‐small cell lung cancer (NSCLC) patients harboring an EGFR T790M mutation, who have progressed
JAK2 V617F, MPL W515L and JAK2 Exon 12 Mutations in Chinese Patients with Primary Myelofibrosis.
Xia, Jun; Lu, Mi-Ze; Jiang, Yuan-Qiang; Yang, Guo-Hua; Zhuang, Yun; Sun, Hong-Li; Shen, Yun-Feng
2012-03-01
JAK2 V617F, MPL W515L and JAK2 exon 12 mutations are novel acquired mutations that induce constitutive cytokine-independent activation of the JAK-STAT pathway in myeloproliferative disorders (MPD). The discovery of these mutations provides novel mechanism for activation of signal transduction in hematopoietic malignancies. This research was to investigate their prevalence in Chinese patients with primary myelofibrosis (PMF). We introduced allele-specific PCR (AS-PCR) combined with sequence analysis to simultaneously screen JAK2 V617F, MPL W515L and JAK2 exon 12 mutations in 30 patients with PMF. Fifteen PMF patients (50.0%) carried JAK2 V617F mutation, and only two JAK2 V617F-negative patients (6.7%) harbored MPL W515L mutation. None had JAK2 exon 12 mutations. Furthermore, these three mutations were not detected in 50 healthy controls. MPL W515L and JAK2 V617F mutations existed in PMF patients but JAK2 exon 12 mutations not. JAK2 V617F and MPL W515L and mutations might contribute to the primary molecular pathogenesis in patients with PMF.
Gao, Xin; Le, Xiuning; Costa, Daniel B.
2016-01-01
First- and second-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) are the evidence-based first-line treatment for metastatic non-small-cell lung cancers (NSCLCs) that harbor sensitizing EGFR mutations (i.e., exon 19 deletions or L858R). However, acquired resistance to EGFR TKI monotherapy occurs invariably within a median time frame of one year. The most common form of biological resistance is through the selection of tumor clones harboring the EGFR T790M mutation, present in >50% of repeat biopsies. The presence of the EGFR T790M mutation negates the inhibitory activity of gefitinib, erlotinib, and afatinib. A novel class of third-generation EGFR TKIs has been identified by probing a series of covalent pyrimidine EGFR inhibitors that bind to amino-acid residue C797 of EGFR and preferentially inhibit mutant forms of EGFR versus the wild-type receptor. We review the rapid clinical development and approval of the third-generation EGFR TKI osimertinib for treatment of NSCLCs with EGFR-T790M. PMID:26943236
OSUMI, HIROKI; SHINOZAKI, EIJI; OSAKO, MASAHIKO; KAWAZOE, YOSHIMASA; OBA, MASARU; MISAKA, TAKAHARU; GOTO, TAKASHI; KAMO, HITOMI; SUENAGA, MITSUKUNI; KUMEKAWA, YOSUKE; OGURA, MARIKO; OZAKA, MASATO; MATSUSAKA, SATOSHI; CHIN, KEISHO; HATAKE, KIYOHIKO; MIZUNUMA, NOBUYUKI
2015-01-01
A number of previous studies have reported that 30–50% of patients with colorectal cancer (CRC) harbor Kirsten rat sarcoma viral oncogene homolog (KRAS) mutations, which is a major predictive biomarker of resistance to epidermal growth factor (EGFR)-targeted therapy. Treatment with an anti-EGFR inhibitor is recommended for patients with KRAS wild-type metastatic colorectal cancer (mCRC). A recent retrospective study of cetuximab reported that patients with KRAS p.G13D mutations had better outcomes compared with those with other mutations. The aim of this retrospective study was to assess the prevalence of KRAS p.G13D mutations and evaluate the effectiveness of cetuximab in mCRC patients with KRAS p.G13D or other KRAS mutations. We reviewed the clinical records of 98 mCRC patients with KRAS mutations who were treated between August, 2004 and January, 2011 in four hospitals located in Tokyo and Kyushu Island. We also investigated KRAS mutation subtypes and patient characteristics. In the patients who received cetuximab, univariate and multivariate analyses were performed to assess the effect of KRAS p.G13D mutations on progression-free survival (PFS) and overall survival (OS). Of the 98 patients, 23 (23.5%) had KRAS p.G13D-mutated tumors, whereas 75 (76.5%) had tumors harboring other mutations. Of the 31 patients who received cetuximab, 9 (29.0%) had KRAS p.G13D mutations and 22 (71.0%) had other mutations. There were no significant differences in age, gender, primary site, pathological type, history of chemotherapy, or the combined use of irinotecan between either of the patient subgroups. The univariate analysis revealed no significant difference in PFS or OS between the patients with KRAS p.G13D mutations and those with other mutations (median PFS, 4.5 vs. 2.8 months, respectively; P=0.65; and median OS, 15.3 vs. 8.9 months, respectively; P=0.51). However, the multivariate analysis revealed a trend toward better PFS among patients harboring p.G13D mutations (PFS
KIT gene mutations and patterns of protein expression in mucosal and acral melanoma.
Abu-Abed, Suzan; Pennell, Nancy; Petrella, Teresa; Wright, Frances; Seth, Arun; Hanna, Wedad
2012-01-01
Recently characterized KIT (CD117) gene mutations have revealed new pathways involved in melanoma pathogenesis. In particular, certain subtypes harbor mutations similar to those observed in gastrointestinal stromal tumors, which are sensitive to treatment with tyrosine kinase inhibitors. The purpose of this study was to characterize KIT gene mutations and patterns of protein expression in mucosal and acral melanoma. Formalin-fixed, paraffin-embedded tissues were retrieved from our archives. Histologic assessment included routine hematoxylin-eosin stains and immunohistochemical staining for KIT. Genomic DNA was used for polymerase chain reaction-based amplification of exons 11 and 13. We identified 59 acral and mucosal melanoma cases, of which 78% showed variable levels of KIT expression. Sequencing of exons 11 and 13 was completed on all cases, and 4 (6.8%) mutant cases were isolated. We successfully optimized conditions for the detection of KIT mutations and showed that 8.6% of mucosal and 4.2% of acral melanoma cases at our institution harbor KIT mutations; all mutant cases showed strong, diffuse KIT protein expression. Our case series represents the first Canadian study to characterize KIT gene mutations and patterns of protein expression in acral and mucosal melanoma.
Yamazaki, Shota; Higuchi, Youichi; Ishibashi, Masayuki; Hashimoto, Hiroko; Yasunaga, Masahiro; Matsumura, Yasuhiro; Tsuchihara, Katsuya; Tsuboi, Masahiro; Goto, Koichi; Ochiai, Atsushi; Ishii, Genichiro
2018-06-01
Primary resistance to epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) is a serious problem in lung adenocarcinoma patients harboring EGFR mutations. The aim of this study was to examine whether and how collagen type I (Col I), the most abundantly deposited matrix in tumor stroma, affects EGFR-TKI sensitivity in EGFR-mutant cells. We evaluated the EGFR-TKI sensitivity of EGFR-mutated cancer cells cultured with Col I. Changes in the activation of downstream signaling molecules of EGFR were analyzed. We also examined the association between the Col I expression in tumor stroma in surgical specimens and EGFR-TKI response of postoperative recurrence patients with EGFR mutations. Compared to cancer cells without Col I, the survival rate of cancer cells cultured with Col I was significantly higher after EGFR-TKI treatment. In cancer cells cultured with and without Col I, EGFR-TKI suppressed the levels of phosphorylated (p-)EGFR, p-ERK1/2, and p-Akt. When compared to cancer cells without Col I, expression of p-P70S6K, a hallmark of mTOR activation, was dramatically upregulated in cancer cells with Col I. This activation was maintained even after EGFR-TKI treatment. Simultaneous treatment with EGFR-TKI and mTOR inhibitor abrogated Col I-induced resistance to EGFR-TKI. Patients with Col I-rich stroma had a significantly shorter progression-free survival time after EGFR-TKI therapy (238 days vs 404 days; P < .05). Collagen type I induces mTOR activation through an Akt-independent pathway, which results in EGFR-TKI resistance. Combination therapy using EGFR-TKI and mTOR inhibitor could be a possible strategy to combat this resistance. © 2018 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
Group B Streptococcal Toxic Shock Syndrome and covR/S Mutations Revisited.
Sendi, Parham; El Hay, Muad Abd; Brandt, Claudia M; Spellerberg, Barbara
2017-01-01
Gene mutations in the virulence regulator CovR/S of group A Streptococcus play a substantial role in the pathogenesis of streptococcal toxic shock syndrome. We screened 25 group B Streptococcus (GBS) isolates obtained from patients with streptococcal toxic shock syndrome and found only 1 GBS clone harboring this kind of mutation.
The Landscape of Somatic Genetic Alterations in Breast Cancers From ATM Germline Mutation Carriers.
Weigelt, Britta; Bi, Rui; Kumar, Rahul; Blecua, Pedro; Mandelker, Diana L; Geyer, Felipe C; Pareja, Fresia; James, Paul A; Couch, Fergus J; Eccles, Diana M; Blows, Fiona; Pharoah, Paul; Li, Anqi; Selenica, Pier; Lim, Raymond S; Jayakumaran, Gowtham; Waddell, Nic; Shen, Ronglai; Norton, Larry; Wen, Hannah Y; Powell, Simon N; Riaz, Nadeem; Robson, Mark E; Reis-Filho, Jorge S; Chenevix-Trench, Georgia
2018-02-28
Pathogenic germline variants in ataxia-telangiectasia mutated (ATM), a gene that plays a role in DNA damage response and cell cycle checkpoints, confer an increased breast cancer (BC) risk. Here, we investigated the phenotypic characteristics and landscape of somatic genetic alterations in 24 BCs from ATM germline mutation carriers by whole-exome and targeted sequencing. ATM-associated BCs were consistently hormone receptor positive and largely displayed minimal immune infiltrate. Although 79.2% of these tumors exhibited loss of heterozygosity of the ATM wild-type allele, none displayed high activity of mutational signature 3 associated with defective homologous recombination DNA (HRD) repair. No TP53 mutations were found in the ATM-associated BCs. Analysis of an independent data set confirmed that germline ATM variants and TP53 somatic mutations are mutually exclusive. Our findings indicate that ATM-associated BCs often harbor bi-allelic inactivation of ATM, are phenotypically distinct from BRCA1/2-associated BCs, lack HRD-related mutational signatures, and that TP53 and ATM genetic alterations are likely epistatic.
A Landscape of Driver Mutations in Melanoma
Hodis, Eran; Watson, Ian R.; Kryukov, Gregory V.; Arold, Stefan T.; Imielinski, Marcin; Theurillat, Jean-Philippe; Nickerson, Elizabeth; Auclair, Daniel; Li, Liren; Place, Chelsea; DiCara, Daniel; Ramos, Alex H.; Lawrence, Michael S.; Cibulskis, Kristian; Sivachenko, Andrey; Voet, Douglas; Saksena, Gordon; Stransky, Nicolas; Onofrio, Robert C.; Winckler, Wendy; Ardlie, Kristin; Wagle, Nikhil; Wargo, Jennifer; Chong, Kelly; Morton, Donald L.; Stemke-Hale, Katherine; Chen, Guo; Noble, Michael; Meyerson, Matthew; Ladbury, John E.; Davies, Michael A.; Gershenwald, Jeffrey E.; Wagner, Stephan N.; Hoon, Dave S.B.; Schadendorf, Dirk; Lander, Eric S.; Gabriel, Stacey B.; Getz, Gad; Garraway, Levi A.; Chin, Lynda
2012-01-01
SUMMARY Despite recent insights into melanoma genetics, systematic surveys for driver mutations are challenged by an abundance of passenger mutations caused by carcinogenic ultraviolet (UV) light exposure. We developed a permutation-based framework to address this challenge, employing mutation data from intronic sequences to control for passenger mutational load on a per gene basis. Analysis of large-scale melanoma exome data by this approach discovered six novel melanoma genes (PPP6C, RAC1, SNX31, TACC1, STK19 and ARID2), three of which - RAC1, PPP6C and STK19 - harbored recurrent and potentially targetable mutations. Integration with chromosomal copy number data contextualized the landscape of driver mutations, providing oncogenic insights in BRAF- and NRAS-driven melanoma as well as those without known NRAS/BRAF mutations. The landscape also clarified a mutational basis for RB and p53 pathway deregulation in this malignancy. Finally, the spectrum of driver mutations provided unequivocal genomic evidence for a direct mutagenic role of UV light in melanoma pathogenesis. PMID:22817889
33 CFR 100.109 - Winter Harbor Lobster Boat Race, Winter Harbor, ME.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Winter Harbor Lobster Boat Race, Winter Harbor, ME. 100.109 Section 100.109 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF... Lobster Boat Race, Winter Harbor, ME. (a) Regulated area. The regulated area includes all waters of Winter...
Targeting Bcl-2 stability to sensitize cells harboring oncogenic ras.
Peng, Bo; Ganapathy, Suthakar; Shen, Ling; Huang, Junchi; Yi, Bo; Zhou, Xiaodong; Dai, Wei; Chen, Changyan
2015-09-08
The pro-survival factor Bcl-2 and its family members are critical determinants of the threshold of the susceptibility of cells to apoptosis. Studies are shown that cells harboring an oncogenic ras were extremely sensitive to the inhibition of protein kinase C (PKC) and Bcl-2 could antagonize this apoptotic process. However, it remains unrevealed how Bcl-2 is being regulated in this apoptotic process. In this study, we investigate the role of Bcl-2 stability in sensitizing the cells harboring oncogenic K-ras to apoptosis triggered by PKC inhibitor GO6976. We demonstrated that Bcl-2 in Swiss3T3 cells ectopically expressing or murine lung cancer LKR cells harboring K-ras rapidly underwent ubiquitin-dependent proteasome pathway after the treatment of GO6976, accompanied with induction of apoptosis. In this process, Bcl-2 formed the complex with Keap-1 and Cul3. The mutation of serine-17 and deletion of BH-2 or 4 was required for Bcl-2 ubiquitination and degradation, which elevate the signal threshold for the induction of apoptosis in the cells following PKC inhibition. Thus, Bcl-2 appears an attractive target for the induction of apoptosis by PKC inhibition in cancer cells expressing oncogenic K-ras.
Activating HER2 mutations in HER2 gene amplification negative breast cancer.
Bose, Ron; Kavuri, Shyam M; Searleman, Adam C; Shen, Wei; Shen, Dong; Koboldt, Daniel C; Monsey, John; Goel, Nicholas; Aronson, Adam B; Li, Shunqiang; Ma, Cynthia X; Ding, Li; Mardis, Elaine R; Ellis, Matthew J
2013-02-01
Data from 8 breast cancer genome-sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized 13 HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture, and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGF receptor (EGFR) exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings show that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. We show that the majority of HER2 somatic mutations in breast cancer patients are activating mutations that likely drive tumorigenesis. Several patients had mutations that are resistant to the reversible HER2 inhibitor lapatinib, but are sensitive to the irreversible HER2 inhibitor, neratinib. Our results suggest that patients with HER2 mutation–positive breast cancers could benefit from existing HER2-targeted drugs.
Group B Streptococcal Toxic Shock Syndrome and covR/S Mutations Revisited
Sendi, Parham; el Hay, Muad Abd; Brandt, Claudia M.
2017-01-01
Gene mutations in the virulence regulator CovR/S of group A Streptococcus play a substantial role in the pathogenesis of streptococcal toxic shock syndrome. We screened 25 group B Streptococcus (GBS) isolates obtained from patients with streptococcal toxic shock syndrome and found only 1 GBS clone harboring this kind of mutation. PMID:27983484
HER2 activating mutations are targets for colorectal cancer treatment
Kavuri, Shyam M.; Jain, Naveen; Galimi, Francesco; Cottino, Francesca; Leto, Simonetta M.; Migliardi, Giorgia; Searleman, Adam C.; Shen, Wei; Monsey, John; Trusolino, Livio; Jacobs, Samuel A.; Bertotti, Andrea; Bose, Ron
2015-01-01
The Cancer Genome Atlas project identified HER2 somatic mutations and gene amplification in 7% of colorectal cancer patients. Introduction of the HER2 mutations, S310F, L755S, V777L, V842I, and L866M, into colon epithelial cells increased signaling pathways and anchorage-independent cell growth, indicating that they are activating mutations. Introduction of these HER2 activating mutations into colorectal cancer cell lines produced resistance to cetuximab and panitumumab by sustaining MAPK phosphorylation. HER2 mutations are potently inhibited by low nanomolar doses of the irreversible tyrosine kinase inhibitors, neratinib and afatinib. HER2 gene sequencing of 48 cetuximab resistant, quadruple (KRAS, NRAS, BRAF, and PIK3CA) WT colorectal cancer patient-derived xenografts (PDX’s) identified 4 PDX’s with HER2 mutations. HER2 targeted therapies were tested on two PDX’s. Treatment with a single HER2 targeted drug (trastuzumab, neratinib, or lapatinib) delayed tumor growth, but dual HER2 targeted therapy with trastuzumab plus tyrosine kinase inhibitors produced regression of these HER2 mutated PDX’s. PMID:26243863
Activating HER2 mutations in HER2 gene amplification negative breast cancer
Bose, Ron; Kavuri, Shyam M.; Searleman, Adam C.; Shen, Wei; Shen, Dong; Koboldt, Daniel C.; Monsey, John; Goel, Nicholas; Aronson, Adam B.; Li, Shunqiang; Ma, Cynthia X.; Ding, Li; Mardis, Elaine R.; Ellis, Matthew J.
2012-01-01
Data from eight breast cancer genome sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized thirteen HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGFR exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings demonstrate that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. PMID:23220880
Activation of tyrosine kinases by mutation of the gatekeeper threonine
Azam, Mohammad; Seeliger, Markus A; Gray, Nathanael S; Kuriyan, John; Daley, George Q
2008-01-01
Protein kinases targeted by small-molecule inhibitors develop resistance through mutation of the ‘gatekeeper’ threonine residue of the active site. Here we show that the gatekeeper mutation in the cellular forms of c-ABL, c-SRC, platelet-derived growth factor receptor-α and -β, and epidermal growth factor receptor activates the kinase and promotes malignant transformation of BaF3 cells. Structural analysis reveals that a network of hydrophobic interactions—the hydrophobic spine—characteristic of the active kinase conformation is stabilized by the gatekeeper substitution. Substitution of glycine for the residues constituting the spine disrupts the hydrophobic connectivity and inactivates the kinase. Furthermore, a small-molecule inhibitor that maximizes complementarity with the dismantled spine (compound 14) inhibits the gatekeeper mutation of BCR-ABL-T315I. These results demonstrate that mutation of the gatekeeper threonine is a common mechanism of activation for tyrosine kinases and provide structural insights to guide the development of next-generation inhibitors. PMID:18794843
Operation and Maintence, Vermilion Harbor, Erie County, Ohio.
1976-03-01
channel and structural maintenance activities at Vermilion Harbor. Although 6 ...- this alternative would eliminate temporary adverse ecological effects of...of dredging on water quality, aquatic ecology , and harbor recreation and related 4 businesses wbuld be reduced to a level commensurate with reduced...effects on aquatic ecology but would have long- term, beneficial effects on shoreline erosion and beach areas. There have been no specific requests from
Oncogenically active MYD88 mutations in human lymphoma.
Ngo, Vu N; Young, Ryan M; Schmitz, Roland; Jhavar, Sameer; Xiao, Wenming; Lim, Kian-Huat; Kohlhammer, Holger; Xu, Weihong; Yang, Yandan; Zhao, Hong; Shaffer, Arthur L; Romesser, Paul; Wright, George; Powell, John; Rosenwald, Andreas; Muller-Hermelink, Hans Konrad; Ott, German; Gascoyne, Randy D; Connors, Joseph M; Rimsza, Lisa M; Campo, Elias; Jaffe, Elaine S; Delabie, Jan; Smeland, Erlend B; Fisher, Richard I; Braziel, Rita M; Tubbs, Raymond R; Cook, J R; Weisenburger, Denny D; Chan, Wing C; Staudt, Louis M
2011-02-03
The activated B-cell-like (ABC) subtype of diffuse large B-cell lymphoma (DLBCL) remains the least curable form of this malignancy despite recent advances in therapy. Constitutive nuclear factor (NF)-κB and JAK kinase signalling promotes malignant cell survival in these lymphomas, but the genetic basis for this signalling is incompletely understood. Here we describe the dependence of ABC DLBCLs on MYD88, an adaptor protein that mediates toll and interleukin (IL)-1 receptor signalling, and the discovery of highly recurrent oncogenic mutations affecting MYD88 in ABC DLBCL tumours. RNA interference screening revealed that MYD88 and the associated kinases IRAK1 and IRAK4 are essential for ABC DLBCL survival. High-throughput RNA resequencing uncovered MYD88 mutations in ABC DLBCL lines. Notably, 29% of ABC DLBCL tumours harboured the same amino acid substitution, L265P, in the MYD88 Toll/IL-1 receptor (TIR) domain at an evolutionarily invariant residue in its hydrophobic core. This mutation was rare or absent in other DLBCL subtypes and Burkitt's lymphoma, but was observed in 9% of mucosa-associated lymphoid tissue lymphomas. At a lower frequency, additional mutations were observed in the MYD88 TIR domain, occurring in both the ABC and germinal centre B-cell-like (GCB) DLBCL subtypes. Survival of ABC DLBCL cells bearing the L265P mutation was sustained by the mutant but not the wild-type MYD88 isoform, demonstrating that L265P is a gain-of-function driver mutation. The L265P mutant promoted cell survival by spontaneously assembling a protein complex containing IRAK1 and IRAK4, leading to IRAK4 kinase activity, IRAK1 phosphorylation, NF-κB signalling, JAK kinase activation of STAT3, and secretion of IL-6, IL-10 and interferon-β. Hence, the MYD88 signalling pathway is integral to the pathogenesis of ABC DLBCL, supporting the development of inhibitors of IRAK4 kinase and other components of this pathway for the treatment of tumours bearing oncogenic MYD88 mutations.
Mon, Sann Y; Riedlinger, Gregory; Abbott, Collette E; Seethala, Raja; Ohori, N Paul; Nikiforova, Marina N; Nikiforov, Yuri E; Hodak, Steven P
2018-05-01
Thyroid-stimulating hormone receptor (TSHR) gene mutations play a critical role in thyroid cell proliferation and function. They are found in 20%-82% of hyperfunctioning nodules, hyperfunctioning follicular thyroid cancers (FTC), and papillary thyroid cancers (PTC). The diagnostic importance of TSHR mutation testing in fine needle aspiration (FNA) specimens remains unstudied. To examine the association of TSHR mutations with the functional status and surgical outcomes of thyroid nodules, we evaluated 703 consecutive thyroid FNA samples with indeterminate cytology for TSHR mutations using next-generation sequencing. Testing for EZH1 mutations was performed in selected cases. The molecular diagnostic testing was done as part of standard of care treatment, and did not require informed consent. TSHR mutations were detected in 31 (4.4%) nodules and were located in exons 281-640, with codon 486 being the most common. Allelic frequency ranged from 3% to 45%. Of 16 cases (12 benign, 3 FTC, 1 PTC) with surgical correlation, 15 had solitary TSHR mutations and 1 PTC had comutation with BRAF V600E. Hyperthyroidism was confirmed in all 3 FTC (2 overt, 1 subclinical). Of 5 nodules with solitary TSHR mutations detected at high allelic frequency, 3 (60%) were FTC. Those at low allelic frequency (3%-22%) were benign. EZH1 mutations were detected in 2 of 4 TSHR-mutant malignant nodules and neither of 2 benign nodules. We report that TSHR mutations occur in ∼5% thyroid nodules in a large consecutive series with indeterminate cytology. TSHR mutations may be associated with an increased cancer risk when present at high allelic frequency, even when the nodule is hyperfunctioning. Benign nodules were however most strongly correlated with TSHR mutations at low allelic frequency. © 2018 Wiley Periodicals, Inc.
Large deletion in PIGL: a common mutational mechanism in CHIME syndrome?
Ceroni, José RM; Yamamoto, Guilherme L; Honjo, Rachel S; Kim, Chong A; Passos-Bueno, Maria R; Bertola, Débora R
2018-01-01
Abstract CHIME syndrome is an extremely rare autosomal recessive multisystemic disorder caused by mutations in PIGL. PIGL is an endoplasmic reticulum localized enzyme that catalyzes the second step of glycosylphosphatidylinositol (GPI) biosynthesis, which plays a role in the anchorage of cell-surface proteins including receptors, enzymes, and adhesion molecules. Germline mutations in other members of GPI and Post GPI Attachment to Proteins (PGAP) family genes have been described and constitute a group of diseases within the congenital disorders of glycosylation. Patients in this group often present alkaline phosphatase serum levels abnormalities and neurological symptoms. We report a CHIME syndrome patient who harbors a missense mutation c.500T > C (p.Leu167Pro) and a large deletion involving the 5’ untranslated region and part of exon 1 of PIGL. In CHIME syndrome, a recurrent missense mutation c.500T > C (p.Leu167Pro) is found in the majority of patients, associated with a null mutation in the other allele, including an overrepresentation of large deletions. The latter are not detected by the standard analysis in sequencing techniques, including next-generation sequencing. Thus, in individuals with a clinical diagnosis of CHIME syndrome in which only one mutation is found, an active search for a large deletion should be sought. PMID:29473937
Large deletion in PIGL: a common mutational mechanism in CHIME syndrome?
Ceroni, José Rm; Yamamoto, Guilherme L; Honjo, Rachel S; Kim, Chong A; Passos-Bueno, Maria R; Bertola, Débora R
2018-01-01
CHIME syndrome is an extremely rare autosomal recessive multisystemic disorder caused by mutations in PIGL. PIGL is an endoplasmic reticulum localized enzyme that catalyzes the second step of glycosylphosphatidylinositol (GPI) biosynthesis, which plays a role in the anchorage of cell-surface proteins including receptors, enzymes, and adhesion molecules. Germline mutations in other members of GPI and Post GPI Attachment to Proteins (PGAP) family genes have been described and constitute a group of diseases within the congenital disorders of glycosylation. Patients in this group often present alkaline phosphatase serum levels abnormalities and neurological symptoms. We report a CHIME syndrome patient who harbors a missense mutation c.500T > C (p.Leu167Pro) and a large deletion involving the 5' untranslated region and part of exon 1 of PIGL. In CHIME syndrome, a recurrent missense mutation c.500T > C (p.Leu167Pro) is found in the majority of patients, associated with a null mutation in the other allele, including an overrepresentation of large deletions. The latter are not detected by the standard analysis in sequencing techniques, including next-generation sequencing. Thus, in individuals with a clinical diagnosis of CHIME syndrome in which only one mutation is found, an active search for a large deletion should be sought.
Novel monoamine oxidase A knock out mice with human-like spontaneous mutation
Scott, Anna L.; Bortolato, Marco; Chen, Kevin; Shih, Jean C.
2012-01-01
A novel line of mutant mice [monoamine oxidase A knockout (MAOAA863T KO)] harboring a spontaneous point nonsense mutation in exon 8 of the MAO A gene was serendipitously identified in a 129/SvEvTac colony. This mutation is analogous to the cause of a rare human disorder, Brunner syndrome, characterized by complete MAO A deficiency and impulsive aggressiveness. Concurrent with previous studies of MAO A KO mice generated by insertional mutagenesis (‘Tg8’), MAOAA863T KO lack MAO A enzyme activity and display enhanced aggression toward intruder mice. MAOAA863T KO, however, exhibited lower locomotor activity in a novel, inescapable open field and similar immobility during tail suspension compared with wild type, observations which differ from reports of Tg8. These findings consolidate evidence linking MAO A to aggression and highlight subtle yet distinctive phenotypical characteristics. PMID:18418249
CVID-associated TACI mutations affect autoreactive B cell selection and activation
Romberg, Neil; Chamberlain, Nicolas; Saadoun, David; Gentile, Maurizio; Kinnunen, Tuure; Ng, Yen Shing; Virdee, Manmeet; Menard, Laurence; Cantaert, Tineke; Morbach, Henner; Rachid, Rima; Martinez-Pomar, Natalia; Matamoros, Nuria; Geha, Raif; Grimbacher, Bodo; Cerutti, Andrea; Cunningham-Rundles, Charlotte; Meffre, Eric
2013-01-01
Common variable immune deficiency (CVID) is an assorted group of primary diseases that clinically manifest with antibody deficiency, infection susceptibility, and autoimmunity. Heterozygous mutations in the gene encoding the tumor necrosis factor receptor superfamily member TACI are associated with CVID and autoimmune manifestations, whereas two mutated alleles prevent autoimmunity. To assess how the number of TACI mutations affects B cell activation and tolerance checkpoints, we analyzed healthy individuals and CVID patients carrying one or two TACI mutations. We found that TACI interacts with the cleaved, mature forms of TLR7 and TLR9 and plays an important role during B cell activation and the central removal of autoreactive B cells in healthy donors and CVID patients. However, only subjects with a single TACI mutation displayed a breached immune tolerance and secreted antinuclear antibodies (ANAs). These antibodies were associated with the presence of circulating B cell lymphoma 6–expressing T follicular helper (Tfh) cells, likely stimulating autoreactive B cells. Thus, TACI mutations may favor CVID by altering B cell activation with coincident impairment of central B cell tolerance, whereas residual B cell responsiveness in patients with one, but not two, TACI mutations enables autoimmune complications. PMID:24051380
Ras mutation cooperates with β-catenin activation to drive bladder tumourigenesis.
Ahmad, I; Patel, R; Liu, Y; Singh, L B; Taketo, M M; Wu, X-R; Leung, H Y; Sansom, O J
2011-03-03
Mutations in the Ras family of proteins (predominantly in H-Ras) occur in approximately 40% of urothelial cell carcinoma (UCC). However, relatively little is known about subsequent mutations/pathway alterations that allow tumour progression. Indeed, expressing mutant H-Ras within the mouse bladder does not lead to tumour formation, unless this is expressed at high levels. The Wnt signalling pathway is deregulated in approximately 25% of UCC, so we examined if this correlated with the activation of MAPK signalling in human UCC and found a significant correlation. To test the functional significance of this association we examined the impact of combining Ras mutation (H-Ras(Q61L) or K-Ras(G12D)) with an activating β-catenin mutation within the mouse bladder using Cre-LoxP technology. Although alone, neither Ras mutation nor β-catenin activation led to UCC (within 12 months), mice carrying both mutations rapidly developed UCC. Mechanistically this was associated with reduced levels of p21 with dependence on the MAPK signalling pathway. Moreover, tumours from these mice were sensitive to MEK inhibition. Importantly, in human UCC there was a negative correlation between levels of p-ERK and p21 suggesting that p21 accumulation may block tumour progression following Ras mutation. Taken together these data definitively show Ras pathway activation strongly cooperates with Wnt signalling to drive UCC in vivo.
Mutations in the Promoter Region of the Aldolase B Gene that cause Hereditary Fructose Intolerance
Coffee, Erin M.; Tolan, Dean R.
2010-01-01
SUMMARY Hereditary fructose intolerance (HFI) is a potentially fatal inherited metabolic disease caused by a deficiency of aldolase B activity in the liver and kidney. Over 40 disease-causing mutations are known in the protein-coding region of ALDOB. Mutations upstream of the protein-coding portion of ALDOB are reported here for the first time. DNA sequence analysis of 61 HFI patients revealed single base mutations in the promoter, intronic enhancer, and the first exon, which is entirely untranslated. One mutation, g.–132G>A, is located within the promoter at an evolutionarily conserved nucleotide within a transcription factor-binding site. A second mutation, IVS1+1G>C, is at the donor splice site of the first exon. In vitro electrophoretic mobility shift assays show a decrease in nuclear extract-protein binding at the g.–132G>A mutant site. The promoter mutation results in decreased transcription using luciferase reporter plasmids. Analysis of cDNA from cells transfected with plasmids harboring the IVS1+1G>C mutation results in aberrant splicing leading to complete retention of the first intron (~ 5 kb). The IVS1+1G>C splicing mutation results in loss of luciferase activity from a reporter plasmid. These novel mutations in ALDOB represent 2% of alleles in American HFI patients, with IVS1+1G>C representing a significantly higher allele frequency (6%) among HFI patients of Hispanic and African-American ethnicity. PMID:20882353
Harms, Paul W; Collie, Angela M B; Hovelson, Daniel H; Cani, Andi K; Verhaegen, Monique E; Patel, Rajiv M; Fullen, Douglas R; Omata, Kei; Dlugosz, Andrzej A; Tomlins, Scott A; Billings, Steven D
2016-03-01
Merkel cell carcinoma is a rare but highly aggressive cutaneous neuroendocrine carcinoma. Cytokeratin 20 (CK20) is expressed in ~95% of Merkel cell carcinomas and is useful for distinction from morphologically similar entities including metastatic small-cell lung carcinoma. Lack of CK20 expression may make diagnosis of Merkel cell carcinoma more challenging, and has unknown biological significance. Approximately 80% of CK20-positive Merkel cell carcinomas are associated with the oncogenic Merkel cell polyomavirus. Merkel cell carcinomas lacking Merkel cell polyomavirus display distinct genetic changes from Merkel cell polyomavirus-positive Merkel cell carcinoma, including RB1 inactivating mutations. Unlike CK20-positive Merkel cell carcinoma, the majority of CK20-negative Merkel cell carcinomas are Merkel cell polyomavirus-negative, suggesting CK20-negative Merkel cell carcinomas predominantly arise through virus-independent pathway(s) and may harbor additional genetic differences from conventional Merkel cell carcinoma. Hence, we analyzed 15 CK20-negative Merkel cell carcinoma tumors (10 Merkel cell polyomavirus-negative, four Merkel cell polyomavirus-positive, and one undetermined) using the Ion Ampliseq Comprehensive Cancer Panel, which assesses copy number alterations and mutations in 409 cancer-relevant genes. Twelve tumors displayed prioritized high-level chromosomal gains or losses (average 1.9 per tumor). Non-synonymous high-confidence somatic mutations were detected in 14 tumors (average 11.9 per tumor). Assessing all somatic coding mutations, an ultraviolet-signature mutational profile was present, and more prevalent in Merkel cell polyomavirus-negative tumors. Recurrent deleterious tumor suppressor mutations affected TP53 (9/15, 60%), RB1 (3/15, 20%), and BAP1 (2/15, 13%). Oncogenic activating mutations included PIK3CA (3/15, 20%), AKT1 (1/15, 7%) and EZH2 (1/15, 7%). In conclusion, CK20-negative Merkel cell carcinoma display overlapping genetic changes
Harms, Paul W.; Collie, Angela M. B.; Hovelson, Daniel H.; Cani, Andi K.; Verhaegen, Monique E.; Patel, Rajiv M.; Fullen, Douglas R.; Omata, Kei; Dlugosz, Andrzej A.; Tomlins, Scott A.; Billings, Steven D.
2016-01-01
Merkel cell carcinoma is a rare but highly aggressive cutaneous neuroendocrine carcinoma. Cytokeratin-20 (CK20) is expressed in approximately 95% of Merkel cell carcinomas and is useful for distinction from morphologically similar entities including metastatic small cell lung carcinoma. Lack of CK20 expression may make diagnosis of Merkel cell carcinoma more challenging, and has unknown biological significance. Approximately 80% of CK20-positive Merkel cell carcinomas are associated with the oncogenic Merkel cell polyomavirus. Merkel cell carcinomas lacking Merkel cell polyomavirus display distinct genetic changes from Merkel cell polyomavirus-positive Merkel cell carcinoma, including RB1 inactivating mutations. Unlike CK20-positive Merkel cell carcinoma, the majority of CK20-negative Merkel cell carcinomas are Merkel cell polyomavirus-negative, suggesting CK20-negative Merkel cell carcinomas predominantly arise through virus-independent pathway(s) and may harbor additional genetic differences from conventional Merkel cell carcinoma. Hence, we analyzed 15 CK20-negative Merkel cell carcinoma tumors (ten Merkel cell polyomavirus-negative, four Merkel cell polyomavirus-positive, and one undetermined) using the Ion Ampliseq Comprehensive Cancer Panel, which assesses copy number alterations and mutations in 409 cancer-relevant genes. Twelve tumors displayed prioritized high-level chromosomal gains or losses (average 1.9 per tumor). Non-synonymous high confidence somatic mutations were detected in 14 tumors (average 11.9 per tumor). Assessing all somatic coding mutations, an ultraviolet-signature mutational profile was present, and more prevalent in Merkel cell polyomavirus-negative tumors. Recurrent deleterious tumor suppressor mutations affected TP53 (9/15, 60%), RB1 (3/15, 20%), and BAP1 (2/15, 13%). Oncogenic activating mutations included PIK3CA (3/15, 20%), AKT1 (1/15, 7%)) and EZH2 (1/15, 7%). In conclusion, CK20-negative Merkel cell carcinoma display overlapping
77 FR 50916 - Safety Zone; Boston Harbor's Rock Removal Project, Boston Inner Harbor, Boston, MA
Federal Register 2010, 2011, 2012, 2013, 2014
2012-08-23
... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 165 [Docket No. USCG-2012-0767] RIN 1625-AA00 Safety Zone; Boston Harbor's Rock Removal Project, Boston Inner Harbor, Boston, MA AGENCY: Coast.... 165.T01-0767 Safety Zone; Boston Harbor's Rock Removal Project, Boston Inner Harbor, Boston, MA. (a...
Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC.
Ahmed, Zubair M; Smith, Tenesha N; Riazuddin, Saima; Makishima, Tomoko; Ghosh, Manju; Bokhari, Sirosh; Menon, Puthezhath S N; Deshmukh, Dilip; Griffith, Andrew J; Riazuddin, Sheikh; Friedman, Thomas B; Wilcox, Edward R
2002-06-01
Human chromosome 11 harbors two Usher type I loci, USHIB and USHIC, which encode myosin VIIA and harmonin, respectively. The USHIC locus overlaps the reported critical interval for nonsyndromic deafness locus DFNB18. We found an IVS12+5G-->C mutation in the USHIC gene, which is associated with nonsyndromic recessive deafness ( DFNB18) segregating in the original family, S-11/12. No other disease-associated mutation was found in the other 27 exons or in the intron-exon boundaries, and the IVS12+5G-->C mutation was not present in 200 representative unaffected individuals ascertained from the same area of India. An exon-trapping assay with a construct harboring IVS12+5G-->C generated wildtype spliced mRNA having exons 11 and 12 and mRNA that skipped exon 12. We conclude that mutations of USHIC can cause both Usher syndrome type IC and nonsyndromic recessive deafness DFNB18.
Futai, Eugene; Osawa, Satoko; Cai, Tetsuo; Fujisawa, Tomoya; Ishiura, Shoichi; Tomita, Taisuke
2016-01-01
γ-Secretase is a multisubunit membrane protein complex containing presenilin (PS1) as a catalytic subunit. Familial Alzheimer disease (FAD) mutations within PS1 were analyzed in yeast cells artificially expressing membrane-bound substrate, amyloid precursor protein, or Notch fused to Gal4 transcriptional activator. The FAD mutations, L166P and G384A (Leu-166 to Pro and Gly-384 to Ala substitution, respectively), were loss-of-function in yeast. We identified five amino acid substitutions that suppress the FAD mutations. The cleavage of amyloid precursor protein or Notch was recovered by the secondary mutations. We also found that secondary mutations alone activated the γ-secretase activity. FAD mutants with suppressor mutations, L432M or S438P within TMD9 together with a missense mutation in the second or sixth loops, regained γ-secretase activity when introduced into presenilin null mouse fibroblasts. Notably, the cells with suppressor mutants produced a decreased amount of Aβ42, which is responsible for Alzheimer disease. These results indicate that the yeast system is useful to screen for mutations and chemicals that modulate γ-secretase activity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Frequent somatic TERT promoter mutations and CTNNB1 mutations in hepatocellular carcinoma.
Lee, Seung Eun; Chang, Seong-Hwan; Kim, Wook Youn; Lim, So Dug; Kim, Wan Seop; Hwang, Tea Sook; Han, Hye Seung
2016-10-25
Genetic alterations of TERT and CTNNB1 have been documented in hepatocellular carcinoma. TERT promoter mutations are the earliest genetic events in the multistep process of hepatocarcinogenesis related to cirrhosis. However, analyses of TERT promoter and CTNNB1 mutations in hepatocellular carcinoma tumor samples have not been performed in the Korean population, where hepatitis B virus-related hepatocellular carcinoma is prevalent. In order to identify the role of TERT promoter and CTNNB1 mutations in the hepatocarcinogenesis and pathogenesis of recurrent hepatocellular carcinoma, we performed the sequence analyses in 140 hepatocellular nodules (including 107 hepatocellular carcinomas), and 8 pairs of matched primary and relapsed hepatocellular carcinomas. TERT promoter and CTNNB1 mutations were only observed in hepatocellular carcinomas but not in precursor lesions. Of 109 patients with hepatocellular carcinoma, 41 (39.0%) and 15 (14.6%) harbored TERT and CTNNB1 mutations, respectively. TERT promotermutations were significantly more frequent in hepatocellular carcinomas related to hepatitis C virus infection (5/6; 83.3%) compared to tumors of other etiologies (P = 0.001). In two cases, discordance in TERT promoter mutation status was observed between the primary and the corresponding recurrent hepatocellular carcinoma. The two patients with discordant cases had early relapses. In conclusion, we identified TERT promoter and CTNNB1 mutations as the most frequent somatic genetic alterations observed in hepatocellular carcinoma, indicating its pivotal role in hepatocarcinogenesis. Furthermore, we suggest the possibility of intratumoral genetic heterogeneity of TERT promoter mutations in hepatocellular carcinoma as indicated by the discordance in TERT promoter mutations between primary and corresponding recurrent hepatocellular carcinoma.
Liu, Liang; Ruiz, Jimmy; O'Neill, Stacey S; Grant, Stefan C; Petty, W Jeffrey; Yang, Meng; Chen, Kexin; Topaloglu, Umit; Pasche, Boris; Zhang, Wei
2018-04-12
Mutations in polymerase ε (POLE) confer favorable prognosis and outcomes in various cancer types, but their role in non-small cell lung cancer (NSCLC) is unknown. Utilizing the data of 513 patients with adenocarcinoma (LUAD) and 497 patients with squamous cell carcinoma (LUSC) from The Cancer Genome Atlas (TCGA) cohort, we tested the prognostic value of POLE mutations and programmed cell death ligand 1 (PD-L1) expression in the two main subtypes of NSCLC. POLE mutation is a favorable biomarker for the improved overall survival (OS) of the LUSC patients (P = 0.033, 28 mutant vs. 469 wildtype patients), but not that of the LUAD patients (P = 0.12, 31 mutant vs. 482 wildtype patients). POLE-mutant LUAD patients with high expression of PD-L1 (Mut-High, n = 6) exhibited improved OS (P = 0.024) when compared to POLE-mutant patients with low PD-L1 expression (Mut-Low, n = 24) and other patients without POLE mutation (n = 476). This benefit was not due to the high content of the tumor infiltrating lymphocytes. Instead, the antitumor immune response was activated in Mut-High patients so that these patients were likely responding more effectively to immuno-oncology (IO) treatments; whereas genes involved with metabolic pathways were enriched in Mut-Low group, which may cause the decreased OS of these patients. Our study sheds light on the molecular basis of NSCLC and adds to our understanding of responses to chemotherapy and IO therapy.
Code of Federal Regulations, 2010 CFR
2010-07-01
..., and port and harbor areas, including vessels and harbor craft therein. 125.15 Section 125.15....15 Access to waterfront facilities, and port and harbor areas, including vessels and harbor craft....09 to those waterfront facilities, and port and harbor areas, including vessels and harbor craft...
Production of infectious chimeric hepatitis C virus genotype 2b harboring minimal regions of JFH-1.
Murayama, Asako; Kato, Takanobu; Akazawa, Daisuke; Sugiyama, Nao; Date, Tomoko; Masaki, Takahiro; Nakamoto, Shingo; Tanaka, Yasuhito; Mizokami, Masashi; Yokosuka, Osamu; Nomoto, Akio; Wakita, Takaji
2012-02-01
To establish a cell culture system for chimeric hepatitis C virus (HCV) genotype 2b, we prepared a chimeric construct harboring the 5' untranslated region (UTR) to the E2 region of the MA strain (genotype 2b) and the region of p7 to the 3' UTR of the JFH-1 strain (genotype 2a). This chimeric RNA (MA/JFH-1.1) replicated and produced infectious virus in Huh7.5.1 cells. Replacement of the 5' UTR of this chimera with that from JFH-1 (MA/JFH-1.2) enhanced virus production, but infectivity remained low. In a long-term follow-up study, we identified a cell culture-adaptive mutation in the core region (R167G) and found that it enhanced virus assembly. We previously reported that the NS3 helicase (N3H) and the region of NS5B to 3' X (N5BX) of JFH-1 enabled replication of the J6CF strain (genotype 2a), which could not replicate in cells. To reduce JFH-1 content in MA/JFH-1.2, we produced a chimeric viral genome for MA harboring the N3H and N5BX regions of JFH-1, combined with a JFH-1 5' UTR replacement and the R167G mutation (MA/N3H+N5BX-JFH1/R167G). This chimeric RNA replicated efficiently, but virus production was low. After the introduction of four additional cell culture-adaptive mutations, MA/N3H+N5BX-JFH1/5am produced infectious virus efficiently. Using this chimeric virus harboring minimal regions of JFH-1, we analyzed interferon sensitivity and found that this chimeric virus was more sensitive to interferon than JFH-1 and another chimeric virus containing more regions from JFH-1 (MA/JFH-1.2/R167G). In conclusion, we established an HCV genotype 2b cell culture system using a chimeric genome harboring minimal regions of JFH-1. This cell culture system may be useful for characterizing genotype 2b viruses and developing antiviral strategies.
The Inherited p53 Mutation in the Brazilian Population.
Achatz, Maria Isabel; Zambetti, Gerard P
2016-12-01
A common criticism of studying rare diseases is the often-limited relevance of the findings to human health. Here, we review ∼15 years of research into an unusual germline TP53 mutation (p.R337H) that began with its detection in children with adrenocortical carcinoma (ACC), a remarkably rare childhood cancer that is associated with poor prognosis. We have come to learn that the p.R337H mutation exists at a very high frequency in Southern and Southeastern Brazil, occurring in one of 375 individuals within a total population of ∼100 million. Moreover, it has been determined that carriers of this founder mutation display variable tumor susceptibility, ranging from isolated cases of pediatric ACC to Li-Fraumeni or Li-Fraumeni-like (LFL) syndromes, thus representing a significant medical issue for this country. Studying the biochemical and molecular consequences of this mutation on p53 tumor-suppressor activity, as well as the putative additional genetic alterations that cooperate with this mutation, is advancing our understanding of how p53 functions in tumor suppression in general. These studies, which originated with a rare childhood tumor, are providing important information for guiding genetic counselors and physicians in treating their patients and are already providing clinical benefit. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.
Gröschel, Stefan; Sanders, Mathijs A.; Hoogenboezem, Remco; Zeilemaker, Annelieke; Havermans, Marije; Erpelinck, Claudia; Bindels, Eric M. J.; Beverloo, H. Berna; Döhner, Hartmut; Löwenberg, Bob; Döhner, Konstanze; Delwel, Ruud
2015-01-01
Myeloid malignancies bearing chromosomal inv(3)/t(3;3) abnormalities are among the most therapy-resistant leukemias. Deregulated expression of EVI1 is the molecular hallmark of this disease; however, the genome-wide spectrum of cooperating mutations in this disease subset has not been systematically elucidated. Here, we show that 98% of inv(3)/t(3;3) myeloid malignancies harbor mutations in genes activating RAS/receptor tyrosine kinase (RTK) signaling pathways. In addition, hemizygous mutations in GATA2, as well as heterozygous alterations in RUNX1, SF3B1, and genes encoding epigenetic modifiers, frequently co-occur with the inv(3)/t(3;3) aberration. Notably, neither mutational patterns nor gene expression profiles differ across inv(3)/t(3;3) acute myeloid leukemia, chronic myeloid leukemia, and myelodysplastic syndrome cases, suggesting recognition of inv(3)/t(3;3) myeloid malignancies as a single disease entity irrespective of blast count. The high incidence of activating RAS/RTK signaling mutations may provide a target for a rational treatment strategy in this high-risk patient group. PMID:25381062
Congenital Heart Disease–Causing Gata4 Mutation Displays Functional Deficits In Vivo
Misra, Chaitali; Sachan, Nita; McNally, Caryn Rothrock; Koenig, Sara N.; Nichols, Haley A.; Guggilam, Anuradha; Lucchesi, Pamela A.; Pu, William T.; Srivastava, Deepak; Garg, Vidu
2012-01-01
Defects of atrial and ventricular septation are the most frequent form of congenital heart disease, accounting for almost 50% of all cases. We previously reported that a heterozygous G296S missense mutation of GATA4 caused atrial and ventricular septal defects and pulmonary valve stenosis in humans. GATA4 encodes a cardiac transcription factor, and when deleted in mice it results in cardiac bifida and lethality by embryonic day (E)9.5. In vitro, the mutant GATA4 protein has a reduced DNA binding affinity and transcriptional activity and abolishes a physical interaction with TBX5, a transcription factor critical for normal heart formation. To characterize the mutation in vivo, we generated mice harboring the same mutation, Gata4 G295S. Mice homozygous for the Gata4 G295S mutant allele have normal ventral body patterning and heart looping, but have a thin ventricular myocardium, single ventricular chamber, and lethality by E11.5. While heterozygous Gata4 G295S mutant mice are viable, a subset of these mice have semilunar valve stenosis and small defects of the atrial septum. Gene expression studies of homozygous mutant mice suggest the G295S protein can sufficiently activate downstream targets of Gata4 in the endoderm but not in the developing heart. Cardiomyocyte proliferation deficits and decreased cardiac expression of CCND2, a member of the cyclin family and a direct target of Gata4, were found in embryos both homozygous and heterozygous for the Gata4 G295S allele. To further define functions of the Gata4 G295S mutation in vivo, compound mutant mice were generated in which specific cell lineages harbored both the Gata4 G295S mutant and Gata4 null alleles. Examination of these mice demonstrated that the Gata4 G295S protein has functional deficits in early myocardial development. In summary, the Gata4 G295S mutation functions as a hypomorph in vivo and leads to defects in cardiomyocyte proliferation during embryogenesis, which may contribute to the development of
Inhibition of Axl improves the targeted therapy against ALK-mutated neuroblastoma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Fei; Li, Hongling; Sun, Yong, E-mail: sunfanqi2010@163.com
2014-11-28
Highlights: • First reported Axl is co-expressed with ALK in neuroblastoma tissues and cell lines. • Axl activation promotes cell growth and impairs the efficiency of ALK inhibitor. • Further found silence of Axl leads to increased sensitivity to ALK inhibitors. • Axl inhibitor promotes the efficiency of targeted therapy in vitro and in vivo. • Axl activation should be considered in the clinical application of ALK inhibitors. - Abstract: Neuroblastoma (NB) patients harboring mutated ALK can be expected to potentially benefit from targeted therapy based on ALK tyrosine kinase inhibitor (TKI), such as crizotinib and ceritinib. However, the effectmore » of the treatment varies with different individuals, although with the same genic changes. Axl receptor tyrosine kinase is expressed in a variety of human cancers, but little data are reported in NB, particularly in which carrying mutated ALK. In this study, we focus on the roles of Axl in ALK-mutated NB for investigating rational therapeutic strategy. We found that Axl is expressed in ALK-positive NB tissues and cell lines, and could be effectively activated by its ligand GAS6. Ligand-dependent Axl activation obviously rescued crizotinib-mediated suppression of cell proliferation in ALK-mutated NB cells. Genetic inhibition of Axl with specific small interfering RNA markedly increased the sensitivity of cells to ALK-TKIs. Furthermore, a small-molecule inhibitor of Axl significantly enhanced ALK-targeted therapy, as an increased frequency of apoptosis was observed in NB cells co-expressing ALK and Axl. Taken together, our results demonstrated that activation of Axl could lead to insensitivity to ALK inhibitors, and dual inhibition of ALK and Axl might be a potential therapeutic strategy against ALK-mutated NB.« less
Clonal and microclonal mutational heterogeneity in high hyperdiploid acute lymphoblastic leukemia
de Smith, Adam J.; Ojha, Juhi; Francis, Stephen S.; Sanders, Erica; Endicott, Alyson A.; Hansen, Helen M.; Smirnov, Ivan; Termuhlen, Amanda M.; Walsh, Kyle M.; Metayer, Catherine; Wiemels, Joseph L.
2016-01-01
High hyperdiploidy (HD), the most common cytogenetic subtype of B-cell acute lymphoblastic leukemia (B-ALL), is largely curable but significant treatment-related morbidity warrants investigating the biology and identifying novel drug targets. Targeted deep-sequencing of 538 cancer-relevant genes was performed in 57 HD-ALL patients lacking overt KRAS and NRAS hotspot mutations and lacking common B-ALL deletions to enrich for discovery of novel driver genes. One-third of patients harbored damaging mutations in epigenetic regulatory genes, including the putative novel driver DOT1L (n=4). Receptor tyrosine kinase (RTK)/Ras/MAPK signaling pathway mutations were found in two-thirds of patients, including novel mutations in ROS1, which mediates phosphorylation of the PTPN11-encoded protein SHP2. Mutations in FLT3 significantly co-occurred with DOT1L (p=0.04), suggesting functional cooperation in leukemogenesis. We detected an extraordinary level of tumor heterogeneity, with microclonal (mutant allele fraction <0.10) KRAS, NRAS, FLT3, and/or PTPN11 hotspot mutations evident in 31/57 (54.4%) patients. Multiple KRAS and NRAS codon 12 and 13 microclonal mutations significantly co-occurred within tumor samples (p=4.8×10−4), suggesting ongoing formation of and selection for Ras-activating mutations. Future work is required to investigate whether tumor microheterogeneity impacts clinical outcome and to elucidate the functional consequences of epigenetic dysregulation in HD-ALL, potentially leading to novel therapeutic approaches. PMID:27683039
Xu, Li; Ji, Jin-Jun; Le, Wangping; Xu, Yan S; Dou, Dandan; Pan, Jieli; Jiao, Yifeng; Zhong, Tianfei; Wu, Dehong; Wang, Yumei; Wen, Chengping; Xie, Guan-Qun; Yao, Feng; Zhao, Heng; Fan, Yong-Sheng; Chin, Y Eugene
2015-10-15
Cytokine or growth factor activated STAT3 undergoes multiple post-translational modifications, dimerization and translocation into nuclei, where it binds to serum-inducible element (SIE, 'TTC(N3)GAA')-bearing promoters to activate transcription. The STAT3 DNA binding domain (DBD, 320-494) mutation in hyper immunoglobulin E syndrome (HIES), called the HIES mutation (R382Q, R382W or V463Δ), which elevates IgE synthesis, inhibits SIE binding activity and sensitizes genes such as TNF-α for expression. However, the mechanism by which the HIES mutation sensitizes STAT3 in gene induction remains elusive. Here, we report that STAT3 binds directly to the AGG-element with the consensus sequence 'AGG(N3)AGG'. Surprisingly, the helical N-terminal region (1-355), rather than the canonical STAT3 DBD, is responsible for AGG-element binding. The HIES mutation markedly enhances STAT3 AGG-element binding and AGG-promoter activation activity. Thus, STAT3 is a dual specificity transcription factor that promotes gene expression not only via SIE- but also AGG-promoter activity. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Yang, Chih-Jen; Hung, Jen-Yu; Tsai, Ming-Ju; Wu, Kuan-Li; Liu, Ta-Chih; Chou, Shah-Hwa; Lee, Jui-Ying; Hsu, Jui-Sheng; Huang, Ming-Shyan; Chong, Inn-Wen
2017-05-10
Epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) such as gefitinib can provide better efficacy and prolonged progression free survival (PFS) than cytotoxic chemotherapy for metastatic lung non-squamous cell carcinoma harboring susceptible EGFR mutations when used as first-line therapy. Cytotoxic chemotherapy is regarded as being the standard therapy to overcome acquired resistance to an initial EGFR TKI. However, there is currently no consensus on how best to treat patients who develop resistance to both an initial EGFR TKI and chemotherapy. We enrolled stage IV lung adenocarcinoma patients with an EGFR mutation and who had developed acquired resistance to gefitinib and cytotoxic chemotherapy from two university-affiliated hospitals in Taiwan from June 2011 to December 2014. Basic demographic data, included Eastern Cooperative Oncology Group (ECOG) performance status were collected, and the response rate, progression-free survival (PFS) and overall survival (OS) were analyzed. Two hundred and nine patients with mutated EGFR and who took gefitinib as the first-line therapy were identified in the study period, of whom 86 received second-line cytotoxic chemotherapy, and 60 who received third-line therapy were eligible for this study. The patients who received cytotoxic chemotherapy had a significantly higher disease control rate than those who received erlotinib (73% vs. 46%, p = 0.0363), however there were no significant differences in PFS (2.9 months vs. 3.1 months, p = 0.9049) and OS (8.9 months vs. 7.9 months, p = 0.4956). Platinum- or pemetrexed-based chemotherapy provided similar PFS and OS as others did. The only significant poor prognostic factors for OS were old age (≥65 years) (HR = 5.97 [2.65-13.44], p < 0.0001) and poor performance status (ECOG ≥2) (HR = 5.84 [2.61-13.09], p < 0.0001). Retreatment with an EGFR TKI is not inferior to cytotoxic chemotherapy when used as salvage therapy for patients
Guerrini, Valentina; Subbian, Selvakumar; Santucci, Pierre; Canaan, Stéphane; Gennaro, Maria Laura; Pozzi, Gianni
2016-01-01
Isolates of the human pathogen Mycobacterium tuberculosis recovered from clinical samples exhibit genetic heterogeneity. Such variation may result from the stressful environment encountered by the pathogen inside the macrophage, which is the host cell tubercle bacilli parasitize. To study the evolution of the M. tuberculosis genome during growth inside macrophages, we developed a model of intracellular culture in which bacteria were serially passaged in macrophage-like THP-1 cells for about 80 bacterial generations. Genome sequencing of single bacterial colonies isolated before and after the infection cycles revealed that M. tuberculosis developed mutations at a rate of about 5.7 × 10-9 / bp/ generation, consistent with mutation rates calculated during in vivo infection. Analysis of mutant growth in macrophages and in mice showed that the mutations identified after the cyclic infection conferred no advantage to the mutants relative to wild-type. Furthermore, activity testing of the recombinant protein harboring one of these mutations showed that the presence of the mutation did not affect the enzymatic activity. The serial infection protocol developed in this work to study M. tuberculosis genome microevolution can be applied to exposure to stressors to determine their effect on genome remodeling during intra-macrophage growth.
Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat
2008-05-01
Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.
E2F1 somatic mutation within miRNA target site impairs gene regulation in colorectal cancer.
Lopes-Ramos, Camila M; Barros, Bruna P; Koyama, Fernanda C; Carpinetti, Paola A; Pezuk, Julia; Doimo, Nayara T S; Habr-Gama, Angelita; Perez, Rodrigo O; Parmigiani, Raphael B
2017-01-01
Genetic studies have largely concentrated on the impact of somatic mutations found in coding regions, and have neglected mutations outside of these. However, 3' untranslated regions (3' UTR) mutations can also disrupt or create miRNA target sites, and trigger oncogene activation or tumor suppressor inactivation. We used next-generation sequencing to widely screen for genetic alterations within predicted miRNA target sites of oncogenes associated with colorectal cancer, and evaluated the functional impact of a new somatic mutation. Target sequencing of 47 genes was performed for 29 primary colorectal tumor samples. For 71 independent samples, Sanger methodology was used to screen for E2F1 mutations in miRNA predicted target sites, and the functional impact of these mutations was evaluated by luciferase reporter assays. We identified germline and somatic alterations in E2F1. Of the 100 samples evaluated, 3 had germline alterations at the MIR205-5p target site, while one had a somatic mutation at MIR136-5p target site. E2F1 gene expression was similar between normal and tumor tissues bearing the germline alteration; however, expression was increased 4-fold in tumor tissue that harbored a somatic mutation compared to that in normal tissue. Luciferase reporter assays revealed both germline and somatic alterations increased E2F1 activity relative to wild-type E2F1. We demonstrated that somatic mutation within E2F1:MIR136-5p target site impairs miRNA-mediated regulation and leads to increased gene activity. We conclude that somatic mutations that disrupt miRNA target sites have the potential to impact gene regulation, highlighting an important mechanism of oncogene activation.
Detecting recurrent gene mutation in interaction network context using multi-scale graph diffusion.
Babaei, Sepideh; Hulsman, Marc; Reinders, Marcel; de Ridder, Jeroen
2013-01-23
Delineating the molecular drivers of cancer, i.e. determining cancer genes and the pathways which they deregulate, is an important challenge in cancer research. In this study, we aim to identify pathways of frequently mutated genes by exploiting their network neighborhood encoded in the protein-protein interaction network. To this end, we introduce a multi-scale diffusion kernel and apply it to a large collection of murine retroviral insertional mutagenesis data. The diffusion strength plays the role of scale parameter, determining the size of the network neighborhood that is taken into account. As a result, in addition to detecting genes with frequent mutations in their genomic vicinity, we find genes that harbor frequent mutations in their interaction network context. We identify densely connected components of known and putatively novel cancer genes and demonstrate that they are strongly enriched for cancer related pathways across the diffusion scales. Moreover, the mutations in the clusters exhibit a significant pattern of mutual exclusion, supporting the conjecture that such genes are functionally linked. Using multi-scale diffusion kernel, various infrequently mutated genes are found to harbor significant numbers of mutations in their interaction network neighborhood. Many of them are well-known cancer genes. The results demonstrate the importance of defining recurrent mutations while taking into account the interaction network context. Importantly, the putative cancer genes and networks detected in this study are found to be significant at different diffusion scales, confirming the necessity of a multi-scale analysis.
Somatic USP8 Gene Mutations Are a Common Cause of Pediatric Cushing Disease.
Faucz, Fabio R; Tirosh, Amit; Tatsi, Christina; Berthon, Annabel; Hernández-Ramírez, Laura C; Settas, Nikolaos; Angelousi, Anna; Correa, Ricardo; Papadakis, Georgios Z; Chittiboina, Prashant; Quezado, Martha; Pankratz, Nathan; Lane, John; Dimopoulos, Aggeliki; Mills, James L; Lodish, Maya; Stratakis, Constantine A
2017-08-01
Somatic mutations in the ubiquitin-specific protease 8 (USP8) gene have been recently identified as the most common genetic alteration in patients with Cushing disease (CD). However, the frequency of these mutations in the pediatric population has not been extensively assessed. We investigated the status of the USP8 gene at the somatic level in a cohort of pediatric patients with corticotroph adenomas. The USP8 gene was fully sequenced in both germline and tumor DNA samples from 42 pediatric patients with CD. Clinical, biochemical, and imaging data were compared between patients with and without somatic USP8 mutations. Five different USP8 mutations (three missense, one frameshift, and one in-frame deletion) were identified in 13 patients (31%), all of them located in exon 14 at the previously described mutational hotspot, affecting the 14-3-3 binding motif of the protein. Patients with somatic mutations were older at disease presentation [mean 5.1 ± 2.1 standard deviation (SD) vs 13.1 ± 3.6 years, P = 0.03]. Levels of urinary free cortisol, midnight serum cortisol, and adrenocorticotropic hormone, as well as tumor size and frequency of invasion of the cavernous sinus, were not significantly different between the two groups. However, patients harboring somatic USP8 mutations had a higher likelihood of recurrence compared with patients without mutations (46.2% vs 10.3%, P = 0.009). Somatic USP8 gene mutations are a common cause of pediatric CD. Patients harboring a somatic mutation had a higher likelihood of tumor recurrence, highlighting the potential importance of this molecular defect for the disease prognosis and the development of targeted therapeutic options. Copyright © 2017 Endocrine Society
Activating ESR1 Mutations Differentially Affect the Efficacy of ER Antagonists.
Toy, Weiyi; Weir, Hazel; Razavi, Pedram; Lawson, Mandy; Goeppert, Anne U; Mazzola, Anne Marie; Smith, Aaron; Wilson, Joanne; Morrow, Christopher; Wong, Wai Lin; De Stanchina, Elisa; Carlson, Kathryn E; Martin, Teresa S; Uddin, Sharmeen; Li, Zhiqiang; Fanning, Sean; Katzenellenbogen, John A; Greene, Geoffrey; Baselga, José; Chandarlapaty, Sarat
2017-03-01
Recent studies have identified somatic ESR1 mutations in patients with metastatic breast cancer and found some of them to promote estrogen-independent activation of the receptor. The degree to which all recurrent mutants can drive estrogen-independent activities and reduced sensitivity to ER antagonists like fulvestrant is not established. In this report, we characterize the spectrum of ESR1 mutations from more than 900 patients. ESR1 mutations were detected in 10%, with D538G being the most frequent (36%), followed by Y537S (14%). Several novel, activating mutations were also detected (e.g., L469V, V422del, and Y537D). Although many mutations lead to constitutive activity and reduced sensitivity to ER antagonists, only select mutants such as Y537S caused a magnitude of change associated with fulvestrant resistance in vivo Correspondingly, tumors driven by Y537S, but not D5358G, E380Q, or S463P, were less effectively inhibited by fulvestrant than more potent and bioavailable antagonists, including AZD9496. These data point to a need for antagonists with optimal pharmacokinetic properties to realize clinical efficacy against certain ESR1 mutants. Significance: A diversity of activating ESR1 mutations exist, only some of which confer resistance to existing ER antagonists that might be overcome by next-generation inhibitors such as AZD9496. Cancer Discov; 7(3); 277-87. ©2016 AACR. This article is highlighted in the In This Issue feature, p. 235 . ©2016 American Association for Cancer Research.
Multiple Hotspot Mutations Scanning by Single Droplet Digital PCR.
Decraene, Charles; Silveira, Amanda B; Bidard, François-Clément; Vallée, Audrey; Michel, Marc; Melaabi, Samia; Vincent-Salomon, Anne; Saliou, Adrien; Houy, Alexandre; Milder, Maud; Lantz, Olivier; Ychou, Marc; Denis, Marc G; Pierga, Jean-Yves; Stern, Marc-Henri; Proudhon, Charlotte
2018-02-01
Progress in the liquid biopsy field, combined with the development of droplet digital PCR (ddPCR), has enabled noninvasive monitoring of mutations with high detection accuracy. However, current assays detect a restricted number of mutations per reaction. ddPCR is a recognized method for detecting alterations previously characterized in tumor tissues, but its use as a discovery tool when the mutation is unknown a priori remains limited. We established 2 ddPCR assays detecting all genomic alterations within KRAS exon 2 and EGFR exon 19 mutation hotspots, which are of clinical importance in colorectal and lung cancer, with use of a unique pair of TaqMan ® oligoprobes. The KRAS assay scanned for the 7 most common mutations in codons 12/13 but also all other mutations found in that region. The EGFR assay screened for all in-frame deletions of exon 19, which are frequent EGFR-activating events. The KRAS and EGFR assays were highly specific and both reached a limit of detection of <0.1% in mutant allele frequency. We further validated their performance on multiple plasma and formalin-fixed and paraffin-embedded tumor samples harboring a panel of different KRAS or EGFR mutations. This method presents the advantage of detecting a higher number of mutations with single-reaction ddPCRs while consuming a minimum of patient sample. This is particularly useful in the context of liquid biopsy because the amount of circulating tumor DNA is often low. This method should be useful as a discovery tool when the tumor tissue is unavailable or to monitor disease during therapy. © 2017 American Association for Clinical Chemistry.
Lee, Yi-Chung; Chung, Chih-Ping; Chao, Nai-Chen; Fuh, Jong-Ling; Chang, Feng-Chi; Soong, Bing-Wing; Liao, Yi-Chu
2018-07-01
Homozygous and compound heterozygous mutations in the high temperature requirement serine peptidase A1 gene ( HTRA1 ) cause cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy. However, heterozygous HTRA1 mutations were recently identified to be associated with autosomal dominant cerebral small vessel disease (SVD). The present study aims at investigating the clinical features, frequency, and spectrum of HTRA1 mutations in a Taiwanese cohort with SVD. Mutational analyses of HTRA1 were performed by Sanger sequencing in 222 subjects, selected from a cohort of 337 unrelated patients with SVD after excluding those harboring a NOTCH3 mutation. The influence of these mutations on HTRA1 protease activities was characterized. Seven novel heterozygous mutations in HTRA1 were identified, including p.Gly120Asp, p.Ile179Asn, p.Ala182Profs*33, p.Ile256Thr, p.Gly276Ala, p.Gln289Ter, and p.Asn324Thr, and each was identified in 1 single index patient. All mutations significantly compromise the HTRA1 protease activities. For the 7 index cases and another 2 affected siblings carrying a heterozygous HTRA1 mutation, the common clinical presentations include lacunar infarction, intracerebral hemorrhage, cognitive decline, and spondylosis at the fifth to sixth decade of life. Among the 9 patients, 4 have psychiatric symptoms as delusion, depression, and compulsive behavior, 3 have leukoencephalopathy in anterior temporal poles, and 2 patients have alopecia. Heterozygous HTRA1 mutations account for 2.08% (7 of 337) of SVD in Taiwan. The clinical and neuroradiological features of HTRA1 -related SVD and sporadic SVD are similar. These findings broaden the mutational spectrum of HTRA1 and highlight the pathogenic role of heterozygous HTRA1 mutations in SVD. © 2018 American Heart Association, Inc.
Software and database for the analysis of mutations in the human FBN1 gene.
Collod, G; Béroud, C; Soussi, T; Junien, C; Boileau, C
1996-01-01
Fibrillin is the major component of extracellular microfibrils. Mutations in the fibrillin gene on chromosome 15 (FBN1) were described at first in the heritable connective tissue disorder, Marfan syndrome (MFS). More recently, FBN1 has also been shown to harbor mutations related to a spectrum of conditions phenotypically related to MFS and many mutations will have to be accumulated before genotype/phenotype relationships emerge. To facilitate mutational analysis of the FBN1 gene, a software package along with a computerized database (currently listing 63 entries) have been created. PMID:8594563
Li, Jin-Rui; Zhang, Ye; Zheng, Jia-Lian
2016-07-01
The brain is a metastatic organ that is most prone to lung adenocarcinoma (LAC). However, the prognosis of patients with brain metastasis remains very poor. In this study, we evaluated the efficacy of icotinib plus whole brain radiation therapy (WBRT) for treating patients with brain metastasis from epidermal growth factor receptor (EGFR)-mutated LAC. All patients received standard WBRT administered to the whole brain in 30 Gy in 10 daily fractions. Each patient was also instructed to take 125 mg icotinib thrice per day beginning from the first day of the WBRT. After completing the WBRT, maintenance icotinib was administered until the disease progressed or intolerable adverse effects were observed. Cranial progression-free survival (CPFS) and overall survival (OS) times were the primary endpoints. A total of 43 patients were enrolled in this study. Two patients (4.7%) presented a complete response (CR), whereas 20 patients (46.5%) presented a partial response (PR). The median CPFS and OS times were 11.0 and 15.0 months, respectively. The one-year CPFS rate was 40.0% for the patients harboring EGFR exon 19 deletion and 16.7% for the patients with EGFR exon 21 L858R (P=0.027). The concurrent administration of icotinib and WBRT exhibited favorable effects on the patients with brain metastasis. EGFR exon 19 deletion was predictive of a long CPFS following icotinib plus WBRT.
Two novel ALK mutations mediate acquired resistance to the next generation ALK inhibitor alectinib
Katayama, Ryohei; Friboulet, Luc; Koike, Sumie; Lockerman, Elizabeth L.; Khan, Tahsin M.; Gainor, Justin F.; Iafrate, A. John; Takeuchi, Kengo; Taiji, Makoto; Okuno, Yasushi; Fujita, Naoya; Engelman, Jeffrey A.; Shaw, Alice T.
2014-01-01
Purpose The first-generation ALK tyrosine kinase inhibitor (TKI) crizotinib is a standard therapy for patients with ALK-rearranged NSCLC. Several next-generation ALK-TKIs have entered the clinic and have shown promising activity in crizotinib-resistant patients. As patients still relapse even on these next-generation ALK-TKIs, we examined mechanisms of resistance to the next-generation ALK-TKI alectinib and potential strategies to overcome this resistance. Experimental Design We established a cell line model of alectinib resistance, and analyzed a resistant tumor specimen from a patient who had relapsed on alectinib. We developed Ba/F3 models harboring alectinib-resistant ALK mutations and evaluated the potency of other next-generation ALK-TKIs in these models. We tested the antitumor activity of the next-generation ALK-TKI ceritinib in the patient with acquired resistance to alectinib. To elucidate structure-activity-relationships of ALK mutations, we performed computational thermodynamic simulation with MP-CAFEE. Results We identified a novel V1180L gatekeeper mutation from the cell line model and a second novel I1171T mutation from the patient who developed resistance to alectinib. Both ALK mutations conferred resistance to alectinib as well as to crizotinib, but were sensitive to ceritinib and other next-generation ALK-TKIs. Treatment of the patient with ceritinib led to a marked response. Thermodynamics simulation suggests that both mutations lead to distinct structural alterations that decrease the binding affinity with alectinib. Conclusions We have identified two novel ALK mutations arising after alectinib exposure which are sensitive to other next generation ALK-TKIs. The ability of ceritinib to overcome alectinib-resistance mutations suggests a potential role for sequential therapy with multiple next-generation ALK-TKIs. PMID:25228534
Two novel ALK mutations mediate acquired resistance to the next-generation ALK inhibitor alectinib.
Katayama, Ryohei; Friboulet, Luc; Koike, Sumie; Lockerman, Elizabeth L; Khan, Tahsin M; Gainor, Justin F; Iafrate, A John; Takeuchi, Kengo; Taiji, Makoto; Okuno, Yasushi; Fujita, Naoya; Engelman, Jeffrey A; Shaw, Alice T
2014-11-15
The first-generation ALK tyrosine kinase inhibitor (TKI) crizotinib is a standard therapy for patients with ALK-rearranged non-small cell lung cancer (NSCLC). Several next-generation ALK-TKIs have entered the clinic and have shown promising activity in crizotinib-resistant patients. As patients still relapse even on these next-generation ALK-TKIs, we examined mechanisms of resistance to the next-generation ALK-TKI alectinib and potential strategies to overcome this resistance. We established a cell line model of alectinib resistance, and analyzed a resistant tumor specimen from a patient who had relapsed on alectinib. We developed Ba/F3 models harboring alectinib-resistant ALK mutations and evaluated the potency of other next-generation ALK-TKIs in these models. We tested the antitumor activity of the next-generation ALK-TKI ceritinib in the patient with acquired resistance to alectinib. To elucidate structure-activity relationships of ALK mutations, we performed computational thermodynamic simulation with MP-CAFEE. We identified a novel V1180L gatekeeper mutation from the cell line model and a second novel I1171T mutation from the patient who developed resistance to alectinib. Both ALK mutations conferred resistance to alectinib as well as to crizotinib, but were sensitive to ceritinib and other next-generation ALK-TKIs. Treatment of the patient with ceritinib led to a marked response. Thermodynamics simulation suggests that both mutations lead to distinct structural alterations that decrease the binding affinity with alectinib. We have identified two novel ALK mutations arising after alectinib exposure that are sensitive to other next-generation ALK-TKIs. The ability of ceritinib to overcome alectinib-resistance mutations suggests a potential role for sequential therapy with multiple next-generation ALK-TKIs. ©2014 American Association for Cancer Research.
TERT promoter mutations in thyroid cancer: a report from a Middle Eastern population.
Qasem, Ebtesam; Murugan, Avaniyapuram Kannan; Al-Hindi, Hindi; Xing, Mingzhao; Almohanna, Mai; Alswailem, Meshael; Alzahrani, Ali S
2015-12-01
Telomerase reverse transcriptase (TERT) promoter mutations C228T and C250T have recently been described in follicular cell-derived thyroid cancer (TC) in patients from North America and Europe. In this study, we explored whether these findings could be replicated in patients from a different ethnic group. We screened 17 benign thyroid adenomas and 265 TC samples from patients in the Middle East for these mutations by PCR and direct sequencing using DNA isolated from paraffin-embedded tumor tissues. None of the 17 benign adenomas harbored TERT promoter mutations. Of 265 TC, 34 (12.8%) harbored TERT promoter mutations, including 10/153 (6.5%) conventional papillary TC (CPTC), 8/57 (14.0%) follicular variant PTC, 9/30 (30%) tall cell variant PTC, 1/3 (30%) Hurthle cell thyroid cancer (HTC), 1/5 (20%) follicular TC, and 5/13 (38.5%) poorly differentiated TC. C250T mutation was present in only 6/265 (2.3%) cases, while C228T mutation was present in a total of 28/265 (10.6%) cases. These two mutations were mutually exclusive. TERT promoter mutations were significantly more common in older (≥45 years) than younger patients and were associated with larger tumour size, vascular invasion, higher TNM stage (stage III and IV), BRAF(V600E) mutation and persistent/recurrent disease at 6-12 months after initial treatment and at the last follow up. These associations were stronger in non-CPTC. Thus, this study on a large cohort of TC patients from Middle East demonstrates that TERT promoter mutations are relatively common, especially in the non-CPTC, and are associated with more aggressive histopathological features, BRAF(V600E) mutation, and disease persistence/recurrence than the WT TERT. © 2015 Society for Endocrinology.
AIP mutations in Brazilian patients with sporadic pituitary adenomas: a single-center evaluation
Kasuki, Leandro; de Azeredo Lima, Carlos Henrique; Ogino, Liana; Camacho, Aline H S; Chimelli, Leila; Korbonits, Márta
2017-01-01
Aryl hydrocarbon receptor-interacting protein (AIP) gene mutations (AIPmut) are the most frequent germline mutations found in apparently sporadic pituitary adenomas (SPA). Our aim was to evaluate the frequency of AIPmut among young Brazilian patients with SPA. We performed an observational cohort study between 2013 and 2016 in a single referral center. AIPmut screening was carried out in 132 SPA patients with macroadenomas diagnosed up to 40 years or in adenomas of any size diagnosed until 18 years of age. Twelve tumor samples were also analyzed. Leukocyte DNA and tumor tissue DNA were sequenced for the entire AIP-coding region for evaluation of mutations. Eleven (8.3%) of the 132 patients had AIPmut, comprising 9/74 (12%) somatotropinomas, 1/38 (2.6%) prolactinoma, 1/10 (10%) corticotropinoma and no non-functioning adenomas. In pediatric patients (≤18 years), AIPmut frequency was 13.3% (2/15). Out of the 5 patients with gigantism, two had AIPmut, both truncating mutations. The Y268* mutation was described in Brazilian patients and the K273Rfs*30 mutation is a novel mutation in our patient. No somatic AIP mutations were found in the 12 tumor samples. A tumor sample from an acromegaly patient harboring the A299V AIPmut showed loss of heterozygosity. In conclusion, AIPmut frequency in SPA Brazilian patients is similar to other populations. Our study identified two mutations exclusively found in Brazilians and also shows, for the first time, loss of heterozygosity in tumor DNA from an acromegaly patient harboring the A299V AIPmut. Our findings corroborate previous observations that AIPmut screening should be performed in young patients with SPA. PMID:29074612
Wong, Chi Wai; Or, Penelope Mei Yu; Wang, Yubing; Li, Lisha; Li, Jing; Yan, Mingfei; Cao, Ye; Luk, Ho Ming; Tong, Tony Ming For; Leslie, Nick R; Lo, Ivan Fai-Man; Choy, Kwong Wai; Chan, Andrew Man Lok
2018-04-02
patients harboring autistic features with gross overgrowth symptoms. Detailed characterization of a PTEN mutation revealed reduced protein stability as one of the underlying mechanisms responsible for reduced PTEN activity. © 2018 The Authors Autism Research published by International Society for Autism Research and Wiley Periodicals, Inc.
Reeves, Michelle D; Yawitch, Tali M; van der Merwe, Nerina C; van den Berg, Hester J; Dreyer, Greta; van Rensburg, Elizabeth J
2004-07-10
Germ-line mutations within BRCA1 are responsible for different proportions of inherited susceptibility to breast/ovarian cancer, and the spectrum of mutations within this gene is often unique to certain populations. At this time, there have been no reports regarding the role of BRCA1 in South African breast and/or ovarian cancer families. We therefore screened 90 South African breast/ovarian cancer families for BRCA1 mutations by means of PCR-based mutation detection assays. Eighteen families (20%) were identified with BRCA1 disease-causing mutations. Four Ashkenazi Jewish families were identified with the 185delAG mutation, whereas 2 Afrikaner and 1 Ashkenazi Jewish family were found to harbor the 5382insC mutation. Five of the families (5.56%), all of whom are Afrikaners, were found to carry the novel E881X mutation. Genotype analyses show that these patients share a common ancestor. Genealogic studies have identified 3 possible founding couples for this mutation, all of whom arrived in the Cape from France in the late 1600s. Of the remaining mutations detected, 3 have not been reported previously and include the S451X, 1493delC (detected twice) and 4957insC mutations. Copyright 2004 Wiley-Liss, Inc.
Biallelic Mutations in DNAJC12 Cause Hyperphenylalaninemia, Dystonia, and Intellectual Disability.
Anikster, Yair; Haack, Tobias B; Vilboux, Thierry; Pode-Shakked, Ben; Thöny, Beat; Shen, Nan; Guarani, Virginia; Meissner, Thomas; Mayatepek, Ertan; Trefz, Friedrich K; Marek-Yagel, Dina; Martinez, Aurora; Huttlin, Edward L; Paulo, Joao A; Berutti, Riccardo; Benoist, Jean-François; Imbard, Apolline; Dorboz, Imen; Heimer, Gali; Landau, Yuval; Ziv-Strasser, Limor; Malicdan, May Christine V; Gemperle-Britschgi, Corinne; Cremer, Kirsten; Engels, Hartmut; Meili, David; Keller, Irene; Bruggmann, Rémy; Strom, Tim M; Meitinger, Thomas; Mullikin, James C; Schwartz, Gerard; Ben-Zeev, Bruria; Gahl, William A; Harper, J Wade; Blau, Nenad; Hoffmann, Georg F; Prokisch, Holger; Opladen, Thomas; Schiff, Manuel
2017-02-02
Phenylketonuria (PKU, phenylalanine hydroxylase deficiency), an inborn error of metabolism, can be detected through newborn screening for hyperphenylalaninemia (HPA). Most individuals with HPA harbor mutations in the gene encoding phenylalanine hydroxylase (PAH), and a small proportion (2%) exhibit tetrahydrobiopterin (BH 4 ) deficiency with additional neurotransmitter (dopamine and serotonin) deficiency. Here we report six individuals from four unrelated families with HPA who exhibited progressive neurodevelopmental delay, dystonia, and a unique profile of neurotransmitter deficiencies without mutations in PAH or BH 4 metabolism disorder-related genes. In these six affected individuals, whole-exome sequencing (WES) identified biallelic mutations in DNAJC12, which encodes a heat shock co-chaperone family member that interacts with phenylalanine, tyrosine, and tryptophan hydroxylases catalyzing the BH 4 -activated conversion of phenylalanine into tyrosine, tyrosine into L-dopa (the precursor of dopamine), and tryptophan into 5-hydroxytryptophan (the precursor of serotonin), respectively. DNAJC12 was undetectable in fibroblasts from the individuals with null mutations. PAH enzyme activity was reduced in the presence of DNAJC12 mutations. Early treatment with BH 4 and/or neurotransmitter precursors had dramatic beneficial effects and resulted in the prevention of neurodevelopmental delay in the one individual treated before symptom onset. Thus, DNAJC12 deficiency is a preventable and treatable cause of intellectual disability that should be considered in the early differential diagnosis when screening results are positive for HPA. Sequencing of DNAJC12 may resolve any uncertainty and should be considered in all children with unresolved HPA. Copyright © 2017 American Society of Human Genetics. All rights reserved.
Canna, Scott W.; de Jesus, Adriana Almeida; Gouni, Sushanth; Brooks, Stephen R.; Marrero, Bernadette; Liu, Yin; DiMattia, Michael A.; Zaal, Kristien J.M.; Montealegre Sanchez, Gina A.; Kim, Hanna; Chapelle, Dawn; Plass, Nicole; Huang, Yan; Villarino, Alejandro V.; Biancotto, Angelique; Fleisher, Thomas A.; Duncan, Joseph A.; O’Shea, John J; Benseler, Susanne; Grom, Alexei; Deng, Zuoming; Laxer, Ronald M; Goldbach-Mansky, Raphaela
2014-01-01
Inflammasomes are innate immune sensors that respond to pathogen and damage-associated signals with caspase-1 activation, IL-1β and IL-18 secretion, and macrophage pyroptosis. The discovery that dominant gain-of-function mutations in NLRP3 cause the Cryopyrin Associated Periodic Syndromes (CAPS) and trigger spontaneous inflammasome activation and IL-1β oversecretion, led to successful treatment with IL-1 blocking agents1. Herein, we report a de novo missense mutation, c.1009A>T, p.Thr337Ser, in the nucleotide-binding domain of inflammasome component NLRC4 (IPAF/CARD12) that causes early-onset recurrent fever flares and Macrophage Activation Syndrome (MAS). Functional analyses demonstrated spontaneous inflammasome formation and production of the inflammasome-dependent cytokines IL-1β and IL-18, the latter exceeding levels in CAPS. The NLRC4 mutation caused constitutive caspase-1 cleavage in transduced cells and increased production of IL-18 by both patient and NLRC4 mutant macrophages. Thus, we describe a novel monoallelic inflammasome defect that expands the monogenic autoinflammatory disease spectrum to include MAS and suggests novel targets for therapy. PMID:25217959
KIT mutations in Russian patients with mucosal melanoma.
Abysheva, Svetlana N; Iyevleva, Aglaya G; Efimova, Nina V; Mokhina, Yulia B; Sabirova, Feruza A; Ivantsov, Alexandr O; Artemieva, Anna S; Togo, Alexandr V; Moiseyenko, Vladimir M; Matsko, Dmitry E; Imyanitov, Evgeny N
2011-12-01
A single institution series of 48 mucosal melanomas (MMs) has been analyzed for the presence of KIT mutations using high-resolution melting and sequencing of abnormally melted DNA fragments. The analysis of exons 9, 11, 13, and 17 has revealed eight of 48 (17%) nonsynonymous alterations, including zero of seven head and neck, six of 24 anorectal, one of 15 genitourinary, one of one gastric, and zero of one mediastinal MMs. Seven of these mutations were potentially associated with the tumor sensitivity to KIT tyrosine kinase inhibitors. One tumor harbored somatically acquired silent nucleotide substitution c.1383A>G (T461T). This study adds to the evidence that a substantial portion of MMs carry a therapeutically relevant mutation in the KIT oncogene.
NASA Astrophysics Data System (ADS)
Dalai, Banzragch; Ishiga, Hiroaki
2014-05-01
Large-scale harbor and settlement sites from the latter half of the eleventh through sixteenth centuries have recently been discovered in the northern part of Masuda City, Shimane Prefecture, Japan. The sites were constructed at the river mouth delta of the Takatsu and Masuda rivers, facing the Sea of Japan. In former time, the mouths of the two rivers are thought to have formed a shallow lagoon connecting with the Sea of Japan. The harbor was thus well located for ships sailing along the sea coast, especially for conducting trade with the China mainland and the Korean peninsula. Archaeological investigations have identified over 800 construction pits, blacksmith hearths, harbor structures and numerous fragments of ceramic porcelain originating both from within Japan and from Asia (China, Korea, Vietnam and Thailand). It seems that the maritime trade network operated from this Medieval harbor site by the Masuda Clan was on an East Asian scale. Consequently, the harbor site can be expected to have received a considerable amount of ancient anthropogenic matter. Concentrations of 22 elements in 66 soil samples from the Nakazu Higashihara site were determined by X-ray fluorescence spectroscopy, in order to identify the land use and human impacts on soil chemistry at the harbor site. The results show that significant differences in geochemical compositional exist between the northern and southern parts of the site due to differences in lithology and land use practice. The south area was a production area of this harbor site. Three different activity areas were recognized within this area (fire pit and charcoal area, building pillars, and a blacksmith furnace area), based on geochemical and archaeological information. Cluster analysis shows a strong relationship exists between As, Pb, Cu, Br, TS, MnO and P2O5 in the fire pit and charcoal area. These charcoal materials were likely derived from fuel used in firing and heating. Close relationships occur between Cr, Sr, Sc
BRAF V600E mutations in papillary craniopharyngioma
Brastianos, Priscilla K.; Santagata, Sandro
2016-01-01
Papillary craniopharyngioma is an intracranial tumor that results in high levels of morbidity. We recently demonstrated that the vast majority of these tumors harbor the oncogenic BRAF V600E mutation. The pathologic diagnosis of papillary craniopharyngioma can now be confirmed using mutation specific immunohistochemistry and targeted genetic testing. Treatment with targeted agents is now also a possibility in select situations. We recently reported a patient with a multiply recurrent papillary craniopharyngioma in whom targeting both BRAF and MEK resulted in a dramatic therapeutic response with a marked anti-tumor immune response. This work shows that activation of the MAPK pathway is the likely principal oncogenic driver of these tumors. We will now investigate the efficacy of this approach in a multicenter phase II clinical trial. Post-treatment resection samples will be monitored for the emergence of resistance mechanisms. Further advances in the non-invasive diagnosis of papillary craniopharyngioma by radiologic criteria and by cell-free DNA testing could someday allow neo-adjuvant therapy for this disease in select patient populations. PMID:26563980
Yoon, Kyong-Ah; Kong, Sun-Young; Lee, Eun Ji; Cho, Jeong Nam; Chang, Suhwan; Lee, Eun Sook
2017-09-01
Germline mutations in the BRCA1 and BRCA2 genes are strong genetic factors for predispositions to breast, ovarian, and other related cancers. This report describes a family with a history of breast and ovarian cancers that harbored a novel BRCA1 germline mutation. A single nucleotide deletion in intron 20, namely c.5332+4delA, was detected in a 43-year-old patient with breast cancer. This mutation led to the skipping of exon 20, which in turn resulted in the production of a truncated BRCA1 protein that was 1773 amino acids in length. The mother of the proband had died due to ovarian cancer and had harbored the same germline mutation. Ectopically expressed mutant BRCA1 protein interacted with the BARD1 protein, but showed a reduced transcriptional function, as demonstrated by the expression of cyclin B1 . This novel germline mutation in the BRCA1 gene caused familial breast and ovarian cancers.
Marin, Talita M.; Keith, Kimberly; Davies, Benjamin; Conner, David A.; Guha, Prajna; Kalaitzidis, Demetrios; Wu, Xue; Lauriol, Jessica; Wang, Bo; Bauer, Michael; Bronson, Roderick; Franchini, Kleber G.; Neel, Benjamin G.; Kontaridis, Maria I.
2011-01-01
LEOPARD syndrome (LS) is an autosomal dominant “RASopathy” that manifests with congenital heart disease. Nearly all cases of LS are caused by catalytically inactivating mutations in the protein tyrosine phosphatase (PTP), non-receptor type 11 (PTPN11) gene that encodes the SH2 domain-containing PTP-2 (SHP2). RASopathies typically affect components of the RAS/MAPK pathway, yet it remains unclear how PTPN11 mutations alter cellular signaling to produce LS phenotypes. We therefore generated knockin mice harboring the Ptpn11 mutation Y279C, one of the most common LS alleles. Ptpn11Y279C/+ (LS/+) mice recapitulated the human disorder, with short stature, craniofacial dysmorphia, and morphologic, histologic, echocardiographic, and molecular evidence of hypertrophic cardiomyopathy (HCM). Heart and/or cardiomyocyte lysates from LS/+ mice showed enhanced binding of Shp2 to Irs1, decreased Shp2 catalytic activity, and abrogated agonist-evoked Erk/Mapk signaling. LS/+ mice also exhibited increased basal and agonist-induced Akt and mTor activity. The cardiac defects in LS/+ mice were completely reversed by treatment with rapamycin, an inhibitor of mTOR. Our results demonstrate that LS mutations have dominant-negative effects in vivo, identify enhanced mTOR activity as critical for causing LS-associated HCM, and suggest that TOR inhibitors be considered for treatment of HCM in LS patients. PMID:21339643
Connell, Paul M; Mayor, Lauren F
2013-06-01
Associations of pleasure and fun with junk foods have the potential to create considerable challenges for efforts to improve diets. The aim of this research was to determine whether activating health goals had the potential to exploit mixed motivations (i.e., health and pleasure) that people have related to food, and subsequently strip junk foods of the expected pleasure derived from them. In study 1, 98 participants evaluated a soft drink brand after being primed (not primed) for health. In study 2, 93 participants evaluated a presweetened breakfast cereal brand after being primed (not primed) for health. In both studies, participants who harbored highly positive feelings for the food brands devalued their hedonic judgments of them when they were primed for health. However, in an unexpected result, participants in both studies who harbored highly negative feelings for the food brands revalued their hedonic judgments of them (i.e., increased the favorability) when they were primed for health. Thus, increasing health salience is only effective in decreasing expected pleasure derived from junk foods for people who harbor positive affect toward junk food brands, and is likely counterproductive for people who harbor negative affect toward junk food brands. Copyright © 2013 Elsevier Ltd. All rights reserved.
Tseng, Jeng-Sen; Wang, Chih-Liang; Yang, Tsung-Ying; Chen, Chih-Yi; Yang, Cheng-Ta; Chen, Kun-Chieh; Hsu, Kuo-Hsuan; Tsai, Chi-Ren; Chang, Gee-Chen
2015-12-01
Smoking status is an important determinant of the prevalence of epidermal growth factor receptor (EGFR) mutations in lung cancer patients. However, it is unclear whether smoking status could also influence the spectrum of EGFR mutations. We enrolled patients with lung adenocarcinoma from three medical centers in Taiwan. EGFR mutations were assessed by Sanger direct sequencing. The objective of this study was to evaluate the influence of smoking status on both the frequency and patterns of EGFR mutations. From 2001 to 2013, a total of 1175 patients with lung adenocarcinoma were enrolled for EGFR mutation analysis. The overall EGFR mutation rate was 59.6%, which was significantly higher in females than males (69.1% vs. 49.8%) and in non-smokers than current/former smokers (73.8% vs. 29.8%) (both P<0.001). Among patients harboring EGFR mutations, smokers expressed L858R mutation less frequently (35.2% vs. 50.2%, P=0.005) and exon 19 deletions more frequently (52.8% vs 38.8%, P=0.008) than non-smokers. Smokers and non-smokers also had divergent exon 19 deletions subtypes (Del E746-A750 82.5% vs. 57.6%, respectively, P<0.001). Among subgroup patients harboring the L858R mutation, smokers were associated with a higher rate of complex mutations than non-smokers (34.2% vs. 8.4%, P<0.001). Our results suggested that smoking status could influence not only the frequency but also the spectrum of EGFR mutations. These findings provide a clue for further investigation of EGFR mutagenesis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Nakae, Shunsuke; Kato, Takema; Murayama, Kazuhiro; Sasaki, Hikaru; Abe, Masato; Kumon, Masanobu; Kumai, Tadashi; Yamashiro, Kei; Inamasu, Joji; Hasegawa, Mitsuhiro; Kurahashi, Hiroki; Hirose, Yuichi
2017-01-01
Most IDH mutant gliomas harbor either 1p/19q co-deletions or TP53 mutation; 1p/19q co-deleted tumors have significantly better prognoses than tumors harboring TP53 mutations. To investigate the clinical factors that contribute to differences in tumor progression of IDH mutant gliomas, we classified recurrent tumor patterns based on MRI and correlated these patterns with their genomic characterization. Accordingly, in IDH mutant gliomas (N = 66), 1p/19 co-deleted gliomas only recurred locally, whereas TP53 mutant gliomas recurred both locally and in remote intracranial regions. In addition, diffuse tensor imaging suggested that remote intracranial recurrence in the astrocytomas, IDH-mutant with TP53 mutations may occur along major fiber bundles. Remotely recurrent tumors resulted in a higher mortality and significantly harbored an 8q gain; astrocytomas with an 8q gain resulted in significantly shorter overall survival than those without an 8q gain. OncoScan® arrays and next-generation sequencing revealed specific 8q regions (i.e., between 8q22 and 8q24) show a high copy number. In conclusion, only tumors with TP53 mutations showed patterns of remote recurrence in IDH mutant gliomas. Furthermore, an 8q gain was significantly associated with remote intracranial recurrence and can be considered a poor prognostic factor in astrocytomas, IDH-mutant. PMID:29156679
Hu, Zexi; Wan, Xiaobo; Hao, Rui; Zhang, Heng; Li, Li; Li, Lin; Xie, Qiang; Wang, Peng; Gao, Yibo; Chen, She; Wei, Min; Luan, Zhidong; Zhang, Aiqun; Huang, Niu; Chen, Liang
2015-01-01
Amplification, overexpression, and somatic mutation of the HER2 gene have been reported to play a critical role in tumorigenesis of various cancers. The HER2 H878Y mutation was recently reported in 11% of hepatocellular carcinoma (HCC) patients. However, its functional impact on the HER2 protein and its role in tumorigenesis has not been determined. Here, we show that HER2 H878Y is a gain-of-function mutation. Y878 represents a phosphorylation site, and phospho-Y878 interacts with R898 residue to stabilize the active conformation of HER2, thereby enhancing its kinase activity. H878Y mutant is transforming and the transformed cells are sensitive to HER2 kinase inhibitors. Thus, our study reveals the following novel mechanism underlying the tumorigenic function of the HER2 H878Y mutation: the introduction of a tyrosine residue into the kinase activation loop via mutagenesis modulates the conformation of the kinase, thereby enhancing its activity. PMID:25853726
Profile of the Roche cobas® EGFR mutation test v2 for non-small cell lung cancer.
Malapelle, Umberto; Sirera, Rafael; Jantus-Lewintre, Eloísa; Reclusa, Pablo; Calabuig-Fariñas, Silvia; Blasco, Ana; Pisapia, Pasquale; Rolfo, Christian; Camps, Carlos
2017-03-01
The discovery of driver mutations in non-small cell lung cancer (NSCLC) has led to the development of genome-based personalized medicine. Fifteen to 20% of adenocarcinomas harbor an epidermal growth factor receptor (EGFR) activating mutation associated with responses to EGFR tyrosine kinase inhibitors (TKIs). Individual laboratories' expertise and the availability of appropriate equipment are valuable assets in predictive molecular pathology, although the choice of methods should be determined by the nature of the samples to be tested and whether the detection of only well-characterized EGFR mutations or rather, of all detectable mutations, is required. Areas covered: The EGFR mutation testing landscape is manifold and includes both screening and targeted methods, each with their own pros and cons. Here we review one of these companion tests, the Roche cobas® EGFR mutation test v2, from a methodological point of view, also exploring its liquid-biopsy applications. Expert commentary: The Roche cobas® EGFR mutation test v2, based on real time RT-PCR, is a reliable option for testing EGFR mutations in clinical practice, either using tissue-derived DNA or plasma-derived cfDNA. This application will be valuable for laboratories with whose purpose is purely diagnostic and lacking high-throughput technologies.
Consequences of a novel caveolin-3 mutation in a large German family.
Fischer, Dirk; Schroers, Anja; Blümcke, Ingmar; Urbach, Horst; Zerres, Klaus; Mortier, Wilhelm; Vorgerd, Matthias; Schröder, Rolf
2003-02-01
Mutations in the human caveolin-3 gene (cav-3) on chromosome 3p25 have been described in limb girdle muscular dystrophy, rippling muscle disease, hyperCKemia, and distal myopathy. Here, we describe the genetic, myopathological, and clinical findings in a large German family harboring a novel heterozygous mutation (GAC-->GAA) in codon 27 of the cav-3 gene. This missense mutation causes an amino acid change from asparagine to glutamate (Asp27Glu) in the N-terminal region of the Cav-3 protein, which leads to a drastic decrease of Cav-3 protein expression in skeletal muscle tissue. In keeping with an autosomal dominant mode of inheritance, this novel cav-3 mutation was found to cosegregate with neuromuscular involvement in the reported family. Ultrastructural analysis of Cav-3-deficient muscle showed an abnormal folding of the plasma membrane as well as multiple vesicular structures in the subsarcolemmal region. Neurological examination of all nine subjects from three generations harboring the novel cav-3 mutation showed clear evidence of rippling muscle disease. However, only two of these nine patients showed isolated signs of rippling muscle disease without muscle weakness or atrophy, whereas five had additional signs of a distal myopathy and two fulfilled the diagnostic criteria of a coexisting limb girdle muscular dystrophy. These findings indicate that mutations in the human cav-3 gene can lead to different and overlapping clinical phenotypes even within the same family. Different clinical phenotypes in caveolinopathies may be attributed to so far unidentified modifying factors/genes in the individual genetic background of affected patients.
Calder, Thomas; de Souza Santos, Marcela; Attah, Victoria; Klimko, John; Fernandez, Jessie; Salomon, Dor; Krachler, Anne-Marie; Orth, Kim
2014-12-01
The Gram-negative bacterium, Vibrio parahaemolyticus, is a major cause of seafood-derived food poisoning throughout the world. The pathogenicity of V. parahaemolyticus is attributed to several virulence factors, including two type III secretion systems (T3SS), T3SS1 and T3SS2. Herein, we compare the virulence of V. parahaemolyticus POR strains, which harbor a mutation in the T3SS needle apparatus of either system, to V. parahaemolyticus CAB strains, which harbor mutations in positive transcriptional regulators of either system. These strains are derived from the clinical RIMD 2210633 strain. We demonstrate that each mutation affects the virulence of the bacterium in a different manner. POR and CAB strains exhibited similar levels of swarming motility and T3SS effector production and secretion, but the CAB3 and CAB4 strains, which harbor a mutation in the T3SS2 master regulator gene, formed reduced biofilm growth under T3SS2 inducing conditions. Additionally, while the cytotoxicity of the POR and CAB strains was similar, the CAB2 (T3SS1 regulatory mutant) strain was strikingly more invasive than the comparable POR2 (T3SS1 structural mutant) strain. In summary, creating structural or regulatory mutations in either T3SS1 or T3SS2 causes differential downstream effects on other virulence systems. Understanding the biological differences of strains created from a clinical isolate is critical for interpreting and understanding the pathogenic nature of V. parahaemolyticus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Effect of point mutations on Herbaspirillum seropedicae NifA activity.
Aquino, B; Stefanello, A A; Oliveira, M A S; Pedrosa, F O; Souza, E M; Monteiro, R A; Chubatsu, L S
2015-08-01
NifA is the transcriptional activator of the nif genes in Proteobacteria. It is usually regulated by nitrogen and oxygen, allowing biological nitrogen fixation to occur under appropriate conditions. NifA proteins have a typical three-domain structure, including a regulatory N-terminal GAF domain, which is involved in control by fixed nitrogen and not strictly required for activity, a catalytic AAA+ central domain, which catalyzes open complex formation, and a C-terminal domain involved in DNA-binding. In Herbaspirillum seropedicae, a β-proteobacterium capable of colonizing Graminae of agricultural importance, NifA regulation by ammonium involves its N-terminal GAF domain and the signal transduction protein GlnK. When the GAF domain is removed, the protein can still activate nif genes transcription; however, ammonium regulation is lost. In this work, we generated eight constructs resulting in point mutations in H. seropedicae NifA and analyzed their effect on nifH transcription in Escherichia coli and H. seropedicae. Mutations K22V, T160E, M161V, L172R, and A215D resulted in inactive proteins. Mutations Q216I and S220I produced partially active proteins with activity control similar to wild-type NifA. However, mutation G25E, located in the GAF domain, resulted in an active protein that did not require GlnK for activity and was partially sensitive to ammonium. This suggested that G25E may affect the negative interaction between the N-terminal GAF domain and the catalytic central domain under high ammonium concentrations, thus rendering the protein constitutively active, or that G25E could lead to a conformational change comparable with that when GlnK interacts with the GAF domain.
Effect of point mutations on Herbaspirillum seropedicae NifA activity
Aquino, B.; Stefanello, A.A.; Oliveira, M.A.S.; Pedrosa, F.O.; Souza, E.M.; Monteiro, R.A.; Chubatsu, L.S.
2015-01-01
NifA is the transcriptional activator of the nif genes in Proteobacteria. It is usually regulated by nitrogen and oxygen, allowing biological nitrogen fixation to occur under appropriate conditions. NifA proteins have a typical three-domain structure, including a regulatory N-terminal GAF domain, which is involved in control by fixed nitrogen and not strictly required for activity, a catalytic AAA+ central domain, which catalyzes open complex formation, and a C-terminal domain involved in DNA-binding. In Herbaspirillum seropedicae, a β-proteobacterium capable of colonizing Graminae of agricultural importance, NifA regulation by ammonium involves its N-terminal GAF domain and the signal transduction protein GlnK. When the GAF domain is removed, the protein can still activate nif genes transcription; however, ammonium regulation is lost. In this work, we generated eight constructs resulting in point mutations in H. seropedicae NifA and analyzed their effect on nifH transcription in Escherichia coli and H. seropedicae. Mutations K22V, T160E, M161V, L172R, and A215D resulted in inactive proteins. Mutations Q216I and S220I produced partially active proteins with activity control similar to wild-type NifA. However, mutation G25E, located in the GAF domain, resulted in an active protein that did not require GlnK for activity and was partially sensitive to ammonium. This suggested that G25E may affect the negative interaction between the N-terminal GAF domain and the catalytic central domain under high ammonium concentrations, thus rendering the protein constitutively active, or that G25E could lead to a conformational change comparable with that when GlnK interacts with the GAF domain. PMID:26176311
Guerrini, Valentina; Subbian, Selvakumar; Santucci, Pierre; Canaan, Stéphane; Pozzi, Gianni
2016-01-01
Isolates of the human pathogen Mycobacterium tuberculosis recovered from clinical samples exhibit genetic heterogeneity. Such variation may result from the stressful environment encountered by the pathogen inside the macrophage, which is the host cell tubercle bacilli parasitize. To study the evolution of the M. tuberculosis genome during growth inside macrophages, we developed a model of intracellular culture in which bacteria were serially passaged in macrophage-like THP-1 cells for about 80 bacterial generations. Genome sequencing of single bacterial colonies isolated before and after the infection cycles revealed that M. tuberculosis developed mutations at a rate of about 5.7 × 10−9 / bp/ generation, consistent with mutation rates calculated during in vivo infection. Analysis of mutant growth in macrophages and in mice showed that the mutations identified after the cyclic infection conferred no advantage to the mutants relative to wild-type. Furthermore, activity testing of the recombinant protein harboring one of these mutations showed that the presence of the mutation did not affect the enzymatic activity. The serial infection protocol developed in this work to study M. tuberculosis genome microevolution can be applied to exposure to stressors to determine their effect on genome remodeling during intra-macrophage growth. PMID:27959952
T antigen mutations are a human tumor-specific signature for Merkel cell polyomavirus
Shuda, Masahiro; Feng, Huichen; Kwun, Hyun Jin; Rosen, Steven T.; Gjoerup, Ole; Moore, Patrick S.; Chang, Yuan
2008-01-01
Merkel cell polyomavirus (MCV) is a virus discovered in our laboratory at the University of Pittsburgh that is monoclonally integrated into the genome of ≈80% of human Merkel cell carcinomas (MCCs). Transcript mapping was performed to show that MCV expresses transcripts in MCCs similar to large T (LT), small T (ST), and 17kT transcripts of SV40. Nine MCC tumor-derived LT genomic sequences have been examined, and all were found to harbor mutations prematurely truncating the MCV LT helicase. In contrast, four presumed episomal viruses from nontumor sources did not possess this T antigen signature mutation. Using coimmunoprecipitation and origin replication assays, we show that tumor-derived virus mutations do not affect retinoblastoma tumor suppressor protein (Rb) binding by LT but do eliminate viral DNA replication capacity. Identification of an MCC cell line (MKL-1) having monoclonal MCV integration and the signature LT mutation allowed us to functionally test both tumor-derived and wild type (WT) T antigens. Only WT LT expression activates replication of integrated MCV DNA in MKL-1 cells. Our findings suggest that MCV-positive MCC tumor cells undergo selection for LT mutations to prevent autoactivation of integrated virus replication that would be detrimental to cell survival. Because these mutations render the virus replication-incompetent, MCV is not a “passenger virus” that secondarily infects MCC tumors. PMID:18812503
Glycogen storage disease type 1a in Israel: biochemical, clinical, and mutational studies.
Parvari, R; Lei, K J; Bashan, N; Hershkovitz, E; Korman, S H; Barash, V; Lerman-Sagie, T; Mandel, H; Chou, J Y; Moses, S W
1997-10-31
Glycogen storage disease type 1a (von Gierke disease, GSD 1a) is caused by the deficiency of microsomal glucose-6-phosphatase (G6Pase) activity which catalyzes the final common step of glycogenolysis and gluconeogenesis. The recent cloning of the G6Pase cDNA and characterization of the human G6Pase gene enabled the characterization of the mutations causing GSD 1a. This, in turn, allows the introduction of a noninvasive DNA-based diagnosis that provides reliable carrier testing and prenatal diagnosis. In this study, we report the biochemical and clinical characteristics as well as mutational analyses of 12 Israeli GSD 1a patients of different families, who represent most GSD 1a patients in Israel. The mutations, G6Pase activity, and glycogen content of 7 of these patients were reported previously. The biochemical data and clinical findings of all patients were similar and compatible with those described in other reports. All 9 Jewish patients, as well as one Muslim Arab patient, presented the R83C mutation. Two Muslim Arab patients had the V166G mutation which was not found in other patients' populations. The V166G mutation, which was introduced into the G6Pase cDNA by site-directed mutagenesis following transient expression in COS-1 cells, was shown to cause complete inactivation of the G6Pase. The characterization of all GSD 1a mutations in the Israeli population lends itself to carrier testing in these families as well as to prenatal diagnosis, which was carried out in 2 families. Since all Ashkenzai Jewish patients harbor the same mutation, our study suggests that DNA-based diagnosis may be used as an initial diagnostic step in Ashkenazi Jews suspected of having GSD 1a, thereby avoiding liver biopsy.
33 CFR 165.904 - Lake Michigan at Chicago Harbor & Burnham Park Harbor-Safety and Security Zone.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Harbor, to the northwest point. (b) Effective times and dates. This safety and security zone will be in... & Burnham Park Harbor-Safety and Security Zone. 165.904 Section 165.904 Navigation and Navigable Waters... Guard District § 165.904 Lake Michigan at Chicago Harbor & Burnham Park Harbor—Safety and Security Zone...
Highly sensitive and quantitative evaluation of the EGFR T790M mutation by nanofluidic digital PCR.
Iwama, Eiji; Takayama, Koichi; Harada, Taishi; Okamoto, Isamu; Ookubo, Fumihiko; Kishimoto, Junji; Baba, Eishi; Oda, Yoshinao; Nakanishi, Yoichi
2015-08-21
The mutation of T790M in EGFR is a major mechanism of resistance to treatment with EGFR-TKIs. Only qualitative detection (presence or absence) of T790M has been described to date, however. Digital PCR (dPCR) analysis has recently been applied to the quantitative detection of target molecules in cancer with high sensitivity. In the present study, 25 tumor samples (13 obtained before and 12 after EGFR-TKI treatment) from 18 NSCLC patients with activating EGFR mutations were evaluated for T790M with dPCR. The ratio of the number of T790M alleles to that of activating mutation alleles (T/A) was determined. dPCR detected T790M in all 25 samples. Although T790M was present in all pre-TKI samples from 13 patients, 10 of these patients had a low T/A ratio and manifested substantial tumor shrinkage during treatment with EGFR-TKIs. In six of seven patients for whom both pre- and post-TKI samples were available, the T/A ratio increased markedly during EGFR-TKI treatment. Highly sensitive dPCR thus detected T790M in all NSCLC patients harboring activating EGFR mutations whether or not they had received EGFR-TKI treatment. Not only highly sensitive but also quantitative detection of T790M is important for evaluation of the contribution of T790M to EGFR-TKI resistance.
Xue, Zhang Xiao; Wen, Wang Xiu; Zhuang, Yu; Hua, Zang Jian; Xia, Yang Ni
2016-09-01
Icotinib hydrochloride is a novel epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) with preclinical and clinical activity in non-small-cell lung cancer (NSCLC). Exon 19 deletion and L858R point mutation are the most commonly encountered EGFR mutations in NSCLC, and they predict improved clinical outcomes following treatment with icotinib. The objective of this study was to evaluate the differential clinical efficacy of icotinib in patients with exon 19 deletion or L858R point mutation of the EGFR gene. A total of 104 patients with advanced NSCLC, who harbored exon 19 deletion or L858R point mutation of EGFR and were treated with icotinib, were enrolled in this study. The tumor response and progression-free survival were evaluated. There were no significant differences between patients with EGFR exon 19 deletion and those with L858R point mutation who received treatment with icotinib.
NASA Astrophysics Data System (ADS)
Delile, H.; Goiran, J.-P.; Blichert-Toft, J.; Arnaud-Godet, F.; Romano, P.; Bravard, J.-P.
2016-10-01
Since the discovery of the ancient harbor of Naples in 2004 during construction work on an underground railway, geoarchaeological studies undertaken on the archaeological excavation have revealed the main stratigraphic and paleo-environmental levels of the harbor site near the Piazza Municipio. However, knowledge of the dynamics and paleo-environmental changes in the water column of the harbor, as well as the processes of transport and deposition of sediments that led to siltation and infilling of the harbor basin, has been lacking due to the absence of high-resolution data. To fill these gaps, we have undertaken a three-dimensional study (longitudinal, transverse and vertical) of the harbor deposits by carrying out geochemical and sedimentological analyses of four stratigraphic sections of the archaeological excavation. The results show that after a phase of relative calm during the first half of the 1st c. AD, siltation of the harbor progressed exponentially up to the 5th c. AD, when dredging operations were carried out to obtain a water level sufficient for the development of maritime and harbor activities. We attribute this acceleration of siltation to a combination of climatic, anthropic and volcanic factors. Volcanic activity was responsible for a high-energy, tsunami-type event during the eruption of Vesuvius in 79 AD. From the 5th c. AD onwards, the harbor basin of Neapolis does not appear to have been functional as evidenced by its transformation into a lagoon following coastal progradation. The last stage of infilling was the development of a flood-dominated fan delta under the combined influences of climatic cooling in the Early Medieval Cool Period and agro-pastoral activities in the catchment area of the harbor. Several generations of paleo-channels, containing flash flood deposits, as well as sheet wash from sheet floods, are indicative of high environmental instability in this period.
The role of BRAF V600 mutation in melanoma
2012-01-01
BRAF is a serine/threonine protein kinase activating the MAP kinase/ERK-signaling pathway. About 50 % of melanomas harbors activating BRAF mutations (over 90 % V600E). BRAFV600E has been implicated in different mechanisms underlying melanomagenesis, most of which due to the deregulated activation of the downstream MEK/ERK effectors. The first selective inhibitor of mutant BRAF, vemurafenib, after highly encouraging results of the phase I and II trial, was compared to dacarbazine in a phase III trial in treatment-naïve patients (BRIM-3). The study results showed a relative reduction of 63 % in risk of death and 74 % in risk of tumor progression. Considering all trials so far completed, median overall survival reached approximately 16 months for vemurafenib compared to less than 10 months for dacarbazine treatment. Vemurafenib has been extensively tested on melanoma patients expressing the BRAFV600E mutated form; it has been demonstrated to be also effective in inhibiting melanomas carrying the V600K mutation. In 2011, both FDA and EMA therefore approved vemurafenib for metastatic melanoma carrying BRAFV600 mutations. Some findings suggest that continuation of vemurafenib treatment is potentially beneficial after local therapy in a subset of patients with disease progression (PD). Among who continued vemurafenib >30 days after local therapy of PD lesion(s), a median overall survival was not reached, with a median follow-up of 15.5 months from initiation of BRAF inhibitor therapy. For patients who did not continue treatment, median overall survival from the time of disease progression was 1.4 months. A clinical phase I/II trial is evaluating the safety, tolerability and efficacy of vemurafenib in combination with the CTLA-4 inhibitor mAb ipilimumab. In the BRIM-7 trial vemurafenib is tested in association with GDC-0973, a potent and highly selective inhibitor of MEK1/2. Preliminary data seem to indicate that an additional inhibitor of mutated BRAF, GSK2118436, might
AR mutations in 28 patients with androgen insensitivity syndrome (Prader grade 0-3).
Wang, Yi; Gong, Chunxiu; Wang, Xiou; Qin, Miao
2017-07-01
We investigated the androgen receptor (AR) gene mutation profiles of Chinese patients exhibiting severe androgen insensitivity syndrome (AIS) phenotypes. The present study enrolled 28 patients with genetically diagnosed AIS, who presented with severe phenotypes (Prader grade 0-3). Patients and some family members were screened via amplification and sequencing of their AR exons 1-8, including the corresponding intronic flanking regions. Luteinizing (LH), follicle-stimulating (FSH), and testosterone (T) hormone levels were found to be slightly, but not significantly, higher in patients with complete androgen insensitivity syndrome (CAIS) than in patients with partial androgen insensitivity syndrome (PAIS) (P>0.05). We identified 24 different AR mutations, including 12 that were novel. Ten patients (cases 2, 3, 10, 28, 11, 12, 19, 20, 24, and 25) were found to carry five recurrent mutations (p.Y572S, p.P914S, p.S176R, p.Y782N, and p.R841H); of these, p.Y572S, p.S176R, and p.Y782N were novel. Among the mutations identified in patients with CAIS, six (66.7%) were characterized as single-nucleotide missense mutations, and six (66.7%) were found to be located in the AR ligand-binding domain (LBD). Among the mutations identified in patients with PAIS, 15 (93.8%) were found to be missense, and 11 (68.8%) were found to be located in the LBD. Patients 10 and 28 were determined to harbor the same missense mutation (p.P914S), but were diagnosed with CAIS and PAIS, respectively. Sex hormone levels were slightly, but not significantly, elevated in patients with CAIS compared to those with PAIS. Missense mutations spanning AR exons 1-8 were the predominant form of identified mutations, and these were mostly located in the AR LBD. Approximately 50% of the identified mutations were novel, and have enriched the AR gene-mutation database. Patients harboring identical mutations were in some instances found to exhibit divergent phenotypes.
Whole-genome sequencing of Atacama skeleton shows novel mutations linked with dysplasia.
Bhattacharya, Sanchita; Li, Jian; Sockell, Alexandra; Kan, Matthew J; Bava, Felice A; Chen, Shann-Ching; Ávila-Arcos, María C; Ji, Xuhuai; Smith, Emery; Asadi, Narges B; Lachman, Ralph S; Lam, Hugo Y K; Bustamante, Carlos D; Butte, Atul J; Nolan, Garry P
2018-04-01
Over a decade ago, the Atacama humanoid skeleton (Ata) was discovered in the Atacama region of Chile. The Ata specimen carried a strange phenotype-6-in stature, fewer than expected ribs, elongated cranium, and accelerated bone age-leading to speculation that this was a preserved nonhuman primate, human fetus harboring genetic mutations, or even an extraterrestrial. We previously reported that it was human by DNA analysis with an estimated bone age of about 6-8 yr at the time of demise. To determine the possible genetic drivers of the observed morphology, DNA from the specimen was subjected to whole-genome sequencing using the Illumina HiSeq platform with an average 11.5× coverage of 101-bp, paired-end reads. In total, 3,356,569 single nucleotide variations (SNVs) were found as compared to the human reference genome, 518,365 insertions and deletions (indels), and 1047 structural variations (SVs) were detected. Here, we present the detailed whole-genome analysis showing that Ata is a female of human origin, likely of Chilean descent, and its genome harbors mutations in genes ( COL1A1 , COL2A1 , KMT2D , FLNB , ATR , TRIP11 , PCNT ) previously linked with diseases of small stature, rib anomalies, cranial malformations, premature joint fusion, and osteochondrodysplasia (also known as skeletal dysplasia). Together, these findings provide a molecular characterization of Ata's peculiar phenotype, which likely results from multiple known and novel putative gene mutations affecting bone development and ossification. © 2018 Bhattacharya et al.; Published by Cold Spring Harbor Laboratory Press.
Wang, Kai; Zhang, Qin; Li, Danan; Ching, Keith; Zhang, Cathy; Zheng, Xianxian; Ozeck, Mark; Shi, Stephanie; Li, Xiaorong; Wang, Hui; Rejto, Paul; Christensen, James; Olson, Peter
2015-03-15
To identify and characterize novel, activating mutations in Notch receptors in breast cancer and to determine response to the gamma secretase inhibitor (GSI) PF-03084014. We used several computational approaches, including novel algorithms, to analyze next-generation sequencing data and related omic datasets from The Cancer Genome Atlas (TCGA) breast cancer cohort. Patient-derived xenograft (PDX) models were sequenced, and Notch-mutant models were treated with PF-03084014. Gene-expression and functional analyses were performed to study the mechanism of activation through mutation and inhibition by PF-03084014. We identified mutations within and upstream of the PEST domains of NOTCH1, NOTCH2, and NOTCH3 in the TCGA dataset. Mutations occurred via several genetic mechanisms and compromised the function of the PEST domain, a negative regulatory domain commonly mutated in other cancers. Focal amplifications of NOTCH2 and NOTCH3 were also observed, as were heterodimerization or extracellular domain mutations at lower incidence. Mutations and amplifications often activated the Notch pathway as evidenced by increased expression of canonical Notch target genes, and functional mutations were significantly enriched in the triple-negative breast cancer subtype (TNBC). PDX models were also identified that harbored PEST domain mutations, and these models were highly sensitive to PF-03084014. This work suggests that Notch-altered breast cancer constitutes a bona fide oncogenic driver segment with the most common alteration being PEST domain mutations present in multiple Notch receptors. Importantly, functional studies suggest that this newly identified class can be targeted with Notch inhibitors, including GSIs. ©2015 American Association for Cancer Research.
Stabilization of luciferase from Renilla reniformis using random mutations.
Shigehisa, Megumi; Amaba, Norie; Arai, Shigeki; Higashi, Chisato; Kawanabe, Ryo; Matsunaga, Ayano; Laksmi, Fina Amreta; Tokunaga, Masao; Ishibashi, Matsujiro
2017-01-01
We expressed luciferase (RLuc) from Renilla reniformis in Escherichia coli RLuc was purified using a Ni-NTA column and subsequently characterized. It was unstable in acidic solutions and at 30°C. To increase the stability of RLuc, the Rluc gene was randomly mutated using error-prone polymerase chain reaction. E. coli harboring the mutated gene was screened by detecting luminescence on a plate containing the substrate coelenterazine at 34°C. Three mutants, i.e. N264SS287P, N178D and F116LI137V, were obtained. The solubilities and specific activities of these mutants were higher than those of the wild type. Furthermore, the N264SS287P mutant maintained stability at a temperature approximately 5°C higher than that of the wild type, while denaturation of the F116LI137V mutant started at a temperature that was 5°C lower than the wild type, and ended at a temperature that was 7°C higher. We examined the obtained mutations using thermal shift assays and a computer program Coot in this study. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Ou, Sai-Hong Ignatius; Greenbowe, Joel; Khan, Ziad U; Azada, Michele C; Ross, Jeffrey S; Stevens, Phil J; Ali, Siraj M; Miller, Vincent A; Gitlitz, Barbara
2015-05-01
Acquired resistance mutations to anaplastic lymphoma kinase (ALK) inhibitors such as crizotinib and alectinib have been documented in non-small cell lung cancer (NSCLC) patients harboring ALK rearrangement (ALK+). Of note I1171T/N/S mutations in the ALK kinase domain have recently been described by several groups to confer resistance to alectinib, a second-generation ALK inhibitor. Additionally one of these reports demonstrated one ALK+ NSCLC patient harboring an I1171T acquired mutation has responded to ceritinib, another second-generation ALK inhibitor. We reported the presence of an ALK I1171N resistance mutation from comprehensive genomic profiling from a liver biopsy of a progressing metastatic lesion in an ALK+ patient on alectinib after an initial partial response. The patient then responded to ceritinib 750 mg orally once daily but required dose reduction to 600 mg once daily. She initially had grade 3 elevation of liver enzymes from crizotinib necessitating the original switch to alectinib but experienced no transaminase elevations with alectinib or ceritinib. This is the fifth patient case to date demonstrating that ALK I1171 mutation confers resistance to alectinib and the second reported case of ALK I1171 mutation being sensitivity to ceritinib. Substitutions of isoleucine at amino acid 1171 in the ALK kinase domain may distinguish which second generation ALK inhibitor will be effective after crizotinib failure. This case also provides evidence that transaminase elevations is likely a unique adverse event associated with crizotinib and unlikely a "class" effect involving all ALK inhibitors. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Saitsu, Hirotomo; Osaka, Hitoshi; Sasaki, Masayuki; Takanashi, Jun-ichi; Hamada, Keisuke; Yamashita, Akio; Shibayama, Hidehiro; Shiina, Masaaki; Kondo, Yukiko; Nishiyama, Kiyomi; Tsurusaki, Yoshinori; Miyake, Noriko; Doi, Hiroshi; Ogata, Kazuhiro; Inoue, Ken; Matsumoto, Naomichi
2011-01-01
Congenital hypomyelinating disorders are a heterogeneous group of inherited leukoencephalopathies characterized by abnormal myelin formation. We have recently reported a hypomyelinating syndrome characterized by diffuse cerebral hypomyelination with cerebellar atrophy and hypoplasia of the corpus callosum (HCAHC). We performed whole-exome sequencing of three unrelated individuals with HCAHC and identified compound heterozygous mutations in POLR3B in two individuals. The mutations include a nonsense mutation, a splice-site mutation, and two missense mutations at evolutionally conserved amino acids. Using reverse transcription-PCR and sequencing, we demonstrated that the splice-site mutation caused deletion of exon 18 from POLR3B mRNA and that the transcript harboring the nonsense mutation underwent nonsense-mediated mRNA decay. We also identified compound heterozygous missense mutations in POLR3A in the remaining individual. POLR3A and POLR3B encode the largest and second largest subunits of RNA Polymerase III (Pol III), RPC1 and RPC2, respectively. RPC1 and RPC2 together form the active center of the polymerase and contribute to the catalytic activity of the polymerase. Pol III is involved in the transcription of small noncoding RNAs, such as 5S ribosomal RNA and all transfer RNAs (tRNA). We hypothesize that perturbation of Pol III target transcription, especially of tRNAs, could be a common pathological mechanism underlying POLR3A and POLR3B mutations. PMID:22036171
IDH1 R132H mutation generates a distinct phospholipid metabolite profile in glioma.
Esmaeili, Morteza; Hamans, Bob C; Navis, Anna C; van Horssen, Remco; Bathen, Tone F; Gribbestad, Ingrid S; Leenders, William P; Heerschap, Arend
2014-09-01
Many patients with glioma harbor specific mutations in the isocitrate dehydrogenase gene IDH1 that associate with a relatively better prognosis. IDH1-mutated tumors produce the oncometabolite 2-hydroxyglutarate. Because IDH1 also regulates several pathways leading to lipid synthesis, we hypothesized that IDH1-mutant tumors have an altered phospholipid metabolite profile that would impinge on tumor pathobiology. To investigate this hypothesis, we performed (31)P-MRS imaging in mouse xenograft models of four human gliomas, one of which harbored the IDH1-R132H mutation. (31)P-MR spectra from the IDH1-mutant tumor displayed a pattern distinct from that of the three IDH1 wild-type tumors, characterized by decreased levels of phosphoethanolamine and increased levels of glycerophosphocholine. This spectral profile was confirmed by ex vivo analysis of tumor extracts, and it was also observed in human surgical biopsies of IDH1-mutated tumors by (31)P high-resolution magic angle spinning spectroscopy. The specificity of this profile for the IDH1-R132H mutation was established by in vitro (31)P-NMR of extracts of cells overexpressing IDH1 or IDH1-R132H. Overall, our results provide evidence that the IDH1-R132H mutation alters phospholipid metabolism in gliomas involving phosphoethanolamine and glycerophosphocholine. These new noninvasive biomarkers can assist in the identification of the mutation and in research toward novel treatments that target aberrant metabolism in IDH1-mutant glioma. ©2014 American Association for Cancer Research.
Schrock, Alexa B.; Anderson, Peter M.; Morris, John C.; Heilmann, Andreas M.; Holmes, Oliver; Wang, Kai; Johnson, Adrienne; Waguespack, Steven G.; Ou, Sai‐Hong Ignatius; Khan, Saad; Fung, Kar‐Ming; Stephens, Philip J.; Erlich, Rachel L.; Miller, Vincent A.; Ross, Jeffrey S.; Ali, Siraj M.
2017-01-01
Background. Thyroid carcinoma, which is rare in pediatric patients (age 0–18 years) but more common in adolescent and young adult (AYA) patients (age 15–39 years), carries the potential for morbidity and mortality. Methods. Hybrid‐capture‐based comprehensive genomic profiling (CGP) was performed prospectively on 512 consecutively submitted thyroid carcinomas, including 58 from pediatric and AYA (PAYA) patients, to identify genomic alterations (GAs), including base substitutions, insertions/deletions, copy number alterations, and rearrangements. This PAYA data series includes 41 patients with papillary thyroid carcinoma (PTC), 3 with anaplastic thyroid carcinoma (ATC), and 14 with medullary thyroid carcinoma (MTC). Results. GAs were detected in 93% (54/58) of PAYA cases, with a mean of 1.4 GAs per case. In addition to BRAF V600E mutations, detected in 46% (19/41) of PAYA PTC cases and in 1 of 3 AYA ATC cases, oncogenic fusions involving RET, NTRK1, NTRK3, and ALK were detected in 37% (15/41) of PAYA PTC and 33% (1/3) of AYA ATC cases. Ninety‐three percent (13/14) of MTC patients harbored RET alterations, including 3 novel insertions/deletions in exons 6 and 11. Two of these MTC patients with novel alterations in RET experienced clinical benefit from vandetanib treatment. Conclusion. CGP identified diverse clinically relevant GAs in PAYA patients with thyroid carcinoma, including 83% (34/41) of PTC cases harboring activating kinase mutations or activating kinase rearrangements. These genomic observations and index cases exhibiting clinical benefit from targeted therapy suggest that young patients with advanced thyroid carcinoma can benefit from CGP and rationally matched targeted therapy. Implications for Practice. The detection of diverse clinically relevant genomic alterations in the majority of pediatric, adolescent, and young adult patients with thyroid carcinoma in this study suggests that comprehensive genomic profiling may be beneficial for young
Consensus for EGFR mutation testing in non-small cell lung cancer: results from a European workshop.
Pirker, Robert; Herth, Felix J F; Kerr, Keith M; Filipits, Martin; Taron, Miquel; Gandara, David; Hirsch, Fred R; Grunenwald, Dominique; Popper, Helmut; Smit, Egbert; Dietel, Manfred; Marchetti, Antonio; Manegold, Christian; Schirmacher, Peter; Thomas, Michael; Rosell, Rafael; Cappuzzo, Federico; Stahel, Rolf
2010-10-01
Activating somatic mutations of the tyrosine kinase domain of epidermal growth factor receptor (EGFR) have recently been characterized in a subset of patients with advanced non-small cell lung cancer (NSCLC). Patients harboring these mutations in their tumors show excellent response to EGFR tyrosine kinase inhibitors (EGFR-TKIs). The EGFR-TKI gefitinib has been approved in Europe for the treatment of adult patients with locally advanced or metastatic NSCLC with activating mutations of the EGFR TK. Because EGFR mutation testing is not yet well established across Europe, biomarker-directed therapy only slowly emerges for the subset of NSCLC patients most likely to benefit: those with EGFR mutations. The "EGFR testing in NSCLC: from biology to clinical practice" International Association for the Study of Lung Cancer-European Thoracic Oncology Platform multidisciplinary workshop aimed at facilitating the implementation of EGFR mutation testing. Recommendations for high-quality EGFR mutation testing were formulated based on the opinion of the workshop expert group. Co-operation and communication flow between the various disciplines was considered to be of most importance. Participants agreed that the decision to request EGFR mutation testing should be made by the treating physician, and results should be available within 7 working days. There was agreement on the importance of appropriate sampling techniques and the necessity for the standardization of tumor specimen handling including fixation. Although there was no consensus on which laboratory test should be preferred for clinical decision making, all stressed the importance of standardization and validation of these tests. The recommendations of the workshop will help implement EGFR mutation testing in Europe and, thereby, optimize the use of EGFR-TKIs in clinical practice.
Neskey, David M; Osman, Abdullah A; Ow, Thomas J; Katsonis, Panagiotis; McDonald, Thomas; Hicks, Stephanie C; Hsu, Teng-Kuei; Pickering, Curtis R; Ward, Alexandra; Patel, Ameeta; Yordy, John S; Skinner, Heath D; Giri, Uma; Sano, Daisuke; Story, Michael D; Beadle, Beth M; El-Naggar, Adel K; Kies, Merrill S; William, William N; Caulin, Carlos; Frederick, Mitchell; Kimmel, Marek; Myers, Jeffrey N; Lichtarge, Olivier
2015-04-01
TP53 is the most frequently altered gene in head and neck squamous cell carcinoma, with mutations occurring in over two-thirds of cases, but the prognostic significance of these mutations remains elusive. In the current study, we evaluated a novel computational approach termed evolutionary action (EAp53) to stratify patients with tumors harboring TP53 mutations as high or low risk, and validated this system in both in vivo and in vitro models. Patients with high-risk TP53 mutations had the poorest survival outcomes and the shortest time to the development of distant metastases. Tumor cells expressing high-risk TP53 mutations were more invasive and tumorigenic and they exhibited a higher incidence of lung metastases. We also documented an association between the presence of high-risk mutations and decreased expression of TP53 target genes, highlighting key cellular pathways that are likely to be dysregulated by this subset of p53 mutations that confer particularly aggressive tumor behavior. Overall, our work validated EAp53 as a novel computational tool that may be useful in clinical prognosis of tumors harboring p53 mutations. ©2015 American Association for Cancer Research.
Geyer, Felipe C; Li, Anqi; Papanastasiou, Anastasios D; Smith, Alison; Selenica, Pier; Burke, Kathleen A; Edelweiss, Marcia; Wen, Huei-Chi; Piscuoglio, Salvatore; Schultheis, Anne M; Martelotto, Luciano G; Pareja, Fresia; Kumar, Rahul; Brandes, Alissa; Fan, Dan; Basili, Thais; Da Cruz Paula, Arnaud; Lozada, John R; Blecua, Pedro; Muenst, Simone; Jungbluth, Achim A; Foschini, Maria P; Wen, Hannah Y; Brogi, Edi; Palazzo, Juan; Rubin, Brian P; Ng, Charlotte K Y; Norton, Larry; Varga, Zsuzsanna; Ellis, Ian O; Rakha, Emad A; Chandarlapaty, Sarat; Weigelt, Britta; Reis-Filho, Jorge S
2018-05-08
Adenomyoepithelioma of the breast is a rare tumor characterized by epithelial-myoepithelial differentiation, whose genetic underpinning is largely unknown. Here we show through whole-exome and targeted massively parallel sequencing analysis that whilst estrogen receptor (ER)-positive adenomyoepitheliomas display PIK3CA or AKT1 activating mutations, ER-negative adenomyoepitheliomas harbor highly recurrent codon Q61 HRAS hotspot mutations, which co-occur with PIK3CA or PIK3R1 mutations. In two- and three-dimensional cell culture models, forced expression of HRAS Q61R in non-malignant ER-negative breast epithelial cells with or without a PIK3CA H1047R somatic knock-in results in transformation and the acquisition of the cardinal features of adenomyoepitheliomas, including the expression of myoepithelial markers, a reduction in E-cadherin expression, and an increase in AKT signaling. Our results demonstrate that adenomyoepitheliomas are genetically heterogeneous, and qualify mutations in HRAS, a gene whose mutations are vanishingly rare in common-type breast cancers, as likely drivers of ER-negative adenomyoepitheliomas.
Puppin, Cinzia; Durante, Cosimo; Sponziello, Marialuisa; Verrienti, Antonella; Pecce, Valeria; Lavarone, Elisa; Baldan, Federica; Campese, Antonio Francesco; Boichard, Amelie; Lacroix, Ludovic; Russo, Diego; Filetti, Sebastiano; Damante, Giuseppe
2014-11-01
Abnormal expression of non-coding micro RNA (miRNA) has been described in medullary thyroid carcinoma (MTC). Expression of genes encoding factors involved in miRNA biogenesis results often deregulated in human cancer and correlates with aggressive clinical behavior. In this study, expression of four genes involved in miRNA biogenesis (DICER, DROSHA, DCGR8, and XPO5) was investigated in 54 specimens of MTC. Among them, 33 and 13 harbored RET and RAS mutations, respectively. DICER, DGCR8, and XPO5 mRNA levels were significantly overexpressed in MTC harboring RET mutations, in particular, in the presence of RET634 mutation. When MTCs with RET and RAS mutations were compared, only DGCR8 displayed a significant difference, while MTCs with RAS mutations did not show significant differences with respect to non-mutated tumors. We then attempted to correlate expression of miRNA biogenesis genes with tumor aggressiveness. According to the TNM status, MTCs were divided in two groups and compared (N0 M0 vs. N1 and/or M1): for all four genes no significant difference was detected. Cell line experiments, in which expression of a RET mutation is silenced by siRNA, suggest the existence of a causal relationship between RET mutation and overexpression of DICER, DGCR8, and XPO5 genes. These findings demonstrate that RET- but not RAS-driven tumorigenic alterations include abnormalities in the expression of some important genes involved in miRNA biogenesis that could represent new potential markers for targeted therapies in the treatment of RET-mutated MTCs aimed to restore the normal miRNA expression profile.
Comprehensive Characterization of Cancer Driver Genes and Mutations.
Bailey, Matthew H; Tokheim, Collin; Porta-Pardo, Eduard; Sengupta, Sohini; Bertrand, Denis; Weerasinghe, Amila; Colaprico, Antonio; Wendl, Michael C; Kim, Jaegil; Reardon, Brendan; Ng, Patrick Kwok-Shing; Jeong, Kang Jin; Cao, Song; Wang, Zixing; Gao, Jianjiong; Gao, Qingsong; Wang, Fang; Liu, Eric Minwei; Mularoni, Loris; Rubio-Perez, Carlota; Nagarajan, Niranjan; Cortés-Ciriano, Isidro; Zhou, Daniel Cui; Liang, Wen-Wei; Hess, Julian M; Yellapantula, Venkata D; Tamborero, David; Gonzalez-Perez, Abel; Suphavilai, Chayaporn; Ko, Jia Yu; Khurana, Ekta; Park, Peter J; Van Allen, Eliezer M; Liang, Han; Lawrence, Michael S; Godzik, Adam; Lopez-Bigas, Nuria; Stuart, Josh; Wheeler, David; Getz, Gad; Chen, Ken; Lazar, Alexander J; Mills, Gordon B; Karchin, Rachel; Ding, Li
2018-04-05
Identifying molecular cancer drivers is critical for precision oncology. Multiple advanced algorithms to identify drivers now exist, but systematic attempts to combine and optimize them on large datasets are few. We report a PanCancer and PanSoftware analysis spanning 9,423 tumor exomes (comprising all 33 of The Cancer Genome Atlas projects) and using 26 computational tools to catalog driver genes and mutations. We identify 299 driver genes with implications regarding their anatomical sites and cancer/cell types. Sequence- and structure-based analyses identified >3,400 putative missense driver mutations supported by multiple lines of evidence. Experimental validation confirmed 60%-85% of predicted mutations as likely drivers. We found that >300 MSI tumors are associated with high PD-1/PD-L1, and 57% of tumors analyzed harbor putative clinically actionable events. Our study represents the most comprehensive discovery of cancer genes and mutations to date and will serve as a blueprint for future biological and clinical endeavors. Published by Elsevier Inc.
Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko
2018-05-24
Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Jabbar, Kausar J; Luthra, Rajalakshmi; Patel, Keyur P; Singh, Rajesh R; Goswami, Rashmi; Aldape, Ken D; Medeiros, L Jeffrey; Routbort, Mark J
2015-04-01
Mutation-specific antibodies for BRAF V600E and IDH1 R132H offer convenient immunohistochemical (IHC) assays to detect these mutations in tumors. Previous studies using these antibodies have shown high sensitivity and specificity, but use in routine diagnosis with qualitative assessment has not been well studied. In this retrospective study, we reviewed BRAF and IDH1 mutation-specific IHC results compared with separately obtained clinical next-generation sequencing results. For 67 tumors with combined IDH1 IHC and mutation data, IHC was unequivocally reported as positive or negative in all cases. Sensitivity of IHC for IDH1 R132H was 98% and specificity was 100% compared with mutation status. Four IHC-negative samples showed non-R132H IDH1 mutations including R132C, R132G, and P127T. For 128 tumors with combined BRAF IHC and mutation data, IHC was positive in 33, negative in 82, and equivocal in 13 tumors. The sensitivity of IHC was 97% and specificity was 99% when including only unequivocally positive or negative results. If equivocal IHC cases were included in the analysis as negative, sensitivity fell to 81%. If equivocal cases were classified as positive, specificity dropped to 91%. Eight IHC-negative samples showed non-V600E BRAF mutations including V600K, N581I, V600M, and K601E. We conclude that IHC for BRAF V600E and IDH1 R132H is relatively sensitive and specific, but there is a discordance rate that is not trivial. In addition, a significant proportion of patients harbor BRAF non-V600E or IDH1 non-R132H mutations not detectable by IHC, potentially limiting utility of IHC screening for BRAF and IDH1 mutations.
Hossain, Manzar; Stillman, Bruce
2012-08-15
Like DNA replication, centrosomes are licensed to duplicate once per cell division cycle to ensure genetic stability. In addition to regulating DNA replication, the Orc1 subunit of the human origin recognition complex controls centriole and centrosome copy number. Here we report that Orc1 harbors a PACT centrosome-targeting domain and a separate domain that differentially inhibits the protein kinase activities of Cyclin E-CDK2 and Cyclin A-CDK2. A cyclin-binding motif (Cy motif) is required for Orc1 to bind Cyclin A and inhibit Cyclin A-CDK2 kinase activity but has no effect on Cyclin E-CDK2 kinase activity. In contrast, Orc1 inhibition of Cyclin E-CDK2 kinase activity occurs by a different mechanism that is affected by Orc1 mutations identified in Meier-Gorlin syndrome patients. The cyclin/CDK2 kinase inhibitory domain of Orc1, when tethered to the PACT domain, localizes to centrosomes and blocks centrosome reduplication. Meier-Gorlin syndrome mutations that disrupt Cyclin E-CDK2 kinase inhibition also allow centrosome reduplication. Thus, Orc1 contains distinct domains that control centrosome copy number and DNA replication. We suggest that the Orc1 mutations present in some Meier-Gorlin syndrome patients contribute to the pronounced microcephaly and dwarfism observed in these individuals by altering centrosome duplication in addition to DNA replication defects.
Monzon, Jose G; Cremin, Carol; Armstrong, Linlea; Nuk, Jennifer; Young, Sean; Horsman, Doug E; Garbutt, Kristy; Bajdik, Chris D; Gill, Sharlene
2010-02-15
Lynch syndrome is defined by the presence of germline mutations in mismatch repair (MMR) genes. Several models have been recently devised that predict mutation carrier status (Myriad Genetics, Wijnen, Barnetson, PREMM and MMRpro models). Families at moderate-high risk for harboring a Lynch-associated mutation, referred to the BC Cancer Agency (BCCA) Hereditary Cancer Program (HCP), underwent mutation analysis, immunohistochemistry and/or microsatellite testing. Seventy-two tested cases were included. Twenty-five patients were mutation positive (34.7%) and 47 were mutation negative (65.3%). Nineteen of 43 patients who were both microsatellite stable and normal on immunohistochemistry for MLH1 and MSH2 were also genotyped for mutations in these genes; all 19 were negative for MMR gene mutations. Model-derived probabilities of harboring a MMR gene mutation in the proband were calculated and compared to observed results. The area under the ROC curves were 0.75 (95%CI; 0.63-0.87), 0.86 (0.7-0.96), 0.89 (0.82-0.97), 0.89 (0.81-0.98) and 0.93 (0.86-0.99) for the Myriad, Barnetson, Wijnen, MMRpro and PREMM models, respectively. The Amsterdam II criteria had a sensitivity and specificity of 0.76 and 0.74, respectively, in this cohort. The PREMM model demonstrated the best performance for predicting carrier status based on the positive likelihood ratios at the >10%, >20% and >30% probability thresholds. In this referred cohort, the PREMM model had the most favorable concordance index and predictive performance for carrier status based on the positive LR. These prediction models (PREMM, MMRPro and Wijnen) may soon replace the Amsterdam II and revised Bethesda criteria as a prescreening tool for Lynch mutations.
Federal Register 2010, 2011, 2012, 2013, 2014
2010-12-16
... Operation Regulation; Gulf Intracoastal Waterway, New Orleans Harbor, Inner Harbor Navigation Canal, New Orleans, Orleans Parish, LA AGENCY: Coast Guard, DHS. ACTION: Notice of temporary deviation from... Harvey Lock), at New Orleans, Orleans Parish, Louisiana. This deviation is necessary to adjust the...
Makishima, Hideki; Cazzolli, Heather; Szpurka, Hadrian; Dunbar, Andrew; Tiu, Ramon; Huh, Jungwon; Muramatsu, Hideki; O'Keefe, Christine; Hsi, Eric; Paquette, Ronald L.; Kojima, Seiji; List, Alan F.; Sekeres, Mikkael A.; McDevitt, Michael A.; Maciejewski, Jaroslaw P.
2009-01-01
Purpose Acquired somatic uniparental disomy (UPD) is commonly observed in myelodysplastic syndromes (MDS), myelodysplastic/myeloproliferative neoplasms (MDS/MPN), or secondary acute myelogenous leukemia (sAML) and may point toward genes harboring mutations. Recurrent UPD11q led to identification of homozygous mutations in c-Cbl, an E3 ubiquitin ligase involved in attenuation of proliferative signals transduced by activated receptor tyrosine kinases. We examined the role and frequency of Cbl gene family mutations in MPN and related conditions. Methods We applied high-density SNP-A karyotyping to identify loss of heterozygosity of 11q in 442 patients with MDS, MDS/MPN, MPN, sAML evolved from these conditions, and primary AML. We sequenced c-Cbl, Cbl-b, and Cbl-c in patients with or without corresponding UPD or deletions and correlated mutational status with clinical features and outcomes. Results We identified c-Cbl mutations in 5% and 9% of patients with chronic myelomonocytic leukemia (CMML) and sAML, and also in CML blast crisis and juvenile myelomonocytic leukemia (JMML). Most mutations were homozygous and affected c-Cbl; mutations in Cbl-b were also found in patients with similar clinical features. Patients with Cbl family mutations showed poor prognosis, with a median survival of 5 months. Pathomorphologic features included monocytosis, monocytoid blasts, aberrant expression of phosphoSTAT5, and c-kit overexpression. Serial studies showed acquisition of c-Cbl mutations during malignant evolution. Conclusion Mutations in the Cbl family RING finger domain or linker sequence constitute important pathogenic lesions associated with not only preleukemic CMML, JMML, and other MPN, but also progression to AML, suggesting that impairment of degradation of activated tyrosine kinases constitutes an important cancer mechanism. PMID:19901108
Ancot, Frédéric; Arcand, Suzanna L; Mes-Masson, Anne-Marie; Provencher, Diane M; Tonin, Patricia N
2015-06-01
French Canadian families with breast cancer and breast-ovarian cancer syndrome harbor specific BRCA1, BRCA2 and PALB2 germline mutations, which have been attributed to common founders. Mutations in these genes confer an increased risk to breast and ovarian cancers, and have been identified to play a role in and directly interact with the common homologous recombination DNA repair pathways. Our previous study described the case of a female diagnosed with breast cancer at 45 years old, who harbored the PALB2:c.2323C>T [p.Q775X] and BRCA2:c.9004G>A [p.E3002K] germline mutations, which have been found to recur in the French Canadian cancer families. As the frequency of double heterozygous carriers of breast-ovarian cancer susceptibility alleles is unknown, and due to the possibility that there may be implications for genetic counseling and management for these carriers, the present study investigated the co-occurrence of BRCA1/BRCA2 and PALB2 mutations in the French Canadian cancer families. The PALB2:c.2323C>T [p.Q775X] mutation, which is the only PALB2 mutation to have been identified in French Canadian cancer families, was screened in 214 breast cancer cases and 22 breast-ovarian cancer cases from 114 BRCA1/BRCA2 mutation-positive French Canadian breast cancer (n=61) and breast-ovarian cancer (n=53) families using a tailored polymerase chain reaction-based TaqMan® SNP Genotyping Assay. No additional PALB2:c.2323C>T [p.Q775X] mutation carriers were identified among the BRCA1/BRCA2 mutation carriers. The results suggest that carriers of the PALB2:c.2323C>T [p.Q775X] mutation rarely co-occur in French Canadian breast cancer and breast-ovarian cancer families harboring BRCA1 or BRCA2 mutations.
33 CFR 165.904 - Lake Michigan at Chicago Harbor & Burnham Park Harbor-Safety and Security Zone.
Code of Federal Regulations, 2012 CFR
2012-07-01
... & Burnham Park Harbor-Safety and Security Zone. 165.904 Section 165.904 Navigation and Navigable Waters... Guard District § 165.904 Lake Michigan at Chicago Harbor & Burnham Park Harbor—Safety and Security Zone... entrance of the harbor connecting coordinates 41°51′09″ N, 087°36′36″W and 41°51′11″ N, 087°36′22″ W. (b...
33 CFR 165.904 - Lake Michigan at Chicago Harbor & Burnham Park Harbor-Safety and Security Zone.
Code of Federal Regulations, 2014 CFR
2014-07-01
... & Burnham Park Harbor-Safety and Security Zone. 165.904 Section 165.904 Navigation and Navigable Waters... Guard District § 165.904 Lake Michigan at Chicago Harbor & Burnham Park Harbor—Safety and Security Zone... entrance of the harbor connecting coordinates 41°51′09″ N, 087°36′36″ W and 41°51′11″ N, 087°36′22″ W. (b...
33 CFR 165.904 - Lake Michigan at Chicago Harbor & Burnham Park Harbor-Safety and Security Zone.
Code of Federal Regulations, 2013 CFR
2013-07-01
... & Burnham Park Harbor-Safety and Security Zone. 165.904 Section 165.904 Navigation and Navigable Waters... Guard District § 165.904 Lake Michigan at Chicago Harbor & Burnham Park Harbor—Safety and Security Zone... entrance of the harbor connecting coordinates 41°51′09″ N, 087°36′36″W and 41°51′11″ N, 087°36′22″ W. (b...
Neskey, David M.; Osman, Abdullah A.; Ow, Thomas J.; Katsonis, Panagiotis; McDonald, Thomas; Hicks, Stephanie C.; Hsu, Teng-Kuei; Pickering, Curtis R.; Ward, Alexandra; Patel, Ameeta; Yordy, John S.; Skinner, Heath D.; Giri, Uma; Sano, Daisuke; Story, Michael D.; Beadle, Beth M.; El-Naggar, Adel K.; Kies, Merrill S.; William, William N.; Caulin, Carlos; Frederick, Mitchell; Kimmel, Marek; Myers, Jeffrey N.; Lichtarge, Olivier
2015-01-01
TP53 is the most frequently altered gene in head and neck squamous cell carcinoma (HNSCC) with mutations occurring in over two third of cases, but the prognostic significance of these mutations remains elusive. In the current study, we evaluated a novel computational approach termed Evolutionary Action (EAp53) to stratify patients with tumors harboring TP53 mutations as high or low risk, and validated this system in both in vivo and in vitro models. Patients with high risk TP53 mutations had the poorest survival outcomes and the shortest time to the development of distant metastases. Tumor cells expressing high risk TP53 mutations were more invasive and tumorigenic and they exhibited a higher incidence of lung metastases. We also documented an association between the presence of high risk mutations and decreased expression of TP53 target genes, highlighting key cellular pathways that are likely to be dysregulated by this subset of p53 mutations which confer particularly aggressive tumor behavior. Overall, our work validated EAp53 as a novel computational tool that may be useful in clinical prognosis of tumors harboring p53 mutations. PMID:25634208
Boyanova, Lyudmila; Markovska, Rumyana; Yordanov, Daniel; Gergova, Galina; Mitov, Ivan
2016-04-01
Antibiotic resistance is the major cause for Helicobacter pylori eradication failure. H. pylori clarithromycin resistance mutations were evaluated in 84 (82 phenotypically clarithromycin resistant and 2 intermediately susceptible) strains by allele-specific PCR and 3'-mismatched PCR. Many (57.1%) of these strains were metronidazole resistant. Prevalence of cagA(+), cagE(+), vacA s1a, m1, i1, and i2 strains was 76.2%, 58.0%, 82.1%, 35.7%, 50.0%, and 50.0%, respectively. A2143G, A2142G, A2142C, and A2143G+A2142G mutation rates were 64.3%, 23.8%, 1.2%, and 10.7%, respectively. Strains harboring the A2142G mutation showed 5.3-fold higher clarithromycin MIC50 than those harboring the A2143G mutation. The A2143G mutation alone was 1.7-fold more common in vacA i2 strains compared with vacA i1 strains, while the A2142G mutation alone was 3-fold more frequent in vacA i1 strains than vacA i2 strains and 3.1-fold more common in metronidazole-susceptible compared with metronidazole-resistant strains. Briefly, clarithromycin resistance mutations were significantly linked to vacA i allele and metronidazole susceptibility. This is the first report about associations between the A2143G mutation and less virulent vacA i2 strains, and between the A2142G mutation and more virulent vacA i1 strains. As the 2143G mutation often predicts eradication failure by clarithromycin-based regimens, the results may be linked to the better eradication of more virulent strains compared with the less virulent strains.
An active site mutation increases the polymerase activity of the guinea pig-lethal Marburg virus.
Koehler, Alexander; Kolesnikova, Larissa; Becker, Stephan
2016-10-01
Marburg virus (MARV) causes severe, often fatal, disease in humans and transient illness in rodents. Sequential passaging of MARV in guinea pigs resulted in selection of a lethal virus containing 4 aa changes. A D184N mutation in VP40 (VP40D184N), which leads to a species-specific gain of viral fitness, and three mutations in the active site of viral RNA-dependent RNA polymerase L, which were investigated in the present study for functional significance in human and guinea pig cells. The transcription/replication activity of L mutants was strongly enhanced by a substitution at position 741 (S741C), and inhibited by other substitutions (D758A and A759D) in both species. The polymerase activity of L carrying the S741C substitution was eightfold higher in guinea pig cells than in human cells upon co-expression with VP40D184N, suggesting that the additive effect of the two mutations provides MARV a replicative advantage in the new host.
Highly sensitive and quantitative evaluation of the EGFR T790M mutation by nanofluidic digital PCR
Iwama, Eiji; Takayama, Koichi; Harada, Taishi; Okamoto, Isamu; Ookubo, Fumihiko; Kishimoto, Junji; Baba, Eishi; Oda, Yoshinao; Nakanishi, Yoichi
2015-01-01
The mutation of T790M in EGFR is a major mechanism of resistance to treatment with EGFR-TKIs. Only qualitative detection (presence or absence) of T790M has been described to date, however. Digital PCR (dPCR) analysis has recently been applied to the quantitative detection of target molecules in cancer with high sensitivity. In the present study, 25 tumor samples (13 obtained before and 12 after EGFR-TKI treatment) from 18 NSCLC patients with activating EGFR mutations were evaluated for T790M with dPCR. The ratio of the number of T790M alleles to that of activating mutation alleles (T/A) was determined. dPCR detected T790M in all 25 samples. Although T790M was present in all pre-TKI samples from 13 patients, 10 of these patients had a low T/A ratio and manifested substantial tumor shrinkage during treatment with EGFR-TKIs. In six of seven patients for whom both pre- and post-TKI samples were available, the T/A ratio increased markedly during EGFR-TKI treatment. Highly sensitive dPCR thus detected T790M in all NSCLC patients harboring activating EGFR mutations whether or not they had received EGFR-TKI treatment. Not only highly sensitive but also quantitative detection of T790M is important for evaluation of the contribution of T790M to EGFR-TKI resistance. PMID:26015401
Georgiou, Theodoros; Chuang, Jacinta L.; Wynn, R. Max; Stylianidou, Goula; Korson, Mark; Chuang, David T.
2009-01-01
We report five mutations, three of them novel, responsible for maple syrup urine disease in four unrelated Cypriot families. The five children studied are the first cases of classic maple syrup urine disease to be reported among Cypriots. The first novel mutation identified is a single-base deletion in exon 6 of the Elα gene (c.718delG), which leads to a frameshift after Ala240 and to a stop codon 89 residues further downstream. The other two novel mutations identified are in the Elβ subunit: a two-base deletion in exon 6, c.662_663delCC, which leads to a frameshift after Ala221 and creates a stop codon 17 residues further downstream, as well as a splice mutation, IVS3[+3]delA, which results in the skipping of exon 3. The two known mutations identified are in the Elα gene: the G > C transversion at the 3′-splice acceptor site, (IVS5-1G > C), which results in the deletion of the entire exon 6, and the missense mutation in exon 5 (c.632C > T), which corresponds to a p.Thr211Met substitution. The p.Thr211Met substitution is located in a potassium-ion pocket in the E1 component required for stability of the bound cofactor thiamine diphosphate. The mutant E1 protein harboring the p.Thr211Met substitution was shown unable to bind thiamine diphosphate, leading to undetectable E1 activity. PMID:19715473
The New Bedford Harbor Superfund Site Long Term ...
Background. New Bedford Harbor (NBH), located in southeastern Massachusetts, was designated as a marine Superfund site in 1983 due to sediment contamination by polychlorinated biphenyls (PCBs). Based on risks to human health and the environment, the first two phases of the site cleanup involved dredging PCB-contaminated sediments from the harbor. Therefore, a long-term monitoring program (LTM) was developed to measure spatial and temporal chemical and biological changes in sediment, water, and biota to assess the effects and effectiveness of the remedial activities. Approach. A systematic, probabilistic sampling design was used to select approximately 70 sediment sampling stations. Sediment was collected at each station and chemical (e.g., PCBs, metals), physical (e.g., grain size), and biological (e.g., benthic community) measurements were conducted on all samples. There have been six sample collections to date: 1993-baseline, 1995-post hot spot removal, 1999-prior to full scale dredging, and then at 5 year intervals: 2004, 2009, and 2014. Mussel (Mytilus edulis) bioaccumulation has also been measured twice yearly. Results. There is a decreasing spatial gradient in sediment PCB concentrations from the northern boundary (upper harbor) to the southern boundary (outer harbor) of the site. Along this same transect, there is an increase in biological condition (e.g., benthic community diversity). Temporally, the contaminant and biological gradients have been
Kumagai, Toru; Tomita, Yasuhiko; Nakatsuka, Shin-Ichi; Kimura, Madoka; Kunimasa, Kei; Inoue, Takako; Tamiya, Motohiro; Nishino, Kazumi; Susaki, Yoshiyuki; Kusu, Takashi; Tokunaga, Toshiteru; Okami, Jiro; Higashiyama, Masahiko; Imamura, Fumio
2018-04-01
Activating EGFR mutations, HER2, and HER3 are implicated in lung cancer; however, with the exception of EGFR gene amplification in lung adenocarcinoma harboring EGFR mutations, their involvement in disease progression during the early stages is poorly understood. In this paper, we focused on which receptor is correlated with lung adenocarcinoma progression in the presence or absence of EGFR mutation from stage 0 to IA1. HER2 and HER3 expression and activating EGFR mutations in surgically resected lung adenocarcinoma exhibiting ground glass nodules on chest computed tomography and re-classified to stage 0 and IA1 were examined by immunohistochemistry and peptide nucleic acid-locked nucleic acid PCR clamp method, respectively. HER2 and HER3 expression was detected in 22.2% and 86.1% of samples, respectively. The frequency of EGFR mutation was 45.7% and was not significantly different between stage 0 and IA1 (40.0% and 48.0%, respectively), suggesting that EGFR mutation does not correlate with cancer progression from stage 0 to IA1. HER2 expression also did not correlate to progression. However, not only the frequency, but also the intensity of HER3 expression was increased in stage IA1 lung adenocarcinoma, particularly in lung adenocarcinoma without EGFR mutation. HER3 tends to be intensively expressed during the progression of lung adenocarcinoma without EGFR mutation from carcinoma in situ to invasive carcinoma. © 2018 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.
Pearl Harbor Biological Survey
1974-08-30
properties, uses, and driving mechanisms affecting the harbor is given. The methods of obtaining current data, salinity profiles, and temperature... salinities were used for each calibration In order to check the salinity computation mechanism of the Instrument. Temperature calibrations were...Water Temperature Contours for Navy Thermal Discharges 3.2-23 3.2-7. General Layout of Pearl Harbor Showing Mean Monthly Salinity (3L) Variation
Loeppen, Sandra; Schneider, Daniela; Gaunitz, Frank; Gebhardt, Rolf; Kurek, Raffael; Buchmann, Albrecht; Schwarz, Michael
2002-10-15
Phenobarbital (PB) is an antiepileptic drug that promotes hepatocarcinogenesis in rodents when administered subsequent to an initiating carcinogen like N-nitrosodiethylamine (DEN). In the mouse, the promotional effect of PB on liver tumor development results from a selective stimulation of clonal outgrowth of hepatocytes harboring activating mutations in the beta-catenin gene. Because glutamine synthetase (GS) has recently been shown to be a putative transcriptional target of beta-catenin, expression of GS during PB-mediated promotion of mouse hepatocarcinogenesis was investigated. Preneoplastic and neoplastic liver lesions were induced in 6-week-old male mice by a single injection of 90 micro g/g body weight of DEN, and groups of mice were subsequently kept on PB-containing (0.05%) or control diet for 39 weeks. In PB-treated mice, 46 of 51 lesions ( approximately 90%) were GS-positive in contrast to only 16 of 46 ( approximately 35%) in mice not treated with PB. Approximately 33% of liver was occupied by neoplastic tissue in PB-treated mice, of which >80% was GS positive. By contrast, only approximately 3.5% of liver consisted of neoplastic tissue in mice treated with DEN only, and approximately 25% of this was GS positive. We have previously shown that beta-catenin mutations are present in approximately 80% of liver tumors from PB-treated mice but are absent in liver tumors from mice treated with DEN only. By analyzing a panel of larger liver tumors, we now observed that tumors harboring beta-catenin mutations were GS positive, whereas tumors without beta-catenin mutations were GS negative. Similarly, tumors from an additional mouse carcinogenicity experiment where PB inhibited rather than promoted hepatocarcinogenesis were mostly GS negative. These data suggest that promotion of hepatocarcinogenesis by PB confers beta-catenin-mutated tumor cells with a selective advantage by up-regulation of GS expression.
Sediment toxicity in Savannah Harbor
Winger, P.V.; Lasier, P.J.
1995-01-01
Savannah Harbor, located near the mouth of the Savannah River, Georgia and South Carolina, is impacted by industrial and municipal effluents. Potential release of contaminants stored in harbor sediments through dredging and shipping operations requires that contaminated areas be identified for proper management of the system and protection of wildlife resources. During 1991, Hyalella azteca were exposed in 10-d static-renewal toxicity tests to pore-water and solid-phase sediment samples collected from 26 sites within Savannah Harbor. Pore-water toxicity was more pronounced than that for solidphase sediment. Toxicity and reduced leaf consumption demonstrated impaired sediment quality at specific sites within Savannah Harbor and Back River. Factors responsible for the decreased sediment quality were ammonia, alkalinity, and metal concentrations (cadmium, chromium, lead, molybdenum, and nickel). Elevated concentrations of metals and toxicities in Back River sediments indicated impacts from adjacent dredge-spoil areas.
Subsidence at the Fairport Harbor Water Level Gauge
NASA Astrophysics Data System (ADS)
Conner, D. A.
2014-12-01
SUBSIDENCE AT THE FAIRPORT HARBOR WATER LEVEL GAUGE I will provide information on methods being used to monitor Lake Erie water levels and earth movement at Fairport Harbor, Ohio. Glacial Isostatic Adjustment (GIA) is responsible for vertical movement throughout the Great Lakes region. Fairport Harbor is also experiencing vertical movement due to salt mining, so the nearby water level gauge operated by the National Oceanic and Atmospheric Administration (NOAA) is affected by both GIA and mining. NOAA's National Geodetic Survey (NGS) defines and maintains the National Spatial Reference System (NSRS). The NSRS includes a network of permanently marked points; a consistent, accurate, and up-to-date national shoreline; a network of Continuously Operating Reference Stations (CORS) which supports three-dimensional positioning activities; and a set of accurate models describing dynamic, geophysical processes that affect spatial measurements. The NSRS provides the spatial reference foundation for transportation, mapping, charting and a multitude of scientific and engineering applications. Fundamental elements of geodetic infrastructure include GPS CORS (3-D), water level and tide gauges (height) and a system of vertical bench marks (height). When two or more of these elements converge they may provide an independent determination of position and vertical stability as is the case here at the Fairport Harbor water level gauge. Analysis of GPS, leveling and water level data reveal that this gauge is subsiding at about 2-3 mm/year, independent of the effects of GIA. Analysis of data from the nearby OHLA GPS CORS shows it subsiding at about 4 mm/yr, four times faster than expected due to GIA alone. A long history of salt mine activity in the area is known to geologists but it came as a surprise to other scientists.
Deihimi, Safoora; Lev, Avital; Slifker, Michael; Shagisultanova, Elena; Xu, Qifang; Jung, Kyungsuk; Vijayvergia, Namrata; Ross, Eric A; Xiu, Joanne; Swensen, Jeffrey; Gatalica, Zoran; Andrake, Mark; Dunbrack, Roland L; El-Deiry, Wafik S
2017-06-20
Deficient mismatch repair (MMR) and microsatellite instability (MSI) contribute to ~15% of colorectal cancer (CRCs). We hypothesized MSI leads to mutations in DNA repair proteins including BRCA2 and cancer drivers including EGFR. We analyzed mutations among a discovery cohort of 26 MSI-High (MSI-H) and 558 non-MSI-H CRCs profiled at Caris Life Sciences. Caris-profiled MSI-H CRCs had high mutation rates (50% vs 14% in non-MSI-H, P < 0.0001) in BRCA2. Of 1104 profiled CRCs from a second cohort (COSMIC), MSH2/MLH1-mutant CRCs showed higher mutation rates in BRCA2 compared to non-MSH2/MLH1-mutant tumors (38% vs 6%, P < 0.0000001). BRCA2 mutations in MSH2/MLH1-mutant CRCs included 75 unique mutations not known to occur in breast or pancreatic cancer per COSMIC v73. Only 5 deleterious BRCA2 mutations in CRC were previously reported in the BIC database as germ-line mutations in breast cancer. Some BRCA2 mutations were predicted to disrupt interactions with partner proteins DSS1 and RAD51. Some CRCs harbored multiple BRCA2 mutations. EGFR was mutated in 45.5% of MSH2/MLH1-mutant and 6.5% of non-MSH2/MLH1-mutant tumors (P < 0.0000001). Approximately 15% of EGFR mutations found may be actionable through TKI therapy, including N700D, G719D, T725M, T790M, and E884K. NTRK gene mutations were identified in MSH2/MLH1-mutant CRC including NTRK1 I699V, NTRK2 P716S, and NTRK3 R745L. Our findings have clinical relevance regarding therapeutic targeting of BRCA2 vulnerabilities, EGFR mutations or other identified oncogenic drivers such as NTRK in MSH2/MLH1-mutant CRCs or other tumors with mismatch repair deficiency.
Brief report: EGFR L858M/L861Q cis mutations confer selective sensitivity to afatinib
Saxon, Jamie A.; Sholl, Lynette M.; Jänne, Pasi A.
2017-01-01
Introduction Tyrosine kinase inhibitors (TKIs) have been developed to treat patients with epidermal growth factor receptor (EGFR)-mutant lung cancers. However, the therapeutic efficacy of TKIs in patients with uncommon EGFR mutations remains unclear. Methods Next-generation sequencing was performed on a patient’s lung adenocarcinoma tumor sample, revealing rare combined in cis (on the same allele) EGFR mutations. Stable Ba/F3 and NIH-3T3 cell lines harboring the mutations were established to investigate the effect of first, second, and third generation EGFR TKIs on cell proliferation by MTS assay and EGFR phosphorylation by Western blotting. Results EGFR L858M/L861Q mutations in cis were detected in a non-small cell lung cancer patient’s tumor. The patient demonstrated primary resistance to erlotinib and was subsequently treated with afatinib, which caused tumor regression. In in vitro studies, first and third generation TKIs exhibited a decreased capacity to prevent EGFR phosphorylation and inhibit cell proliferation in EGFR L858M/L861Q cells compared to cells harboring the common EGFR L858R point mutation. In contrast, afatinib treatment reduced proliferation and inhibited EGFR phosphorylation in L858M/L861Q and L858R mutant cells at similar concentrations. Conclusions Afatinib may be a beneficial therapeutic option for a subset of lung cancer patients with rare EGFR mutations in their tumors. Understanding how uncommon mutations affect protein structure and TKI binding will be important for identifying effective targeted therapies for these patients. PMID:28088511
Safdar, Adeel; Bourgeois, Jacqueline M.; Ogborn, Daniel I.; Little, Jonathan P.; Hettinga, Bart P.; Akhtar, Mahmood; Thompson, James E.; Melov, Simon; Mocellin, Nicholas J.; Kujoth, Gregory C.; Prolla, Tomas A.; Tarnopolsky, Mark A.
2011-01-01
A causal role for mitochondrial DNA (mtDNA) mutagenesis in mammalian aging is supported by recent studies demonstrating that the mtDNA mutator mouse, harboring a defect in the proofreading-exonuclease activity of mitochondrial polymerase gamma, exhibits accelerated aging phenotypes characteristic of human aging, systemic mitochondrial dysfunction, multisystem pathology, and reduced lifespan. Epidemiologic studies in humans have demonstrated that endurance training reduces the risk of chronic diseases and extends life expectancy. Whether endurance exercise can attenuate the cumulative systemic decline observed in aging remains elusive. Here we show that 5 mo of endurance exercise induced systemic mitochondrial biogenesis, prevented mtDNA depletion and mutations, increased mitochondrial oxidative capacity and respiratory chain assembly, restored mitochondrial morphology, and blunted pathological levels of apoptosis in multiple tissues of mtDNA mutator mice. These adaptations conferred complete phenotypic protection, reduced multisystem pathology, and prevented premature mortality in these mice. The systemic mitochondrial rejuvenation through endurance exercise promises to be an effective therapeutic approach to mitigating mitochondrial dysfunction in aging and related comorbidities. PMID:21368114
Demagny, Hadrien; De Robertis, Edward M
2016-01-01
The tumor suppressor Smad4/DPC4 is an essential transcription factor in the TGF-β pathway and is frequently mutated or deleted in prostate, colorectal, and pancreatic carcinomas. We recently discovered that Smad4 activity and stability are regulated by the FGF/EGF and Wnt signaling pathways through a series of MAPK and GSK3 phosphorylation sites located in its linker region. In the present study, we report that loss-of-function associated with 2 point mutations commonly found in colorectal and pancreatic cancers results from enhanced Smad4 phosphorylation by GSK3, generating a phosphodegron that leads to subsequent β-TrCP–mediated polyubiquitination and proteasomal degradation. Using chemical GSK3 inhibitors, we show that Smad4 point mutant proteins can be stabilized and TGF-β signaling restored in cancer cells harboring such mutations. PMID:27308538
HER2 mutations in lung adenocarcinomas: A report from the Lung Cancer Mutation Consortium.
Pillai, Rathi N; Behera, Madhusmita; Berry, Lynne D; Rossi, Mike R; Kris, Mark G; Johnson, Bruce E; Bunn, Paul A; Ramalingam, Suresh S; Khuri, Fadlo R
2017-11-01
Human epidermal growth factor receptor 2 (HER2) mutations have been reported in lung adenocarcinomas. Herein, the authors describe the prevalence, clinical features, and outcomes associated with HER2 mutations in 1007 patients in the Lung Cancer Mutation Consortium (LCMC). Patients with advanced-stage lung adenocarcinomas were enrolled to the LCMC. Tumor specimens were assessed for diagnosis and adequacy; multiplexed genotyping was performed in Clinical Laboratory Improvement Amendments (CLIA)-certified laboratories to examine 10 oncogenic drivers. The LCMC database was queried for patients with HER2 mutations to access demographic data, treatment history, and vital status. An exploratory analysis was performed to evaluate the survival of patients with HER2 mutations who were treated with HER2-directed therapies. A total of 920 patients were tested for HER2 mutations; 24 patients (3%) harbored exon 20 insertion mutations (95% confidence interval, 2%-4%). One patient had a concurrent mesenchymal-epithelial transition factor (MET) amplification. The median age of the patients was 62 years, with a slight predominance of females over males (14 females vs 10 males). The majority of the patients were never-smokers (71%) and presented with advanced disease at the time of diagnosis. The median survival for patients who received HER2-targeted therapies (12 patients) was 2.1 years compared with 1.4 years for those who did not (12 patients) (P = .48). Patients with HER2 mutations were found to have inferior survival compared with the rest of the LCMC cohort with other mutations: the median survival was 3.5 years in the LCMC population receiving targeted therapy and 2.4 years for patients not receiving targeted therapy. HER2 mutations were detected in 3% of patients with lung adenocarcinoma in the LCMC. HER2-directed therapies should be investigated in this subgroup of patients. Cancer 2017;123:4099-4105. © 2017 American Cancer Society. © 2017 American Cancer Society.
A hotspot in the glucocorticoid receptor DNA-binding domain susceptible to loss of function mutation
Banuelos, Jesus; Shin, Soon Cheon; Lu, Nick Z.
2015-01-01
Glucocorticoids (GCs) are used to treat a variety of inflammatory disorders and certain cancers. However, GC resistance occurs in subsets of patients. We found that EL4 cells, a GC-resistant mouse thymoma cell line, harbored a point mutation in their GC receptor (GR) gene, resulting in the substitution of arginine 493 by a cysteine in the second zinc finger of the DNA-binding domain. Allelic discrimination analyses revealed that the R493C mutation occurred on both alleles. In the absence of GCs, the GR in EL4 cells localized predominantly in the cytoplasm and upon dexamethasone treatment underwent nuclear translocation, suggesting the ligand binding ability of the GR in EL4 cells was intact. In transient transfection assays, the R493C mutant could not transactivate the MMTV-luciferase reporter. Site-directed mutagenesis to revert the R493C mutation restored the transactivation activity. Cotransfection experiments showed that the R493C mutant did not inhibit the transcriptional activities of the wild-type GR. In addition, the R493C mutant did not repress either the AP-1 or NF-κB reporters as effectively as WT GR. Furthermore, stable expression of the WT GR in the EL4 cells enabled GC-mediated gene regulation, specifically upregulation of IκBα and downregulation of interferon γ and interleukin 17A. Arginine 493 is conserved among multiple species and all human nuclear receptors and its mutation has also been found in the human GR, androgen receptor, and mineralocorticoid receptor. Thus, R493 is necessary for the transcriptional activity of the GR and a hotspot for mutations that result in GC resistance. PMID:25676786
Autoimmune manifestations in SCID due to IL7R mutations: Omenn syndrome and cytopenias.
Zago, Claudia Augusta; Jacob, Cristina Miuki Abe; de Albuquerque Diniz, Edna Maria; Lovisolo, Silvana Maria; Zerbini, Maria Claudia Nogueira; Dorna, Mayra; Watanabe, Letícia; Fernandes, Juliana Folloni; Rocha, Vanderson; Oliveira, João Bosco; Carneiro-Sampaio, Magda
2014-07-01
B+NK+SCID (severe combined immunodeficiency) due to IL7Rα deficiency represents approximately 10% of American SCID cases. To better understand the spectrum of autoimmune disorders associated with IL7Rα deficiency, we describe two unrelated IL7Rα-deficient female SCID infants whose clinical picture was dominated by autoimmune manifestations: one with intrauterine Omenn syndrome (OS) and another with persistent thrombocytopenic purpura since 4months of age. The OS baby harbored a homozygous p.C118Y mutation in IL7R. She presented dense eosinophilic infiltrates in several organs, including pancarditis, which may have contributed to her death (on the 2nd day of life). B cells were observed in lymph nodes, spleen, bone marrow and thymus. The second patient harbored compound heterozygous p.C118Y and p.I121NfsX8 mutations. She underwent a successful unrelated cord blood transplant. In conclusion, early OS can be observed in patients with IL7R mutations, and autoimmune cytopenias could also complicate the clinical course of SCID babies with this type of defect. Copyright © 2014. Published by Elsevier Inc.
33 CFR 80.1122 - Channel Islands Harbor, CA.
Code of Federal Regulations, 2012 CFR
2012-07-01
... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1122 Channel Islands Harbor, CA. (a) A line drawn from Channel Islands Harbor South Jetty Light 2 to Channel Islands Harbor Breakwater... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Channel Islands Harbor, CA. 80...
33 CFR 80.1122 - Channel Islands Harbor, CA.
Code of Federal Regulations, 2010 CFR
2010-07-01
... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1122 Channel Islands Harbor, CA. (a) A line drawn from Channel Islands Harbor South Jetty Light 2 to Channel Islands Harbor Breakwater... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Channel Islands Harbor, CA. 80...
33 CFR 80.1122 - Channel Islands Harbor, CA.
Code of Federal Regulations, 2014 CFR
2014-07-01
... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1122 Channel Islands Harbor, CA. (a) A line drawn from Channel Islands Harbor South Jetty Light 2 to Channel Islands Harbor Breakwater... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Channel Islands Harbor, CA. 80...
33 CFR 80.1122 - Channel Islands Harbor, CA.
Code of Federal Regulations, 2013 CFR
2013-07-01
... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1122 Channel Islands Harbor, CA. (a) A line drawn from Channel Islands Harbor South Jetty Light 2 to Channel Islands Harbor Breakwater... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Channel Islands Harbor, CA. 80...
33 CFR 80.1122 - Channel Islands Harbor, CA.
Code of Federal Regulations, 2011 CFR
2011-07-01
... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1122 Channel Islands Harbor, CA. (a) A line drawn from Channel Islands Harbor South Jetty Light 2 to Channel Islands Harbor Breakwater... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Channel Islands Harbor, CA. 80...
Rattarittamrong, Ekarat; Tantiworawit, Adisak; Kumpunya, Noppamas; Wongtagan, Ornkamon; Tongphung, Ratchanoo; Phusua, Arunee; Chai-Adisaksopha, Chatree; Hantrakool, Sasinee; Rattanathammethee, Thanawat; Norasetthada, Lalita; Charoenkwan, Pimlak; Lekawanvijit, Suree
2018-03-09
The primary objective was to determine the prevalence of calreticulin (CALR) mutation in patients with non-JAK2V617F mutated essential thrombocythemia (ET). The secondary objectives were to evaluate the accuracy of CALR mutation analysis by high-resolution melting (HRM) analysis and real-time polymerase chain reaction (PCR) compared with DNA sequencing and to compare clinical characteristics of CALR mutated and JAK2V617F mutated ET. This was a prospective cohort study involving ET patients registered at Chiang Mai University in the period September 2015-September 2017 who were aged more than 2 years, and did not harbor JAK2V617F mutation. The presence of CALR mutation was established by DNA sequencing, HRM, and real-time PCR for type 1 and type 2 mutation. Clinical data were compared with that from ET patients with mutated JAK2V617F. Twenty-eight patients were enrolled onto the study. CALR mutations were found in 10 patients (35.7%). Three patients had type 1 mutation, 5 patients had type 2 mutation, 1 patient had type 18 mutation, and 1 patients had novel mutations (c.1093 C-G, c.1098_1131 del, c.1135 G-A). HRM could differentiate between the types of mutation in complete agreement with DNA sequencing. Patients with a CALR mutation showed a significantly greater male predominance and had a higher platelet count when compared with 42 JAK2V617F patients. The prevalence of CALR mutation in JAK2V617F-negative ET in this study is 35.7%. HRM is an effective method of detecting CALR mutation and is a more advantageous method of screening for CALR mutation.
Order Matters: The Order of Somatic Mutations Influences Cancer Evolution.
Kent, David G; Green, Anthony R
2017-04-03
Cancers evolve as a consequence of multiple somatic lesions, with competition between subclones and sequential subclonal evolution. Some driver mutations arise either early or late in the evolution of different individual tumors, suggesting that the final malignant properties of a subclone reflect the sum of mutations acquired rather than the order in which they arose. However, very little is known about the cellular consequences of altering the order in which mutations are acquired. Recent studies of human myeloproliferative neoplasms show that the order in which individual mutations are acquired has a dramatic impact on the cell biological and molecular properties of tumor-initiating cells. Differences in clinical presentation, complications, and response to targeted therapy were all observed and implicate mutation order as an important player in cancer biology. These observations represent the first demonstration that the order of mutation acquisition influences stem and progenitor cell behavior and clonal evolution in any cancer. Thus far, the impact of different mutation orders has only been studied in hematological malignancies, and analogous studies of solid cancers are now required. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.
Cardiac muscle activation blunted by a mutation to the regulatory component, troponin T.
Kobayashi, Minae; Debold, Edward P; Turner, Matthew A; Kobayashi, Tomoyoshi
2013-09-06
The striated muscle thin filament comprises actin, tropomyosin, and troponin. The Tn complex consists of three subunits, troponin C (TnC), troponin I (TnI), and troponin T (TnT). TnT may serve as a bridge between the Ca(2+) sensor (TnC) and the actin filament. In the short helix preceding the IT-arm region, H1(T2), there are known dilated cardiomyopathy-linked mutations (among them R205L). Thus we hypothesized that there is an element in this short helix that plays an important role in regulating the muscle contraction, especially in Ca(2+) activation. We mutated Arg-205 and several other amino acid residues within and near the H1(T2) helix. Utilizing an alanine replacement method to compare the effects of the mutations, the biochemical and mechanical impact on the actomyosin interaction was assessed by solution ATPase activity assay, an in vitro motility assay, and Ca(2+) binding measurements. Ca(2+) activation was markedly impaired by a point mutation of the highly conserved basic residue R205A, residing in the short helix H1(T2) of cTnT, whereas the mutations to nearby residues exhibited little effect on function. Interestingly, rigor activation was unchanged between the wild type and R205A TnT. In addition to the reduction in Ca(2+) sensitivity observed in Ca(2+) binding to the thin filament, myosin S1-ADP binding to the thin filament was significantly affected by the same mutation, which was also supported by a series of S1 concentration-dependent ATPase assays. These suggest that the R205A mutation alters function through reduction in the nature of cooperative binding of S1.
Germline cytotoxic lymphocytes defective mutations in Chinese patients with lymphoma.
Chen, Xue; Zhang, Yang; Wang, Fang; Wang, Mangju; Teng, Wen; Lin, Yuehui; Han, Xiangping; Jin, Fangyuan; Xu, Yuanli; Cao, Panxiang; Fang, Jiancheng; Zhu, Ping; Tong, Chunrong; Liu, Hongxing
2017-11-01
Certain patients with lymphoma may harbor mutations in perforin 1 (PRF1), unc-13 homolog D (UNC13D), syntaxin 11 (STX11), STXBP2 (syntaxin binding protein 2) or SH2 domain containing 1A (SH2D1A), which causes functional defects of cytotoxic lymphocytes. Data regarding the association between genetic defects and the development of lymphoma in Chinese patients are limited to date. In the present study, 90 patients with lymphoma were analyzed for UNC13D, PRF1, STXBP2, STX11, SH2D1A and X-linked inhibitor of apoptosis. Mutations were observed in 24 (26.67%) patients; 16 patients exhibited mutations in UNC13D, 7 exhibited PRF1 mutations, and 1 exhibited monoallelic mutation in STX11. UNC13D c.2588G>A/p.G863D mutation was detected in 9 patients (10.00%) and in 4/210 controls (1.90%). This mutation was predicted to be pathogenic and it predominantly existed in the Chinese population. These findings suggest that impaired cytotoxic machinery may represent a predisposing factor for the development of lymphoma. Furthermore, these data describe a distinct mutation spectrum in Chinese patients with lymphoma, whereby UNC13D is the most frequently mutated gene. In addition, these findings suggest UNC13D c.2588G>A mutation is a founder mutation in Chinese patients.
Germline cytotoxic lymphocytes defective mutations in Chinese patients with lymphoma
Chen, Xue; Zhang, Yang; Wang, Fang; Wang, Mangju; Teng, Wen; Lin, Yuehui; Han, Xiangping; Jin, Fangyuan; Xu, Yuanli; Cao, Panxiang; Fang, Jiancheng; Zhu, Ping; Tong, Chunrong; Liu, Hongxing
2017-01-01
Certain patients with lymphoma may harbor mutations in perforin 1 (PRF1), unc-13 homolog D (UNC13D), syntaxin 11 (STX11), STXBP2 (syntaxin binding protein 2) or SH2 domain containing 1A (SH2D1A), which causes functional defects of cytotoxic lymphocytes. Data regarding the association between genetic defects and the development of lymphoma in Chinese patients are limited to date. In the present study, 90 patients with lymphoma were analyzed for UNC13D, PRF1, STXBP2, STX11, SH2D1A and X-linked inhibitor of apoptosis. Mutations were observed in 24 (26.67%) patients; 16 patients exhibited mutations in UNC13D, 7 exhibited PRF1 mutations, and 1 exhibited monoallelic mutation in STX11. UNC13D c.2588G>A/p.G863D mutation was detected in 9 patients (10.00%) and in 4/210 controls (1.90%). This mutation was predicted to be pathogenic and it predominantly existed in the Chinese population. These findings suggest that impaired cytotoxic machinery may represent a predisposing factor for the development of lymphoma. Furthermore, these data describe a distinct mutation spectrum in Chinese patients with lymphoma, whereby UNC13D is the most frequently mutated gene. In addition, these findings suggest UNC13D c.2588G>A mutation is a founder mutation in Chinese patients. PMID:29113160
Taylor, David I
2010-04-01
Boston Harbor, a bay-estuary in the north-east USA, has recently been the site of one of the largest wastewater infrastructure projects conducted in the USA, the Boston Harbor Project (BHP). The BHP, which was conducted from 1991 to 2000, ended over a century of direct wastewater treatment facility discharges to the harbor. The BHP caused the loadings of total nitrogen (TN), total phosphorus (TP), total suspended solids (TSS) and particulate organic carbon (POC) to the harbor, to decrease by between 80% and 90%. Approximately one-third of the decreases in TSS and POC loadings occurred between 1991 and 1992; the remaining two-thirds, between 1995 and 2000. For TN and TP, the bulk of the decreases occurred between 1997 or 1998, and 2000. (c) 2009 Elsevier Ltd. All rights reserved.
Two novel CHN1 mutations in two families with Duane’s retraction syndrome
Chan, Wai-Man; Miyake, Noriko; Zhu-Tam, Lily; Andrews, Caroline; Engle, Elizabeth C.
2012-01-01
Objective To determine the genetic cause of Duane’s retraction syndrome (DRS) in two families segregating DRS as an autosomal dominant trait. Method Members of two unrelated pedigrees were enrolled in an ongoing genetic study. Linkage analysis was performed using fluorescent microsatellite markers flanking the CHN1 locus. Probands and family members were screened for CHN1 mutations. Results Of the six clinically affected individuals in the two pedigrees, three have bilateral and three have unilateral DRS. Both pedigrees are consistent with linkage to the DURS2 locus, one with complete and one with incomplete penetrance. Sequence analysis revealed the pedigrees segregate novel heterozygous missense CHN1 mutations, c.422C>T and c.754C>T, predicted to result in α2-chimaerin amino acid substitutions P141L and P252S, respectively. Conclusion Genetic analysis of two pedigrees segregating nonsyndromic DRS reveals two novel mutations in CHN1, bringing the number of DRS pedigrees know to harbor CHN1 mutations, and the number of unique CHN1 mutations, from seven to nine. Both mutations identified in this study alter residues that participate in intramolecular interactions that stabilize the inactive, closed conformation of α2-chimerin, and thus are predicted to result in its hyper-activation. Moreover, amino acid residue P252 was altered to a different residue in a previously reported DRS pedigree; thus, this is the first report of two CHN1 mutations altering the same residue, further supporting a gain-of-function etiology. Clinical Relevance Members of families segregating DRS as an autosomal dominant trait should be screened for mutations in the CHN1 gene, enhancing genetic counseling and permitting earlier diagnosis. PMID:21555619
Farag, S; van der Kolk, L E; van Boven, H H; van Akkooi, A C J; Beets, G L; Wilmink, J W; Steeghs, N
2018-04-01
Gastrointestinal stromal tumors (GISTs) occur mostly sporadically. GISTs associated with a familial syndrome are very rare and are mostly wild type for KIT and platelet-derived growth factor alpha (PDGFRA). To date 35 kindreds and 8 individuals have been described with GISTs associated with germline KIT mutations. This is the third family described with a germline p.Trp557Arg mutation in exon 11 of the KIT gene. The effect of imatinib in patients harboring a germline KIT mutation has been rarely described. Moreover, in some studies imatinib treatment was withheld considering the lack of evidence for efficacy of this treatment in GIST patients harboring a germline KIT mutation. This paper describes a 52-year old patient with a de novo germline p.Trp557Arg mutation with multiple GISTs throughout the gastrointestinal tract and cutaneous hyperpigmentation. Imatinib treatment showed long-term regression of the GISTs and evident pathological response was seen after resection. Remarkably, the hyperpigmentation of the skin also diminished during imatinib treatment. Genetic screening of the family revealed the same mutation in two daughters, both with similar cutaneous hyperpigmentation. One daughter, aged 23, was diagnosed with multiple small intestine GISTs, which were resected. She was treated with adjuvant imatinib which prompted rapid regression of the cutaneous hyperpigmentation. Imatinib treatment in GIST patients harboring a germline KIT mutation shows favorable and long-term responses in both the tumor and the phenotypical hyperpigmentation.
CD45RO enriches for activated, highly mutated human germinal center B cells
Jackson, Stephen M.; Harp, Natessa; Patel, Darshna; Zhang, Jeffrey; Willson, Savannah; Kim, Yoon J.; Clanton, Christian
2007-01-01
To date, there is no consensus regarding the influence of different CD45 isoforms during peripheral B-cell development. Examining correlations between surface CD45RO expression and various physiologic processes ongoing during the germinal center (GC) reaction, we hypothesized that GC B cells, like T cells, that up-regulate surface RO should progressively acquire phenotypes commonly associated with activated, differentiating lymphocytes. GC B cells (IgD−CD38+) were subdivided into 3 surface CD45RO fractions: RO−, RO+/−, and RO+. We show here that the average number of mutations per IgVH transcript increased in direct correlation with surface RO levels. Conjunctional use of RO and CD69 further delineated low/moderately and highly mutated fractions. Activation-induced cytidine deaminase (AID) mRNA was slightly reduced among RO+ GC B cells, suggesting that higher mutation averages are unlikely due to elevated somatic mutation activity. Instead, RO+ GC B cells were negative for Annexin V, comprised mostly (93%) of CD77− centrocytes, and were enriched for CD69+ cells. Collectively, RO+ GC B cells occupy what seems to be a specialized niche comprised mostly of centrocytes that may be in transition between activation states. These findings are among the first to sort GC B cells into populations enriched for live mutated cells solely using a single extracellular marker. PMID:17644737
Novel KRAS Gene Mutations in Sporadic Colorectal Cancer
Naser, Walid M.; Shawarby, Mohamed A.; Al-Tamimi, Dalal M.; Seth, Arun; Al-Quorain, Abdulaziz; Nemer, Areej M. Al; Albagha, Omar M. E.
2014-01-01
Introduction In this article, we report 7 novel KRAS gene mutations discovered while retrospectively studying the prevalence and pattern of KRAS mutations in cancerous tissue obtained from 56 Saudi sporadic colorectal cancer patients from the Eastern Province. Methods Genomic DNA was extracted from formalin-fixed, paraffin-embedded cancerous and noncancerous colorectal tissues. Successful and specific PCR products were then bi-directionally sequenced to detect exon 4 mutations while Mutector II Detection Kits were used for identifying mutations in codons 12, 13 and 61. The functional impact of the novel mutations was assessed using bioinformatics tools and molecular modeling. Results KRAS gene mutations were detected in the cancer tissue of 24 cases (42.85%). Of these, 11 had exon 4 mutations (19.64%). They harbored 8 different mutations all of which except two altered the KRAS protein amino acid sequence and all except one were novel as revealed by COSMIC database. The detected novel mutations were found to be somatic. One mutation is predicted to be benign. The remaining mutations are predicted to cause substantial changes in the protein structure. Of these, the Q150X nonsense mutation is the second truncating mutation to be reported in colorectal cancer in the literature. Conclusions Our discovery of novel exon 4 KRAS mutations that are, so far, unique to Saudi colorectal cancer patients may be attributed to environmental factors and/or racial/ethnic variations due to genetic differences. Alternatively, it may be related to paucity of clinical studies on mutations other than those in codons 12, 13, 61 and 146. Further KRAS testing on a large number of patients of various ethnicities, particularly beyond the most common hotspot alleles in exons 2 and 3 is needed to assess the prevalence and explore the exact prognostic and predictive significance of the discovered novel mutations as well as their possible role in colorectal carcinogenesis. PMID:25412182
Preclinical Evaluation of Vemurafenib as Therapy for BRAFV600E Mutated Sarcomas.
Gouravan, Sarina; Meza-Zepeda, Leonardo A; Myklebost, Ola; Stratford, Eva W; Munthe, Else
2018-03-23
The BRAF V600E mutation, which in melanoma is targetable with vemurafenib, is also found in sarcomas and we here evaluate the therapeutic potential in sarcoma cell lines. Four sarcoma cell lines harboring the BRAFV600E mutation, representing liposarcomas (SA-4 and SW872), Ewing sarcoma (A673) and atypical synovial sarcoma (SW982), were treated with vemurafenib and the effects on cell growth, apoptosis, cell cycle progression and cell signaling were determined. Vemurafenib induced a strong cytostatic effect in SA-4 cells, mainly due to cell cycle arrest, whereas only moderate levels of apoptosis were observed. However, a high dose was required compared to BRAF V600E mutated melanoma cells, and removal of vemurafenib demonstrated that the continuous presence of drug was required for sustained growth inhibition. A limited growth inhibition was observed in the other three cell lines. Protein analyses demonstrated reduced phosphorylation of ERK during treatment with vemurafenib in all the four sarcoma cell lines confirming that the MAPK pathway is active in these cell lines, and that the pathway can be inhibited by vemurafenib, but also that these cells can proliferate despite this. These findings indicate that vemurafenib alone would not be an efficient therapy against BRAF V600E mutated sarcomas. However, further investigations of combination with other drugs are warranted.
33 CFR 110.38 - Edgartown Harbor, Mass.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Edgartown Harbor, Mass. 110.38 Section 110.38 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.38 Edgartown Harbor, Mass. An area in the inner harbor...
33 CFR 110.38 - Edgartown Harbor, Mass.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Edgartown Harbor, Mass. 110.38 Section 110.38 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.38 Edgartown Harbor, Mass. An area in the inner harbor...
33 CFR 110.38 - Edgartown Harbor, Mass.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Edgartown Harbor, Mass. 110.38 Section 110.38 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.38 Edgartown Harbor, Mass. An area in the inner harbor...
33 CFR 110.38 - Edgartown Harbor, Mass.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Edgartown Harbor, Mass. 110.38 Section 110.38 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.38 Edgartown Harbor, Mass. An area in the inner harbor...
33 CFR 110.38 - Edgartown Harbor, Mass.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Edgartown Harbor, Mass. 110.38 Section 110.38 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.38 Edgartown Harbor, Mass. An area in the inner harbor...
Big Bay Harbor Operation and Maintenance Activities, Marquette County, Michigan.
1975-04-01
and Custom House St. Paul, Minnesota 55101 April 1975 ENVIRON1ENTAL ASSESSMENT REPORT OPERATION AND MAINTENANCE BIG BAY HARBOR BIG BAY, MICHIGAN LAKE...these parameters is important because of the deleterious effects of the parent and breakdown products. The presence of heavy metals, taconite tailings...iron mines further south in the county. 2.522 Powell Township is governed by a town supervisor and town board, all of whom are elected. The town owns a
Dopamine Induces Oscillatory Activities in Human Midbrain Neurons with Parkin Mutations.
Zhong, Ping; Hu, Zhixing; Jiang, Houbo; Yan, Zhen; Feng, Jian
2017-05-02
Locomotor symptoms in Parkinson's disease (PD) are accompanied by widespread oscillatory neuronal activities in basal ganglia. Here, we show that activation of dopamine D1-class receptors elicits a large rhythmic bursting of spontaneous excitatory postsynaptic currents (sEPSCs) in midbrain neurons differentiated from induced pluripotent stem cells (iPSCs) of PD patients with parkin mutations, but not normal subjects. Overexpression of wild-type parkin, but not its PD-causing mutant, abolishes the oscillatory activities in patient neurons. Dopamine induces a delayed enhancement in the amplitude of spontaneous, but not miniature, EPSCs, thus increasing quantal content. The results suggest that presynaptic regulation of glutamatergic transmission by dopamine D1-class receptors is significantly potentiated by parkin mutations. The aberrant dopaminergic regulation of presynaptic glutamatergic transmission in patient-specific iPSC-derived midbrain neurons provides a mechanistic clue to PD pathophysiology, and it demonstrates the usefulness of this model system in understanding how mutations of parkin cause movement symptoms in Parkinson's disease. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Kuschal, Christiane; Botta, Elena; Orioli, Donata; Digiovanna, John J.; Seneca, Sara; Keymolen, Kathelijn; Tamura, Deborah; Heller, Elizabeth; Khan, Sikandar G.; Caligiuri, Giuseppina; Lanzafame, Manuela; Nardo, Tiziana; Ricotti, Roberta; Peverali, Fiorenzo A.; Stephens, Robert; Zhao, Yongmei; Lehmann, Alan R.; Baranello, Laura; Levens, David; Kraemer, Kenneth H.; Stefanini, Miria
2016-01-01
The general transcription factor IIE (TFIIE) is essential for transcription initiation by RNA polymerase II (RNA pol II) via direct interaction with the basal transcription/DNA repair factor IIH (TFIIH). TFIIH harbors mutations in two rare genetic disorders, the cancer-prone xeroderma pigmentosum (XP) and the cancer-free, multisystem developmental disorder trichothiodystrophy (TTD). The phenotypic complexity resulting from mutations affecting TFIIH has been attributed to the nucleotide excision repair (NER) defect as well as to impaired transcription. Here, we report two unrelated children showing clinical features typical of TTD who harbor different homozygous missense mutations in GTF2E2 (c.448G>C [p.Ala150Pro] and c.559G>T [p.Asp187Tyr]) encoding the beta subunit of transcription factor IIE (TFIIEβ). Repair of ultraviolet-induced DNA damage was normal in the GTF2E2 mutated cells, indicating that TFIIE was not involved in NER. We found decreased protein levels of the two TFIIE subunits (TFIIEα and TFIIEβ) as well as decreased phosphorylation of TFIIEα in cells from both children. Interestingly, decreased phosphorylation of TFIIEα was also seen in TTD cells with mutations in ERCC2, which encodes the XPD subunit of TFIIH, but not in XP cells with ERCC2 mutations. Our findings support the theory that TTD is caused by transcriptional impairments that are distinct from the NER disorder XP. PMID:26996949
Miyauchi, Eisaku; Inoue, Akira; Kobayashi, Kunihiko; Maemondo, Makoto; Sugawara, Shunichi; Oizumi, Satoshi; Isobe, Hiroshi; Gemma, Akihiko; Saijo, Yasuo; Yoshizawa, Hirohisa; Hagiwara, Koichi; Nukiwa, Toshihiro
2015-07-01
Epidermal growth factor receptor tyrosine kinase inhibitors are effective as first-line therapy for advanced non-small cell lung cancer patients harboring epidermal growth factor receptor mutations. However, it is unknown whether second-line platinum-based chemotherapy after epidermal growth factor receptor tyrosine kinase inhibitor therapy could lead to better outcomes. We evaluated the efficacy of second-line platinum-based chemotherapy after gefitinib for advanced non-small cell lung cancers harboring epidermal growth factor receptor mutations (the NEJ002 study). Seventy-one non-small cell lung cancers, treated with gefitinib as first-line therapy and then receiving platinum-based chemotherapy as second-line therapy were evaluated in NEJ002. Patients were evaluated for antitumor response to second-line chemotherapy by computed tomography according to the criteria of the Response Evaluation Criteria in Solid Tumors group (version 1.0). Of the 71 patients receiving platinum-based chemotherapy after first-line gefitinib, a partial response was documented in 25.4% (18/71), stable disease in 43.7% (31/71) and progression of disease in 21.1% (15/71). The objective response and disease control rates were 25.4% (18/71) and 69% (49/71), respectively. There was no significant difference between first- and second-line chemotherapy in objective response and disease control rates for advanced non-small cell lung cancer harboring activating epidermal growth factor receptor mutations. In the analysis of epidermal growth factor receptor mutation types, the objective responses of deletions in exon 19 and a point mutation in exon 21 (L858R) were 27.3% (9/33) and 28.1% (9/32), respectively, but these differences between objective response rates were not significant. The efficacy of second-line platinum-based chemotherapy followed at progression by gefitinib was similar to first-line platinum-based chemotherapy, and epidermal growth factor receptor mutation types did not influence
CRISPR-mediated direct mutation of cancer genes in the mouse liver
Xue, Wen; Chen, Sidi; Yin, Hao; Tammela, Tuomas; Papagiannakopoulos, Thales; Joshi, Nikhil S.; Cai, Wenxin; Yang, Gillian; Bronson, Roderick; Crowley, Denise G.; Zhang, Feng; Anderson, Daniel G.; Sharp, Phillip A.; Jacks, Tyler
2014-01-01
The study of cancer genes in mouse models has traditionally relied on genetically-engineered strains made via transgenesis or gene targeting in embryonic stem (ES) cells1. Here we describe a new method of cancer model generation using the CRISPR/Cas system in vivo in wild-type mice. We have used hydrodynamic injection to deliver a CRISPR plasmid DNA expressing Cas9 and single guide RNAs (sgRNAs)2–4 to the liver and directly target the tumor suppressor genes Pten5 and p536, alone and in combination. CRISPR-mediated Pten mutation led to elevated Akt phosphorylation and lipid accumulation in hepatocytes, phenocopying the effects of deletion of the gene using Cre-LoxP technology7, 8. Simultaneous targeting of Pten and p53 induced liver tumors that mimicked those caused by Cre-loxP-mediated deletion of Pten and p53. DNA sequencing of liver and tumor tissue revealed insertion or deletion (indel) mutations of the tumor suppressor genes, including bi-allelic mutations of both Pten and p53 in tumors. Furthermore, co-injection of Cas9 plasmids harboring sgRNAs targeting the β-Catenin gene (Ctnnb1) and a single-stranded DNA (ssDNA) oligonucleotide donor carrying activating point mutations led to the generation of hepatocytes with nuclear localization of β-Catenin. This study demonstrates the feasibility of direct mutation of tumor suppressor genes and oncogenes in the liver using the CRISPR/Cas system, which presents a new avenue for rapid development of liver cancer models and functional genomics. PMID:25119044
Glioma-derived mutations in isocitrate dehydrogenase 2 beneficial to traditional chemotherapy
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fu, Yuejun, E-mail: yjfu@sxu.edu.cn; Huang, Rui; Zheng, Yali
2011-07-01
Highlights: {yields} IDH1 and IDH2 mutations are not detected in the rat C6 glioma cell line model. {yields} IDH2 mutations are not required for the tumorigenesis of glioma. {yields} IDH2{sup R172G} can sensitize glioma sensitivity to chemotherapy through NADPH levels. {yields} IDH2{sup R172G} can give a benefit to traditional chemotherapy of glioma. {yields} This finding serves as an important complement to existing research on this topic. -- Abstract: Heterozygous mutations in either the R132 residue of isocitrate dehydrogenase I (IDH1) or the R172 residue of IDH2 in human gliomas were recently highlighted. In the present study, we report that mutationsmore » of IDH1 and IDH2 are not detected in the rat C6 glioma cell line model, which suggests that these mutations are not required for the development of glioblastoma induced by N,N'-nitroso-methylurea. The effects of IDH2 and IDH2{sup R172G} on C6 cells proliferation and sensitivity to chemotherapy and the possible mechanism are analyzed at the cellular level. IDH1 and IDH2 mutations lead to simultaneous loss and gain of activities in the production of {alpha}-ketoglutarate ({alpha}-KG) and 2-hydroxyglutarate (2HG), respectively, and result in lowering NADPH levels even further. The low NADPH levels can sensitize tumors to chemotherapy, and account for the prolonged survival of patients harboring the mutations. Our data extrapolate potential importance of the in vitro rat C6 glioma cell model, show that the IDH2{sup R172G} mutation in gliomas may give a benefit to traditional chemotherapy of this cancer and serve as an important complement to existing research on this topic.« less
Novel mutation of Endothelin-B receptor gene in Waardenburg-Hirschsprung disease.
Sangkhathat, Surasak; Chiengkriwate, Piyawan; Kusafuka, Takeshi; Patrapinyokul, Sakda; Fukuzawa, Masahiro
2005-12-01
Homozygous mutations of EDNRB in human have been reported to result in Waardenburg-Hirschsprung disease (WS4), while mutated heterozygotes manifested isolated Hirschsprung disease in lower penetrance. We investigated a case of WS4 together with all members of her nuclear family for the alteration of the EDNRB gene by using PCR-SSCP and direct sequencing technique. The index patient, who was born to a family with no history of Hirschsprung disease, presented total colonic aganglionosis with small bowel extension, sensorineural hearing loss and generalized cutaneous pigmentary defects. Interestingly, both irides were normally black. The study detected a homozygous missense mutation at codon 196 in exon 2 (Ser196Asn), which has not been reported. Both parents and four in six siblings harbored heterozygous mutation without any clinical manifestation. Our findings were consistent with previous observations that full spectrum of WS4 occurred to the mutate homozygotes. Moreover, the non-penetrance of heterozygotes in our pedigree, which differs from other reports, demonstrates the high pleiotropic effect of EDNRB mutations in human.
Deleterious BRCA1/2 mutations in an urban population of Black women
Smith, Karen Lisa; Stein, Julie; DeMarco, Tiffani; Wang, Yiru; Wang, Hongkun; Fries, Melissa; Peshkin, Beth N.; Isaacs, Claudine
2018-01-01
Information on the prevalence of deleterious BRCA1 and BRCA2 (BRCA1/2) mutations in clinic-based populations of Black women is limited. In order to address this gap, we performed a retrospective study to determine the prevalence of deleterious BRCA1/2 mutations, predictors of having a mutation, and acceptance of risk-reducing surgeries in Black women. In an urban unselected clinic-based population, we evaluated 211 self-identified Black women who underwent genetic counseling for hereditary breast–ovarian cancer syndrome. BRCA1/2 mutations were identified in 13.4 % of the participants who received genetic testing. Younger age at diagnosis, higher BRCA-PRO score, significant family history, and diagnosis of triple-negative breast cancer were associated with identification of a BRCA1/2 mutation. Of the affected patients found to have a deleterious mutation, almost half underwent prophylactic measures. In our study population, 1 in 7 Black women who underwent genetic testing harbored a deleterious BRCA1/2 mutation independent of age at diagnosis or family history. PMID:26250392
33 CFR 110.130 - Bar Harbor, Maine.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Bar Harbor, Maine. 110.130... ANCHORAGE REGULATIONS Anchorage Grounds § 110.130 Bar Harbor, Maine. (a) Anchorage grounds. (1) Anchorage “A” is that portion of Frenchman Bay, Bar Harbor, ME enclosed by a rhumb line connecting the following...
Somatic activating mutations in MAP2K1 cause melorheostosis.
Kang, Heeseog; Jha, Smita; Deng, Zuoming; Fratzl-Zelman, Nadja; Cabral, Wayne A; Ivovic, Aleksandra; Meylan, Françoise; Hanson, Eric P; Lange, Eileen; Katz, James; Roschger, Paul; Klaushofer, Klaus; Cowen, Edward W; Siegel, Richard M; Marini, Joan C; Bhattacharyya, Timothy
2018-04-11
Melorheostosis is a sporadic disease of uncertain etiology characterized by asymmetric bone overgrowth and functional impairment. Using whole exome sequencing, we identify somatic mosaic MAP2K1 mutations in affected, but not unaffected, bone of eight unrelated patients with melorheostosis. The activating mutations (Q56P, K57E and K57N) cluster tightly in the MEK1 negative regulatory domain. Affected bone displays a mosaic pattern of increased p-ERK1/2 in osteoblast immunohistochemistry. Osteoblasts cultured from affected bone comprise two populations with distinct p-ERK1/2 levels by flow cytometry, enhanced ERK1/2 activation, and increased cell proliferation. However, these MAP2K1 mutations inhibit BMP2-mediated osteoblast mineralization and differentiation in vitro, underlying the markedly increased osteoid detected in affected bone histology. Mosaicism is also detected in the skin overlying bone lesions in four of five patients tested. Our data show that the MAP2K1 oncogene is important in human bone formation and implicate MEK1 inhibition as a potential treatment avenue for melorheostosis.
De novo activating epidermal growth factor mutations (EGFR) in small-cell lung cancer.
Thai, Alesha; Chia, Puey L; Russell, Prudence A; Do, Hongdo; Dobrovic, Alex; Mitchell, Paul; John, Thomas
2017-09-01
In Australia, mutations in epidermal growth factor mutations (EGFR) occur in 15% of patients diagnosed with non-small-cell lung cancer and are found with higher frequency in female, non-smokers of Asian ethnicity. Activating mutations in the EGFR gene are rarely described in SCLC. We present two cases of de novo EGFR mutations in patients with SCLC detected in tissue and in plasma cell free DNA, both of whom were of Asian ethnicity and never-smokers. These two cases add to the growing body of evidence suggesting that screening for EGFR mutations in SCLC should be considered in patients with specific clinical features. © 2017 Royal Australasian College of Physicians.
Lee, Seung Eun; Hwang, Tae Sook; Choi, Yoon-La; Kim, Wook Youn; Han, Hye Seung; Lim, So Dug; Kim, Wan-Seop; Yoo, Young Bum; Kim, Suk Kyeong
2017-06-01
The BRAF V600E mutation in papillary thyroid carcinoma (PTC) is particularly prevalent in Korea, and a considerable number of wild-type BRAF PTCs harbor RAS mutations. In addition, subsets of other genetic alterations clearly exist, but their prevalence in the Korean population has not been well studied. Recent increased insight into noninvasive encapsulated follicular variant PTC has prompted endocrine pathologists to reclassify this entity as "noninvasive follicular thyroid neoplasm with papillary-like nuclear features" (NIFTP). This study analyzed the genetic alterations among the histologic variants of PTC, including NIFTP. Mutations of the BRAF and RAS genes and rearrangement of the RET/PTC1, NTRK1, and ALK genes using 769 preoperative fine-needle aspiration specimens and resected PTCs were analyzed. Molecular alterations were found in 687 (89.3%) of 769 PTCs. BRAF V600E mutation (80.8%) was the most frequent alteration, followed by RAS mutation and RET/PTC1, NTRK1, and ALK rearrangements (5.6%, 2.1%, 0.4%, and 0%, respectively). The low prevalence of NTRK1 fusions and the absence of an ALK fusion detected in Korea may also be attributed to the higher prevalence of the BRAF V600E mutation. There were significant differences in the frequency of the genetic alterations among the histologic variants of PTC. The prevalence of NIFTP in PTC was 2.7%, and among the NIFTPs, 28.6% and 57.1% harbored BRAF and RAS mutations, respectively. Clinicopathologic factors and mutational profiles between NIFTP and encapsulated follicular variant PTC with capsular invasion group were not significantly different. Genetic alterations in PTC vary among its different histologic variants and seem to be different in each ethnic group.
Tadokoro-Cuccaro, Rieko; Davies, John; Mongan, Nigel P; Bunch, Trevor; Brown, Rosalind S; Audi, Laura; Watt, Kate; McEwan, Iain J; Hughes, Ieuan A
2014-01-01
Androgen receptor (AR) mutations are associated with androgen insensitivity syndrome (AIS). Missense mutations identified in the AR-N-terminal domain (AR-NTD) are rare, and clinical phenotypes are typically mild. We investigated 7 missense mutations and 2 insertion/deletions located in the AR-NTD. This study aimed to elucidate the pathogenic role of AR-NTD mutants in AIS and to use this knowledge to further define AR-NTD function. AR-NTD mutations (Q120E, A159T, G216R, N235K, G248V, L272F, and P380R) were introduced into AR-expression plasmids. Stably expressing cell lines were established for del57L and ins58L. Transactivation was measured using luciferase reporter constructs under the control of GRE and Pem promoters. Intrinsic fluorescence spectroscopy and partial proteolysis studies were performed for mutations which showed reduced activities by using a purified AR-AF1 protein. Pem-luciferase reporter activation was reduced for A159T, N235K, and G248V but not the GRE-luciferase reporter. Protein structure analysis detected no significant change in the AR-AF1 region for these mutations. Reduced cellular expression and transactivation activity were observed for ins58L. The mutations Q120E, G216R, L272F, P380R, and del57L showed small or no detectable changes in function. Thus, clinical and experimental analyses have identified novel AR-signalling defects associated with mutations in the structurally disordered AR-NTD domain in patients with AIS. © 2014 S. Karger AG, Basel.
33 CFR 110.9 - Wells Harbor, Maine.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Wells Harbor, Maine. 110.9... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.9 Wells Harbor, Maine. (a) Anchorage “A”. All of the... approximately 5,800 sq. yards, encompassing the central portion of Wells Harbor. (b) Anchorage “B”. All of the...
33 CFR 110.9 - Wells Harbor, Maine.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Wells Harbor, Maine. 110.9... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.9 Wells Harbor, Maine. Link to an amendment published at..., encompassing the central portion of Wells Harbor. (b) Anchorage “B”. All of the waters enclosed by a line...
Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.
Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza
2012-01-01
Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.
Exome Sequencing Identifies Potentially Druggable Mutations in Nasopharyngeal Carcinoma.
Chow, Yock Ping; Tan, Lu Ping; Chai, San Jiun; Abdul Aziz, Norazlin; Choo, Siew Woh; Lim, Paul Vey Hong; Pathmanathan, Rajadurai; Mohd Kornain, Noor Kaslina; Lum, Chee Lun; Pua, Kin Choo; Yap, Yoke Yeow; Tan, Tee Yong; Teo, Soo Hwang; Khoo, Alan Soo-Beng; Patel, Vyomesh
2017-03-03
In this study, we first performed whole exome sequencing of DNA from 10 untreated and clinically annotated fresh frozen nasopharyngeal carcinoma (NPC) biopsies and matched bloods to identify somatically mutated genes that may be amenable to targeted therapeutic strategies. We identified a total of 323 mutations which were either non-synonymous (n = 238) or synonymous (n = 85). Furthermore, our analysis revealed genes in key cancer pathways (DNA repair, cell cycle regulation, apoptosis, immune response, lipid signaling) were mutated, of which those in the lipid-signaling pathway were the most enriched. We next extended our analysis on a prioritized sub-set of 37 mutated genes plus top 5 mutated cancer genes listed in COSMIC using a custom designed HaloPlex target enrichment panel with an additional 88 NPC samples. Our analysis identified 160 additional non-synonymous mutations in 37/42 genes in 66/88 samples. Of these, 99/160 mutations within potentially druggable pathways were further selected for validation. Sanger sequencing revealed that 77/99 variants were true positives, giving an accuracy of 78%. Taken together, our study indicated that ~72% (n = 71/98) of NPC samples harbored mutations in one of the four cancer pathways (EGFR-PI3K-Akt-mTOR, NOTCH, NF-κB, DNA repair) which may be potentially useful as predictive biomarkers of response to matched targeted therapies.
Isocitrate dehydrogenase mutation as a therapeutic target in gliomas.
Han, Catherine H; Batchelor, Tracy T
2017-06-01
Isocitrate dehydrogenases (IDH) are important enzymes that catalyze the oxidative decarboxylation of isocitrate to α-ketoglutarate (α-KG), producing NADPH in the process. More than 80% of low-grade gliomas and secondary glioblastoma (GBM) harbor an IDH mutation. IDH mutations involve the catalytic pocket of the enzyme and lead to a neomorphic ability to produce 2-hydroxyglutarate (2HG) while oxidizing NADPH to NADP+. 2HG is considered as an 'oncometabolite' which is thought to be responsible for many, if not all, biologic effects of IDH mutations. 2HG accumulation competitively inhibits α-KG-dependent dioxygenases, including histone lysine demethylases and DNA demethylases, resulting in a hypermethylation phenotype with alterations in cellular epigenetic status as well as a block in cellular differentiation. IDH mutations have been suggested as an important early event in tumorigenesis, however it remains unclear whether IDH mutation by itself causes cancer or if it requires other oncogenic events to initiate tumorigenesis. Significant efforts have been made to better understand the mechanisms of IDH mutations in tumor initiation and progression, and to develop targeted therapies for IDH-mutated tumors. This review provides an overview of the function of mutant IDH, and the current understanding of the role IDH mutations play in gliomagenesis. In addition, several potential therapeutic strategies for IDH-mutant gliomas, including mutant IDH inhibitors which have entered clinical evaluation in glioma patients, will be discussed.
Exome Sequencing Identifies Potentially Druggable Mutations in Nasopharyngeal Carcinoma
Chow, Yock Ping; Tan, Lu Ping; Chai, San Jiun; Abdul Aziz, Norazlin; Choo, Siew Woh; Lim, Paul Vey Hong; Pathmanathan, Rajadurai; Mohd Kornain, Noor Kaslina; Lum, Chee Lun; Pua, Kin Choo; Yap, Yoke Yeow; Tan, Tee Yong; Teo, Soo Hwang; Khoo, Alan Soo-Beng; Patel, Vyomesh
2017-01-01
In this study, we first performed whole exome sequencing of DNA from 10 untreated and clinically annotated fresh frozen nasopharyngeal carcinoma (NPC) biopsies and matched bloods to identify somatically mutated genes that may be amenable to targeted therapeutic strategies. We identified a total of 323 mutations which were either non-synonymous (n = 238) or synonymous (n = 85). Furthermore, our analysis revealed genes in key cancer pathways (DNA repair, cell cycle regulation, apoptosis, immune response, lipid signaling) were mutated, of which those in the lipid-signaling pathway were the most enriched. We next extended our analysis on a prioritized sub-set of 37 mutated genes plus top 5 mutated cancer genes listed in COSMIC using a custom designed HaloPlex target enrichment panel with an additional 88 NPC samples. Our analysis identified 160 additional non-synonymous mutations in 37/42 genes in 66/88 samples. Of these, 99/160 mutations within potentially druggable pathways were further selected for validation. Sanger sequencing revealed that 77/99 variants were true positives, giving an accuracy of 78%. Taken together, our study indicated that ~72% (n = 71/98) of NPC samples harbored mutations in one of the four cancer pathways (EGFR-PI3K-Akt-mTOR, NOTCH, NF-κB, DNA repair) which may be potentially useful as predictive biomarkers of response to matched targeted therapies. PMID:28256603
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false St. Lawrence River, Cape Vincent Harbor, N.Y.; use, administration, and navigation of the harbor and U.S. breakwater. 207.610 Section 207... NAVIGATION REGULATIONS § 207.610 St. Lawrence River, Cape Vincent Harbor, N.Y.; use, administration, and...
TERT, HRAS, and EIF1AX Mutations in a Patient with Follicular Adenoma.
Topf, Michael C; Wang, Zi-Xuan; Tuluc, Madalina; Pribitkin, Edmund A
2018-06-01
Molecular markers are increasingly used as diagnostic tools in the management of thyroid nodules. There is a paucity of studies evaluating the prevalence of molecular markers in benign lesions. A 68-year-old woman with hypothyroidism presented with a right thyroid nodule, which was atypia of undetermined significance on cytology. The fine-needle aspirate of the nodule was examined with next-generation sequencing and found to harbor a C228T mutation in the TERT gene, a Q61R mutation in the HRAS gene, and an A113_splice mutation in the EIF1AX gene. Right thyroid lobectomy was performed, with final pathology showing follicular adenoma. All three mutations detected in the original fine-needle aspirate specimen were detected in the final surgical specimen as well. A rare case of TERT, HRAS, and EIF1AX mutations is reported in a patient with follicular adenoma. TERT promoter mutations may be an early genetic event in the molecular pathogenesis of follicular thyroid carcinoma.
Quek, Richard; Farid, Mohamad; Kanjanapan, Yada; Lim, Cindy; Tan, Iain Beehuat; Kesavan, Sittampalam; Lim, Tony Kiat Hon; Oon, Lynette Lin-Ean; Goh, Brian Kp; Chan, Weng Hoong; Teo, Melissa; Chung, Alexander Yf; Ong, Hock Soo; Wong, Wai Keong; Tan, Patrick; Yip, Desmond
2017-06-01
Benefit of adjuvant imatinib therapy following curative resection in patients with intermediate-risk gastrointestinal stromal tumor (GIST) is unclear. GIST-specific exon mutations, in particular exon 11 deletions, have been shown to be prognostic. We hypothesize that specific KIT mutations may improve risk stratification in patients with intermediate-risk GIST, identifying a subgroup of patients who may benefit from adjuvant therapy. In total, 142 GIST patients with complete clinicopathologic and mutational data from two sites were included. Risk classification was based on the modified National Institute of Health (NIH) criteria. In this cohort, 74% (n = 105) of patients harbored a KIT mutation; 61% (n = 86) were found in exon 11 of which nearly 70% were KIT exon 11 deletions (n = 60). A total of 18% (n = 25) of cases were classified as having intermediate-risk disease. Univariate analysis confirmed tumor size, mitotic index, nongastric origin, presence of tumor rupture and modified NIH criteria were adversely prognostic for relapse-free survival (RFS). Among KIT/PDGFRA mutants, KIT exon 11 deletions had a significantly worse prognosis (hazard ratio 2.31; 95% confidence interval, 1.30-4.10; P = 0.003). Multivariate analysis confirmed KIT exon 11 deletion (P = 0.003) and clinical risk classification (P < 0.001) as independent adverse prognostic factors for RFS. Intermediate-risk patients harboring KIT exon 11 deletions had RFS outcomes similar to high-risk patients. The presence of KIT exon 11 deletion mutation in patients with intermediate-risk GIST is associated with an inferior clinical outcome with RFS similar to high-risk patients. © 2016 John Wiley & Sons Australia, Ltd.
33 CFR 117.272 - Boot Key Harbor.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Boot Key Harbor. 117.272 Section 117.272 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Florida § 117.272 Boot Key Harbor. The draw of the Boot Key Harbor drawbridge, mile 0.13, between...
Defense.gov Special Report: Pearl Harbor Anniversary
Department of Defense Submit Search 71th Anniversary of the Attack on Pearl Harbor - World War II News Joint Chiefs of Staff, saluted veterans at the National World War II Memorial in Washington, D.C Attack Video Return To Pearl Harbor Return To Pearl Harbor World War II Timeline The attack on Pearl
Geoscience rediscovers Phoenicia's buried harbors
NASA Astrophysics Data System (ADS)
Marriner, Nick; Morhange, Christophe; Doumet-Serhal, Claude; Carbonel, Pierre
2006-01-01
After centuries of archaeological debate, the harbors of Phoenicia's two most important city states, Tyre and Sidon, have been rediscovered, and including new geoarcheological results reveal how, where, and when they evolved after their Bronze Age foundations. The early ports lie beneath their present urban centers, and we have indentified four harbor phases. (1) During the Bronze Age, Tyre and Sidon were characterized by semi-open marine coves that served as protoharbors. (2) Biostratigraphic and lithostratigraphic data indicate the presence of early artificial basins after the first millennium B.C. (3) The harbors reached their apogees during the Greco-Roman and Byzantine periods. (4) Silting up and coastal progradation led to burial of the medieval basins, lost until now.
Vassiliki, Kokkinou; George, Koutsodontis; Polixeni, Stamatiou; Christoforos, Giatzakis; Minas, Aslanides Ioannis; Stavrenia, Koukoula; Ioannis, Datseris
2018-01-01
Aim To evaluate the frequency and pattern of disease-associated mutations of ABCA4 gene among Greek patients with presumed Stargardt disease (STGD1). Materials and Methods A total of 59 patients were analyzed for ABCA4 mutations using the ABCR400 microarray and PCR-based sequencing of all coding exons and flanking intronic regions. MLPA analysis as well as sequencing of two regions in introns 30 and 36 reported earlier to harbor deep intronic disease-associated variants was used in 4 selected cases. Results An overall detection rate of at least one mutant allele was achieved in 52 of the 59 patients (88.1%). Direct sequencing improved significantly the complete characterization rate, that is, identification of two mutations compared to the microarray analysis (93.1% versus 50%). In total, 40 distinct potentially disease-causing variants of the ABCA4 gene were detected, including six previously unreported potentially pathogenic variants. Among the disease-causing variants, in this cohort, the most frequent was c.5714+5G>A representing 16.1%, while p.Gly1961Glu and p.Leu541Pro represented 15.2% and 8.5%, respectively. Conclusions By using a combination of methods, we completely molecularly diagnosed 48 of the 59 patients studied. In addition, we identified six previously unreported, potentially pathogenic ABCA4 mutations. PMID:29854428
Substrate mimicry—overcoming HIV-1 integrase resistance mutations | Center for Cancer Research
HIV integrase (IN) strand transfer inhibitors (INSTIs) are among the newest anti-AIDS drugs; however, mutant forms of IN can confer resistance. We developed noncytotoxic naphthyridine-containing INSTIs that retain low nanomolar IC50 values against HIV-1 variants harboring all of the major INSTI-resistant mutations. We found by analyzing crystal structures of inhibitors bound
Backbone dynamics and global effects of an activating mutation in minimized Mtu RecA inteins.
Du, Zhenming; Liu, Yangzhong; Ban, David; Lopez, Maria M; Belfort, Marlene; Wang, Chunyu
2010-07-23
Inteins mediate protein splicing, which has found many applications in biotechnology and protein engineering. A single valine-to-leucine mutation (V67L) can globally enhance splicing and related cleavage reactions in minimized Mycobacterium tuberculosis RecA inteins. However, V67L mutation causes little change in crystal structures. To test whether protein dynamics contribute to activity enhancement in the V67L mutation, we have studied the conformations and dynamics of the minimized and engineered intein DeltaDeltaIhh-V67CM and a single V67L mutant, DeltaDeltaIhh-L67CM, by solution NMR. Chemical shift perturbations established that the V67L mutation causes global changes, including changes at the N-terminus and C-terminus of the intein, which are active sites for protein splicing. The single V67L mutation significantly slows hydrogen-exchange rates globally, indicating a shift to more stable conformations and reduction in ensemble distribution. Whereas the V67L mutation causes little change for motions on the picosecond-to-nanosecond timescale, motions on the microsecond-to-millisecond timescale affect a region involving the conserved F-block histidine and C-terminal asparagine, which are residues important for C-terminal cleavage. The V67L mutation is proposed to activate splicing by reducing the ensemble distribution of the intein structure and by modifying the active sites. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
Ten Broek, Roel W; Bekers, Elise M; de Leng, Wendy W J; Strengman, Eric; Tops, Bastiaan B J; Kutzner, Heinz; Leeuwis, Jan Willem; van Gorp, Joost M; Creytens, David H; Mentzel, Thomas; van Diest, Paul J; Eijkelenboom, Astrid; Flucke, Uta
2017-12-01
Spindle cell hemangioma (SCH) is a distinct vascular soft-tissue lesion characterized by cavernous blood vessels and a spindle cell component mainly occurring in the distal extremities of young adults. The majority of cases harbor heterozygous mutations in IDH1/2 sporadically or rarely in association with Maffucci syndrome. However, based on mosaicism and accordingly a low percentage of lesional cells harboring a mutant allele, detection can be challenging. We tested 19 sporadic SCHs by Sanger sequencing, multiplex ligation-dependent probe amplification (MLPA), conventional next generation sequencing (NGS), and NGS using a single molecule molecular inversion probes (smMIP)-based library preparation to compare their diagnostic value. Out of 10 cases tested by Sanger sequencing and 2 analyzed using MLPA, 4 and 1, respectively, revealed a mutation in IDH1 (p.R132C). The 7 remaining negative cases and additional 6 cases were investigated using smMIP/NGS, showing hot spot mutations in IDH1 (p.R132C) (8 cases) and IDH2 (3 cases; twice p.R172S and once p.R172G, respectively). One case was negative. Owing to insufficient DNA quality and insufficient coverage, 2 cases were excluded. In total, in 16 out of 17 cases successfully tested, an IDH1/2 mutation was found. Given that IDH1/2 mutations were absent in 161 other vascular lesions tested by smMIP/NGS, the mutation can be considered as highly specific for SCH. © 2017 Wiley Periodicals, Inc.
Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia
2016-05-01
This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected.
Varghese, Leila N; Defour, Jean-Philippe; Pecquet, Christian; Constantinescu, Stefan N
2017-01-01
A well-functioning hematopoietic system requires a certain robustness and flexibility to maintain appropriate quantities of functional mature blood cells, such as red blood cells and platelets. This review focuses on the cytokine receptor that plays a significant role in thrombopoiesis: the receptor for thrombopoietin (TPO-R; also known as MPL). Here, we survey the work to date to understand how this receptor functions at a molecular level throughout its lifecycle, from traffic to the cell surface, dimerization and binding cognate cytokine via its extracellular domain, through to its subsequent activation of associated Janus kinases and initiation of downstream signaling pathways, as well as the regulation of these processes. Atomic level resolution structures of TPO-R have remained elusive. The identification of disease-causing mutations in the receptor has, however, offered some insight into structure and function relationships, as has artificial means of receptor activation, through TPO mimetics, transmembrane-targeting receptor agonists, and engineering in dimerization domains. More recently, a novel activation mechanism was identified whereby mutated forms of calreticulin form complexes with TPO-R via its extracellular N-glycosylated domain. Such complexes traffic pathologically in the cell and persistently activate JAK2, downstream signal transducers and activators of transcription (STATs), and other pathways. This pathologic TPO-R activation is associated with a large fraction of human myeloproliferative neoplasms.
IDH1/2 mutations target a key hallmark of cancer by deregulating cellular metabolism in glioma.
Zhang, Chunzhi; Moore, Lynette M; Li, Xia; Yung, W K Alfred; Zhang, Wei
2013-09-01
Isocitrate dehydrogenase (IDH) enzymes have recently become a focal point for research aimed at understanding the biology of glioma. IDH1 and IDH2 are mutated in 50%-80% of astrocytomas, oligodendrogliomas, oligoastrocytomas, and secondary glioblastomas but are seldom mutated in primary glioblastomas. Gliomas with IDH1/2 mutations always harbor other molecular aberrations, such as TP53 mutation or 1p/19q loss. IDH1 and IDH2 mutations may serve as prognostic factors because patients with an IDH-mutated glioma survive significantly longer than those with an IDH-wild-type tumor. However, the molecular pathogenic role of IDH1/2 mutations in the development of gliomas is unclear. The production of 2-hydroxyglutarate and enhanced NADP+ levels in tumor cells with mutant IDH1/2 suggest mechanisms through which these mutations contribute to tumorigenesis. Elucidating the pathogenesis of IDH mutations will improve understanding of the molecular mechanisms of gliomagenesis and may lead to development of a new molecular classification system and novel therapies.
English, Diana P; Bellone, Stefania; Cocco, Emiliano; Bortolomai, Ileana; Pecorelli, Sergio; Lopez, Salvatore; Silasi, Dan-Arin; Schwartz, Peter E; Rutherford, Thomas; Santin, Alessandro D
2013-11-01
To evaluate PIK3CA mutational status and c-erbB2 gene amplification in a series of primary uterine serous carcinomas (USC) cell lines. To assess the efficacy of GDC-0980, a potent inhibitor of Class I PI3 kinase and mTOR kinase (TORC1/2), against primary USC harboring HER2/neu gene amplification and/or PIK3CA mutations. Twenty-two primary USC cell lines were evaluated for c-erbB2 oncogene amplification by fluorescence in situ hybridization (FISH) assays and for PIK3CA gene mutations by direct DNA sequencing of exons 9 and 20. In vitro sensitivity to GDC-0980 was evaluated by flow-cytometry-based viability and proliferation assays. Downstream cellular responses to GDC-0980 were assessed by measuring phosphorylation of the 4-EBP1 protein by flow-cytometry. Five of 22 (22.7%) USC cell lines contained oncogenic PIK3CA mutations although 9 (40.9%) harbored c-erbB2 gene amplification by FISH. GDC-0980 caused a strong differential growth inhibition in FISH+ USC when compared with FISH- (GDC-0980 IC50 mean ± SEM = 0.29 ± 0.05 μM in FISH+ vs 1.09 ± 0.20 μM in FISH- tumors, P = .02). FISH+ USC harboring PIK3CA mutations were significantly more sensitive to GDC-0980 exposure when compared with USC cell lines harboring wild-type PIK3CA (P = .03). GDC-0980 growth-inhibition was associated with a significant and dose-dependent decline in phosphorylated 4-EBP1 levels. Oncogenic PIK3CA mutations and c-erbB2 gene amplification may represent biomarkers to identify patients harboring USC who may benefit most from the use of GDC-0980. Copyright © 2013 Mosby, Inc. All rights reserved.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-10-02
... California sea lions (Zalophus californianus), Pacific harbor seals (Phoca vitulina), and Northern elephant... elephant seals by Level B harassment only. We have outlined the purpose of the program in a previous notice...; and Northern elephant seals by Level B harassment only. To date, we have issued nine, 1-year...
Osimertinib for EGFR T790M mutation-positive non-small cell lung cancer.
Soejima, Kenzo; Yasuda, Hiroyuki; Hirano, Toshiyuki
2017-01-01
Significant advances have been made since the development of epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) targeting EGFR mutations in non-small-cell lung cancer (NSCLC), however, lung cancer cells eventually acquire resistance to those agents. Osimertinib (AZD9291) has been developed as 3 rd generation EGFR-TKI with activities against sensitizing mutations and T790 M resistance mutation, which account for about 50% of the mechanisms of acquired resistance to 1 st or 2 nd generation EGFR-TKIs. A recent phase I/II clinical trial with osimertinib for advanced NSCLC patients with known sensitizing EGFR mutations and documented disease progression on prior EGFR-TKIs revealed promising effect with acceptable toxicities. Areas covered: This article summarizes current understanding and available preclinical and clinical data on osimertinib and also discusses future directions. The literature search included PubMed and the latest articles from international conferences. Expert commentary: The development of osimertinib has provided new therapeutic options for NSCLC patients harboring T790 M. Compared with other EGFR-TKIs including rociletinib, osimertinib seems to possess an advantage with respect to the effect and safety profile among existing EGFR-TKIs. However, tumor progression still occurs even when treating with osimertinib. A further understanding of the mechanisms of resistance is eagerly anticipated in order to develop next generation EGFR-TKIs.
Pfarr, Nicole; Darb-Esfahani, Silvia; Leichsenring, Jonas; Taube, Eliane; Boxberg, Melanie; Braicu, Ioana; Jesinghaus, Moritz; Penzel, Roland; Endris, Volker; Noske, Aurelia; Weichert, Wilko; Schirmacher, Peter; Denkert, Carsten; Stenzinger, Albrecht
2017-10-01
Brenner tumors (BT) are rare ovarian tumors encompassing benign, borderline, and malignant variants. While the histopathology of BTs and their clinical course is well described, little is known about the underlying genetic defects. We employed targeted next generation sequencing to analyze the mutational landscape in a cohort of 23 BT cases (17 benign, 2 borderline, and 4 malignant) and 3 ovarian carcinomas with transitional cell histology (TCC). Copy number variations (CNV) were validated by fluorescence in-situ hybridization (FISH) and quantitative PCR-based copy number assays. Additionally, we analyzed the TERT promotor region by conventional Sanger sequencing. We identified 25 different point mutations in 23 of the analyzed genes in BTs and 10 mutations in 8 genes in TCCs. About 57% percent of mutations occurred in genes involved in cell cycle control, DNA repair, and epigenetic regulation processes. All TCC cases harbored TP53 mutations whereas all BTs were negative and none of the mutations observed in BTs were present in TCCs. CNV analysis revealed recurrent MDM2 amplifications in 3 out of 4 of the malignant BT cases with one case harboring a concomitant amplification of CCND1. No mutations were observed in the TERT promoter region in BTs and TCCs, which is mutated in about 50%-75% of urothelial carcinoma and in 16% of ovarian clear-cell carcinomas. In conclusion, our study highlights distinct genetic features of BTs, and detection of the triplet phenotype MDM2 amplification/TP53 wt/TERT wt may aid diagnosis of malignant BT in difficult cases. Moreover, selected genetic lesions may be clinically exploitable in a metastatic setting. © 2017 Wiley Periodicals, Inc.
Astolfi, Annalisa; Patterson, Janice; Nannini, Margherita; Saponara, Maristella; Gatto, Lidia; Santini, Donatella; do Valle, Italo F.; Castellani, Gastone; Fiorentino, Michelangelo; von Mehren, Margaret; Brandi, Giovanni; Biasco, Guido; Heinrich, Michael C.; Pantaleo, Maria Abbondanza
2018-01-01
Gastrointestinal stromal tumors (GIST) carrying the D842V activating mutation in the platelet-derived growth factor receptor alpha (PDGFRA) gene are a very rare subgroup of GIST (about 10%) known to be resistant to conventional tyrosine kinase inhibitors (TKIs) and to show an indolent behavior. In this study, we performed an integrated molecular characterization of D842V mutant GIST by whole-transcriptome and whole-exome sequencing coupled with protein–ligand interaction modelling to identify the molecular signature and any additional recurrent genomic event related to their clinical course. We found a very specific gene expression profile of D842V mutant tumors showing the activation of G-protein-coupled receptor (GPCR) signaling and a relative downregulation of cell cycle processes. Beyond D842V, no recurrently mutated genes were found in our cohort. Nevertheless, many private, clinically relevant alterations were found in each tumor (TP53, IDH1, FBXW7, SDH-complex). Molecular modeling of PDGFRA D842V suggests that the mutant protein binds imatinib with lower affinity with respect to wild-type structure, showing higher stability during the interaction with other type I TKIs (like crenolanib). D842V mutant GIST do not show any actionable recurrent molecular events of therapeutic significance, therefore this study supports the rationale of novel TKIs development that are currently being evaluated in clinical studies for the treatment of D842V mutant GIST. PMID:29510530
Kalay, Ersan; Uzumcu, Abdullah; Krieger, Elmar; Caylan, Refik; Uyguner, Oya; Ulubil-Emiroglu, Melike; Erdol, Hidayet; Kayserili, Hülya; Hafiz, Gunter; Başerer, Nermin; Heister, Angelien J G M; Hennies, Hans C; Nürnberg, Peter; Başaran, Seher; Brunner, Han G; Cremers, Cor W R J; Karaguzel, Ahmet; Wollnik, Bernd; Kremer, Hannie
2007-10-15
Myosin XVA is an unconventional myosin which has been implicated in autosomal recessive nonsyndromic hearing impairment (ARNSHI) in humans. In Myo15A mouse models, vestibular dysfunction accompanies the autosomal recessive hearing loss. Genomewide homozygosity mapping and subsequent fine mapping in two Turkish families with ARNSHI revealed significant linkage to a critical interval harboring a known deafness gene MYO15A on chromosome 17p13.1-17q11.2. Subsequent sequencing of the MYO15A gene led to the identification of a novel missense mutation, c.5492G-->T (p.Gly1831Val) and a novel splice site mutation, c.8968-1G-->C. These mutations were not detected in additional 64 unrelated ARNSHI index patients and in 230 Turkish control chromosomes. Gly1831 is a conserved residue located in the motor domains of the different classes of myosins of different species. Molecular modeling of the motor head domain of the human myosin XVa protein suggests that the Gly1831Val mutation inhibits the powerstroke by reducing backbone flexibility and weakening the hydrophobic interactions necessary for signal transmission to the converter domain. Copyright (c) 2007 Wiley-Liss, Inc.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-06-27
...-AA08 Special Local Regulations; Red Bull Flugtag National Harbor Event, Potomac River; National Harbor... waters of the Potomac River on September 21, 2013. These special local regulations are necessary to... temporarily restrict vessel traffic in a portion of the Potomac River during the event. DATES: This rule is...
Lee-Chen, Guey-Jen; Lin, Shuan-Pei; Chen, I-Shen; Chang, Jui-Hung; Yang, Chyau-Wen; Chin, Yi-Wen
2002-06-01
Mucopolysaccharidosis type I (MPS I) is caused by a deficiency of the lysosomal enzyme alpha-L-iduronidase (IDUA). MPS I covers a broad spectrum of clinical severity ranging from severe Hurler syndrome through intermediate Hurler/Scheie syndrome to mild Scheie syndrome. Mutation screening was performed in two unrelated Taiwanese MPS I patients. A Hurler/Scheie patient had A79V (C to T transition in codon 79) in exon 2 and R619G (C to G transversion in codon 619) in exon 14. R619G has been shown to cause disease. Expression of A79V in COS-7 cells showed trace amounts of IDUA activity, demonstrating the deleterious nature of the mutation. A79V mutation did not cause a reduction in IDUA mRNA levels. The reduced level of IDUA protein suggests increased degradation of the mutant enzyme. A Hurler patient had 134del12 (in-frame deletion of codons 16-19 in signal peptide) in exon 1 and Q584X (C to T transition in codon 584) in exon 13. Transfection of COS-7 cells with Q584X did not yield active enzyme. Q584X mutation caused an apparent reduction in the IDUA mRNA level and no IDUA protein was detected. Conversely, 134del12 showed 124.6% of normal activity in transfected cells and a 77-kDa precursor protein was observed on Western blot, suggesting biologic activity of precursor IDUA without posttranslational cleavage. These findings provide further evidence of the molecular heterogeneity in mutations in MPS I.
Federal Register 2010, 2011, 2012, 2013, 2014
2011-04-19
... Mariner harbor operations for one year. After addressing comments from NMFS, ULA modified its application...; and 43 Northern elephant seals by Level B harassment only. To date, NMFS has issued eight, 1-year..., with the last IHA expiring on September 3, 2010 (74 FR 46742, September 11, 2009). ULA did not [[Page...
Ji, Hongbin; Zhao, Xiaojun; Yuza, Yuki; Shimamura, Takeshi; Li, Danan; Protopopov, Alexei; Jung, Boonim L.; McNamara, Kate; Xia, Huili; Glatt, Karen A.; Thomas, Roman K.; Sasaki, Hidefumi; Horner, James W.; Eck, Michael; Mitchell, Albert; Sun, Yangping; Al-Hashem, Ruqayyah; Bronson, Roderick T.; Rabindran, Sridhar K.; Discafani, Carolyn M.; Maher, Elizabeth; Shapiro, Geoffrey I.; Meyerson, Matthew; Wong, Kwok-Kin
2006-01-01
The tyrosine kinase inhibitors gefitinib (Iressa) and erlotinib (Tarceva) have shown anti-tumor activity in the treatment of non-small cell lung cancer (NSCLC). Dramatic and durable responses have occurred in NSCLC tumors with mutations in the tyrosine kinase domain of the epidermal growth factor receptor (EGFR). In contrast, these inhibitors have shown limited efficacy in glioblastoma, where a distinct EGFR mutation, the variant III (vIII) in-frame deletion of exons 2–7, is commonly found. In this study, we determined that EGFRvIII mutation was present in 5% (3/56) of analyzed human lung squamous cell carcinoma (SCC) but was not present in human lung adenocarcinoma (0/123). We analyzed the role of the EGFRvIII mutation in lung tumorigenesis and its response to tyrosine kinase inhibition. Tissue-specific expression of EGFRvIII in the murine lung led to the development of NSCLC. Most importantly, these lung tumors depend on EGFRvIII expression for maintenance. Treatment with an irreversible EGFR inhibitor, HKI-272, dramatically reduced the size of these EGFRvIII-driven murine tumors in 1 week. Similarly, Ba/F3 cells transformed with the EGFRvIII mutant were relatively resistant to gefitinib and erlotinib in vitro but proved sensitive to HKI-272. These findings suggest a therapeutic strategy for cancers harboring the EGFRvIII mutation. PMID:16672372
Determination of EGFR and KRAS mutational status in Greek non-small-cell lung cancer patients
PAPADOPOULOU, EIRINI; TSOULOS, NIKOLAOS; TSIRIGOTI, ANGELIKI; APESSOS, ANGELA; AGIANNITOPOULOS, KONSTANTINOS; METAXA-MARIATOU, VASILIKI; ZAROGOULIDIS, KONSTANTINOS; ZAROGOULIDIS, PAVLOS; KASARAKIS, DIMITRIOS; KAKOLYRIS, STYLIANOS; DAHABREH, JUBRAIL; VLASTOS, FOTIS; ZOUBLIOS, CHARALAMPOS; RAPTI, AGGELIKI; PAPAGEORGIOU, NIKI GEORGATOU; VELDEKIS, DIMITRIOS; GAGA, MINA; ARAVANTINOS, GERASIMOS; KARAVASILIS, VASILEIOS; KARAGIANNIDIS, NAPOLEON; NASIOULAS, GEORGE
2015-01-01
It has been reported that certain patients with non-small-cell lung cancer (NSCLC) that harbor activating somatic mutations within the tyrosine kinase domain of the epidermal growth factor receptor (EGFR) gene may be effectively treated using targeted therapy. The use of EGFR inhibitors in patient therapy has been demonstrated to improve response and survival rates; therefore, it was suggested that clinical screening for EGFR mutations should be performed for all patients. Numerous clinicopathological factors have been associated with EGFR and Kirsten-rat sarcoma oncogene homolog (KRAS) mutational status including gender, smoking history and histology. In addition, it was reported that EGFR mutation frequency in NSCLC patients was ethnicity-dependent, with an incidence rate of ~30% in Asian populations and ~15% in Caucasian populations. However, limited data has been reported on intra-ethnic differences throughout Europe. The present study aimed to investigate the frequency and spectrum of EGFR mutations in 1,472 Greek NSCLC patients. In addition, KRAS mutation analysis was performed in patients with known smoking history in order to determine the correlation of type and mutation frequency with smoking. High-resolution melting curve (HRM) analysis followed by Sanger sequencing was used to identify mutations in exons 18–21 of the EGFR gene and in exon 2 of the KRAS gene. A sensitive next-generation sequencing (NGS) technology was also employed to classify samples with equivocal results. The use of sensitive mutation detection techniques in a large study population of Greek NSCLC patients in routine diagnostic practice revealed an overall EGFR mutation frequency of 15.83%. This mutation frequency was comparable to that previously reported in other European populations. Of note, there was a 99.8% concordance between the HRM method and Sanger sequencing. NGS was found to be the most sensitive method. In addition, female non-smokers demonstrated a high prevalence of
Federal Register 2010, 2011, 2012, 2013, 2014
2013-03-26
...-AA08 Special Local Regulations; Red Bull Flugtag National Harbor Event, Potomac River; National Harbor... event,'' to be held on the waters of the Potomac River on September 21, 2013. These special local... representative. This action is intended to temporarily restrict vessel traffic in a portion of the Potomac River...
Effects of BRAF mutations and BRAF inhibition on immune responses to melanoma
Ilieva, Kristina M.; Correa, Isabel; Josephs, Debra H.; Karagiannis, Panagiotis; Egbuniwe, Isioma U.; Cafferkey, Michiala J.; Spicer, James F.; Harries, Mark; Nestle, Frank O.; Lacy, Katie E.; Karagiannis, Sophia N.
2014-01-01
Malignant melanoma is associated with poor clinical prognosis; however, novel molecular and immune therapies are now improving patient outcomes. Almost 50% of melanomas harbor targetable activating mutations of BRAF which promote RAS-RAF-MEK-ERK pathway activation and melanoma proliferation. Recent evidence also indicates that melanomas bearing mutant BRAF may also have altered immune responses, suggesting additional avenues for treatment of this patient group. The small molecule inhibitors selective for mutant BRAF induce significant but short-lived clinical responses in a proportion of patients, but also lead to immune stimulatory bystander events, which then subside with the emergence of resistance to inhibition. Simultaneous BRAF and MEK inhibition, and especially combination of BRAF inhibitors with new immunotherapies such as checkpoint blockade antibodies, may further enhance immune activation, or counteract immunosuppressive signals. Pre-clinical evaluation and ongoing clinical trials should provide novel insights into the role of immunity in the therapy of BRAF-mutant melanoma. PMID:25385327
Activation of Antibiotic Production in Bacillus spp. by Cumulative Drug Resistance Mutations
Tojo, Shigeo; Tanaka, Yukinori
2015-01-01
Bacillus subtilis strains produce a wide range of antibiotics, including ribosomal and nonribosomal peptide antibiotics, as well as bacilysocin and neotrehalosadiamine. Mutations in B. subtilis strain 168 that conferred resistance to drugs such as streptomycin and rifampin resulted in overproduction of the dipeptide antibiotic bacilysin. Cumulative drug resistance mutations, such as mutations in the mthA and rpsL genes, which confer low- and high-level resistance, respectively, to streptomycin, and mutations in rpoB, which confer resistance to rifampin, resulted in cells that overproduced bacilysin. Transcriptional analysis demonstrated that the enhanced transcription of biosynthesis genes was responsible for the overproduction of bacilysin. This approach was effective also in activating the cryptic genes of Bacillus amyloliquefaciens, leading to actual production of antibiotic(s). PMID:26369962
Facchinetti, Francesco; Bluthgen, Maria Virginia; Tergemina-Clain, Gabrielle; Faivre, Laura; Pignon, Jean-Pierre; Planchard, David; Remon, Jordi; Soria, Jean-Charles; Lacroix, Ludovic; Besse, Benjamin
2017-10-01
LKB1/STK11 (STK11) is among the most inactivated tumor-suppressor genes in non-small cell lung cancer (NSCLC). While evidence concerning the biologic role of STK11 is accumulating, its prognostic significance in advanced NSCLC has not been envisaged yet. This retrospective analysis included consecutive NSCLC patients with available STK11 information who underwent a platinum-based chemotherapy. STK11 mutational status was correlated to clinico-pathological and mutational features. Kaplan-Meier and Cox models were used for survival curves and multivariate analyses, respectively. Among the 302 patients included, 267 (89%) were diagnosed with stage IIIB/IV NSCLC and 25 (8%) harbored a STK11 mutation (STK11mut). No statistical differences were observed between STK11 status and clinico-pathological variables. We detected a significant correlation between STK11 and KRAS status (p=0.008); among the 25 STK11mut patients, 13 (52%) harbored a concomitant KRAS mutation. Overall survival (OS) was shorter for STK11mut (median OS=10.4months) compared to wild-type patients (STK11wt; median OS=17.3months) in univariate analysis (p=0.085). STK11 status did not impact upon OS in multivariate analysis (p=0.45) and non-significant results were observed for progression-free survival. The co-occurrence of KRAS and STK11 mutations suggest a trend toward detrimental effect in OS (p=0.12). In our cohort enriched for advanced NSCLC patients who received platinum-based chemotherapy, STK11 mutations were not specifically associated with clinico-pathological features and they did not impact upon survival. We confirm the positive correlation between STK11 and KRAS mutations. The co-occurrence of KRAS and STK11 mutations could label a more aggressive molecular subtype of NSCLC. Copyright © 2017 Elsevier B.V. All rights reserved.
Kobayashi, Yoshihisa; Togashi, Yosuke; Yatabe, Yasushi; Mizuuchi, Hiroshi; Jangchul, Park; Kondo, Chiaki; Shimoji, Masaki; Sato, Katsuaki; Suda, Kenichi; Tomizawa, Kenji; Takemoto, Toshiki; Hida, Toyoaki; Nishio, Kazuto; Mitsudomi, Tetsuya
2015-12-01
Lung cancers harboring common EGFR mutations respond to EGFR tyrosine kinase inhibitors (TKI), whereas exon 20 insertions (Ins20) are resistant to them. However, little is known about mutations in exon 18. Mutational status of lung cancers between 2001 and 2015 was reviewed. Three representative mutations in exon 18, G719A, E709K, and exon 18 deletion (Del18: delE709_T710insD) were retrovirally introduced into Ba/F3 and NIH/3T3 cells. The 90% inhibitory concentrations (IC90s) of first-generation (1G; gefitinib and erlotinib), second-generation (2G; afatinib, dacomitinib, and neratinib), and third-generation TKIs (3G; AZD9291 and CO1686) were determined. Among 1,402 EGFR mutations, Del19, L858R, and Ins20 were detected in 40%, 47%, and 4%, respectively. Exon 18 mutations, including G719X, E709X, and Del18, were present in 3.2%. Transfected Ba/F3 cells grew in the absence of IL3, and NIH/3T3 cells formed foci with marked pile-up, indicating their oncogenic abilities. IC90s of 1G and 3G TKIs in G719A, E709K, and Del18 were much higher than those in Del19 (by >11-50-fold), whereas IC90s of afatinib were only 3- to 7-fold greater than those for Del19. Notably, cells transfected with G719A and E709K exhibited higher sensitivity to neratinib (by 5-25-fold) than those expressing Del19. Patients with lung cancers harboring G719X exhibited higher response rate to afatinib or neratinib (∼ 80%) than to 1G TKIs (35%-56%) by compilation of data in the literature. Lung cancers harboring exon 18 mutations should not be overlooked in clinical practice. These cases can be best treated with afatinib or neratinib, although the currently available in vitro diagnostic kits cannot detect all exon 18 mutations. ©2015 American Association for Cancer Research.
Yang, Da; Zhang, Min; Gold, Barry
2017-07-17
Wnt signaling is compromised early in the development of human colorectal cancer (CRC) due to truncating nonsense mutations in adenomatous polyposis coli (APC). CRC induced by chemical carcinogens, such as heterocyclic aromatic amines and azoxymethane, in mice also involves dysregulation of Wnt signaling but via activating missense mutations in the β-catenin oncogene despite the fact that genetically modified mice harboring an inactive APC allele efficiently develop CRC. In contrast, activating mutations in β-catenin are rarely observed in human CRC. Dysregulation of the Wnt signaling pathway by the two distinct mechanisms reveals insights into the etiology of human CRC. On the basis of calculations related to DNA adduct levels produced in mouse CRC models using mutagens, and the number of stem cells in the mouse colon, we show that two nonsense mutations required for biallelic disruption of APC are statistically unlikely to produce CRC in experiments using small numbers of mice. We calculate that an activating mutation in one allele near the critical GSK3β phosphorylation site on β-catenin is >10 5 -times more likely to produce CRC by random mutagenesis due to chemicals than inactivating two alleles in APC, yet it does not occur in humans. Therefore, the mutagenesis mechanism in human CRC cannot be random. We explain that nonsense APC mutations predominate in human CRC because of deamination at 5-methylcytosine at CGA and CAG codons, coupled with the number of human colonic stem cells and lifespan. Our analyses, including a comparison of mutation type and age at CRC diagnosis in U.S. and Chinese patients, also indicate that APC mutations in CRC are not due to environmental mutagens that randomly damage DNA.
Takagi, Masaki; Ishii, Tomohiro; Inokuchi, Mikako; Amano, Naoko; Narumi, Satoshi; Asakura, Yumi; Muroya, Koji; Hasegawa, Yukihiro; Adachi, Masanori; Hasegawa, Tomonobu
2012-01-01
Mutations in transcription factors genes, which are well regulated spatially and temporally in the pituitary gland, result in congenital hypopituitarism (CH) in humans. The prevalence of CH attributable to transcription factor mutations appears to be rare and varies among populations. This study aimed to define the prevalence of CH in terms of nine CH-associated genes among Japanese patients. We enrolled 91 Japanese CH patients for DNA sequencing of POU1F1, PROP1, HESX1, LHX3, LHX4, SOX2, SOX3, OTX2, and GLI2. Additionally, gene copy numbers for POU1F1, PROP1, HESX1, LHX3, and LHX4 were examined by multiplex ligation-dependent probe amplification. The gene regulatory properties of mutant LHX4 proteins were characterized in vitro. We identified two novel heterozygous LHX4 mutations, namely c.249-1G>A, p.V75I, and one common POU1F1 mutation, p.R271W. The patient harboring the c.249-1G>A mutation exhibited isolated growth hormone deficiency at diagnosis and a gradual loss of ACTH, whereas the patient with the p.V75I mutation exhibited multiple pituitary hormone deficiency. In vitro experiments showed that both LHX4 mutations were associated with an impairment of the transactivation capacities of POU1F1 andαGSU, without any dominant-negative effects. The total mutation prevalence in Japanese CH patients was 3.3%. This study is the first to describe, a gradual loss of ACTH in a patient carrying an LHX4 mutation. Careful monitoring of hypothalamic–pituitary -adrenal function is recommended for CH patients with LHX4 mutations. PMID:23029363
Analysis of PIK3CA Mutations and Activation Pathways in Triple Negative Breast Cancer.
Cossu-Rocca, Paolo; Orrù, Sandra; Muroni, Maria Rosaria; Sanges, Francesca; Sotgiu, Giovanni; Ena, Sara; Pira, Giovanna; Murgia, Luciano; Manca, Alessandra; Uras, Maria Gabriela; Sarobba, Maria Giuseppina; Urru, Silvana; De Miglio, Maria Rosaria
2015-01-01
Triple Negative Breast Cancer (TNBC) accounts for 12-24% of all breast carcinomas, and shows worse prognosis compared to other breast cancer subtypes. Molecular studies demonstrated that TNBCs are a heterogeneous group of tumors with different clinical and pathologic features, prognosis, genetic-molecular alterations and treatment responsivity. The PI3K/AKT is a major pathway involved in the regulation of cell survival and proliferation, and is the most frequently altered pathway in breast cancer, apparently with different biologic impact on specific cancer subtypes. The most common genetic abnormality is represented by PIK3CA gene activating mutations, with an overall frequency of 20-40%. The aims of our study were to investigate PIK3CA gene mutations on a large series of TNBC, to perform a wider analysis on genetic alterations involving PI3K/AKT and BRAF/RAS/MAPK pathways and to correlate the results with clinical-pathologic data. PIK3CA mutation analysis was performed by using cobas® PIK3CA Mutation Test. EGFR, AKT1, BRAF, and KRAS genes were analyzed by sequencing. Immunohistochemistry was carried out to identify PTEN loss and to investigate for PI3K/AKT pathways components. PIK3CA mutations were detected in 23.7% of TNBC, whereas no mutations were identified in EGFR, AKT1, BRAF, and KRAS genes. Moreover, we observed PTEN loss in 11.3% of tumors. Deregulation of PI3K/AKT pathways was revealed by consistent activation of pAKT and p-p44/42 MAPK in all PIK3CA mutated TNBC. Our data shows that PIK3CA mutations and PI3K/AKT pathway activation are common events in TNBC. A deeper investigation on specific TNBC genomic abnormalities might be helpful in order to select patients who would benefit from current targeted therapy strategies.
Mutations in XRCC4 cause primordial dwarfism without causing immunodeficiency.
Saito, Shinta; Kurosawa, Aya; Adachi, Noritaka
2016-08-01
In successive reports from 2014 to 2015, X-ray repair cross-complementing protein 4 (XRCC4) has been identified as a novel causative gene of primordial dwarfism. XRCC4 is indispensable for non-homologous end joining (NHEJ), the major pathway for repairing DNA double-strand breaks. As NHEJ is essential for V(D)J recombination during lymphocyte development, it is generally believed that abnormalities in XRCC4 cause severe combined immunodeficiency. Contrary to expectations, however, no overt immunodeficiency has been observed in patients with primordial dwarfism harboring XRCC4 mutations. Here, we describe the various XRCC4 mutations that lead to disease and discuss their impact on NHEJ and V(D)J recombination.
Frawley, Thomas; O'Brien, Cathal P; Conneally, Eibhlin; Vandenberghe, Elisabeth; Percy, Melanie; Langabeer, Stephen E; Haslam, Karl
2018-02-01
The classical Philadelphia chromosome-negative myeloproliferative neoplasms (MPNs), consisting of polycythemia vera, essential thrombocythemia, and primary myelofibrosis, are a heterogeneous group of neoplasms that harbor driver mutations in the JAK2, CALR, and MPL genes. The detection of mutations in these genes has been incorporated into the recent World Health Organization (WHO) diagnostic criteria for MPN. Given a pressing clinical need to screen for mutations in these genes in a routine diagnostic setting, a targeted next-generation sequencing (NGS) assay for the detection of MPN-associated mutations located in JAK2 exon 14, JAK2 exon 12, CALR exon 9, and MPL exon 10 was developed to provide a single platform alternative to reflexive, stepwise diagnostic algorithms. Polymerase chain reaction (PCR) primers were designed to target mutation hotspots in JAK2 exon 14, JAK2 exon 12, MPL exon 10, and CALR exon 9. Multiplexed PCR conditions were optimized by using qualitative PCR followed by NGS. Diagnostic genomic DNA from 35 MPN patients, known to harbor driver mutations in one of the target genes, was used to validate the assay. One hundred percent concordance was observed between the previously-identified mutations and those detected by NGS, with no false positives, nor any known mutations missed (specificity = 100%, CI = 0.96, sensitivity = 100%, CI = 0.89). Improved resolution of mutation sequences was also revealed by NGS analysis. Detection of diagnostically relevant driver mutations of MPN is enhanced by employing a targeted multiplex NGS approach. This assay presents a robust solution to classical MPN mutation screening, providing an alternative to time-consuming sequential analyses.
33 CFR 162.155 - Sandusky and Huron Harbors, Ohio.
Code of Federal Regulations, 2011 CFR
2011-07-01
... Harbors, Ohio. (a) In Sandusky Harbor, no vessel greater than 40 feet in length may exceed 10 miles per hour. (b) In Huron Harbor, no vessel greater than 40 feet in length may exceed 6 miles per hour, except in the outer harbor where no vessel greater than 40 feet in length may exceed 10 miles per hour. Note...
33 CFR 162.155 - Sandusky and Huron Harbors, Ohio.
Code of Federal Regulations, 2014 CFR
2014-07-01
... Harbors, Ohio. (a) In Sandusky Harbor, no vessel greater than 40 feet in length may exceed 10 miles per hour. (b) In Huron Harbor, no vessel greater than 40 feet in length may exceed 6 miles per hour, except in the outer harbor where no vessel greater than 40 feet in length may exceed 10 miles per hour. Note...
33 CFR 162.155 - Sandusky and Huron Harbors, Ohio.
Code of Federal Regulations, 2013 CFR
2013-07-01
... Harbors, Ohio. (a) In Sandusky Harbor, no vessel greater than 40 feet in length may exceed 10 miles per hour. (b) In Huron Harbor, no vessel greater than 40 feet in length may exceed 6 miles per hour, except in the outer harbor where no vessel greater than 40 feet in length may exceed 10 miles per hour. Note...
33 CFR 162.155 - Sandusky and Huron Harbors, Ohio.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Harbors, Ohio. (a) In Sandusky Harbor, no vessel greater than 40 feet in length may exceed 10 miles per hour. (b) In Huron Harbor, no vessel greater than 40 feet in length may exceed 6 miles per hour, except in the outer harbor where no vessel greater than 40 feet in length may exceed 10 miles per hour. Note...
33 CFR 162.155 - Sandusky and Huron Harbors, Ohio.
Code of Federal Regulations, 2012 CFR
2012-07-01
... Harbors, Ohio. (a) In Sandusky Harbor, no vessel greater than 40 feet in length may exceed 10 miles per hour. (b) In Huron Harbor, no vessel greater than 40 feet in length may exceed 6 miles per hour, except in the outer harbor where no vessel greater than 40 feet in length may exceed 10 miles per hour. Note...
Vannucchi, A M; Rotunno, G; Bartalucci, N; Raugei, G; Carrai, V; Balliu, M; Mannarelli, C; Pacilli, A; Calabresi, L; Fjerza, R; Pieri, L; Bosi, A; Manfredini, R; Guglielmelli, P
2014-01-01
Mutations in the gene calreticulin (CALR) occur in the majority of JAK2- and MPL-unmutated patients with essential thrombocythemia (ET) and primary myelofibrosis (PMF); identifying CALR mutations contributes to the diagnostic pathway of ET and PMF. CALR mutations are heterogeneous spanning over the exon 9, but all result in a novel common protein C terminus. We developed a polyclonal antibody against a 17-amino-acid peptide derived from mutated calreticulin that was used for immunostaining of bone marrow biopsies. We show that this antibody specifically recognized patients harboring different types of CALR mutation with no staining in healthy controls and JAK2- or MPL-mutated ET and PMF. The labeling was mostly localized in megakaryocytes, whereas myeloid and erythroid cells showed faint staining, suggesting a preferential expression of calreticulin in megakaryocytes. Megakaryocytic-restricted expression of calreticulin was also demonstrated using an antibody against wild-type calreticulin and by measuring the levels of calreticulin RNA by gene expression analysis. Immunostaining using an antibody specific for mutated calreticulin may become a rapid, simple and cost-effective method for identifying CALR-mutated patients complementing molecular analysis; furthermore, the labeling pattern supports the preferential expansion of megakaryocytic cell lineage as a result of CALR mutation in an immature hematopoietic stem cell. PMID:24618731
Alagappan, Uma; Pramono, Zacharias A D; Chong, Wei-Sheng
2017-03-01
Erythropoietic protoporphyria (EPP) is a rare inherited disorder of heme biosynthesis caused by decreased activity of the enzyme ferrochelatase (FECH ). The frequency of the hypomorphic c.333-48C allele in a population directly contributes to the prevalence of EPP in the same population. This study sought to identify the molecular basis of EPP in a Chinese patient from Singapore and the c.333-48C allele frequency among the Chinese population in Singapore. FECH gene was screened for mutation in the patient's DNA sample by polymerase chain reaction amplification and DNA sequencing. To validate the identified mutation, the FECH region harboring the mutation was screened in DNA samples from all healthy controls. One patient and 46 ethnically matched healthy controls were included in the study. A novel c.474dupC which leads to a frameshift and premature stop codon was identified in one allele, while the other allele showed to carry c.333-48C and c.337C>T variants in the patient's FECH. The frequency of the c.333-48C hypomorphic allele is 27% among Chinese population in Singapore. c.474dupC in one allele trans to hypomorphic c.333-48C and c.337C>T allele in FECH gene may be the underlying cause of the clinical EPP of the studied patient. The FECH hypomorphic c.333-48C allele frequency in Singapore is lower than the Han Chinese (41.3%) and Japanese (43%) populations but nearly the same as the Southeast Asian (31%) population and higher than the European (2.7-11%) population. © 2016 The International Society of Dermatology.
Chan, Raymond Tsz-Tong
2018-03-01
Non-small cell lung cancers (NSCLC) harboring the uncommon epidermal growth factor receptor (EGFR) exon 20 insertion mutations are generally thought to be unresponsive to EGFR-tyrosine kinase inhibitor (TKI) therapy. Presented here is a case of stage IV NSCLC harboring an uncommon EGFR exon 20 insertion mutation that was maintained at minimal progressive disease for 54 months, with 36 months on the second-generation TKI afatinib. Contrary to the existing literature, the patient in this case demonstrated a long, durable response to the EGFR-TKI, which was exhibited by a long survival endpoint. This suggests that stability in clinical symptoms might be sufficient to warrant continuation of therapy. © 2018 The Authors. Asia-Pacific Journal of Clinical Oncology Published by John Wiley & Sons Australia, Ltd.
33 CFR 117.811 - Tonawanda Harbor.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Tonawanda Harbor. 117.811 Section 117.811 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements New York § 117.811 Tonawanda Harbor. The draw of the...
Disease Mutations in Rab7 Result in Unregulated Nucleotide Exchange and Inappropriate Activation
DOE Office of Scientific and Technical Information (OSTI.GOV)
B McCray; E Skordalakes; J Taylor
2011-12-31
Rab GTPases are molecular switches that orchestrate vesicular trafficking, maturation and fusion by cycling between an active, GTP-bound form, and an inactive, GDP-bound form. The activity cycle is coupled to GTP hydrolysis and is tightly controlled by regulatory proteins. Missense mutations of the GTPase Rab7 cause a dominantly inherited axonal degeneration known as Charcot-Marie-Tooth type 2B through an unknown mechanism. We present the 2.8 A crystal structure of GTP-bound L129F mutant Rab7 which reveals normal conformations of the effector binding regions and catalytic site, but an alteration to the nucleotide binding pocket that is predicted to alter GTP binding. Throughmore » extensive biochemical analysis, we demonstrate that disease-associated mutations in Rab7 do not lead to an intrinsic GTPase defect, but permit unregulated nucleotide exchange leading to both excessive activation and hydrolysis-independent inactivation. Consistent with augmented activity, mutant Rab7 shows significantly enhanced interaction with a subset of effector proteins. In addition, dynamic imaging demonstrates that mutant Rab7 is abnormally retained on target membranes. However, we show that the increased activation of mutant Rab7 is counterbalanced by unregulated, GTP hydrolysis-independent membrane cycling. Notably, disease mutations are able to rescue the membrane cycling of a GTPase-deficient mutant. Thus, we demonstrate that disease mutations uncouple Rab7 from the spatial and temporal control normally imposed by regulatory proteins and cause disease not by a gain of novel toxic function, but by misregulation of native Rab7 activity.« less
Wang, Shu; Yu, Bing; Ng, Chiu Chin; Mercorella, Belinda; Selinger, Christina I.; O’Toole, Sandra A.
2015-01-01
Background Patients with advanced non-small cell lung cancer (NSCLC) benefit from treatment with epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) when their tumor harbors an activating EGFR mutation. As the majority of NSCLC patients present with advanced disease, cytology and small biopsy specimens are frequently the only tissue available for mutation testing, but can pose challenges due to low tumor content. We aim to better define the suitability of these specimens for mutation testing. Methods NSCLC cases referred to our institution for mutation testing over a 15-month period were retrospectively reviewed. Specimens were tested for mutations including EGFR, KRAS, and BRAF, using a multiplex PCR assay (OncoCarta Panel v1.0) and analyzed on the Agena Bioscience MassARRAY platform. Results A total of 146 specimens were tested, comprising 53 (36.3%) resection specimens (including 28 lung resection specimens), 55 (37.7%) small biopsy specimens and 38 (26%) cytology specimens. Of 142 cases with sufficient DNA for mutation testing, EGFR mutations were detected in 31 specimens (21.8%), KRAS mutations in 31 specimens (21.8%) and BRAF mutations in three specimens (2.1%). There was no significant difference in the EGFR mutation rate between lung resection (10 of 28 cases; 35.7%), small biopsy (9 of 53 cases; 17%), and cytology specimens (8 of 36 cases; 22.2%). Conclusions Our results support the utility of small biopsy and cytology specimens for mutation testing. Careful evaluation of the adequacy of small specimens is required to minimize the risk of false negative or positive results. PMID:25870794
Ueda, Yoshihide; Marusawa, Hiroyuki; Egawa, Hiroto; Okamoto, Shinya; Ogura, Yasuhiro; Oike, Fumitaka; Nishijima, Norihiro; Takada, Yasutsugu; Uemoto, Shinji; Chiba, Tsutomu
2011-01-01
De novo activation of HBV occurs after liver transplantation from hepatitis B surface antigen (HBsAg)-negative and hepatitis B core antibody (anti-HBc)-positive donors, even under hepatitis B immunoglobulin (HBIG) prophylaxis. One reason for the activation of HBV is the emergence of HBV with escape mutations from hepatitis B surface antibody (anti-HBs). The aim of this study is to clarify the clinical features for de novo activation of HBV with anti-HBs escape mutations after liver transplantation. Clinical features of 75 patients who received HBIG prophylaxis >6 months after liver transplantation with liver grafts from anti-HBc-positive donors were retrospectively analysed. Among the 75 recipients, 19 (25%) developed de novo activation of HBV. Of the 19 recipients, the emergence of HBV with anti-HBs escape mutations was confirmed in 7 patients. The rate of de novo activation of HBV with anti-HBs escape mutations was 12% at 5 years. Sequence analysis revealed mutations in the common 'a' determinant region of the surface gene, including G145R, G145A and Q129P, in HBsAg. Administration of entecavir immediately after the occurrence of de novo HBV activation resolved hepatitis and induced clearance of serum HBsAg and HBV DNA in all four patients receiving entecavir. Escape mutations from anti-HBs caused de novo activation of HBV under HBIG prophylaxis after liver transplantation. Early administration of entecavir was effective on de novo activation of HBV with anti-HBs escape mutations.
Suzukawa, Keisuke; Yamagami, Takeshi; Ohnuma, Takayuki; Hirakawa, Hideki; Kuhara, Satoru; Aso, Yoichi; Ishiguro, Masatsune
2003-02-01
We expressed chitinase-1 (TBC-1) from tulip bulbs (Tulipa bakeri) in E. coli cells and used site-directed mutagenesis to identify amino acid residues essential for catalytic activity. Mutations at Glu-125 and Trp-251 completely abolished enzyme activity, and activity decreased with mutations at Asp-123 and Trp-172 when glycolchitin was the substrate. Activity changed with the mutations of Trp-251 to one of several amino acids with side-chains of little hydrophobicity, suggesting that hydrophobic interaction of Trp-251 is important for the activity. Molecular dynamics (MD) simulation analysis with hevamine as the model compound showed that the distance between Asp-123 and Glu-125 was extended by mutation of Trp-251. Kinetic studies of Trp-251-mutated chitinases confirmed these various phenomena. The results suggested that Glu-125 and Trp-251 are essential for enzyme activity and that Trp-251 had a direct role in ligand binding.
Lee, Jeffrey C; Vivanco, Igor; Beroukhim, Rameen; Huang, Julie H. Y; Feng, Whei L; DeBiasi, Ralph M; Yoshimoto, Koji; King, Jennifer C; Nghiemphu, Phioanh; Yuza, Yuki; Xu, Qing; Greulich, Heidi; Thomas, Roman K; Paez, J. Guillermo; Peck, Timothy C; Linhart, David J; Glatt, Karen A; Getz, Gad; Onofrio, Robert; Ziaugra, Liuda; Levine, Ross L; Gabriel, Stacey; Kawaguchi, Tomohiro; O'Neill, Keith; Khan, Haumith; Liau, Linda M; Nelson, Stanley F; Rao, P. Nagesh; Mischel, Paul; Pieper, Russell O; Cloughesy, Tim; Leahy, Daniel J; Sellers, William R; Sawyers, Charles L; Meyerson, Matthew; Mellinghoff, Ingo K
2006-01-01
Background Protein tyrosine kinases are important regulators of cellular homeostasis with tightly controlled catalytic activity. Mutations in kinase-encoding genes can relieve the autoinhibitory constraints on kinase activity, can promote malignant transformation, and appear to be a major determinant of response to kinase inhibitor therapy. Missense mutations in the EGFR kinase domain, for example, have recently been identified in patients who showed clinical responses to EGFR kinase inhibitor therapy. Methods and Findings Encouraged by the promising clinical activity of epidermal growth factor receptor (EGFR) kinase inhibitors in treating glioblastoma in humans, we have sequenced the complete EGFR coding sequence in glioma tumor samples and cell lines. We identified novel missense mutations in the extracellular domain of EGFR in 13.6% (18/132) of glioblastomas and 12.5% (1/8) of glioblastoma cell lines. These EGFR mutations were associated with increased EGFR gene dosage and conferred anchorage-independent growth and tumorigenicity to NIH-3T3 cells. Cells transformed by expression of these EGFR mutants were sensitive to small-molecule EGFR kinase inhibitors. Conclusions Our results suggest extracellular missense mutations as a novel mechanism for oncogenic EGFR activation and may help identify patients who can benefit from EGFR kinase inhibitors for treatment of glioblastoma. PMID:17177598
Purcell, Ryan H; Toro, Camilo; Gahl, William A; Hall, Randy A
2017-12-01
Mutations in G protein-coupled receptors (GPCRs) that increase constitutive signaling activity can cause human disease. A de novo C-terminal mutation (R1465W) in the adhesion GPCR BAI2 (also known as ADGRB2) was identified in a patient suffering from progressive spastic paraparesis and other neurological symptoms. In vitro studies revealed that this mutation strongly increases the constitutive signaling activity of an N-terminally cleaved form of BAI2, which represents the activated form of the receptor. Further studies dissecting the mechanism(s) underling this effect revealed that wild-type BAI2 primarily couples to Gα z , with the R1465W mutation conferring increased coupling to Gα i . The R1465W mutation also increases the total and surface expression of BAI2. The mutation has no effect on receptor binding to β-arrestins, but does perturb binding to the endocytic protein endophilin A1, identified here as a novel interacting partner for BAI2. These studies provide new insights into the signaling capabilities of the adhesion GPCR BAI2/ADGRB2 and shed light on how an apparent gain-of-function mutation to the receptor's C-terminus may lead to human disease. © 2017 Wiley Periodicals, Inc.
Fennell, Lochlan J; Clendenning, Mark; McKeone, Diane M; Jamieson, Saara H; Balachandran, Samanthy; Borowsky, Jennifer; Liu, John; Kawamata, Futoshi; Bond, Catherine E; Rosty, Christophe; Burge, Matthew E; Buchanan, Daniel D; Leggett, Barbara A; Whitehall, Vicki L J
2018-01-01
The WNT signaling pathway is commonly altered during colorectal cancer development. The E3 ubiquitin ligase, RNF43, negatively regulates the WNT signal through increased ubiquitination and subsequent degradation of the Frizzled receptor. RNF43 has recently been reported to harbor frequent truncating frameshift mutations in sporadic microsatellite unstable (MSI) colorectal cancers. This study assesses the relative frequency of RNF43 mutations in hereditary colorectal cancers arising in the setting of Lynch syndrome. The entire coding region of RNF43 was Sanger sequenced in 24 colorectal cancers from 23 patients who either (i) carried a germline mutation in one of the DNA mismatch repair genes (MLH1, MSH6, MSH2, PMS2), or (ii) showed immunohistochemical loss of expression of one or more of the DNA mismatch repair proteins, was BRAF wild type at V600E, were under 60 years of age at diagnosis, and demonstrated no promoter region methylation for MLH1 in tumor DNA. A validation cohort of 44 colorectal cancers from mismatch repair germline mutation carriers from the Australasian Colorectal Cancer Family Registry (ACCFR) were sequenced for the most common truncating mutation hotspots (X117 and X659). RNF43 mutations were found in 9 of 24 (37.5%) Lynch syndrome colorectal cancers. The majority of mutations were frameshift deletions in the G659 G7 repeat tract (29%); 2 cancers (2/24, 8%) from the one patient harbored frameshift mutations at codon R117 (C6 repeat tract) within exon 3. In the ACCFR validation cohort, RNF43 hotspot mutations were identified in 19/44 (43.2%) of samples, which was not significantly different to the initial series. The proportion of mutant RNF43 in Lynch syndrome related colorectal cancers is significantly lower than the previously reported mutation rate found in sporadic MSI colorectal cancers. These findings identify further genetic differences between sporadic and hereditary colorectal cancers. This may be because Lynch Syndrome cancers
Sundararajan, S; Khadanga, Mukunda Kesari; Kumar, J Prince Prakash Jeba; Raghumaran, S; Vijaya, R; Jena, Basanta Kumar
2017-01-15
In this study, different types of indices were used to assess the ecological risk of trace metal contamination in sediments on the basis of sediment quality guidelines at Veraval Fishery Harbor. Sediment samples were collected from three sectors in pre-, post-, and monsoon seasons in 2006. Trace metal concentrations were higher in the inner sector during post-monsoon, and it showed the highest statistical significance (p<0.01) among the stations. Pollution load index was higher than unity, indicating alternation by effluent discharge from industries. Enrichment factor and geo-accumulation index showed that Cd, Pb, and Zn were enriched in the northern part of the harbor and Pb had accumulated in the harbor sediment. The ecological risk assessment index revealed that Ni, Zn, and Pb were higher than the effect range median values, indicating their potential toxicity to the aquatic environment in the Veraval Harbor. Hence, the harbor is dominated by anthropogenic activities rather than natural process. Copyright © 2016 Elsevier Ltd. All rights reserved.
A mutation in a new gene bglJ, activates the bgl operon in Escherichia coli K-12
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giel, M.; Desnoyer, M.; Lopilato, J.
1996-06-01
A new mutation , bglJ4, has been characterized that results in the expression of the silent bgl operon. The bgl operon encodes proteins necessary for the transport and utilization of the aromatic {beta}-glucosides arbutin and salicin. A variety of mutations activate the operon and result in a Bgl{sup +} phenotype. Activating mutations are located upstream of the bgl promoter and in genes located elsewhere on the chromosome. Mutations outside of the bgl operon occur in the genes encoding DNA gyrase and in the gene encoding the nucleoid associated protein H-NS. The mutation described here, bglJ4, has been mapped to amore » new locus at min 99 on the Escherichia coli K-12 genetic map. The putative protein encoded by the bglJ gene has homology to a family of transcriptional activators. Evidence is presented that increased expression of the bglJ product is needed for activation of the bgl operon. 56 refs., 3 figs., 3 tabs.« less
Hull, Claire M.; Parker, Josie E.; Bader, Oliver; Weig, Michael; Gross, Uwe; Warrilow, Andrew G. S.; Kelly, Diane E.
2012-01-01
We identified a clinical isolate of Candida glabrata (CG156) exhibiting flocculent growth and cross-resistance to fluconazole (FLC), voriconazole (VRC), and amphotericin B (AMB), with MICs of >256, >256, and 32 μg ml−1, respectively. Sterol analysis using gas chromatography-mass spectrometry (GC-MS) revealed that CG156 was a sterol 14α-demethylase (Erg11p) mutant, wherein 14α-methylated intermediates (lanosterol was >80% of the total) were the only detectable sterols. ERG11 sequencing indicated that CG156 harbored a single-amino-acid substitution (G315D) which nullified the function of native Erg11p. In heterologous expression studies using a doxycycline-regulatable Saccharomyces cerevisiae erg11 strain, wild-type C. glabrata Erg11p fully complemented the function of S. cerevisiae sterol 14α-demethylase, restoring growth and ergosterol synthesis in recombinant yeast; mutated CG156 Erg11p did not. CG156 was culturable using sterol-free, glucose-containing yeast minimal medium (glcYM). However, when grown on sterol-supplemented glcYM (with ergosta 7,22-dienol, ergosterol, cholestanol, cholesterol, Δ7-cholestenol, or desmosterol), CG156 cultures exhibited shorter lag phases, reached higher cell densities, and showed alterations in cellular sterol composition. Unlike comparator isolates (harboring wild-type ERG11) that became less sensitive to FLC and VRC when cultured on sterol-supplemented glcYM, facultative sterol uptake by CG156 did not affect its azole-resistant phenotype. Conversely, CG156 grown using glcYM with ergosterol (or with ergosta 7,22-dienol) showed increased sensitivity to AMB; CG156 grown using glcYM with cholesterol (or with cholestanol) became more resistant (MICs of 2 and >64 μg AMB ml−1, respectively). Our results provide insights into the consequences of sterol uptake and metabolism on growth and antifungal resistance in C. glabrata. PMID:22615281
Activation of Antibiotic Production in Bacillus spp. by Cumulative Drug Resistance Mutations.
Tojo, Shigeo; Tanaka, Yukinori; Ochi, Kozo
2015-12-01
Bacillus subtilis strains produce a wide range of antibiotics, including ribosomal and nonribosomal peptide antibiotics, as well as bacilysocin and neotrehalosadiamine. Mutations in B. subtilis strain 168 that conferred resistance to drugs such as streptomycin and rifampin resulted in overproduction of the dipeptide antibiotic bacilysin. Cumulative drug resistance mutations, such as mutations in the mthA and rpsL genes, which confer low- and high-level resistance, respectively, to streptomycin, and mutations in rpoB, which confer resistance to rifampin, resulted in cells that overproduced bacilysin. Transcriptional analysis demonstrated that the enhanced transcription of biosynthesis genes was responsible for the overproduction of bacilysin. This approach was effective also in activating the cryptic genes of Bacillus amyloliquefaciens, leading to actual production of antibiotic(s). Copyright © 2015, American Society for Microbiology. All Rights Reserved.
33 CFR 80.1136 - Moss Landing Harbor, CA.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Moss Landing Harbor, CA. 80.1136... NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1136 Moss Landing Harbor, CA. A line drawn from the seaward extremity of the pier located 0.3 mile south of Moss Landing Harbor Entrance to the...
33 CFR 80.1136 - Moss Landing Harbor, CA.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Moss Landing Harbor, CA. 80.1136... NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1136 Moss Landing Harbor, CA. A line drawn from the seaward extremity of the pier located 0.3 mile south of Moss Landing Harbor Entrance to the...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fan, L.; Fuss, J.O.; Cheng, Q.J.
2009-05-18
Mutations in XPD helicase, required for nucleotide excision repair (NER) as part of the transcription/repair complex TFIIH, cause three distinct phenotypes: cancer-prone xeroderma pigmentosum (XP), or aging disorders Cockayne syndrome (CS), and trichothiodystrophy (TTD). To clarify molecular differences underlying these diseases, we determined crystal structures of the XPD catalytic core from Sulfolobus acidocaldarius and measured mutant enzyme activities. Substrate-binding grooves separate adjacent Rad51/RecA-like helicase domains (HD1, HD2) and an arch formed by 4FeS and Arch domains. XP mutations map along the HD1 ATP-binding edge and HD2 DNA-binding channel and impair helicase activity essential for NER. XP/CS mutations both impair helicasemore » activity and likely affect HD2 functional movement. TTD mutants lose or retain helicase activity but map to sites in all four domains expected to cause framework defects impacting TFIIH integrity. These results provide a foundation for understanding disease consequences of mutations in XPD and related 4Fe-4S helicases including FancJ.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tainer, John; Fan, Li; Fuss, Jill O.
2008-06-02
Mutations in XPD helicase, required for nucleotide excision repair (NER) as part of the transcription/repair complex TFIIH, cause three distinct phenotypes: cancer-prone xeroderma pigmentosum (XP), or aging disorders Cockayne syndrome (CS), and trichothiodystrophy (TTD). To clarify molecular differences underlying these diseases, we determined crystal structures of the XPD catalytic core from Sulfolobus acidocaldarius and measured mutant enzyme activities. Substrate-binding grooves separate adjacent Rad51/RecA-like helicase domains (HD1, HD2) and an arch formed by 4FeS and Arch domains. XP mutations map along the HD1 ATP-binding edge and HD2 DNA-binding channel and impair helicase activity essential for NER. XP/CS mutations both impair helicasemore » activity and likely affect HD2 functional movement. TTD mutants lose or retain helicase activity but map to sites in all four domains expected to cause framework defects impacting TFIIH integrity. These results provide a foundation for understanding disease consequences of mutations in XPD and related 4Fe-4S helicases including FancJ.« less
De Rosa, Anna; Pellegrino, Teresa; Pappatà, Sabina; Pellecchia, Maria Teresa; Peluso, Silvio; Saccà, Francesco; Barone, Paolo; Cuocolo, Alberto; De Michele, Giuseppe
2017-02-01
PARK2 is an autosomal recessive parkinsonism caused by parkin gene mutations. Several Parkinson's Disease (PD) cases harbor single parkin mutations, raising a debate about the pathogenic meaning of heterozygous mutations. Here, we evaluate cardiac autonomic innervation in patients with either two or one parkin mutations compared to patients with idiopathic PD (IPD). Myocardial 123 I-metaiodobenzylguanidine (MIBG) scintigraphy was performed in six PD patients with single parkin mutations (HET), four with two mutations (PARK2), and eight with IPD. In comparison to control group, IPD patients showed lower early and late heart-to-mediastinum (H/M) ratios and higher washout rates, whereas HET patients had only lower early H/M ratio, and PARK2 patients were not different for any parameter. At individual level, MIBG findings were abnormal in 7/8 IPD, in 4/6 HET and in 1/4 PARK2 patients. Preserved cardiac 123 I-MIBG uptake confirms that PARK2 pathogenic mechanism, at least partially, differs from that responsible for IPD. HET subjects show intermediate findings, suggesting possible heterogeneity.
Osoegawa, Atsushi; Hashimoto, Takafumi; Takumi, Yohei; Abe, Miyuki; Yamada, Tomonori; Kobayashi, Ryoji; Miyawaki, Michiyo; Takeuchi, Hideya; Okamoto, Tatsuro; Sugio, Kenji
2018-03-28
Background Acquired resistance (AR) to an epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) is a common event, and several underlying mechanisms, including T790 M, MET amplification and PTEN downregulation, have been reported for the common EGFR mutations. EGFR G719X is an uncommon mutation that has been reported to show sensitivity to EGFR-TKIs. However, no established cell lines harboring the EGFR G719X have been reported in the literature. Materials and Methods G719S-GR cells were established from malignant pleural effusion of a patient whose tumor developed AR from gefitinib treatment. G719S-GR cells were then genotyped and tested for drug sensitivities. Multiplex ligation-dependent probe amplification (MLPA) was used to compare the clinical tumor samples with G719S-GR. Results G719S-GR cells were resistant to EGFR-TKIs with an LC50 of around 10 μM. A genomic analysis showed that G719S-GR cells harbor the EGFR G719S mutation as well as the amplification of EGFR locus. The homozygous deletion of CDKN2A and the loss of PTEN and TSC1 were also detected. On comparing the copy number of tumor suppressor genes using MLPA, G719S-GR cells were found to lack one copy of PTEN, which was not observed in a tumor obtained before gefitinib treatment. Loss of PTEN may result in AKT activation. The mTORC1/2 inhibitor Torin-1 was able to inhibit the downstream signaling when combined with osimertinib. Discussion The newly established G719S-GR cell line may be useful for investigating the mechanism underlying the development of AR in the G719X mutation; the loss of PTEN may be one such mechanism.
Reducing Vulnerability of Ports and Harbors to Earthquake and Tsunami Hazards
Wood, Nathan J.; Good, James W.; Goodwin, Robert F.
2002-01-01
Recent scientific research suggests the Pacific Northwest could experience catastrophic earthquakes in the near future, both from distant and local sources, posing a significant threat to coastal communities. Damage could result from numerous earthquake-related hazards, such as severe ground shaking, soil liquefaction, landslides, land subsidence/uplift, and tsunami inundation. Because of their geographic location, ports and harbors are especially vulnerable to these hazards. Ports and harbors, however, are important components of many coastal communities, supporting numerous activities critical to the local and regional economy and possibly serving as vital post-event, response-recovery transportation links. A collaborative, multi-year initiative is underway to increase the resiliency of Pacific Northwest ports and harbors to earthquake and tsunami hazards, involving Oregon Sea Grant (OSG), Washington Sea Grant (WSG), the National Oceanic and Atmospheric Administration Coastal Services Center (CSC), and the U.S. Geological Survey Center for Science Policy (CSP). Specific products of this research, planning, and outreach initiative include a regional stakeholder issues and needs assessment, a community-based mitigation planning process, a Geographic Information System (GIS) — based vulnerability assessment methodology, an educational web-site and a regional data archive. This paper summarizes these efforts, including results of two pilot port-harbor community projects, one in Yaquina Bay, Oregon and the other in Sinclair Inlet, Washington. Finally, plans are outlined for outreach to other port and harbor communities in the Pacific Northwest and beyond, using "getting started" workshops and a web-based tutorial.
Wu, Qing-Yun; Ma, Meng-Meng; Fu, Lin; Zhu, Yuan-Yuan; Liu, Yang; Cao, Jiang; Zhou, Ping; Li, Zhen-Yu; Zeng, Ling-Yu; Li, Feng; Wang, Xiao-Yun; Xu, Kai-Lin
2018-05-18
Janus tyrosine kinase 2 (JAK2) mediates downstream signaling of cytokine receptors in all hematological lineages, constitutively active somatic JAK2 mutations play key roles in the pathology of myeloproliferative neoplasms (MPNs). Recently, germline JAK2 mutations are also associated with triple-negative MPNs. A novel germline mutation JAK2 V625F is reported to be involved in a subset of MPNs patients. However, the pathogenesis of this mutation caused MPN is still unclear. In this study, the homology models of JAK2 V625F showed that the newly formed interaction between F625 and Y613 disrupted the JAK2 JH1-JH2 domain interactions was responsible for its activation, when F625 and Y613 interaction was disrupted, its activity significantly decreased. While, when this interaction was repaired whether by forming hydrogen bond or salt bond, it would cause JAK2 activation. Biochemical studies also demonstrated that JAK2 V625F mutation led to JAK2-STAT5 pathway activation and promoted the proliferation of BaF3 cells. Thus, our results herein provide clues to understand the mechanism JAK2 V625F mutation caused MPNs and give information for the development of JAK2 mutation specific inhibitors. Copyright © 2018 Elsevier B.V. All rights reserved.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-09-28
... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 165 [Docket No. USCG-2012-0767] RIN 1625-AA00 Safety Zone, Changes to Original Rule; Boston Harbor's Rock Removal Project, Boston Inner Harbor... original provisions of that temporary final rule, but adds two additional safety zones necessary for the...
Fine-Scale Variability in Harbor Seal Foraging Behavior
Wilson, Kenady; Lance, Monique; Jeffries, Steven; Acevedo-Gutiérrez, Alejandro
2014-01-01
Understanding the variability of foraging behavior within a population of predators is important for determining their role in the ecosystem and how they may respond to future ecosystem changes. However, such variability has seldom been studied in harbor seals on a fine spatial scale (<30 km). We used a combination of standard and Bayesian generalized linear mixed models to explore how environmental variables influenced the dive behavior of harbor seals. Time-depth recorders were deployed on harbor seals from two haul-out sites in the Salish Sea in 2007 (n = 18) and 2008 (n = 11). Three behavioral bout types were classified from six dive types within each bout; however, one of these bout types was related to haul-out activity and was excluded from analyses. Deep foraging bouts (Type I) were the predominant type used throughout the study; however, variation in the use of bout types was observed relative to haul-out site, season, sex, and light (day/night). The proportional use of Type I and Type II (shallow foraging/traveling) bouts differed dramatically between haul-out sites, seasons, sexes, and whether it was day or night; individual variability between seals also contributed to the observed differences. We hypothesize that this variation in dive behavior was related to habitat or prey specialization by seals from different haul-out sites, or individual variability between seals in the study area. The results highlight the potential influence of habitat and specialization on the foraging behavior of harbor seals, and may help explain the variability in diet that is observed between different haul-out site groups in this population. PMID:24717815
Kwon, Dohee; Koh, Jaemoon; Kim, Sehui; Go, Heounjeong; Kim, Young A; Keam, Bhumsuk; Kim, Tae Min; Kim, Dong-Wan; Jeon, Yoon Kyung; Chung, Doo Hyun
2017-04-01
MET mutations leading to exon 14 skipping rarely occur in non-small cell lung cancer (NSCLC). Recently, small molecule inhibitors targeting MET mutations showed clinical benefit. However, the clinicopathological characteristics of NSCLC harboring MET mutations, and the correlation among mutations, protein expression, and gene copy number of MET in NSCLC remain unclear. Therefore, we address these issues. MET exon 14 skipping mutations were evaluated using real-time quantitative reverse-transcription-PCR (qRT-PCR) in 102 triple-negative (i.e., EGFR mutation (-)/ALK translocation (-)/KRAS mutation (-)) pulmonary adenocarcinomas, and 45 pleomorphic carcinomas. MET mutation and gene copy were also examined in microdissected tissues obtained from tumor areas with heterogeneous MET immunohistochemical expression. MET mutations were detected in 8.8% (9/102) of triple-negative adenocarcinomas and 20% (9/45) of pleomorphic carcinomas of the lung. Patients with MET-mutated adenocarcinomas was significantly older than those without MET mutations (P=0.015). The male to female and ever-to never-smoker ratios were 3:6 and 2:7, respectively, among patients with MET-mutated adenocarcinomas. All (9/9) of the MET-mutated adenocarcinomas showed acinar predominant histology with associated lepidic patterns. In contrast, the male to female and ever- to never-smoker ratios were 8:1 and 7:1, respectively, among patients with MET-mutated pleomorphic carcinomas. The carcinoma component of MET-mutated pleomorphic carcinomas was mostly adenocarcinoma of acinar pattern (8/9). MET mutation was detected by qRT-PCR in all samples with heterogeneous MET expression microdissected from five cases with MET-mutated adenocarcinoma, while MET gene amplification was detected in tumor areas expressing high MET protein levels among MET-mutated adenocarcinomas. MET-mutated NSCLC is characterized by older age in patients with adenocarcinoma and by an acinar histology and variable MET expression in patients
The co-occurrence of driver mutations in chronic myeloproliferative neoplasms.
Boddu, Prajwal; Chihara, Dai; Masarova, Lucia; Pemmaraju, Naveen; Patel, Keyur P; Verstovsek, Srdan
2018-06-27
Myeloproliferative neoplasms (MPNs) are clonal disorders characterized by proliferation of one or more elements of the myeloid lineage. Key genetic aberrations include the BCR-ABL1 gene rearrangement in Philadelphia chromosome-positive chronic myelogenous leukemia (CML) and JAK2/MPL/CALR aberrations in Philadelphia chromosome-negative MPNs. While thought to be mutually exclusive, occasional isolated reports of coexistence of BCR-ABL1 and JAK2, and JAK2 with MPL or CALR aberrations have been described. Given the paucity of data, clinical characteristics and outcome of patients harboring concurrent Philadelphia-positive and Philadelphia-negative mutations or dual Philadelphia-negative driver mutations have not been systematically evaluated, and their clinical relevance is largely unknown. It is difficult to determine the true relevance of co-existing driver mutations on outcomes given the rarity of its occurrence. In this case series, we describe those patients who had dual driver mutations detected at any point during the course of their disease and characterized their clinical and laboratory features, bone marrow pathology, and overall disease course.
Teaching about Pearl Harbor. Curriculum Enhancement Series #1.
ERIC Educational Resources Information Center
Shields, Anna Marshall
These materials consist of sample lesson plans for teaching about the Japanese attack on Pearl Harbor on December 7, 1941, in both U.S. and world history classes. The lesson plans challenge students to examine how current attitudes toward the Japanese may be rooted in World War II and Pearl Harbor. Selected bibliographies on Pearl Harbor, World…
The New Bedford Harbor Superfund site long-term monitoring program (1993-2009).
Nelson, William G; Bergen, Barbara J
2012-12-01
New Bedford Harbor (NBH), located in southeastern Massachusetts, was designated as a marine Superfund site in 1983 due to sediment contamination by polychlorinated biphenyls (PCBs). Based on risks to human health and the environment, the first two phases of the site cleanup involved dredging PCB-contaminated sediments from the harbor. Therefore, a long-term monitoring program (LTM) was developed to measure spatial and temporal chemical and biological changes in sediment, water, and biota to assess the effects and effectiveness of the remedial activities. A systematic, probabilistic sampling design was used to select sediment sampling stations. This unbiased design allowed the three segments of the harbor to be compared spatially and temporally to quantify changes resulting from dredging the contaminated sediments. Sediment was collected at each station, and chemical (e.g., PCBs and metals), physical (e.g., grain size), and biological (e.g., benthic community) measurements were conducted on all samples. This paper describes the overall NBH-LTM approach and the results from the five rounds of sample collections. There is a decreasing spatial gradient in sediment PCB concentrations from the northern boundary (upper harbor) to the southern boundary (outer harbor) of the site. Along this same transect, there is an increase in biological condition (e.g., benthic community diversity). Temporally, the contaminant and biological gradients have been maintained since the 1993 baseline collection; however, since the onset of full-scale remediation, PCB concentrations have decreased throughout the site, and one of the benthic community indices has shown significant improvement in the lower and outer harbor areas.
Neurologic syndrome associated with homozygous mutation at MAG sialic acid binding site.
Roda, Ricardo H; FitzGibbon, Edmond J; Boucekkine, Houda; Schindler, Alice B; Blackstone, Craig
2016-08-01
The MAG gene encodes myelin-associated glycoprotein (MAG), an abundant protein involved in axon-glial interactions and myelination during nerve regeneration. Several members of a consanguineous family with a clinical syndrome reminiscent of Pelizaeus-Merzbacher disease and demyelinating leukodystrophy on brain MRI were recently found to harbor a homozygous missense p.Ser133Arg MAG mutation. Here, we report two brothers from a nonconsanguineous family afflicted with progressive cognitive impairment, neuropathy, ataxia, nystagmus, and gait disorder. Exome sequencing revealed the homozygous missense mutation p.Arg118His in MAG. This Arg118 residue in immunoglobulin domain 1 is critical for sialic acid binding, providing a compelling mechanistic basis for disease pathogenesis.
Oncogenic mutations in melanomas and benign melanocytic nevi of the female genital tract
Tseng, Diane; Kim, Julie; Warrick, Andrea; Nelson, Dylan; Pukay, Marina; Beadling, Carol; Heinrich, Michael; Selim, Maria Angelica; Corless, Christopher L.; Nelson, Kelly
2015-01-01
Background The genetic heterogeneity of melanomas and melanocytic nevi of the female genital tract is poorly understood. Objective We aim to characterize the frequency of mutations of the following genes: BRAF, NRAS, KIT, GNA11, and GNAQ in female genital tract melanomas. We also characterize the frequency of BRAF mutations in female genital tract melanomas compared with melanocytic nevi. Methods Mutational screening was performed on the following female genital tract melanocytic neoplasms: 25 melanomas, 7 benign melanocytic nevi, and 4 atypical melanocytic nevi. Results Of the 25 female genital tract melanoma specimens queried, KIT mutations were detected in 4 (16.0%), NRAS mutations in 4 (16.0%), and BRAF mutations in 2 (8.0%) samples. Two of the tumors with KIT mutations harbored double mutations in the same exon. No GNAQ or GNA11 mutations were identified among 11 melanomas screened. BRAF V600E mutations were detected in 7 of 7 benign melanocytic genital nevi (100%) and 3 of 4 atypical genital nevi (75%). Limitations Our study is limited by the small sample size of this rare subset of melanomas. Conclusion KIT, NRAS, and BRAF mutations are found in a subset of female genital tract melanomas. Screening for oncogenic mutations is important for developing and applying clinical therapies for melanomas of the female genital tract. PMID:24842760
Oncogenic mutations in melanomas and benign melanocytic nevi of the female genital tract.
Tseng, Diane; Kim, Julie; Warrick, Andrea; Nelson, Dylan; Pukay, Marina; Beadling, Carol; Heinrich, Michael; Selim, Maria Angelica; Corless, Christopher L; Nelson, Kelly
2014-08-01
The genetic heterogeneity of melanomas and melanocytic nevi of the female genital tract is poorly understood. We aim to characterize the frequency of mutations of the following genes: BRAF, NRAS, KIT, GNA11, and GNAQ in female genital tract melanomas. We also characterize the frequency of BRAF mutations in female genital tract melanomas compared with melanocytic nevi. Mutational screening was performed on the following female genital tract melanocytic neoplasms: 25 melanomas, 7 benign melanocytic nevi, and 4 atypical melanocytic nevi. Of the 25 female genital tract melanoma specimens queried, KIT mutations were detected in 4 (16.0%), NRAS mutations in 4 (16.0%), and BRAF mutations in 2 (8.0%) samples. Two of the tumors with KIT mutations harbored double mutations in the same exon. No GNAQ or GNA11 mutations were identified among 11 melanomas screened. BRAF V600E mutations were detected in 7 of 7 benign melanocytic genital nevi (100%) and 3 of 4 atypical genital nevi (75%). Our study is limited by the small sample size of this rare subset of melanomas. KIT, NRAS, and BRAF mutations are found in a subset of female genital tract melanomas. Screening for oncogenic mutations is important for developing and applying clinical therapies for melanomas of the female genital tract. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.
Whole-genome sequencing of Atacama skeleton shows novel mutations linked with dysplasia
Bhattacharya, Sanchita; Li, Jian; Sockell, Alexandra; Kan, Matthew J.; Bava, Felice A.; Chen, Shann-Ching; Ávila-Arcos, María C.; Ji, Xuhuai; Smith, Emery; Asadi, Narges B.; Lachman, Ralph S.; Lam, Hugo Y.K.; Bustamante, Carlos D.; Butte, Atul J.; Nolan, Garry P.
2018-01-01
Over a decade ago, the Atacama humanoid skeleton (Ata) was discovered in the Atacama region of Chile. The Ata specimen carried a strange phenotype—6-in stature, fewer than expected ribs, elongated cranium, and accelerated bone age—leading to speculation that this was a preserved nonhuman primate, human fetus harboring genetic mutations, or even an extraterrestrial. We previously reported that it was human by DNA analysis with an estimated bone age of about 6–8 yr at the time of demise. To determine the possible genetic drivers of the observed morphology, DNA from the specimen was subjected to whole-genome sequencing using the Illumina HiSeq platform with an average 11.5× coverage of 101-bp, paired-end reads. In total, 3,356,569 single nucleotide variations (SNVs) were found as compared to the human reference genome, 518,365 insertions and deletions (indels), and 1047 structural variations (SVs) were detected. Here, we present the detailed whole-genome analysis showing that Ata is a female of human origin, likely of Chilean descent, and its genome harbors mutations in genes (COL1A1, COL2A1, KMT2D, FLNB, ATR, TRIP11, PCNT) previously linked with diseases of small stature, rib anomalies, cranial malformations, premature joint fusion, and osteochondrodysplasia (also known as skeletal dysplasia). Together, these findings provide a molecular characterization of Ata's peculiar phenotype, which likely results from multiple known and novel putative gene mutations affecting bone development and ossification. PMID:29567674
Collod-Béroud, G; Béroud, C; Adès, L; Black, C; Boxer, M; Brock, D J; Godfrey, M; Hayward, C; Karttunen, L; Milewicz, D; Peltonen, L; Richards, R I; Wang, M; Junien, C; Boileau, C
1997-01-01
Fibrillin is the major component of extracellular microfibrils. Mutations in the fibrillin gene on chromosome 15 (FBN1) were described at first in the heritable connective tissue disorder, Marfan syndrome (MFS). More recently, FBN1 has also been shown to harbor mutations related to a spectrum of conditions phenotypically related to MFS. These mutations are private, essentially missense, generally non-recurrent and widely distributed throughout the gene. To date no clear genotype/phenotype relationship has been observed excepted for the localization of neonatal mutations in a cluster between exons 24 and 32. The second version of the computerized Marfan database contains 89 entries. The software has been modified to accomodate new functions and routines. PMID:9016526
Constitutional Mutations in RTEL1 Cause Severe Dyskeratosis Congenita
Walne, Amanda J.; Vulliamy, Tom; Kirwan, Michael; Plagnol, Vincent; Dokal, Inderjeet
2013-01-01
Dyskeratosis congenita (DC) and its phenotypically severe variant, Hoyeraal-Hreidarsson syndrome (HHS), are multisystem bone-marrow-failure syndromes in which the principal pathology is defective telomere maintenance. The genetic basis of many cases of DC and HHS remains unknown. Using whole-exome sequencing, we identified biallelic mutations in RTEL1, encoding a helicase essential for telomere maintenance and regulation of homologous recombination, in an individual with familial HHS. Additional screening of RTEL1 identified biallelic mutations in 6/23 index cases with HHS but none in 102 DC or DC-like cases. All 11 mutations in ten HHS individuals from seven families segregated in an autosomal-recessive manner, and telomere lengths were significantly shorter in cases than in controls (p = 0.0003). This group had significantly higher levels of telomeric circles, produced as a consequence of incorrect processing of telomere ends, than did controls (p = 0.0148). These biallelic RTEL1 mutations are responsible for a major subgroup (∼29%) of HHS. Our studies show that cells harboring these mutations have significant defects in telomere maintenance, but not in homologous recombination, and that incorrect resolution of T-loops is a mechanism for telomere shortening and disease causation in humans. They also demonstrate the severe multisystem consequences of its dysfunction. PMID:23453664
Acquired Resistance to Crizotinib from a Mutation in CD74–ROS1
Awad, Mark M.; Katayama, Ryohei; McTigue, Michele; Liu, Wei; Deng, Ya-Li; Brooun, Alexei; Friboulet, Luc; Huang, Donghui; Falk, Matthew D.; Timofeevski, Sergei; Wilner, Keith D.; Lockerman, Elizabeth L.; Khan, Tahsin M.; Mahmood, Sidra; Gainor, Justin F.; Digumarthy, Subba R.; Stone, James R.; Mino-Kenudson, Mari; Christensen, James G.; Iafrate, A. John; Engelman, Jeffrey A.; Shaw, Alice T.
2013-01-01
Summary Crizotinib, an inhibitor of anaplastic lymphoma kinase (ALK), has also recently shown efficacy in the treatment of lung cancers with ROS1 translocations. Resistance to crizotinib developed in a patient with metastatic lung adenocarcinoma harboring a CD74–ROS1 rearrangement who had initially shown a dramatic response to treatment. We performed a biopsy of a resistant tumor and identified an acquired mutation leading to a glycine-to-arginine substitution at codon 2032 in the ROS1 kinase domain. Although this mutation does not lie at the gatekeeper residue, it confers resistance to ROS1 kinase inhibition through steric interference with drug binding. The same resistance mutation was observed at all the meta-static sites that were examined at autopsy, suggesting that this mutation was an early event in the clonal evolution of resistance. (Funded by Pfizer and others; ClinicalTrials.gov number, NCT00585195.) PMID:23724914
Somatic mutations in early onset luminal breast cancer
de Lyra, Eduardo Carneiro; Hirata Katayama, Maria Lucia; Maistro, Simone; de Vasconcellos Valle, Pedro Wilson Mompean; de Lima Pereira, Gláucia Fernanda; Rodrigues, Lívia Munhoz; de Menezes Pacheco Serio, Pedro Adolpho; de Gouvêa, Ana Carolina Ribeiro Chaves; Geyer, Felipe Correa; Basso, Ricardo Alves; Pasini, Fátima Solange; del Pilar Esteves Diz, Maria; Brentani, Maria Mitzi; Guedes Sampaio Góes, João Carlos; Chammas, Roger; Boutros, Paul C.; Koike Folgueira, Maria Aparecida Azevedo
2018-01-01
Breast cancer arising in very young patients may be biologically distinct; however, these tumors have been less well studied. We characterized a group of very young patients (≤ 35 years) for BRCA germline mutation and for somatic mutations in luminal (HER2 negative) breast cancer. Thirteen of 79 unselected very young patients were BRCA1/2 germline mutation carriers. Of the non-BRCA tumors, eight with luminal subtype (HER2 negative) were submitted for whole exome sequencing and integrated with 29 luminal samples from the COSMIC database or previous literature for analysis. We identified C to T single nucleotide variants (SNVs) as the most common base-change. A median of six candidate driver genes was mutated by SNVs in each sample and the most frequently mutated genes were PIK3CA, GATA3, TP53 and MAP2K4. Potential cancer drivers affected in the present non-BRCA tumors include GRHL2, PIK3AP1, CACNA1E, SEMA6D, SMURF2, RSBN1 and MTHFD2. Sixteen out of 37 luminal tumors (43%) harbored SNVs in DNA repair genes, such as ATR, BAP1, ERCC6, FANCD2, FANCL, MLH1, MUTYH, PALB2, POLD1, POLE, RAD9A, RAD51 and TP53, and 54% presented pathogenic mutations (frameshift or nonsense) in at least one gene involved in gene transcription. The differential biology of luminal early-age onset breast cancer needs a deeper genomic investigation. PMID:29854292
Toll-like receptor 3 as an immunotherapeutic target for KRAS mutated colorectal cancer
Maitra, Radhashree; Augustine, Titto; Dayan, Yitzchak; Chandy, Carol; Coffey, Matthew; Goel, Sanjay
2017-01-01
New therapeutic interventions are essential for improved management of patients with metastatic colorectal cancer (mCRC). This is especially critical for those patients whose tumors harbor a mutation in the KRAS oncogene (40-45% of all patients). This patient cohort is excluded from receiving anti-EGFR monoclonal antibodies that have added a significant therapeutic benefit for KRAS wild type CRC patients. Reovirus, a double stranded (ds) RNA virus is in clinical development for patients with chemotherapy refractory KRAS mutated tumors. Toll Like Receptor (TLR) 3, a member of the toll like receptor family of the host innate immune system is the pattern recognition motif for dsRNA pathogens. Using TLR3 expressing commercial HEK-Blue™-hTLR3 cells we confirm that TLR3 is the host pattern recognition motif responsible for the detection of reovirus. Further, our investigation with KRAS mutated HCT116 cell line showed that effective expression of host TLR3 dampens the infection potential of reovirus by mounting a robust innate immune response. Down regulation of TLR3 expression with siRNA improves the anticancer activity of reovirus. In vivo experiments using human CRC cells derived xenografts in athymic mice further demonstrate the beneficial effects of TLR3 knock down by improving tumor response rates to reovirus. Strategies to mitigate the TLR3 response pathway can be utilized as a tool towards improved reovirus efficacy to specifically target the dissemination of KRAS mutated CRC. PMID:28422714
Bonatti, Francesco; Adorni, Alessia; Matichecchia, Annalisa; Mozzoni, Paola; Uliana, Vera; Pisani, Francesco; Garavelli, Livia; Graziano, Claudio; Gnoli, Maria; Bigoni, Stefania; Boschi, Elena; Martorana, Davide; Percesepe, Antonio
2017-01-01
Neurofibromatosis type I, a genetic disorder due to mutations in the NF1 gene, is characterized by a high mutation rate (about 50% of the cases are de novo) but, with the exception of whole gene deletions associated with a more severe phenotype, no specific hotspots and few solid genotype/phenotype correlations. After retrospectively re-evaluating all NF1 gene variants found in the diagnostic activity, we studied 108 patients affected by neurofibromatosis type I who harbored mutations that had not been previously reported in the international databases, with the aim of analyzing their type and distribution along the gene and of correlating them with the phenotypic features of the affected patients. Out of the 108 previously unreported variants, 14 were inherited by one of the affected parents and 94 were de novo. Twenty-nine (26.9%) mutations were of uncertain significance, whereas 79 (73.2%) were predicted as pathogenic or probably pathogenic. No differential distribution in the exons or in the protein domains was observed and no statistically significant genotype/phenotype correlation was found, confirming previous evidences. PMID:28961165
Zhukova, Nataliya; Ramaswamy, Vijay; Remke, Marc; Martin, Dianna C; Castelo-Branco, Pedro; Zhang, Cindy H; Fraser, Michael; Tse, Ken; Poon, Raymond; Shih, David J H; Baskin, Berivan; Ray, Peter N; Bouffet, Eric; Dirks, Peter; von Bueren, Andre O; Pfaff, Elke; Korshunov, Andrey; Jones, David T W; Northcott, Paul A; Kool, Marcel; Pugh, Trevor J; Pomeroy, Scott L; Cho, Yoon-Jae; Pietsch, Torsten; Gessi, Marco; Rutkowski, Stefan; Bognár, Laszlo; Cho, Byung-Kyu; Eberhart, Charles G; Conter, Cecile Faure; Fouladi, Maryam; French, Pim J; Grajkowska, Wieslawa A; Gupta, Nalin; Hauser, Peter; Jabado, Nada; Vasiljevic, Alexandre; Jung, Shin; Kim, Seung-Ki; Klekner, Almos; Kumabe, Toshihiro; Lach, Boleslaw; Leonard, Jeffrey R; Liau, Linda M; Massimi, Luca; Pollack, Ian F; Ra, Young Shin; Rubin, Joshua B; Van Meir, Erwin G; Wang, Kyu-Chang; Weiss, William A; Zitterbart, Karel; Bristow, Robert G; Alman, Benjamin; Hawkins, Cynthia E; Malkin, David; Clifford, Steven C; Pfister, Stefan M; Taylor, Michael D; Tabori, Uri
2014-12-24
TP53 mutations confer subgroup specific poor survival for children with medulloblastoma. We hypothesized that WNT activation which is associated with improved survival for such children abrogates TP53 related radioresistance and can be used to sensitize TP53 mutant tumors for radiation. We examined the subgroup-specific role of TP53 mutations in a cohort of 314 patients treated with radiation. TP53 wild-type or mutant human medulloblastoma cell-lines and normal neural stem cells were used to test radioresistance of TP53 mutations and the radiosensitizing effect of WNT activation on tumors and the developing brain. Children with WNT/TP53 mutant medulloblastoma had higher 5-year survival than those with SHH/TP53 mutant tumours (100% and 36.6%±8.7%, respectively (p<0.001)). Introduction of TP53 mutation into medulloblastoma cells induced radioresistance (survival fractions at 2Gy (SF2) of 89%±2% vs. 57.4%±1.8% (p<0.01)). In contrast, β-catenin mutation sensitized TP53 mutant cells to radiation (p<0.05). Lithium, an activator of the WNT pathway, sensitized TP53 mutant medulloblastoma to radiation (SF2 of 43.5%±1.5% in lithium treated cells vs. 56.6±3% (p<0.01)) accompanied by increased number of γH2AX foci. Normal neural stem cells were protected from lithium induced radiation damage (SF2 of 33%±8% for lithium treated cells vs. 27%±3% for untreated controls (p=0.05). Poor survival of patients with TP53 mutant medulloblastoma may be related to radiation resistance. Since constitutive activation of the WNT pathway by lithium sensitizes TP53 mutant medulloblastoma cells and protect normal neural stem cells from radiation, this oral drug may represent an attractive novel therapy for high-risk medulloblastomas.
Quantitative metabolome analysis profiles activation of glutaminolysis in glioma with IDH1 mutation.
Ohka, Fumiharu; Ito, Maki; Ranjit, Melissa; Senga, Takeshi; Motomura, Ayako; Motomura, Kazuya; Saito, Kaori; Kato, Keiko; Kato, Yukinari; Wakabayashi, Toshihiko; Soga, Tomoyoshi; Natsume, Atsushi
2014-06-01
Isocitrate dehydrogenase 1 (IDH1), which localizes to the cytosol and peroxisomes, catalyzes the oxidative decarboxylation of isocitrate to α-ketoglutarate (α-KG) and in parallel converts NADP(+) to NADPH. IDH1 mutations are frequently detected in grades 2-4 gliomas and in acute myeloid leukemias (AML). Mutations of IDH1 have been identified at codon 132, with arginine being replaced with histidine in most cases. Mutant IDH1 gains novel enzyme activity converting α-KG to D-2-hydroxyglutarate (2-HG) which acts as a competitive inhibitor of α-KG. As a result, the activity of α-KG-dependent enzyme is reduced. Based on these findings, 2-HG has been proposed to be an oncometabolite. In this study, we established HEK293 and U87 cells that stably expressed IDH1-WT and IDH1-R132H and investigated the effect of glutaminase inhibition on cell proliferation with 6-diazo-5-oxo-L-norleucine (DON). We found that cell proliferation was suppressed in IDH1-R132H cells. The addition of α-KG restored cell proliferation. The metabolic features of 33 gliomas with wild type IDH1 (IDH1-WT) and with IDH1-R132H mutation were examined by global metabolome analysis using capillary electrophoresis time-of-flight mass spectrometry (CE-TOFMS). We showed that the 2-HG levels were highly elevated in gliomas with IDH1-R132H mutation. Intriguingly, in gliomas with IDH1-R132H, glutamine and glutamate levels were significantly reduced which implies replenishment of α-KG by glutaminolysis. Based on these results, we concluded that glutaminolysis is activated in gliomas with IDH1-R132H mutation and that development of novel therapeutic approaches targeting activated glutaminolysis is warranted.
Kaltenbach, Miriam; Emond, Stephane; Hollfelder, Florian; Tokuriki, Nobuhiko
2016-10-01
The extent to which an emerging new function trades off with the original function is a key characteristic of the dynamics of enzyme evolution. Various cases of laboratory evolution have unveiled a characteristic trend; a large increase in a new, promiscuous activity is often accompanied by only a mild reduction of the native, original activity. A model that associates weak trade-offs with "evolvability" was put forward, which proposed that enzymes possess mutational robustness in the native activity and plasticity in promiscuous activities. This would enable the acquisition of a new function without compromising the original one, reducing the benefit of early gene duplication and therefore the selection pressure thereon. Yet, to date, no experimental study has examined this hypothesis directly. Here, we investigate the causes of weak trade-offs by systematically characterizing adaptive mutations that occurred in two cases of evolutionary transitions in enzyme function: (1) from phosphotriesterase to arylesterase, and (2) from atrazine chlorohydrolase to melamine deaminase. Mutational analyses in various genetic backgrounds revealed that, in contrast to the prevailing model, the native activity is less robust to mutations than the promiscuous activity. For example, in phosphotriesterase, the deleterious effect of individual mutations on the native phosphotriesterase activity is much larger than their positive effect on the promiscuous arylesterase activity. Our observations suggest a revision of the established model: weak trade-offs are not caused by an intrinsic robustness of the native activity and plasticity of the promiscuous activity. We propose that upon strong adaptive pressure for the new activity without selection against the original one, selected mutations will lead to the largest possible increases in the new function, but whether and to what extent they decrease the old function is irrelevant, creating a bias towards initially weak trade-offs and the
Watanabe, Masaru; Kawaguchi, Tomoya; Isa, Shun-Ichi; Ando, Masahiko; Tamiya, Akihiro; Kubo, Akihito; Saka, Hideo; Takeo, Sadanori; Adachi, Hirofumi; Tagawa, Tsutomu; Kawashima, Osamu; Yamashita, Motohiro; Kataoka, Kazuhiko; Ichinose, Yukito; Takeuchi, Yukiyasu; Watanabe, Katsuya; Matsumura, Akihide; Koh, Yasuhiro
2017-07-01
Epidermal growth factor receptor (EGFR) mutations have been used as the strongest predictor of effectiveness of treatment with EGFR tyrosine kinase inhibitors (TKIs). Three most common EGFR mutations (L858R, exon 19 deletion, and T790M) are known to be major selection markers for EGFR-TKIs therapy. Here, we developed a multiplex picodroplet digital PCR (ddPCR) assay to detect 3 common EGFR mutations in 1 reaction. Serial-dilution experiments with genomic DNA harboring EGFR mutations revealed linear performance, with analytical sensitivity ~0.01% for each mutation. All 33 EGFR-activating mutations detected in formalin-fixed paraffin-embedded (FFPE) tissue samples by the conventional method were also detected by this multiplex assay. Owing to the higher sensitivity, an additional mutation (T790M; including an ultra-low-level mutation, <0.1%) was detected in the same reaction. Regression analysis of the duplex assay and multiplex assay showed a correlation coefficient (R 2 ) of 0.9986 for L858R, 0.9844 for an exon 19 deletion, and 0.9959 for T790M. Using ddPCR, we designed a multiplex ultrasensitive genotyping platform for 3 common EGFR mutations. Results of this proof-of-principle study on clinical samples indicate clinical utility of multiplex ddPCR for screening for multiple EGFR mutations concurrently with an ultra-rare pretreatment mutation (T790M). Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Kino, Tomoshige
2018-05-11
The human genome contains numerous single nucleotide variations (SNVs), and the human GR gene harbors ∼450 of these genetic changes. Among them, extremely rare non-synonymous variants known as pathologic GR gene mutations develop a characteristic pathologic condition, familial/sporadic generalized glucocorticoid resistance syndrome, by replacing the amino acids critical for GR protein structure and functions, whereas others known as pathologic polymorphisms develop mild manifestations recognized mainly at population bases by changing the GR activities slightly. Recent progress on the structural analysis to the GR protein and subsequent computer-based structural simulation revealed details of the molecular defects caused by such pathologic GR gene mutations, including their impact on the receptor interaction to ligands, nuclear receptor coactivators (NCoAs) or DNA glucocorticoid response elements (GREs). Indeed, those found in the GR ligand-binding domain significantly damage protein structure of the ligand-binding pocket and/or the activation function-2 transactivation domain and change their molecular interaction to glucocorticoids or the LxxLL signature motif of NCoAs. Two mutations found in GR DBD also affect interaction of the mutant receptors to GRE DNA by affecting the critical amino acid for the interaction or changing local hydrophobic circumstance. In this review, we discuss recent findings on the structural simulation of the pathologic GR mutants in connection to their functional and clinical impacts along with brief explanation to recent research achievement on the GR polymorphisms.
Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.
Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung
2008-01-01
The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.
Analysis of PIK3CA Mutations and Activation Pathways in Triple Negative Breast Cancer
Muroni, Maria Rosaria; Sanges, Francesca; Sotgiu, Giovanni; Ena, Sara; Pira, Giovanna; Murgia, Luciano; Manca, Alessandra; Uras, Maria Gabriela; Sarobba, Maria Giuseppina; Urru, Silvana; De Miglio, Maria Rosaria
2015-01-01
Background Triple Negative Breast Cancer (TNBC) accounts for 12–24% of all breast carcinomas, and shows worse prognosis compared to other breast cancer subtypes. Molecular studies demonstrated that TNBCs are a heterogeneous group of tumors with different clinical and pathologic features, prognosis, genetic-molecular alterations and treatment responsivity. The PI3K/AKT is a major pathway involved in the regulation of cell survival and proliferation, and is the most frequently altered pathway in breast cancer, apparently with different biologic impact on specific cancer subtypes. The most common genetic abnormality is represented by PIK3CA gene activating mutations, with an overall frequency of 20–40%. The aims of our study were to investigate PIK3CA gene mutations on a large series of TNBC, to perform a wider analysis on genetic alterations involving PI3K/AKT and BRAF/RAS/MAPK pathways and to correlate the results with clinical-pathologic data. Materials and Methods PIK3CA mutation analysis was performed by using cobas® PIK3CA Mutation Test. EGFR, AKT1, BRAF, and KRAS genes were analyzed by sequencing. Immunohistochemistry was carried out to identify PTEN loss and to investigate for PI3K/AKT pathways components. Results PIK3CA mutations were detected in 23.7% of TNBC, whereas no mutations were identified in EGFR, AKT1, BRAF, and KRAS genes. Moreover, we observed PTEN loss in 11.3% of tumors. Deregulation of PI3K/AKT pathways was revealed by consistent activation of pAKT and p-p44/42 MAPK in all PIK3CA mutated TNBC. Conclusions Our data shows that PIK3CA mutations and PI3K/AKT pathway activation are common events in TNBC. A deeper investigation on specific TNBC genomic abnormalities might be helpful in order to select patients who would benefit from current targeted therapy strategies. PMID:26540293
Park, Min Ju; Shen, Hailian; Spaeth, Jason M; Tolvanen, Jaana H; Failor, Courtney; Knudtson, Jennifer F; McLaughlin, Jessica; Halder, Sunil K; Yang, Qiwei; Bulun, Serdar E; Al-Hendy, Ayman; Schenken, Robert S; Aaltonen, Lauri A; Boyer, Thomas G
2018-03-30
Somatic mutations in exon 2 of the RNA polymerase II transcriptional Mediator subunit MED12 occur at high frequency in uterine fibroids (UFs) and breast fibroepithelial tumors as well as recurrently, albeit less frequently, in malignant uterine leimyosarcomas, chronic lymphocytic leukemias, and colorectal cancers. Previously, we reported that UF-linked mutations in MED12 disrupt its ability to activate cyclin C (CycC)-dependent kinase 8 (CDK8) in Mediator, implicating impaired Mediator-associated CDK8 activity in the molecular pathogenesis of these clinically significant lesions. Notably, the CDK8 paralog CDK19 is also expressed in myometrium, and both CDK8 and CDK19 assemble into Mediator in a mutually exclusive manner, suggesting that CDK19 activity may also be germane to the pathogenesis of MED12 mutation-induced UFs. However, whether and how UF-linked mutations in MED12 affect CDK19 activation is unknown. Herein, we show that MED12 allosterically activates CDK19 and that UF-linked exon 2 mutations in MED12 disrupt its CDK19 stimulatory activity. Furthermore, we find that within the Mediator kinase module, MED13 directly binds to the MED12 C terminus, thereby suppressing an apparent UF mutation-induced conformational change in MED12 that otherwise disrupts its association with CycC-CDK8/19. Thus, in the presence of MED13, mutant MED12 can bind, but cannot activate, CycC-CDK8/19. These findings indicate that MED12 binding is necessary but not sufficient for CycC-CDK8/19 activation and reveal an additional step in the MED12-dependent activation process, one critically dependent on MED12 residues altered by UF-linked exon 2 mutations. These findings confirm that UF-linked mutations in MED12 disrupt composite Mediator-associated kinase activity and identify CDK8/19 as prospective therapeutic targets in UFs. © 2018 Park et al.
Guan, Jikui; Fransson, Susanne; Siaw, Joachim Tetteh T; Treis, Diana; Van den Eynden, Jimmy; Chand, Damini; Umapathy, Ganesh; Svenberg, Petter; Ruuth, Kristina; Wessman, Sandra; Shamikh, Alia; Jacobsson, Hans; Gordon, Lena; Stenman, Jakob; Larsson, Erik; Svensson, Par-Johan; Hansson, Magnus; Martinsson, Tommy; Kogner, Per; Palmer, Ruth H; Hallberg, Bengt
2018-06-15
Tumors with Anaplastic Lymphoma Kinase (ALK) fusion rearrangements, including non-small cell lung cancer and anaplastic large cell lymphoma, are highly sensitive to ALK tyrosine kinase inhibitors (TKIs), underscoring the notion that such cancers are addicted to ALK activity. While mutations in ALK are heavily implicated in childhood neuroblastoma, response to the ALK TKI crizotinib has been disappointing. Embryonal tumors in patients with DNA repair defects such as Fanconi anemia (FA) often have a poor prognosis, due to lack of therapeutic options. Here we report a child with underlying FA and ALK mutant high-risk neuroblastoma responding strongly to precision therapy with the ALK TKI ceritinib. Conventional chemotherapy treatment caused severe, life-threatening toxicity. Genomic analysis of the initial biopsy identified germ-line FANCA mutations as well as a novel ALK-I1171T variant. ALK-I1171T generates a potent gain-of-function mutant, as measured in PC12 cell neurite outgrowth and NIH3T3 transformation. Pharmacological inhibition profiling of ALK-I1171T in response to various ALK TKIs identified an 11-fold improved inhibition of ALK-I1171T with ceritinib when compared with crizotinib. Immunoaffinity-coupled LC-MS/MS phosphoproteomics analysis indicated a decrease in ALK signaling in response to ceritinib. Ceritinib was therefore selected for treatment in this child. Mono-therapy with ceritinib was well tolerated and resulted in normalized catecholamine markers and tumor shrinkage. After 7.5 months treatment, residual primary tumor was surgically removed and exhibited hallmarks of differentiation together with reduced Ki67 levels. Clinical follow-up after 21 months treatment revealed complete clinical remission including all metastatic sites. Therefore, ceritinib presents a viable therapeutic option for ALK-positive neuroblastoma. Cold Spring Harbor Laboratory Press.
ERIC Educational Resources Information Center
Johnson, Jennifer, Ed.
1992-01-01
This issue of "Loblolly Magazine" was written in observance of the 50th anniversary of the U.S. entrance into World War II. The publication features interviews conducted by East Texas high school students with Clarence Otterman, one of the few survivors of the crew of the USS Arizona, which was bombed during the attack on Pearl Harbor,…
2013-01-01
Background Given that hearing loss occurs in 1 to 3 of 1,000 live births and approximately 90 to 95 percent of them are born into hearing families, it is of importance and necessity to get better understanding about the carrier rate and mutation spectrum of genes associated with hearing impairment in the general population. Methods 7,263 unrelated women of childbearing age with normal hearing and without family history of hearing loss were tested with allele-specific PCR-based universal array. Further genetic testing were provided to the spouses of the screened carriers. For those couples at risk, multiple choices were provided, including prenatal diagnosis. Results Among the 7,263 normal hearing participants, 303 subjects carried pathogenic mutations included in the screening chip, which made the carrier rate 4.17%. Of the 303 screened carriers, 282 harbored heterozygous mutated genes associated with autosomal recessive hearing loss, and 95 spouses took further genetic tests. 8 out of the 9 couples harbored deafness-causing mutations in the same gene received prenatal diagnosis. Conclusions Given that nearly 90 to 95 percent of deaf and hard-of-hearing babies are born into hearing families, better understanding about the carrier rate and mutation spectrum of genes associated with hearing impairment in the female population of childbearing age may be of importance in carrier screening and genetic counseling. PMID:23718755
Yin, Aihua; Liu, Chang; Zhang, Yan; Wu, Jing; Mai, Mingqin; Ding, Hongke; Yang, Jiexia; Zhang, Xiaozhuang
2013-05-29
Given that hearing loss occurs in 1 to 3 of 1,000 live births and approximately 90 to 95 percent of them are born into hearing families, it is of importance and necessity to get better understanding about the carrier rate and mutation spectrum of genes associated with hearing impairment in the general population. 7,263 unrelated women of childbearing age with normal hearing and without family history of hearing loss were tested with allele-specific PCR-based universal array. Further genetic testing were provided to the spouses of the screened carriers. For those couples at risk, multiple choices were provided, including prenatal diagnosis. Among the 7,263 normal hearing participants, 303 subjects carried pathogenic mutations included in the screening chip, which made the carrier rate 4.17%. Of the 303 screened carriers, 282 harbored heterozygous mutated genes associated with autosomal recessive hearing loss, and 95 spouses took further genetic tests. 8 out of the 9 couples harbored deafness-causing mutations in the same gene received prenatal diagnosis. Given that nearly 90 to 95 percent of deaf and hard-of-hearing babies are born into hearing families, better understanding about the carrier rate and mutation spectrum of genes associated with hearing impairment in the female population of childbearing age may be of importance in carrier screening and genetic counseling.
Luo, Su-shan; Xi, Jian-ying; Cai, Shuang; Zhao, Chong-bo; Lu, Jia-hong; Zhu, Wen-hua; Lin, Jie; Qiao, Kai; Wang, Yin; Ye, Zhu-rong
2014-01-01
Danon disease is an Xlinked dominant lysosomal glycogen storage disorder characterized by cardiomyopathy, skeletal myopathy, and mental retardation. This study described two Chinese cases of Danon disease in order to broaden the phenotypic and genetic spectrum. Clinical data were collected and LAMP2 mutations were analyzed. Patient A had fluctuating limb weakness during 6 months follow-up and was diagnosed with drug-induced myopathy due to anti-hepatitis B therapy with lamivudine. However, the first muscle biopsy with large cytoplasmic vacuoles confused the diagnosis and led to the second biopsy that allowed for the final diagnosis. Patient B had severe cardiac disturbances leading to sudden death. Molecularly, patient A harbored a synonymous mutation adjacent to the exon 6-intron 6 junction; mRNA analysis provided evidence that totally abolished the donor site and caused skipping of exon 6. Patient B harbored a frame-shift deletion mutation in exon 3 (c.396delA) leading to a truncated protein. To our knowledge, this is the first report of Danon disease caused by a synonymous exon mutation that affected mRNA splicing, which indicates that a synonymous substitution may not be silent when it is in the exon sequences close to the splice sites. It is also the first description of Danon disease clinically presenting as druginduced myopathy at onset; the pathological changes might be the key point for making a differential diagnosis. *These two authors contributed equally to this work.
Mei, Z B; Duan, C Y; Li, C B; Cui, L; Ogino, S
2016-10-01
Somatic mutations in the phosphatidylinositol-4,5-bisphosphate 3-kinase/AKT pathway play a vital role in carcinogenesis. Approximately 15%-20% of colorectal cancers (CRCs) harbor activating mutations in PIK3CA, making it one of the most frequently mutated genes in CRC. We thus carried out a systematic review and meta-analysis investigating the prognostic significance of PIK3CA mutations in CRC. Electronic databases were searched from inception through May 2015. We extracted the study characteristics and prognostic data of each eligible study. The hazard ratio (HR) and 95% confidence interval (CI) were derived and pooled using the random-effects Mantel-Haenszel model. Twenty-eight studies enrolling 12 747 patients were eligible for inclusion. Data on overall survival (OS) and progression-free survival (PFS) were available from 19 and 10 studies, respectively. Comparing PIK3CA-mutated CRC patients with PIK3CA-wild-type CRC patients, the summary HRs for OS and PFS were 0.96 (95% CI 0.83-1.12) and 1.20 (95% CI 0.98-1.46), respectively. The trim-and-fill, Copas model and subgroup analyses stratified by the study characteristics confirmed the robustness of the results. Five studies reported the CRC prognosis for PIK3CA mutations in exons 9 and 20 separately; neither exon 9 mutation nor exon 20 mutation in PIK3CA was significantly associated with patient survival. Our findings suggest that PIK3CA mutation has the neutral prognostic effects on CRC OS and PFS. Evidence was accumulating for the establishment of CRC survival between PIK3CA mutations and patient-specific clinical or molecular profiles. © The Author 2016. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
2013-01-01
Background Wide use of ciprofloxacin and levofloxacin has often led to increased resistance. The resistance rate to these two agents varies in different clinical isolates of Enterobacteriaceae. Mutations of GyrA within the quinolone resistance-determining regions have been found to be the main mechanism for quinolone resistance in Enterobacteriaceae. It has been shown that only some of the mutations in the gyrA gene identified from clinical sources were involved in fluoroquinolone resistance. Whether different patterns of gyrA mutation are related to antimicrobial resistance against ciprofloxacin and levofloxacin is unclear. Methods The minimum inhibitory concentration (MIC) of ciprofloxacin and levofloxacin were determined by the agar dilution method followed by PCR amplification and sequencing of the quinolone resistance determining region of gyrA to identify all the mutation types. The correlation between fluoroquinolone resistance and the individual mutation type was analyzed. Results Resistance differences between ciprofloxacin and levofloxacin were found in 327 isolates of K. pneumoniae and E. coli in Harbin, China and in the isolates reported in PubMed publications. GyrA mutations were found in both susceptible and resistant isolates. For the isolates with QRDR mutations, the resistance rates to ciprofloxacin and levofloxacin were also statistically different. Among the 14 patterns of alterations, two single mutations (Ser83Tyr and Ser83Ile), and three double mutations (Ser83Leu+Asp87Asn, Ser83Leu+Asp87Tyr and Ser83Phe+Asp87Asn) were associated with both ciprofloxacin and levofloxacin resistance. Two single mutations (Ser83Phe and Ser83Leu) were related with ciprofloxacin resistance but not to levofloxacin. Resistance difference between ciprofloxacin and levofloxacin in isolates harboring mutation Ser83Leu+Asp87Asn were of statistical significance among all Enterobacteriaceae (P<0.001). Conclusions Resistance rate to ciprofloxacin and levofloxacin were
Ullah, Inayat; Kabir, Firoz; Iqbal, Muhammad; Gottsch, Clare Brooks S.; Naeem, Muhammad Asif; Assir, Muhammad Zaman; Khan, Shaheen N.; Akram, Javed; Riazuddin, Sheikh; Ayyagari, Radha; Hejtmancik, J. Fielding
2016-01-01
Purpose To identify pathogenic mutations responsible for autosomal recessive retinitis pigmentosa (arRP) in consanguineous familial cases. Methods Seven large familial cases with multiple individuals diagnosed with retinitis pigmentosa were included in the study. Affected individuals in these families underwent ophthalmic examinations to document the symptoms and confirm the initial diagnosis. Blood samples were collected from all participating members, and genomic DNA was extracted. An exclusion analysis with microsatellite markers spanning the TULP1 locus on chromosome 6p was performed, and two-point logarithm of odds (LOD) scores were calculated. All coding exons along with the exon–intron boundaries of TULP1 were sequenced bidirectionally. We constructed a single nucleotide polymorphism (SNP) haplotype for the four familial cases harboring the K489R allele and estimated the likelihood of a founder effect. Results The ophthalmic examinations of the affected individuals in these familial cases were suggestive of RP. Exclusion analyses confirmed linkage to chromosome 6p harboring TULP1 with positive two-point LOD scores. Subsequent Sanger sequencing identified the single base pair substitution in exon14, c.1466A>G (p.K489R), in four families. Additionally, we identified a two-base deletion in exon 4, c.286_287delGA (p.E96Gfs77*); a homozygous splice site variant in intron 14, c.1495+4A>C; and a novel missense variation in exon 15, c.1561C>T (p.P521S). All mutations segregated with the disease phenotype in the respective families and were absent in ethnically matched control chromosomes. Haplotype analysis suggested (p<10−6) that affected individuals inherited the causal mutation from a common ancestor. Conclusions Pathogenic mutations in TULP1 are responsible for the RP phenotype in seven familial cases with a common ancestral mutation responsible for the disease phenotype in four of the seven families. PMID:27440997
Long range dynamic effects of point-mutations trap a response regulator in an active conformation
Bobay, Benjamin G.; Thompson, Richele J.; Hoch, James A.; Cavanagh, John
2010-01-01
When a point-mutation in a protein elicits a functional change, it is most common to assign this change to local structural perturbations. Here we show that point-mutations, distant from an essential highly dynamic kinase recognition loop in the response regulator Spo0F, lock this loop in an active conformation. This ‘conformational trapping’ results in functionally hyperactive Spo0F. Consequently, point-mutations are seen to affect functionally critical motions both close to and far from the mutational site. PMID:20828564
Somatic GNAQ Mutation is Enriched in Brain Endothelial Cells in Sturge-Weber Syndrome.
Huang, Lan; Couto, Javier A; Pinto, Anna; Alexandrescu, Sanda; Madsen, Joseph R; Greene, Arin K; Sahin, Mustafa; Bischoff, Joyce
2017-02-01
Sturge-Weber syndrome (SWS) is a rare congenital neurocutaneous disorder characterized by facial and extracraniofacial capillary malformations and capillary-venule malformations in the leptomeninges. A somatic mosaic mutation in GNAQ (c.548G>A; p.R183Q) was found in SWS brain and skin capillary malformations. Our laboratory showed endothelial cells in skin capillary malformations are enriched for the GNAQ mutation. The purpose of this study is to determine whether the GNAQ mutation is also enriched in endothelial cells in affected SWS brain. Two human SWS brain specimens were fractionated by fluorescence-activated cell sorting into hematopoietic (CD45), endothelial (CD31, VE-Cadherin, and vascular endothelial growth factor receptor 2), and perivascular (platelet-derived growth factor receptor beta) cells and cells negative for all markers. The sorted cell populations were analyzed for GNAQ p.R183Q mutation by droplet digital polymerase chain reaction. SWS patient-derived brain endothelial cells were selected by anti-CD31-coated magnetic beads and cultured in endothelial growth medium in vitro. The GNAQ p.R183Q mutation was present in brain endothelial cells in two SWS specimens, with mutant allelic frequencies of 34.7% and 24.0%. Cells negative for all markers also harbored the GNAQ mutation. The mutant allelic frequencies in these unidentified cells were 9.2% and 8.4%. SWS patient-derived brain endothelial cells with mutant allelic frequencies of 14.7% and 21% survived and proliferated in vitro. Our study provides evidence that GNAQ p.R183Q mutation is enriched in endothelial cells in SWS brain lesions and thereby reveals endothelial cells as a source of aberrant Gαq signaling. This will help to understand the pathophysiology of SWS, to discover biomarkers for predicting cerebral involvement, and to develop therapeutic targets to prevent neurological impairments in SWS. Copyright © 2016 Elsevier Inc. All rights reserved.
Tonacchera, M; Agretti, P; Chiovato, L; Rosellini, V; Ceccarini, G; Perri, A; Viacava, P; Naccarato, A G; Miccoli, P; Pinchera, A; Vitti, P
2000-06-01
Toxic multinodular goiter, a heterogeneous disease producing hyperthyroidism, is frequently found in iodine-deficient areas. The pathogenesis of this common clinical entity is still unclear. The aim of the present study was to search for activating TSH receptor (TSHr) or Gs alpha mutations in areas of toxic or functionally autonomous multinodular goiters that appeared hyperfunctioning at thyroid scintiscan but did not clearly correspond to definite nodules at physical or ultrasonographic examination. Surgical tissue specimens from nine patients were carefully dissected, matching thyroid scintiscan and thyroid ultrasonography, to isolate hyperfunctioning and nonfunctioning areas even if they did not correspond to well-defined nodules. TSHr and Gs alpha mutations were searched for by direct sequencing after PCR amplification of genomic DNA. Only 2 adenomas were identified at microscopic examination, whereas the remaining 18 hyperfunctioning areas corresponded to hyperplastic nodules containing multiple aggregates of micromacrofollicules not surrounded by a capsule. Activating TSHr mutations were detected in 14 of these 20 hyperfunctioning areas, whereas no mutation was identified in nonfunctioning nodules or areas contained in the same gland. No Gs alpha mutation was found. In conclusion, activating TSHr mutations are present in the majority of nonadenomatous hyperfunctioning nodules scattered throughout the gland in patients with toxic or functionally autonomous multinodular goiter.
Macchiaroli, Annamaria; Kelberman, Daniel; Auriemma, Renata Simona; Drury, Suzanne; Islam, Lily; Giangiobbe, Sara; Ironi, Gabriele; Lench, Nicholas; Sowden, Jane C; Colao, Annamaria; Pivonello, Rosario; Cavallo, Luciano; Gasperi, Maurizio; Faienza, Maria Felicia
2014-01-25
Heterozygous de novo mutations in SOX2 have been reported in approximately 10-20% of patients with unilateral or bilateral anophthalmia or microphthalmia. An additional phenotype of hypopituitarism, with anterior pituitary hypoplasia and hypogonadotropic hypogonadism, has been reported in patients carrying SOX2 alterations. We report a novel heterozygous mutation in the SOX2 gene in a male affected with congenital bilateral anophthalmia, hypogonadotrophic hypogonadism and growth hormone deficiency. The mutation we describe is a cytosine deletion in position 905 (c905delC) which causes frameshift and an aberrant C-terminal domain. Our report highlights the fact that subjects affected with eye anomalies and harboring SOX2 mutations are at high risk for gonadotropin deficiency, which has important implications for their clinical management. Copyright © 2013 Elsevier B.V. All rights reserved.
The melatonin-MT1 receptor axis modulates tumor growth in PTEN-mutated gliomas.
Ma, Huihui; Wang, Zhen; Hu, Lei; Zhang, Shangrong; Zhao, Chenggang; Yang, Haoran; Wang, Hongzhi; Fang, Zhiyou; Wu, Lijun; Chen, Xueran
2018-02-19
More than 40% of glioma patients have tumors that harbor PTEN (phosphatase and tensin homologue deleted on chromosome ten) mutations; this disease is associated with poor therapeutic resistance and outcome. Such mutations are linked to increased cell survival and growth, decreased apoptosis, and drug resistance; thus, new therapeutic strategies focusing on inhibiting glioma tumorigenesis and progression are urgently needed. Melatonin, an indolamine produced and secreted predominantly by the pineal gland, mediates a variety of physiological functions and possesses antioxidant and antitumor properties. Here, we analyzed the relationship between PTEN and the inhibitory effect of melatonin in primary human glioma cells and cultured glioma cell lines. The results showed that melatonin can inhibit glioma cell growth both in culture and in vivo. This inhibition was associated with PTEN levels, which significantly correlated with the expression level of MT1 in patients. In fact, c-fos-mediated MT1 was shown to be a key modulator of the effect of melatonin on gliomas that harbor wild type PTEN. Taken together, these data suggest that melatonin-MT1 receptor complexes represent a potential target for the treatment of glioma. Copyright © 2018 Elsevier Inc. All rights reserved.
Characterization of two MODY2 mutations with different susceptibility to activation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Langer, Sara; Platz, Christian; Waterstradt, Rica
2015-09-04
Glucokinase plays a key role in glucose sensing in pancreatic beta cells and in liver metabolism. Heterozygous inactivating glucokinase mutations cause the autosomal dominantly inherited MODY2 subtype of maturity-onset diabetes of the young. The goal of this study was to elucidate the pathogenicity of the recently described glucokinase mutants L304P and L315H, located in an alpha-helix and connecting region, respectively, at the outer region of the large domain of glucokinase. Both mutants showed wild-type-like cytosolic localization, but faster protein degradation in insulin-secreting MIN6 cells. However, strongly reduced nuclear/cytoplasmic localization of the mutants was observed in primary hepatocytes suggesting reduced interactionmore » with the liver specific glucokinase regulatory protein. Both mutants displayed a significantly lowered glucokinase activity compared to the wild-type protein. Even though the L315H protein showed the lowest enzymatic activity, this mutant was very sensitive to allosteric activation. The endogenous activator fructose-2,6-bisphosphatase evoked an increase in glucokinase activity for both mutants, but much stronger for L315H compared to L304P. The synthetic activator RO281675 was ineffective against the L304P mutant. Expression of the mutant proteins evoked loss of glucose-induced insulin secretion in MIN6 cells. Administration of RO281675 increased insulin secretion, however, only for the L315H mutant. Thus, a glucokinase activator drug therapy may help MODY2 patients not in general, but seems to be a useful strategy for carriers of the L315H glucokinase mutation. - Highlights: • The GK mutants L304P and L315H display a highly reduced enzymatic activity. • In hepatocytes both mutations lower the nuclear/cytoplasmic localization ratio of GK. • Both mutants inhibit stimulus-secretion coupling in insulin-producing cells. • Activation by fructose-2,6-bisphosphatase and by RO281675 is stronger for L315H. • RO281675
Loss-of-function CARD8 mutation causes NLRP3 inflammasome activation and Crohn's disease.
Mao, Liming; Kitani, Atsushi; Similuk, Morgan; Oler, Andrew J; Albenberg, Lindsey; Kelsen, Judith; Aktay, Atiye; Quezado, Martha; Yao, Michael; Montgomery-Recht, Kim; Fuss, Ivan J; Strober, Warren
2018-05-01
In these studies, we evaluated the contribution of the NLRP3 inflammasome to Crohn's disease (CD) in a kindred containing individuals having a missense mutation in CARD8, a protein known to inhibit this inflammasome. Whole exome sequencing and PCR studies identified the affected individuals as having a V44I mutation in a single allele of the T60 isoform of CARD8. The serum levels of IL-1β in the affected individuals were increased compared with those in healthy controls, and their peripheral monocytes produced increased amounts of IL-1β when stimulated by NLRP3 activators. Immunoblot studies probing the basis of these findings showed that mutated T60 CARD8 failed to downregulate the NLRP3 inflammasome because it did not bind to NLRP3 and inhibit its oligomerization. In addition, these studies showed that mutated T60 CARD8 exerted a dominant-negative effect by its capacity to bind to and form oligomers with unmutated T60 or T48 CARD8 that impeded their binding to NLRP3. Finally, inflammasome activation studies revealed that intact but not mutated CARD8 prevented NLRP3 deubiquitination and serine dephosphorylation. CD due to a CARD8 mutation was not effectively treated by anti-TNF-α, but did respond to IL-1β inhibitors. Thus, patients with anti-TNF-α-resistant CD may respond to this treatment option.
Katrancha, Sara M; Wu, Yi; Zhu, Minsheng; Eipper, Betty A; Koleske, Anthony J; Mains, Richard E
2017-12-01
Bipolar disorder, schizophrenia, autism and intellectual disability are complex neurodevelopmental disorders, debilitating millions of people. Therapeutic progress is limited by poor understanding of underlying molecular pathways. Using a targeted search, we identified an enrichment of de novo mutations in the gene encoding the 330-kDa triple functional domain (TRIO) protein associated with neurodevelopmental disorders. By generating multiple TRIO antibodies, we show that the smaller TRIO9 isoform is the major brain protein product, and its levels decrease after birth. TRIO9 contains two guanine nucleotide exchange factor (GEF) domains with distinct specificities: GEF1 activates both Rac1 and RhoG; GEF2 activates RhoA. To understand the impact of disease-associated de novo mutations and other rare sequence variants on TRIO function, we utilized two FRET-based biosensors: a Rac1 biosensor to study mutations in TRIO (T)GEF1, and a RhoA biosensor to study mutations in TGEF2. We discovered that one autism-associated de novo mutation in TGEF1 (K1431M), at the TGEF1/Rac1 interface, markedly decreased its overall activity toward Rac1. A schizophrenia-associated rare sequence variant in TGEF1 (F1538Intron) was substantially less active, normalized to protein level and expressed poorly. Overall, mutations in TGEF1 decreased GEF1 activity toward Rac1. One bipolar disorder-associated rare variant (M2145T) in TGEF2 impaired inhibition by the TGEF2 pleckstrin-homology domain, resulting in dramatically increased TGEF2 activity. Overall, genetic damage to both TGEF domains altered TRIO catalytic activity, decreasing TGEF1 activity and increasing TGEF2 activity. Importantly, both GEF changes are expected to decrease neurite outgrowth, perhaps consistent with their association with neurodevelopmental disorders. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Hyakuna, Nobuyuki; Muramatsu, Hideki; Higa, Takeshi; Chinen, Yasutsugu; Wang, Xinan; Kojima, Seiji
2015-03-01
Germline mutations in CBL have been identified in patients with Noonan syndrome-like phenotypes, while juvenile myelomonocytic leukemia (JMML) harbors duplication of a germline CBL, resulting in acquired isodisomy. The association between moyamoya disease and Noonan syndrome carrying a PTPN11 mutation has recently been reported. We present a patient with JMML who developed moyamoya disease and neovascular glaucoma. Our patient exhibited a Noonan syndrome-like phenotype. Genetic analysis revealed acquired isodisomy and a germline heterozygous mutation in CBL. This is a rare case of CBL mutation associated with moyamoya disease. Prolonged RAS pathway signaling may cause disruption of cerebrovascular development. © 2014 Wiley Periodicals, Inc.
Jia, Xiangbo; Qian, Rulin; Zhang, Binbin; Zhao, Song
2016-10-01
Lung cancer is the leading cause of cancer-related deaths worldwide; unfortunately, its prognosis is still very poor. Therefore, developing the target molecular is very important for lung cancer diagnosis and treatment, especially in the early stage. With this in view, spalt-like transcription factor 4 ( SALL4 ) is considered a potential biomarker for diagnosis and prognosis in cancers, including lung cancer. In order to better investigate the association between the expression of SALL4 and driver genes mutation, 450 histopathologically diagnosed patients with lung cancer and 11 non-cancer patients were enrolled to test the expression of SALL4 and the status of driver genes mutation. This investigation included epidermal growth factor receptor ( EGFR ), kirsten rat sarcoma viral oncogene homolog ( KRAS ), and a fusion gene of the echinoderm microtubule-associated protein-like 4 ( EML4 ) and the anaplastic lymphoma kinase ( ALK ). The results of the study showed that females harbored more EGFR mutation in adenocarcinoma (ADC). The mutation rate of KRAS and EML4-ALK was about 5%, and the double mutations of EGFR/EML4-ALK were higher than EGFR/KRAS . In the expression analysis, the expression of SALL4 was much higher in cancer tissues than normally expected, especially in tissues that carried EGFR mutation (P<0.05), however, there were no significant differences between different mutation types. Likewise, there were no significant differences between expression of SALL4 and KRAS and EML4-ALK mutations. SALL4 is up regulated in lung cancer specimens and harbors EGFR mutation; this finding indicates that SALL4 expression may be relevant with EGFR , which could provide a new insight to lung cancer therapy. The mechanism needs further investigation and analysis.
Valdez-Flores, Marco A; Vargas-Poussou, Rosa; Verkaart, Sjoerd; Tutakhel, Omar A Z; Valdez-Ortiz, Angel; Blanchard, Anne; Treard, Cyrielle; Hoenderop, Joost G J; Bindels, René J M; Jeleń, Sabina
2016-12-01
Gitelman syndrome (GS) is an autosomal recessive salt-wasting tubular disorder resulting from loss-of-function mutations in the thiazide-sensitive NaCl cotransporter (NCC). Functional analysis of these mutations has been limited to the use of Xenopus laevis oocytes. The aim of the present study was, therefore, to analyze the functional consequences of NCC mutations in a mammalian cell-based assay, followed by analysis of mutated NCC protein expression as well as glycosylation and phosphorylation profiles using human embryonic kidney (HEK) 293 cells. NCC activity was assessed with a novel assay based on thiazide-sensitive iodide uptake in HEK293 cells expressing wild-type or mutant NCC (N59I, R83W, I360T, C421Y, G463R, G731R, L859P, or R861C). All mutations caused a significantly lower NCC activity. Immunoblot analysis of the HEK293 cells revealed that 1) all NCC mutants have decreased NCC protein expression; 2) mutant N59I, R83W, I360T, C421Y, G463R, and L859P have decreased NCC abundance at the plasma membrane; 3) mutants C421Y and L859P display impaired NCC glycosylation; and 4) mutants N59I, R83W, C421Y, C731R, and L859P show affected NCC phosphorylation. In conclusion, we developed a mammalian cell-based assay in which NCC activity assessment together with a profiling of mutated protein processing aid our understanding of the pathogenic mechanism of the NCC mutations. Copyright © 2016 the American Physiological Society.
Nieves-Rivera, Francisco; González-Pijem, Lilliam
2011-06-01
Neonatal diabetes mellitus (NDM) is a rare disorder. A one-month-old boy presented with vomiting, hyperglycemia (968 mg/dl [53.8 mmol/L]), severe acetonemia, and metabolic acidosis (pH 6.95, HCO3-4.2 mmol/L). A second child (three months of age) presented with upper respiratory tract symptoms and a plasma glucose level of 835 mg/dl, without acetonemia or acidosis. Both were hospitalized and managed with intravenous fluids and then discharged on insulin. Genetic testing identified the presence of the de nova V59M and E322K activating mutations in the KCNJ11 gene encoding the sulphonylurea/potassium channel (Kir6.2 subunit) of the insulin beta cell. Both patients were switched to glibenclamide and remain off insulin. To our knowledge, these are the first children in Puerto Rico identified with NDM secondary to a KCNJ11 activating mutation. We conclude that NDM secondary to KCNJ11/Kir6.2 activating mutations, although unusual, should be considered in similar cases since patients with these mutations could come off insulin.
Vazquez Fonseca, Luis; Doimo, Mara; Calderan, Cristina; Desbats, Maria Andrea; Acosta, Manuel J; Cerqua, Cristina; Cassina, Matteo; Ashraf, Shazia; Hildebrandt, Friedhelm; Sartori, Geppo; Navas, Placido; Trevisson, Eva; Salviati, Leonardo
2018-03-01
Mutations in COQ8B cause steroid-resistant nephrotic syndrome with variable neurological involvement. In yeast, COQ8 encodes a protein required for coenzyme Q (CoQ) biosynthesis, whose precise role is not clear. Humans harbor two paralog genes: COQ8A and COQ8B (previously termed ADCK3 and ADCK4). We have found that COQ8B is a mitochondrial matrix protein peripherally associated with the inner membrane. COQ8B can complement a ΔCOQ8 yeast strain when its mitochondrial targeting sequence (MTS) is replaced by a yeast MTS. This model was employed to validate COQ8B mutations, and to establish genotype-phenotype correlations. All mutations affected respiratory growth, but there was no correlation between mutation type and the severity of the phenotype. In fact, contrary to the case of COQ2, where residual CoQ biosynthesis correlates with clinical severity, patients harboring hypomorphic COQ8B alleles did not display a different phenotype compared with those with null mutations. These data also suggest that the system is redundant, and that other proteins (probably COQ8A) may partially compensate for the absence of COQ8B. Finally, a COQ8B polymorphism, present in 50% of the European population (NM_024876.3:c.521A > G, p.His174Arg), affects stability of the protein and could represent a risk factor for secondary CoQ deficiencies or for other complex traits. © 2017 The Authors. Human Mutation published by Wiley Periodicals, Inc.
Goto, Ayano; Ozawa, Yuichi; Koda, Keigo; Akahori, Daisuke; Koyauchi, Takashi; Amano, Yusuke; Kakutani, Takuya; Sato, Yoshiko; Hasegawa, Hirotsugu; Matsui, Takashi; Yokomura, Koshi; Suda, Takafumi
2018-03-01
The management of skin toxicity is crucial for efficient afatinib treatment, but the role of tetracycline class antibiotics (TCs) in managing these rashes is relatively unknown. We reviewed the clinical records of patients who were administered afatinib for the treatment of non-small cell lung cancer harboring epidermal growth factor receptor mutations between October 2014 and November 2016. Twenty-five patients, who received TCs for the management of afatinib-related skin disorders, were enrolled. Minocycline was administered orally to participants. Afatinib-related toxic effects, such as rash, diarrhea, and paronychia, were observed in 92%, 92%, and 40% of cases, respectively. Although 24% of diarrhea and 4% of paronychia cases were rated grade 3 or higher, no severe cases of rash were observed during afatinib treatment. Of the 18 afatinib dose reductions, 14 (78%), three (17%), and one (6%) resulted from diarrhea, paronychia, and stomatitis, respectively; no patients required a dose reduction because of rash. When minocycline treatment started, 21 patients (84%) had a rash of grade 1 or less, and three patients had a grade 2 rash. A response to afatinib was observed in 18 patients (72%) and the median duration of afatinib administration was 501 days. An adverse event related to minocycline (grade 1 nausea) was observed in one patient. A large proportion of the study patients started minocycline before grade 2 rash development and the severity of afatinib-related rash was lower than that previously reported. Oral TCs may be beneficial, especially if started early. Copyright © 2017 The Japanese Respiratory Society. Published by Elsevier B.V. All rights reserved.
Chauvot de Beauchêne, Isaure; Allain, Ariane; Panel, Nicolas; Laine, Elodie; Trouvé, Alain; Dubreuil, Patrice; Tchertanov, Luba
2014-01-01
Receptor tyrosine kinase KIT controls many signal transduction pathways and represents a typical allosterically regulated protein. The mutation-induced deregulation of KIT activity impairs cellular physiological functions and causes serious human diseases. The impact of hotspots mutations (D816H/Y/N/V and V560G/D) localized in crucial regulatory segments, the juxtamembrane region (JMR) and the activation (A-) loop, on KIT internal dynamics was systematically studied by molecular dynamics simulations. The mutational outcomes predicted in silico were correlated with in vitro and in vivo activation rates and drug sensitivities of KIT mutants. The allosteric regulation of KIT in the native and mutated forms is described in terms of communication between the two remote segments, JMR and A-loop. A strong correlation between the communication profile and the structural and dynamical features of KIT in the native and mutated forms was established. Our results provide new insight on the determinants of receptor KIT constitutive activation by mutations and resistance of KIT mutants to inhibitors. Depiction of an intra-molecular component of the communication network constitutes a first step towards an integrated description of vast communication pathways established by KIT in physiopathological contexts. PMID:25079768
Active-to-absorbing-state phase transition in an evolving population with mutation.
Sarkar, Niladri
2015-10-01
We study the active to absorbing phase transition (AAPT) in a simple two-component model system for a species and its mutant. We uncover the nontrivial critical scaling behavior and weak dynamic scaling near the AAPT that shows the significance of mutation and highlights the connection of this model with the well-known directed percolation universality class. Our model should be a useful starting point to study how mutation may affect extinction or survival of a species.
Wiedmeier, Julia Erin; Kato, Catherine; Zhang, Zhenzhen; Lee, Hyunjung; Dunlap, Jennifer; Nutt, Eric; Rattray, Rogan; McKay, Sarah; Eide, Christopher; Press, Richard; Mori, Motomi; Druker, Brian; Dao, Kim-Hien
2016-09-01
Recent large cohort studies revealed that healthy older individuals harbor somatic mutations that increase their risk for hematologic malignancy and all-cause cardiovascular deaths. The majority of these mutations are in chromatin and epigenetic regulatory genes (CERGs). CERGs play a key role in regulation of DNA methylation (DNMT3A and TET2) and histone function (ASXL1) and in clonal proliferation of hematopoietic stem cells. We hypothesize that older women manifesting clonal hematopoiesis, defined here as a functional phenomenon in which a hematopoietic stem cell has acquired a survival and proliferative advantage, harbor a higher frequency of somatic mutations in CERGs. The human androgen receptor gene (HUMARA) assay was used in our study to detect the presence of nonrandom X inactivation in women, a marker for clonal hematopoiesis. In our pilot study, we tested 127 blood samples from women ≥65 years old without a history of invasive cancer or hematologic malignancies. Applying stringent qualitative criteria, we found that 26% displayed clonal hematopoiesis; 52.8% displayed polyclonal hematopoiesis; and 21.3% had indeterminate patterns (too close to call by qualitative assessment). Using Illumina MiSeq next-generation sequencing, we identified somatic mutations in CERGs in 15.2% of subjects displaying clonal hematopoiesis (three ASXL1 and two DNMT3A mutations with an average variant allele frequency of 15.7%, range: 6.3%-23.3%). In a more limited sequencing analysis, we evaluated the frequency of ASXL1 mutations by Sanger sequencing and found mutations in 9.7% of the clonal samples and 0% of the polyclonal samples. By comparing several recent studies (with some caveats as described), we determined the fold enrichment of detecting CERG mutations by using the HUMARA assay as a functional screen for clonal hematopoiesis. We conclude that a functional assay of clonal hematopoiesis is enriching for older women with somatic mutations in CERGs, particularly for ASXL
32 CFR 765.6 - Regulations for Pearl Harbor, Hawaii.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 32 National Defense 5 2010-07-01 2010-07-01 false Regulations for Pearl Harbor, Hawaii. 765.6... RULES RULES APPLICABLE TO THE PUBLIC § 765.6 Regulations for Pearl Harbor, Hawaii. The Commander, U.S. Naval Base, Pearl Harbor, Hawaii, is responsible for prescribing and enforcing such rules and...
Turin, Ilaria; Delfanti, Sara; Ferulli, Federica; Brugnatelli, Silvia; Tanzi, Matteo; Maestri, Marcello; Cobianchi, Lorenzo; Lisini, Daniela; Luinetti, Ombretta; Paulli, Marco; Perotti, Cesare; Todisco, Elisabetta; Pedrazzoli, Paolo; Montagna, Daniela
2018-05-01
Treatment of advanced metastatic colorectal cancer (mCRC) patients is associated with a poor prognosis and significant morbidity. Moreover, targeted therapies such as anti-epidermal growth factor receptor (EGFR) have no effect in metastatic patients with tumors harboring a mutation in the RAS gene. The failure of conventional treatment to improve outcomes in mCRC patients has prompted the development of adoptive immunotherapy approaches including natural killer (NK)-based therapies. In this study, after confirmation that patients' NK cells were not impaired in their cytotoxic activity, evaluated against long-term tumor cell lines, we evaluated their interactions with autologous mCRC cells. Molecular and phenotypical evaluation of mCRC cells, expanded in vitro from liver metastasis, showed that they expressed high levels of polio virus receptor and Nectin-2, whereas UL16-binding proteins were less expressed in all tumor samples evaluated. Two different patterns of MICA/B and HLA class I expression on the membrane of mCRC were documented; approximately half of mCRC patients expressed high levels of these molecules on the membrane surface, whereas, in the remaining, very low levels were documented. Resting NK cells were unable to display sizeable levels of cytotoxic activity against mCRC cells, whereas their cytotoxic activity was enhanced after overnight or 5-day incubation with IL-2 or IL-15. The susceptibility of NK-mediated mCRC lysis was further significantly enhanced after coating with cetuximab, irrespective of their RAS mutation and HLA class I expression. These data open perspectives for combined NK-based immunotherapy with anti-epidermal growth factor receptor antibodies in a cohort of mCRC patients with a poor prognosis refractory to conventional therapies.
Dixit, Anshuman; Verkhivker, Gennady M.
2009-01-01
Structural and functional studies of the ABL and EGFR kinase domains have recently suggested a common mechanism of activation by cancer-causing mutations. However, dynamics and mechanistic aspects of kinase activation by cancer mutations that stimulate conformational transitions and thermodynamic stabilization of the constitutively active kinase form remain elusive. We present a large-scale computational investigation of activation mechanisms in the ABL and EGFR kinase domains by a panel of clinically important cancer mutants ABL-T315I, ABL-L387M, EGFR-T790M, and EGFR-L858R. We have also simulated the activating effect of the gatekeeper mutation on conformational dynamics and allosteric interactions in functional states of the ABL-SH2-SH3 regulatory complexes. A comprehensive analysis was conducted using a hierarchy of computational approaches that included homology modeling, molecular dynamics simulations, protein stability analysis, targeted molecular dynamics, and molecular docking. Collectively, the results of this study have revealed thermodynamic and mechanistic catalysts of kinase activation by major cancer-causing mutations in the ABL and EGFR kinase domains. By using multiple crystallographic states of ABL and EGFR, computer simulations have allowed one to map dynamics of conformational fluctuations and transitions in the normal (wild-type) and oncogenic kinase forms. A proposed multi-stage mechanistic model of activation involves a series of cooperative transitions between different conformational states, including assembly of the hydrophobic spine, the formation of the Src-like intermediate structure, and a cooperative breakage and formation of characteristic salt bridges, which signify transition to the active kinase form. We suggest that molecular mechanisms of activation by cancer mutations could mimic the activation process of the normal kinase, yet exploiting conserved structural catalysts to accelerate a conformational transition and the enhanced
Pardanani, A; Lasho, T; Smith, G; Burns, C J; Fantino, E; Tefferi, A
2009-08-01
Somatic mutations in Janus kinase 2 (JAK2), including JAK2V617F, result in dysregulated JAK-signal transducer and activator transcription (STAT) signaling, which is implicated in myeloproliferative neoplasm (MPN) pathogenesis. CYT387 is an ATP-competitive small molecule that potently inhibits JAK1/JAK2 kinases (IC(50)=11 and 18 nM, respectively), with significantly less activity against other kinases, including JAK3 (IC(50)=155 nM). CYT387 inhibits growth of Ba/F3-JAK2V617F and human erythroleukemia (HEL) cells (IC(50) approximately 1500 nM) or Ba/F3-MPLW515L cells (IC(50)=200 nM), but has considerably less activity against BCR-ABL harboring K562 cells (IC=58 000 nM). Cell lines harboring mutated JAK2 alleles (CHRF-288-11 or Ba/F3-TEL-JAK2) were inhibited more potently than the corresponding pair harboring mutated JAK3 alleles (CMK or Ba/F3-TEL-JAK3), and STAT-5 phosphorylation was inhibited in HEL cells with an IC(50)=400 nM. Furthermore, CYT387 selectively suppressed the in vitro growth of erythroid colonies harboring JAK2V617F from polycythemia vera (PV) patients, an effect that was attenuated by exogenous erythropoietin. Overall, our data indicate that the JAK1/JAK2 selective inhibitor CYT387 has potential for efficacious treatment of MPN harboring mutated JAK2 and MPL alleles.
Unilateral vestibular schwannoma in a patient with schwannomatosis in the absence of LZTR1 mutation
Mehta, Gautam U.; Feldman, Michael J.; Wang, Herui; Ding, Dale; Chittiboina, Prashant
2016-01-01
The presence of vestibular schwannomas has long been considered an exclusion criterion for the diagnosis of schwannomatosis. Recently, 2 cases of vestibular schwannoma were reported in patients with schwannomatosis, leading to a revision of the diagnostic criteria for this genetic disorder. Overall, the relative infrequency of vestibular schwannomas in schwannomatosis is unexplained, and the genetics of this uncommon phenomenon have not been described. The authors report on a family with clinical manifestations consistent with schwannomatosis, including 4 affected members, that was identified as having an affected member harboring a unilateral cerebellopontine angle mass with extension into the internal auditory canal. Radiologically, this mass was consistent with a vestibular schwannoma and resulted in a symptomatic change in ipsilateral hearing (word recognition 86% at 52 dB) and increased latency of the wave I–V interval on auditory brainstem response testing. The patient was found to be negative for a germline mutation of NF2 and LZTR1, and her affected mother was found to harbor neither NF2 nor SMARCB1 mutations on genetic testing. Although vestibular schwannomas have been classically considered to not occur in the setting of schwannomatosis, this patient with schwannomatosis and a vestibular schwannoma further confirms that schwannomas can occur on the vestibular nerve in this syndrome. Further, this is the first such case found to be negative for a mutation on the LZTR1 gene. PMID:26848914
Unilateral vestibular schwannoma in a patient with schwannomatosis in the absence of LZTR1 mutation.
Mehta, Gautam U; Feldman, Michael J; Wang, Herui; Ding, Dale; Chittiboina, Prashant
2016-12-01
The presence of vestibular schwannomas has long been considered an exclusion criterion for the diagnosis of schwannomatosis. Recently, 2 cases of vestibular schwannoma were reported in patients with schwannomatosis, leading to a revision of the diagnostic criteria for this genetic disorder. Overall, the relative infrequency of vestibular schwannomas in schwannomatosis is unexplained, and the genetics of this uncommon phenomenon have not been described. The authors report on a family with clinical manifestations consistent with schwannomatosis, including 4 affected members, that was identified as having an affected member harboring a unilateral cerebellopontine angle mass with extension into the internal auditory canal. Radiologically, this mass was consistent with a vestibular schwannoma and resulted in a symptomatic change in ipsilateral hearing (word recognition 86% at 52 dB) and increased latency of the wave I-V interval on auditory brainstem response testing. The patient was found to be negative for a germline mutation of NF2 and LZTR1, and her affected mother was found to harbor neither NF2 nor SMARCB1 mutations on genetic testing. Although vestibular schwannomas have been classically considered to not occur in the setting of schwannomatosis, this patient with schwannomatosis and a vestibular schwannoma further confirms that schwannomas can occur on the vestibular nerve in this syndrome. Further, this is the first such case found to be negative for a mutation on the LZTR1 gene.
Vazquez Fonseca, Luis; Doimo, Mara; Calderan, Cristina; Desbats, Maria Andrea; Acosta, Manuel J.; Cerqua, Cristina; Cassina, Matteo; Ashraf, Shazia; Hildebrandt, Friedhelm; Sartori, Geppo; Navas, Placido; Trevisson, Eva
2017-01-01
Abstract Mutations in COQ8B cause steroid‐resistant nephrotic syndrome with variable neurological involvement. In yeast, COQ8 encodes a protein required for coenzyme Q (CoQ) biosynthesis, whose precise role is not clear. Humans harbor two paralog genes: COQ8A and COQ8B (previously termed ADCK3 and ADCK4). We have found that COQ8B is a mitochondrial matrix protein peripherally associated with the inner membrane. COQ8B can complement a ΔCOQ8 yeast strain when its mitochondrial targeting sequence (MTS) is replaced by a yeast MTS. This model was employed to validate COQ8B mutations, and to establish genotype–phenotype correlations. All mutations affected respiratory growth, but there was no correlation between mutation type and the severity of the phenotype. In fact, contrary to the case of COQ2, where residual CoQ biosynthesis correlates with clinical severity, patients harboring hypomorphic COQ8B alleles did not display a different phenotype compared with those with null mutations. These data also suggest that the system is redundant, and that other proteins (probably COQ8A) may partially compensate for the absence of COQ8B. Finally, a COQ8B polymorphism, present in 50% of the European population (NM_024876.3:c.521A > G, p.His174Arg), affects stability of the protein and could represent a risk factor for secondary CoQ deficiencies or for other complex traits. PMID:29194833
33 CFR 110.132 - Rockland Harbor, Maine.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Rockland Harbor, Maine. 110.132... ANCHORAGE REGULATIONS Anchorage Grounds § 110.132 Rockland Harbor, Maine. (a) The anchorage grounds—(1..., power plant, oil terminal, marine terminal, munitions plant, military or naval arsenal or depot...
33 CFR 110.132 - Rockland Harbor, Maine.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Rockland Harbor, Maine. 110.132... ANCHORAGE REGULATIONS Anchorage Grounds § 110.132 Rockland Harbor, Maine. (a) The anchorage grounds—(1..., power plant, oil terminal, marine terminal, munitions plant, military or naval arsenal or depot...
33 CFR 110.132 - Rockland Harbor, Maine.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Rockland Harbor, Maine. 110.132... ANCHORAGE REGULATIONS Anchorage Grounds § 110.132 Rockland Harbor, Maine. (a) The anchorage grounds—(1..., power plant, oil terminal, marine terminal, munitions plant, military or naval arsenal or depot...
33 CFR 110.132 - Rockland Harbor, Maine.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Rockland Harbor, Maine. 110.132... ANCHORAGE REGULATIONS Anchorage Grounds § 110.132 Rockland Harbor, Maine. (a) The anchorage grounds—(1..., power plant, oil terminal, marine terminal, munitions plant, military or naval arsenal or depot...
33 CFR 110.132 - Rockland Harbor, Maine.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Rockland Harbor, Maine. 110.132... ANCHORAGE REGULATIONS Anchorage Grounds § 110.132 Rockland Harbor, Maine. (a) The anchorage grounds—(1..., power plant, oil terminal, marine terminal, munitions plant, military or naval arsenal or depot...
Neoplasia of the ampulla of Vater. Ki-ras and p53 mutations.
Scarpa, A.; Capelli, P.; Zamboni, G.; Oda, T.; Mukai, K.; Bonetti, F.; Martignoni, G.; Iacono, C.; Serio, G.; Hirohashi, S.
1993-01-01
Eleven tumors of the ampulla of Vater (5 stage IV and 2 stage II adenocarcinomas, 1 stage II papillary carcinoma, 1 neuroendocrine carcinoma, and 2 adenomas, one with foci of carcinoma) were examined for Ki-ras and p53 gene mutations by single-strand conformation polymorphism analysis and direct sequencing of polymerase chain reaction-amplified DNA fragments. Ki-ras mutations were found in one adenocarcinoma and in the adenoma with foci of carcinoma, both involving mainly the intraduodenal bile duct component of the ampulla. Seven cases showed p53 gene mutations: four advanced-stage adenocarcinomas, the papillary carcinoma, the neuroendocrine carcinoma, and the adenoma with foci of carcinoma. Nuclear accumulation of p53 protein was immunohistochemically detected in the morphologically high-grade areas of the five cancers harboring a p53 gene missense point mutation. The adenomas, the two frame shift-mutated cancers, and the adenomatous and low-grade cancer areas of mutated carcinomas were immunohistochemically negative. Our data suggest that in ampullary neoplasia 1) p53 mutations are common abnormalities associated with the transformation of adenomas and low-grade cancers into morphologically high-grade carcinomas, and 2) Ki-ras mutations are relatively less frequent and might be restricted to tumors originating from the bile duct component of the ampulla. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:8475992
Mitochondrial DNA mutations in single human blood cells.
Yao, Yong-Gang; Kajigaya, Sachiko; Young, Neal S
2015-09-01
Determination mitochondrial DNA (mtDNA) sequences from extremely small amounts of DNA extracted from tissue of limited amounts and/or degraded samples is frequently employed in medical, forensic, and anthropologic studies. Polymerase chain reaction (PCR) amplification followed by DNA cloning is a routine method, especially to examine heteroplasmy of mtDNA mutations. In this review, we compare the mtDNA mutation patterns detected by three different sequencing strategies. Cloning and sequencing methods that are based on PCR amplification of DNA extracted from either single cells or pooled cells yield a high frequency of mutations, partly due to the artifacts introduced by PCR and/or the DNA cloning process. Direct sequencing of PCR product which has been amplified from DNA in individual cells is able to detect the low levels of mtDNA mutations present within a cell. We further summarize the findings in our recent studies that utilized this single cell method to assay mtDNA mutation patterns in different human blood cells. Our data show that many somatic mutations observed in the end-stage differentiated cells are found in hematopoietic stem cells (HSCs) and progenitors within the CD34(+) cell compartment. Accumulation of mtDNA variations in the individual CD34+ cells is affected by both aging and family genetic background. Granulocytes harbor higher numbers of mutations compared with the other cells, such as CD34(+) cells and lymphocytes. Serial assessment of mtDNA mutations in a population of single CD34(+) cells obtained from the same donor over time suggests stability of some somatic mutations. CD34(+) cell clones from a donor marked by specific mtDNA somatic mutations can be found in the recipient after transplantation. The significance of these findings is discussed in terms of the lineage tracing of HSCs, aging effect on accumulation of mtDNA mutations and the usage of mtDNA sequence in forensic identification. Copyright © 2015 Elsevier B.V. All rights
Yen, Katharine; Travins, Jeremy; Wang, Fang; David, Muriel D; Artin, Erin; Straley, Kimberly; Padyana, Anil; Gross, Stefan; DeLaBarre, Byron; Tobin, Erica; Chen, Yue; Nagaraja, Raj; Choe, Sung; Jin, Lei; Konteatis, Zenon; Cianchetta, Giovanni; Saunders, Jeffrey O; Salituro, Francesco G; Quivoron, Cyril; Opolon, Paule; Bawa, Olivia; Saada, Véronique; Paci, Angelo; Broutin, Sophie; Bernard, Olivier A; de Botton, Stéphane; Marteyn, Benoît S; Pilichowska, Monika; Xu, YingXia; Fang, Cheng; Jiang, Fan; Wei, Wentao; Jin, Shengfang; Silverman, Lee; Liu, Wei; Yang, Hua; Dang, Lenny; Dorsch, Marion; Penard-Lacronique, Virginie; Biller, Scott A; Su, Shin-San Michael
2017-05-01
Somatic gain-of-function mutations in isocitrate dehydrogenases ( IDH ) 1 and 2 are found in multiple hematologic and solid tumors, leading to accumulation of the oncometabolite ( R )-2-hydroxyglutarate (2HG). 2HG competitively inhibits α-ketoglutarate-dependent dioxygenases, including histone demethylases and methylcytosine dioxygenases of the TET family, causing epigenetic dysregulation and a block in cellular differentiation. In vitro studies have provided proof of concept for mutant IDH inhibition as a therapeutic approach. We report the discovery and characterization of AG-221, an orally available, selective, potent inhibitor of the mutant IDH2 enzyme. AG-221 suppressed 2HG production and induced cellular differentiation in primary human IDH2 mutation-positive acute myeloid leukemia (AML) cells ex vivo and in xenograft mouse models. AG-221 also provided a statistically significant survival benefit in an aggressive IDH2 R140Q -mutant AML xenograft mouse model. These findings supported initiation of the ongoing clinical trials of AG-221 in patients with IDH2 mutation-positive advanced hematologic malignancies. Significance: Mutations in IDH1/2 are identified in approximately 20% of patients with AML and contribute to leukemia via a block in hematopoietic cell differentiation. We have shown that the targeted inhibitor AG-221 suppresses the mutant IDH2 enzyme in multiple preclinical models and induces differentiation of malignant blasts, supporting its clinical development. Cancer Discov; 7(5); 478-93. ©2017 AACR. See related commentary by Thomas and Majeti, p. 459 See related article by Shih et al., p. 494 This article is highlighted in the In This Issue feature, p. 443 . ©2017 American Association for Cancer Research.
Choi, Hye Joo; Lee, Jinseon; Jung, Kyungsoo; Irwin, Darry; Liu, Xiao; Lira, Maruja E.; Mao, Mao; Kim, Hong Kwan; Choi, Yong Soo; Shim, Young Mog; Park, Woong Yang; Choi, Yoon-La; Kim, Jhingook
2015-01-01
The aim of this study was to determine the distribution of known oncogenic driver mutations in female never-smoker Asian patients with lung adenocarcinoma. We analyzed 214 mutations across 26 lung cancer-associated genes and three fusion genes using the MassARRAY® LungCarta Panel and the ALK, ROS1, and RET fusion assays in 198 consecutively resected lung adenocarcinomas from never-smoker females at a single institution. EGFR mutation, which was the most frequent driver gene mutation, was detected in 124 (63%) cases. Mutation of ALK, KRAS, PIK3CA, ERBB2, BRAF, ROS1, and RET genesoccurred in 7%, 4%, 2.5%, 1.5%, 1%, 1%, and 1% of cases, respectively. Thus, 79% of lung adenocarcinomas from never-smoker females harbored well-known oncogenic mutations. Mucinous adenocarcinomas tended to have a lower frequency of known driver gene mutations than other histologic subtypes. EGFR mutation was associated with older age and a predominantly acinar pattern, while ALK rearrangement was associated with younger age and a predominantly solid pattern. Lung cancer in never-smoker Asian females is a distinct entity, with the majority of these cancers developing from oncogenic mutations. PMID:25760072
Krassowski, Michal; Paczkowska, Marta; Cullion, Kim; Huang, Tina; Dzneladze, Irakli; Ouellette, B F Francis; Yamada, Joseph T; Fradet-Turcotte, Amelie
2018-01-01
Abstract Interpretation of genetic variation is needed for deciphering genotype-phenotype associations, mechanisms of inherited disease, and cancer driver mutations. Millions of single nucleotide variants (SNVs) in human genomes are known and thousands are associated with disease. An estimated 21% of disease-associated amino acid substitutions corresponding to missense SNVs are located in protein sites of post-translational modifications (PTMs), chemical modifications of amino acids that extend protein function. ActiveDriverDB is a comprehensive human proteo-genomics database that annotates disease mutations and population variants through the lens of PTMs. We integrated >385,000 published PTM sites with ∼3.6 million substitutions from The Cancer Genome Atlas (TCGA), the ClinVar database of disease genes, and human genome sequencing projects. The database includes site-specific interaction networks of proteins, upstream enzymes such as kinases, and drugs targeting these enzymes. We also predicted network-rewiring impact of mutations by analyzing gains and losses of kinase-bound sequence motifs. ActiveDriverDB provides detailed visualization, filtering, browsing and searching options for studying PTM-associated mutations. Users can upload mutation datasets interactively and use our application programming interface in pipelines. Integrative analysis of mutations and PTMs may help decipher molecular mechanisms of phenotypes and disease, as exemplified by case studies of TP53, BRCA2 and VHL. The open-source database is available at https://www.ActiveDriverDB.org. PMID:29126202
Cazes, Alex; Lopez-Delisle, Lucille; Tsarovina, Konstantina; Pierre-Eugène, Cécile; De Preter, Katleen; Peuchmaur, Michel; Nicolas, André; Provost, Claire; Louis-Brennetot, Caroline; Daveau, Romain; Kumps, Candy; Cascone, Ilaria; Schleiermacher, Gudrun; Prignon, Aurélie; Speleman, Frank; Rohrer, Hermann; Delattre, Olivier; Janoueix-Lerosey, Isabelle
2014-01-01
Activating mutations of the ALK (Anaplastic lymphoma Kinase) gene have been identified in sporadic and familial cases of neuroblastoma, a cancer of early childhood arising from the sympathetic nervous system (SNS). To decipher ALK function in neuroblastoma predisposition and oncogenesis, we have characterized knock-in (KI) mice bearing the two most frequent mutations observed in neuroblastoma patients. A dramatic enlargement of sympathetic ganglia is observed in AlkF1178L mice from embryonic to adult stages associated with an increased proliferation of sympathetic neuroblasts from E14.5 to birth. In a MYCN transgenic context, the F1178L mutation displays a higher oncogenic potential than the R1279Q mutation as evident from a shorter latency of tumor onset. We show that tumors expressing the R1279Q mutation are sensitive to ALK inhibition upon crizotinib treatment. Furthermore, our data provide evidence that activated ALK triggers RET upregulation in mouse sympathetic ganglia at birth as well as in murine and human neuroblastoma. Using vandetanib, we show that RET inhibition strongly impairs tumor growth in vivo in both MYCN/KI AlkR1279Q and MYCN/KI AlkF1178L mice. Altogether, our findings demonstrate the critical role of activated ALK in SNS development and pathogenesis and identify RET as a therapeutic target in ALK mutated neuroblastoma. PMID:24811913
Remacha, Laura; Comino-Méndez, Iñaki; Richter, Susan; Contreras, Laura; Currás-Freixes, María; Pita, Guillermo; Letón, Rocío; Galarreta, Antonio; Torres-Pérez, Rafael; Honrado, Emiliano; Jiménez, Scherezade; Maestre, Lorena; Moran, Sebastian; Esteller, Manel; Satrústegui, Jorgina; Eisenhofer, Graeme; Robledo, Mercedes; Cascón, Alberto
2017-10-15
Purpose: Mutations in Krebs cycle genes are frequently found in patients with pheochromocytomas/paragangliomas. Disruption of SDH, FH or MDH2 enzymatic activities lead to accumulation of specific metabolites, which give rise to epigenetic changes in the genome that cause a characteristic hypermethylated phenotype. Tumors showing this phenotype, but no alterations in the known predisposing genes, could harbor mutations in other Krebs cycle genes. Experimental Design: We used downregulation and methylation of RBP1, as a marker of a hypermethylation phenotype, to select eleven pheochromocytomas and paragangliomas for targeted exome sequencing of a panel of Krebs cycle-related genes. Methylation profiling, metabolite assessment and additional analyses were also performed in selected cases. Results: One of the 11 tumors was found to carry a known cancer-predisposing somatic mutation in IDH1 A variant in GOT2 , c.357A>T, found in a patient with multiple tumors, was associated with higher tumor mRNA and protein expression levels, increased GOT2 enzymatic activity in lymphoblastic cells, and altered metabolite ratios both in tumors and in GOT2 knockdown HeLa cells transfected with the variant. Array methylation-based analysis uncovered a somatic epigenetic mutation in SDHC in a patient with multiple pheochromocytomas and a gastrointestinal stromal tumor. Finally, a truncating germline IDH3B mutation was found in a patient with a single paraganglioma showing an altered α-ketoglutarate/isocitrate ratio. Conclusions: This study further attests to the relevance of the Krebs cycle in the development of PCC and PGL, and points to a potential role of other metabolic enzymes involved in metabolite exchange between mitochondria and cytosol. Clin Cancer Res; 23(20); 6315-24. ©2017 AACR . ©2017 American Association for Cancer Research.
33 CFR 80.1116 - Redondo Harbor, CA.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Redondo Harbor, CA. 80.1116 Section 80.1116 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1116 Redondo Harbor, CA. A line drawn from...
33 CFR 80.1116 - Redondo Harbor, CA.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Redondo Harbor, CA. 80.1116 Section 80.1116 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1116 Redondo Harbor, CA. A line drawn from...
33 CFR 80.1108 - Oceanside Harbor, CA.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Oceanside Harbor, CA. 80.1108 Section 80.1108 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1108 Oceanside Harbor, CA. A line drawn from...
33 CFR 80.1108 - Oceanside Harbor, CA.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Oceanside Harbor, CA. 80.1108 Section 80.1108 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1108 Oceanside Harbor, CA. A line drawn from...
33 CFR 80.1134 - Monterey Harbor, CA.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Monterey Harbor, CA. 80.1134 Section 80.1134 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1134 Monterey Harbor, CA. A line drawn from...
33 CFR 80.1134 - Monterey Harbor, CA.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Monterey Harbor, CA. 80.1134 Section 80.1134 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1134 Monterey Harbor, CA. A line drawn from...
33 CFR 80.1134 - Monterey Harbor, CA.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Monterey Harbor, CA. 80.1134 Section 80.1134 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1134 Monterey Harbor, CA. A line drawn from...
33 CFR 80.1116 - Redondo Harbor, CA.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Redondo Harbor, CA. 80.1116 Section 80.1116 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1116 Redondo Harbor, CA. A line drawn from...
33 CFR 80.1134 - Monterey Harbor, CA.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Monterey Harbor, CA. 80.1134 Section 80.1134 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1134 Monterey Harbor, CA. A line drawn from...
33 CFR 80.1108 - Oceanside Harbor, CA.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Oceanside Harbor, CA. 80.1108 Section 80.1108 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1108 Oceanside Harbor, CA. A line drawn from...
33 CFR 80.1108 - Oceanside Harbor, CA.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Oceanside Harbor, CA. 80.1108 Section 80.1108 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1108 Oceanside Harbor, CA. A line drawn from...
33 CFR 80.1116 - Redondo Harbor, CA.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Redondo Harbor, CA. 80.1116 Section 80.1116 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1116 Redondo Harbor, CA. A line drawn from...
33 CFR 80.1116 - Redondo Harbor, CA.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Redondo Harbor, CA. 80.1116 Section 80.1116 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1116 Redondo Harbor, CA. A line drawn from...
33 CFR 80.1134 - Monterey Harbor, CA.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Monterey Harbor, CA. 80.1134 Section 80.1134 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1134 Monterey Harbor, CA. A line drawn from...
33 CFR 80.1108 - Oceanside Harbor, CA.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Oceanside Harbor, CA. 80.1108 Section 80.1108 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1108 Oceanside Harbor, CA. A line drawn from...
33 CFR 110.82 - Charlevoix Harbor, Mich.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Charlevoix Harbor, Mich. 110.82 Section 110.82 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.82 Charlevoix Harbor, Mich. The waters on the north side...
33 CFR 110.50 - Stonington Harbor, Conn.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Stonington Harbor, Conn. 110.50 Section 110.50 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.50 Stonington Harbor, Conn. (a) Area No. 1. Beginning at...
33 CFR 110.82 - Charlevoix Harbor, Mich.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Charlevoix Harbor, Mich. 110.82 Section 110.82 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.82 Charlevoix Harbor, Mich. The waters on the north side...
33 CFR 110.50 - Stonington Harbor, Conn.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Stonington Harbor, Conn. 110.50 Section 110.50 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.50 Stonington Harbor, Conn. (a) Area No. 1. Beginning at...
33 CFR 110.82 - Charlevoix Harbor, Mich.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Charlevoix Harbor, Mich. 110.82 Section 110.82 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.82 Charlevoix Harbor, Mich. The waters on the north side...
33 CFR 110.82 - Charlevoix Harbor, Mich.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Charlevoix Harbor, Mich. 110.82 Section 110.82 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.82 Charlevoix Harbor, Mich. The waters on the north side...
33 CFR 110.50 - Stonington Harbor, Conn.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Stonington Harbor, Conn. 110.50 Section 110.50 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.50 Stonington Harbor, Conn. (a) Area No. 1. Beginning at...
33 CFR 110.50 - Stonington Harbor, Conn.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Stonington Harbor, Conn. 110.50 Section 110.50 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.50 Stonington Harbor, Conn. (a) Area No. 1. Beginning at...
33 CFR 110.82 - Charlevoix Harbor, Mich.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Charlevoix Harbor, Mich. 110.82 Section 110.82 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.82 Charlevoix Harbor, Mich. The waters on the north side...
33 CFR 110.50 - Stonington Harbor, Conn.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Stonington Harbor, Conn. 110.50 Section 110.50 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.50 Stonington Harbor, Conn. (a) Area No. 1. Beginning at...
33 CFR 110.142 - Nantucket Harbor, Mass.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Nantucket Harbor, Mass. 110.142 Section 110.142 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.142 Nantucket Harbor, Mass. (a) The anchorage grounds. In the...
33 CFR 110.138 - Boston Harbor, Mass.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Boston Harbor, Mass. 110.138 Section 110.138 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.138 Boston Harbor, Mass. (a) The anchorage grounds—(1) Bird...
33 CFR 110.142 - Nantucket Harbor, Mass.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Nantucket Harbor, Mass. 110.142 Section 110.142 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.142 Nantucket Harbor, Mass. (a) The anchorage grounds. In the...
16 CFR 312.11 - Safe harbor programs.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 16 Commercial Practices 1 2014-01-01 2014-01-01 false Safe harbor programs. 312.11 Section 312.11 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS CHILDREN'S ONLINE PRIVACY PROTECTION RULE § 312.11 Safe harbor programs. (a) In general. Industry groups or other persons...
Knappskog, Stian; Chrisanthar, Ranjan; Løkkevik, Erik; Anker, Gun; Østenstad, Bjørn; Lundgren, Steinar; Risberg, Terje; Mjaaland, Ingvil; Leirvaag, Beryl; Miletic, Hrvoje; Lønning, Per E
2012-03-15
Mutations affecting p53 or its upstream activator Chk2 are associated with resistance to DNA-damaging chemotherapy in breast cancer. ATM (Ataxia Telangiectasia Mutated protein) is the key activator of p53 and Chk2 in response to genotoxic stress. Here, we sought to evaluate ATM's potential role in resistance to chemotherapy. We sequenced ATM and assessed gene expression levels in pre-treatment biopsies from 71 locally advanced breast cancers treated in the neoadjuvant setting with doxorubicin monotherapy or mitomycin combined with 5-fluorouracil. Findings were confirmed in a separate patient cohort treated with epirubicin monotherapy. Each tumor was previously analyzed for CHEK2 and TP53 mutation status. While ATM mutations were not associated with chemo-resistance, low ATM expression levels predicted chemo-resistance among patients with tumors wild-type for TP53 and CHEK2 (P = 0.028). Analyzing the ATM-chk2-p53 cascade, low ATM levels (defined as the lower 5 to 50% percentiles) or mutations inactivating TP53 or CHEK2 robustly predicted anthracycline resistance (P-values varying between 0.001 and 0.027 depending on the percentile used to define "low" ATM levels). These results were confirmed in an independent cohort of 109 patients treated with epirubicin monotherapy. In contrast, ATM-levels were not suppressed in resistant tumors harboring TP53 or CHEK2 mutations (P > 0.5). Our data indicate loss of function of the ATM-Chk2-p53 cascade to be strongly associated with resistance to anthracycline/mitomycin-containing chemotherapy in breast cancer.
2012-01-01
Introduction Mutations affecting p53 or its upstream activator Chk2 are associated with resistance to DNA-damaging chemotherapy in breast cancer. ATM (Ataxia Telangiectasia Mutated protein) is the key activator of p53 and Chk2 in response to genotoxic stress. Here, we sought to evaluate ATM's potential role in resistance to chemotherapy. Methods We sequenced ATM and assessed gene expression levels in pre-treatment biopsies from 71 locally advanced breast cancers treated in the neoadjuvant setting with doxorubicin monotherapy or mitomycin combined with 5-fluorouracil. Findings were confirmed in a separate patient cohort treated with epirubicin monotherapy. Each tumor was previously analyzed for CHEK2 and TP53 mutation status. Results While ATM mutations were not associated with chemo-resistance, low ATM expression levels predicted chemo-resistance among patients with tumors wild-type for TP53 and CHEK2 (P = 0.028). Analyzing the ATM-chk2-p53 cascade, low ATM levels (defined as the lower 5 to 50% percentiles) or mutations inactivating TP53 or CHEK2 robustly predicted anthracycline resistance (P-values varying between 0.001 and 0.027 depending on the percentile used to define "low" ATM levels). These results were confirmed in an independent cohort of 109 patients treated with epirubicin monotherapy. In contrast, ATM-levels were not suppressed in resistant tumors harboring TP53 or CHEK2 mutations (P > 0.5). Conclusions Our data indicate loss of function of the ATM-Chk2-p53 cascade to be strongly associated with resistance to anthracycline/mitomycin-containing chemotherapy in breast cancer. PMID:22420423
Guttery, David S; Page, Karen; Hills, Allison; Woodley, Laura; Marchese, Stephanie D; Rghebi, Basma; Hastings, Robert K; Luo, Jinli; Pringle, J Howard; Stebbing, Justin; Coombes, R Charles; Ali, Simak; Shaw, Jacqueline A
2015-07-01
Activating mutations in the estrogen receptor 1 (ESR1) gene are acquired on treatment and can drive resistance to endocrine therapy. Because of the spatial and temporal limitations of needle core biopsies, our goal was to develop a highly sensitive, less invasive method of detecting activating ESR1 mutations via circulating cell-free DNA (cfDNA) and tumor cells as a "liquid biopsy." We developed a targeted 23-amplicon next-generation sequencing (NGS) panel for detection of hot-spot mutations in ESR1, phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha (PIK3CA), tumor protein p53 (TP53), fibroblast growth factor receptor 1 (FGFR1), and fibroblast growth factor receptor 2 (FGFR2) in 48 patients with estrogen receptor-α-positive metastatic breast cancer who were receiving systemic therapy. Selected mutations were validated using droplet digital PCR (ddPCR). Nine baseline cfDNA samples had an ESR1 mutation. NGS detected 3 activating mutations in ESR1, and 3 hot-spot mutations in PIK3CA, and 3 in TP53 in baseline cfDNA, and the ESR1 p.D538G mutation in 1 matched circulating tumor cell sample. ddPCR analysis was more sensitive than NGS and identified 6 additional baseline cfDNA samples with the ESR1 p.D538G mutation at a frequency of <1%. In serial blood samples from 11 patients, 4 showed changes in cfDNA, 2 with emergence of a mutation in ESR1. We also detected a low frequency ESR1 mutation (1.3%) in cfDNA of 1 primary patient who was thought to have metastatic disease but was clear by scans. Early identification of ESR1 mutations by liquid biopsy might allow for cessation of ineffective endocrine therapies and switching to other treatments, without the need for tissue biopsy and before the emergence of metastatic disease. © 2015 American Association for Clinical Chemistry.
Mairinger, Fabian D; Vollbrecht, Claudia; Streubel, Anna; Roth, Andreas; Landt, Olfert; Walter, Henry F R; Kollmeier, Jens; Mairinger, Thomas
2014-01-01
Activating epidermal growth factor receptor (EGFR) gene mutations can be successfully treated by EGFR tyrosine kinase inhibitors (EGFR-TKIs), but nearly 50% of all patients' exhibit progression of the disease until treatment because of T790M mutations. It is proposed that this is mostly caused by therapy-resistant tumor clones harboring a T790M mutation. Until now no cost-effective routine-diagnostic method for EGFR-resistance mutation status analysis is available leaving long-time response to TKI treatment to chance. Unambiguous identification of T790M EGFR mutations is mandatory to optimize initial treatment strategies. Artificial EGFR T790M mutations and human wild-type gDNA were prepared in several dilution series. Preferential amplification using coamplification at lower denaturation temperature-PCR (COLD-PCR) of the mutant sequence and subsequent HybProbe melting curve detection or pyrosequencing were performed in comparison to normal processing. COLD-PCR-based amplification allowed the detection of 0.125% T790M mutant DNA in a background of wild-type DNA in comparison to 5% while normal processing. These results were reproducible. COLD-PCR is a powerful and cost-effective tool for routine diagnostic to detect underrepresented tumor clones in clinical samples. A diagnostic tool for unambiguous identification of T790M-mutated minor tumor clones is now available enabling optimized therapy.
Baran, Natalia; ter Braak, Michael; Saffrich, Rainer; Woelfle, Joachim; Schmitz, Udo
2015-05-15
Autosomal dominant hypocalcaemia (ADH) is caused by activating mutations in the calcium sensing receptor gene (CaR) and characterised by mostly asymptomatic mild to moderate hypocalcaemia with low, inappropriately serum concentration of PTH. The purpose of the present study was to biochemically and functionally characterise a novel mutation of CaR. A female proband presenting with hypocalcaemia was diagnosed to have "idiopathic hypoparathyroidism" at the age of 10 with a history of muscle pain and cramps. Further examinations demonstrated hypocalcaemia in nine additional family members, affecting three generations. P136L CaR mutation was predicted to cause gain of function of CaR. Affected family members showed relevant hypocalcaemia (mean ± SD; 1.9 ± 0.1 mmol/l). Patient history included mild seizures and recurrent nephrolithiasis. Genetic analysis confirmed that hypocalcaemia cosegregated with a heterozygous mutation at codon 136 (CCC → CTC/Pro → Leu) in exon 3 of CaR confirming the diagnosis of ADH. For in vitro studies P136L mutant CaR was generated by site-directed mutagenesis and examined in transiently transfected HEK293 cells. Extracellular calcium stimulation of transiently transfected HEK293 cells showed significantly increased intracellular Ca(2+) mobilisation and MAPK activity for mutant P136L CaR compared to wild type CaR. The present study gives insight about a novel activating mutation of CaR and confirms that the novel P136L-CaR mutation is responsible for ADH in this family. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Constitutional mutations in RTEL1 cause severe dyskeratosis congenita.
Walne, Amanda J; Vulliamy, Tom; Kirwan, Michael; Plagnol, Vincent; Dokal, Inderjeet
2013-03-07
Dyskeratosis congenita (DC) and its phenotypically severe variant, Hoyeraal-Hreidarsson syndrome (HHS), are multisystem bone-marrow-failure syndromes in which the principal pathology is defective telomere maintenance. The genetic basis of many cases of DC and HHS remains unknown. Using whole-exome sequencing, we identified biallelic mutations in RTEL1, encoding a helicase essential for telomere maintenance and regulation of homologous recombination, in an individual with familial HHS. Additional screening of RTEL1 identified biallelic mutations in 6/23 index cases with HHS but none in 102 DC or DC-like cases. All 11 mutations in ten HHS individuals from seven families segregated in an autosomal-recessive manner, and telomere lengths were significantly shorter in cases than in controls (p = 0.0003). This group had significantly higher levels of telomeric circles, produced as a consequence of incorrect processing of telomere ends, than did controls (p = 0.0148). These biallelic RTEL1 mutations are responsible for a major subgroup (∼29%) of HHS. Our studies show that cells harboring these mutations have significant defects in telomere maintenance, but not in homologous recombination, and that incorrect resolution of T-loops is a mechanism for telomere shortening and disease causation in humans. They also demonstrate the severe multisystem consequences of its dysfunction. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Erie Harbor, Pennsylvania, Channel Shoaling Analysis
2011-07-01
Presque Isle is located on the southern shore of Lake Erie and shelters the federal harbor at Erie , Pennsylvania . The US Army...the evaluation of the shoaling and dredging of sediment materials from Erie Harbor as part of the Presque Isle , Pennsylvania 204 feasibility study...ERDC TR-11-4 1 1 Introduction Problem statement Presque Isle is located on the southern shore of Lake Erie , Pennsylvania at the city of Erie
Estuarine studies in upper Grays Harbor, Washington
Beverage, Joseph P.; Swecker, Milton N.
1969-01-01
Improved management of the water resources of Grays Harbor, Wash., requires more data on the water quality of the harbor and a better understanding of the influences of industrial and domestic wastes on the local fisheries resources. To provide a more comprehensive understanding of these influences, the U.S. Geological Survey joined other agencies in a cooperative study of Grays Harbor. This report summarizes the Survey's study of circulation patterns, description of water-quality conditions, and characterization of bottom material in the upper harbor. Salt water was found to intrude at least as far as Montesano, 28.4 nautical miles from the mouth of the harbor. Longitudinal salinity distributions were used to compute dispersion (diffusivity) coefficients ranging from 842 to 3,520 square feet per second. These values were corroborated by half-tidal-cycle dye studies. The waters of the harbor were found to be well mixed after extended periods of low fresh-water flow but stratified at high flows. Salinity data were used lo define the cumulative 'mean age' of the harbor water, which may be used to approximate a mean 'flushing time.' Velocity-time curves for the upper harbor are distorted from simple harmonic functions owing to channel geometry and frictional effects. Surface and bottom velocity data were used to estimate net tidal 'separation' distance, neglecting vertical mixing. Net separation distances between top and bottom water ranged from 1.65 nautical miles when fresh-water inflow was 610 cubic feet per second to 13.4 miles when inflow was 15,900 cubic feet per second. The cumulative mean age from integration of the fresh-water velocity equation was about twice that obtained from the salinity distribution. Excursion distances obtained with dye over half-tidal cycles exceeded those estimated from longitudinal salinity distributions and those obtained by earlier investigators who used floats. Net tidal excursions were as much as twice those obtained with floats
33 CFR 80.165 - New York Harbor.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false New York Harbor. 80.165 Section 80.165 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Atlantic Coast § 80.165 New York Harbor. A line drawn from East...
33 CFR 110.9 - Wells Harbor, Maine.
Code of Federal Regulations, 2014 CFR
2014-07-01
... Section 110.9 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.9 Wells Harbor, Maine. (a) Anchorage “A”. All of the... approximately 5,800 sq. yards, encompassing the central portion of Wells Harbor. (b) Anchorage “B”. All of the...
12 CFR 350.11 - Safe harbor provision.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Safe harbor provision. 350.11 Section 350.11 Banks and Banking FEDERAL DEPOSIT INSURANCE CORPORATION REGULATIONS AND STATEMENTS OF GENERAL POLICY DISCLOSURE OF FINANCIAL AND OTHER INFORMATION BY FDIC-INSURED STATE NONMEMBER BANKS § 350.11 Safe harbor...
33 CFR 110.250 - St. Thomas Harbor, Charlotte Amalie, V.I.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false St. Thomas Harbor, Charlotte... SECURITY ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.250 St. Thomas Harbor, Charlotte Amalie... move promptly upon notification by the Harbor Master. (4) The harbor regulations for the Port of St...
Oh, Hye Rim; An, Chang Hyeok; Yoo, Nam Jin; Lee, Sug Hyung
2014-12-01
Metabolic reprogramming is an emerging topic in cancer research. However, genetic alterations in genes encoding enzymes involved in amino acid metabolism are largely unknown. The aim of this study was to explore whether genes known to be involved in amino acid metabolism are mutated in gastric cancer (GC) and/or colorectal cancer (CRC). Through a public database search, we found that a number of genes known to be involved in amino acid metabolism, i.e., AGXT, ALDH2, APIP, MTR, DNMT1, ASH1L, ASPA, CAD, DDC, GCDH, DLD, LAP3, MCEE and MUT, harbor mononucleotide repeats that may serve as mutation targets in cancers exhibiting microsatellite instability (MSI). We assessed these genes for the presence of the mutations in 79 GCs and 124 CRCs using single-strand conformation polymorphism (SSCP) and direct sequencing analyses. Using SSCP in conjunction with DNA sequencing we detected frameshift mutations in AGXT (17 cases), ALDH2 (3 cases), APIP (4 cases), MTR (5 cases), DNMT1 (1 case), ASH1L (1 case), ASPA (2 cases), CAD (2 cases), DDC (1 case), GCDH (3 cases), DLD (1 case), LAP3 (1 case), MCEE (5 cases) and MUT (1 case). These mutations were exclusively detected in MSI-high (MSI-H), and not in MSI-low or MSI-stable (MSI-L/MSS) cases. In addition, we analyzed 16 CRCs for the presence of intra-tumor heterogeneity (ITH) and found that two CRCs harbored regional ITH for GCDH frameshift mutations. Our data indicate that genes known to be involved in amino acid metabolism recurrently acquire somatic mutations in MSH-H GCs and MSH-H CRCs and that, in addition, mutation ITH does occur in at least some of these tumors. Together, these data suggest that metabolic reprogramming may play a role in the etiology of MSI-H GCs and CRCs. Our data also suggest that ultra-regional mutation analysis is required for a more comprehensive evaluation of the mutation status in these tumors.
Gebreyohannes, Yemarshet K; Schöffski, Patrick; Van Looy, Thomas; Wellens, Jasmien; Vreys, Lise; Cornillie, Jasmien; Vanleeuw, Ulla; Aftab, Dana T; Debiec-Rychter, Maria; Sciot, Raf; Wozniak, Agnieszka
2016-12-01
In the majority of gastrointestinal stromal tumors (GIST), oncogenic signaling is driven by KIT mutations. Advanced GIST is treated with tyrosine kinase inhibitors (TKI) such as imatinib. Acquired resistance to TKI is mainly caused by secondary KIT mutations, but can also be attributed to a switch of KIT dependency to another receptor tyrosine kinase (RTK). We tested the efficacy of cabozantinib, a novel TKI targeting KIT, MET, AXL, and vascular endothelial growth factor receptors (VEGFR), in patient-derived xenograft (PDX) models of GIST, carrying different KIT mutations. NMRI nu/nu mice (n = 52) were bilaterally transplanted with human GIST: UZLX-GIST4 (KIT exon 11 mutation, imatinib sensitive), UZLX-GIST2 (KIT exon 9, imatinib dose-dependent resistance), or UZLX-GIST9 (KIT exon 11 and 17 mutations, imatinib resistant). Mice were grouped as control (untreated), imatinib (50 mg/kg/bid), and cabozantinib (30 mg/kg/qd) and treated orally for 15 days. Cabozantinib resulted in significant tumor regression in UZLX-GIST4 and -GIST2 and delayed tumor growth in -GIST9. In all three models, cabozantinib inhibited the proliferative activity, which was completely absent in UZLX-GIST4 and significantly reduced in -GIST2 and -GIST9. Increased apoptotic activity was observed only in UZLX-GIST4. Cabozantinib inhibited the KIT signaling pathway in UZLX-GIST4 and -GIST2. In addition, compared with both control and imatinib, cabozantinib significantly reduced microvessel density in all models. In conclusion, cabozantinib showed antitumor activity in GIST PDX models through inhibition of tumor growth, proliferation, and angiogenesis, in both imatinib-sensitive and imatinib-resistant models. Mol Cancer Ther; 15(12); 2845-52. ©2016 AACR. ©2016 American Association for Cancer Research.
A girl with West syndrome and autistic features harboring a de novo TBL1XR1 mutation.
Saitsu, Hirotomo; Tohyama, Jun; Walsh, Tom; Kato, Mitsuhiro; Kobayashi, Yu; Lee, Ming; Tsurusaki, Yoshinori; Miyake, Noriko; Goto, Yu-Ichi; Nishino, Ichizo; Ohtake, Akira; King, Mary-Claire; Matsumoto, Naomichi
2014-10-01
Recently, de novo mutations in TBL1XR1 were found in two patients with autism spectrum disorders. Here, we report on a Japanese girl presenting with West syndrome, Rett syndrome-like and autistic features. Her initial development was normal until she developed a series of spasms at 5 months of age. Electroencephalogram at 7 months showed a pattern of hypsarrhythmia, which led to a diagnosis of West syndrome. Stereotypic hand movements appeared at 8 months of age, and autistic features such as deficits in communication, hyperactivity and excitability were observed later, at 4 years and 9 months. Whole exome sequencing of the patient and her parents revealed a de novo TBL1XR1 mutation [c.209 G>A (p.Gly70Asp)] occurring at an evolutionarily conserved amino acid in an F-box-like domain. Our report expands the clinical spectrum of TBL1XR1 mutations to West syndrome with Rett-like features, together with autistic features.
New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.
Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C
2001-05-04
The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.
Pamungkas, Aryo D.; Medriano, Carl A.; Sim, Eunjung; Lee, Sungyong; Park, Youngja H.
2017-01-01
The most common type of lung cancer is non-small cell lung cancer (NSCLC), which is frequently characterized by a mutation in the epidermal growth factor receptor (EGFR). Determining the presence of an EGFR mutation in lung cancer is important, as it determines the type of treatment that a patients will receive. Therefore, the aim of the present study was to apply high-resolution metabolomics (HRM) using liquid chromatography-mass spectrometry to identify significant compounds in human plasma samples obtained from South Korean NSCLC patients, as potential biomarkers for providing early detection and diagnosis of minimally-invasive NSCLC. The metabolic differences between lung cancer patients without EGFR mutations were compared with patients harboring EGFR mutations. Univariate analysis was performed, with a false discovery rate of q=0.05, in order to identify significant metabolites between the two groups. In addition, hierarchical clustering analysis was performed to discriminate between the metabolic profiles of the two groups. Furthermore, the significant metabolites were identified and mapped using Mummichog software, in order to generate a potential metabolic network model. Using metabolome-wide association studies, metabolic alterations were identified. Linoleic acid [303.23 m/z, (M+Na)+], 5-methyl tetrahydrofolate [231.10 m/z, (M+2H)+] and N-succinyl-L-glutamate-5 semialdehyde [254.06 m/z, (M+Na)+], were observed to be elevated in patients harboring EGFR mutations, whereas tetradecanoyl carnitine [394.29 m/z, (M+Na)+] was observed to be reduced. This suggests that these compounds may be affected by the EGFR mutation. In conclusion, the present study identified four potential biomarkers in patients with EGFR mutations, using HRM combined with pathway analysis. These results may facilitate the development of novel diagnostic tools for EGFR mutation detection in patients with lung cancer. PMID:28487968
Novellasdemunt, Laura; Foglizzo, Valentina; Cuadrado, Laura; Antas, Pedro; Kucharska, Anna; Encheva, Vesela; Snijders, Ambrosius P; Li, Vivian S W
2017-10-17
The tumor suppressor gene adenomatous polyposis coli (APC) is mutated in most colorectal cancers (CRCs), resulting in constitutive Wnt activation. To understand the Wnt-activating mechanism of the APC mutation, we applied CRISPR/Cas9 technology to engineer various APC-truncated isogenic lines. We find that the β-catenin inhibitory domain (CID) in APC represents the threshold for pathological levels of Wnt activation and tumor transformation. Mechanistically, CID-deleted APC truncation promotes β-catenin deubiquitination through reverse binding of β-TrCP and USP7 to the destruction complex. USP7 depletion in APC-mutated CRC inhibits Wnt activation by restoring β-catenin ubiquitination, drives differentiation, and suppresses xenograft tumor growth. Finally, the Wnt-activating role of USP7 is specific to APC mutations; thus, it can be used as a tumor-specific therapeutic target for most CRCs. Copyright © 2017 The Francis Crick Institute. Published by Elsevier Inc. All rights reserved.
33 CFR 117.802 - New Rochelle Harbor.
Code of Federal Regulations, 2010 CFR
2010-07-01
... DRAWBRIDGE OPERATION REGULATIONS Specific Requirements New York § 117.802 New Rochelle Harbor. (a) The draw of the Glen Island Bridge, mile 0.8, at New Rochelle, New York, shall open on signal, except as... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false New Rochelle Harbor. 117.802...
Congenital secretory diarrhoea caused by activating germline mutations in GUCY2C
Müller, Thomas; Rasool, Insha; Heinz-Erian, Peter; Mildenberger, Eva; Hülstrunk, Christian; Müller, Andreas; Michaud, Laurent; Koot, Bart G P; Ballauff, Antje; Vodopiutz, Julia; Rosipal, Stefan; Petersen, Britt-Sabina; Franke, Andre; Fuchs, Irene; Witt, Heiko; Zoller, Heinz; Janecke, Andreas R; Visweswariah, Sandhya S
2016-01-01
Objective Congenital sodium diarrhoea (CSD) refers to a form of secretory diarrhoea with intrauterine onset and high faecal losses of sodium without congenital malformations. The molecular basis for CSD remains unknown. We clinically characterised a cohort of infants with CSD and set out to identify disease-causing mutations by genome-wide genetic testing. Design We performed whole-exome sequencing and chromosomal microarray analyses in 4 unrelated patients, followed by confirmatory Sanger sequencing of the likely disease-causing mutations in patients and in their family members, followed by functional studies. Results We identified novel de novo missense mutations in GUCY2C, the gene encoding receptor guanylate cyclase C (GC-C) in 4 patients with CSD. One patient developed severe, early-onset IBD and chronic arthritis at 4 years of age. GC-C is an intestinal brush border membrane-bound guanylate cyclase, which functions as receptor for guanylin, uroguanylin and Escherichia coli heat-stable enterotoxin. Mutations in GUCY2C were present in different intracellular domains of GC-C, and were activating mutations that enhanced intracellular cyclic guanosine monophosphate accumulation in a ligand-independent and ligand-stimulated manner, following heterologous expression in HEK293T cells. Conclusions Dominant gain-of-function GUCY2C mutations lead to elevated intracellular cyclic guanosine monophosphate levels and could explain the chronic diarrhoea as a result of decreased intestinal sodium and water absorption and increased chloride secretion. Thus, mutations in GUCY2C indicate a role for this receptor in the pathogenesis of sporadic CSD. PMID:25994218
Shen, Hujun; Deng, Mingsen; Zhang, Yachao
2017-10-01
Recent crystal structures of RNA-dependent RNA polymerase (3D pol ) from Coxsackievirus B3 (CVB3) revealed that a tyrosine mutation at Phe364 (F364Y) resulted in structures with open active site whereas a hydrophobic mutation at Phe364 (F364A) led to conformations with closed active site. Besides, the crystal structures showed that the F364W mutation had no preference between the open and closed active sites, similar to wild-type. In this paper, we present a molecular dynamics (MD) study on CVB3 3D pol in order to address some important questions raised by experiments. First, MD simulations of F364Y and F364A were carried out to explore how these mutations at Phe364 influence active site dynamics and conformations. Second, MD simulations of wild-type and mutants were performed to discover the connection between active site dynamics and polymerase function. MD simulations reveal that the effect of mutations on active site dynamics is associated with the interaction between the structural motifs A and D in CVB3 3D pol . Interestingly, we discover that the active site state is influenced by the formation of a hydrogen bond between backbone atoms of Ala231 (in motif A) and Ala358 (in motif D), which has never been revealed before. Copyright © 2017 Elsevier Inc. All rights reserved.
Leigh Syndrome and the Mitochondrial m.13513G>A Mutation: Expanding the Clinical Spectrum.
Monlleo-Neila, Laura; Toro, Mireia Del; Bornstein, Belen; Garcia-Arumi, Elena; Sarrias, Axel; Roig-Quilis, Manuel; Munell, Francina
2013-11-01
The mitochondrial DNA m.13513G>A mutation in the ND5 subunit gene is a frequent cause of Leigh syndrome. Patients harboring this mutation typically present with ptosis and cardiac conduction abnormalities, particularly Wolff-Parkinson-White syndrome, and have a late clinical onset, which contrasts with the typical infantile form. The authors describe a patient presenting with intrauterine growth retardation and visual impairment at 3 months of age, followed by infantile spasms, severe gastrointestinal dysmotility, and neurological regression. The patient had hyperlactacidemia and bilateral basal ganglia and brainstem lesions on MRI. Although he did not present cardiac conduction abnormalities, his mother had been diagnosed with Wolff-Parkinson-White syndrome. The m.13513G>A mutation was found in the patient's muscle and in several tissues of his mother. The present results expand the phenotype of Leigh syndrome associated with the m.13513G>A mutation, which should be suspected in patients with early-onset mitochondrial encephalopathy with infantile spasms or prominent gastrointestinal smooth muscle involvement.
Cao, Xiang; Zhou, Yi; Sun, Hongfang; Xu, Miao; Bi, Xiaowen; Zhao, Zhihui; Shen, Binghui; Wan, Fengyi; Hong, Zhuan; Lan, Lei; Luo, Lan; Guo, Zhigang; Yin, Zhimin
2018-06-28
Non-small cell lung cancer (NSCLC) patients harboring EGFR-activating mutations initially respond to EGFR tyrosine kinase inhibitors (EGFR-TKIs) and have shown favorable outcomes. However, acquired drug resistance to EGFR-TKIs develops in almost all patients mainly due to the EGFR T790 M mutation. Here, we show that treatment with low-dose EGFR-TKI results in the emergence of the EGFR T790 M mutation and in the reduction of HSP70 protein levels in HCC827 cells. Erlotinib treatment inhibits HSP70 phosphorylation at tyrosine 41 and increases HSP70 ubiquitination, resulting in HSP70 degradation. We show that EGFR-TKI treatment causes increased DNA damage and enhanced gene mutation rates, which are secondary to the EGFR-TKI-induced reduction of HSP70 protein. Importantly, HSP70 overexpression delays the occurrence of Erlotinib-induced EGFR T790 M mutation. We further demonstrate that HSP70 interacts with multiple enzymes in the base excision repair (BER) pathway and promotes not only the efficiency but also the fidelity of BER. Collectively, our findings show that EGFR-TKI treatment facilitates gene mutation and the emergence of EGFR T790 M secondary mutation by the attenuation of BER via induction of HSP70 protein degradation. Copyright © 2018. Published by Elsevier B.V.
Villanueva, Carine; Jacobson-Dickman, Elka; Xu, Cheng; Manouvrier, Sylvie; Dwyer, Andrew A; Sykiotis, Gerasimos P; Beenken, Andrew; Liu, Yang; Tommiska, Johanna; Hu, Youli; Tiosano, Dov; Gerard, Marion; Leger, Juliane; Drouin-Garraud, Valérie; Lefebvre, Hervé; Polak, Michel; Carel, Jean-Claude; Phan-Hug, Franziska; Hauschild, Michael; Plummer, Lacey; Rey, Jean-Pierre; Raivio, Taneli; Bouloux, Pierre; Sidis, Yisrael; Mohammadi, Moosa; de Roux, Nicolas; Pitteloud, Nelly
2015-08-01
Congenital hypogonadotropic hypogonadism (CHH) and split hand/foot malformation (SHFM) are two rare genetic conditions. Here we report a clinical entity comprising the two. We identified patients with CHH and SHFM through international collaboration. Probands and available family members underwent phenotyping and screening for FGFR1 mutations. The impact of identified mutations was assessed by sequence- and structure-based predictions and/or functional assays. We identified eight probands with CHH with (n = 3; Kallmann syndrome) or without anosmia (n = 5) and SHFM, seven of whom (88%) harbor FGFR1 mutations. Of these seven, one individual is homozygous for p.V429E and six individuals are heterozygous for p.G348R, p.G485R, p.Q594*, p.E670A, p.V688L, or p.L712P. All mutations were predicted by in silico analysis to cause loss of function. Probands with FGFR1 mutations have severe gonadotropin-releasing hormone deficiency (absent puberty and/or cryptorchidism and/or micropenis). SHFM in both hands and feet was observed only in the patient with the homozygous p.V429E mutation; V429 maps to the fibroblast growth factor receptor substrate 2α binding domain of FGFR1, and functional studies of the p.V429E mutation demonstrated that it decreased recruitment and phosphorylation of fibroblast growth factor receptor substrate 2α to FGFR1, thereby resulting in reduced mitogen-activated protein kinase signaling. FGFR1 should be prioritized for genetic testing in patients with CHH and SHFM because the likelihood of a mutation increases from 10% in the general CHH population to 88% in these patients.
Decadal Changes In Benthic Community Measures In New York Harbor
Monitoring in New York Harbor, NY, as part of the Regional Environmental Monitoring and Assessment Program has spanned a decade, and includes habitat and water quality measures and sediment contaminant levels from four sub-basins (Upper NY Harbor, Lower NY Harbor, Newark Bay, and...
Murali, Rajmohan; Chandramohan, Raghu; Möller, Inga; Scholz, Simone L.; Berger, Michael; Huberman, Kety; Viale, Agnes; Pirun, Mono; Socci, Nicholas D.; Bouvier, Nancy; Bauer, Sebastian; Artl, Monika; Schilling, Bastian; Schimming, Tobias; Sucker, Antje; Schwindenhammer, Benjamin; Grabellus, Florian; Speicher, Michael R.; Schaller, Jörg; Hillen, Uwe; Schadendorf, Dirk; Mentzel, Thomas; Cheng, Donavan T.; Wiesner, Thomas; Griewank, Klaus G.
2015-01-01
Angiosarcomas are rare malignant mesenchymal tumors of endothelial differentiation. The clinical behavior is usually aggressive and the prognosis for patients with advanced disease is poor with no effective therapies. The genetic bases of these tumors have been partially revealed in recent studies reporting genetic alterations such as amplifications of MYC (primarily in radiation-associated angiosarcomas), inactivating mutations in PTPRB and R707Q hotspot mutations of PLCG1. Here, we performed a comprehensive genomic analysis of 34 angiosarcomas using a clinically-approved, hybridization-based targeted next-generation sequencing assay for 341 well-established oncogenes and tumor suppressor genes. Over half of the angiosarcomas (n = 18, 53%) harbored genetic alterations affecting the MAPK pathway, involving mutations in KRAS, HRAS, NRAS, BRAF, MAPK1 and NF1, or amplifications in MAPK1/CRKL, CRAF or BRAF. The most frequently detected genetic aberrations were mutations in TP53 in 12 tumors (35%) and losses of CDKN2A in 9 tumors (26%). MYC amplifications were generally mutually exclusive of TP53 alterations and CDKN2A loss and were identified in 8 tumors (24%), most of which (n = 7, 88%) arose post-irradiation. Previously reported mutations in PTPRB (n = 10, 29%) and one (3%) PLCG1 R707Q mutation were also identified. Our results demonstrate that angiosarcomas are a genetically heterogeneous group of tumors, harboring a wide range of genetic alterations. The high frequency of genetic events affecting the MAPK pathway suggests that targeted therapies inhibiting MAPK signaling may be promising therapeutic avenues in patients with advanced angiosarcomas. PMID:26440310
Facchinetti, Francesco; Loriot, Yohann; Kuo, Mei-Shiue; Mahjoubi, Linda; Lacroix, Ludovic; Planchard, David; Besse, Benjamin; Farace, Françoise; Auger, Nathalie; Remon, Jordi; Scoazec, Jean-Yves; André, Fabrice; Soria, Jean-Charles; Friboulet, Luc
2016-12-15
The identification of molecular mechanisms conferring resistance to tyrosine kinase inhibitor (TKI) is a key step to improve therapeutic results for patients with oncogene addiction. Several alterations leading to EGFR and anaplastic lymphoma kinase (ALK) resistance to TKI therapy have been described in non-small cell lung cancer (NSCLC). Only two mutations in the ROS1 kinase domain responsible for crizotinib resistance have been described in patients thus far. A patient suffering from a metastatic NSCLC harboring an ezrin (EZR)-ROS1 fusion gene developed acquired resistance to the ALK/ROS1 inhibitor crizotinib. Molecular analysis (whole-exome sequencing, CGH) and functional studies were undertaken to elucidate the mechanism of resistance. Based on this case, we took advantage of the structural homology of ROS1 and ALK to build a predictive model for drug sensitivity regarding future ROS1 mutations. Sequencing revealed a dual mutation, S1986Y and S1986F, in the ROS1 kinase domain. Functional in vitro studies demonstrated that ROS1 harboring either the S1986Y or the S1986F mutation, while conferring resistance to crizotinib and ceritinib, was inhibited by lorlatinib (PF-06463922). The patient's clinical response confirmed the potency of lorlatinib against S1986Y/F mutations. The ROS1 S1986Y/F and ALK C1156Y mutations are homologous and displayed similar sensitivity patterns to ALK/ROS1 TKIs. We extended this analogy to build a model predicting TKI efficacy against potential ROS1 mutations. Clinical evidence, in vitro validation, and homology-based prediction provide guidance for treatment decision making for patients with ROS1-rearranged NSCLC who progressed on crizotinib. Clin Cancer Res; 22(24); 5983-91. ©2016 AACR. ©2016 American Association for Cancer Research.
Genetic predictors of MEK dependence in non-small cell lung cancer.
Pratilas, Christine A; Hanrahan, Aphrothiti J; Halilovic, Ensar; Persaud, Yogindra; Soh, Junichi; Chitale, Dhananjay; Shigematsu, Hisayuki; Yamamoto, Hiromasa; Sawai, Ayana; Janakiraman, Manickam; Taylor, Barry S; Pao, William; Toyooka, Shinichi; Ladanyi, Marc; Gazdar, Adi; Rosen, Neal; Solit, David B
2008-11-15
Hyperactivated extracellular signal-regulated kinase (ERK) signaling is common in human cancer and is often the result of activating mutations in BRAF, RAS, and upstream receptor tyrosine kinases. To characterize the mitogen-activated protein kinase/ERK kinase (MEK)/ERK dependence of lung cancers harboring BRAF kinase domain mutations, we screened a large panel of human lung cancer cell lines (n = 87) and tumors (n = 916) for BRAF mutations. We found that non-small cell lung cancers (NSCLC) cells with both V600E and non-V600E BRAF mutations were selectively sensitive to MEK inhibition compared with those harboring mutations in epidermal growth factor receptor (EGFR), KRAS, or ALK and ROS kinase fusions. Supporting its classification as a "driver" mutation in the cells in which it is expressed, MEK inhibition in (V600E)BRAF NSCLC cells led to substantial induction of apoptosis, comparable with that seen with EGFR kinase inhibition in EGFR mutant NSCLC models. Despite high basal ERK phosphorylation, EGFR mutant cells were uniformly resistant to MEK inhibition. Conversely, BRAF mutant cell lines were resistant to EGFR inhibition. These data, together with the nonoverlapping pattern of EGFR and BRAF mutations in human lung cancer, suggest that these lesions define distinct clinical entities whose treatment should be guided by prospective real-time genotyping. To facilitate such an effort, we developed a mass spectrometry-based genotyping method for the detection of hotspot mutations in BRAF, KRAS, and EGFR. Using this assay, we confirmed that BRAF mutations can be identified in a minority of NSCLC tumors and that patients whose tumors harbor BRAF mutations have a distinct clinical profile compared with those whose tumors harbor kinase domain mutations in EGFR.
Sediment resuspension characteristics in Baltimore Harbor, Maryland
Maa, J.P.-Y.; Sanford, L.; Halka, J.P.
1998-01-01
Critical bed shear stress for sediment resuspension and sediment erosion rate were measured in-situ at sites from inner to outer Baltimore Harbor using the VIMS Sea Carousel. Clay mineral contents and biological conditions were almost the same at the four study sites. The experimental results indicated that the erosion rate increased from the outer harbor toward the inner harbor with a maximum difference of about 10 times at an excess bed shear stress of 0.1 Pa. The measured critical bed shear stress strongly depended on the existence of a fluff layer. It was approximately 0.05 Pa if a fluff layer existed, and increases to about 0.1 Pa in the absence of a fluff layer.
U2AF1 mutations alter splice site recognition in hematological malignancies.
Ilagan, Janine O; Ramakrishnan, Aravind; Hayes, Brian; Murphy, Michele E; Zebari, Ahmad S; Bradley, Philip; Bradley, Robert K
2015-01-01
Whole-exome sequencing studies have identified common mutations affecting genes encoding components of the RNA splicing machinery in hematological malignancies. Here, we sought to determine how mutations affecting the 3' splice site recognition factor U2AF1 alter its normal role in RNA splicing. We find that U2AF1 mutations influence the similarity of splicing programs in leukemias, but do not give rise to widespread splicing failure. U2AF1 mutations cause differential splicing of hundreds of genes, affecting biological pathways such as DNA methylation (DNMT3B), X chromosome inactivation (H2AFY), the DNA damage response (ATR, FANCA), and apoptosis (CASP8). We show that U2AF1 mutations alter the preferred 3' splice site motif in patients, in cell culture, and in vitro. Mutations affecting the first and second zinc fingers give rise to different alterations in splice site preference and largely distinct downstream splicing programs. These allele-specific effects are consistent with a computationally predicted model of U2AF1 in complex with RNA. Our findings suggest that U2AF1 mutations contribute to pathogenesis by causing quantitative changes in splicing that affect diverse cellular pathways, and give insight into the normal function of U2AF1's zinc finger domains. © 2015 Ilagan et al.; Published by Cold Spring Harbor Laboratory Press.
Association of PKD2 (polycystin 2) mutations with left-right laterality defects.
Bataille, Stanislas; Demoulin, Nathalie; Devuyst, Olivier; Audrézet, Marie-Pierre; Dahan, Karin; Godin, Michel; Fontès, Michel; Pirson, Yves; Burtey, Stéphane
2011-09-01
Mutations in the PKD1 (polycystin 1) and PKD2 (polycystin 2) genes cause autosomal dominant polycystic kidney disease (ADPKD). Most Pkd2-null mouse embryos present with left-right laterality defects. For the first time, we report the association of ADPKD resulting from a mutation in PKD2 and left-right asymmetry defects. PKD1 and PKD2 were screened for mutations or large genomic rearrangements in 3 unrelated patients with ADPKD presenting with laterality defects: dextrocardia in one and situs inversus totalis in 2 others. A large gene deletion, a single-exon duplication, and an in-frame duplication respectively, were found in the 3 patients. These polymorphisms were found in all tested relatives with ADPKD, but were absent in unaffected related individuals. No left-right anomalies were found in other members of the 3 families. A possible association between heterotaxia and a PKD2 mutation in our 3 patients is suggested by: (1) the existence of laterality defects in Pkd2-null mouse and zebrafish models and (2) detection of a pathogenic PKD2 mutation in the 3 probands, although PKD2 mutations account for only 15% of ADPKD families. The presence of left-right laterality defects should be systematically screened in larger cohorts of patients with ADPKD harboring PKD2 mutations. Copyright © 2011 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.
Activated RET and ROS: two new driver mutations in lung adenocarcinoma
Bos, Marc; Gardizi, Masyar; Schildhaus, Hans-Ulrich; Buettner, Reinhard
2013-01-01
Rearrangements of ROS1 and RET have been recently described as new driver mutations in lung adenocarcinoma with a frequency of about 1% each. RET and ROS1 rearrangements both represent unique molecular subsets of lung adenocarcinoma with virtually no overlap with other known driver mutations described so far in lung adenocarcinoma. Specific clinicopathologic characteristics have been described and several multitargeted receptor kinase inhibitors have shown in vitro activity against NSCLC cells harbouring these genetic alterations. In addition, the MET/ALK/ROS inhibitor crizotinib has already shown impressive clinical activity in patients with advanced ROS1-positive lung cancer. Currently, several early proof of concept clinical trials are testing various kinase inhibitors in both molecular subsets of lung adenocarcinoma patients. Most probably, personalized treatment of these genetically defined new subsets of lung adenocarcinoma will be implemented in routine clinical care of lung cancer patients in the near future. PMID:25806222
Salvat, Regina S; Verma, Deeptak; Parker, Andrew S; Kirsch, Jack R; Brooks, Seth A; Bailey-Kellogg, Chris; Griswold, Karl E
2017-06-27
Therapeutic proteins of wide-ranging function hold great promise for treating disease, but immune surveillance of these macromolecules can drive an antidrug immune response that compromises efficacy and even undermines safety. To eliminate widespread T-cell epitopes in any biotherapeutic and thereby mitigate this key source of detrimental immune recognition, we developed a Pareto optimal deimmunization library design algorithm that optimizes protein libraries to account for the simultaneous effects of combinations of mutations on both molecular function and epitope content. Active variants identified by high-throughput screening are thus inherently likely to be deimmunized. Functional screening of an optimized 10-site library (1,536 variants) of P99 β-lactamase (P99βL), a component of ADEPT cancer therapies, revealed that the population possessed high overall fitness, and comprehensive analysis of peptide-MHC II immunoreactivity showed the population possessed lower average immunogenic potential than the wild-type enzyme. Although similar functional screening of an optimized 30-site library (2.15 × 10 9 variants) revealed reduced population-wide fitness, numerous individual variants were found to have activity and stability better than the wild type despite bearing 13 or more deimmunizing mutations per enzyme. The immunogenic potential of one highly active and stable 14-mutation variant was assessed further using ex vivo cellular immunoassays, and the variant was found to silence T-cell activation in seven of the eight blood donors who responded strongly to wild-type P99βL. In summary, our multiobjective library-design process readily identified large and mutually compatible sets of epitope-deleting mutations and produced highly active but aggressively deimmunized constructs in only one round of library screening.
33 CFR 110.138 - Boston Harbor, Mass.
Code of Federal Regulations, 2012 CFR
2012-07-01
... line running due north from Old Harbor Buoy 4 to the shore line at City Point. (5) Explosives anchorage... beacon on top of the Boston Custom House tower; and thence to the point of beginning. (2) President Roads... adjacent land; on the east by a line between Castle Rocks Fog Signal Light and Old Harbor Shoal Buoy 2; on...
33 CFR 110.138 - Boston Harbor, Mass.
Code of Federal Regulations, 2013 CFR
2013-07-01
... line running due north from Old Harbor Buoy 4 to the shore line at City Point. (5) Explosives anchorage... beacon on top of the Boston Custom House tower; and thence to the point of beginning. (2) President Roads... adjacent land; on the east by a line between Castle Rocks Fog Signal Light and Old Harbor Shoal Buoy 2; on...